US9243239B2 - Purification of cystathionine beta-synthase - Google Patents
Purification of cystathionine beta-synthase Download PDFInfo
- Publication number
- US9243239B2 US9243239B2 US13/830,494 US201313830494A US9243239B2 US 9243239 B2 US9243239 B2 US 9243239B2 US 201313830494 A US201313830494 A US 201313830494A US 9243239 B2 US9243239 B2 US 9243239B2
- Authority
- US
- United States
- Prior art keywords
- cbs
- protein
- column
- truncated
- imac
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/51—Lyases (4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/36—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving ionic interaction
- B01D15/361—Ion-exchange
- B01D15/363—Anion-exchange
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/38—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving specific interaction not covered by one or more of groups B01D15/265 - B01D15/36
- B01D15/3804—Affinity chromatography
- B01D15/3823—Affinity chromatography of other types, e.g. avidin, streptavidin, biotin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/01—Hydro-lyases (4.2.1)
- C12Y402/01022—Cystathionine beta-synthase (4.2.1.22)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention generally relates to methods for purification of Cystathionine ⁇ -Synthase (CBS), particularly truncated variants thereof.
- CBS Cystathionine ⁇ -Synthase
- the present invention also relates to compositions of substantially pure CBS produced through said methods of purification.
- Cystathionine ⁇ -synthase plays an essential role in homocysteine (Hcy) metabolism in eukaryotes (Mudd et al., 2001, in The Metabolic and Molecular Bases of Inherited Disease, 8 Ed., pp. 2007-2056, McGraw-Hill, New York).
- the CBS enzyme catalyzes a pyridoxal 5′-phosphate (PLP; Vitamin B 6 )-dependent condensation of serine and homocysteine to form cystathionine, which is then used to produce cysteine by another PLP-dependent enzyme, cystathionine ⁇ -lyase.
- PLP pyridoxal 5′-phosphate
- CBS occupies a key regulatory position between the remethylation of Hcy to methionine or its alternative use in the biosynthesis of cysteine.
- AdoMet intracellular S-adenosylmethionine
- AdoMet activates the mammalian CBS enzyme by as much as 5-fold with an apparent dissociation constant of 15 ⁇ M (Finkelstein et al., 1975, Biochem. Biophys. Res. Commun. 66: 81-87; Roper et al., 1992, Arch. Biochem. Biophys. 298: 514-521; Kozich et al., 1992, Hum. Mutation 1: 113-123).
- the C-terminal regulatory domain of human CBS consists of ⁇ 140 amino acid residues (Kery et al., 1998, Arch. Biochem. Biophys. 355: 222-232). This region is required for tetramerization of the human enzyme and AdoMet activation (Kery et al., 1998, id.).
- the C-terminal regulatory region also encompasses the previously defined “CBS domains” (Bateman, 1997 , Trends Biochem. Sci. 22: 12-13). These hydrophobic sequences (CBS 1 and CBS 2), spanning amino acid residues 416-468 and 486-543 of SEQ ID NO: 1, respectively, are conserved in a wide range of otherwise unrelated proteins.
- CBS-mediated conversion of Hcy to cystathionine is the rate-limiting intermediate step of methionine (Met) metabolism to cysteine (Cys).
- Vitamin B 6 is an essential coenzyme for this process.
- the conversion of Hcy to cystathionine is slowed or absent, resulting in elevations in the serum concentrations of the enzymatic substrate (Hcy) and a corresponding decrease in the serum concentrations of the enzymatic product (cystathionine).
- the clinical condition of an elevated serum level of Hcy, and its concomitant excretion into the urine, is collectively known as homocystinuria.
- Deficiency of CBS is the most common cause of inherited homocystinuria, a serious life-threatening disease that results in severely elevated homocysteine levels in plasma, tissues and urine.
- Estimates on the prevalence of homocystinuria vary widely. Ascertainment by newborn screening and clinical ascertainment have indicated a prevalence ranging from 1:200,000 to 1:335,000 (Mudd et al., 1995, The Metabolic and Molecular Basis of Inherited Diseases , McGraw-Hill: New York, p. 1279).
- the primary health problems associated with CBS-deficient homocystinuria include: cardiovascular disease with a predisposition to thrombosis, resulting in a high rate of mortality in untreated and partially treated patients; connective tissue problems affecting the ocular system with progressive myopia and lens dislocation; connective tissue problems affecting the skeleton characterized by marfanoid habitus, osteoporosis, and scoliosis; and central nervous system problems, including mental retardation and seizures.
- Symptoms include dislocated optic lenses, skeletal disorders, mental retardation and premature arteriosclerosis and thrombosis (Mudd et al., 2001, id.).
- Homozygous CBS deficiency is associated with a multitude of clinical symptoms, including mental retardation, osteoporosis, kyphoscoliosis, stroke, myocardial infarction, ectopia lentis, and pulmonary embolism. Cardiovascular complications of the disease, in particular arterial and venous thrombosis, are the principal contributors to early mortality.
- Each of these three therapies is aimed at lowering serum Hcy concentration.
- the standard treatment for individuals affected with Vitamin B 6 non-responsive CBSDH consists of a Met-restricted diet supplemented with a metabolic formula and Cys in the form of cysteine (which has become a conditionally essential amino acid in this condition). Intake of meat, dairy products, and other food high in natural protein is prohibited. Daily consumption of a poorly palatable, synthetic metabolic formula containing amino acids and micronutrients is required to prevent secondary malnutrition.
- betaine serves as a methyl donor for the remethylation of Hcy to Met catalyzed by betaine-homocysteine methyltransferase in the liver (Wilcken et al., 1983, N. Engl. J. Med. 309: 448-53). Dietary compliance generally has been poor, even in those medical centers where optimal care and resources are provided, and this non-compliance has major implications on the development of life-threatening complications of homocystinuria.
- Enzyme replacement therapy as a way to increase enzyme activity in these patients requires exogenous enzyme, which is not present in the art and thus raises a need in the art for improved reagents and methods for producing CBS in greater yields of sufficiently purified enzyme for therapeutic administration.
- This invention provides methods for purifying cystathionine ⁇ -Synthase (CBS), wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, and particularly truncated CBS produced in recombinant cells.
- the method comprises the steps of: (a) providing a CBS-containing solution in the presence of at least one impurity; and (b) performing chromatographic separation of said CBS-containing solution using a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- the method comprises the steps of: (a) providing a CBS-containing solution in the presence of at least one impurity; and (b) performing chromatographic separation of said CBS-containing solution using an ion exchange chromatography column and a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- the method further comprises performance of additional chromatographic steps (known in the art as “polishing” steps).
- the methods of the invention include the step of performing chromatographic separation using a Hydrophobic Interaction Chromatography (HIC) column.
- the method further comprises the step of performing chromatographic separation using a ceramic hydroxyapaptite resin.
- the ion exchange column is an anion exchanger, preferably a weak anion exchanger.
- the anion exchanger is a DEAE-Sepharose FF column.
- the IMAC resin is charged with a divalent ion.
- the divalent metal ion is nickel, copper, cobalt or zinc. In more specific embodiments the divalent metal ion is zinc.
- the method further comprises eluting CBS from the IMAC resin with an elution buffer comprising imidazole.
- the CBS-containing solution is a clarified CBS solution, wherein cell debris and other particulate matter is removed from a suspension comprising CBS including but not limited to supernatant after centrifugation or filtrate after filtration.
- the CBS-containing solution is obtained by homogenizing cells expressing a recombinant construct comprising a nucleic acid sequence encoding CBS.
- the CBS nucleic acid sequence comprises SEQ ID NO. 1 and encodes a protein have the amino acid sequence identified as SEQ ID NO: 2.
- the nucleic acid sequence is truncated.
- the truncated CBS nucleic acid sequence has been truncated to an ending position of one of amino acid residues from 382-532, 382-550 or 543-550 of SEQ ID NO:2
- the recombinant cells are microbial cells, particularly bacterial cells.
- the bacterial cells are E. coli cells, particularly recombinant E. coli cells that produce a mammalian, preferably human, CBS protein.
- said human CBS protein has an amino acid sequence as set forth in SEQ ID NO:3 or a truncated CBS nucleic acid sequence that has been truncated to an ending position of one of amino acid residues from 382-532 or 543-550 of SEQ ID NO:2.
- the truncated CBS nucleic acid sequence is optimized for expression in E. coli , identified by SEQ ID NO: 4.
- a substantially purified CBS solution is provided using a method comprising the steps of: a) providing a CBS-containing solution in the presence of at least one impurity, wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, and particularly truncated; and (b) performing chromatographic separation of said CBS-containing solution using a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- a substantially purified CBS solution is provided using a method comprising the steps of: (a) providing a CBS-containing solution in the presence of at least one impurity; and (b) performing chromatographic separation of said CBS-containing solution using an ion exchange chromatography column and a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- the substantially purified CBS solution is formulated in a pharmaceutically acceptable carrier.
- the invention provides methods for producing an enriched CBS solution, the method comprising of: (a) providing a CBS-containing solution in the presence of at least one impurity, wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, and particularly truncated; and (b) performing chromatographic separation of said CBS-containing solution using an immobilized metal affinity chromatography (IMAC) resin charged with a divalent metal ion.
- IMAC immobilized metal affinity chromatography
- an enriched CBS solution is provided using a method comprising the steps of: a) providing a CBS-containing solution in the presence of at least one impurity, wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, and particularly truncated; and (b) performing chromatographic separation of said CBS-containing solution using an immobilized metal affinity chromatography (IMAC) resin charged with a divalent metal ion.
- IMAC immobilized metal affinity chromatography
- FIG. 1 is a purification train summary from scale-up generation runs using a multi-step chromatography method including DEAE-Sepharose-FF, Zn-IMAC and HIC chromatography.
- FIG. 2 is a purification summary from purification experiments using a DEAE-Sepharose-FF column and CBS purified using the “non-optimized” bacterial expression construct.
- Mobile phases included 10% ethylene glycol in addition to other components as set forth in the Examples.
- FIG. 3 is a purification train summary from scale-up generation runs using a multi-step chromatography method including DEAE-Sepharose-FF, Zn-IMAC, ceramic hydroxyapaptite resin and HIC chromatography.
- FIG. 4 is a photoimage of a SDS page gel showing the relative amounts of CBS protein and impurities for each stage of the purification step using a DEAE column.
- FIG. 5 is a photoimage of a SDS page gel showing the relative amounts of CBS protein and impurities for a 3 column purification method including: a DEAE column, a Zn-IMAC column and HIC column.
- FIG. 6 is a photoimage of a SDS page gel showing the relative amounts of CBS protein and impurities for a 4 column purification method including: a DEAE column, a Zn-IMAC column, a ceramic hydroxyapaptite resin and a HIC column.
- FIG. 7 is chromatograms demonstrating the components of the separated mixture following purification using Zn-IMAC.
- FIG. 8 is a purification summary from development runs using a Ni-IMAC column.
- FIG. 9 is a summary table demonstrating the total protein following a purification method using a Ni-IMAC column.
- FIG. 10 is a photoimage of a SDS page gel showing the relative amounts of CBS protein and impurities for each stage of the purification step using a Ni-IMAC column.
- FIG. 11 is a purification summary from scale-up generation runs using a Cu-IMAC column.
- FIG. 12 is a summary table demonstrating the total protein following a purification method using a Zn-IMAC column.
- FIG. 13 is a photoimage of a SDS page gel showing the relative amounts of CBS protein and impurities for each stage of the purification step using a Zn-IMAC column.
- FIG. 14 is a scheme of the purification method using multi-step chromatography purification steps.
- This invention provides methods for purification of CBS protein, wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, and particularly a truncated protein CBS produced in recombinant cells.
- the invention provides methods for the purification of a CBS protein that include the steps (a) providing a CBS-containing solution in the presence of at least one impurity; and (b) performing chromatographic separation of said CBS-containing solution using a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- the method comprises the steps of: (a) providing a CBS-containing solution in the presence of at least one impurity; and (b) performing chromatographic separation of said CBS-containing solution using an ion exchange chromatography column and a metal affinity chromatography (IMAC) resin.
- IMAC metal affinity chromatography
- a particular chromatographic separation step in the certain embodiments of the methods provided by this invention comprises an ion exchange chromatography column.
- the ion exchange chromatography column is an anion exchanger, preferably a weak anion exchanger.
- anion exchange resins can be used, including DEAE-Sephadex, QAE-Sephadex, DEAE-Sephacel, DEAE-cellulose and DEAE-Sepharose-FF.
- the anion exchange resin is DEAE-Sepharose-FF.
- Another particular chromatographic separation step in the certain of the methods provided by this invention comprises a metal affinity chromatography (IMAC) resin having appropriate pH and conductivity such to allow the protein to bind to the column while selective intermediate washes are used to remove weaker binding proteins and other molecular species.
- IMAC metal affinity chromatography
- Suitable metal affinity resins include immobilized metal affinity columns charged with a divalent metal ion including nickel, copper, cobalt or zinc.
- the metal affinity chromatography (IMAC) column is used following ion exchange chromatography.
- the IMAC column is preferably charge with zinc as a divalent cation.
- the IMAC column is used as an initial chromatographic step.
- nickel or copper divalent cations are preferably used to charge the IMAC column.
- HIC hydrophobic interaction chromatography
- chromatographic steps provided in certain embodiments of the methods of this invention for purifying CBS from a CBS-containing solution include without limitation a ceramic hydroxyapatite resin.
- Ceramic hydroxyapatite or “CHAP” refers to an insoluble hydroxylated calcium phosphate of the formula (Ca 10 (PO 4 ) 6 (OH) 2 ), which has been sintered at high temperatures into a spherical, macroporous ceramic form.
- the methods of the invention also can be used with hydroxyapatite resin that is loose or packed in a column. The choice of column dimensions can be determined by the skilled artisan.
- Chromatography matrices useful in the method of the invention are materials capable of binding biochemical compounds, preferably proteins, nucleic acids, and/or endotoxins, wherein the affinity of said biochemical compounds to said chromatography matrix is influenced by the ion composition of the surrounding solution (buffer). Controlling the ion composition of said solution allows to use the chromatography materials of the invention either in subtractive mode (CBS passes through said chromatography matrix, at least certain contaminants bind to said chromatography matrix) or, preferably, in adsorptive mode (CBS binds to the chromatography matrix).
- CBS subtractive mode
- CBS adsorptive mode
- the method for purification comprises the step of homogenizing host cells, particularly recombinant cells and in certain embodiments, recombinant cells producing mammalian, preferable human, CBS protein, wherein said recombinant construct encodes a CBS protein that is a naturally occurring truncated variant, or a genetically engineered truncate thereof, and particularly wherein said construct has been optimized for recombinant cell expression.
- said recombinant cells are microbial cells and particularly bacterial cells.
- the bacterial cells are E.
- cells are harvested, e.g. by centrifugation, and optionally stored at ⁇ 80 degree ° C.
- Homogenization of host cells is performed by disrupting the cells host using physical, chemical or enzymatic means or by a combination thereof.
- homogenation is performed by disrupting the cell wall of said bacterial host by sonication.
- homogenizing is performed by destabilizing the bacterial cell wall of the host by exposure to a cell wall degrading enzyme such as lysozyme.
- the methods of the invention can further comprise a clarified CBS homogenate, wherein cell debris is removed from the homogenate by either filtration or centrifugation.
- clarifying is performed by centrifuging the homogenate at an effective rotational speed.
- the required centrifugation time depends inter alia on the volume of the homogenate, which can be determined empirically to obtain a sufficiently solid pellet.
- a combination of centrifugation and filtration can be performed on the homogenate.
- recombinant cell refers to suitable cells (including progeny of such cells) from any species into which has been introduced a recombinant expression construct capable of expressing a nucleic acid encoding CBS protein, preferably human CBS protein and most particularly a human CBS protein that is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof.
- the truncated CBS protein encoded by said recombinant expression construct has an amino acid sequence as set forth in SEQ ID NO: 3.
- bacterial cell refers to bacteria that produces a mammalian, preferably human, CBS protein inter alia using recombinant genetic methods including progeny of said recombinant cell, wherein said CBS protein is a naturally occurring truncated variant, or a genetically engineered truncate thereof.
- recombinant expression construct refers to a nucleic acid having a nucleotide sequence of a mammalian, preferably human, CBS protein, and sequences sufficient to direct the synthesis of CBS protein in cultures of cells into which the recombinant expression construct is introduced and the progeny thereof.
- CBS protein or polypeptide preferably includes a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof, or fusion proteins, or any homologue (variant, mutant) thereof, and specifically mammalian CBS and preferably human CBS.
- a CBS protein can include, but is not limited to, purified CBS protein, recombinantly produced CBS protein, soluble CBS protein, insoluble CBS protein, and isolated CBS protein associated with other proteins.
- a “human CBS protein” refers to a CBS protein from a human ( Homo sapiens ) preferably includes a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate thereof.
- a human CBS protein can include purified, partially purified, recombinant, mutated/modified and synthetic proteins.
- the CBS protein truncates are advantageously soluble CBS proteins that are produced in bacteria without the creation of insoluble inclusion bodies.
- homologue or variant or mutant
- protein or peptide which differs from a naturally occurring protein or peptide (i.e., the “prototype” or “wild-type” protein) by modifications to the naturally occurring protein or peptide, but which maintains the basic protein and side chain structure of the naturally occurring form.
- Such changes include, but are not limited to: changes in one, few, or even several amino acid side chains; changes in one, few or several amino acids, including deletions (e.g., a truncated version of the protein or peptide), insertions and/or substitutions; changes in stereochemistry of one or a few atoms; and/or minor derivatizations, including but not limited to: methylation, glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation and/or addition of glycosylphosphatidyl inositol.
- a homologue can have enhanced, decreased, changed, or substantially similar properties as compared to the naturally occurring protein or peptide.
- a homologue can include an agonist of a protein or an antagonist of a protein.
- allelic variants can be the result of natural allelic variation or natural mutation.
- a naturally occurring allelic variant of a nucleic acid encoding a protein is a gene that occurs at essentially the same locus (or loci) in the genome as the gene which encodes such protein, but which, due to natural variations caused by, for example, mutation or recombination, has a similar but not identical sequence.
- Allelic variants typically encode proteins having similar activity to that of the protein encoded by the gene to which they are being compared.
- One class of allelic variants can encode the same protein but have different nucleic acid sequences due to the degeneracy of the genetic code.
- Allelic variants can also comprise alterations in the 5′ or 3′ untranslated regions of the gene (e.g., in regulatory control regions). Allelic variants are well known to those skilled in the art.
- Homologues can be produced using techniques known in the art for the production of proteins including, but not limited to, direct modifications to the isolated, naturally occurring protein, direct protein synthesis, or modifications to the nucleic acid sequence encoding the protein using, for example, classic or recombinant DNA techniques to effect random or targeted mutagenesis.
- CBS variants are described in U.S. Pat. No. 8,007,787, which is incorporated herein by reference in its entirety; in particular and preferred embodiments, the reagents and methods of the invention set forth herein preferably include a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate of human CBS protein.
- Particular truncated forms of SEQ ID NO: 3 according to the present invention include N-terminal deletion variants, C-terminal deletion variants, and variants having both N-terminal and C-terminal deletions.
- substantially pure refers to a purity that allows for the effective use of the protein in vitro, ex vivo or in vivo.
- a protein to be useful in vitro, ex vivo or in vivo it is preferably substantially free of contaminants, other proteins and/or chemicals that might interfere or that would interfere with its use, or that at least would be undesirable for inclusion with a CBS protein (including homologues thereof).
- an enriched CBS solution is a solution subjected to one or more purification steps.
- the purity of protein can be determined by calculating fold purification, i.e. a formula that provides a measure of how much more a purified solution is compared to a less purified solution or crude extract.
- Fold purification is calculated using the following formula: Specific activity final fraction/Specific activity crude fraction.
- CBS protein compositions provided by this invention are useful for regulating biological processes and particularly, processes associated with the catalysis of the pyridoxal 5′-phosphate (PLP)-dependent condensation of serine and homocysteine to form cystathionine.
- compositions of the present invention are useful for producing cystathionine and cysteine in vitro or for treating a patient that will benefit from increased CBS activity (e.g., a patient with homocystinuria).
- the invention provides said compositions of CBS protein, preferably human CBS protein, wherein said CBS protein is a naturally occurring truncated variant, or a chemically cleaved or genetically engineered truncate of human CBS protein, as pharmaceutical compositions comprising said CBS protein and a pharmaceutically acceptable carrier.
- a “pharmaceutically acceptable carrier” includes pharmaceutically acceptable excipients and/or pharmaceutically acceptable delivery vehicles, suitable for use in suitable administration of the composition in vitro, ex vivo or in vivo.
- Suitable in vitro, in vivo or ex vivo administration preferably comprises any site where it is desirable to regulate CBS activity.
- Suitable pharmaceutically acceptable carriers are capable of maintaining a CBS protein as provided by this invention in a form that, upon arrival of the protein at the target cell or tissue in a culture or in patient, the protein has its expected or desired biological activity.
- compositions of the present invention can be sterilized by conventional methods and/or lyophilized.
- a truncated human CBS variant lacking specific portions of the non-conserved regions (r-hC ⁇ S ⁇ C; SEQ ID No: 3) were constructed and over-expressed using the previously described E. coli based expression system (Kozich and Kraus, 1992, supra).
- the CBS truncate encoded by SEQ ID NO: 3 was expressed without any fusion partner under the control of the tac promoter.
- Constructs encoding the truncated human CBS protein variant r-hC ⁇ S ⁇ C were generated by a modification of the previously described pHCS3 CBS expression construct (Kozich and Kraus, 1992, Hum. Mutat. 1, 113-123) which contains the CBS full-length coding sequence (SEQ ID NO: 1) cloned into pKK388.1.
- CBS expression was governed by the IPTG inducible lac promoter.
- CBS cDNA fragments spanning the desired nucleotide residues were amplified using primers incorporating Sph I and Kpn I sites to the 5′ and 3′ respective ends of the PCR product.
- pKK CBS ⁇ 414-551 sense (SEQ ID NO: 5) CGTAGAATTCACCTTTGCCC GCATGC TGAT (SphI) antisense: (SEQ ID NO: 6) TACG GGTACC TCAACGGAGGTGCCACCACCAGGGC (KpnI)
- the construct was transformed into E. coli BL21 (Stratagene). The authenticity of the construct was verified by DNA sequencing using a Thermo Sequenase Cy5.5 sequencing kit (Amersham Pharmacia Biotech) and the Visible Genetics Long-Read Tower System-V3.1 DNA sequencer according to the manufacturer's instructions.
- BL21 cells bearing the CBS truncation mutant construct were grown at 37° C. aerobically in 1 L NZCYMT media (Gibco/BRL, Gaithersburg, Md.) containing 75 ⁇ g/mL ampicilin and 0.001% thiamine in the presence or absence of 0.3 mM ⁇ -aminolevulinate ( ⁇ -ALA) until they reached turbidity of 0.5 at 600 nm. IPTG was then added to 0.5 mM and the bacteria were grown further.
- NZCYMT media Gibco/BRL, Gaithersburg, Md.
- ⁇ -ALA ⁇ -aminolevulinate
- the insoluble fraction was prepared as follows: after the centrifugation of the sonicated homogenate, pelleted cell debris were thoroughly washed with chilled Ix Tris-buffered saline, pH 8.0. The pellets were then resuspended in 1 ml of the lysis buffer (Maclean et al., ibid.) followed by a brief sonication in order to homogenize the insoluble fraction.
- CBS activity was determined by a previously described radioisotope assay using [ 14 C] serine as the labeled substrate (Kraus, 1987 , Methods Enzymol. 143, 388-394). Protein concentrations were determined by the Lowry procedure (Lowry et al., 1951, J. Biol. Chem. 193, 265-275) using bovine serum albumin (BSA) as a standard.
- BSA bovine serum albumin
- One unit of activity is defined as the amount of CBS that catalyzes the formation of 1 ⁇ mol of cystathionine in 1 h at 37° C.
- Quantitative densitometry analysis was performed using the Imagemaster ID (version 2.0) software (Pharmacia). To construct a calibration curve, 50, 75, 100, 250, 500 and 1000 ng of purified wild type CBS protein were run on an SDS-PAGE together with crude cell lysates of the individual mutants. Following electrophoresis, Western blot immunoanalysis was conducted using rabbit anti-CBS serum. The signals corresponding to the experimentally observed CBS mutant subunits were all within the linear range of the calibration curve constructed with purified human CBS.
- Crude CBS protein-containing extracts was prepared for use in downstream chromatography steps.
- Frozen pellets obtained from fermentation of recombinant bacteria producing human truncated CBS variant (r-hC ⁇ S ⁇ C; SEQ ID No: 3) were lysed, wherein said bacteria expressed truncated human CBS encoded by SEQ ID NO: 4.
- Lysis buffer for initial isolations contained 1 mM DTT, 1% Triton X-100, and Protease Inhibitor. These components were eventually removed from the buffer.
- the buffer used for the final isolations that produced material for scale-up runs consisted of 20 mM Sodium Phosphate, 50 mM NaCl, 0.1 mM PLP (pH 7.2), with lysozyme added to a concentration of 2 mg/mL after homogenization. Following mixing with lysozyme for 1 hr at 4° C., the homogenate was sonicated until viscosity was reduced and then subjected to centrifugation at 20,000 rpm (48,000 ⁇ g) for 30 min. The supernatant was collected, aliquoted, and stored at ⁇ 70° C. until use. Generally, the crude extract was thawed at 37° C. prior to chromatographic purification.
- DEAE-Sepharose FF was used in this Example of the purification methods for CBS because it possesses good capacity and flow properties and has been manufactured consistently for several years.
- This step employed a drip/gravity column that contained approximately 6 mL of resin.
- the column was equilibrated in Sodium Phosphate buffer with 50 mM NaCl, pH 7.0. Loading of the crude extract was targeted at approximately 20 mg total protein/mL resin. After loading the column, the red color of the load was concentrated near the top of the column. Following a wash with equilibration buffer, the column was washed with a buffer containing 150 mm NaCl, whereby the majority of color eluted from the column (all steps were performed at pH 7.0).
- IMAC immobilized metal affinity column
- Copper (Cu ++ ) was tested as a candidate species of IMAC column based on its relatively strong binding characteristics. Prior to being applied to the IMAC column, the CBS solution was adjusted to 0.4M NaCl. The results indicated that capture was near complete, with an acceptable activity recovery (70-80%). Recovery of CBS was obtained using 100 mM imidazole, which resulted in significant precipitation upon thawing from storage at ⁇ 70° C. ( FIG. 11 ). In addition, there was only a small increase in purity relative to the load. Thus, experiments employing Ni ++ IMAC were conducted as the metal of choice. In these experiments, the CBS sample was run through a G-25 column to remove dithiothreitol (DTT) prior to loading the solution onto the IMAC column. Purity enhancement remained low and selectivity was similar to Cu ++ , as evidenced by a relatively small A 280 peak in the high imidazole strip fraction. ( FIGS. 8 , 9 and 10 ).
- Ceramic hydroxyapatite is a resin that has a unique, potentially mixed binding mode chemistry that was utilized in a CBS purification method. CBS displayed acidic characteristics and therefore initial investigation focused on using phosphate-modulated partitioning. The initial experiments utilized HIC eluate that was buffer exchanged into a 0.05M NaCl, 0.005M Potassium Phosphate (pH 6.8) buffer. A 5 mL ceramic hydroxyapatite (Type 1) cartridge was equilibrated in the same buffer and the conditioned HIC eluate was loaded onto the column. There was no visible breakthrough of protein (as measured by A 280 ) during the load and subsequent wash with equilibration/wash buffer.
- the particular multi-step method described in these Examples was evaluated at the scale of a 60 mL capture column.
- All of the purification trains utilized starting material (crude extract) obtained from fermentations that were seeded with recombinant cells comprising a construct comprising a truncated variant of human CBS encoded by a nucleic acid having codons optimized for expression in E. coli .
- This construct resulted in starting material that was approximately 2-fold higher in specific activity, and significantly impacted the final purity achieved from the integrated purification method.
- the overall purification results using the multi-step method were measured by SDS-PAGE and Specific Activity ( FIGS. 5 and 6 ). The results demonstrated that the purity and specific activity met or exceeded that of the purified tagged truncated CBS. All Specific Activities of final column eluates obtained by the largest scale currently possible exceeded 1200 U/mg total protein.
- the following table summarizes the overall purification results from the scale-up runs.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Analytical Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Obesity (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (19)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/830,494 US9243239B2 (en) | 2012-03-26 | 2013-03-14 | Purification of cystathionine beta-synthase |
CN201380027463.0A CN104540940B (zh) | 2012-03-26 | 2013-03-25 | 胱硫醚β‑合酶的纯化 |
EP19179948.5A EP3569706A1 (fr) | 2012-03-26 | 2013-03-25 | Purification de la cystathionine bêta-synthase |
BR112014023570-8A BR112014023570B1 (pt) | 2012-03-26 | 2013-03-25 | Método de purificação da protéina cistationina betasintase (cbs) |
JP2015503433A JP6146934B2 (ja) | 2012-03-26 | 2013-03-25 | シスタチオンβ−シンターゼの精製 |
PCT/US2013/033716 WO2013148580A1 (fr) | 2012-03-26 | 2013-03-25 | Purification de la cystathionine bêta-synthase |
EP17165825.5A EP3263701B1 (fr) | 2012-03-26 | 2013-03-25 | Purification de la cystathionine bêta-synthase |
CA2867719A CA2867719C (fr) | 2012-03-26 | 2013-03-25 | Purification de la cystathionine beta-synthase |
EP13716577.5A EP2831229B8 (fr) | 2012-03-26 | 2013-03-25 | Purification de la cystathionine beta synthase |
AU2013240003A AU2013240003B2 (en) | 2012-03-26 | 2013-03-25 | Purification of cystathionine beta-synthase |
IN7920DEN2014 IN2014DN07920A (fr) | 2012-03-26 | 2013-03-25 | |
IL234635A IL234635B (en) | 2012-03-26 | 2014-09-14 | Purification of cystathionine beta-synthase |
US14/970,814 US10160962B2 (en) | 2012-03-26 | 2015-12-16 | Purification of cystathionine beta-synthase |
JP2017078808A JP6839595B2 (ja) | 2012-03-26 | 2017-04-12 | シスタチオンβ−シンターゼの精製 |
HK18105730.4A HK1246350B (zh) | 2012-03-26 | 2018-05-03 | 胱硫醚β-合酶的純化 |
US16/178,024 US20190055537A1 (en) | 2012-03-26 | 2018-11-01 | Purification of cystathionine beta-synthase |
IL26316218A IL263162B (en) | 2012-03-26 | 2018-11-21 | Purification of cystathionine beta-synthase |
JP2019187777A JP6952361B2 (ja) | 2012-03-26 | 2019-10-11 | シスタチオンβ−シンターゼの精製 |
US16/739,169 US10941392B2 (en) | 2012-03-26 | 2020-01-10 | Purification of cystathionine beta-synthase |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261615629P | 2012-03-26 | 2012-03-26 | |
US13/830,494 US9243239B2 (en) | 2012-03-26 | 2013-03-14 | Purification of cystathionine beta-synthase |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/970,814 Continuation US10160962B2 (en) | 2012-03-26 | 2015-12-16 | Purification of cystathionine beta-synthase |
Publications (2)
Publication Number | Publication Date |
---|---|
US20130251700A1 US20130251700A1 (en) | 2013-09-26 |
US9243239B2 true US9243239B2 (en) | 2016-01-26 |
Family
ID=49212017
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/830,494 Active US9243239B2 (en) | 2012-03-26 | 2013-03-14 | Purification of cystathionine beta-synthase |
US14/970,814 Active 2033-08-09 US10160962B2 (en) | 2012-03-26 | 2015-12-16 | Purification of cystathionine beta-synthase |
US16/178,024 Abandoned US20190055537A1 (en) | 2012-03-26 | 2018-11-01 | Purification of cystathionine beta-synthase |
US16/739,169 Active US10941392B2 (en) | 2012-03-26 | 2020-01-10 | Purification of cystathionine beta-synthase |
Family Applications After (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/970,814 Active 2033-08-09 US10160962B2 (en) | 2012-03-26 | 2015-12-16 | Purification of cystathionine beta-synthase |
US16/178,024 Abandoned US20190055537A1 (en) | 2012-03-26 | 2018-11-01 | Purification of cystathionine beta-synthase |
US16/739,169 Active US10941392B2 (en) | 2012-03-26 | 2020-01-10 | Purification of cystathionine beta-synthase |
Country Status (11)
Country | Link |
---|---|
US (4) | US9243239B2 (fr) |
EP (3) | EP2831229B8 (fr) |
JP (3) | JP6146934B2 (fr) |
CN (1) | CN104540940B (fr) |
AU (1) | AU2013240003B2 (fr) |
BR (1) | BR112014023570B1 (fr) |
CA (1) | CA2867719C (fr) |
HK (1) | HK1246350B (fr) |
IL (2) | IL234635B (fr) |
IN (1) | IN2014DN07920A (fr) |
WO (1) | WO2013148580A1 (fr) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11324811B2 (en) | 2017-04-17 | 2022-05-10 | The Regents Of The University Of Colorado, A Body Corporate | Optimization of enzyme replacement therapy for treatment of homocystinuria |
US11400143B2 (en) | 2013-01-29 | 2022-08-02 | The Regents Of The University Of Colorado | Compositions and methods for treatment of homocystinuria |
US11771745B2 (en) | 2015-11-09 | 2023-10-03 | The Regents Of The University Of Colorado | Compositions and methods for treatment of homocystinuria |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9034318B2 (en) | 2011-08-30 | 2015-05-19 | The Regents Of The University Of Colorado, A Body Corporate | Chemically modified cystathionine beta-synthase enzyme for treatment of homocystinuria |
US9243239B2 (en) * | 2012-03-26 | 2016-01-26 | The Regents Of The University Of Colorado, A Body Corporate | Purification of cystathionine beta-synthase |
WO2020264061A1 (fr) * | 2019-06-25 | 2020-12-30 | Zymergen Inc. | Voies de biosynthèse d'ingénierie pour la production de cystathionine par fermentation |
EP3990005A1 (fr) * | 2019-06-26 | 2022-05-04 | Travere Therapeutics Switzerland GmbH | Cystathionine bêta synthase pégylée pour une enzymothérapie pour le traitement de l'homocystinurie |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995007714A1 (fr) | 1993-09-13 | 1995-03-23 | Regents Of The University Of Colorado | SEQUENCE D'ADN CODANT LA CYSTATHIONINE β-SYNTHASE HUMAINE |
US5635375A (en) | 1995-01-09 | 1997-06-03 | Regents Of The University Of Colorado | Method of increasing the yield and heme saturation of cystathione β-synthase |
WO2003106971A2 (fr) | 2002-06-17 | 2003-12-24 | The Regents Of The University Of Colorado | Variants de la cystathionine $g(b)-synthase humaine et leurs procedes de production |
EP1396537A1 (fr) | 2002-09-04 | 2004-03-10 | Avidis SA | Méthode de traitement du taux élevé d'homocystéine dans le plasma |
EP1878739A1 (fr) | 2006-07-14 | 2008-01-16 | LEK Pharmaceuticals D.D. | Purification de protéines en une étape par IMAC (MCAC) |
US7816495B2 (en) * | 2002-07-10 | 2010-10-19 | Nhs Blood And Transplant | Processes for the preparation of fibrinogen |
WO2011097381A2 (fr) | 2010-02-04 | 2011-08-11 | The Board Of Regents Of Use University Of Texas System | Enzymes génétiquement modifiées par des enzymes méthionine-gamma-lyase, et préparations pharmacologiques associées |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS5576559A (en) | 1978-12-01 | 1980-06-09 | Chiyou Lsi Gijutsu Kenkyu Kumiai | Electron beam fine adjusting device |
CN1552905A (zh) * | 2003-12-18 | 2004-12-08 | 中国农业科学院茶叶研究所 | 一类茶树胱硫醚-γ-合成酶特异表达序列标签及其生物芯片 |
US9243239B2 (en) | 2012-03-26 | 2016-01-26 | The Regents Of The University Of Colorado, A Body Corporate | Purification of cystathionine beta-synthase |
-
2013
- 2013-03-14 US US13/830,494 patent/US9243239B2/en active Active
- 2013-03-25 WO PCT/US2013/033716 patent/WO2013148580A1/fr active Application Filing
- 2013-03-25 EP EP13716577.5A patent/EP2831229B8/fr active Active
- 2013-03-25 JP JP2015503433A patent/JP6146934B2/ja active Active
- 2013-03-25 CN CN201380027463.0A patent/CN104540940B/zh active Active
- 2013-03-25 CA CA2867719A patent/CA2867719C/fr active Active
- 2013-03-25 EP EP19179948.5A patent/EP3569706A1/fr not_active Withdrawn
- 2013-03-25 IN IN7920DEN2014 patent/IN2014DN07920A/en unknown
- 2013-03-25 BR BR112014023570-8A patent/BR112014023570B1/pt active IP Right Grant
- 2013-03-25 EP EP17165825.5A patent/EP3263701B1/fr active Active
- 2013-03-25 AU AU2013240003A patent/AU2013240003B2/en active Active
-
2014
- 2014-09-14 IL IL234635A patent/IL234635B/en active IP Right Grant
-
2015
- 2015-12-16 US US14/970,814 patent/US10160962B2/en active Active
-
2017
- 2017-04-12 JP JP2017078808A patent/JP6839595B2/ja active Active
-
2018
- 2018-05-03 HK HK18105730.4A patent/HK1246350B/zh unknown
- 2018-11-01 US US16/178,024 patent/US20190055537A1/en not_active Abandoned
- 2018-11-21 IL IL26316218A patent/IL263162B/en active IP Right Grant
-
2019
- 2019-10-11 JP JP2019187777A patent/JP6952361B2/ja active Active
-
2020
- 2020-01-10 US US16/739,169 patent/US10941392B2/en active Active
Patent Citations (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995007714A1 (fr) | 1993-09-13 | 1995-03-23 | Regents Of The University Of Colorado | SEQUENCE D'ADN CODANT LA CYSTATHIONINE β-SYNTHASE HUMAINE |
US5523225A (en) | 1993-09-13 | 1996-06-04 | Regents Of The University Of Colorado | DNA sequence encoding human cystathionine β-synthase |
US5635375A (en) | 1995-01-09 | 1997-06-03 | Regents Of The University Of Colorado | Method of increasing the yield and heme saturation of cystathione β-synthase |
WO2003106971A2 (fr) | 2002-06-17 | 2003-12-24 | The Regents Of The University Of Colorado | Variants de la cystathionine $g(b)-synthase humaine et leurs procedes de production |
US7485307B2 (en) | 2002-06-17 | 2009-02-03 | The Regents Of The University Of Colorado | Human cystathionine β-synthase variants and methods of production thereof |
US8007787B2 (en) | 2002-06-17 | 2011-08-30 | The Regents of the Universit of Colorado | Human cystathionine β-synthase variants and methods of production thereof |
US7816495B2 (en) * | 2002-07-10 | 2010-10-19 | Nhs Blood And Transplant | Processes for the preparation of fibrinogen |
EP1396537A1 (fr) | 2002-09-04 | 2004-03-10 | Avidis SA | Méthode de traitement du taux élevé d'homocystéine dans le plasma |
EP1878739A1 (fr) | 2006-07-14 | 2008-01-16 | LEK Pharmaceuticals D.D. | Purification de protéines en une étape par IMAC (MCAC) |
WO2011097381A2 (fr) | 2010-02-04 | 2011-08-11 | The Board Of Regents Of Use University Of Texas System | Enzymes génétiquement modifiées par des enzymes méthionine-gamma-lyase, et préparations pharmacologiques associées |
Non-Patent Citations (23)
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11400143B2 (en) | 2013-01-29 | 2022-08-02 | The Regents Of The University Of Colorado | Compositions and methods for treatment of homocystinuria |
US11771745B2 (en) | 2015-11-09 | 2023-10-03 | The Regents Of The University Of Colorado | Compositions and methods for treatment of homocystinuria |
US11324811B2 (en) | 2017-04-17 | 2022-05-10 | The Regents Of The University Of Colorado, A Body Corporate | Optimization of enzyme replacement therapy for treatment of homocystinuria |
US12042529B2 (en) | 2017-04-17 | 2024-07-23 | The Regents Of The University Of Colorado, A Body Corporate | Optimization of enzyme replacement therapy for treatment of homocystinuria |
Also Published As
Publication number | Publication date |
---|---|
JP6146934B2 (ja) | 2017-06-21 |
IL234635B (en) | 2018-12-31 |
HK1246350B (zh) | 2020-05-15 |
EP3569706A1 (fr) | 2019-11-20 |
CA2867719A1 (fr) | 2013-10-03 |
AU2013240003A1 (en) | 2014-10-02 |
CA2867719C (fr) | 2020-08-11 |
US20160177287A1 (en) | 2016-06-23 |
US20200131497A1 (en) | 2020-04-30 |
BR112014023570B1 (pt) | 2022-03-15 |
US20130251700A1 (en) | 2013-09-26 |
JP6952361B2 (ja) | 2021-10-20 |
IL263162B (en) | 2019-11-28 |
BR112014023570A2 (pt) | 2021-06-01 |
EP3263701A1 (fr) | 2018-01-03 |
EP3263701B1 (fr) | 2019-06-19 |
IN2014DN07920A (fr) | 2015-05-01 |
US20190055537A1 (en) | 2019-02-21 |
EP2831229B1 (fr) | 2017-10-18 |
CN104540940B (zh) | 2018-03-06 |
CN104540940A (zh) | 2015-04-22 |
JP2017121255A (ja) | 2017-07-13 |
EP2831229A1 (fr) | 2015-02-04 |
JP6839595B2 (ja) | 2021-03-10 |
WO2013148580A1 (fr) | 2013-10-03 |
EP2831229B8 (fr) | 2018-10-17 |
JP2020000259A (ja) | 2020-01-09 |
AU2013240003B2 (en) | 2018-04-19 |
IL263162A (en) | 2018-12-31 |
US10941392B2 (en) | 2021-03-09 |
JP2015512639A (ja) | 2015-04-30 |
US10160962B2 (en) | 2018-12-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10941392B2 (en) | Purification of cystathionine beta-synthase | |
Mihara et al. | cDNA cloning, purification, and characterization of mouse liver selenocysteine lyase: candidate for selenium delivery protein in selenoprotein synthesis | |
Chen et al. | Production of the neuromodulator H2S by cystathionine β-synthase via the condensation of cysteine and homocysteine | |
US10624959B2 (en) | Chemically modified cystathionine beta-synthase enzyme for treatment of homocystinuria | |
Jakubowski | Quality control in tRNA charging-editing of homocysteine | |
US9011844B2 (en) | Human cystathionine β-synthase variants and methods of production thereof | |
Chatterjee et al. | Characterization of VnfG, the δ subunit of the vnf-encoded apodinitrogenase from Azotobacter vinelandii: Implications for its role in the formation of functional dinitrogenase 2 | |
Mahnke-Zizelman et al. | Novel aspects of tetramer assembly and N-terminal domain structure and function are revealed by recombinant expression of human AMP deaminase isoforms | |
Plaxton et al. | Molecular and regulatory properties of leucoplast pyruvate kinase from Brassica napus (rapeseed) suspension cells | |
AU2011294798A1 (en) | Recombinant therapeutic glycine N-acyltransferase | |
Anguera et al. | Cloning, expression, and purification of 5, 10-methenyltetrahydrofolate synthetase from Mus musculus | |
Ibrahim | Acyl-CoA dehydrogenases: characterization of the new member Isobutyryl-CoA dehydrogenase, genetic defects and correlation to thermal unfolding | |
Ibrahim | Acyl-CoA Dehydrogenases: Characterization of the New Member Isobutyryl-CoA | |
Katb et al. | S-Adenosylmethionine synthetase from human lymphocytes | |
Christensen | The NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase and 10-formyltetrahydrofolate synthetase: an optimized mitochondrial one-carbon folate pathway |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: THE REGENTS OF THE UNIVERSITY OF COLORADO, A BODY Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KRAUS, JAN;MAJTAN, TOMAS;REEL/FRAME:033599/0890 Effective date: 20140821 |
|
AS | Assignment |
Owner name: ORPHAN TECHNOLOGIES, LTD., SWITZERLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CARRILLO, RICHARD;NAVEH, DAVID;REEL/FRAME:033692/0716 Effective date: 20101110 |
|
AS | Assignment |
Owner name: THE REGENTS OF THE UNIVERSITY OF COLORADO, A BODY Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ORPHAN TECHNOLOGIES, LTD.;REEL/FRAME:033794/0885 Effective date: 20140923 |
|
STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY Year of fee payment: 4 |
|
MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY Year of fee payment: 8 |