US8586313B2 - DNA methylation markers based on epigenetic stem cell signatures in cancer - Google Patents

DNA methylation markers based on epigenetic stem cell signatures in cancer Download PDF

Info

Publication number
US8586313B2
US8586313B2 US12/520,841 US52084107A US8586313B2 US 8586313 B2 US8586313 B2 US 8586313B2 US 52084107 A US52084107 A US 52084107A US 8586313 B2 US8586313 B2 US 8586313B2
Authority
US
United States
Prior art keywords
cancer
precursor cell
cell population
pcg
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US12/520,841
Other languages
English (en)
Other versions
US20100172880A1 (en
Inventor
Peter W. Laird
Martin Widschwendter
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University College London
University of Southern California USC
Original Assignee
University College London
University of Southern California USC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College London, University of Southern California USC filed Critical University College London
Priority to US12/520,841 priority Critical patent/US8586313B2/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF SOUTHERN CALIFORNIA
Publication of US20100172880A1 publication Critical patent/US20100172880A1/en
Assigned to THE UNIVERSITY OF SOUTHERN CALIFORNIA reassignment THE UNIVERSITY OF SOUTHERN CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LAIRD, PETER W.
Assigned to UNIVERSITY COLLEGE LONDON reassignment UNIVERSITY COLLEGE LONDON ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WIDSCHWENDTER, MARTIN
Application granted granted Critical
Publication of US8586313B2 publication Critical patent/US8586313B2/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • markers e.g., diagnostic and/or prognostic DNA methylation markers
  • markers for cellular proliferative disorders and/or cancer and markers or for developmental lineages and/or stages
  • precursor cells e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, etc
  • precursor cells e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, etc
  • methods for identifying preferred DNA methylation markers for cellular proliferative disorders and/or cancer or markers for developmental lineages and/or stages and for validating and/or monitoring of precursor cells (e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, cells of a particular developmental lineage and/or stage, etc), particularly of precursor cells to be used therapeutically.
  • precursor cells e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, cells of a particular developmental lineage and/or stage, etc
  • Additional aspects relate to method for diagnosis or prognosis of ovarian cancer comprising determining the methylation state of a HOX genomic DNA sequence. Yet further aspects relate to methods for predicting the response to neoadjuvant and/or adjuvant chemotherapy in a solid tumor.
  • Cancer cells contain extensive aberrant epigenetic alterations, including promoter CpG island DNA hypermethylation and associated alterations in histone modifications and chromatin structure.
  • Aberrant epigenetic silencing of tumor-suppressor genes in cancer involves changes in gene expression, chromatin structure, histone modifications and cytosine-5 DNA methylation.
  • Embryonic stem cells are unique in the ability to maintain pluripotency over significant periods in culture, making them leading candidates for use in cell therapy.
  • Embryonic stem (ES) cell differentiation involves epigenetic mechanisms to control lineage-specific gene expression patterns.
  • ES cells rely on Polycomb group (PcG) proteins to reversibly repress genes required for differentiation, promoting ES cell self-renewal potential.
  • ES cell-based therapies hold great promise for the treatment of many currently intractable heritable, traumatic, and degenerative disorders.
  • these therapeutic strategies inevitably involve the introduction of human cells that have been maintained, manipulated, and/or differentiated ex vivo to provide the desired precursor cells (e.g., somatic stem cells, etc.), raising the specter that aberrant or rogue cells (e.g., cancer cells or cells predisposed to cancer that may occur during such manipulations and differentiation protocols) may be administered along with desired cells.
  • desired precursor cells e.g., somatic stem cells, etc.
  • aberrant or rogue cells e.g., cancer cells or cells predisposed to cancer that may occur during such manipulations and differentiation protocols
  • aspects of the present invention provide the first real evidence that stem-cell polycomb group (PcG) targets are substantially more likely to have cancer-specific promoter DNA hypermethylation than non-targets, thus providing, for the first time, effective and efficient methods for stem cell and/or precursor cell monitoring and validation, and for novel therapeutic methods, comprising monitoring and/or validating stem cells and/or precursor cells prior to therapeutic administration to preclude introduction of aberrant or rogue cells (e.g., cancer cells or cells predisposed to cancer).
  • PcG stem-cell polycomb group
  • stem-cell polycomb group (PcG) targets are up to twelve-fold more likely to have cancer-specific promoter DNA hypermethylation than non-targets, indicating a stem-cell origin of cancer, in which reversible gene repression is replaced by permanent silencing, locking the cell into a perpetual state of self-renewal and thereby predisposing to subsequent malignant transformation.
  • PcG stem-cell polycomb group
  • Exemplary aspects provide methods for identifying preferred DNA methylation markers for cellular proliferative disorders and/or cancer, based on identifying PcG protein or PcG repressive complex genomic target loci (collectively, PcG target loci) within a precursor cell (e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, progenitor cell, etc.) population, and determining, in cells of the cellular proliferative disorder and/or cancer (e.g., colorectal, breast, ovarian, hematopoietic, etc.), a characteristic (cancer-specific) methylation status of CpG sequences within loci corresponding to the precursor cell PcG target loci.
  • ES embryonic stem
  • somatic stem cells e.g., cancer stem cells, progenitor cell, etc.
  • a characteristic (cancer-specific) methylation status of CpG sequences within loci corresponding to the precursor cell PcG target loci e.g., color
  • Specific embodiments provide a method for identifying, screening, selecting or enriching for preferred DNA methylation markers for a cellular proliferative disorder and/or cancer, comprising: identifying, with respect to a precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or Polycomb repressive complex (collectively referred to herein as PcG target loci); obtaining a sample of genomic DNA from cells of a cellular proliferative disorder and/or cancer; and determining, by analyzing the genomic DNA from the cells of the cellular proliferative disorder and/or cancer using a suitable assay, a cancer-specific methylation status of at least one CpG dinucleotide sequence position within at least one region of at least one of the polycomb group protein (PcG) target loci, wherein the presence of said CpG methylation status identifies the at least one region of at least one of the polycomb group protein (PcG) target loci as a preferred DNA methylation
  • Particular embodiments provide a method for identifying, screening, selecting or enriching for preferred DNA methylation markers for cells of a particular developmental lineage or stage, comprising: identifying, with respect to a precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex (PcG target loci); obtaining a sample of genomic DNA from cells of a particular developmental lineage or stage; and determining, by analyzing the genomic DNA from the cells of the particular developmental lineage or stage using a suitable assay, a lineage-specific or stage-specific DNA methylation status of at least one CpG dinucleotide sequences within at least one region of at least one of the polycomb group protein (PcG) target loci, wherein the presence of said CpG methylation status identifies the at least one region of at least one of the polycomb group protein (PcG) target loci as a preferred DNA methylation marker for the particular developmental lineage or stage.
  • PcG
  • determining the lineage-specific or stage-specific methylation status of the at least one CpG dinucleotide sequences within at least one region of at least one of the polycomb group protein (PcG) target loci is determining the DNA methylation status of a locus that has a cancer-specific DNA methylation status.
  • Additional aspects provide methods for validating and/or monitoring a precursor cell (e.g., embryonic stem (ES) cells, somatic stem cells, cancer stem cells, progenitor cell, etc.) population, comprising screening or monitoring one or more PcG genomic target loci of a precursor cell population for the presence of absence of target loci methylation status that is characteristic of (disorders-specific, cancer-specific) the PcG target loci in one or more cellular proliferative disorders and/or cancers, or that, in certain further embodiments corresponds to (is specific for) a particular developmental status (e.g., lineage or stage).
  • ES embryonic stem
  • somatic stem cells e.g., somatic stem cells, cancer stem cells, progenitor cell, etc.
  • Specific embodiments provide a method for validating and/or monitoring a precursor cell population, comprising: identifying, with respect to a reference precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex; identifying one or a plurality of said target loci having a characteristic (disorder-specific, cancer specific) DNA methylation status in a cellular proliferative disorder and/or cancer to provide a set of preferred disorder and/or cancer-related diagnostic/prognostic loci; obtaining genomic DNA from a first test therapeutic precursor cell population of interest; and determining, by analyzing the genomic DNA of the first test therapeutic precursor cell population using a suitable assay, the methylation status of at least one CpG dinucleotide sequence within at least one region of at least one of the polycomb group protein (PcG) preferred diagnostic/prognostic loci, wherein the first test therapeutic precursor cell population is validated and/or monitored with respect to the presence or absence of the characteristic (
  • a method for validating and/or monitoring a precursor cell population comprising: identifying, with respect to a reference precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex; identifying one or a plurality of said target loci having a characteristic DNA methylation status (lineage-specific, stage specific, etc.) in a cell of a particular developmental lineage or stage to provide a set of preferred lineage or stage specific diagnostic/prognostic loci; obtaining genomic DNA from a first test therapeutic cell population of interest; and determining, by analyzing the genomic DNA of the first test therapeutic cell population using a suitable assay, the DNA methylation status of at least one CpG dinucleotide sequence within at least one region of at least one of the polycomb group protein (PcG) preferred diagnostic/prognostic loci, wherein the first test therapeutic cell population is validated and/or monitored with respect to the presence or absence of the characteristic methylation status (line
  • determining the lineage-specific or stage-specific methylation status of the at least one CpG dinucleotide sequences within at least one region of at least one of the polycomb group protein (PcG) target loci is determining the methylation status of a locus that has a cancer-specific methylation status.
  • various stem or precursor cells are used to identify transcriptional repressor occupancy sites (e.g., by chromatin immunoprecipitation chip analysis) and status for not only polycomb repressive complex 2 (PRC2), but also for other repressors and repressor complexes (e.g., repressors of developmental genes) as well, and these ChIP-Chip targets are then used as a means of enrichment for cancer-specific DNA methylation markers as taught herein using the exemplary combination of embryonic stems cells and PRC2 targets.
  • PRC2 polycomb repressive complex 2
  • the instant approach has substantial utility for various types of stem and precursor cells (ES cell, somatic stem cells, hematopoietic stem cells, leukemic stem cells, skin stem cells, intestinal stem cells, gonadal stem cells, brain stem cells, muscle stem cells (muscle myoblasts, etc.), mammary stem cells, neural stem cells (e.g., cerebellar granule neuron progenitors, etc.), etc), and for various stem- or precursor cell repressor complexes (e.g., such as those described in Table 1 of Sparmann & Lohuizen, Nature 6, 2006 (Nature Reviews Cancer, November 2006), incorporated herein by reference), and for various types of cancer, where the requirements are that the repressor occupancy sites/loci and corresponding occupancy status are defined/established, and a characteristic DNA methylation status (e.g., disorder-specific, cancer-specific, etc.) (e.g., DNA hypermethylation) is established at corresponding sites/loci in one or more cellular pro
  • stem and precursor cells
  • Yet additional aspects provide a method for the diagnosis or prognosis of ovarian cancer comprising: performing methylation analysis of genomic DNA of a subject tissue sample; and determining the methylation state of a HOX genomic DNA sequence relative to a control HOX genomic DNA sequence, wherein diagnosis or prognosis of ovarian cancer is provided.
  • the HOX genomic DNA sequence is that of HOXA10 or HOXA11, and hypermethylation is used to provide the ovarian cancer related diagnosis or prognosis.
  • the HOX genomic DNA sequence is that of HOXA11, and hypermethylation is used to provide a ovarian cancer related prognosis of poor outcome.
  • the diagnostic or prognosic marker is for at least one selected from the group consisting of: for stem cells that are unable to differentiate; for stem cell that are resistant to therapy; for residual tumor after cytoreductive surgery; for cancer stem cells; for mucinous cancer cases; for serous cancer cases; for endometrioid cancer cases; for clear cell cases; and for tumor distribution.
  • NEUROD1 methylation is a chemosensitivity marker in estrogen receptor (ER) negative breast cancer.
  • methylation analysis is at least one of: methylation analysis in core breast cancer biopsies taken prior to preoperative chemotherapy with complete pathological response as the endpoint; and seroconversion of NEUROD1 methylation in serum DNA during adjuvant chemotherapy with survival as the endpoint.
  • the chemosensitivity is with respect to at least one of cyclophospamide, methotrexate, 5-fluorouracil, anthracycline, and combinations thereof.
  • FIGS. 1A and B show, according to aspects of the present invention, PRC2 promoter occupancy in human ES cells and DNA methylation in human colorectal tumors and matched normal mucosa, along with a progression model.
  • genes are ranked by decreasing cancer-specific DNA methylation as defined by the differential mean PMR between tumor and normal samples with a ‘cutpoint’ of 2.
  • FIGS. 2A and B show Kaplan Meier survival curves and HOXA11 DNA methylation (dichotomized cases with methylated scores of PMR ⁇ 12 and PMR>12).
  • FIGS. 3A and B show NEUROD1 DNA methylation in the pretreatment breast cancer core biopsies of the training set.
  • FIGS. 4A and B show Kaplan Meier survival curves and NEUROD1 DNA methylation status in serum samples.
  • A Overall and B, relapse-free survival of 21 ER negative primary breast cancer patients with positive NEUROD1 methylation in pre-treatment serum.
  • Broken and continuous lines represent negative and positive serum NEUROD1 methylation after chemotherapy, respectively.
  • FIG. 5 shows association of COX-2 mRNA expression and NEUROD1 DNA methylation in ER negative primary breast cancer specimens (outliers excluded).
  • PcG Polycomb group proteins
  • FIG. 1A shows, according particular aspects of the present invention, SUZ12 and EED occupancy data and H3K27Me status for 177 genes (as reported by Lee, T. I. et al., Cell 125:301-313, 2006), as indicated by blue bars in FIG. 1A and in the legend at the bottom thereof.
  • Gene identities and primer and probe sequences are supplied in the working EXAMPLES disclosed herein below.
  • DNA methylation data was as reported by Weisenberger, D. J. et al. ( Nat Genet 38:787-793, 2006, incorporated by reference herein).
  • PMR values are indicated by colored bars in FIG. 1 , and in the legend at the bottom thereof.
  • FIG. 1B shows, according to additional inventive aspects, a model for the progression of epigenetic marks from reversible repression in ES cells to aberrant DNA methylation in cancer precursor cells, and persistent gene silencing in cancer cells.
  • the predisposition of ES-cell PRC2 targets to cancer-specific DNA hypermethylation indicates crosstalk between PRC2 and de novo DNA methyltransferases in an early precursor cell with a PRC2 distribution similar to that of ES cells.
  • the precise developmental stage and type of cell in which such crosstalk occurs is unknown, and is not likely to be an embryonic stem cell.
  • Other stem and embryonic cell types display a similar PRC2 preference for DNA-binding proteins and transcription factors (Squazzo et al. Genome Res 16:890-900, 2006; Bracken et al., Genes Dev 20:1123-1136, 2006, both incorporated herein by reference in their entireties).
  • colorectal and breast cancer cell lines display a markedly different set of PRC2 targets, enriched in genes encoding glycoproteins, receptors, and immunoglobulin-related genes (Squazzo et al. Genome Res 16:890-900, 2006), which are not frequent cancer-specific DNA hypermethylation targets.
  • this phenomenon is observable in enriched adult stem cell populations.
  • the high sensitivity of the MethyLightTM assay allowed for the detection of low frequency dense promoter methylation in CD34-positive hematopoietic progenitor cells (see working EXAMPLE 5, respectively, below).
  • the first predisposing steps towards malignancy occur very early, and are consistent with reports of field changes in histologically normal tissues adjacent to malignant tumors (Feinberg et al., Nat Rev Genet 7:21-33, 2006; Eads et al., Cancer Res 60:5021-5026, 2000; Shen et al. J Natl Cancer Inst 97:1330-1338, 2005).
  • the instant results provide a mechanistic basis for the predisposition of some (e.g., a subset), but not other promoter CpG islands to cancer-associated DNA hypermethylation.
  • the instant teachings indicate a residual stem-cell memory, rather than selective pressure for silencing of these particular genes during the transformation process in epithelial cells.
  • aberrant PRC2-DNA methyltransferase ‘crosstalk’ occurs at low frequency in stem cells, and does not disrupt normal differentiation if the silencing affects a small number of PRC2 targets that are not crucial to differentiation. However, if a sufficient number of a particular subset is affected, then the resulting DNA methylation ‘seeds’ prevent proper differentiation, and predispose the cell to further malignant development.
  • tissue-specific repressive complexes are capable of causing a similar predisposition to characteristic DNA methylation status (e.g., hypermethylation).
  • screening for PRC2 target promoter DNA hypermethylation has substantial utility for therapeutic applications involving introduction of precursor cells derived from cloned or cultured ES cells (see, e.g., for background, Roy et al. Nat Med 12: 1259-1268, 2006).
  • various stem or precursor cells are used to identify transcriptional repressor occupancy sites (e.g., by chromatin immunoprecipitation chip analysis) and status for not only PRC2, but also for other repressors and repressor complexes as well (e.g., such as those described in Table 1 of Sparmann & Lohuizen, Nature 6, 2006 (Nature Reviews Cancer, November 2006), incorporated herein by reference), and these ChIP-Chip targets as then used as a means of enrichment for cancer-specific DNA methylation markers as taught herein using the exemplary combination of embryonic stems cells and PRC2 targets.
  • Particular embodiments provide methods for validating and/or monitoring a precursor cell population, for example, with respect to the presence or absence of cells of a proliferative disorder or cancer, or cells having a development predisposition thereto, or cell of a particular development lineage or stage (see, e.g., EXAMPLE 9).
  • a preferred marker is a marker that is a developmental repressor locus (e.g., for PcGs, and PRC1, PRC2, etc.) and that further comprises at least one CpG dinucleotide sequence position having a DNA methylation state (e.g., DNA hypermethylation) that is cellular proliferative disorder-specific and/or cancer specific.
  • a developmental repressor locus e.g., for PcGs, and PRC1, PRC2, etc.
  • CpG dinucleotide sequence position having a DNA methylation state e.g., DNA hypermethylation
  • a marker that is a PRC1 or PRC2 developmental repressor locus with occupation by at least one of SUZ 12, EED, and H3K27me3, and that further comprises at least one CpG dinucleotide sequence position having a DNA methylation state (e.g., hypermethylation) that is cellular proliferative disorder-specific and/or cancer specific.
  • a DNA methylation state e.g., hypermethylation
  • a marker that is a PRC1 or PRC2 developmental repressor locus with occupation by at least two of SUZ 12, EED, and H3K27me3, and that further comprises at least one CpG dinucleotide sequence position having a methylation state (e.g., hypermethylation) that is cellular proliferative disorder-specific and/or cancer specific.
  • a methylation state e.g., hypermethylation
  • a marker that is a PRC1 or PRC2 developmental repressor locus with occupation by all three of SUZ 12, EED, and H3K27me3, and that further comprises at least one CpG dinucleotide sequence position having a methylation state (e.g., hypermethylation) that is cellular proliferative disorder-specific and/or cancer specific.
  • a methylation state e.g., hypermethylation
  • various stem or precursor cells are used to identify transcriptional repressor (e.g., transcription factor) occupancy sites (e.g., by chromatin immunoprecipitation chip analysis) and status for not only PRC2, but also for other repressors and repressor complexes as well (e.g., at least one transcription factor of the Dlx, Irx, Lhx and Pax gene families (neurogenesis, hematopoiesis and axial patterning), or the Fox, Sox, Gata and Tbx families (developmental processes)), and these ChIP-Chip targets as then used as a means of enrichment for cancer-specific DNA methylation markers as taught herein using the exemplary combination of embryonic stems cells and PRC2 targets.
  • transcriptional repressor e.g., transcription factor occupancy sites
  • other repressors and repressor complexes e.g., at least one transcription factor of the Dlx, Irx, Lhx and Pax gene families (neur
  • PBPC Peripheral blood progenitor cells
  • n 9; age range: 20.1 to 49.4 yrs.; mean: 35.6 years; 3 breast cancer patients in a clinical trial setting, 2 patients with acute myeloid leukemia, 1 patient with B acute lymphoblastic leukemia, 1 patient with medulloblastoma, 1 patient with T non-Hodgkin's lymphoma and 1 patient with idiopathic thrombocytopenic purpura).
  • Mobilization of PBPC was performed by administration of chemotherapy followed by G-CSF.
  • PBPC peripheral venous blood cell separator
  • the harvest of PBPC was performed as large-volume, continuous-flow collection using a COBE Spectra® blood cell separator (Gambro BCT, Colorado, USA) through bilateral peripheral venous accesses.
  • the blood was processed at a rate of 50 to 120 ml/min.
  • a second collection was optional and depended on the yield of CD34 pos. progenitors cells obtained during the first procedure.
  • the CD34 pos. cells were isolated with CD34 conjugated magnetic beads (Miltenyi Biotec; Bergisch Gladbach, Germany) according the manufacturer's instructions.
  • CD34 purity was controlled by flow cytometric analysis. Only cell fractions with >90% purity were further analyzed.
  • Genomic DNA from cell and tissue samples was isolated using the DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.
  • CXCR4 (SEQ ID NO: 1) Forward: CGCTAATTCTCCAAATACGATAACTACTAAA; (SEQ ID NO: 2) Reverse: TCGGTC GCGGTTAGAAATTTT, (SEQ ID NO: 3) Probe: 5′FAM- TCGACGTCACTTTACTACCTACTACCGCA ACCA-3′BHQ1; SFRP1: (SEQ ID NO: 4) Forward: CAACTCCCGACGAAACGAA; (SEQ ID NO: 5) Reverse: CGCGAGG GAGGCGATT, (SEQ ID NO: 6) Probe: 5′FAM-CACTCGTTACCACGTCCGTCA CCG-3′BHQ1; SFRP2: (SEQ ID NO: 7) Forward: AAACCTACCCGCCCGAAA; (SEQ ID NO: 8) Reverse: GTTGAACGGTGGTTGGAGATTC, (SEQ ID NO: 9) Probe: 5′FAM-CGCCTCGACGAACTTCGTTTTCCCT-3′BHQ1; SFRP4:
  • Table 1 lists the 177 MethyLightTM reactions from Weisenberger et al. (2006) for which the PRC2 occupancy could be established from the data published in Lee et al. (2006). Of the 177 reactions, 164 (93%) are located within 1 kb of the transcription start site. Of the PRC2 targets, 95% are located within 1 kb of the transcription start site. See Table 5 herein below for primer and probe details.
  • Table 2 lists DNA methylation values (PMR) of 35 genes analyzed in 18 normal ovaries and 22 ovarian cancers. These genes were selected for their potential utility as cancer-specific DNA methylation markers without prior knowledge of their PRC2 occupancy status. P-values of genes that demonstrate significant higher DNA methylation levels (Mann Whitney U test) in cancer compared to normal ovaries are shaded and referred as to “cancer genes”. Applicants defined “Stem cell genes” as genes which are occupied with at least two of the three components (SUZ12, EED and H3K27me3) in human embryonic stem cells. Nine genes demonstrated higher frequencies of densely methylated alleles (as reflected in the listed values for PMR) in cancer tissues compared to normal ovaries.
  • Table 3 lists DNA methylation values (PMR) of 61 genes (with known PRC2 component occupancy status in human embryonic stem cells) analyzed in 15 non-neoplastic breast and 15 breast cancers.
  • PMR DNA methylation values
  • P-values of genes that demonstrate significant higher DNA methylation levels (Mann Whitney U test) in cancer compared to non-neoplastic breast are shaded and referred as to “cancer genes”.
  • Table 4 lists DNA methylation values (PMR) of 35 genes (with known PRC2 component occupancy status in human embryonic stem cells) analyzed in CD34 positive hematopoietic progenitor cells from nine patients.
  • PMR DNA methylation values
  • stem cell genes genes which are occupied with at least two of the three components (SUZ12, EED and H3K27me3) in human embryonic stem cells.
  • Particular examples and embodiments disclosed herein provide an efficient way to identify/enrich for candidate cancer-specific DNA methylation markers, based on ES-cell PRC2 targets, and in certain aspects, based on a subset of ES-cell PRC2 targets that also bind at least one of the transcription factors: OCT4, SOX2, Nanog.
  • various stem or precursor cells are used to identify transcriptional repressor (e.g., transcription factor) occupancy sites (e.g., by chromatin immunoprecipitation chip analysis) and status for not only PRC2, but also for other repressors and repressor complexes as well (e.g., at least one transcription factor of the Dlx, Irx, Lhx and Pax gene families (neurogenesis, hematopoiesis and axial patterning), or the Fox, Sox, Gata and Tbx families (developmental processes)), and these ChIP-Chip targets as then used as a means of enrichment for cancer-specific DNA methylation markers as taught herein using the exemplary combination of embryonic stems cells and PRC2 targets.
  • transcriptional repressor e.g., transcription factor occupancy sites
  • other repressors and repressor complexes e.g., at least one transcription factor of the Dlx, Irx, Lhx and Pax gene families (neur
  • the instant approach has substantial utility for various types of stem and precursor cells (ES cell, somatic stem cells, hematopoietic stem cells, leukemic stem cells, skin stem cells, intestinal stem cells, gonadal stem cells, brain stem cells, muscle stem cells (muscle myoblasts, etc.), mammary stem cells, neural stem cells (e.g., cerebellar granule neuron progenitors, etc.), etc) and for various stem- or precursor cell repressor complexes as discussed above, and for various types of cancer (e.g., as discussed herein above and further including basal carcinoma, pancreatic adenocarcinoma, small cell lung cancer and metastatic prostate cancer), where the requirements are that the repressor occupancy sites/loci and corresponding occupancy status are defined/established, and a characteristic methylation status (e.g., hypermethylation) is established at corresponding sites/loci in one or more cellular proliferative disorders or cancers of interest, or, in particular embodiments, in
  • Particular embodiments provide a method for identifying, screening, selecting or enriching for preferred DNA methylation markers for a cellular proliferative disorder and/or cancer, comprising: identifying, within a precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or Polycomb repressive complex; obtaining a sample of genomic DNA from cells of a cellular proliferative disorder and/or cancer; and determining, by analyzing the genomic DNA from the cells of the cellular proliferative disorder and/or cancer using a suitable assay, the DNA methylation status of at least one CpG dinucleotide sequence within at least one region of at least one of the polycomb group protein (PcG) target loci, wherein the presence of said CpG methylation status identifies the at least one region of at least one of the polycomb group protein (PcG) target loci as a preferred DNA methylation marker for the cellular proliferative disorder and/or cancer.
  • PcG poly
  • identifying one or a plurality of polycomb group protein (PcG) target loci comprises identifying a plurality of said target loci using genomic DNA from stem cells.
  • the stem cells consist of, or comprise embryonic stem (ES) cells.
  • the CpG methylation status is that of hypermethylation.
  • identifying comprises chromatin immunoprecipitation.
  • determining the methylation status comprises use of a high-throughput methylation assay.
  • the at least one region of at least one of the polycomb group protein (PcG) target loci comprises a CpG island or a portion thereof.
  • the cellular proliferative disorder and/or cancer is at least one selected from the group consisting of human colorectal cancer, ovarian cancer, breast cancer, and proliferative disorders and/or cancers associated with haematopoietic stem cells.
  • Particular embodiments provide a method for identifying, screening, selecting or enriching for preferred DNA methylation markers for cells of a particular developmental lineage or stage, comprising: identifying, within a precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex; obtaining a sample of genomic DNA from cells of a particular developmental lineage or stage; and determining, by analyzing the genomic DNA from the cells of the particular developmental lineage or stage using a suitable assay, the methylation status of at least one CpG dinucleotide sequences within at least one region of at least one of the polycomb group protein (PcG) target loci, wherein the presence of said CpG methylation status identifies the at least one region of at least one of the polycomb group protein (PcG) target loci as a preferred DNA methylation marker for the particular developmental lineage or stage.
  • PcG polycomb group protein
  • identifying one or a plurality of polycomb group protein (PcG) target loci comprises identifying a plurality of said target loci using genomic DNA from stem cell-derived cells of a particular developmental lineage or stage.
  • the stem cells comprise embryonic stem (ES) cells.
  • the CpG methylation status is that of hypermethylation.
  • a Method for Validating and/or Monitoring a Precursor Cell Population (e.g., Therapeutic Precursor Cell Population)
  • Particular embodiments provide a method for validating and/or monitoring a precursor cell population, comprising: identifying, within a reference precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex; identifying one or a plurality of said target loci having a characteristic (disorder-specific, cancer-specific, etc.) DNA methylation status (e.g., at one or more CpG dinucleotide sequence positions of said at least one loci) in a cellular proliferative disorder and/or cancer to provide a set of preferred disorder and/or cancer-related diagnostic/prognostic loci; obtaining genomic DNA from a first test therapeutic precursor cell population of interest; and determining, by analyzing the genomic DNA of the first test therapeutic precursor cell population using a suitable assay, the methylation status of at least one CpG dinucleotide sequence position within the at least one region of the at least one of the polycomb group protein (PcG) preferred diagnostic/
  • identifying one or a plurality of polycomb group protein (PcG) target loci within a reference precursor cell population comprises identifying a plurality of said target loci of genomic DNA of stem cells.
  • the stem cells consist of, or comprise embryonic stem (ES) cells.
  • ES embryonic stem
  • the CpG methylation status is that of DNA hypermethylation. In other embodiments the status is DNA hypomethylation.
  • identifying one or a plurality of said target loci having a characteristic (disorder-specific and/or cancer-specific, etc.) DNA methylation status in a cellular proliferative disorder and/or cancer comprises obtaining a sample of genomic DNA from cells of a cellular proliferative disorder and/or cancer, and determining, by analyzing the genomic DNA using a suitable assay, the methylation status of at least one CpG dinucleotide sequence within the at least one region of the at least one of the polycomb group protein (PcG) target locus.
  • determining the methylation status comprises use of a high-throughput DNA methylation assay.
  • the at least one region of at least one of the polycomb group protein (PcG) target loci comprises a CpG island or a portion thereof.
  • the cellular proliferative disorder and/or cancer is at least one selected from the group consisting of human colorectal cancer, ovarian cancer, breast cancer, and cellular proliferative disorders and/or cancers associated with hematopoietic stem cells.
  • the methods further comprise: obtaining genomic DNA from a second test precursor cell population; applying the method steps to said second stem cell population; and comparing the methylation status of the first and second test precursor cell populations to provide for distinguishing or selecting a preferred precursor cell population.
  • the first and second test precursor cell populations consist of, or comprise stem cells, cultured stem cells, or cells derived from stem cells or cultured stem cells.
  • the stem cells consist of, or comprise embryonic stem (ES) cells.
  • the CpG methylation status of the first and second test precursor cell populations is that of hypermethylation.
  • validating and/or monitoring is of the precursor cell population in culture, subjected to one or more differentiation protocols, or in storage, etc.
  • the precursor cell population consists of, or comprises stem cells.
  • validating and/or monitoring (e.g., validation monitoring) is of the precursor cell population during or after differentiation of the precursor cell population.
  • the precursor cell population consists of, or comprises stem cells.
  • validating and/or monitoring comprises validating and/or monitoring during culture or differentiation of the stem cells population for a presence or absence of rogue cells of the cellular proliferative disorder and/or cancer, or of cells having a predisposition thereto, or for cells of a particular developmental lineage of stage.
  • a method for validating and/or monitoring a precursor cell population comprising: identifying, within a reference precursor cell population, one or a plurality of genomic target loci for at least one polycomb group protein (PcG) or polycomb repressive complex; identifying one or a plurality of said target loci having a characteristic (lineage-specific and/or stage-specific) DNA methylation status of at least one CpG dinucleotide sequence position within at least one region of the at least one of the polycomb group protein (PcG) target loci in a cell of a particular developmental lineage or stage, and wherein the one or the plurality of said target loci also has a cellular proliferative disorder-specific and/or cancer-specific methylation status, to provide a set of preferred diagnostic/prognostic loci for the lineage and/or stage; obtaining genomic DNA from a first test cell population of interest; and determining, by analyzing the genomic DNA of the first test cell population using a suitable assay, the DNA methyl
  • Human ES cell lines are, for example, maintained according to the specific directions for each cell line.
  • WA09 H9 are cultured on MEFs in 80% DMEM/F12, 20% KSR, 1 mM L-glutamine, 1 ⁇ NEAA, 4 ng/ml FGF-2.
  • the cells are passaged by treatment with collagenase IV, 5-7 minutes at 37° C., and scraping to remove colonies, washed 1 ⁇ in DMEM/F12 and plated on inactivated MEF feeder layer in 60 mm plates or 6-well plates every 5-7 days.
  • ES02 (HES-2) are, for example, cultured on MEFs in 80% DMEM, 20% FBS, 2 mM L glutamine, 1 ⁇ NEAA, 50/50 Pen/Strep, 1 ⁇ ITS, 0.1 mM 2-ME.
  • the cells are cultured in 1 ml organ culture dishes, by carefully cutting undifferentiated pieces from hESC colonies placing them onto inactivated MEFs every 5-7 days.
  • HUES cell lines will be cultured on MEFs in 80% KO-DMEM, 10% Plasmanate (Talecris Biotherapeutics, Inc. formerly Bayer Corporation), 10% KSR, 2 mM L-glutamine, 1 ⁇ NEAA, 0.1 mM 2-ME, 10 ng/ml FGF-2.
  • the cells are passaged by short treatment with 0.05% trypsin/EDTA and retitration every 4-5 days.
  • the DNA methylation assays are species-specific, so the use of mouse embryonic fibroblasts will not interfere with the epi
  • All cells are, for example, monitored daily for morphology and medium exchange. Additional analysis and validation is optionally performed for stem cell markers on a routine basis, including Alkaline Phosphatase every 5 passages, OCT4, NANOG, TRA-160, TRA-181, SEAA-4, CD30 and Karyotype by G-banding every 10-15 passages.
  • culture conditions and differentiation protocols are analyzed for their tendency to predispose ES cells to the acquisition of aberrant epigenetic alterations.
  • undirected differentiation by maintenance in suboptimal culture conditions such as the cultivation to high density for four to seven weeks without replacement of a feeder layer is analyzed as an exemplary condition having such a tendency.
  • DNA samples are, for example, taken at regular intervals from parallel differentiation cultures to investigate progression of abnormal epigenetic alterations.
  • directed differentiation protocols such as differentiation to neural lineages 32,33 can be analyzed for their tendency to predispose ES cells to the acquisition of aberrant epigenetic alterations. pancreatic lineages (Segev et al., J.
  • Chromatin immunoprecipitation can be combined with hybridization to high-density genome tiling microarrays (ChIP-Chip) to obtain comprehensive genomic data.
  • Chromatin immunoprecipitation is not able to detect epigenetic abnormalities in a small percentage of cells, whereas DNA methylation analysis has been successfully applied to the highly sensitive detection of tumor-derived free DNA in the bloodstream of cancer patients (Laird, P. W. Nat Rev Cancer 3, 253-66, 2003).
  • a sensitive, accurate, fluorescence-based methylation-specific PCR assay e.g., MethyLightTM
  • MethyLightTM is used, which can detect abnormally methylated molecules in a 10.000-fold excess of unmethylated molecules
  • MethyLightTM analyses are performed as previously described by the present applicants (e.g., Weisenberger, D. J. et al.
  • High-throughput Illumina platforms can be used to screen PRC2 targets (or other targets) for aberrant DNA methylation in a large collection of human ES cell DNA samples (or other derivative and/or precursor cell populations), and then MethyLightTM and MethyLightTM variations can be used to sensitively detect abnormal DNA methylation at a limited number of loci (e.g., in a particular number of cell lines during cell culture and differentiation).
  • Illumina, Inc. (San Diego) has recently developed a flexible DNA methylation analysis technology based on their GoldenGateTM platform, which can interrogate 1,536 different loci for 96 different samples on a single plate (Bibikova, M. et al. Genome Res 16:383-393, 2006). Recently, Illumina reported that this platform can be used to identify unique epigenetic signatures in human embryonic stem cells (Bibikova, M. et al. Genome Res 16:1075-83, 200)). Therefore, Illumina analysis platforms are preferably used.
  • High-throughput Illumina platforms can be used to screen PRC2 targets (or other targets) for aberrant DNA methylation in a large collection of human ES cell DNA samples (or other derivative and/or precursor cell populations), and then MethyLightTM and MethyLightTM variations can be used to sensitively detect abnormal DNA methylation at a limited number of loci (e.g., in a particular number of cell lines during cell culture and differentiation).
  • stepwise strategies e.g., Weisenberger et al., Nat Genet 38:787-793, 2006, incorporated herein
  • stepwise strategies are used as taught by the methods exemplified herein to provide DNA methylation markers that are targets for oncogenic epigenetic silencing in ES cells.
  • Particular embodiments provide methods for providing a validated cell population (e.g., precursor cell population) for therapeutic administration, comprising, prior to therapeutically administering a cell population, screening or monitoring the cell population using methods as described herein to validate the cells to be administered with respect to the presence or absence of cells of a cellular proliferative disorder and/or cancer (e.g., rogue cancer cells) or cells having a developmental predisposition thereto, or the presence or absence of cells of a particular development lineage or stage, or to validate that cells population to be delivered as being of a particular development lineage or stage, to provide for a validated precursor cell population.
  • a validated cell population e.g., precursor cell population
  • cell populations for therapeutic administration may be stem cells, or early progenitor cells, or typically may be cell populations derived from stem cells or from early progenitor cells.
  • the cell population to be administered is free of cancer cells, or cells having a predisposition to become cancer cells.
  • it is desired to know that the cell population to be administered is free of cells of a particular type, developmental lineage or stage, or cells having a predisposition to become cells of a particular type, developmental lineage or stage.
  • the cell population to be administered is of cells of a particular type, developmental lineage or stage, or is of cells having a predisposition to become cells of a particular type, developmental lineage or stage.
  • a sensitive DNA methylation assay is preferably used that is suitable to detect a characteristic DNA methylation pattern or status in one or fewer than one abnormal cells among about 1,000 or more normal cells, or among about 5,000 or more normal cells, and preferably that allows the detection of a single abnormally methylated promoter in a background of 10,000 cells without this epigenetic abnormality (e.g., MethyLightTM or suitable variations thereof).
  • stem cells e.g., embryonic stem cells
  • stem cells are strategically differentiated to further developed cell types or lineages that suitable and appropriate for the particular therapeutic administration.
  • it is such differentiated cell populations that will be screened or monitored or validated using methods of the present invention.
  • PGCTs stem cell Polycomb group targets
  • ovarian cancer specimens were analyzed from 22 patients (age range: 30.1 to 80.9 yrs.; mean: 61.8 yrs.; 7 serous cystadeno, 6 mucinous, 6 endometrioid and 3 clear cell cancers) and apparently normal ovaries from 18 patients (age range: 24.1 to 76.9 yrs.; mean: 61.6 yrs.; 13, 4 and 1 had endometrial and cervical cancer and fibroids, respectively).
  • HOXA10 and HOXA11 methylation analysis 92 primary ovarian cancer cases were studied; details are provided in Supplementary TABLE 51 and TABLE 6. 77 patients received platinum-based chemotherapy.
  • Genomic DNA from lyophilized, quick-frozen specimens was isolated using the DNeasyTM tissue kit (Qiagen, Hilden, Germany). Sodium bisulfite conversion of genomic DNA and the MethyLightTM assay were performed as previously described, and PMR (Percentage of Methylated Reference) values were determined (11). For methylation analysis, ACTB was used as reference gene. Most of the primers and probes for the MethyLightTM reactions have been published (11-14, incorporated by reference herein; (HOXA10; (SEQ ID NO: 598) AC004080.
  • HOXA10 and HOXA11 methylation were analyzed in more detail.
  • HOXA11 demonstrated higher methylation levels in patients >60 years of age, whereas HOXA10 methylation was higher in poorly differentiated cancers (Supplementary TABLE S1).
  • HOXA10 and HOXA11 methylation could be observed already in the normal frozen specimens (highest PMR value was 11.39 and 11.02 for HOXA10 and HOXA11, respectively).
  • HOX genes which are known to be the key players in the development of the mullerian duct (15), are dysregulated in endometrial (16) and in ovarian cancer (17).
  • ES embryonic stem
  • HOXA family are targets (and thereby silenced) by the Polycomb group proteins (PcG) SUZ12 and EED and associated with nucleosomes that are trimethylated at histone H3 lysine-27 (H3K27me3) for maintenance of transcriptional suppression in human embryonic stem cells.
  • PcG control is critical for long term gene silencing essential for development and adult cell renewal.
  • HOXA10 and HOXA11 are epigenetically silenced in embryonic stem cells in conjunction with our observation that both genes are already methylated at a low level in normal ovarian tissue and increasingly methylated in ovarian cancers, indicated to applicants that HOXA10 and HOXA11 methylation acts as a tag for ovarian cancer's cell of origin and as a marker for cancer stem cells.
  • HOXA11 is a factor which is of paramount importance in Mullerian Duct biology (15) and is known to be occupied and thereby suppressed by PRC2 in human embryonic stem cells.
  • the interesting finding that 93% of the tumors with more than 2 cm residual after surgery had HOXA11 PMR values >12 shows that HOXA11 may act also as a marker for the tumor distribution. This would support the view that the technical ability to cytoreduce the cancer simply identifies a biologically more favourable patient subgroup (18).
  • HOXA11 provides a surrogate marker for cancer stem cells, and its methylation is a factor which determines cancer progression.
  • NEUROD1 Methylation was Shown Herein to be a Novel Chemosensitivity Marker in Breast Cancer (e.g., ER Negative Breast Cancer)
  • PGCTs stem cell Polycomb group targets
  • NEUROD1 DNA methylation was the best discriminator between these different groups (4).
  • this EXAMPLE we focused on the role of NEUROD1 methylation in breast cancer biology, and analyzed tumor samples, pre-treatment core biopsies and pre- and post-therapeutic serum samples by means of MethyLightTM, a sensitive fluorescence-based real-time PCR technique (5).
  • NEUROD1 methylation is provided as a chemosensitivity marker in breast cancer (e.g., ER negative breast cancer).
  • Clinicopathological features are shown in TABLE 9A.
  • applicants analysed samples from an independent test set from 21 patients.
  • One patient received 3 cycles of a combination of cyclophospamide, methotrexate and 5-fluorouracil, 10 patients received 4 cycles, 9 patients 6 cycles and 1 patient 3 cycles of an anthracycline-based therapy.
  • Clinicopathological features are shown in TABLE 9B.
  • Hormone receptor status was determined by either radioligand binding assay or immunohistochemistry. Clinicopathological features are shown TABLE 10. Patients' blood samples were drawn before or 1 year after therapeutic intervention. Blood was centrifuged at 2,000 ⁇ g for 10 minutes at room temperature and 1 mL aliquots of serum samples were stored at ⁇ 30° C.
  • Genomic DNA from fresh frozen tissue samples or paraffin embedded tissue sample respectively was isolated using the DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer s protocol. DNA isolation from serum samples, bisulfite modification, and MethyLight analysis was done as described previously (2). Primers and Probe for NEUROD1 (AC013733; e.g., amplicon position 78576-78657 (SEQ ID NO: 597)) have been described recently (6, incorporated by reference herein).
  • RNA Isolation and RT-PCR Total cellular RNA was extracted from the tumor specimens as previously described by the acid guanidium thiocyanate-phenol-chlorophorm method.
  • RNA Reverse Transcription of RNA was performed as previously described.
  • the following primers were used for COX-2 expression analysis: Forward: 5-TGCTGCTGTGCGCGG-3 (SEQ ID NO: 592), Reverse: 5-GGTTTTGACATGGGTGGGAAC-3 (SEQ ID NO: 593), Probe: 5 FAM-CCTGGCGCTCAGCCATACAG CAAA-3 TAMRA (SEQ ID NO 594).
  • Primers and probes for the TATA box-binding protein (TBP) were used according to Bieche et al (7).
  • Real-time PCR was performed using an ABI Prism 7900HT Detection System (Applied Biosystems, Foster City, Calif.) as recently described.
  • the standard curves were generated using serially diluted solutions of standard cDNA derived from the HBL-100 breast carcinoma cell-line.
  • NEUROD1 methylation is the best discriminator between breast cancer and non-neoplastic tissue samples (4; Supplementary TABLE S4).
  • NEUROD1 methylation is the best discriminator between breast cancer and non-neoplastic tissue samples (4; Supplementary TABLE S4).
  • the promoter of NEUROD1 is occupied by repressive regulators in human embryonic stem cells (8) which would be consistent with NEUROD1 DNA methylation marking cancer stem cells in the tumor.
  • NEUROD1 methylation is associated with other tumor features like responsiveness to systemic treatment in breast cancer.
  • NEUROD1 methylation analysis in core breast cancer biopsies taken prior to preoperative chemotherapy with complete pathological response as the endpoint model 1
  • seroconversion of NEUROD1 methylation in serum DNA during adjuvant chemotherapy with survival as the endpoint model 2
  • model 1 applicants first analyzed DNA from pretreatment core biopsies from 23 breast cancer patients (training set). 21/23 samples yielded sufficient DNA and 7/21 patients demonstrated a CR (TABLE 9A). Patients with a CR demonstrated significantly higher NEUROD1 methylation levels in their pretreatment cancer cores ( FIG. 3A ).
  • applicants' second model applicants assessed whether serum NEUROD1 methylation is able to predict the response to adjuvant chemotherapy in patients with primary breast cancer.
  • Pretreatment NEUROD1 serum DNA methylation was more prevalent in postmenopausal women, whereas no difference in any of the other clinicopathological features could be observed.
  • persistence of NEUROD1 DNA methylation after chemotherapy indicated poor overall and relapse-free survival in the univariate analysis ( FIG. 4 , and TABLE 12). Characteristics of these patients are shown in TABLE 10B.
  • NEUROD1 methylation values 25th; 75th n
  • Ataxia telenoiestasis mutated (includes complemantation groups A, C and D) N N ATR ATR-M1B HB-180 Ataxia telenoiestasis and Red3 related: FRP1; SCKL; SCKL1 N N AXIN1 AXIN1-M1B HB-227 Axin 1 N N BCL2 BCL2-M1B HB-140 Bcl-2; B-ce-1I CLUlvrnchome 2 Y Y BDNF BDNF-M2B HB-258 Brain derived neurotropohic factor Y Y BRCA1 BRCA1-M1B HB-045 Breast cancer 1, early onset RNF53; BRCC1 N N BRCA2 BRCA2-M1B HB-126 breast cancer 2, early onset N N CACNA1G CACNA1G-M1B HB-158 Caldum channel,
  • TGFBR2 TGFBR2-M1B HB-246 Transforming growth factor, beta receptor II (70/80 kDa); MFS2 N N THBS1 THBS1-M1B HB-247 Thrombospondin 1; TSP1 Y N THRB THRB-M1B HB-216 Thyroid hormone receptor, beta; ERBA2; THRB1; THRB2; NR1A2 Y N TIMP3 TIMP3-M1B HB-167 TIMP metallopeptidase Inhibitor 3 (Scrsby fundus dystrophy, pseudoinflammatory); SFD Y N TITF1 TITF1-M1B HB-213 Thyroid transcription factor 1; NKX2A; BCH; TTF-1 Y N TMEFF2 TMEFF2-M1B HB-274 Transmembrane protein with EGF-like and two follistatin-like domains 2; TENB2 Y N TNFR
  • the reaction was designed towards the promoter-associated CpG Island of the OPCML gene. However, the MethyLight PCR primers and probe share 99% identity to the CpG Island associated with the HNT genomic locus. Therefore, this reaction likely recognizes methylation at either locus.
  • the antisense primer used in this study has a mismatch compared to the current GenBank sequence for the genomic locus. The correct antisense primer sequence should read: 5-AAACGACCGCGA C CCCATA-3′. Also, the final three nucleosidase of the probe oligomer (GAA) are mismatched with the genomic DNA sequence. The correct sequence should read: 5′-CGCTCCGAAAACCCGAACCCGC-3′.
  • the probe sequence in order to correctly meet the melting temperature PCR requirements, we recommend the probe sequence to be: 5′-CGCTCCGAAAACCCGAACCCG-3′.
  • the correct nucleotide(s) are underlined for both the antisense and probe oligomers.
  • the antisense primer contains an extra 5′-TCC-3′ trinucleotide that is not present in the current version of the GenBank genomic sequence.
  • the correct antisense primer sequence should read: 5′-ACAACGAAAATCCTCCAAAAATACA-3′.
  • the MINT designations are not HGNC-approved gene names, but loci identified as cancer-specifically methylated. MINT1 is located in intron1 of SV2C.
  • the dose % locus to MINT2 is FANCL at 187 kb distance.
  • MINT31 is located near CACNA1G, but in a different CoG island from the MethyLight reaction designed for the CACNA1G locus (HB-158).
  • Neoadjuvant chemotherapy has been widely used prior to surgery for locally advanced breast cancer (12, 13). Response to this kind of therapy has been shown to be a valid surrogate marker of survival and facilitates breast conserving surgery (14-16). But current clinical and pathological markers poorly predict response to neoadjuvant chemotherapy. In applicants EXAMPLE study, ER negative breast cancers with high NEUROD1 methylation are more likely to respond with a complete pathological response following neoadjuvant chemotherapy.
  • Predictive factors in adjuvant breast cancer therapy are limited to ER, progesterone receptor, and HER-2/neu. These markers are used to predict response to hormonal treatment and herceptin, respectively (17, 18). Recently HER-2/neu in serum was shown to be a significant predictor of response to neoadjuvant anthracycline-based chemotherapy for breast cancer, whereas the HER-2/neu status of tumor tissue did not correlate with response to treatment (19). Furthermore HER-2/neu overexpression was identified as a major prognostic factor in stage II and III breast cancer patients treated with a neoadjuvant docetaxel and epirubicin combination (20). Despite these findings a more extensive range of predictive markers is highly needed in order to extend the range of individualized therapies for breast cancer patients.
  • COX-2 cyclooxygenase-2
  • MDR1/P-glycoprotein MDR1/P-gp
  • COX-2 derived Prostaglandin E2 protects embryonic stem cells from apoptosis (26).
  • this is the first study describing a DNA based marker which is able to predict the response to neoadjuvant as well as adjuvant chemotherapy in a solid tumor independent of gene transcription and the source of DNA analyzed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US12/520,841 2006-12-27 2007-12-27 DNA methylation markers based on epigenetic stem cell signatures in cancer Active 2029-10-14 US8586313B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/520,841 US8586313B2 (en) 2006-12-27 2007-12-27 DNA methylation markers based on epigenetic stem cell signatures in cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US87753006P 2006-12-27 2006-12-27
US88294806P 2006-12-31 2006-12-31
US12/520,841 US8586313B2 (en) 2006-12-27 2007-12-27 DNA methylation markers based on epigenetic stem cell signatures in cancer
PCT/US2007/088994 WO2008083251A2 (fr) 2006-12-27 2007-12-27 Marqueurs de méthylation de l'adn basés sur des signatures de cellule souche épigénétique dans le cancer

Publications (2)

Publication Number Publication Date
US20100172880A1 US20100172880A1 (en) 2010-07-08
US8586313B2 true US8586313B2 (en) 2013-11-19

Family

ID=39589208

Family Applications (1)

Application Number Title Priority Date Filing Date
US12/520,841 Active 2029-10-14 US8586313B2 (en) 2006-12-27 2007-12-27 DNA methylation markers based on epigenetic stem cell signatures in cancer

Country Status (3)

Country Link
US (1) US8586313B2 (fr)
CA (1) CA2673784A1 (fr)
WO (1) WO2008083251A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9580437B2 (en) 2014-12-23 2017-02-28 Novartis Ag Triazolopyrimidine compounds and uses thereof
US10676479B2 (en) 2016-06-20 2020-06-09 Novartis Ag Imidazolepyridine compounds and uses thereof
US10689378B2 (en) 2016-06-20 2020-06-23 Novartis Ag Triazolopyridine compounds and uses thereof
US11091489B2 (en) 2016-06-20 2021-08-17 Novartis Ag Crystalline forms of a triazolopyrimidine compound

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100024492A (ko) * 2005-03-18 2010-03-05 (주)지노믹트리 바이오마커 스크리닝 시스템
EP2382325B1 (fr) * 2008-12-23 2015-08-19 Koninklijke Philips N.V. Marqueurs biologiques de méthylation pour prédire la survie sans rechute
WO2011025819A1 (fr) 2009-08-25 2011-03-03 New England Biolabs, Inc. Détection et quantification de nucléotides hydroxyméthylés dans une préparation polynucléotidique
WO2012037456A1 (fr) 2010-09-17 2012-03-22 President And Fellows Of Harvard College Analyse de génomique fonctionnelle pour caractérisation de l'utilité et de l'innocuité de cellules souches pluripotentes
WO2012058634A2 (fr) 2010-10-28 2012-05-03 Salk Institute For Biological Studies Signatures épigénétiques de cellules souches pluripotentes induites
GB201102014D0 (en) * 2011-02-04 2011-03-23 Ucl Business Plc Method for predicting risk of developing cancer
EP2673738A4 (fr) 2011-02-11 2017-08-23 E-4 Endeavors, Inc. Système et procédé de modélisation de spécimen de biopsie
CA2816446C (fr) * 2013-03-15 2020-04-14 Christopher Robert Mueller Procedes et necessaires de diagnostic, de pronostic de risque ou de resultat, ou de traitement de cancer du sein
SG11201605259QA (en) * 2013-12-30 2016-07-28 Agency Science Tech & Res Methods for measuring biomarkers in gastrointestinal cancer
CN111781358A (zh) * 2020-07-13 2020-10-16 张瑜 Xab2蛋白作为卵巢癌预后和/或预测铂类耐药标志物
CN114395623B (zh) * 2021-12-16 2024-03-08 上海市杨浦区中心医院(同济大学附属杨浦医院) 一种基因甲基化检测引物组合物及其试剂盒和应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Bracken et al., "Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions," Genes & Development, 2006, pp. 1123-1136, vol. 20.
Notterman et al, in Microarrays and Cancer Research, 2002, Warrington et al (eds.), Eaton Publishing, Westborough, MA, pp. 81-111. *
Strausberg et al, in Microarrays and Cancer Research, 2002, Warrington et al (eds.), Eaton Publishing, Westborough, MA, pp. xi-xvi. *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9580437B2 (en) 2014-12-23 2017-02-28 Novartis Ag Triazolopyrimidine compounds and uses thereof
US10220036B2 (en) 2014-12-23 2019-03-05 Novartis Ag Triazolopyrimidine compounds and uses thereof
US11207325B2 (en) 2014-12-23 2021-12-28 Novartis Ag Triazolopyrimidine compounds and uses thereof
US11931363B2 (en) 2014-12-23 2024-03-19 Novartis Ag Triazolopyrimidine compounds and uses thereof
US10676479B2 (en) 2016-06-20 2020-06-09 Novartis Ag Imidazolepyridine compounds and uses thereof
US10689378B2 (en) 2016-06-20 2020-06-23 Novartis Ag Triazolopyridine compounds and uses thereof
US11091489B2 (en) 2016-06-20 2021-08-17 Novartis Ag Crystalline forms of a triazolopyrimidine compound
US11548897B2 (en) 2016-06-20 2023-01-10 Novartis Ag Crystalline forms of a triazolopyrimidine compound

Also Published As

Publication number Publication date
WO2008083251A3 (fr) 2008-10-23
CA2673784A1 (fr) 2008-07-10
US20100172880A1 (en) 2010-07-08
WO2008083251A2 (fr) 2008-07-10

Similar Documents

Publication Publication Date Title
US8586313B2 (en) DNA methylation markers based on epigenetic stem cell signatures in cancer
Selamat et al. Genome-scale analysis of DNA methylation in lung adenocarcinoma and integration with mRNA expression
Nakamura et al. RASSF1A and NORE1A methylation and BRAFV600E mutations in thyroid tumors
Okugawa et al. Epigenetic alterations in colorectal cancer: emerging biomarkers
Kang et al. DNA methylation profiles of gastric carcinoma characterized by quantitative DNA methylation analysis
Gottardo et al. Micro-RNA profiling in kidney and bladder cancers
CN108350504B (zh) 膀胱癌的诊断方法
Ibanez de Caceres et al. Identification of novel target genes by an epigenetic reactivation screen of renal cancer
Natale et al. Deciphering DNA methylation signatures of pancreatic cancer and pancreatitis
Deng et al. Epigenetic alterations as cancer diagnostic, prognostic, and predictive biomarkers
Hanoun et al. The silencing of microRNA 148a production by DNA hypermethylation is an early event in pancreatic carcinogenesis
US8110361B2 (en) DNA methylation markers associated with the CpG island methylator phenotype (CIMP) in human colorectal cancer
Marzese et al. Emerging technologies for studying DNA methylation for the molecular diagnosis of cancer
Patai et al. Comprehensive DNA methylation analysis reveals a common ten-gene methylation signature in colorectal adenomas and carcinomas
Visone et al. DNA methylation of shelf, shore and open sea CpG positions distinguish high microsatellite instability from low or stable microsatellite status colon cancer stem cells
Okamura et al. Leukemia inhibitory factor receptor (LIFR) is detected as a novel suppressor gene of hepatocellular carcinoma using double-combination array
US20120178634A1 (en) Method for determination of presence of cancer cell, and method for determination of prognosis of cancer patient
WO2009108917A2 (fr) Marqueurs pour la détection améliorée du cancer du sein
MX2008011839A (es) Propagacion de celulas primarias.
Brait et al. Association of promoter methylation of VGF and PGP9. 5 with ovarian cancer progression
Ortiz et al. Loss of DNA methylation is related to increased expression of miR-21 and miR-146b in papillary thyroid carcinoma
Yi et al. Epigenetic alterations in inflammatory bowel disease and cancer
US20220307091A1 (en) Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
CN112992354A (zh) 一种基于甲基标志物组合评估结直肠癌转移复发风险和动态监测的方法以及系统
EP3140420B1 (fr) Marqueurs épigénétiques du cancer du sein utiles dans le pronostic de traitement à l'anthracycline

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF SOUTHERN CALIFORNIA;REEL/FRAME:022963/0527

Effective date: 20090709

AS Assignment

Owner name: UNIVERSITY COLLEGE LONDON, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WIDSCHWENDTER, MARTIN;REEL/FRAME:024845/0995

Effective date: 20091215

Owner name: THE UNIVERSITY OF SOUTHERN CALIFORNIA, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LAIRD, PETER W.;REEL/FRAME:024845/0986

Effective date: 20100716

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FEPP Fee payment procedure

Free format text: 7.5 YR SURCHARGE - LATE PMT W/IN 6 MO, SMALL ENTITY (ORIGINAL EVENT CODE: M2555); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8