US7939083B2 - Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain - Google Patents

Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain Download PDF

Info

Publication number
US7939083B2
US7939083B2 US12/312,016 US31201607A US7939083B2 US 7939083 B2 US7939083 B2 US 7939083B2 US 31201607 A US31201607 A US 31201607A US 7939083 B2 US7939083 B2 US 7939083B2
Authority
US
United States
Prior art keywords
amino acid
hiv
acid position
polypeptide
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US12/312,016
Other languages
English (en)
Other versions
US20100041875A1 (en
Inventor
Antu K. Dey
John P. Moore
William C. Olson
Sai Prasad N. Iyer
Yun (Kenneth) Kang
Michael Franti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell Research Foundation Inc
Progenics Pharmaceuticals Inc
Original Assignee
Progenics Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Progenics Pharmaceuticals Inc filed Critical Progenics Pharmaceuticals Inc
Priority to US12/312,016 priority Critical patent/US7939083B2/en
Assigned to PROGENICS PHARMACEUTICALS, INC. reassignment PROGENICS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FRANTI, MICHAEL, IYER, SAI PRASAD N., KANG, KENNETH, OLSON, WILLIAM C.
Assigned to CORNELL RESEARCH FOUNDATION, INC. reassignment CORNELL RESEARCH FOUNDATION, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DEY, ANTU K., MOORE, JOHN P.
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: CORNELL UNIVERSITY
Assigned to CORNELL RESEARCH FOUNDATION, INC. reassignment CORNELL RESEARCH FOUNDATION, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DEY, ANTU K., MOORE, JOHN P.
Assigned to PROGENICS PHARMACEUTICALS, INC. reassignment PROGENICS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FRANTI, MICHAEL, IYER, SAI PRASAD N., KANG, YUN (KENNETH), OLSON, WILLIAM C.
Publication of US20100041875A1 publication Critical patent/US20100041875A1/en
Publication of US7939083B2 publication Critical patent/US7939083B2/en
Application granted granted Critical
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: CORNELL UNIVERSITY
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • HIV-1 Env complex The ability of human immunodeficiency virus type 1 (HIV-1) to enter its target cell and establish an infection is dependent on interactions between functional HIV envelope glycoprotein (Env) complexes on the virus and receptors on the host cell.
  • the HIV-1 Env complex is initially synthesized as the polyprotein precursor gp160, which undergoes oligomerization, disulfide bond formation and extensive glycosylation in the endoplasmic reticulum (Earl, Moss, and Doms, 1991) and is then proteolytically cleaved into the surface (gp120) and transmembrane (gp41) subunits by furin-like endo-proteases in the Golgi network (Fields, 1996; Hunter and Swanstrom, 1990).
  • the resulting Env complex is a trimer, with three gp120 proteins associated non-covalently with three gp41 subunits.
  • gp120 interacts with the CD4 receptor, which triggers conformational changes that facilitate gp120 binding to a coreceptor, CCR5 or CXCR4 (Berger, Murphy, and Farber, 1999; Rizzuto et al., 1998). These interactions promote extensive conformational changes in the gp41 subunit that drive the insertion of the hydrophobic gp41 N-terminal region (fusion peptide) into the host cell membrane.
  • TM transmembrane
  • CT cytoplasmic tail
  • gp120 rapidly dissociates from gp41 when soluble forms of gp140 proteins are expressed, and trimeric gp140 proteins can degrade into dimers and monomers, or associate into tetramers (dimers of dimers) and aggregates (Earl et al., 1994; Schulke et al., 2002; Staropoli et al., 2000).
  • gp120-gp41 structures are found to be present on cells that express Env proteins, as are both gp41 stumps from which gp120 has been shed and uncleaved proteins that have evaded the host cell proteases that typically process gp160 (Herrera et al., 2005; Kuznetsov et al., 2003; Moore et al., 2006; Thomas et al., 1991; Wyatt and Sodroski, 1998; Zhu et al., 2003).
  • the present invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, the gp41 ectodomain polypeptide portion being modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); and lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); and optionally being modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535) and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • This invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, the gp41 ectodomain polypeptide portion being modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535); glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the invention also provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, the gp41 ectodomain polypeptide portion being modified to comprise isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588, wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • I isoleucine
  • Q amino acid position 543
  • S serine
  • K lysine
  • R arginine
  • This invention also provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises an A ⁇ C mutation at amino acid position 492, numbered by reference to the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a T ⁇ C mutation at amino acid position 596, numbered by reference to the HIV-1 isolate JR-FL; and (ii) isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588, wherein amino acid positions 535, 543, 553, 567 and
  • the gp120 polypeptide portion of the above described modified gp140 envelope polypeptides is modified to comprise a cysteine (C) residue at an amino acid position equivalent to amino acid position 492, numbered by reference to the HIV isolate JR-FL.
  • the gp41 ectodomain polypeptide portion of the above described modified gp140 envelope polypeptide is modified to comprise a cysteine (C) residue at an amino acid position equivalent to amino acid position 596, numbered by reference to the HIV-1 isolate JR-FL.
  • the gp41 ectodomain polypeptide portion of the above described modified gp140 envelope polypeptide is modified to comprise a proline (P) residue at an amino acid position equivalent to amino acid position 559, numbered by reference to the HIV-1 isolate KNH1144.
  • the isoleucine (I) at the amino acid position equivalent to amino acid position 535 is the result of an M535I mutation
  • the glutamine (Q) at the amino acid position equivalent to amino acid position 543 is the result of an L543Q mutation
  • the serine (S) at the amino acid position equivalent to amino acid position 553 is the result of an N553S mutation
  • the lysine (K) at the amino acid position equivalent to amino acid position 567 is the result of a Q567K mutation
  • the arginine (R) at the amino acid position equivalent to amino acid position 588 is the result of a G588R mutation, wherein the amino acid positions 535, 543, 553, 567 and 588 are numbered by reference to the HIV-1 isolate KNH1144.
  • the invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises an cysteine (C) at an amino acid position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a cysteine (C) at an amino acid position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL; (ii) a proline (P) at an amino acid position equivalent to amino acid 559 of the HIV-1 isolate KNH1144; and (iii) isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535); glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q54
  • the invention further provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises an A ⁇ C mutation at amino acid position 492, numbered by reference to the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a T ⁇ C mutation at amino acid position 596, numbered by reference to the HIV-1 isolate JR-FL; and (ii) isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588, wherein the 535, 543, 553, 567 and 588
  • the present invention also provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises a cysteine (C) residue at an amino acid position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a cysteine (C) residue at an amino acid position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL; (ii) a proline (P) residue at an amino acid position equivalent to amino acid position 559 of the HIV-1 isolate KNH1144; and (iii) glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 5
  • the invention provides an isolated nucleic acid encoding a modified form of an HIV-1 gp120 and gp41 polypeptide complex, wherein the modification in gp120 comprises a mutation of a non-cysteine amino acid to cysteine (C) at an amino acid position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL; and the modifications in gp41 comprise a mutation of a non-cysteine amino acid to cysteine (C) at an amino acid position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL, a mutation of a non-isoleucine amino acid to isoleucine (I) at an amino acid position equivalent to amino acid position 535 of the HIV-1 isolate KNH1144, a mutation of a non-glutamine amino acid to glutamine (Q) at an amino acid position equivalent to amino acid position 543 of the HIV-1 isolate KNH1144, a mutation of a non-serine amino acid to serine (S) at an amino acid position equivalent to amino acid position 553
  • the modifications in gp41 encoded by the isolated nucleic acid further comprise a mutation of a non-proline amino acid to proline (P) at an amino acid position equivalent to amino acid position 559 of the HIV-1 isolate KNH1144.
  • the isolated nucleic acid is DNA, cDNA, or RNA.
  • an expression vector which may contain an expression cassette, contains the above-described nucleic acid.
  • a eukaryotic or prokaryotic host cell contains the expression vector.
  • This invention further provides an isolated nucleic acid encoding a modified form of an HIV-1 gp120 and gp41 polypeptide complex, wherein the modification in gp120 comprises an A492C mutation and the modifications in gp41 comprise a T596C mutation, an M535I mutation; an L543Q mutation; an N553S mutation; a Q567K mutation and a G588R mutation, wherein the A492C and T596C mutations are numbered by reference to the HIV-1 isolate JR-FL, and the M535I, L543Q, N553S, Q567K and G588R mutations are numbered by reference to the HIV-1 isolate KNH1144.
  • This invention also provides a method for eliciting an immune response against HIV-1 or an HIV-1 infected cell in a subject comprising administering to the subject an amount of the composition of the invention effective to elicit the immune response in the subject.
  • This invention provides a method for eliciting an immune response against HIV-1 or an HIV-1 infected cell in a subject comprising administering to the subject an amount of the trimeric complex of the invention effective to elicit the immune response in the subject.
  • This invention also provides a method for preventing a subject from becoming infected with HIV-1, comprising administering to the subject an amount of the composition of the invention effective to prevent the subject from becoming infected with HIV-1.
  • This invention further provides a method for reducing the likelihood of a subject becoming infected with HIV-1, comprising administering to the subject an amount of the composition of of the invention effective to reduce the likelihood of the subject becoming infected with HIV-1.
  • This invention also provides a method for delaying the onset of, or slowing the rate of progression of, an HIV-1-related disease in an HIV-1-infected subject, which comprises administering to the subject an amount of an isolated nucleic acid encoding a modified form of an HIV-1 gp120 and gp41 polypeptide complex, wherein the modification in gp120 comprises an A492C mutation and the modifications in gp41 comprise a T596C mutation, an M535I mutation; an L543Q mutation; an N553S mutation, a Q567K mutation and a G588R mutation, wherein the A492C and T596C mutations are numbered by reference to the HIV-1 isolate JR-FL, and the M535I, L543Q, N553S, Q567K and G588R mutations are numbered by reference to the HIV-1 isolate KNH1144 effective to delay the onset of, or slow the rate of progression of, the HIV-1-related disease in the subject.
  • This invention also provides a method of stabilizing HIV-1 trimer complexes which comprise non-covalently associated gp120 and gp41 envelope polypeptides, which polypeptides comprise consecutive amino acids, said method comprising: introducing into the gp41 ectodomain polypeptide an isoleucine (I) at an amino acid position equivalent to amino acid position 535; a glutamine (Q) at an amino acid position equivalent to amino acid position 543; a serine (S) at an amino acid position equivalent to amino acid position 553; a lysine (K) at an amino acid position equivalent to amino acid position 567; and an arginine (R) at an amino acid position equivalent to amino acid position 588, wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • I isoleucine
  • Q glutamine
  • S serine
  • K lysine
  • R arginine
  • the invention provides a chimeric gp140 polypeptide comprising (i) a gp120 envelope polypeptide of a lade B subtype of an HIV-1 isolate and (ii) a gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144, said polypeptides comprising consecutive amino acids, wherein the KNH1144 gp41 ectodomain polypeptide comprises isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588; and wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the invention further provides a chimeric gp140 polypeptide comprising (i) a gp120 envelope polypeptide of a clade B subtype of an HIV-1 isolate and (ii) a gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144, said polypeptides comprising consecutive amino acids, wherein the KNH1144 gp41 ectodomain polypeptide comprises the sequence as set forth in SEQ ID NO:1 or SEQ ID NO:18.
  • the invention further provides a chimeric gp140 polypeptide comprising (i) a gp120 envelope polypeptide of a clade B subtype of an HIV-1 isolate and (ii) a gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144, said polypeptides comprising consecutive amino acids, wherein the KNH1144 gp41 ectodomain polypeptide comprises an amino acid sequence as set forth in SEQ ID NO:20 or SEQ ID NO:21, or the gp41 ectodomain polypeptide portion of the gp160 polypeptide as set forth in any one of SEQ ID NOS:5-8.
  • This invention provides a gp41 ectodomain polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:1, SEQ ID NO:18, SEQ ID NO:2, SEQ ID NO:22, SEQ ID NO:3, SEQ ID NO:25, or SEQ ID NO:28, which sequences contain or are modified to contain one or more of the trimer stabilizing amino acid residues described herein.
  • the gp41 ectodomain polypeptide contains at least three of the trimer stabilizing amino acid residues.
  • the invention further provides a modified gp41 ectodomain polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, or SEQ ID NO:30.
  • the invention also provides a modified gp160 polypeptide, which comprises a consecutive amino acid sequence as set forth in any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17.
  • the invention further provides a gp160 polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:9, SEQ ID NO:12, or SEQ ID NO:15, which sequences are modified to contain one or more of the trimer stabilizing amino acid residues described herein.
  • the modified gp160 polypeptides contain at least three of the trimer stabilizing amino acid residues.
  • trimers also provided are the gp120 and gp41 portions of the modified gp160 polypeptides, which can complex to form stabilized trimers of the invention.
  • the trimers further comprise a non-ionic detergent as described herein.
  • the present invention further provides an antibody, or a portion of the antibody, generated by immunizing an animal with a modified gp140 polypeptide as described herein; an antibody, or a portion of the antibody, generated by immunizing an animal with a trimeric complex as described herein; an antibody, or a portion of the antibody, generated by immunizing an animal with a composition as described herein; an antibody, or a portion of the antibody, generated by immunizing an animal with a modified gp41 ectodomain polypeptide as described herein; or an antibody, or a portion of the antibody, generated by immunizing an animal with the modified gp160 polypeptide or a portion thereof, e.g., gp120 polypeptide and/or gp41 ectodomain polypeptide, as described herein.
  • the antibody is a monoclonal antibody, or a portion of the monoclonal antibody.
  • the antibody is a humanized antibody, or a portion of the humanized antibody.
  • This invention also provides trimeric complexes and compositions as described herein, further comprising a non-ionic detergent.
  • the invention further provides a use of a modified gp140 polypeptide, a trimeric complex, a composition, a modified gp41 ectodomain polypeptide, or a modified gp160 polypeptide, or portion thereof, e.g., gp120 polypeptide and/or gp41 ectodomain polypeptide, for the preparation of a medicament for the treatment or prevention of infection by human immunodeficiency virus (HIV).
  • HAV human immunodeficiency virus
  • FIGS. 1A and 1B (A) Schematic view of gp41 region showing the location of the fusion peptide (FP), heptad repeat regions 1 and 2 (HR1 and HR2), the transmembrane region (TM) and the cytoplasmic tail (CT). The intramolecular disulfide bond is also shown. (B) Alignment of the N-terminus regions of KNH1144, JR-FL and Ba-L gp41, highlighting the 5 amino acids (bold and shaded) in and near the HR1 region (underlined) that differ in JR-FL and B-aL when compared to KNH1144.
  • FIGS. 2A-2C Trimer formation by cleaved, wild-type and mutant KNH1144 gp140 proteins.
  • A SOS and SOSIP versions of KNH1144 gp140 proteins.
  • B KNH1144 SOSIP gp140 mutants containing the indicated single residue substitutions in the gp41 N-terminal region, compared with the wild-type KNH1144 SOSIP gp140.
  • C KNH1144 SOSIP and SOS mutant gp140s, as indicated. Each panel shows a BN-PAGE analysis, followed by western blotting using MAb CA13.
  • FIGS. 3A-3C Trimer formation by cleaved, wild-type and mutant JR-FL SOS gp140 proteins.
  • A Design of various chimeric and mutant JR-FL gp140s. The intermolecular disulfide bond (SOS) and the Ile to Pro substitution at position 559 (I559P; SOSIP) are shown.
  • B The indicated wild-type and mutant/chimeric gp140 proteins were analyzed using BN-PAGE and western blotting with MAb CA13.
  • the designation NT 1-5 refers to substitution of the 5 amino acids M535I, L543Q, N553S, Q567K and G588R, in the gp41 N-terminus region.
  • FIGS. 4A and 4B (A) The wild-type JR-FL SOS gp140 and (B) the JR-FL gp41 NT 1-5 SOS gp140 mutant were analyzed by size-exclusion chromatography followed by BN-PAGE and western blotting with MAb CA13. The mutant protein is predominantly trimeric, the wild-type protein mostly monomeric.
  • FIGS. 5A and 5B (A) Representative SPR analysis of the binding of MAbs to the JR-FL SOS gp140 and the gp41 NT 1-5 SOS gp140 mutant to the following test agents were: (I) CD4IgG2, (II) b12, (III) 2G12, (IV) 2F5, (V) 4E10, (VI) PA-1, (VII) b6 and (VIII) 17b ⁇ /+ D1D2-CD4. The y-axis shows the SPR response unit (RU), the x-axis the time in seconds (s). (B) Injected samples from the BIAcore machine were manually collected after the ligand binding analysis, then analyzed by BN-PAGE. The wild-type JR-FL SOS gp140 and the gp41 NT 1-5 SOS gp140 mutant proteins are shown, from a representative experiment, one using the PA-1 mAb.
  • FIGS. 6A and 6B Stabilizing cleaved Ba-L SOS gp140 trimers.
  • A The wild-type Ba-L SOS gp140 and the mutant Ba-L gp41 NT 1-4 SOS gp140 proteins were analyzed by BN-PAGE and western blotting with MAb CA13.
  • B The same proteins were analyzed by SDS-PAGE and western blotting, followed by detection with MAb B13.
  • the ⁇ and + symbols indicate the absence and presence of DTT.
  • FIG. 7 Effect of gp41 N-terminus substitutions on Env incorporation into pseudovirions.
  • the JR-FL WT and gp41 NT 1-5 mutant viruses were produced by transfection of HEK 293T cells and pelleted from clarified supernatants.
  • the gp120, gp41 and p24 proteins wree resolved by SDS-PAGE and analyzed by Western blotting with the appropriate antibodies.
  • FIGS. 8A and 8B Effect of gp41 N-terminal changes on the Env forms present on pseudovirions.
  • FIG. 8A Virions, normalized for p24 content and expressing either the JR-FL WT Env glycoprotein, or the gp41 NT 1-5 mutant Env glycoprotein, were solubilized and analyzed under native conditions on a 4-12% Bis-Tris NuPAGE gel and Western blotted with the anti-gp12-MAb ARP43119. Env tetramers and dimers are highlighted with black arrows; trimers are indicated with a gray arrow.
  • FIG. 8B The histogram shows the relative proportions of the different Env forms present on the WT (black bars) and mutant (gray bars) pseudovirions. The densitometric data represents the Mean ⁇ Standard Deviation of values from four independent experiments.
  • FIGS. 9A and 9B Effect of gp41 N-terminal substitutions on soluble CD4- and temperature-induced gp120 shedding from pseudovirions.
  • FIG. 9A Pseudovirions expressing the JR-FL WT Env or gp41 NT 1-5 mutant Env were incubated for 2 hours with sCD4 at the concentrations indicated, at either 4° C. or 37° C.
  • FIG. 10 Effect of gp41 N-terminal substitutions on Env-pseudotyped virus infectivity.
  • Pseudovirions containing normalized amounts of p24 antigen and bearing the WT or mutant forms of JR-FL Env were serially diluted and used to infect U87.CD4.CCR5 cells. Infectivity was quantified by measuring luciferase activity four days post infection.
  • FIGS. 11A and 11B Effect of gp41 N-terminal substitutions on Env-mediated cell-cell fusion.
  • the kinetics of fusion mediated by the WT (black squares) and mutant (gray triangles) forms of JR-FL Env were determined in a ⁇ -lactamase reporter assay using HeLa-CD4/CCR5 (RC49) cells.
  • the extent of fusion is expressed as the percentage of the maximal fusion mediated by each Env ( FIG. 11A ), or the maximal fusion mediated by the WT Env ( FIG. 11B ).
  • the data represent the Mean ⁇ Standard Errors of three independent experiments. The various kinetic parameters are described in Table 3.
  • FIGS. 12A and 12B Effect of gp41 N-terminal substitutions on the binding of MAbs to pseudovirions. Equal amounts (judged by p24 antigen content) of virions expressing either the WT (black bars) or mutant (white bars) forms of JR-FL Env were tested in a virus capture assay. The amount of p24 antigen captured by each of the indicated MAbs is recorded.
  • FIGS. 13A and 13B Cell-surface expression of wild-type and gp41 mutant Env glycoproteins and their reactivity with CD4-IgG2 and MAbs.
  • FIG. 13A Cell surface-expressed Envs were biotinylated, avidin-precipitated and detected using MAb ARP3119. Cell surface expressed CD47 served as a loading control (lower panel).
  • FIG. 13B The WT and gp41 NT mutant Env glycoproteins were stained with 10 ⁇ g/ml of biotinylated MAbs, followed by streptavidin-PE. Background fluorescence due to the secondary antibody was determined using isotype-matched controls; background values were subtracted from experimental values. The MFI (mean fluorescence intensity) values are shown as Mean ⁇ Standard Deviation from a representative experiment performed in triplicate.
  • FIG. 14 Analysis of purified KNH1144 SOSIP R6 gp140 trimer and gp120 monomer.
  • Purified KNH1144 gp120 monomer (left panel, gp120) and SOSIP R6 gp140 trimer were analyzed by reducing (left panel, SOSIP R6, Red) and non-reducing SDS-PAGE (left panel, SOSIP R6, NR). Proteins were visualized by Coomassie G-250 stain.
  • Purified trimer was also analyzed via ARP3119 western blot on non-reducing SDS-PAGE to examine presence of SDS-insoluble aggregates (middle panel, Anti-Env blot). The numbers on the left represent the migratory positions of the molecular weight standard proteins.
  • the right panel shows BN-PAGE analysis of purified trimer, either untreated or treated with Tween® 20 (SOSIPR6, ⁇ /+ lanes) and purified gp120 monomer in absence or presence of Tween® 20 treatment (gp120, ⁇ /+ lanes).
  • Arrows indicate high molecular weight (HMW) aggregate, trimer and gp120 monomer species.
  • M stands for the 669k thyroglobulin and 440k ferritin molecular weight protein standards.
  • FIGS. 15A-15D Tween® 20 conversion experiments.
  • A Dose response: Purified KNH1144 SOSIP R6 gp140 trimer was incubated with 0 (no detergent control), or 0.1, 0.05, 0.01, 0.001, or 0.0001% Tween® 20 and analyzed by BN-PAGE and Coomassie G-250 stain. Arrows point to HMW aggregate and trimer species. M stands for the 669k thyroglobulin and 440k ferritin molecular weight protein standards.
  • B Time course: Purified KNH1144 SOSIP R6 gp140 trimer was incubated with Tween® 20 for 5 min (left panel) or 10 min (right panel).
  • Trimer was either untreated ( ⁇ lane) or Tween® 20 treated (+lane). Arrows indicate trimer and HMW aggregate bands.
  • C Temperature effect: Purified KNH1144 SOSIP R6 gp140 trimer was either untreated ( ⁇ lane) or treated with Tween® 20 at on ice (0), room temperature (RT) or 37° C. Reactions were analyzed by BN-PAGE and Coomassie G-250 stain. Arrows indicate HMW aggregate and trimer proteins.
  • Tween® 20 effect on HMW aggregate and dimer fractions A preparation composed predominantly of HMW aggregate (>80%) was untreated (left panel, ⁇ lane), or incubated with Tween® 20 (left panel, +lane), and analyzed by BN-PAGE and Coomassie G-250 stain. Solid arrows indicate HMW aggregate and trimer proteins. Preparations composed of HMW aggregate, dimers and monomers were untreated (right panel, ⁇ lane) or incubated with Tween® 20 (right panel, +lane) and analyzed by BN-PAGE and Coomassie G-250 stain. Arrows on the right hand side point to aggregate, trimer, dimer and monomer species.
  • FIG. 16 Size Exchange Chromatography (SEC) analysis of KNH1144 SOSIP R6 gp140 trimer.
  • SEC Size Exchange Chromatography
  • FIGS. 17A and 17B Effect of Tween® 20 treatment on KNH1144 SOSIP R6 HMW aggregate antigenicity.
  • the Y-axis represents the calorimetric signal at OD492 and the X-axis represents antibody concentration in [ug/ml].
  • the Y-axis represents the calorimetric signal at OD492 and the X-axis represents antibody concentration in [ug/ml].
  • FIG. 18 Effect of Tween® 20 treatment on KNH1144 SOSIP R6 gp140 trimer binding to DEAE anion exchange column.
  • sample was applied over an anion exchange column (DEAE HiTrap FF 1 ml column) (Load). Flow through (FT) fractions were collected and the column was washed (Wash). The column was eluted (Elution) and fractions were analyzed over BN-PAGE, followed by Coomassie G-250 stain.
  • anion exchange column DEAE HiTrap FF 1 ml column
  • FT Flow through
  • the top panel shows fractions analyzed from the untreated control trimer DEAE application.
  • the bottom panel shows fractions analyzed from the Tween® 20 treated trimer DEAE application.
  • M stands for the 669k thyroglobulin and 440k ferritin molecular weight protein standards. Asterisks highlight the fraction where the trimer is found.
  • FIG. 20 SEC analysis of KNH1144 gp120 monomer: KNH1144 gp120 monomer was resolved on a Superdex 200 10/300 GL column in TN-500 buffer. The top chromatograph shows its A 280 protein profile of the run. As a control, JR-FL gp120 monomer was resolved in a similar manner and its A 280 protein profile is displayed in the bottom chromatograph. The observed retention times for both monomers and their apparent calculated molecular weights are indicated.
  • FIG. 21 Tween® 20 effect on a 2 M: Purified a 2 M was incubated with Tween® 20 (+lane) or waa untreated ( ⁇ lane). Reactions were analyzed by BN-PAGE and Coomassie stain. Arrow indicates a 2 M band.
  • A492C mutation refers to a point mutation of amino acid 492, for example, in the HIV-1 JRFL isolate gp120 protein, from alanine to cysteine. Because of sequence and sequence numbering variability among different HIV strains and isolates, it will be appreciated that the same amino acid may not reside at position 492 in all other HIV isolates.
  • the corresponding amino acid, or the amino acid position that is equivalent to amino acid position A492 in the JR-FL isolate is A511; in HIV-1 HXB2 the corresponding or equivalent amino acid is A501 (Genbank Accession No. AAB50262); and in HIV-1 NL4-3 such amino acid is A499 (Genbank Accession No. AAA44992).
  • the amino acid may also be an amino acid other than alanine or cysteine which has similar polarity or charge characteristics, for example.
  • This invention encompasses the replacement of such amino acids by cysteine, as may be readily identified in other HIV isolates by those skilled in the art.
  • the invention encompasses an HIV-1 isolate in which a cysteine residue replaces, or is substituted for, (e.g., by mutation), a non-cysteine amino acid at an amino acid position equivalent to position 492 in the HIV-1 isolate JR-FL.
  • equivalent amino acid position(s) in other HIV-1 strains or clades may be determined by reference to SEQ ID NO:9, SEQ ID NO:2 and/or SEQ ID NO:22.
  • I559P refers to a point mutation wherein the isoleucine residue at position 559 of a polypeptide chain is replaced by a proline residue.
  • the invention encompasses an HIV-1 isolate in which a proline residue replaces, or is substituted for, a non-proline (e.g., isoleucine) amino acid at an amino acid position equivalent to position 559 in the HIV-1 isolate KNH1144, for example.
  • a proline residue replaces, or is substituted for, a non-proline (e.g., isoleucine) amino acid at an amino acid position equivalent to position 559 in the HIV-1 isolate KNH1144, for example.
  • equivalent amino acid position(s) in other HIV-1 strains or clades may be determined by reference to SEQ ID NO:1, SEQ ID NO:5 and/or SEQ ID NO:18.
  • a “T596C mutation” refers to a point mutation of an amino acid at amino acid position 596 in the HIV-1 JRFL isolate gp41 ectodomain from threonine to cysteine. Because of sequence and sequence numbering variability among different HIV strains and isolates, it will be appreciated that this amino acid will not be at position 596 in all other HIV isolates. For example, in HIV-1 KNH1144 isolate, the corresponding amino acid is T605; in HIV-1 HXB2 the corresponding amino acid is T605 (Genbank Accession No. AAB50262); and in HIV-1 NL4-3 the corresponding amino acid is T603 (Genbank Accesion No. AAA44992).
  • the amino acid may also be an amino acid other than threonine or cysteine which has similar polarity or charge characteristics, for example.
  • This invention encompasses cysteine mutations in such amino acids, which can be readily identified in other HIV isolates by those skilled in the art.
  • This invention encompasses the replacement, or substitution, of such amino acids by cysteine, as may be readily identified in other HIV isolates by those skilled in the art.
  • the invention further encompasses an HIV-1 isolate in which a cysteine residue replaces, or is substituted for, a non-cysteine amino acid at an amino acid position equivalent to position 596 in the HIV-1 isolate JR-FL.
  • the invention encompasses an HIV-1 isolate in which a cysteine residue replaces, or is substituted for, a non-cysteine amino acid at an amino acid position equivalent to position 492 in the HIV-1 isolate JR-FL.
  • HIV refers to the human immunodeficiency virus. HIV includes, without limitation, HIV-1. HIV may be either of the two known types of HIV, i.e., HIV-1 or HIV-2. The HIV-1 virus may represent any of the known major subtypes or clades (e.g., Classes A, B, C, D, E, F, G, J, and H) or outlying subtype (Group O). Also encompassed are other HIV-1 subtypes or clades that may be isolated.
  • gp140 envelope refers to a protein having two disulfide-linked polypeptide chains, the first chain comprising the amino acid sequence of the HIV gp120 glycoprotein and the second chain comprising the amino acid sequence of the water-soluble portion of HIV gp41 glycoprotein (“gp41 portion”).
  • HIV gp140 protein includes, without limitation, proteins wherein the gp41 portion comprises a point mutation such as I559P.
  • gp140 envelope comprising such mutation is encompassed by the terms “HIV SOS gp140”, as well as “HIV gp140 monomer” or “SOSIP gp140”.
  • gp41 includes, without limitation, (a) the entire gp41 polypeptide including the transmembrane and cytoplasmic domains; (b) gp41 ectodomain (gp41 ECTO ); (c) gp41 modified by deletion or insertion of one or more glycosylation sites; (d) gp41 modified so as to eliminate or mask the well-known immunodominant epitope; (e) a gp41 fusion protein; and (f) gp41 labeled with an affinity ligand or other detectable marker.
  • ectodomain means the extracellular region of a transmembrane protein exclusive of the transmembrane spanning and cytoplasmic regions.
  • “Host cells” include, but are not limited to, prokaryotic cells, e.g., bacterial cells (including gram-positive cells), yeast cells, fungal cells, insect cells and animal cells. Suitable animal cells include, but are not limited to HeLa cells, COS cells, CVI cells and various primary mammalian cells. Numerous mammalian cells can be used as hosts, including, but not limited to, mouse embryonic fibroblast NIH-3T3 cells, CHO cells, HeLa cells, L(tk ⁇ ) cells and COS cells. Mammalian cells can be transfected by methods well known in the art, such as calcium phosphate precipitation, electroporation and microinjection. Electroporation can also be performed in vivo as described previously (see, e.g., U.S. Pat. Nos. 6,110,161; 6,262,281; and 6,610,044).
  • Immunizing means generating an immune response to an antigen in a subject. This can be accomplished, for example, by administering a primary dose of an antigen, e.g., a vaccine, to a subject, followed after a suitable period of time by one or more subsequent administrations of the antigen or vaccine, so as to generate in the subject an immune response against the antigen or vaccine.
  • a suitable period of time between administrations of the antigen or vaccine may readily be determined by one skilled in the art, and is usually on the order of several weeks to months.
  • Adjuvant may or may not be co-administered.
  • Nucleic acid refers to any nucleic acid or polynucleotide, including, without limitation, DNA, RNA and hybrids thereof.
  • the nucleic acid bases that form nucleic acid molecules can be the bases A, C, T, G and U, as well as derivatives thereof. Derivatives of these bases are well known in the art and are exemplified in PCR Systems, Reagents and Consumables (Perkin-Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., USA).
  • a “vector” refers to any nucleic acid vector known in the art. Such vectors include, but are not limited to, plasmid vectors, cosmid vectors and bacteriophage vectors.
  • one class of vectors utilizes DNA elements which are derived from animal viruses such as animal papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTC or MOMLV), Semliki Forest virus or SV40 virus.
  • the eukaryotic expression plasmid PPI4 and its derivatives are widely used in constructs described herein. However, the invention is not limited to derivatives of the PPI4 plasmid and may include other plasmids known to those skilled in the art.
  • vector systems for expression of recombinant proteins may be employed.
  • one class of vectors utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV), Semliki Forest virus or SV40 virus.
  • cells which have stably integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow for the selection of transfected host cells.
  • the marker may provide, for example, prototropy to an auxotrophic host, biocide (e.g., antibiotic) resistance, or resistance to heavy metals such as copper or the like.
  • the selectable marker gene can be either directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcriptional promoters, enhancers, and termination signals.
  • the cDNA expression vectors incorporating such elements include those described by (Okayama and Berg, 1983).
  • “Pharmaceutically acceptable carriers” are well known to those skilled in the art and include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer, phosphate-buffered saline (PBS), or 0.9% saline. Additionally, such pharmaceutically acceptable carriers may include, but are not limited to, aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers, diluents and excipients include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like.
  • Solid compositions may comprise nontoxic solid carriers such as, for example, glucose, sucrose, mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or cellulose derivatives, sodium carbonate and magnesium carbonate.
  • an agent or composition is preferably formulated with a nontoxic surfactant, for example, esters or partial esters of C6 to C22 fatty acids or natural glycerides, and a propellant.
  • a nontoxic surfactant for example, esters or partial esters of C6 to C22 fatty acids or natural glycerides
  • Additional carriers such as lecithin may be included to facilitate intranasal delivery.
  • Preservatives and other additives, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases, and the like may also be included with all the above carriers.
  • Adjuvants are formulations and/or additives that are routinely combined with antigens to boost immune responses.
  • Suitable adjuvants for nucleic acid based vaccines include, but are not limited to, saponins, Quil A, imiquimod, resiquimod, interleukin-12 delivered in purified protein or nucleic acid form, short bacterial immunostimulatory nucleotide sequences such as CpG-containing motifs, interleukin-2/Ig fusion proteins delivered in purified protein or nucleic acid form, oil in water micro-emulsions such as MF59, polymeric microparticles, cationic liposomes, monophosphoryl lipid A, immunomodulators such as Ubenimex, and genetically detoxified toxins such as E. coli heat labile toxin and cholera toxin from Vibrio.
  • Such adjuvants and methods of combining adjuvants with antigens are well known to those skilled in the art.
  • Adjuvants suitable for use with protein immunization include, but are not limited to, alum; Freund's incomplete adjuvant (FIA); saponin; Quil A; QS-21; Ribi Detox; monophosphoryl lipid A (MPL) adjuvants such as EnhanzynTM; nonionic block copolymers such as L-121 (Pluronic; Syntex SAF); TiterMax Classic adjuvant (block copolymer, CRL89-41, squalene and microparticulate stabilizer; Sigma-Aldrich); TiterMax Gold Adjuvant (new block copolymer, CRL-8300, squalene and a sorbitan monooleate; Sigma-Aldrich); Ribi adjuvant system using one or more of the following: monophosphoryl lipid A, synthetic trehalose, dicorynomycolate, mycobacterial cell wall skeleton incorporated into squalene and polysorbate-80; Corixa); RC-552 (a small
  • cytotoxic T lymphocyte and other cellular immune responses are elicited when protein-based immunogens are formulated and administered with appropriate adjuvants, such as ISCOMs and micron-sized polymeric or metal oxide particles.
  • adjuvants such as ISCOMs and micron-sized polymeric or metal oxide particles.
  • Certain microbial products also act as adjuvants by activating macrophages, lymphocytes and other cells within the immune system, and thereby stimulating a cascade of cytokines that regulate immune responses.
  • One such adjuvant is monophosphoryl lipid A (MPL) which is a derivative of the gram-negative bacterial lipid A molecule, one of the most potent immunostimulants known.
  • MPL monophosphoryl lipid A
  • the EnhanzynTM adjuvant (Corixa Corporation, Hamilton, Mont.) consists of MPL, mycobacterial cell wall skeleton and squalene.
  • Adjuvants may be in particulate form.
  • the antigen may be incorporated into biodegradable particles composed of poly-lactide-co-glycolide (PLG) or similar polymeric material.
  • PLG poly-lactide-co-glycolide
  • Such biodegradable particles are known to provide sustained release of the immunogen and thereby stimulate long-lasting immune responses to the immunogen.
  • Other particulate adjuvants include, but are not limited to, micellular particles comprising Quillaia saponins, cholesterol and phospholipids known as immunostimulating complexes (ISCOMs; CSL Limited, Victoria AU), and superparamagnetic particles.
  • Superparamagnetic microbeads include, but are not limited to, ⁇ MACSTM Protein G and ⁇ MACSTM Protein A microbeads (Miltenyi Biotec), Dynabeads® Protein G and Dynabeads® Protein A (Dynal Biotech). In addition to their adjuvant effect, superparamagnetic particles such as ⁇ MACSTM Protein G and Dynabeads® Protein G have the important advantage of enabling immunopurification of proteins.
  • a “prophylactically effective amount” is any amount of an agent which, when administered to a subject prone to suffer from a disease or disorder, inhibits or prevents the onset of the disorder.
  • the prophylactically effective amount will vary with the subject being treated, the condition to be treated, the agent delivered and the route of delivery. A person of ordinary skill in the art can perform routine titration experiments to determine such an amount.
  • the prophylactically effective amount of agent can be delivered continuously, such as by continuous pump, or at periodic intervals (for example, on one or more separate occasions). Desired time intervals of multiple amounts of a particular agent can be determined without undue experimentation by one skilled in the art.
  • “Inhibiting” the onset of a disorder means either lessening the likelihood of the disorder's onset, preventing the onset of the disorder entirely, or in some cases, reducing the severity of the disease or disorder after onset. In the preferred embodiment, inhibiting the onset of a disorder means preventing its onset entirely.
  • “Reducing the likelihood of a subject's becoming infected with HIV-1” means reducing the likelihood of the subject's becoming infected with HIV-1 by at least two-fold. For example, if a subject has a 1% chance of becoming infected with HIV-1, a two-fold reduction in the likelihood of the subject becoming infected with HIV-1 would result in the subject having a 0.5% chance of becoming infected with HIV-1. In the preferred embodiment of this invention, reducing the likelihood of the subject's becoming infected with HIV-1 means reducing the likelihood of the subject's becoming infected with the virus by at least ten-fold.
  • Subject means any animal or artificially modified animal.
  • Animals include, but are not limited to, humans, non-human primates, cows, horses, sheep, goats, pigs, dogs, cats, rabbits, ferrets, rodents such as mice, rats and guinea pigs, and birds and fowl, such as chickens and turkeys.
  • Artificially modified animals include, but are not limited to, transgenic animals or SCID mice with human immune systems. In the preferred embodiment, the subject is a human.
  • Exposed to HIV-1 means contact or association with HIV-1 such that infection could result.
  • a “therapeutically effective amount” is any amount of an agent which, when administered to a subject afflicted with a disorder against which the agent is effective, causes the subject to be treated. “Treating” a subject afflicted with a disorder shall mean causing the subject to experience a reduction, diminution, remission, suppression, or regression of the disorder and/or its symptoms. In one embodiment, recurrence of the disorder and/or its symptoms is prevented. Most preferably, the subject is cured of the disorder and/or its symptoms.
  • HIV-1 infected means the introduction of viral components, virus particles, or viral genetic information into a cell, such as by fusion of cell membrane with HIV-1.
  • the cell may be a cell of a subject. In the preferred embodiment, the cell is a cell in a human subject.
  • the present invention encompasses HIV envelope (Env) glycoprotein complexes, which comprise non-covalently-associated surface gp120 and transmembrane gp41 glycoprotein subunits, and soluble forms thereof.
  • the HIV envelope (Env) glycoprotein complexes of the invention are more structurally stable than native Env complexes, which are characteristically more labile or unstable in order to be capable of efficiently undergoing conformational changes during the process of virus-cell fusion.
  • the structural instability of the native HIV Env complex, or soluble forms thereof is overcome by the introduction of amino acid sequence changes designed to stabilize inter-subunit interactions between gp120 and gp41, or between the gp41 components of a trimer.
  • Such changes according to this invention include not only the introduction of a disulfide bond between gp120 and gp41; an additional change in gp41 that promotes trimer stability after gp120 and gp41 are cleaved into separate subunits during Env processing, and additional changes at the cleavage site between gp120 and gp41 to promote proteolytic processing, but also include amino acid changes, namely, five amino acid changes, in the highly conserved Leucine-zipper (LZ)-like motif near the N-terminus (NT) of gp41.
  • LZ Leucine-zipper
  • NT N-terminus
  • the present invention provides trimer stability enhancing amino acids which, when present in the NT of gp41 in an HIV isolate, allow the generation of more stable trimer complexes comprised of gp120 and gp41 envelope polypeptides.
  • the invention thus provides a reduction in the qualitative heterogeneity of the Env glycoprotein, which is beneficial for the production of anti-HIV vaccines and immunogens designed to mimic the native trimeric form of viral Env.
  • the invention encompasses envelope trimers for the production of virus like particles (VPLS) and pseudoparticles for use as VLP-based immunogens, to generate neutralizing antibodies, for example, and VLP-based vaccines against which a subject can mount a potent immune response against HIV.
  • VPLS virus like particles
  • pseudoparticles for use as VLP-based immunogens, to generate neutralizing antibodies, for example, and VLP-based vaccines against which a subject can mount a potent immune response against HIV.
  • gp120/gp41 trimers comprising the stabilizing N-terminal gp41 mutations of the invention, as well as gp120/gp41 trimers comprising other stabilizing mutations in gp120 and gp41 and the N-terminal gp41 mutations as described herein, are used to generate VPLs and pseudovirions having reduced monomer, dimer and tetramer forms and enhanced trimer forms of gp120/gp41 Env.
  • N-terminal stabilizing mutations in the context of HIV-1 virus as described herein can yield trimer forms of Env (gp120/gp41) on VLP and pseudovirions, to the virtual exclusion of monomer, dimer and tetramer forms, thus allowing for an immunogen that more closely resembles native HIV envelope trimers.
  • This invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids, and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, said gp41 ectodomain polypeptide portion being modified to comprise isoleucine (I) at amino acid position 535 (I535); glutamine (Q) at amino acid position 543 (Q543); serine (S) at amino acid position 553 (S553); lysine (K) at amino acid position 567 (K567); and arginine (R) at amino acid position 588 (R588), wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the isoleucine (I) at amino acid position 535 is the result of an M535I mutation.
  • the glutamine (Q) at amino acid position 543 is the result of an L543Q mutation.
  • the serine (S) at amino acid position 553 is the result of an N553S mutation.
  • the lysine (K) at amino acid position 567 is the result of a Q567K mutation.
  • the arginine (R) at amino acid position 588 is the result of a G588R mutation.
  • the invention further provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids, and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, said gp41 ectodomain polypeptide portion being modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535); glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); lysine (K) at an amino acid position equivalent to amino acid position 567 K567); and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the invention also provides a modified gp140 envelope polypeptide of an HIV-1 isolate comprising a gp120 polypeptide portion comprising consecutive amino acids and a gp41 ectodomain polypeptide portion comprising consecutive amino acids, said gp41 ectodomain polypeptide portion being modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); and lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); and optionally being modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535) and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588); wherein the amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • This invention further provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises a cysteine (C) at an amino acid position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL (e.g., SEQ ID NO:9), and the modified gp41 ectodomain polypeptide comprises (i) a cysteine (C) at an amino acid position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL (e.g., SEQ ID NOS:2 and 22); and (ii) at least one of isoleucine (I) at an amino amino acid position equivalent to amino acid position 535 (I535); glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q
  • the modified gp140 envelope polypeptide further comprises proline (P) at an amino acid position equivalent to amino acid position 559, numbered by reference to the HIV-1 isolate KNH1144.
  • the gp41 ectodomain polypeptide portion of the modified gp140 envelope polypeptide is modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); and lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); and is optionally modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535) and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the 543, 553, 567, 535 and 588 amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the gp41 ectodomain polypeptide portion of the modified gp140 envelope polypeptide is modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535); and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the 543, 553, 567, 535 and 588 amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • This invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises a cysteine (C) at an amino acid position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a cysteine (C) at an amino acid position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL; (ii) a proline (P) at an amino acid position equivalent to amino acid position 559 of the HIV-1 isolate KNH1144 (e.g., SEQ ID NO:6; SEQ ID NO:19); and (iii) one or more of isoleucine (I) at an amino amino acid position equivalent to amino acid position 5
  • the gp41 ectodomain polypeptide portion of the modified gp140 envelope polypeptide is modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); and lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); and is optionally modified to comprise isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535) and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the 543, 553, 567, 535 and 588 amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the gp41 ectodomain polypeptide portion of the modified gp140 envelope polypeptide is modified to comprise glutamine (Q) at an amino acid position equivalent to amino acid position 543 (Q543); serine (S) at an amino acid position equivalent to amino acid position 553 (S553); lysine (K) at an amino acid position equivalent to amino acid position 567 (K567); isoleucine (I) at an amino acid position equivalent to amino acid position 535 (I535); and arginine (R) at an amino acid position equivalent to amino acid position 588 (R588), wherein the 543, 553, 567, 535 and 588 amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the isoleucine (I) at an amino acid position equivalent to amino acid position 535 is the result of an M535I mutation
  • the glutamine (Q) at an amino acid position equivalent to amino acid position 543 is the result of an L543Q mutation
  • the serine (S) at an amino acid position equivalent to amino acid position 553 is the result of an N553S mutation
  • the lysine (K) at an amino acid position equivalent to amino acid position 567 is the result of a Q567K mutation
  • the arginine (R) at an amino acid position equivalent to amino acid position 588 is the result of a G588R mutation, wherein the 543, 553, 567, 535 and 588 amino acid positions are numbered by reference to the HIV-1 isolate KNH1144.
  • the invention provides a modified gp140 envelope polypeptide of an HIV-1 isolate, wherein a first portion of the gp140 polypeptide corresponds to a modified gp120 polypeptide and a second portion of the gp140 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gp120 polypeptide comprises an A ⁇ C mutation at amino acid position 492, numbered by reference to the HIV-1 isolate JR-FL, and the modified gp41 ectodomain polypeptide comprises (i) a T ⁇ C mutation at amino acid position 596, numbered by reference to the HIV-1 isolate JR-FL; and (ii) isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588, wherein the 535, 543, 553, 567 and
  • This invention provides a modified gp41 ectodomain polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:1, SEQ ID NO:18, SEQ ID NO:2, SEQ ID NO:22, SEQ ID NO:3, SEQ ID NO:25, or SEQ ID NO:28.
  • the invention further provides a modified gp41 ectodomain polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, or SEQ ID NO:30.
  • This invention provides a modified gp160 polypeptide which comprises the consecutive amino acid sequence as set forth in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:12, or SEQ ID NO:15.
  • the invention further provides a modified gp160 polypeptide which comprises the consecutive amino acid sequence as set forth in any one of SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17.
  • Also embraced by the invention are the sequences of the gp120 and gp41 portions of the gp160 polypeptides described herein.
  • the HIV-1 isolate represents a subtype selected from the group consisting of clades A, B, C, D, E, F, G, H, J and O.
  • the HIV-1 isolate is a lade A subtype.
  • the HIV-1 isolate is a lade B subtype.
  • the HIV isolate that is modified to contain the trimer stabilizing amino acid residues of the invention may be a strain or a lade other than those particularly specified.
  • This invention provides a trimeric complex which comprises a noncovalent oligomer of three identical modified HIV-1 gp140 envelope polypeptides of the invention.
  • the invention further provides a trimeric complex which comprises a noncovalent oligomer of three identical modified gp41 ectodomain polypeptides of the invention.
  • composition comprising the modified polypeptide of the invention and a pharmaceutically acceptable carrier, excipient, or diluent.
  • compositions comprising the trimeric complex of the invention and a pharmaceutically acceptable carrier, excipient, or diluent.
  • the composition further comprises an adjuvant.
  • the composition further comprises an antiretroviral agent.
  • This invention provides an isolated nucleic acid encoding a modified form of an HIV-1 gp120 and gp41 polypeptide complex, wherein the modification in gp120 comprises a mutation of the amino acid at a position equivalent to amino acid position 492 of the HIV-1 isolate JR-FL to cysteine (C); and the modifications in gp41 comprise (i) a mutation of the amino acid at a position equivalent to amino acid position 596 of the HIV-1 isolate JR-FL to cysteine (C); (ii) a mutation of the amino acid at a position equivalent to amino acid position 543 of the HIV-1 isolate KNH1144 to glutamine (Q); (iii) a mutation of the amino acid at a position equivalent to amino acid position 553 of the HIV-1 isolate KNH1144 to serine (S); (iv) a mutation of the amino acid at a position equivalent to amino acid position 567 of the HIV-1 isolate KNH1144 to lysine (K); and optionally, (v) a mutation of the amino acid at
  • the modifications in gp41 further comprise a mutation to proline of a non-proline amino acid at a position equivalent to amino acid position 559, as numbered by reference to the HIV-1 isolate KNH1144 (e.g., SEQ ID NOS:1, 18 and/or 19).
  • the modifications in gp41 further comprise a mutation to isoleucine of a non-isoleucine amino acid at a position equivalent to amino acid position 535, as numbered by reference to the HIV-1 isolate KNH1144.
  • the modifications in gp41 further comprise a mutation to methionine of a non-methionine amino acid at a position equivalent to amino acid position 535, as numbered by reference to the HIV-1 isolate KNH1144 (e.g., SEQ ID NO:20; SEQ ID NO:21).
  • the isolated nuceic acid is DNA.
  • the isolated nucleic acid is cDNA.
  • the isolated nucleic acid is RNA.
  • This invention provides a vector comprising the isolated nucleic of the invention.
  • This invention also provides a host cell comprising the vector or expression cassette of the invention.
  • the host cell may be a eukaryotic cell or a prokaryotic cell.
  • This invention further provides a method for eliciting an immune response against HIV-1 or an HIV-1 infected cell in a subject comprising administering to the subject an amount of the compositions of the invention effective to elicit the immune response in the subject.
  • the composition is administered in a single dose or in multiple doses.
  • the composition is administered as part of a heterologous prime-boost regimen.
  • This invention provides a method for preventing a subject from becoming infected with HIV-1, comprising administering to the subject an amount of the compositions of the invention effective to prevent the subject from becoming infected with HIV-1.
  • This invention provides a method for reducing the likelihood of a subject becoming infected with HIV-1, comprising administering to the subject an amount of the compositions of the invention effective to reduce the likelihood of the subject becoming infected with HIV-1.
  • the subject has been exposed to HIV-1.
  • This invention also provides a method for delaying the onset of, or slowing the rate of progression of, an HIV-1-related disease in an HIV-1-infected subject, which comprises administering to the subject an amount of the compositions of the invention effective to delay the onset of, or slow the rate of progression of, the HIV-1-related disease in the subject.
  • This invention provides the trimeric complexes of the invention, or the composition of the invention, further comprising a non-ionic detergent.
  • the non-ionic detergent is a polyethylene type detergent.
  • the non-ionic detergent is a polyethylene type detergent.
  • the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate.
  • the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate.
  • the polyethylene type detergent is poly(oxyethylene) sorbitan monooleate.
  • the non-ionic detergent is present in an amount of from 0.01% to 1%. In another embodiment, the non-ionic detergent is present in an amount of from 0.01% to 0.05%.
  • This invention further provides a method of stabilizing HIV-1 trimer complexes which comprise non-covalently associated gp120 and gp41 envelope polypeptides, which polypeptides comprise consecutive amino acids, said method comprising: introducing into the gp41 ectodomain polypeptide a glutamine (Q) at an amino acid position equivalent to amino acid position 543 of the HIV-1 isolate KNH1144; a serine (S) at an amino acid position equivalent to amino acid position 553 of the HIV-1 isolate KNH1144; a lysine (K) at an amino acid position equivalent to amino acid position 567 of the HIV-1 isolate KNH1144; and optionally, an isoleucine (I) at an amino acid position equivalent to amino acid position 535 of the HIV-1 isolate KNH1144 and an arginine (R) at an amino acid position equivalent to amino acid position 588 of the HIV-1 isolate KNH1144.
  • Q glutamine
  • S serine
  • K lysine
  • the method further comprises introducing a cysteine (C) at an amino acid position equivalent to amino acid position 492 of the gp120 polypeptide of the HIV-1 isolate JR-FL, and a cysteine (C) at an amino acid position equivalent to amino acid position 596 of the gp41 ectodomain polypeptide of the HIV-1 isolate JR-FL.
  • the method further comprises introducing a proline (P) at an amino acid position equivalent to amino acid position 559 of the gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144.
  • This invention further provides a method of stabilizing HIV-1 trimer complexes which comprise non-covalently associated gp120 and gp41 envelope polypeptides, which polypeptides comprise consecutive amino acids, said method comprising: introducing into the gp41 ectodomain polypeptide a glutamine (Q) at an amino acid position equivalent to amino acid position 543 of the HIV-1 isolate KNH1144; a serine (S) at an amino acid position equivalent to amino acid position 553 of the HIV-1 isolate KNH1144; a lysine (K) at an amino acid position equivalent to amino acid position 567 of the HIV-1 isolate KNH1144; an isoleucine (I) at an amino acid position equivalent to amino acid position 535 of the HIV-1 isolate KNH1144; and an arginine (R) at an amino acid position equivalent to amino acid position 588 of the HIV-1 isolate KNH1144.
  • Q glutamine
  • S serine
  • K lysine
  • I isoleucine
  • I isoleucine
  • the method further comprises introducing a cysteine (C) residue at an amino acid position equivalent to amino acid position 492 in the gp120 polypeptide of the HIV-1 isolate JR-FL, and a cysteine (C) at an amino acid position equivalent to amino acid position 596 in the gp41 ectodomain polypeptide of the HIV-1 isolate JR-FL.
  • the method further comprises introducing a proline (P) at an amino acid position equivalent to amino acid position 559 of the gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144.
  • This invention provides a chimeric gp140 polypeptide comprising (i) a gp120 envelope polypeptide of a clade B subtype of an HIV-1 isolate and (ii) a gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144, said polypeptides comprising consecutive amino acids, wherein the KNH1144 gp41 ectodomain polypeptide comprises isoleucine (I) at amino acid position 535; glutamine (Q) at amino acid position 543; serine (S) at amino acid position 553; lysine (K) at amino acid position 567; and arginine (R) at amino acid position 588.
  • This invention further provides a chimeric gp140 polypeptide comprising (i) a gp120 envelope polypeptide of a clade B subtype of an HIV-1 isolate and (ii) a gp41 ectodomain polypeptide of the HIV-1 isolate KNH1144, said polypeptides comprising consecutive amino acids, wherein the KNH1144 gp41 ectodomain polypeptide comprises an amino acid sequence as set forth in SEQ ID NO:1, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, or the gp41 polypeptide portion of the gp160 polypeptide as set forth in any one of SEQ ID NOS:5-8.
  • the HIV-1 isolate is an HIV-1 JR-FL , HIV-1 Ba-L , HIV-1 5768 , HIV-1 DH123 , HIV-1 GUN-1 , HIV-1 89.6 , or HIV-1 HXB2 isolate.
  • the present invention encompasses a method for treating or preventing human immunodeficiency viral (HIV) infection in a subject by administering to the subject a therapeutically or prophylactically effective amount of a pharmaceutical composition that includes one or more gp160, gp120, gp41 polypeptides or a combination of gp160, gp120, gp41 polypeptides.
  • a pharmaceutical composition that includes one or more gp160, gp120, gp41 polypeptides or a combination of gp160, gp120, gp41 polypeptides.
  • the composition contains a trimeric complex of three gp120 proteins and three gp41 subunits, which have been modified for enhanced stability in accordance with the invention.
  • the present invention provides a method for treating or preventing human immunodeficiency viral infection (HIV) in a subject by administering an amount of a pharmaceutical composition that includes one or more gp160, gp120, gp41 polypeptides, or a combination of gp160, gp120, gp41 polypeptides, using a dosing and resting regimen to effectively treat or prevent at least 70% of subjects in a population of at least ten subjects.
  • a pharmaceutical composition that includes one or more gp160, gp120, gp41 polypeptides, or a combination of gp160, gp120, gp41 polypeptides
  • Cure or prevention rates of the present invention include, but are not limited to, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% of subjects having human immunodeficiency viral infection effectively treated, e.g., by reducing viral load, reducing or eliminating viral nucleic acid, or increasing CD4+ cells, in a population of at least 100 subjects.
  • compositions and immunogenic preparations comprising the polypeptides of the present invention capable of inducing an immunological reaction (including protective immunity) in a suitably treated animal or human, and a suitable carrier therefore, are provided.
  • Immunogenic compositions are those which result in specific antibody production or in cellular immunity when injected into a human or an animal.
  • Such immunogenic compositions or vaccines are useful, for example, in immunizing an animal, including a human, against infection and/or damage caused by HIV.
  • the vaccine preparations comprise an immunogenic amount of one or more of the polypeptides of the invention.
  • immunogenic amount is meant an amount capable of eliciting the production of antibodies directed against the retrovirus in a mammal into which the vaccine has been administered.
  • the route of administration and the immunogenic composition may be designed to optimize the immune response on mucosal surfaces, for example, using nasal administration (via an aerosol) of the immunogenic composition.
  • the methods and compositions of the invention also include use of another antiviral agent in addition to the one or more of the present gp160, gp120, gp41 polypeptides, or a combination of gp160, gp120, gp41 polypeptides as described herein.
  • antiretroviral agents or compounds which can be administered in addition to the polypeptides and compositions of the invention include, without limitation, protease inhibitors, retroviral polymerase inhibitors, azidothymidine (AZT), didanoside (DDI), soluble CD4, a polysaccharide sulfates, T22, bicyclam, suramin, antisense oliogonulceotides, ribozymes, rev inhibitors, protease inhibitors, glycolation inhibitors, interferon and the like.
  • Examples include acyclovir, 3-aminopyridine-2-carboxyaldehyde thiosemicarbazone (3-AP, TriapineTM) and 3-amino-4-methylpyridine-2-carboxaldehyde thiosemicarbazone (3-AMP), thiamine disulfide, thiamine disulfide nitrate, thiamine disulfide phosphate, bisbentiamine, bisbutytiamine, bisibutiamine, alitiamine, fursultiamine and octotiamine.
  • Polypeptides of the invention can be made recombinantly using convenient vectors, expression systems and host cells.
  • the invention therefore provides expression cassettes, vectors and host cells useful for expressing a peptide of the invention, for example, any of the gp160, gp120 and/or gp41 polypeptides as described herein.
  • the expression cassettes of the invention include a promoter. Any promoter able to direct transcription of an encoded peptide or polypeptide may be used. Accordingly, many promoters may be included within the expression cassette of the invention. Some useful promoters include constitutive promoters, inducible promoters, regulated promoters, cell specific promoters, viral promoters, and synthetic promoters.
  • a promoter is a nucleotide sequence that controls expression of an operably linked nucleic acid sequence by providing a recognition site for RNA polymerase, and possibly other factors, required for proper transcription.
  • a promoter includes a minimal promoter, consisting only of all basal elements needed for transcription initiation, such as a TATA-box and/or other sequences that serve to specify the site of transcription initiation.
  • a promoter may be obtained from a variety of different sources. For example, a promoter may be derived entirely from a native gene, be composed of different elements derived from different promoters found in nature, or be composed of nucleic acid sequences that are entirely synthetic.
  • a promoter may be derived from many different types of organisms and tailored for use within a given cell.
  • a bacterial promoter is any DNA sequence capable of binding bacterial RNA polymerase and initiating the downstream (3′) transcription of a coding sequence into mRNA.
  • a promoter will have a transcription initiation region that is usually placed proximal to the 5′ end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a second domain called an operator may be present and overlap an adjacent RNA polymerase binding site at which RNA synthesis begins. The operator permits negatively regulated (inducible) transcription, as a gene repressor protein may bind the operator and thereby inhibit transcription of a specific gene.
  • Constitutive expression may occur in the absence of negative regulatory elements, such as the operator.
  • positive regulation may be achieved by a gene activator protein binding sequence, which, if present is usually proximal (5′) to the RNA polymerase binding sequence.
  • a gene activator protein is the catabolite activator protein (CAP), which helps initiate transcription of the lac operon in E. coli (Raibaud et al., Ann. Rev. Genet., 18:173 (1984)). Regulated expression may therefore be positive or negative, thereby either enhancing or reducing transcription.
  • CAP catabolite activator protein
  • Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences.
  • Illustrative examples include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) (Chang et al., Nature, 198:1056 (1977) and maltose.
  • Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (Trp) (Goeddel et al., Nuc. Acids Res., 8:4057 (1980); Yelverton et al., Nuc. Acids Res., 9:731 (1981); U.S. Pat. No. 4,738,921; and EPO Publ. Nos. 036 776 and 121 775).
  • the ⁇ -lactamase (bla) promoter system (Weissmann, “The cloning of interferon and other mistakes”, in: Interferon 3 (ed. I. Gresser), 1981).
  • Bacteriophage lambda PL (Shimatake et al., Nature, 292:128 (1981)) and T5 (U.S. Pat. No. 4,689,406) promoter systems also provide useful promoter sequences.
  • Another promoter is the Chlorella virus promoter (U.S. Pat. No. 6,316,224).
  • Synthetic promoters that do not occur in nature also function as bacterial promoters.
  • transcription activation sequences of one bacterial or bacteriophage promoter may be joined with the operon sequences of another bacterial or bacteriophage promoter, creating a synthetic hybrid promoter (U.S. Pat. No. 4,551,433).
  • the tac promoter is a hybrid trp-lac promoter comprised of both trp promoter and lac operon sequences that is regulated by the lac repressor (Amann et al., Gene, 25:167 (1983); de Boer et al., Proc. Natl. Acad. Sci. USA, 80:21 (1983)).
  • a bacterial promoter can include naturally occurring promoters of non-bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription.
  • a naturally occurring promoter of non-bacterial origin can also be coupled with a compatible RNA polymerase to produce high levels of expression of some genes in prokaryotes.
  • the bacteriophage T7 RNA polymerase/promoter system is an example of a coupled promoter system (Studier et al., J. Mol. Biol., 189:113 (1986); Tabor et al., Proc. Natl. Acad. Sci. USA, 82:1074 (1985)).
  • a hybrid promoter can also be comprised of a bacteriophage promoter and an E. coli operator region (EPO Publ. No. 267 851).
  • An expression cassette having a baculovirus promoter can be used for expression of a polypeptide in an insect cell.
  • a baculovirus promoter is any DNA sequence capable of binding a baculovirus RNA polymerase and initiating transcription of a coding sequence into mRNA.
  • a promoter will have a transcription initiation region that is usually placed proximal to the 5′ end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a second domain called an enhancer may be present and is usually distal to the structural gene.
  • a baculovirus promoter may be a regulated promoter or a constitutive promoter.
  • Useful promoter sequences may be obtained from structural genes that are transcribed at times late in a viral infection cycle. Examples include sequences derived from the gene encoding the baculoviral polyhedron protein (Friesen et al., “The Regulation of Baculovirus Gene Expression”, in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler), 1986; and EPO Publ. Nos. 127 839 and 155 476) and the gene encoding the baculoviral p10 protein (Vlak et al., J. Gen. Virol., 69:765 (1988)).
  • Promoters that are functional in yeast are known to those of ordinary skill in the art.
  • a yeast promoter may also have a second region called an upstream activator sequence.
  • the upstream activator sequence permits regulated expression that may be induced. Constitutive expression occurs in the absence of an upstream activator sequence. Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription.
  • Promoters for use in yeast may be obtained from yeast genes that encode enzymes active in metabolic pathways. Examples of such genes include alcohol dehydrogenase (ADH) (EPO Publ. No. 284 044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphatedehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglyceratemutase, and pyruvate kinase (PyK). (EPO Publ. No. 329 203).
  • the yeast PHO5 gene encoding acid phosphatase, also provides useful promoter sequences. (Myanohara et al., Proc. Natl. Acad. Sci. USA, 80:1 (1983)).
  • Synthetic promoters that do not occur in nature may also be used for expression in yeast.
  • upstream activator sequences from one yeast promoter may be joined with the transcription activation region of another yeast promoter, creating a synthetic hybrid promoter.
  • hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region (U.S. Pat. Nos. 4,876,197 and 4,880,734).
  • Other examples of hybrid promoters include promoters which consist of the regulatory sequences of either the ADH2, GAL4, GAL10, or PHO5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK (EPO Publ. No. 164 556).
  • a yeast promoter can include naturally occurring promoters of non-yeast origin that have the ability to bind yeast RNA polymerase and initiate transcription. Examples of such promoters are known in the art. (Cohen et al., Proc. Natl. Acad. Sci. USA, 77:1078 (1980); Henikoff et al., Nature, 283:835 (1981); Hollenberg et al., Curr. Topics Microbiol. Immunol., 96:119 (1981)); Hollenberg et al., “The Expression of Bacterial Antibiotic Resistance Genes in the Yeast Saccharomyces cerevisiae” , in: Plasmids of Medical, Environmental and Commercial Importance (eds. K. N. Timmis and A. Puhler), 1979; (Mercerau-Puigalon et al., Gene, 11:163 (1980); Panthier et al., Curr. Genet., 2:109 (1980)).
  • Mammalian promoters as known in the art that may be used in conjunction with the expression cassette of the invention.
  • Mammalian promoters often have a transcription initiating region, which is usually placed proximal to the 5′ end of the coding sequence, and a TATA box, usually located 25-30 base pairs (bp) upstream of the transcription initiation site.
  • the TATA box is thought to direct RNA polymerase II to begin RNA synthesis at the correct site.
  • a mammalian promoter may also contain an upstream promoter element, usually located within 100 to 200 bp upstream of the TATA box.
  • An upstream promoter element determines the rate at which transcription is initiated and can act in either orientation (Sambrook et al., “Expression of Cloned Genes in Mammalian Cells”, in: Molecular Cloning: A Laboratory Manual, 2nd ed., 1989).
  • Mammalian viral genes are often highly expressed and have a broad host range; therefore sequences encoding mammalian viral genes often provide useful promoter sequences.
  • Nonlimiting examples include the SV40 early promoter, mouse mammary tumour virus LTR promoter, adenovirus major late promoter (Ad MLP), and Herpes Simplex Virus promoter.
  • sequences derived from non-viral genes, such as the murine metallothionein gene also provide useful promoter sequences. Expression may be either constitutive or regulated.
  • a mammalian promoter may also be associated with an enhancer.
  • the presence of an enhancer will usually increase transcription from an associated promoter.
  • An enhancer is a regulatory DNA sequence that can stimulate transcription up to 1000-fold when linked to homologous or heterologous promoters, with synthesis beginning at the normal RNA start site. Enhancers are active when they are placed upstream or downstream from the transcription initiation site, in either normal or flipped orientation, or at a distance of more than 1000 nucleotides from the promoter. (Maniatis et al., Science, 236:1237 (1987); Alberts et al., Molecular Biology of the Cell, 2nd ed., 1989). Enhancer elements derived from viruses are often times useful, because they usually have a broad host range.
  • Nonlimiting examples include the SV40 early gene enhancer (Dijkema et al., EMBO J., 4:761 (1985)) and the enhancer/promoters derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus (Gorman et al., Proc. Natl. Acad. Sci. USA, 79:6777 (1982b)) and from human cytomegalovirus (Boshart et al., Cell, 41:521 (1985)).
  • LTR long terminal repeat
  • enhancers are regulatable and become active only in the presence of an inducer, such as a hormone or metal ion (Sassone-Corsi and Borelli, Trends Genet., 2:215 (1986); Maniatis et al., Science, 236:1237 (1987)).
  • an inducer such as a hormone or metal ion
  • promoters and associated regulatory elements may be used within the expression cassette of the invention to transcribe an encoded polypeptide.
  • the promoters described above are provided merely provided as examples and are not to be considered as a complete list of promoters that are included within the scope of the invention.
  • the expression cassette of the invention may contain a nucleic acid sequence for increasing the translation efficiency of an mRNA encoding a polypeptide of the invention. Such increased translation serves to increase production of the polypeptide.
  • the presence of an efficient ribosome binding site is useful for gene expression in prokaryotes. In bacterial mRNA, a conserved stretch of six nucleotides, the Shine-Dalgarno sequence, is usually found upstream of the initiating AUG codon. (Shine et al., Nature, 254:34 (1975)). This sequence is thought to promote ribosome binding to the mRNA by base pairing between the ribosome binding site and the 3′ end of Escherichia coli 16S rRNA.
  • a translation initiation sequence can be derived from any expressed Escherichia coli gene and can be used within an expression cassette of the invention. Preferably the gene is a highly expressed gene.
  • a translation initiation sequence can be obtained via standard recombinant methods, synthetic techniques, purification techniques, or combinations thereof, which are all well known. (Ausubel et al., Current Protocols in Molecular Biology , Green Publishing Associates and Wiley Interscience, NY. (1989); Beaucage and Caruthers, Tetra. Letts., 22:1859 (1981); VanDevanter et al., Nucleic Acids Res., 12:6159 (1984).
  • translational start sequences can be obtained from numerous commercial vendors.
  • the T7 translation initiation sequence is used.
  • the T7 translation. initiation sequence is derived from the highly expressed T7 Gene 10 cistron and can have a sequence that includes tctagaaataattttgtttaactttaagaaggagatata (SEQ ID NO:4).
  • translation initiation sequences include, but are not limited to, the maltose-binding protein (Mal E gene) start sequence (Guan et al., Gene, 67:21 (1997)) present in the pMalc2 expression vector (New England Biolabs, Beverly, Mass.) and the translation initiation sequence for the following genes: thioredoxin gene (Novagen, Madison, Wis.), Glutathione-S-transferase gene (Pharmacia, Piscataway, N.J.), ⁇ -galactosidase gene, chloramphenicol acetyltransferase gene and E. coli Trp E gene (Ausubel et al., 1989, Protocols in Molecular Biology, Chapter 16, Green Publishing Associates and Wiley Interscience, NY).
  • Mal E gene maltose-binding protein
  • pMalc2 expression vector New England Biolabs, Beverly, Mass.
  • thioredoxin gene Novagen, Madison, Wis.
  • Eucaryotic mRNA does not contain a Shine-Dalgarno sequence. Instead, the selection of the translational start codon is usually determined by its proximity to the cap at the 5′ end of an mRNA. The nucleotides immediately surrounding the start codon in eucaryotic mRNA influence the efficiency of translation. Accordingly, one skilled in the art can determine what nucleic acid sequences will increase translation of a polypeptide encoded by the expression cassette of the invention. Such nucleic acid sequences are within the scope of the invention.
  • the invention therefore provides an expression cassette that includes a promoter operable in a selected host and a nucleic acid encoding a polypeptide having a sequence of the invention.
  • the encoded polypeptide comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:25, or SEQ ID NO:28, modified to contain HIV trimer stabilizing amino acids as described herein.
  • the encoded polypeptide comprises SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, or SEQ ID NO:30, comprising HIV trimer stabilizing amino acid modifications as described herein.
  • the expression cassette can also have other elements, for example, termination signals, origins of replication, enhancers, and the like as described herein.
  • the expression cassette can also be placed in a vector for easy replication and maintenance.
  • recombinant expression of the peptides and polypeptides of the invention avoids degradation frequently observed for short peptides within a cell in which they are expressed when the peptides and polypeptides are expressed and stored within inclusion bodies present within the host cells. Hence, the peptides can readily be purified from inclusion bodies.
  • recombinant peptides are expressed in E. coli strain BL21(DE3)/pLysS (Novagen). Cells were grown at 37° C. in LB medium to an optical density of 0.8 at 600 nm and were induced with isopropylthio- ⁇ -D-galactoside for 3-4 hr at 37° C.
  • the cells are centrifuged, frozen at ⁇ 80° C., resuspended in 50 mM Tris-HCl (pH 8.0) and 1 mM EDTA plus 25% sucrose, and disrupted by sonication. Inclusion bodies of the cell lysate are isolated and washed three times with Triton buffer (20 mM Tris-HCl [pH 8.0], 1 mM EDTA, and 1% Triton X-100). The inclusion bodies are then solubilized in 50 mM Tris-HCl (pH 8.5) plus 8 M urea.
  • Insoluble debris is removed by centrifugation (18,000 g, 1 hr, 4° C.); the supernatant is loaded on a DEAE Sepharose column (Amersham Pharmacia Biotech) equilibrated with buffer A (50 mM Tris-HCl [pH 8.5] plus 3 M urea). The soluble peptide is eluted with a linear salt gradient (0-500 mM NaCl in buffer A). The peptide solution is dialyzed into 5% acetic acid overnight at 4° C.
  • Peptides from the soluble fraction are purified to homogeneity by reverse-phase high-performance liquid chromatography (Waters, Inc.) on a Vydac C-18 preparative column (Hesperia, Calif.), using a water-acetonitrile gradient in the presence of 0.1% trifluoroacetic acid, and lyophilized.
  • inclusion bodies that can readily be separated from other cellular components.
  • inclusion bodies are more or less soluble under defined conditions that include, but are not limited to, pH, temperature, salt concentration, and protein concentration.
  • an inclusion body can be insoluble in water but soluble in the presence of urea, acid, guanidinium chloride, and other agents.
  • the host cells can be isolated and lysed, and inclusion bodies can be collected, for example, by centrifugation.
  • the inclusion bodies can be rinsed with dilute buffer and then solubilized in urea or other agent. Insoluble debris can be removed by centrifugation and the solubilized peptides can be further purified, for example, by ion exchange chromatography or reverse-phase HPLC.
  • the invention is also directed to binding entities and antibodies that can bind to a trimeric gp120/gp41 polypeptide complex stabilized as described herein.
  • the binding domains of such antibodies for example, the CDR regions of these antibodies, can also be transferred into or utilized with any convenient binding entity backbone.
  • HIV-1 envelope glycoprotein is the major target for neutralizing antibodies during the course of natural infection and has been extensively employed as an immunogen in vaccine studies (Burton et al., Nature Med. 4, 495-498 (1998); Letvin, Science 280, 1875-1880 (1998); Burton, Proc. Natl. Acad. Sci. USA 94, 10018-10023 (1997); Burton et al., J. Acquir. Immune Defic. Syndr. 11 (Suppl A), 587-598 (1997); Montefiori et al., AIDS Res. Hum. Retroviruses 15, 689-698 (1999); Wyatt et al., Science. 280, 1884-1888 (1998); Parren et al., AIDS.
  • the present invention affords a solution to the problem(s) of reproducibly providing stable HIV immunogens that can be used to generate an anti-HIV immune response and potent, neutralizing anti-HIV antibodies.
  • Antibody molecules belong to a family of plasma proteins called immunoglobulins.
  • the heavy and light chains of an antibody consist of different domains. Each light chain has one variable domain (VL) and one constant domain (CL), while each heavy chain has one variable domain (VH) and three or four constant domains (CH). See, e.g., Alzari, P. N. et al., (1988). Three-dimensional structure of antibodies. Annu. Rev. Immunol. 6:555-580.
  • Each domain consisting of about 110 amino acid residues, is folded into a characteristic ⁇ -sandwich structure formed from two ⁇ -sheets packed against each other, the immunoglobulin fold.
  • the VH and VL domains each have three complementarity determining regions (CDR1-3) that are loops, or turns, connecting ⁇ -strands at one end of the domains.
  • CDR1-3 complementarity determining regions
  • the variable regions of both the light and heavy chains generally contribute to antigen specificity, although the contribution of the individual chains to specificity is not always equal.
  • Antibody molecules have evolved to bind to a large number of molecules by using six randomized loops (CDRs).
  • Immunoglobulins can be assigned to different classes depending on the amino acid sequences of the constant domain of their heavy chains. There are at least five (5) major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM. Several of these may be further divided into subclasses (isotypes), for example, IgG1, IgG2 (IgG2a and IgG2b), IgG3 and IgG4; IgA1 and IgA2.
  • the heavy chain constant domains that correspond to the IgA, IgD, IgE, IgG and IgM classes of immunoglobulins are called alpha (a), delta ( ⁇ ), epsilon ( ⁇ ), gamma ( ⁇ ) and mu ( ⁇ ), respectively.
  • the light chains of antibodies can be assigned to one of two clearly distinct types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino sequences of their constant domain.
  • kappa ( ⁇ ) and lambda ( ⁇ ) based on the amino sequences of their constant domain.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • variable domains are concentrated in three segments called complementarity determining regions (CDRs), also known as hypervariable regions in both the light chain and the heavy chain variable domains.
  • CDRs complementarity determining regions
  • FR framework
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from another chain, contribute to the formation of the antigen-binding site of antibodies.
  • the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
  • an antibody that is contemplated for use in the present invention thus can be in any of a variety of forms, including a whole immunoglobulin, an antibody portion or fragment, such as Fv, Fab, Fab′2, and similar fragments, a single chain antibody which includes the variable domain complementarity determining regions (CDR), and the like forms, all of which fall under the broad term “antibody”, as used herein.
  • the present invention contemplates the use of any specificity of an antibody, polyclonal or monoclonal, and is not limited to antibodies that recognize and immunoreact with a specific peptide sequence described herein or a derivative thereof. However, in some embodiments, the antibody binds with specificity to a polypeptide with any of the polypeptide sequences disclosed herein, or a combination or complex thereof.
  • binding regions, or CDRS, of antibodies can be placed within the backbone of any convenient binding entity polypeptide.
  • an antibody, binding entity, or portion or fragment thereof is used that is immunospecific for any of the polypeptides described herein, as well as the derivatives thereof, including crosslinked derivatives thereof.
  • antibody fragment refers to a portion of a full-length antibody, generally the antigen binding or variable region.
  • antibody fragments include Fab, Fab′, F(ab′) 2 and Fv fragments.
  • Fv is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in a tight, non-covalent association (V H -V L dimer). It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the V H -V L dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody.
  • variable domain or half of an Fv comprising only three CDRs specific for an antigen
  • functional fragment refers to Fv, F(ab) and F(ab′) 2 fragments.
  • Additional fragments can include diabodies, linear antibodies, single-chain antibody molecules and multispecific antibodies formed from antibody fragments.
  • Single chain antibodies are genetically engineered molecules containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
  • Such single chain antibodies are also referred to as “single-chain Fv” or “sFv” antibody fragments.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the sFv to form the desired structure for antigen binding.
  • diabodies refers to a small antibody fragments with two antigen-binding sites, where the fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL).
  • VH heavy chain variable domain
  • VL light chain variable domain
  • VH-VL polypeptide chain
  • Antibody portions or fragments contemplated by the invention are therefore not full-length antibodies. However, such antibody fragments can have similar or improved immunological properties relative to a full-length antibody. Such antibody fragments may be as small as about 3-4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, 9 amino acids, about 12 amino acids, about 15 amino acids, about 17 amino acids, about 18 amino acids, about 20 amino acids, about 25 amino acids, about 30 amino acids or more.
  • an antibody fragment of the invention can have any upper size limit as long as it has similar or improved immunological properties relative to an antibody that binds with specificity to a polypeptide described herein.
  • smaller binding entities and light chain antibody fragments can have less than about 200 amino acids, less than about 175 amino acids, less than about 150 amino acids, or less than about 120 amino acids if the antibody fragment is related to a light chain antibody subunit.
  • larger binding entities and heavy chain antibody fragments can have less than about 425 amino acids, less than about 400 amino acids, less than about 375 amino acids, less than about 350 amino acids, less than about 325 amino acids or less than about 300 amino acids if the antibody fragment is related to a heavy chain antibody subunit.
  • Antibodies directed against various immunogens or disease markers can be made by a number of known procedures. Methods for preparing polyclonal antibodies are practiced by those skilled in the art. See, for example, Green, et al., Production of Polyclonal Antisera, in: Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press); Coligan, et al., Production of Polyclonal Antisera in Rabbits, Rats Mice and Hamsters, in: Current Protocols in Immunology , section 2.4.1 (1992), which are hereby incorporated by reference.
  • monoclonal antibodies which are highly specific and directed against a single epitopic site or determinant on an antigen (or immunogen), are also embraced by this invention.
  • monoclonal antibodies herein specifically include “chimeric” antibodies in which a portion of the heavy and/or light chain is identical or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass. Fragments of such antibodies can also be used, so long as they exhibit the desired biological activity. See U.S. Pat. No. 4,816,567; Morrison et al. Proc. Natl. Acad Sci. USA. 81, 6851-55 (1984).
  • the monoclonal antibodies herein also specifically include those made from different animal species, including mouse, rat, human and rabbit.
  • Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method as described above, or they may be made by recombinant methods, e.g., as described in U.S. Pat. No. 4,816,567.
  • Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described, for example, in Clackson et al. Nature. 352:624-628 (1991), as well as in Marks et al., J. Mol Biol. 222:581-597 (1991).
  • Antibody fragments of the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression of nucleic acids encoding the antibody fragment in a suitable host.
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment described as F(ab′) 2 .
  • This fragment can be further cleaved using a thiol reducing agent, and optionally using a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab′ monovalent fragments.
  • Fv fragments comprise an association of V H and V L chains. This association may be noncovalent, or the variable chains can be linked by an intermolecular disulfide bond, or cross-linked by chemicals such as glutaraldehyde.
  • the Fv fragments comprise V H and V L chains connected by a peptide linker.
  • sFv single-chain antigen binding proteins
  • sFv single-chain antigen binding proteins
  • the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli .
  • the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • Whitlow, et al. Methods: a Companion to Methods in Enzymology , Vol. 2, page 97 (1991); Bird, et al., Science. 242:423-426 (1988); Ladner, et al, U.S. Pat. No. 4,946,778; and Pack, et al., Bio/Technology. 11:1271-77 (1993).
  • CDR peptides (“minimal recognition units”) are often involved in antigen recognition and binding.
  • CDR peptides can be obtained by cloning or constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick, et al., Methods: a Companion to Methods in Enzymology . Vol.2, page 106 (1991).
  • the invention also encompasses human and humanized forms of non-human (e.g., murine) antibodies (monoclonal antibodies).
  • humanized antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab′, F(ab′) 2 or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the human recipient antibody are replaced by residues from the CDRs of a nonhuman species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance.
  • humanized antibodies will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • the invention further encompasses the use of binding entities, which comprise polypeptides that can recognize and bind to gp41 and/or gp120 polypeptides having the three dimensional structures provided herein.
  • a number of proteins can serve as protein scaffolds to which binding domains can be attached and thereby form a suitable binding entity.
  • the binding domains bind or interact with the polypeptide sequences of the invention while the protein scaffold merely holds and stabilizes the binding domains so that they can bind.
  • a number of protein scaffolds can be used, for example, phage capsid proteins. See Review in Clackson & Wells, Trends Biotechnol. 12:173-184 (1994). Phage capsid proteins have been used as scaffolds for displaying random peptide sequences, including bovine pancreatic trypsin inhibitor (Roberts et al., PNAS USA. 89:2429-2433 (1992)), human growth hormone (Lowman et al., Biochemistry.
  • Tendamistat has also been employed as a presentation scaffold on the filamentous phage M13. (McConnell, S. J., & Hoess, R. H., J. Mol. Biol. 250:460-470 (1995)). Tendamistat is a ⁇ -sheet protein derived from Streptomyces tendae . It has a number of features that make it an attractive scaffold for binding entities, including its small size, stability, and the availability of high resolution NMR and X-ray structural data. The overall topology of Tendamistat is similar to that of an immunoglobulin domain, with two ⁇ -sheets connected by a series of loops.
  • the ⁇ -sheets of Tendamistat are held together with two rather than one disulfide bond, accounting for the considerable stability of the protein.
  • the loops of Tendamistat can serve a function similar to the CDR loops of immunoglobulins and can be easily randomized by in vitro mutagenesis.
  • Tendamistat may be antigenic in humans.
  • binding entities that employ Tendamistat are preferably employed in vitro.
  • Fibronectin type III domain has also been used as a protein scaffold to which binding entities can be attached.
  • Fibronectin type III is part of a large subfamily (Fn3 family or s-type Ig family) of the immunoglobulin superfamily. Sequences, vectors and cloning procedures for using such a fibronectin type III domain as a protein scaffold for binding entities (e.g. CDR peptides) are provided, for example, in U.S. Patent Application Publication 20020019517. See also, Bork, P. & Doolittle, R. F. (1992) Proc. Natl. Acad. Sci. USA. 89, 8990-8994; Jones, E. Y. (1993) The immunoglobulin superfamily. Curr.
  • binding entities are selected and amplified from a large library (affinity maturation).
  • the combinatorial techniques employed in immune cells can be mimicked by mutagenesis and the generation of combinatorial libraries of binding entities.
  • Variant binding entities, antibody fragments and antibodies therefore can also be generated through display-type technologies.
  • display-type technologies include, for example, phage display, retroviral display, ribosomal display, and other techniques.
  • Techniques available in the art can be used for generating libraries of binding entities and for screening those libraries; the selected binding entities can be subjected to additional maturation, such as affinity maturation. Wright and Harris, supra., Hanes and Plucthau PNAS USA 94:4937-4942 (1997) (ribosomal display), Parmley and Smith, Gene.
  • a mutant binding domain refers to an amino acid sequence variant of a selected binding domain (e.g., a CDR).
  • a selected binding domain e.g., a CDR
  • one or more of the amino acid residues in the mutant binding domain is different from what is present in the reference binding domain.
  • Such mutant antibodies necessarily have less than 100% sequence identity or similarity with the reference amino acid sequence.
  • mutant binding domains have at least 75% amino acid sequence identity or similarity with the amino acid sequence of the reference binding domain.
  • mutant binding domains have at least 80%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95% amino acid sequence identity or similarity with the amino acid sequence of the reference binding domain.
  • affinity maturation using phage display can be utilized as one method for generating mutant binding domains.
  • Affinity maturation using phage display refers to a process, such as is described in Lowman et al., Biochemistry. 30(45): 10832-10838 (1991) and in Hawkins et al., J. Mol Biol. 254: 889-896 (1992). While not strictly limited to the following description, this process can be described briefly as involving mutation of several binding domains or antibody hypervariable regions at a number of different sites with the goal of generating all possible amino acid substitutions at each site. The binding domain mutants thus generated are displayed in a monovalent fashion from filamentous phage particles as fusion proteins.
  • Fusions are generally made to the gene III product of M13.
  • the phage expressing the various mutants can be cycled through several rounds of selection for the trait of interest, e.g. binding affinity or selectivity.
  • the mutants of interest are isolated and sequenced. Such methods are described in more detail in U.S. Pat. Nos. 5,750,373,6,290,957 and in Cunningham, B. C. et al., EMBO J. 13(11), 2508-2515 (1994).
  • the invention provides methods of manipulating binding entity or antibody polypeptides or the nucleic acids encoding them to generate binding entities, antibodies and antibody fragments with improved binding properties that recognize and bind to gp41, gp120 and/or gp41/gp120 stabilized trimer complexes.
  • Such methods of mutating portions of an existing binding entity or antibody involve fusing a nucleic acid encoding a polypeptide that encodes a binding domain for an antigen, immunogen, or disease marker to a nucleic acid encoding a phage coat protein to generate a recombinant nucleic acid encoding a fusion protein, mutating the recombinant nucleic acid encoding the fusion protein to generate a mutant nucleic acid encoding a mutant fusion protein, expressing the mutant fusion protein on the surface of a phage, and selecting phage that bind to the gp41 and/or gp120 polypeptides comprising a stabilized trimer.
  • the invention provides antibodies, antibody fragments, and binding entity polypeptides that can recognize and bind to a gp140 or a gp41-gp120 stabilized trimer complex (e.g., polypeptides having any of the sequences provided herein or combinations thereof).
  • the invention further provides methods of manipulating those antibodies, antibody fragments, and binding entity polypeptides to optimize their binding properties or other desirable properties (e.g., stability, size, ease of use).
  • polypeptides, binding entities and antibodies of the invention are administered so as to achieve a reduction in at least one symptom associated with an infection, indication or disease, or a decrease in the amount of antibody associated with the indication or disease.
  • the binding entities, antibodies, polypeptides (e.g. having any of the sequences disclosed here, or combinations thereof), variants thereof, a combination thereof, or compositions comprising any of these may be administered as single or divided dosages, for example, of at least about 0.01 mg/kg to about 500 to 750 mg/kg, of at least about 0.01 mg/kg to about 300 to 500 mg/kg, at least about 0.1 mg/kg to about 100 to 300 mg/kg or at least about 1 mg/kg to about 50 to 100 mg/kg of body weight, although other dosages may provide beneficial results.
  • the amount administered will vary depending on various factors including, but not limited to, the polypeptide, binding entity or antibody chosen, the disease, the weight, the physical condition, the health, the age of the mammal, whether prevention or treatment is to be achieved, and if the polypeptide, binding entity or antibody is chemically modified. Such factors can be readily determined by the clinician employing animal models or other test systems that are available in the art.
  • Administration of the therapeutic agents in accordance with the present invention may be in a single dose, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
  • the administration of the therapeutic agents of the invention may be essentially continuous over a pre-selected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
  • compositions for administration to a subject polypeptides, binding entities or antibodies are synthesized or otherwise obtained, purified as necessary or desired and then lyophilized and stabilized. Such therapeutic agents can then be adjusted to the appropriate concentration, and optionally combined with other agents.
  • the absolute weight of a given therapeutic agent included in a unit dose can vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one therapeutic agent of the invention, or a plurality of therapeutic agents can be administered.
  • the unit dosage can vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.
  • Daily doses of the therapeutic agents of the invention can vary as well.
  • Such daily doses can range, for example, from about 0.1 g/day to about 50 g/day, from about 0.1 g/day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.
  • an appropriate dosage level will generally be about 0.001 to 100 mg per kg patient body weight per day, which can be administered in single or multiple doses.
  • the dosage level will be about 0.01 to about 25 mg/kg per day; more preferably about 0.05 to about 10 mg/kg per day.
  • a suitable dosage level may be about 0.01 to 25 mg/kg per day, about 0.05 to 10 mg/kg per day, or about 0.1 to 5 mg/kg per day. Within this range the dosage may be about 0.005 to about 0.05, 0.05 to 0.5 or 0.5 to 5 mg/kg per day.
  • compositions are preferably provided in the form of tablets containing about 1 to 1000 milligrams of the active ingredient, particularly about 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, 600, 750, 800, 900, and 1000 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.
  • the compounds may be administered on a regimen of 1 to 4 times per day, preferably once or twice per day.
  • one or more suitable unit dosage forms comprising the therapeutic agents of the invention can be administered by a variety of routes including oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, vaginal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
  • the therapeutic agents may also be formulated for sustained release (for example, using microencapsulation, see WO 94/07529, and U.S. Pat. No. 4,962,091).
  • the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to the pharmaceutical arts. Such methods may include the step of mixing the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
  • the therapeutic agents of the invention are prepared for oral administration, they are generally combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation, or unit dosage form.
  • the therapeutic agents may be present as a powder, a granular formulation, a solution, a suspension, an emulsion or in a natural or synthetic polymer or resin for ingestion of the active ingredients from a chewing gum.
  • the active therapeutic agents may also be presented as a bolus, electuary or paste orally administered therapeutic agents of the invention can also be formulated for sustained release, e.g., the therapeutic agents can be coated, micro-encapsulated, or otherwise placed within a sustained delivery device.
  • the total active ingredients in such formulations comprise from 0.1 to 99.9% by weight of the formulation.
  • pharmaceutically acceptable it is meant a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation and that is not deleterious to the recipient thereof.
  • Pharmaceutically acceptable formulations containing the therapeutic agents of the invention can be prepared by procedures known in the art using well-known and readily available ingredients.
  • the therapeutic agents can be formulated with common excipients, diluents, or carriers, and formed into tablets, capsules, solutions, suspensions, powders, aerosols and the like.
  • excipients, diluents, and carriers that are suitable for such formulations include buffers, as well as fillers and extenders such as starch, cellulose, sugars, mannitol, and silicic derivatives.
  • Binding agents can also be included such as carboxymethyl cellulose, hydroxymethylcellulose, hydroxypropyl methylcellulose and other cellulose derivatives, alginates, gelatin, and polyvinyl-pyrrolidone.
  • Moisturizing agents can be included such as glycerol, disintegrating agents such as calcium carbonate and sodium bicarbonate.
  • Agents for retarding dissolution can also be included such as paraffin.
  • Resorption accelerators such as quaternary ammonium compounds can also be included.
  • Surface active agents such as cetyl alcohol and glycerol monostearate can be included.
  • Adsorptive carriers such as kaolin and bentonite can be added.
  • Lubricants such as talc, calcium and magnesium stearate, and solid polyethyl glycols can also be included. Preservatives may also be added.
  • the compositions of the invention can also contain thickening agents such as cellulose and/or cellulose derivatives. They can also contain gums such as xanthan, guar or carbo gum or gum arabic, or alternatively polyethylene glycols, bentones and montmorillonites, and the like.
  • tablets or caplets containing the therapeutic agents of the invention can include buffering agents, such as calcium carbonate, magnesium oxide and magnesium carbonate.
  • Caplets and tablets can also include inactive ingredients such as cellulose, pre-gelatinized starch, silicon dioxide, hydroxy propyl methyl cellulose, magnesium stearate, microcrystalline cellulose, starch, talc, titanium dioxide, benzoic acid, citric acid, corn starch, mineral oil, polypropylene glycol, sodium phosphate, zinc stearate, and the like.
  • Hard or soft gelatin capsules containing at least one therapeutic agent of the invention can contain inactive ingredients such as gelatin, microcrystalline cellulose, sodium lauryl sulfate, starch, talc, and titanium dioxide, and the like, as well as liquid vehicles such as polyethylene glycols (PEGs) and vegetable oil.
  • inactive ingredients such as gelatin, microcrystalline cellulose, sodium lauryl sulfate, starch, talc, and titanium dioxide, and the like
  • liquid vehicles such as polyethylene glycols (PEGs) and vegetable oil.
  • enteric-coated caplets or tablets containing one or more therapeutic agents of the invention are designed to resist disintegration in the stomach and dissolve in the more neutral to alkaline environment of the duodenum.
  • the therapeutic agents of the invention can also be formulated as elixirs or solutions for convenient oral administration or as solutions appropriate for parenteral administration, for instance by intramuscular, subcutaneous, intraperitoneal or intravenous routes.
  • the pharmaceutical formulations of the therapeutic agents of the invention can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension or salve.
  • the therapeutic agents may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion containers or in multi-dose containers.
  • preservatives can be added to help maintain the shelve life of the dosage form.
  • the therapeutic agents and other ingredients may form suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the therapeutic agents and other ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
  • formulations can contain pharmaceutically acceptable carriers, vehicles and adjuvants that are well known in the art. It is possible, for example, to prepare solutions using one or more organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name “Dowanol,” polyglycols and polyethylene glycols, C 1 -C 4 alkyl esters of short-chain acids, ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name “Miglyol,” isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.
  • organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name “Dowanol,” polyg
  • an adjuvant selected from antioxidants, surfactants, other preservatives, film-forming, keratolytic or comedolytic agents, perfumes, flavorings and colorings.
  • Antioxidants such as t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene and ⁇ -tocopherol and its derivatives can be added.
  • the therapeutic agents are well suited to formulation as sustained release dosage forms and the like.
  • the formulations can be so constituted that they release the active therapeutic agents, for example, in a particular part of the intestinal or respiratory tract or within the vagina or rectum, possibly over a period of time.
  • Coatings, envelopes, and protective matrices may be made, for example, from polymeric substances, such as polylactide-glycolates, liposomes, microemulsions, microparticles, nanoparticles, or waxes.
  • the therapeutic agents may be formulated as is known in the art for direct application to a target area.
  • Forms chiefly conditioned for topical application take the form, for example, of creams, milks, gels, foams, dispersion or microemulsions, lotions thickened to a greater or lesser extent, impregnated pads of tampons, ointments or sticks, aerosol formulations (e.g., sprays or foams), soaps, detergents, lotions or cakes of soap.
  • Other conventional forms for this purpose include wound dressings, coated bandages or other polymer coverings, ointments, creams, foams, lotions, pastes, jellies, sprays, and aerosols.
  • the therapeutic agents of the invention can be delivered via patches or bandages for dermal administration.
  • the therapeutic agents can be formulated to be part of an adhesive polymer, such as polyacrylate or acrylate/vinyl acetate copolymer.
  • an adhesive polymer such as polyacrylate or acrylate/vinyl acetate copolymer.
  • the backing layer can be any appropriate thickness that will provide the desired protective and support functions. A suitable thickness will generally be from about 10 to about 200 microns.
  • Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents.
  • Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents.
  • the active polypeptides can also be delivered via iontophoresis, e.g., as disclosed in U.S. Pat. Nos. 4,140,122; 4,383,529; or 4,051,842.
  • the percent by weight of a therapeutic agent of the invention present in a topical formulation will depend on various factors, but generally will be from 0.01% to 95% of the total weight of the formulation, and typically 0.1-85% by weight.
  • Drops such as eye drops or nose drops, may be formulated with one or more of the therapeutic agents in an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents.
  • Liquid sprays are conveniently delivered from pressurized packs. Drops can be delivered via a simple eye dropper-capped bottle, or via a plastic bottle adapted to deliver liquid contents dropwise, via a specially shaped closure.
  • the therapeutic agents may further be formulated for topical administration in the mouth or throat.
  • the active ingredients may be formulated as a lozenge further comprising a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the composition of the present invention in a suitable liquid carrier.
  • the pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are available in the art.
  • pharmaceutically acceptable carriers such as physiologically buffered saline solutions and water.
  • diluents such as phosphate buffered saline solutions pH 7.0-8.0.
  • the dosage forms of the invention comprise an amount of at least one of the agents of the invention effective to treat, reduce the severity of, or prevent the clinical symptoms of a specific infection, indication, condition, or disease. Any statistically significant attenuation of one or more symptoms of an infection, indication or disease that has been treated pursuant to the method of the present invention is considered to be a treatment of such infection, indication or disease within the scope of the invention.
  • the composition may take the form of a dry powder, for example, a powder mix of the therapeutic agent and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator, insufflator, or a metered-dose inhaler (see, for example, the pressurized metered dose inhaler (MDI) and the dry powder inhaler disclosed in Newman, S. P. in Aerosols and the Lung , Clarke, S. W. and Davia, D. eds., pp. 197-224, Butterworths, London, England, 1984).
  • MDI pressurized metered dose inhaler
  • the dry powder inhaler disclosed in Newman, S. P. in Aerosols and the Lung , Clarke, S. W. and Davia, D. eds., pp. 197
  • Therapeutic agents of the present invention can be administered as a dry powder or in an aqueous solution when administered in an aerosol or inhaled form.
  • Other aerosol pharmaceutical formulations may comprise, for example, a physiologically acceptable buffered saline solution containing between about 0.1 mg/ml and about 100 mg/ml of one or more of the polypeptides of the present invention specific for the indication or disease to be treated. Dry aerosol in the form of finely divided solid compound, polypeptide or polypeptide particles that are not dissolved or suspended in a liquid are also useful in the practice of the present invention.
  • Therapeutic agents of the present invention may be formulated as dusting powders and comprise finely divided particles having an average particle size of between about 1 and 5 ⁇ m, alternatively between 2 and 3 ⁇ m.
  • Finely divided particles may be prepared by pulverization and screen filtration using techniques well known in the art.
  • the particles may be administered by inhaling a predetermined quantity of the finely divided material, which can be in the form of a powder.
  • the unit content of active ingredient or ingredients contained in an individual aerosol dose of each dosage form need not in itself constitute an effective amount for treating the particular infection, indication or disease since the necessary effective amount can be reached by administration of a plurality of dosage units.
  • the effective amount may be achieved using less than the dose in the dosage form, either individually, or in a series of administrations.
  • the therapeutic agents of the invention can also be administered to the respiratory tract.
  • the present invention also provides aerosol pharmaceutical formulations and dosage forms for use in the methods of the invention.
  • the therapeutic polypeptides of the invention are conveniently delivered from a nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Nebulizers include, but are not limited to, those described in U.S. Pat. Nos. 4,624,251; 3,703,173; 3,561,444; and 4,635,627. Aerosol delivery systems of the type disclosed herein are available from numerous commercial sources including Fisons Corporation (Bedford, Mass.), Schering Corp. (Kenilworth, N.J.) and American Pharmoseal Co., (Valencia, Calif.).
  • the therapeutic agents may be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered-dose inhaler. Typical of atomizers are the Mistometer (Wintrop) and the Medihaler (Riker).
  • combination products that include one or more of the therapeutic agents as active agents, e.g., antibodies and binding proteins, of the present invention and one or more other therapeutic agents, e.g., anti-viral agents, anti-microbial agents, pain relievers, anti-inflammatory agents, anti-bacterial agents, antihistamines, bronchodilators and the like, whether for the condition(s) described or some other condition.
  • therapeutic agents e.g., antibodies and binding proteins
  • other therapeutic agents e.g., anti-viral agents, anti-microbial agents, pain relievers, anti-inflammatory agents, anti-bacterial agents, antihistamines, bronchodilators and the like, whether for the condition(s) described or some other condition.
  • anti-retroviral agents can be included in the compositions of the invention such as protease inhibitors, retroviral polymerase inhibitors, azidothymidine (AZT), didanoside (DDI), soluble CD4, a polysaccharide sulfates, T22, bicyclam, suramin, antisense oliogonulceotides, ribozymes, rev inhibitors, protease inhibitors, glycolation inhibitors, interferon and the like.
  • the present invention further pertains to a packaged pharmaceutical composition for treating and/or preventing viral (e.g. HIV) infections, such as a kit or other container.
  • a packaged pharmaceutical composition for treating and/or preventing viral (e.g. HIV) infections such as a kit or other container.
  • the kit or container holds a therapeutically effective amount of a pharmaceutical composition for treating and preventing viral infections and instructions for using the pharmaceutical composition for treating and preventing the viral infection.
  • the pharmaceutical composition can include at least one polypeptide of the present invention, in a therapeutically effective amount such that viral infection is treated or prevented.
  • the pharmaceutical composition can include at least one binding entity or antibody of the present invention in a therapeutically effective amount such that the viral infection is treated, reduced, ameliorated, or prevented.
  • the HIV-1 envelope glycoprotein is expressed on the viral membrane as a trimeric complex, formed by three gp120 surface glycoproteins non-covalently associated with three membrane-anchored gp41 subunits.
  • the labile nature of the association between gp120 and gp41 hinders the expression of soluble, fully cleaved, trimeric gp140 proteins for structural and immunization studies. Disruption of the primary cleavage site within gp160 allows the production of stable gp140 trimers, but cleavage-defective trimers are antigenically dissimilar from their cleaved counterparts.
  • Soluble, stabilized, proteolytically cleaved, trimeric gp41 proteins can be generated by engineering an intermolecular disulphide bond between gp120 and gp41 (SOS), combined with a single residue change, I559P, within gp41 (SOSIP).
  • SOSIP gp140 proteins based on the subtype A HIV-1 strain KNH1144 form particularly homogenous trimers compared to a prototypic strain (JR-FL, subtype B).
  • These stabilized trimers retain the epitopes for several neutralizing antibodies and related agents (CD4-IgG2, b12, 2G12, 2F5 and 4E10) and the CD4-IgG2 molecule, so that the overall antigenic structure of the gp140 protein has not been adversely impaired by the trimer-stabilizing substitutions.
  • CD4-IgG2 PRO 542 (Allaway et al., 1995) and monoclonal antibody (MAb) PA-1 were provided by Dr. William Olson (Progenics Pharmaceuticals, Inc.) Soluble D1D2-CD4 (sCD4-183, 2 domain) (Garlick et al., 1990) was obtained from the NIH AIDS Research and Reference Program.
  • MAb CA13 ARP3119
  • Ms C. Arnold was provided by the EU Programme EVA Centralized Facility for AIDS Reagents, NIBSC, UK (AVIP Contract Number LSHP-CT-2004-503487).
  • MAbs 2G12 Calarese et al., 2003; Trkola et al., 1996), 2F5 (Parker et al., 2001; Zwick et al., 2001), 4E10 (Cardoso et al., 2005; Zwick et al., 2001) were obtained from Hermann Katinger, MAb 17b (Thali et al., 1993) from James Robinson and MAb b12 (Burton et al., 1994) from Dennis Burton.
  • the hybridoma for the production of MAb B13 (HIV-1 gp160 Hyb, Chessie 13-39.1) (Abacioglu et al., 1994) was obtained from NIH AIDS Research and Reference Program (donated by George K. Lewis).
  • HIV-1 Env genes cloned into the high-level mammalian expression vector pPPI4, were used for expression of soluble gp140 glycoproteins as previously described.
  • Furin was expressed from pcDNA3.1-Furin (Binley et al., 2000; Sanders et al., 2000).
  • the HIV-1 Env subtype A clone KNH1144 (accession number AF457066) (Beddows et al., 2006) and the subtype B clones JR-FL and Ba-L have been described previously (Binley et al., 2000).
  • the JR-FL gp41 ectodomain was replaced with the corresponding region of KNH1144 gp41, using EcoRI and HindIII restriction enzymes, followed by repair of the restriction sites and verification of the sequences.
  • Specific amino acid substitutions were made using the QuikChange® II XL site-directed mutagenesis kit (Stratagene Inc., La Jolla, Calif.) and the appropriate primers. The introduced mutations were verified by sequencing.
  • the human Embryonic Kidney cell line HEK293T was used for expression of the various envelope glycoproteins by transient transfection, as previously described (Binley et al., 2000; Sanders et al., 2000; Sanders et al., 2002).
  • HEK293T cells were grown in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal calf serum, penicillin, streptomycin and L-glutamine.
  • Transient transfections were performed using Polyethylenimine (PEI) (Polysciences Inc., Warrington, Pa.) (Boussif et al., 995; Kirschner et al., 2006).
  • PEI Polyethylenimine
  • BN-PAGE was performed as described previously by Schulke et al. (2002).
  • Concentrated culture supernatants or purified protein samples were diluted with an equal volume of a loading buffer containing 100 mM 4-(N-morpholino) propane sulfonic acid (MOPS), 100 mM Tris-HCl (pH 7.7), 40% glycerol, 0.1% Coomassie blue, and loaded onto a 4-12% Bis-Tris NuPAGE gel (Invitrogen).
  • Gel electrophoresis was performed at 100 V for 3 h using 50 mM MOPS, 50 mM Tris (pH 7.7) as electrophoresis buffer.
  • SDS-PAGE was performed as described previously by Schulke et al. (2002).
  • PVDF polyvinylidene difluoride
  • Protein mixtures containing Thyroglobulin (669 kDa), Ferritin (440 kDa), Catalase (232 kDa), Lactate dehydrogenase (140 kDa) and BSA (66 kDa) (Amersham Biosciences) were used as standard markers for native gels.
  • Thyroglobulin 669 kDa
  • Ferritin 440 kDa
  • Catalase 232 kDa
  • Lactate dehydrogenase 140 kDa
  • BSA 66 kDa
  • the BIAcore X system (BIAcore Inc., Uppsala, Sweden) was used for comparison of the JR-FL WT versus mutant gp140 env binding to various monoclonal antibodies. All assays were performed at 25° C. using HBS-EP buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% [v/v] Surfactant P20; BIAcore, Uppsala, Sweden), which was degassed for 1 h before use. The flow-rate was maintained at 10 ⁇ l/minute.
  • SA BIAcore streptavidin
  • SOSIP gp140 proteins from the subtype A strain KNH1144 form unusually stable and homogenous trimers compared to JR-FL SOSIP gp140, which is expressed as both dimers and trimers (Sanders et al., 2002).
  • the SOS gp140 protein from KNH1144 is also more stable than the corresponding JR-FL construct, the latter being expressed as a mixture of trimers, dimers and, predominantly, monomers (Beddows et al., 2006; Binley et al., 2000).
  • JR-FL SOS gp140 yields mostly monomeric gp140 proteins as a result of the instability of the gp41-gp41 interactions (Binley et al., 2000).
  • the N-terminal region of gp41 particularly around the Heptad Repeat 1 (HR1) region, plays a role in oligomerization of gp140 proteins (Center, Kemp, and Poumbourios, 1997; Center et al., 2004; Poumbourios et al., 1997).
  • HR1 Heptad Repeat 1
  • KNH1144 has isoleucine (I) at amino acid position 535, JR-FL has methionine (M); while KNH1144 has glutamine (Q) at amino acid position 543, JR-FL has leucine (L); while KNH1144 has serine (S) at amino acid position 553, JR-FL has asparagine (N); while KNH1144 has lysine (K) at amino acid position 567, JR-FL has glutamine (Q); and while KNH1144 has arginine (R) at amino acid position 588, JR-FL has glycine (G).
  • each residue in KNH11144 SOSIP gp140 was substituted with the corresponding one from JR-FL; the mutant Env proteins were then expressed and studied on BN-PAGE gels.
  • the wild-type forms of KNH1144 SOS and SOSIP gp140 proteins were also analyzed to allow a comparison with the trimer-stabilizing effect of the I559P substitution in the SOSIP version ( FIG. 2A ).
  • the amino acid substitutions described below had similar effects whether they were made in the SOS or the SOSIP gp140 background, so only a subset of the results is depicted.
  • the JR-FL gp120 subunit was combined with the KNH1144 gp41 ectodomain (JR-FLgp120-1144gp41 ECTO);
  • the second construct was a mutant JR-FL SOS gp140 in which the five varying amino acids (positions 535, 543, 553, 567 and 588) were substituted by the corresponding residues from KNH1144 (JR-FL gp41 NT 1-5);
  • the third was another chimera in which the C-terminal region of gp 41 ECTO from JR-FL was replaced by the corresponding segment of KNH1144 gp41 (JR-FL-1144 gp41 CT) ( FIG. 3A ).
  • JR-FL SOS gp140 was predominantly monomeric, while by contrast, the SOSIP gp140 formed dimers and trimers ( FIG. 3B , lanes 1 and 2).
  • the insertion of gp 41 ECTO from KNH1144 into the JR-FL SOS gp140 template stabilized the trimeric form, with a reduction in the amount of monomers present ( FIG. 3B , lane 3).
  • trimer-promoting determinants of KNH1144 are located in the N-terminal region of gp41.
  • greater stability of KNH1144 gp140 trimers can be conferred upon a heterologous gp140, JR-FL, by altering the specific residues that differ between the two proteins.
  • JR-FL gp41 NT 1-5 SOS gp140 trimers To further assess the formation and stability of JR-FL gp41 NT 1-5 SOS gp140 trimers, this protein and JR-FL SOS gp140 were purified using lectin-affinity and size exclusion chromatography (SEC) techniques. The SEC-fractionated aliquots were then resolved by BN-PAGE ( FIG. 4 ). The JR-FL SOS gp140 protein was predominantly a monomer ( FIG. 4A ), while a much greater proportion of the Env species present in JR-FL gp41 NT 1-5 SOS migrated as well-resolved trimers ( FIG. 4B ; compare lanes 11-16 with the corresponding lanes in FIG. 4A ).
  • the CD4-IgG2 protein (used as a surrogate for CD4) and the following MAbs were all studied: b12 (neutralizing, anti-CD4BS), 2G12 (neutralizing, high-mannose epitope on the ‘silent face’), 2F5, 4E10 (both neutralizing, anti-gp41), PA-1 (nonneutralizing, anti-V3), b6 (non-neutralizing, anti-CD4BS) and 17b (non-neutralizing, CD4-induced epitope). Equal molar amounts of purified wild-type and mutant gp140 trimers (>90% purity) were then injected at 10 ⁇ l/min, to react with the immobilized MAbs.
  • the reactivities of wild-type SOS gp140 and the mutant gp41 NT 1-5 SOS gp140 with b12 and 2G12 were also similar, with similar response unit (RU) values at the end-of-injection time (t 180 s).
  • the injected gp140 samples used in the ligand-binding assays were manually collected from the BIAcore X system and analyzed using BNPAGE. Both gp140 proteins were substantially trimeric, even after passage through the BIAcore system ( FIG. 5B ).
  • Ba-L another subtype B Env protein, Ba-L was studied. Like JR-FL, Ba-L contains Met, Leu, Asn and Gln residues at positions 535, 543, 553 and 567, respectively. However, at position 588, Ba-L contains Arg, as does KNH1144 ( FIG. 1 ). The four non-cognate amino acids from KNH1144 were introduced into the N-terminal region of Ba-L (M535I, L543Q, N553S, Q567K) to construct a mutant Ba-L gp41 NT 1-4 SOS gp140 protein.
  • the wild-type Ba-L SOS gp140 When expressed in HEK293T cells, the wild-type Ba-L SOS gp140, like JR-FL, was a mixture of monomers, dimers and trimers ( FIG. 6A , lane 1). However, the mutant containing the above four amino acid substitutions was predominantly trimeric ( FIG. 6A , lane 2), with >40% reduction in monomer formation. No individual substitution had as pronounced an effect as the quadruple combination. The enhanced trimerization of the mutant Ba-L gp41 NT 1-4 SOS gp140 was not attributable to the presence of aberrantly cross-linked proteins, as shown by SDS-PAGE under reducing and non-reducing conditions ( FIG. 6B ).
  • residues in the N-terminal region of the gp41 ectodomain that influence the stability of trimeric forms of the HIV-1 gp140 glycoprotein, particularly the trimers that most, but of course incompletely, resemble the native form of the Env complex.
  • the residues were found by inspection of the sequence of gp 41 ECTO from a subtype A SOSIP gp140 (KNH1144) that formed stable, cleaved trimers with unusual efficiency. Comparison of this sequence with that of JR-FL, a strain from which homogenous trimers are less easily made, identified five variable residues in a plausibly relevant region of gp 41 ECTO that lay in and around HR1.
  • Substituting naturally variable amino acids may be a less invasive way to promote trimer stabilization than previously described alternatives, such as the use of heterologous trimerization domains (Yang et al., 2000; Yang et al., 2002), or the insertion of the SIV gp41 N-terminal region to make a HIV-SIV chimeric envelope glycoprotein (Center et al., 2004).
  • the effect of substituting the KNH1144 gp41 residues into JR-FL and Ba-L is to reduce the heterogeneity of the oligomeric forms of SOS gp140 proteins when they are expressed as unpurified culture supernatants.
  • there was a marked decrease in the amount of monomers present lesser but sill notable decreases in dimers, tetramers and high-molecular weight aggregates and, of most relevance, an increase in the proportion of trimers.
  • the overall antigenic structure of the stabilized gp140 trimers was not adversely influenced by the sequence changes introduced into gp41.
  • the stabilized JR-FL trimers bound non-neutralizing antibodies (PA-1, b6 and 17b) to a lesser extent than the corresponding wild type trimers. Stabilizing the conformation of gp140 trimers is advantageous for use of these proteins as vaccine immunogens.
  • the invention provides less heterogeneous envelope trimers for the production of virus like particles (VPLs) and pseudoparticles for use as VLP-based immunogens and vaccines.
  • VPLs virus like particles
  • gp120/gp41 trimers comprising the stabilizing N-terminal gp41 mutations of the invention, as well as gp120/gp41 trimers comprising other stabilizing mutations in gp120 and gp41 and the N-terminal gp41 mutations as described herein, can be used to generate VPLs and pseudovirions having reduced monomer, dimer and tetramer forms and enhanced trimer forms of gp120/gp41 Env.
  • N-terminal stabilizing mutations in the context of HIV-1 virus as described herein can serve to restrict VLP and pseudovirion immunogens to the expression of Env trimers and to yield trimer forms of Env (gp120/gp41) on VLP and pseudovirions to the virtual exclusion of monomer, dimer, tetramer, or aggregate forms, thus providing an immunogen and/or vaccine that more closely resembles native HIV envelope trimers.
  • Env proteins serve as targets for the binding of non-neutralizing antibodies, thereby complicating any analysis of the relationships between the antibody binding and virus neutralization.
  • the binding of various non-neutralizing antibodies to virions and Env-expressing cells was reduced for the gp41 mutant compared with wild-type JR-FL, without adversely affecting the binding of neutralizing antibodies.
  • the use of the form of Env gp41 containing the five mutations, as well as SOS and SOSIP mutations, may also simplify the analyses of antibody binding and neutralization.
  • the pCI plasmid was used to express full-length WT JR-FL (gp160) Env (JR-FL WT) (Herrera et al., 2005).
  • the JR-FL gp41 NT 1-5 mutant was created by site-directed DNA mutagenesis; five amino acid substitutions (M535I, L543Q, N553S, Q567K and G588R) near the N-terminus (NT) of gp41 were made using the QuikChange® II XL site-directed mutagenesis kit (Stratagene Inc., CA) and the appropriate primers according to the manufacturer's instructions. The introduced mutations were verified by sequencing.
  • the pcDNA3.1-Furin plasmid was used for expressing Furin (Binley et al., 2000).
  • Soluble CD4, CD4-IgG2 (PRO-542) (Allaway et al., 1995) and the anti-V3 (JR-FL) MAb PA1 (Trkola et al., 1996a) were provided by Dr. William Olson (Progenics Pharmaceuticals, Inc., NY).
  • MAbs 2G12 (Buchacher et al., 1994; Scanlan et al., 2002; Trkola et al., 1996b), 2F5 (Buchacher et al., 1992; Muster et al., 1993) and 4E10 (Buchacher et al., 1992; Stiegler et al., 2001; Zwick et al., 2001) were obtained from Hermann Katinger, MAb 17b (Thali et al., 1993) was obtained from James Robinson and MAb b12 (Burton et al., 1991) was obtained from Dennis Burton.
  • MAbs A32 (Moore et al., 1994; Wyatt et al., 1995) and 15e (Robinson et al., 1990) were obtained from the Neutralizing Antibody Consortium (NAC) repository.
  • F425-B4e8 (Cavacini et al., 2003) was obtained through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, from Dr. Marshall Posner and Dr. Lisa Cavacini.
  • the anti-v3 MAb 447-52D was also obtained from the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, contributed by S. Zolla-Pazner (Gorny et al., 1992 and 1993).
  • T-20 Endfuvirtide
  • HEK 293T cells were grown in Dulbecco's minimal essential medium (DMEM, GIBCO), supplemented to contain 10% fetal calf serum (FCS), 2 mM L-glutamine, antibiotics (100 U/ml penicillin, 100 ⁇ g/ml streptomycin) and 0.5 mg/ml of the neomycin analog G-418.
  • DMEM Dulbecco's minimal essential medium
  • FCS fetal calf serum
  • antibiotics 100 U/ml penicillin, 100 ⁇ g/ml streptomycin
  • U87.CD4.CCR5 and U87.CD4.CXCR4 cells were cultured under conditions similar to those of the HEK 293T cells, but under selection by 0.3 mg/ml of G-418 and 0.5 mg/ml of puromycin.
  • Env-pseudotyped viruses 1 ⁇ 10 8 HEK 293T cells cultured in growth medium lacking antibotics were co-transfected with plasmid DNA expressing gp160 Envs (WT or gp41 NT 1-5 mutant) and the pNL4-3Env( ⁇ )Luc(+) reporter plasmid (Connor et al., 1995 and 1996) using Polyethylenimine (PEI), (Polysciences, Inc., Warrington, Pa.), (Boussif et al., 1995; Kirschner et al., 2006).
  • PEI Polyethylenimine
  • the cells were washed and the medium was replaced with DMEM containing 10% FCS, antibiotics and L-glutamine.
  • DMEM fetal calf serum
  • the virion-containing supernatants were clarified by low speed centrifugation and were filtered through a 0.45- ⁇ m membrane.
  • the clarified, filtered supernatants were layered over a 20% sucrose cushion in phosphate buffered saline (PBS) and were centrifuged for 2 hours at 100,000 ⁇ g.
  • PBS phosphate buffered saline
  • the viral pellet also referred to as pseudovirions or pseudoviruses herein
  • HEK 293T cells were transiently transfected with plasmid DNA essentially as described above.
  • pcDNA3.1-Furin was used for Furin co-transfection at a Furin:Env plasmid DNA ratio of 2:1 (Binley et al., 2000). After 24 hours, the cells were washed, and fresh culture medium was added. Forty-eight hours post-transfection, the cell-surface expressed Envs were biotin labeled for polyacrylamide gel electrophoresis (PAGE), or were stained with anti-Env antibodies for FACS analysis as described below.
  • the cell surface-expressed envelope glycoproteins were biotinylated as described previously (Daniels and Amara, 1998) with minor modifications. Briefly, the Env-expressing cells were washed extensively with ice-cold PBS containing 1.2 mM CaCl 2 , 1 mM MgCl 2 and were incubated with 0.5 mg/ml of EZ-link sulfo-NHS-SS-Biotin (Pierce Biotechnology, Rockford, Ill.) for 1 hour at 4° C. The biotin reaction was quenched using 50 mM ammonium chloride.
  • the cells were then washed extensively and lysed in a buffer containing 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 ⁇ Protease Inhibitors cocktail (Roche Diagnostic GmbH, Mannheim, Del.). The homogenates were centrifuged at 14,000 ⁇ g for 15 minutes at 4° C.
  • Bound proteins were resuspended in 50 ⁇ l of 2 ⁇ SDS-PAGE sample buffer, boiled and resolved on a reduced SDS-PAGE gradient (4-12%) Tris-glycine gel (Invitrogen, Carlsbad, Calif.). After transfer to a PVDF membrane, the samples were immunoblotted with anti-gp120 antibody ARP3119, with anti-CD47 antibody (Santa Cruz Biotechnology) at 0.31 ⁇ g/ml, or with anti-GAPDH antibody (Meridian Life Science, Inc.) at 0.1 ⁇ g/ml. GAPDH was used as a control for equal loading of proteins in the total cell lysate; cell-surface CD47 expression served a similar purpose for studying cell-surface-expressed Env.
  • FACS Fluorescence-Activated Cell Sorting
  • CD4-IgG2 and MAbs were biotinylated using the EZ-link Sulfo-NHS-LC-Biotinylation kit (Pierce) according to the manufacturer's instructions. Env-expressing, transiently-transfected HEK 293T cells (0.5 ⁇ 10 6 cells per analysis) were harvested, washed extensively with. PBS and incubated with 10 ⁇ g/ml of biotinylated CD4-IgG2 or MAbs in FACS buffer (PBS containing 5% FCS) for 1 hour at 4° C.
  • FACS buffer PBS containing 5% FCS
  • the cells were washed repeatedly in FACS buffer and then were incubated with 100 ⁇ l of Streptavidin-phycoerthyrin (PE), (BD Biosciences), at a 1:250 dilution for 30 minutes at 4° C. The stained cells were then washed, fixed using 2% paraformaldehyde and analyzed. Each binding assay was performed in triplicate. Mean Fluorescence Intensity (MFI) values were derived using the appropriate isotype-matched control MAb. The resulting background signal was subtracted from the experimental results and presented as Mean ⁇ Standard Deviation.
  • PE Streptavidin-phycoerthyrin
  • Env that was expressed on the surface of pseudovirions was analyzed under non-denaturing conditions by the use of BN-PAGE (Schulke et al., 2002), with modifications as described elsewhere (Moore et al., 2006; Schagger et al., 1994).
  • the cathode buffer was 50 mM MOPS/50 mM Tris, pH 7.7, containing 0.002% Coommassie Blue, and the same buffer without Coommassie Blue served as the anode buffer.
  • the gel was then blotted onto a polyvinylidene difluoride (PVDF) membrane, which was then washed with 30% methanol/10% acetic acid, followed by 100% methanol, to remove excess Coommassie Blue dye.
  • PVDF polyvinylidene difluoride
  • Thyroglobulin (669 kDa), Ferritin (440 kDa), Catalase (232 kDa), Lactate dehydrogenase (140 kDa) and BSA (66 kDa) were used as molecular weight markers (Amersham Biosciences, PA). Densitometric analyses were performed using ImageJ software (NIH).
  • the membrane was then destained, treated with blocking buffer (4% nonfat milk in PBS) for 30 minutes and probed using 0.5 pg/ml of the anti-gp120 MAb CA13 or 20 ⁇ g/ml each of the 4E10 and 2F5 antibodies (anti-gp41 MAb cocktail).
  • the mouse MAb 39/6.14 (Abcam Inc., MA) was used to detect p24.
  • Goat anti-human and/or mouse Fc and Fab′2 alkaline phosphatase conjugates (Jackson Labs) were used at a dilution of 1:3,000, as appropriate, to detect the primary MAbs, followed by the Western blot Chemiluminescence Reagent Plus System (Perkin-Elmer Life Sciences, MA).
  • the MultiMark® multi-colored standard kit (Invitrogen, Calif.) was used as a molecular weight marker.
  • Pseudovirions in 200 ⁇ l of PBS containing 0.5% BSA, were incubated with or without sCD4 for 2 hours at 4° C. or 37° C. (or without sCD4, but at various temperatures), and then were layered over a 1 ml cushion of 20% sucrose and ultracentrifuged at 100,000 g for 1.2 hours.
  • the purified virions were then resuspended in 200 ⁇ l of dilution buffer (TMSS: 2% milk powder, 20% sheep serum in Tris-Buffered Saline (TBS)) for analysis of their gp120 content by capture ELISA.
  • TMSS 2% milk powder, 20% sheep serum in Tris-Buffered Saline (TBS)
  • gp120 capture ELISA was carried out as previously described (Moore et al., 1992). Briefly, gp120 was captured onto microtiter plate wells by the absorbed sheep antibody D7324 to the C-terminus (Cliniqa Corp.) and detected using either polyclonal HIVIg or CD4-IgG2 (0.1 ⁇ g/ml).
  • the virus capture assay was performed as previously described (Poignard et al., 2003). Briefly, ELISA plates were coated with goat anti-mouse IgG (Fc-specific) antibody (Sigma-Aldrich, Mo.), blocked with 3% BSA in PBS, and then incubated with anti-gp120 MAbs at 10 ⁇ g/ml in 100 ⁇ l of PBS. After washing thoroughly to remove unbound MAbs, 100 ⁇ l of medium containing pseudoviruses (0.5-1.5 ng of p24 antigen) was added for 4 hours at room temperature.
  • Fc-specific antibody goat anti-mouse IgG (Fc-specific) antibody
  • pseudoviruses were lysed in 200 ⁇ l of lysis buffer and their p24 content was determined using an HIV-1 p24 ELISA kit (ZeptoMetrix Corp., NY). Wells that lacked anti-gp120 antibody served as negative controls for background binding of the added pseudoviruses.
  • Pseudotyped virions bearing JR-FL envelope glycoproteins were produced by cotransfection of selected env clones with a luciferase-expressing reporter vector, pNL4-3Env( ⁇ )Luc(+), as described above.
  • luciferase-expressing Env-pseudotyped viruses 50 ⁇ l containing normalized amounts of p24 antigen were added to 3 ⁇ 10 3 U87.CD4.CCR5 cells/well.
  • U87.CD4.CXCR4 cells were used as a negative control.
  • th cells were lysed with 75 ⁇ l of 1 ⁇ Glo lysis buffer (Promega, Calif.) for subsequent quantification of luciferase, which was expressed by the Env-pseudotyped virions that contain the gene for firefly luciferase inserted into the nef gene of HIV-1, using the Bright-GloTM Luciferase Assay Substrate (Promega, Calif.) and a VICTOR3 1420 multilabel counter (Perkin Elmer Life Sciences, Mass.).
  • the ⁇ -lactamase cell-cell fusion assay was performed in HeLa-CD4/CCR5 cells (RC49) as described previously. (Lineberger et al., 2002; Rucker et al., 1997).
  • the five amino acids I535, Q543, S553, K567 and R588 located near the N-terminus of HIV-1 gp41 are associated with the formation and/or stability of soluble, trimeric gp140 proteins based on the subtype A strain KNH1144 of HIV-1. Moreover, introducing these residues into HIV-1 subtype B gp140 proteins with different amino acids at the same positions had a beneficial impact on trimer stability. Of the five residues, Q543, S553 and K567 had the greatest effect when introduced in combination, with I535 and R588 perhaps making an additional minor contribution.
  • Table 2 lists the prevalence (expressed as a percentage) of the five trimer-promoting acids (I535, Q543, S553, K567 and R588), singly or in combination, in gp41 sequences from viruses fo subtypes A, B, C, D and from subtypes F+G+H+J+K treated collectively (too few sequences from subtypes F, G, H, J and K were available to warrant a separate analysis).
  • Env sequences from what was formerly called subtype E are included within subtype A as the “subtype E” env gene is actually from subtype A.
  • the comparatively high collective prevalence of the five amino acids in subtype A sequences is highlighted in gray.
  • the statistical significance (P value) of the prevalence of the five amino acids in subtype B viruses, singly or in combination, relative to the rest of the subtypes is calculated using Fisher's Exact Test.
  • JR-FL WT The full-length, wild type (WT) JR-FL gp160 env gene (JR-FL WT) was mutated at the same five positions to generate the JR-FL gp41 NT 1-5 mutant.
  • Env-pseudotyped virions pseudovirions based on the WT and mutant sequences were generated by co-transfecting HEK 293T cell with each individual full-length Env-encoding plasmid and the pNL4-3.Luc.R-E-reporter plasmid (Connor et al., 1996).
  • Pseudovirions from the two virus preparations were pelleted by ultracentrifugation onto a 20% sucrose cushion and were found to contain similar amounts of the p24 antigen (107 pg/ml for WT; 112 pg/ml for the NT 1-5 mutant).
  • the gp120 and gp41 content of the WT and the NT 1-5 mutant viruses were then determined by SDS-PAGE and Western blotting, followed by densitometric analysis using ImageJ software ( FIG. 7 ).
  • the normalized gp120:p24 ratios for the WT and mutant viruses were 1 and 0.28, respectively.
  • the corresponding gp41:p24 ratios were 1 and 0.4, respectively.
  • the mutant pseudovirions contained ⁇ 3.5-fold less gp120 and 2.5-fold less gp41 than the WT viruses per unit of particulate p24 antigen.
  • mutant viruses incorporate and retain ⁇ 30-40% of the total Env content of the WT viruses.
  • the Env content of the purified pseudovirions was studied in more detail by using BN-PAGE to assess the presence of dimeric, trimeric and tetrameric Env forms ( FIG. 8A ). Consistent with the gel analysis under denaturing conditions, the total Env content of the mutants was ⁇ 2.5-fold lower than thet of the WT viruses. However, a densitometric analysis showed that this reduction was entirely attributable to a decrease in the amounts of Env tetramers and dimers that were present on the mutant particles (no monomers were visible in either of the preparations); the trimer contents of the two sets of virions were identical ( FIGS. 8A and 8B ).
  • FIG. 12B An additional non-neutralizing Mab, A32, directed to the C1-C4 region of gp120, bound minimally, but comparably, to both pseudovirion preparations ( FIG. 12B ).
  • Sensitivity to T-20 was also studied in the same assay system, because the five amino acid changes are located close to the gp41 HR1 region, which is associated with T-20 resistance (Carmona et al., 2005; Greenberg and Cammack, 2004).
  • the IC50 for T-20 against the WT Env-pseudotyped virus was 2-fold greater than against the mutant, suggesting that one or more of the five amino acid substitutions does modestly affect the binding or antiviral activity of the T-20 peptide against the gp41 NT 1-5 mutant. (Table 4).
  • HIV-1 envelope glycoproteins When the HIV-1 envelope glycoproteins are expressed as recombinant proteins for use as vaccine antigens, for structural studies, or for analysis of neutralization mechanisms, their structural heterogeneity creates problems.
  • preparations of soluble gp140 proteins can, and often do, contain monomers, dimers, trimers, tetramers and aggregates (Center et al., 2004; Earl et al., 1994; Schulke et al., 2002; Staropoli et al., 2000), and multiple forms of membrane-bound Env are present on pseudovirions and on Env-expressing cells. (Herrera et al., 2005; Moore et al., 2006; Poignard et al., 2003).
  • the identity of selected residues near the N-terminus of gp41 provides one of the genetic influences on the formation of aberrant forms of Env.
  • the residues associated with increased trimer formation/stabilization are much rarer in HIV-1 subtype B viruses compared with those from other subtypes, particularly HIV-1 subtype A, for reasons that are not completely understood.
  • the relevant residues when inserted into subtype B viruses, they increase the formation and/or stability of trimers.
  • most vaccine-related studies with soluble gp140 proteins have been carried out using subtype B sequences as templates, it seems possible that the commonly observed Env instability might not be as pronounced with proteins from other subtypes as it is with subtype B. (Jeffs et al., 2004).
  • the gp41 amino acid changes in the N-terminal region had no effect on pseudovirion infectivity, and they did not cause any destabilization of the gp120-gp41 linkage. Thus, they seem to be benign from the perspective of the overall topology of the Env complex. Their lack of effect on the overall structure of functional, native Env complexes is further shown by the similar binding of various neutralizing MAbs to both the WT and mutant pseudovirions and their identical neutralization sensitivities. An exception was the slightly greater sensitivity of the mutant viruses to the CD4i MAb 17b in the presence of sCD4, which was associated with a comparable increase in 17b binding in a pseudovirion-capture assay in the presence of sCD4.
  • the gp41 NT substitutions do have a modest impact on the exposure of the CD4i epitope post CD4 binding. Broadly similar effects of selected gp41 sequence changes on gp120 topology have been described. (Back et al., 1993; Klasse et al., 1993; Reitz et al., 1988; Thali et al., 1994).
  • the gp41 changes did have a modest effect on fusion kinetics in a cell-cell fusion assay, but seemingly not enough to affect infectivity when the same Env proteins were present on pseudovirions. Mutational studies of the gp41 HR1 segment have shown that mutations in the “a” and “d” positions, particularly helix-disrupting mutations, impair fusion. (Cao et al., 1993; Chen et al., 1993; Chen, 1994; Dubay et al., 1992). The S553, K567 and R588 residues that were identified are not helix disrupting and occupy the “b” position on the coiled-coil helix, which may explain why their adverse effect is so modest.
  • the NT substitutions also had a slight affect on T-20 sensitivity, decreasing the IC50 by 2-fold. Although the substitutions lie outside the 547 GIV 549 ‘hot spot’ associated with T-20 reactivity (Rimsky et al., 1998), natural polymorphisms at position 553 (e.g., N553S) most commonly observed in non-subtype B isolates, have been associated with increased susceptibility to T-20. (Carmona et al., 2005; Whitcomb et al., 2003).
  • V3 MAbs e.g., PA1, 447-52D and F425-B4e8, captured pseudoviruses efficiently, but only F425-B4e8 was neutralizing. Nonetheless, the introduction of the five NT substitutions in gp41 that reduce (but that do not eliminate) the presence of non-native forms of Env on pseudoviruses did improve the performance of the virion capture assay. For example, the difference between the closely related neutralizing and non-neutralizing CD4BS MAbs b12 and b6 was substantially increased in the virion capture assay when the gp41 NT 1-5 Env mutant pseudoviruses were used ( FIG. 12A ).
  • Binding assays involving Env expressed on the surface of transfected cells were less informative, probably because of the multiplicity of Env configurations present on the cells. This further reinforces the problems associated with these types of assays when they are used to assess the relationship between antibody binding and virus neutralization (Gorse et al., 1999; Herrera et al., 2003; Sattentau and Moore, 1995; Si et al., 2001; York et al., 2001).
  • the five amino acid changes in gp41 have a generally beneficial effect on the overall configuration of the subtype B gp140 and gp160 Env proteins (as well as on those of subtype A Env proteins as described in Experimental Details I) by reducing the presence of non-native Env forms, i.e., non-trimer forms, without compromising the function of trimers. Accordingly, the present invention encompasses a facilitation of the production of Env trimers for HIV vaccine development and production and for HIV structural and immunogenicity studies.
  • Chemokine receptors as HIV-1 coreceptors roles in viral entry, tropism, and disease. Annu Rev Immunol 17, 657-700.
  • a recombinant human immunodeficiency virus type 1 envelope glycoprotein complex stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits is an antigenic mimic of the trimeric virion-associated structure. J Virol 74(2), 627-43.
  • Antibody domain exchange is an immunological solution to carbohydrate cluster recognition. Science 300(5628), 2065-71.
  • Vpr is required for efficient replication of human immunodeficiency virus type 1 in human mononuclear phagocytes. Virology. 206(2), 935-44.
  • Nonneutralizing antibodies to the CD4-binding site on the gp120 subunit of human immunodeficiency virus type 1 do not interfere with the activity of a neutralizing antibody against the same site. J. Virol. 77(2), 1084-91.
  • Virions of primary human immunodeficiency virus type 1 isolates resistant to soluble CD4 (sCD4) neutralization differ in sCD4 binding and glycoprotein gp120 retention from sCD4-sensitive isolates. J. Virol. 66(1), 235-43.
  • HIV-1 human immunodeficiency virus type 1
  • a global neutralization resistance phenotype of human immunodeficiency virus type 1 is determined by distinct mechanisms mediating enhanced infectivity and conformational change of the envelope complex. J. Virol. 74(9), 4183-91.
  • Variable-loop-deleted variants of the human immunodeficiency virus type 1 envelope glycoprotein can be stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits. J Virol 74(11), 5091-100.
  • gp160 the envelope glycoprotein of human immunodeficiency virus type 1
  • gp160 is a dimer of 125-kilodalton subunits stabilized through interactions between their gp41 domains. J. Virol. 65(7), 3797-803.
  • Human monoclonal antibody 2G12 defines a distinctive neutralization epitope on the gp120 glycoprotein of human immunodeficiency virus type 1. J Virol 70(2), 1100-8.
  • Trkola A., Dragic, T., Arthos, J., Binley, J. M., Olson, W. C., Allaway, G. P., Cheng-Mayer, C., Robinson, J., Maddon, P. J., and Moore, J. P. (1996a). CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5. Nature. 384(6605), 184-7.
  • Peptides corresponding to a predictive alpha-helical domain of human immunodeficiency virus type 1 gp41 are potent inhibitors of virus infection. Proc. Natl. Acad. Sci. USA., 100(19), 91(21), 9770-4.
  • HIV-1 envelope glycoproteins fusogens, antigens, and immunogens. Science. 280(5371), 1884-8.
  • NAb neutralizing antibodies
  • oligomeric env protein complex on the surface of the virus is comprised of a gp120-gp41 heterodimer present in a homotrimer configuration (held together via non-covalent interactions), resembling a “spike” structure.
  • glycoproteins are derived from a gp160 precursor protein, which undergoes processing and cleavage in the cell to result in gp120 and gp41 heterodimers that are then targeted to the surface of the HIV viral envelope (12, 13). Fusion of the virus with the CD4 + cell membrane and oligomerization of the trimer spike is mediated by the gp41 glycoprotein, which is tethered to the virion surface via its transmembrane domain (12, 13).
  • subtype B HIV JR-FL Env was used as a template and a disulfide bond was introduced between gp 120 -gp 41 ECTO subunits (SOS gp140), followed by a further modification to gp41 ECTO (I559P mutation), which successfully allowed for the expression of stable, cleaved and fully processed oligomeric gp140 proteins in a trimeric conformation (SOSIP gp 140 ) (8-11, 15-17, and WO 2003/022869).
  • KNH1144 SOSIP R6 gp140 derived from a contemporary East African subtype A HIV-1 primary isolate, using methodologies that improve on currently implemented purification procedures.
  • the purified KNH1144 SOSIP R6 gp140 is a trimer based on BN-PAGE and size exclusion chromatography (SEC).
  • SEC size exclusion chromatography
  • described herein are novel findings of the effects of non-ionic detergents such as Tween 20 on the KNH1144 SOSIP R6 aggregates (19). These findings reveal new insights into the nature of the aggregate species.
  • the KNH1144 SOSIP R6 envelope and furin DNA plasmids were as described.
  • HEK 293T cells were seeded in triple flasks at a density of 2.5 ⁇ 10 7 cells/flask and cultured in DMEM/10% FBS/1% pen-strep with 1% L-glutamine 24 hours prior to transfection.
  • 270 ug of KNH1144 SOSIP R6 envelope DNA was mixed with 90 ug of Furin protease DNA plasmid (per flask) in Opti-MEM.
  • Polyethyleneimine (PEI) was added stepwise (2 mg PEI: 1 mg total DNA) and vortexed immediately in between each addition.
  • the PEI/DNA complex solutions were incubated for 20 minutes at room temperature. Complexes were then added to the flasks and incubated for 6 hours at 32° C., 5% CO 2 .
  • the cells were then washed with warmed PBS and then incubated in exchange media (DMEM/0.05% BSA/1% pen-strep) for 48 hours at 32° C., 5% CO 2 . After the 48 hour incubation, the supernatants were collected and a cocktail of protease inhibitors was added to minimize protein degradation. Harvested supernatants were then clarified by filtration through a 0.45 um filter and concentrated to 53 ⁇ .
  • KNH1144 gp120 monomer has been previously described (1) and typically, 1-2 L of cell culture supernatants from transfected cells were harvested. Supernatants were clarified by filtration and stored at ⁇ 80° C. without any concentration prior to purification.
  • KNH1144 SOSIP R6 gp140 trimer was purified via a four step process starting with an ammonium sulfate precipitation followed by lectin affinity, size exclusion and ion-exchange chromatography.
  • 53X concentrated cell culture supernatant was precipitated with an equal volume of 3.8 M ammonium sulfate to remove contaminant proteins (with the major contaminant being -2-macroglobulin).
  • the ammonium sulfate was added with constant stirring with a stir bar and then was immediately centrifuged at 4000 rpm, 4° C. for 45 minutes.
  • the resulting supernatant was diluted 4-fold with PBS, pH 7.25, and was filtered using a 0.45 um vacuum filter.
  • the sample was then loaded at 0.5-0.8 ml/min onto a Galanthus nivalis (GNA) lectin (Vector Laboratories, Burlingame, Calif.) column equilibrated with PBS-pH 7.25. Once the load was finished, the column was washed with PBS pH 7.25 until OD 280 reached baseline, followed by a second wash with 0.5 M NaCl PBS pH 7.25 at 1 ml/min in order to remove contaminant proteins (mainly BSA). The column was then eluted with 1 M MMP PBS pH 7.25 starting with flowing one half CV through the column at 0.3 ml/min and pausing the purification for a 1 hour incubation in MMP elution buffer.
  • GAA Galanthus nivalis
  • the fractions were analyzed by BN-PAGE using a 4-12% Bis-Tris NuPAGE gel (Invitrogen, Carlsbad, Calif.) (10). All trimer containing fractions were pooled and diluted to 75 mM NaCl with 20 mM Tris pH 8. The diluted SEC pool was then applied over a 1 ml HiTrap DEAE FF column (GE Healthcare), equilibrated in 20 mM Tris pH 8, 75 mM NaCl (TN-75). The diluted SEC pool was loaded at 0.5 ml/min. The column was washed with TN-75 at 1 ml/min until the OD 280 reached baseline. The column was then eluted with 20 mM Tris, 300 mM NaCl pH 8 at 1 ml/min, collecting 0.5 ml fractions.
  • trimer yield the flow-through fraction from the DEAE column was re-applied over the column (equilibrated in TN-75) and typically 20-30% or 30-40% more trimer was recovered in this manner.
  • the fractions were analyzed by BN-PAGE and by reducing and non-reducing SDS-PAGE. Western blot analysis on non-reduced SDS-PAGE gel was performed with the ARP3119 monoclonal antibody.
  • the trimer containing fractions were pooled and trimer concentration was determined through densitometry on a reducing SDS-PAGE gel using JR-FL gp120 as a standard.
  • Unconcentrated cell culture supernatants containing secreted gp120 monomer were applied directly over a GNA lectin column equilibrated in 20 mM imidazole pH 7.1 at 1-2 ml/min. Following adsorption, the column was washed with a high salt (PBS containing 1 M NaCl, pH 7.1) wash, followed by a low salt (20 mM imidazole pH 7.1) wash. The column was eluted with 1 M MMP in 20 mM imidazole, 0.2 M NaCl pH 7.1.
  • Peak fractions were pooled and diluted with 20 mM imidazole, pH 7.1, thirteen-fold to a final buffer concentration of 20 mM imidazole, pH 7.1, 15 mM NaCl.
  • the diluted GNA elution was applied over 1 ml HiTrap Q Sepharose FF (GE Healthcare) equilibrated in 20 mM imidazole, pH 7.1.
  • the column was washed with 20 mM imidazole, pH 7.1, and was eluted with 20 mM imidazole, 0.2 M NaCl, pH 7.1.
  • Tween® 20 Dose effect: 1 ug of purified KNH1144 SOSIP R6 trimer was incubated with varying concentrations of Tween® 20 (polyoxyethylene sorbitan monolaurate) ranging from 0 to 0.0001% (v/v) and incubated for 1 hour at room temperature. Following incubation, samples were analyzed by BN-PAGE as described above.
  • Tween® 20 polyoxyethylene sorbitan monolaurate
  • Tween® 20 Temperature dependance on Tween® 20 effect: To determine if temperature affected the ability of Tween® 20 to recover trimers from aggregates (i.e., collapse aggregate into trimer), 1 ug of purified KNH1144 SOSIP R6 trimer was incubated with Tween® 20 to a final concentration of 0.05% (v/v) at 0° C. (on ice), room temperature (22-23° C.) at 37° C., or left untreated for 10 minutes. Following the incubation, samples were analyzed by BN-PAGE and Coomassie staining.
  • Tween® 20 effect on KNH1144 gp120 To test if Tween® 20 had a similar effect on KNH1144 gp120, 1 ug of purified gp120 monomer was either untreated or incubated with Tween® 20 at a final concentration of 0.05% for 10 minutes at room temperature. Following the treatment, samples were analyzed by BN-PAGE and Coomassie staining.
  • Tween® 20 effect on -2-macroglogulin (a 2 M) 0.5 ug of purified -2-macroglobulin was either untreated or treated with Tween® 20 at a final concentration of 0.05% for 10 minutes at room temperature. Reactions were analyzed via BN-PAGE, followed by Coomassie staining.
  • Molecular weight standards SEC A Superdex 200 10/300 GL column was equilibrated in 20 mM Tris pH 8, 0.5 M NaCl (TN-500) and calibrated with the following molecular weight standard proteins: thyroglobulin 669,000 Da; ferritin 440,000 Da; BSA 67,000 Da; and RNAse A 13,700 Da. A standard curve was generated by plotting the observed retention volumes of the standard proteins against the log values of their predicted molecular weights.
  • KNH1144 gp120 SEC analysis 14 ug of purified KNH1144 gp120 (either untreated or Tween® 20-treated as described above) was applied over the Superdex 200 column equilibrated in TN-500 and resolved at a flow rate of 0.4 ml/min. As a control, 10-14 ug of JR-FL gp120 was also analyzed in a similar manner.
  • KNH1144 SOSIP R6 gp140 SEC analysis 8-10 ug of purified KNH1144 SOSIP R6 gp140 was treated with Tween® 20 at a final concentration of 0.05% for 10-30 minutes at room temperature. Treated samples were then applied over the Superdex 200 column equilibrated with TN-500 containing 0.05% Tween® 20 (TNT-500) and resolved at 0.4 ml/min, collecting 0.4 ml fractions. Trimer-containing fractions were then analyzed by BN-PAGE, followed by silver staining. Fractions were also separated by BN-PAGE, followed by Western blot analysis with ARP 3119 antibody.
  • Human mAbs b6 (32), b12 (33) and 2G12 (26), HIVIg (40) were obtained from Dr. Dennis Burton (The Scripps Research Institute, La Jolla, Calif.) or Dr. Herman Katinger (University of Natural Resources and Applied Life Sciences, Austria, Vienna).
  • anti-Env antibodies 2G12, b6, b12 and HIVIg were used.
  • the CD4-IgG2 antibody conjugate PRO 542 (39) was also used.
  • ELISA plates were coated overnight at 4° C. with lentil lectin powder from Lens culinaris (L9267, Sigma) at 10 ug/ml concentration. Plates were washed with PBS twice and blocked with SuperBlock (Pierce) (warmed to RT). Excess blocking agent was washed off with PBS. SEC fractions containing HMW aggregate were either untreated or treated with 0.05% Tween® 20 (v/v, final concentration) for 30 minutes at room temperature (RT) and were added at 0.3 ug/ml (diluted in PBS) and bound to the plates (via the lectin) for 4 hours at RT.
  • EM analysis of the SOSIP trimers was performed by negative stain as previously described (34, 35). Because this technique is incompatible with detergent, 20 l of the original sample (0.5 mg/ml in TN-300) was dialyzed against BSB (0.1 M H 3 BO 3 , 0.025 M Na 2 B 4 O 7 , 0.075 M NaCl, pH 8.3) and subsequently depleted of detergent using the Mini Detergent-OUTTM detergent removal kit (Calbiochem, La Jolla, Calif.) as described by the manufacturer. Two microliters of the resulting protein solution, diluted in 200 l BSB, was affixed to carbon support membrane, stained with 1% uranyl formate, and mounted on 600 mesh copper grids for analysis.
  • BSB 0.1 M H 3 BO 3 , 0.025 M Na 2 B 4 O 7 , 0.075 M NaCl, pH 8.3
  • Mini Detergent-OUTTM detergent removal kit Calbiochem, La Jolla, Calif.
  • EMs were recorded at ⁇ 100,000 at 100 kV on a JOEL JEM 1200 electron microscope. Measurements were made using the Image-Pro Plus software program. Fifty or more trimers were measured and analyzed statistically. The average diameter of the compact trimers formed by the SOSIP gp140 (e.g., KNH1144.R6 SOSIP) proteins was about 12-13 nm.
  • SOSIP gp140 e.g., KNH1144.R6 SOSIP
  • KNH1144 SOSIP R6 gp140 trimers typically involved three chromatography steps: GNA lectin affinity, Superdex 200 size exclusion and DEAE weak anion exchange.
  • 53 ⁇ concentrated cell culture supernatant precipitated with ammonium sulfate was clarified by centrifugation, diluted and applied over the GNA lectin affinity column to capture gp140 proteins via ( ⁇ 1, 3) mannose residues.
  • Analysis of the ammonium sulfate precipitation using different starting concentrations of harvested cell culture supernatant (100 ⁇ to 40 ⁇ ) revealed that 53 ⁇ was the optimum condition at which maximum -2-macroglobulin precipitated out, with minimal envelope protein loss.
  • Typical HMW aggregate content ranged from 10 to 40% of the final preparation prior to non-ionic detergent treatment.
  • Treatment of the purified preparation with Tween® 20 at a final concentration of 0.05% converted the HMW aggregate species to trimers, yielding a homogenous trimer preparation ( FIG. 14 , right panel, SOSIP R6, +lane) (19). It should be noted that treatment with Tween® 20 also caused the treated trimer to migrate slightly more rapidly than the untreated trimer (notice faster mobility of trimer in the +lane).
  • Tween® 20 provided a simple and mild means to obtain homogenous trimers, further characterization of the non-ionic detergent effect was performed.
  • a purified trimer preparation containing ⁇ 30% aggregates e.g., monomer, dimmer and trimer
  • Tween® 20 was treated with Tween® 20 at final concentrations of 0.0001% to 0.1% (v/v) ( FIG. 15A ).
  • the SOSIP R6 aggregates were converted to trimers at concentrations of 0.1% to 0.01% ( FIG. 15A , lanes 3-5). No conversion was observed at Tween® 20 concentrations of 0.001 and 0.0001% ( FIG. 15A , lanes 6 and 7).
  • Tween® 20 To examine whether Tween® 20 could convert preparations containing predominantly aggregate as the major oligomeric species to resulting trimers, a KNH1144 SOSIP R6 preparation containing >70% HMW aggregate was incubated with Tween® 20 and analyzed by BN-PAGE. As shown in FIG. 15D , Tween® 20 was effective in converting the aggregate rich fraction to trimer ( FIG. 19D , left panel). Fractions of less purity containing HMW aggregate, dimers and monomers ( FIG. 15D , right panel, ⁇ lane, each species denoted by arrows), when treated with Tween® 20 also resulted in collapse of HMW aggregate to resulting trimer ( FIG. 15D , right panel, +lane).
  • Tween® 20 efficiently converts the KNH1144 SOSIP HMW aggregate into trimeric form.
  • Tween® 20 efficiently converted into trimers HMW preparations having greater than 10%, (e.g., greater than 10-40%), aggregate. Greater than 90-99%, or 100%, trimers were able to be recovered from non-ionic detergent-, e.g., Tween® 20, treated HMW aggregates.
  • Size exclusion chromatography (SEC) analysis was performed as a second means to characterize the molecular sizes of KNH1144 gp120 monomer and SOSIP R6 gp140 trimer proteins.
  • a Superdex 200 size exclusion column was calibrated with thyroglobulin (669 kDa), ferritin (440 kDa), BSA (67 kDa) and RNAse A (13.7 kDa) as molecular weight standards.
  • monomeric JR-FL gp120 was also analyzed as a control. KNH1144 gp120 and JR-FL gp120 were each found to migrate at an apparent molecular weight of 210 kDa (see FIG. 20 ). These values are consistent with those found for JR-FL gp120 (10).
  • trimer In order to maintain homogenous trimers, treated trimer was resolved in the presence of TN-500 containing 0.05% Tween® 20 (TNT-500). As shown in FIG. 16 , (bottom panel BN-PAGE), the trimer (thick arrow) migrated from fractions B10 through C2, represented in the major peak, with its peak signal at fraction B12 (vertical arrow). The retention time at this fraction corresponds to an apparent calculated molecular weight of ⁇ 518 kDa.
  • the reported apparent molecular weight (MW) of JR-FL SOSIP gp140 trimer calculated via Superdex 200 SEC analysis is ⁇ 520 kDa (9); and thus, the calculated apparent MW value for KNH1144 SOSIP R6 gp140 trimer is consistent with MW values of other SOSIP envelope trimers.
  • Tween® 20 treatment and consequential conversion of HMW aggregate to resulting trimer enhances epitope exposure for Env binding antibodies.
  • Tween® 20 treatment and presence may offer favorable consequences in the context of KNH1144 SOSIP R6 gp140 trimer stability and antibody epitope exposure.
  • DEAE anion exchange chromatography was used to examine the effect of Tween® 20 on the ionic properties of SOSIP R6 gp140 and control proteins. Untreated or Tween® 20 treated KNH1144 SOSIP R6 gp140 trimer spiked with a 2 M contaminating protein (which is unaffected by Tween® 20 and binds to anion exchange resins) were applied over DEAE anion exchange column ( FIG. 18 , Load). The column was washed and eluted and fractions were analyzed via BN-PAGE and Coomassie staining and is shown in FIG. 18 .
  • Electron microscopy was performed on purified SOSIP R6 preparations employing negative stain EM analysis.
  • the results, shown in FIG. 19 reveal that the majority of the observed structures displayed a regular compact morphology with approximate three-fold symmetry. This tri-lobed configuration is most apparent in preparations with deeper stain ( FIG. 19 ; panel of trimers) that are less subject to the flattening that can occur in thinner staining preparations.
  • HIV-1 Env-based protein vaccines In the context of identifying and pursuing a variety of HIV-1 Env-based protein vaccines, described herein is the purification and characterizion of a novel subtype A KNH1144 trimeric envelope spike protein and its properties.
  • Several novel insights were gained as a result of these studies, which revealed the biochemical effects of Tween® 20 on the oligomeric conformations of the KNH1144 SOSIP R6 proteins.
  • HIV-1 JR-FL has been manipulated to a purified form to mimic as closely as possible the native trimeric structure of the HIV-1 viral surface envelope complex via the SOSIP technology (8-11, 15-17).
  • the present invention provides another clade, clade A KNH1144, for which the SOSIP technology results in purified trimeric envelopes that are stable, soluble, and fully cleaved.
  • the purification process implemented according to the present invention for the KNH1144 SOSIP trimers provides a marked improvement over that utilized for JR-FL SOSIP gp140 trimers.
  • the GNA lectin column provided a significant enrichment of gp140 proteins, but elution off the column significantly destabilized the gp140 trimers, resulting in a compromise of trimer fidelity on the column.
  • This destabilization could be brought about from Galanthus Nivalis lectin binding to 1-3 and 1-6 mannose linkages on the gp140 high mannose chains, which are internal linkages and not terminal linkages (20).
  • the affinity of the lectin for the mannan is likely much higher than the intersubunit protein-protein affinities of the 3 gp 120 -gp 41 ECTO monomers contributing to trimer formation, resulting in destabilization and dissociation into component dimers and monomers.
  • a one hour incubation in MMP eluting buffer was included. So while a highly enriching step, the lectin affinity column also decreased the final yield of trimer significantly, due to its dissociation during the elution phase.
  • KNH1144 SOSIP R6 g140 trimer It is relevant to extrapolate from its behavior on anion exchange chromatography that the nature of the KNH1144 SOSIP R6 g140 trimer is that of an acidic protein, which would be contrary to its predicted basic isoelectric point (pI) of 8.73 calculated for the protein backbone.
  • pI basic isoelectric point
  • the likely presence of the predicted acidic sialylated complex oligosaccharide chains on the gp140 (21, 22) would contribute to a decrease in the overall charge of the glycoprotein and thus confer on it properties of an acidic protein.
  • analysis of purified KNH1144 SOSIP R6 gp140 trimers on isoelectric focusing gels reveal it to migrate at a pI range of 5.9 to 6.1, consistent with the above observations.
  • the purified trimer was shown to contain variable amounts of HMW aggregate ( FIG. 14 , right panel, BN-PAGE), which could not be attributed to being formed at any one particular step of the purification, although one possibility might be at the lectin elution step.
  • HMW aggregate FIG. 14 , right panel, BN-PAGE
  • one of the key improvements made in this purification protocol is absence of SDS-insoluble aggregates in the final prep, which are formed by abberantly formed disulfide bonds and are visualized by their slow migration on a non-reduced SDS-PAGE.
  • SDS-insoluble aggregates in the final prep which are formed by abberantly formed disulfide bonds and are visualized by their slow migration on a non-reduced SDS-PAGE.
  • Coomassie staining and confirmed by anti-envelope Western blot little to no SDS-insoluble aggregates were observed ( FIG.
  • Tween® 20 was used to address the co-purifying HMW aggregate present in the final trimer preparations. Tween® 20 was chosen because initial observations had shown that Tween® 20 treatment was mild and did not result in any detectable monomer formation, unlike treatment with the other non-ionic detergents NP-40 and Triton X-100, where dimers and monomers were observed upon treatment (19). Tween® 20 treatment of the final purified KNH1144 SOSIP R6 trimer preparation was highly reproducible and resulted in the “conversion” of the HMW aggregate species, as shown in FIG. 14 (right panel, BN-PAGE).
  • Tween® 20 In order to expand the initial Tween® 20 observations to the stability of HMW aggregates, a variety of experiments were performed to characterize the effect of Tween® 20 and to better understand its mechanism of action. As shown in FIG. 15 , the effect of Tween® 20 is dose dependent, time dependent and temperature independent within the parameters that were examined. Its effect is remarkably specific to KNH1144 SOSIP R6 HMW aggregate and trimers and has no effect on gp120 monomers, or KNH1144 SOSIP R6 dimers. In addition, other similar large, macromolecular, acidic proteins such as a 2 M are not affected by the detergent.
  • the HMW aggregate would have to be comprised of some multiple of trimer (most likely a dimer of trimers), since detergent treatment specifically results in a “rearrangement” to a trimeric configuration.
  • the specificity of this reaction can further be defined by the observation that dimeric KNH1144 SOSIP R6 gp140 proteins are unaffected and do not undergo the collapse ( FIG. 15D ).
  • Tween® 20 treatment would also seem to cause the trimer to assume a more compact configuration, as evident by its slightly more rapid mobility on BN-PAGE ( FIG. 14 ).
  • non-ionic detergents Since the nature of non-ionic detergents is exactly that, i.e., non-ionic, it is difficult to realize how an uncharged molecule such as Tween® 20 would affect the charge status of a large, macromolecular oligomer such as the KNH1144 SOSIP R6 trimer. Furthermore, this effect is highly specific to the trimer, as other such large, highly charged (acidic) oligomeric proteins such as a 2 M and even smaller ones such as BSA are unaffected by the detergent.
  • Tween® 20 was “coating” the trimer in a manner that may cause perturbations in its conformation, resulting in its “compactness”.
  • Tween® 20 and Tween® 80 are polyoxyethylene sorbitan esters of fatty acids and thus may likely interact with the sialic acids, causing a charge “neutralization” effect.
  • the involvement of the sialic acid residues can be investigated by mild sialidase treatment (21, 22) and removal of these residues, followed by Tween® 20 treatment, followed by monitoring of binding on ion exchange resins.
  • the predicted molecular weight for a trimer such as KNH1144 (and JR-FL) would be ⁇ 420 kDa (3 ⁇ 140 kDa monomers).
  • the KNH1144 SOSIP R6 gp140 trimer also exhibits an abberant migration on SEC, presumably due to interactions of its N-linked glycans with the dextran-(agarose polymer) based matrix of Superdex 200, resulting in a higher than expected apparent molecular mass.
  • envelope proteins have been shown to be non-globular in shape (10, 23, 24); therefore, gel filtration may not be optimal for determination of their precise molecular masses.
  • Tween® 20 for KNH1144 SOSIP R6 gp140 proteins would be advantageous, possible Tween® 20 effects on the antigenicity of the HMW aggregate and trimer were examined. Effects on antigenicity was examined by performing lectin ELISAs with the NAbs 2G12, b12, HIVIg, the CD4-IgG2 antibody conjugate PRO 542, as well as the non-neutralizing mAb b6, to gain information on neutralizing/non-neutralizing epitope exposure and accessibility.
  • trimer preparations containing 10-30% HMW aggregate may not undergo significant enough changes that would be detectable in a non-quantitative assay such as IPs, i.e., subtle changes (20-30% changes) may go undetected in such an assay due to sensititivity.
  • samples representing extremes may undergo significantly high changes that should be detectable in an assay format such as ELISA. Therefore, SEC fractions that contained 80% HMW aggregate were used, which would reflect one extreme prior to Tween® 20 treatment and the resulting trimer, which would reflect the other extreme post treatment.
  • a representative reaction of this is illustrated in FIG. 15D .
  • HIVIg which is a low neutralizing polyclonal human antisera directed against gp120 hypervariable loop (40)
  • HIVIg epitope is accessible on the surface of the HMW aggregate, based on its ability to bind the antibody in absence of Tween® 20.
  • HIVIg epitope exposure also significantly increased on the rearranged trimer, upon treatment with Tween® 20.
  • the likely explanation to these increases in epitope exposure is that “disruption/rearrangement” of the aggregate and its subsequent conversion to trimer unshields the above mentioned surfaces and thus, upon conversion, these surfaces are now exposed on their individual trimers and are accessible to the antibodies.
  • KNH1144 SOSIP R6 gp140 proteins were indeed trimeric in nature ( FIG. 19 ).
  • the observation that the KNH1144 SOSIP R6 trimer is compact is associated with anti-Env antibody epitope availability. EM on Tween®-treated trimer which has favorable anti-Env epitope exposure was performed.
  • the present invention expands the panel of trimeric HIV-1 envelope proteins that may be used as protein-based HIV-1 vaccine candidates or serve as a template for future design of Env based protein vaccine candidates, using the SOSIP technology.
  • the description of the KNH1144 SOSIP R6 gp140 trimers of the present invention addresses most of these issues. Furthermore, the description of the Tween® 20 affects on coverting HMW aggregates to trimeric forms further expands on current knowledge of the aggregate species in HIV-1 biology. Of significance, it was shown for the first time, that oligomeric Env protein complexes designed using the SOSIP technology platform are indeed trimeric from EM images and that the trimers are of a similar diameter as native spikes on the HIV-1 virion (36, 37). Expansion of the panel of potential HIV-1 SOSIP protein vaccine candidates by development of a clade A envelope according to this invention now allows for immunological evaluation of the KNH1144 SOSIP R6 gp140 trimer in small animals, for example. Such evaluations will assist in determining the efficacy of KNH1144 SOSIP R6 gp140 trimers as immunogens capable of eliciting broadly neutralizing immune responses directed against HIV-1.
  • the gp41/gp120 trimeric conformation can be stabilized by one or more of the following changes in the gp120 and gp41 sequences:
  • nucleotide and amino acids for gp160 sequences are available, for example, in the database provided by the National Center for Biotechnology Information (NCBI) (see http://www.ncbi.nlm.nih.gov/).
  • gp160 glycoprotein sequence is that of the HIV-1 KNH1144 isolate.
  • a sequence for the KNH1144 gp160 is available at NCBI accession number AAW72237 (gi: 58374202); a nucleotide sequence encoding this gp160 protein is available at accession number AY736812 (gi: 58374201). See website at ncbi.nlm.nih.gov.
  • the amino acid sequence for this KNH1144 gp160 protein is provided below (SEQ ID NO:5).
  • the KNH1144 HIV gp160 protein gives rise to modified gp120 and gp41 polypeptides that have improved gp41/gp120 trimer stability relative gp41/gp120 trimers from other HIV strains.
  • Such stability is due in part to five amino acids differences between the KNH1144 HIV gp160 protein and other HIV gp160 proteins. These five amino acid differences are found at amino acid positions 535, 543, 553, 567 and 588 of the KNH1144 amino acid sequence.
  • the modified, stabilized KNH1144 HIV gp160 protein comprises isoleucine at position 535 (I535), glutamine at position 543 (Q543), serine at position 553 (S553), lysine at position 567 (K567) and arginine at position 588 (R588).
  • I535 isoleucine at position 535
  • Q543 glutamine at position 543
  • S553 serine at position 553
  • K567 lysine at position 567
  • arginine at position 588 R588).
  • These “stabilizing” amino acids are highlighted and underlined in the KNH1144 HIV gp160 sequence shown above.
  • Q543, S553 and K567 have the greatest effect when introduced in combination.
  • I535 and R588 make an additional minor contribution. All five of the amino acid residues may be included in an HIV isolate for the production of stable trimers.
  • Q543, S553 and K567 are included, while I535 and R588 may be optionally included, for stabilization in modified HIV-1 isolates.
  • the introduction of these changes did not impair the exposure of various neutralizing antibody epitopes on the resulting gp140 proteins, suggesting the overall antigenic structure of the trimer is not adversely affected.
  • stabilized gp41/gp120 trimers are formed by modifying an HIV isolate to contain isoleucine at position 535, glutamine at position 543, serine at position 553, and lysine at position 567 and/or arginine at position 588 in any HIV gp160 or gp41 polypeptide.
  • a gp41 protein has improved stability if a proline is used at an amino acid position equivalent to amino acid position 559, for example of the below KNH1144 gp160 polypeptide.
  • the KNH1144 gp160 polypeptide typically has isoleucine instead of proline at position 559.
  • the sequence of the I559P mutant polypeptide of the KNH1144 gp160 protein is provided below (SEQ ID NO:6).
  • a KNH1144 gp41 protein has improved stability if methionine is used at position 535 instead of isoleucine.
  • the sequence of this I535M mutant of the KNH1144 gp160 protein is provided below (SEQ ID NO:7).
  • methionine can be used in any HIV gp160 or gp41 glycoprotein to replace a non-methionine amino acid at an amino acid position equivalent to position 535 of the KNH1144 gp160 protein to stabilize the HIV gp160 or gp41.
  • the I535M mutation can be used in combination with any of the other mutations or amino acid substitutions contemplated herein.
  • the I535M mutation can be combined with the I559P mutation described above (see SEQ ID NO:6) to generate the following mutant KNH1144 gp160 protein (SEQ ID NO:8):
  • gp160 sequence is that of the HIV-1 JR-FL isolate.
  • the JR-FL gp160 amino acid sequence is described as NCBI accession number AAB05604 (gi: 1465781); a nucleotide sequence for this gp160 protein is available at accession number U63632 (gi: 1465777). See website at ncbi.nlm.nih.gov.
  • the amino acid sequence for this JR-FL gp160 protein is provided below (SEQ ID NO:9).
  • the amino acid sequence for this JR-FL gp160 protein can also have a proline instead of an isoleucine at an amino acid position equivalent to the position of isoleucine at amino acid position 559 in the KNH1144 gp160 protein.
  • This mutant JR-FL gp160 protein is provided below (SEQ ID NO:10).
  • the amino acid sequence for this JR-FL gp160 protein can also have isoleucine at a position equivalent to position 535 of the KNH1144 gp160 protein, glutamine at a position equivalent position 543 of the KNH1144 gp160 protein, serine at position 553 of the KNH1144 gp160 protein, lysine at position 567 of the KNH1144 gp160 protein and arginine at position 588 of the KNH1144 gp160 protein, as well as a proline at a position equivalent to the position of the KNH1144 gp160 protein.
  • This mutant JR-FL gp160 protein is provided below (SEQ ID NO:11).
  • HIV-1 Ba-L gp160 amino acid sequence is the HIV-1 Ba-L gp160 amino acid sequence at NCBI accession number AAT67504 (gi: 49617617); a nucleotide sequence for this gp160 protein is available at accession number AY669732 (gi: 49617616). See website at ncbi.nlm.nih.gov.
  • the amino acid sequence for the HIV-1 Ba-L gp160 protein is provided below (SEQ ID NO:12):
  • the amino acid sequence for this Ba-L gp160 protein can also have a proline instead of an isoleucine at an amino acid position equivalent to the amino acid position of the specified isoleucine in the KNH1144 gp160 protein.
  • a modified mutant Ba-L gp160 protein is provided below (SEQ ID NO:13):
  • the amino acid sequence for this Ba-L gp160 protein can have isoleucine at a position equivalent to position 535 of the KNH1144 gp160 protein, glutamine at a position equivalent position 543 of the KNH1144 gp160 protein, serine at position 553 of the KNH1144 gp160 protein, lysine at position 567 of the KNH1144 gp160 protein and arginine at position 588 of the KNH1144 gp160 protein, as well as a proline at a position equivalent to the position of the specified isoleucine in the KNH1144 gp160 protein.
  • Such a modified Ba-L gp160 protein is provided below (SEQ ID NO:14):
  • sequence for gp160 is the amino acid sequence at NCBI accession number AAA76668 (gi: 665491); a nucleotide sequence for this gp160 protein is available at accession number U12032 (gi: 665490). See website at ncbi.nlm.nih.gov. The amino acid sequence for this gp160 protein is provided below (SEQ ID NO:15):
  • the amino acid sequence for this gp160 protein can also be modified to include a proline instead of an isoleucine at an amino acid position equivalent to the amino acid position of the specified isoleucine in the KNH1144 gp160 protein.
  • This mutant gp160 protein is provided below (SEQ ID NO:16):
  • the amino acid sequence for this gp160 protein can also have isoleucine at a position equivalent to position 535 of the KNH1144 gp160 protein, glutamine at a position equivalent position 543 of the KNH1144 gp160 protein, serine at position 553 of the KNH1144 gp160 protein, lysine at position 567 of the KNH1144 gp160 protein and arginine at position 588 of the KNH1144 gp160 protein, as well as a proline at a position equivalent to the position of the specified isoleucine in the KNH1144 gp160 protein.
  • Such a modified gp160 protein is provided below (SEQ ID NO:17):
  • HIV gp160 protein Another example of an amino acid sequence for a HIV gp160 protein is available in the NCBI database at accession number AAA76666 (gi: 665487); the nucleotide sequence for this HIV gp160 protein can be found at accession number U12030 (gi: 665486). See website at ncbi.nlm.nih.gov. Many more sequences for HIV gp160 are available, for example, at the ncbi.nlm.nih.gov website.
  • the gp120 protein derived from the gp160 precursor directs target-cell recognition and viral tropism through interaction with the cell-surface receptor CD4 and one of several co-receptors that are members of the chemokine receptor family.
  • the membrane-spanning gp41 subunit then promotes fusion of the viral and cellular membranes, a process that results in the release of viral contents into the host cell.
  • gp120/gp41 complexes to cellular receptors (e.g., CD4 and a chemokine receptor such as CCR5 or CXCR4) triggers a series of structural rearrangements in the envelope glycoprotein.
  • a transient species arises, termed the prehairpin intermediate, in which gp41 exists as a membrane protein simultaneously in both the viral and cellular membranes.
  • This extended gp41 prehairpin intermediate ultimately collapses into a trimer-of-hairpins structure that provides sufficient tension to drive membrane fusion.
  • the core of the HIV-1 trimer-of-hairpins is a bundle of six ⁇ -helices from three gp41 ectodomains.
  • Three ⁇ -helices derived from the N-terminal HR1 regions form a central, trimeric coiled coil, around which three a-helices derived from the C-terminal HR2 regions pack in an anti-parallel manner into hydrophobic grooves on the surface of the coiled coil.
  • formation of the timer-of-hairpins structure is believed to bring the membranes into close apposition necessary for the fusion event.
  • the gp120 and gp41 envelope glycoproteins can, of course, have a variety of sequences, depending upon the strain, clade, or type of HIV.
  • the KNH1144 gp41 protein can have the following sequence (SEQ ID NO:18):
  • a modified KNH1144 gp41 protein can include a proline rather than an isoleucine at position 559, as indicated in the following sequence (SEQ ID NO:19):
  • a KNH1144 gp41 protein has improved stability if an isoleucine is used at position 535 instead of a methionine residue.
  • the amino acid sequence of this M535I mutant of the KNH1144 gp41 protein is provided below (SEQ ID NO:20).
  • the M535I mutation can be included in combination with any of the other mutations or amino acid substitutions contemplated herein.
  • the M535I mutation can be combined with the I559P mutation described above (see SEQ ID NO:19) to generate the following modified or mutant KNH1144 gp41 protein (SEQ ID NO:21):
  • gp41 amino acid is that of the HIV-1 JR-FL isolate.
  • the amino acid sequence for the HIV-1 JR-FL gp41 protein is provided below (SEQ ID NO:22):
  • the amino acid sequence for the JR-FL gp41 protein may also include a proline instead of an isoleucine at an amino acid position equivalent to amino acid position 559 of the KNH1144 gp41 protein.
  • This modified or mutant JR-FL gp41 protein is provided below (SEQ ID NO:23):
  • the amino acid sequence for the modified HIV-1 JR-FL gp41 protein may also include isoleucine at an amino acid position equivalent to amino acid position 535 of the KNH1144 gp160 protein, glutamine at an amino acid position equivalent amino acid position 543 of the KNH1144 gp160 protein, serine at an amino acid position equivalent to amino acid position 553 of the KNH1144 gp160 protein, lysine at an amino acid position equivalent to amino acid position 567 of the KNH1144 gp160 protein and arginine at an amino acid position equivalent to amino acid position 588 of the KNH1144 gp160 protein, as well as proline at an amino acid position equivalent to amino acid position 559 of the KNH1144 gp160 protein.
  • This modified or mutant JR-FL gp41 protein is provided below (SEQ ID NO:24):
  • HIV-1 Ba-L gp41 amino acid sequence Another example of a sequence for gp41 is the HIV-1 Ba-L gp41 amino acid sequence.
  • the amino acid sequence for the HIV-1 Ba-L gp41 protein is provided below (SEQ ID NO:25):
  • the amino acid sequence for a modified Ba-L gp41 protein may include proline instead of an isoleucine at an amino acid position equivalent to the position of the proline amino acid in the KNH1144 gp41 protein.
  • This mutant Ba-L gp41 protein is provided below (SEQ ID NO:26):
  • the amino acid sequence for the modified HIV-1 Ba-L gp41 protein can also include isoleucine at an amino acid position equivalent to amino acid position 535 of the KNH1144 gp160 protein, glutamine at an amino acid position equivalent to amino acid position 543 of the KNH1144 gp160 protein, serine at an amino acid position equivalent to amino acid position 553 of the KNH1144 gp160 protein, lysine at an amino acid position equivalent to amino acid position 567 of the KNH1144 gp160 protein and arginine at an amino acid position equivalent to amino acid position 588 of the KNH1144 gp160 protein, as well as a proline at a position equivalent to the position of the specified isoleucine in the KNH1144 gp160 protein.
  • Such a mutant or modified Ba-L gp41 protein is provided below (SEQ ID NO:27):
  • sequence for the envelope gp41 glycoprotein is the amino acid sequence at accession number S21998 (gi: 94245). See website at ncbi.nlm.nih.gov.
  • the amino acid sequence for this gp41 protein is provided below (SEQ ID NO:28):
  • the gp41 polypeptide of accession number S21998 can also have a proline instead of an isoleucine at a position equivalent to that of the KNH1144 gp41.
  • Such a mutant gp41 protein has the following sequence (SEQ ID NO:29):
  • the amino acid sequence for the gp41 protein having accession number S21998 can also be modified to contain isoleucine at an amino acid position equivalent to amino acid position 535 of the KNH1144 gp160 protein, glutamine at an amino acid position equivalent to amino acid position 543 of the KNH1144 gp160 protein, serine at an amino acid position equivalent to amino acid position 553 of the KNH1144 gp160 protein, lysine at an amino acid position equivalent to amino acid position 567 of the KNH1144 gp160 protein and arginine at an amino acid position equivalent to amino acid position 588 of the KNH1144 gp160 protein, as well as a proline at an amino acid position equivalent to the 559 position of the specified isoleucine in the KNH1144 gp160 protein.
  • gp41 protein is provided below (SEQ ID NO:30):
  • HIV gp41 polypeptides are available, for example, at the ncbi.nlm.nih.gov website.
  • At least one intermolecular disulfide bond can also be placed between the gp41 and gp120 proteins of the HIV-1 strains.
  • the one or more disulfide bonds are generated by placement of cysteine residues at selected locations in the gp41 and gp120 proteins.
  • one cysteine can be placed at any of positions 470 to 505 and another cysteine can be placed at any of positions 570 to 620.
  • cysteine residues can be placed at positions 492 and 596 in the HIV-1 JR-FL gp160 amino acid sequence (NCBI accession number AAB05604; gi: 1465781).
  • the amino acid sequence for this A492C and T596C double mutant JR-FL gp160 protein is provided below (SEQ ID NO:31):
  • a gp120 glycoprotein with a cysteine instead of an alanine at position 492 has the following sequence (SEQ ID NO:32):
  • a gp41 glycoprotein with a cysteine instead of an threonine at position 596 has the following sequence (SEQ ID NO:33):
  • cysteine residues can be placed in gp160, gp120 and/or gp41 polypeptides of other HIV-1 isolates at amino acid positions equivalent to the alanine 492 and threonine 596 amino acid positions of the JR-FL glycoprotein.
  • amino acid sequence for the KNH1144 gp160 protein can be modified to contain cysteines at positions equivalent to the alanine 492 and threonine 596 positions of the JR-FL glycoprotein as provided below (SEQ ID NO:34):
  • a gp120 glycoprotein containing a cysteine at the amino acid position equivalent to amino acid position 492 of the HIV-1 JR-FL strain has the following sequence (SEQ ID NO:35):
  • a KNH1144 gp41 glycoprotein modified to contain a cysteine at the amino acid position equivalent to amino acid position 596 in the HIV-1 JR-FL isolate has the following sequence (SEQ ID NO:36):
  • amino acid sequence for the Ba-L gp160 protein can be modified to contain cysteines at amino acid positions equivalent to amino acid position 492 (alanine) and amino acid position 596 (threonine) of the JR-FL glycoprotein as provided below (SEQ ID NO:37):
  • a gp120 glycoprotein modified to contain a cysteine at an amino acid position equivalent to amino acid position 492 of HIV-1 JR-FL has the following sequence (SEQ ID NO:38):
  • a Ba-L gp41 glycoprotein modified to contain a cysteine at an amino acid position equivalent to amino acid position 596 of HIV-1 JR-FL has the following sequence (SEQ ID NO:39):
  • any oterh HIV gp120 and gp41 glycoproteins can be modified to contain cysteines residues at amino acid positions equivalent to the amino acid positions of the HIV-1 JR-FL isolate, e.g., at amino acid positions equivalent to amino acid positions 492 and 596 in JR-FL.
  • any of the other “stabilizing” mutations described herein can be combined with the substitution of cysteine at amino acid positions equivalent to the amino acids at positions 492 and 596 in JR-FL.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • AIDS & HIV (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
US12/312,016 2006-10-23 2007-10-17 Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain Expired - Fee Related US7939083B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/312,016 US7939083B2 (en) 2006-10-23 2007-10-17 Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US85403406P 2006-10-23 2006-10-23
US85523606P 2006-10-30 2006-10-30
PCT/US2007/022227 WO2008063331A2 (fr) 2006-10-23 2007-10-17 Polypeptides d'enveloppe gp140 modifiés en provenance d'isolats du vih-1, compositions, complexes trimériques et utilisations de ceux-ci
US12/312,016 US7939083B2 (en) 2006-10-23 2007-10-17 Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain

Publications (2)

Publication Number Publication Date
US20100041875A1 US20100041875A1 (en) 2010-02-18
US7939083B2 true US7939083B2 (en) 2011-05-10

Family

ID=39430255

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/312,016 Expired - Fee Related US7939083B2 (en) 2006-10-23 2007-10-17 Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain
US13/100,941 Abandoned US20110250220A1 (en) 2006-10-23 2011-05-04 Modified gp140 envelope polypeptides of hiv-1 isolates, compositions, stabilized trimeric complexes, and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/100,941 Abandoned US20110250220A1 (en) 2006-10-23 2011-05-04 Modified gp140 envelope polypeptides of hiv-1 isolates, compositions, stabilized trimeric complexes, and uses thereof

Country Status (4)

Country Link
US (2) US7939083B2 (fr)
EP (1) EP2073840A4 (fr)
CA (1) CA2667358A1 (fr)
WO (1) WO2008063331A2 (fr)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130039927A1 (en) * 2010-02-12 2013-02-14 University Of Rochester Antigenic mimics of discontinuous epitopes of pathogen recognized by broadly neutralizing antibodies
WO2013177444A3 (fr) * 2012-05-23 2014-04-10 The Board Of Trustees Of The Leland Stanford Junior University Constructions de vaccins contre la grippe
WO2015051270A1 (fr) * 2013-10-04 2015-04-09 Beth Israel Deaconess Medical Center, Inc. Vaccins de trimères d'enveloppe (env) de clade c du virus de l'immunodéficience humaine (vih) stabilisés et procédés d'utilisation de ceux-ci
EP2873423A2 (fr) 2013-10-07 2015-05-20 International Aids Vaccine Initiative Trimères de glycoprotéines d'enveloppe du vih -1 soluble
US20150183836A1 (en) * 2012-08-03 2015-07-02 Dana-Farber Cancer Institute, Inc. Compositions and Methods for Conformationally Stabilizing Primate Immunodeficiency Virus Envelope Glycoprotein Trimers
EP3069730A2 (fr) 2015-03-20 2016-09-21 International Aids Vaccine Initiative Trimères de glycoprotéines de l'enveloppe du vih-1 soluble
EP3072901A1 (fr) 2015-03-23 2016-09-28 International Aids Vaccine Initiative Trimères de glycoprotéines de l'enveloppe du vih-1 soluble
US9580477B2 (en) * 2015-03-16 2017-02-28 The Catholic University Of America Approach to produce HIV-1 GP140 envelope protein trimers
US9707289B2 (en) 2008-10-10 2017-07-18 Children's Medical Center Corporation Biochemically stabilized HIV-1 ENV trimer vaccine
US20170362280A1 (en) * 2016-06-16 2017-12-21 Janssen Vaccines & Prevention B.V. Hiv vaccine formulation
US9932370B2 (en) 2013-01-07 2018-04-03 Beth Israel Deaconess Medical Center, Inc. Stabilized mosaic human immunodeficiency virus type 1 (HIV-1) GP140 envelope (ENV) trimers
US10137191B2 (en) 2014-09-26 2018-11-27 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against human immunodeficiency virus infection
US10307477B2 (en) 2016-09-02 2019-06-04 Janssen Vaccines & Prevention B.V. Methods for inducing an immune response against human immunodeficiency virus infection in subjects undergoing antiretroviral treatment
US10369214B2 (en) 2015-12-15 2019-08-06 Janssen Vaccines & Prevention B.V. Synthetic human immunodeficiency virus (HIV) envelope antigen, vectors, and compositions thereof
WO2019236736A1 (fr) * 2018-06-05 2019-12-12 International Aids Vaccine Initiative Nanoparticule de ferritine affichant un trimère de vih
US10793607B2 (en) 2016-09-15 2020-10-06 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US10968254B2 (en) 2017-07-19 2021-04-06 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US11230572B2 (en) 2016-10-17 2022-01-25 Beth Israel Deaconess Medical Center, Inc. Signature-based human immunodeficiency virus (HIV) envelope (Env) trimer vaccines and methods of using the same
US11229693B2 (en) 2017-06-15 2022-01-25 Janssen Vaccines & Prevention B.V. Poxvirus vectors encoding HIV antigens, and methods of use thereof
US20230016284A1 (en) * 2016-03-23 2023-01-19 International Aids Vaccine Initiative, Inc. Immunogenic trimers

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011123900A1 (fr) * 2010-04-09 2011-10-13 Immuron Limited Procédés et compositions pour l'inhibition de la transmission du vih
EP2588211A4 (fr) * 2010-06-30 2014-03-05 Torrey Pines Inst Immunogènes trimères d'env
US9060984B2 (en) * 2010-10-30 2015-06-23 George Dacai Liu Recombinant HIV-1 envelope proteins comprising stabilizing two-cysteine mini-domains in gp41
US11318197B2 (en) 2016-03-03 2022-05-03 Duke University Compositions and methods for inducing HIV-1 antibodies
WO2017152146A2 (fr) 2016-03-03 2017-09-08 Duke University Compositions et procédés pour induire des anticorps du vih-1
MX2018013455A (es) * 2016-05-02 2019-02-28 Scripps Research Inst Composiciones y metodos relacionados con inmunogenos de vih-1.
CA3039089A1 (fr) 2016-10-03 2018-04-12 Duke University Procedes d'identification d'immunogenes par ciblage de mutations improbables
EA202092808A1 (ru) 2018-06-13 2021-08-24 Зе Скриппс Рисёрч Инститьют Вакцины на основе наночастиц с новыми структурными компонентами
US20220380414A1 (en) * 2019-09-24 2022-12-01 Centre Hospitalier De L'université De Montréal Compositions and methods based on hiv gp120 mutants

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474914A (en) 1992-07-29 1995-12-12 Chiron Corporation Method of producing secreted CMV glycoprotein H
US5886163A (en) 1993-03-26 1999-03-23 Progenics Pharmaceuticals, Inc. HIV-1 antigens, antibody compositions related thereto, and therapeutic and prophylactic uses thereof
US5935579A (en) 1990-09-25 1999-08-10 Retroscreen Limited AIDS therapy and vaccine
WO2001000648A1 (fr) 1999-06-25 2001-01-04 Progenics Pharmaceuticals, Inc. Proteines d'enveloppe virale stabilisee et utilisations
US6171596B1 (en) 1993-12-10 2001-01-09 The United States Of America As Represented By The Department Of Health And Human Services Oligomeric HIV-1 envelope glycoproteins
WO2003022869A2 (fr) 2001-09-06 2003-03-20 Progenics Pharmaceuticals, Inc. Mutants de glycoproteines d'enveloppe du vih et leurs utilisations
US6602705B1 (en) 1998-12-31 2003-08-05 Chiron Corporation Expression of HIV polypeptides and production of virus-like particles
WO2003087757A2 (fr) 2002-04-05 2003-10-23 Progenics Pharmaceuticals, Inc. Glycoproteines de l'enveloppe du virus d'immunodeficience humaine liees a des particules, compositions et procedes associes
US6710173B1 (en) 1999-06-25 2004-03-23 Progenics Pharmaceuticals, Inc. Stabilized viral envelope proteins and uses thereof
US20040191269A1 (en) 2002-12-03 2004-09-30 Shan Lu Polyvalent, primary HIV-1 glycoprotein DNA vaccines and vaccination methods
WO2004087201A2 (fr) 2003-03-28 2004-10-14 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Mva exprimant des genes modifies enveloppe, gag et pol du vih
US20040259075A1 (en) 2001-10-16 2004-12-23 Dimitrov Dimiter S. Broadly cross-reactive neutralizing antibodies against human immunodeficiency virus selected by env-cd4-co-receptor complexes
US6911205B2 (en) 1999-09-17 2005-06-28 Dana-Farber Cancer Institute, Inc. Stabilized soluble glycoprotein trimers
WO2006002079A2 (fr) 2004-06-15 2006-01-05 Progenics Pharmaceuticals, Inc. Anticorps de neutralisation du vih-1 elicites par un complexe trimerique de glycoproteines d'enveloppe du vih-1
US7105655B2 (en) 1997-10-01 2006-09-12 Dana-Farber Cancer Institute Stabilization of envelope glycoprotein trimers by disulfide bonds introduced into a gp41 glycoprotein ectodomain

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5674698A (en) * 1992-09-14 1997-10-07 Sri International Up-converting reporters for biological and other assays using laser excitation techniques
FR2781676B1 (fr) * 1998-07-31 2004-04-02 Pasteur Merieux Serums Vacc Trimere du produit d'expression du gene env de hiv

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5935579A (en) 1990-09-25 1999-08-10 Retroscreen Limited AIDS therapy and vaccine
US5474914A (en) 1992-07-29 1995-12-12 Chiron Corporation Method of producing secreted CMV glycoprotein H
US5886163A (en) 1993-03-26 1999-03-23 Progenics Pharmaceuticals, Inc. HIV-1 antigens, antibody compositions related thereto, and therapeutic and prophylactic uses thereof
US6171596B1 (en) 1993-12-10 2001-01-09 The United States Of America As Represented By The Department Of Health And Human Services Oligomeric HIV-1 envelope glycoproteins
US7105655B2 (en) 1997-10-01 2006-09-12 Dana-Farber Cancer Institute Stabilization of envelope glycoprotein trimers by disulfide bonds introduced into a gp41 glycoprotein ectodomain
US6602705B1 (en) 1998-12-31 2003-08-05 Chiron Corporation Expression of HIV polypeptides and production of virus-like particles
US6710173B1 (en) 1999-06-25 2004-03-23 Progenics Pharmaceuticals, Inc. Stabilized viral envelope proteins and uses thereof
WO2001000648A1 (fr) 1999-06-25 2001-01-04 Progenics Pharmaceuticals, Inc. Proteines d'enveloppe virale stabilisee et utilisations
US20040224308A1 (en) 1999-06-25 2004-11-11 Progenics Pharmaceuticals, Inc. Stabilized viral envelope proteins and uses thereof
US7479553B2 (en) 1999-06-25 2009-01-20 Progenics Pharmaceuticals, Inc. Nucleic acids encoding mutant disulfide bond-stabilized human immunodeficiency virus type 1 (HIV-1) gp140 envelope glycoproteins
US7022324B2 (en) 1999-06-25 2006-04-04 Progenics Pharmaceuticals, Inc. Stabilized viral envelope proteins and uses thereof
US20060094049A1 (en) 1999-06-25 2006-05-04 Progenics Pharmaceuticals, Inc. Stabilized viral envelope proteins and uses thereof
US6911205B2 (en) 1999-09-17 2005-06-28 Dana-Farber Cancer Institute, Inc. Stabilized soluble glycoprotein trimers
WO2003022869A2 (fr) 2001-09-06 2003-03-20 Progenics Pharmaceuticals, Inc. Mutants de glycoproteines d'enveloppe du vih et leurs utilisations
US20050089526A1 (en) 2001-09-06 2005-04-28 Moore John P. Human immunodeficiency virus envelope clycoprotein mutants and uses thereof
US20040259075A1 (en) 2001-10-16 2004-12-23 Dimitrov Dimiter S. Broadly cross-reactive neutralizing antibodies against human immunodeficiency virus selected by env-cd4-co-receptor complexes
WO2003087757A2 (fr) 2002-04-05 2003-10-23 Progenics Pharmaceuticals, Inc. Glycoproteines de l'enveloppe du virus d'immunodeficience humaine liees a des particules, compositions et procedes associes
US20060051373A1 (en) 2002-04-05 2006-03-09 Olson William C Particle-bound human immunodeficiency virus envelope glycoproteins and related compositions and methods
US20040191269A1 (en) 2002-12-03 2004-09-30 Shan Lu Polyvalent, primary HIV-1 glycoprotein DNA vaccines and vaccination methods
WO2004087201A2 (fr) 2003-03-28 2004-10-14 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Mva exprimant des genes modifies enveloppe, gag et pol du vih
WO2006002079A2 (fr) 2004-06-15 2006-01-05 Progenics Pharmaceuticals, Inc. Anticorps de neutralisation du vih-1 elicites par un complexe trimerique de glycoproteines d'enveloppe du vih-1

Non-Patent Citations (125)

* Cited by examiner, † Cited by third party
Title
Apr. 15, 2004 International Search Report for International PCT Application No. PCT/US02/28331, filed Sep. 6, 2002.
Apr. 24, 2006 Non-Final Office Action issued in connection with U.S. Appl. No. 10/510,268.
Atwell, et al. (1997) "Stable Heterodimers From Remodeling the Domain Interface of a Homodimer Using a Phage Display Library" J. Mol. Biol. 270:26-35.
Aug. 22, 2006 Supplementary European Search Report for Application No. EP/02770472.
Aug. 31, 2006 Supplementary European Search Report for Application No. EP/02770473.
Barnett, S.W. et al., (2001). "The Ability of an Oligomeric Human Immunodeficiency Virus Type 1 (HIV-1) Envelope Antigen to Elicit Neutralizing Antibodies against Primary HIV-1 Isolates Is Improved following Partial Deletion of the Second Hypervariable Region," J. of Virology, 75(12):5526-5540.
Barouch, D.H. et al. (2000) "DNA Vaccination for HIV-1 and SIV" Intervirol. 4:282-287.
Barouch, D.H. et al. (2000) "DNA Vaccination for HIV-1 and SIV" Intervirol. 4:282-287.
Barouch, D.H. et al. (2002) "Eventual AIDS Vaccine Failure in the Rhesus Monkey by Viral Escape From Cytotoxic T Lymphocytes" Nature 415:335-339.
Beddows et al., "Construction and Characterization of Soluble, Cleaved and Stabilized Trimeric Env Proteins Based on HIV Type 1 Env Subtype A," Aids Research and Human Retroviruses, vol. 22, No. 6, Jun. 1, 2006, pp. 575-577.
Beddows et al., "Evaluating the Immunogenicity of a Disulfide-Stabilized, Cleaved, Trimeric Form of the Envelope Glycoprotein Complex of Human Immunodeficiency Virus Type 1," Journal of Virology, vol. 79, No. 14, Jul. 2005, pp. 8812-8827.
Beddows, S., et al., 2006, Construction and characterization of soluble, cleaved, and stabilized trimeric Env proteins based on HIV type 1 Env subtype A, AIDS Res. Human Retrovir. 22(6):569-79. *
Binley et al, "A Recombinant Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Complex Stabilized by an Intermolecular Disulfide Bond Between the GP120 and GP41 Subunits is an Antigenic Mimic of the Trimeric Virion-Associated Structure," Journal of Virology, vol. 74, No. 2, Jan. 1, 2000, pp. 627-643.
Binley, J.M. et al. (2000) "A Recombinant Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Complex Stabilized by an Intermolecular Disulfide Bond Between the gp120 and gp41 Subunits Is an Antigenic Mimic of the Trimeric Viron-Associated Structure" J. Virol. 627-643.
Binley, J.M. et al. (2002) "Enhancing the Proteolytic Maturation of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins." J. of Virology, 76 (6): 2606-2616.
Binley, J.M. et al. (2004). "Comprehensive Cross-Clade Neutralization Analysis of a Panel of Anti-Human Immunodeficiency Virus Type 1 Monoclonal Antibodies," J. of Virology, 78(23):13232-13252.
Binley, J.M. et al., (2003). "Redox-Triggered Infection by Disfulfide-Shackled Human Immunodeficiency Virus Type 1 Pseudovirions," J. of Virology, 77(10):5678-5684.
Brown et al., "Biological and Genetic Characterization of a Panel of Sixty Human Immunodeficiency Virus Type 1 (Hiv-1) Isolates, Representing Clades A, B, C, D, CRF01—AE and CRF02—AG, for the Development and Assessment of Candidate Vaccines," Sep. 27, 2005 (Abstract Only).
Buckner, C. et al., (2003). "Priming B cell-mediated anti-HIV envelope responses by vaccination allows for the long-term control of infection in macaques exposed to a R5-tropic SHIV," Virology, 320:167-180.
Burton, D.R. et al. (1994) "Efficient Neutralization of Primary Isolates of HIV-1 by a Recombinant Human Monoclonal Antibody" Science 266:1024-1027.
Burton, D.R. et al. (1998) Why Do We Not Have an HIV Vaccine and How Can We Make One? Nature Med. Vaccine Suppl. 4(5):495-498.
Cameron et al. (2000) "Polyarginines Are Potent Furin Inhibitors" 275:47, pp. 36741-36749.
Cameron et al. (2000) "Polyarginines Are Potent Furin Inhibitors" 275:47, pp. 36741-36749.
Cao, et al. (1997) "Replication and Neutralization of Human Immunodeficiency Virus Type 1 Lacking the V1 and V2 Variable Loops of the gp120 Envelope Glycoprotein" J. Virol. 71:9808-9812.
Cao, J. et al. (1993) "Effects of Amino Acid Changes in the Extracellular Domain of the Human Immunodeficiency Virus Type 1 Gp41 Envelope Glycoprotein" J. Virol. 67(5):2747-2755.
Charpentier, C., et al., 2006, Extensive recombination among human immunodeficiency virus type 1 quasispecies makes an important contribution to viral diversity in individual patients, J. Virol. 80(5):2472-2482. *
Chen, S. (1993) "Mutational Analysis of the Leucine Zipper-Like Motif of the Human Immunodeficiency Virus Type 1 Envelope Transmembrane Glycoprotein." J. of Virology 67 (6):3615-3619.
Creson, J. (1999) "The Mode and Duration of Anti-CD28 Costimulation Determine Resistance to Infection by Macrophage-Tropic Strains of Human Immunodeficiency Virus Type 1 In Vitro." J. of Virology 73(11):9337-9347.
Currier et al., "CTL Epitope Distribution Patterns in the Gag and Nef Proteins of HIV-1 from Subtype A Infected Subjects in Kenya: Use of Multiple Peptide Sets Increases the Detectable Breadth of the CTL Response," BMC Immunology, vol. 7, No. 1, Apr. 18, 2006, p. 8.
Dec. 1, 2008 Final Office Action issued in connection with U.S. Appl. No. 11/261,390.
Dec. 27, 2006 International Search Report for App. No. PCT/US05/21091, filed Jun. 15, 2005.
Dey et al., "N-Terminal Substitutions in HIV-1 GP41 Reduce the Expression of Non-Trimeric Envelope Glycoproteins on the Virus," Virology, vol. 371, Nov. 26, 2007, pp. 187-200.
Dey et al., "Specific Amino Acids in the N-Terminus of the GP41 Ectodomain Contribute to the Stabilization of a Soluble, Cleaved GP140 Envelope Glycoprotein from Human Immunodeficiency Virus Type 1," Virology, Academic Press, vol. 360, No. 1, Feb. 28, 2007, pp. 199-208.
Ditzel H J et al. (1997) "Mapping the Protein Surface of Human Immunodeficiency Virus Type 1 gp 120 Using Human Monoclonal Antibodies From Phage Display Libraries" J. of Molecular Biology, 267 (3):684-695.
Dong et al., "N- and C-Domains of HIV-1 GP41: Mutation, Structure and Functions," Immunology Letters, vol. 75, Feb. 1, 2001, pp. 215-220.
Dowling et al., "Forty-One Near Full-Length HIV-1 Sequences from Kenya Reveal an Epidemic of Subtype A and A-Containing Recombinants," vol. 16, No. 13, Sep. 6, 2002, pp. 1809-1820.
Dowling, W. E., et al., 2002, Forty-one near full-length HIV-1 sequences from Kenya reveal an epidemic of subtype A and A-containing recombinants, AIDS 16:1809-1820. *
Edinger, et al. (1999) "Functional Dissection of CCR5 Coreceptor Function Through the Use of CD4-Independent Simian Immunodeficiency Virus Strains" J. Virol. 73:4062-4073.
European Search Report and European Search Opinion issued Jul. 23, 2010 in connection with related European Patent Application No. 07809721.9.
European Search Report and European Search Opinion issued Sep. 28, 2010 in connection with related European Patent Application No. 07870794.0.
Farzan, M. et al. (1998) "Stabilization of Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Trimers by Disulfide Bonds Introduced Into the gp 41 Glycoprotein Ectodomain" J. Virol. 72:7620-7625.
Feb. 1, 2007 International Preliminary Report for PCT/US2005/021091, filed Jun. 15, 2005.
Final Office Action issued Mar. 4, 2010 in connection with U.S. Appl. No. 10/489,040.
Fouts, et al. (1997) "Neutralization of the Human Immunodeficiency Virus Type 1 Primary Isolate JR-FL by Human Monoclonal Antibodies Correlates With Antibody Binding to the Oligomeric Form of the Envelope Glycoprotein Complex" J. Virol. 71:2779-2785.
Fouts, et al. (1998) "Interactions of Polyclonal and Monoclonal Anti-Glycoprotein 120 Antibodies With Oligomeric Glycoprotein 120-Glycoprotein 41 Complexes of a Primary HIV Type 1 Isolate: Relationship to Neutralization" AIDS Res Human Retrovir. 14:591-597.
Gallaher, et al. (1995) "A General Model for the Surface Glycoproteins of HIV and Other Retroviruses" AIDS Res. Human Retrovir. 11:191-202.
Gerhardt, M., et al., 2005, In-depth, longitudinal analysis of viral quasispecies from an individual triply infected with late-stage human immunodeficiency virus type 1, using a multiple PCR primer approach, J. Virol. 79(13):8249-8261. *
Haynes, B.F. (1996) "HIV Vaccines: Where Are We and We Are We Going?" Lancet 348:933-937.
Haynes, B.F. (1996) "Update on the Issues of HIV Vaccine Development" Ann. Med. 28:39-41.
Helseth, E. et al. (1991) "Human Immunodeficiency Virus Type 1 gp120 Envelope Glycoprotein Regions Important for Association With the gp41 Transmembrane Glycoprotein" J. Virol. 65(4):2119-2123.
Holland, J. J., et al., 1992, RNA virus populations as quasispecies, Curr. Topics Microbiol. Immunol. 176:1-20. *
International Search Report issued by the International Searching Authority (ISA/US) on Sep. 15, 2008 in connection with International Application No. PCT/US2007/022227.
Ishikawa et al. (1998) "Rapid Formation of the Immune Complexes on Solid Phase in the Immune Complex Transfer Enzyme Immunoassays for HIV-1 P24 Antigen and Antibody IiFfs to HIV-1" J. of Virol. 12:227-237.
Iyer et al. "Purified, Proteolytically Mature HIV Type 1 SOSIP gp140 Envelope Trimers," AIDS Research and Human Retroviruses (2007) 23(6):817-828.
Jan. 23, 2002 International Preliminary Examination Report for Application No. PCT/US00/17267, filed Jun. 23, 2000.
Johnston, M.I. et al. (2001) "Progress in HIV Vaccine Develoment" Curr. Op. Pharmacol. 1(5):504-510.
Johnston, M.I. et al. (2001) "Progress in HIV Vaccine Develoment" Curr. Op. Pharmacol. 1(5):504-510.
Josephson, et al. (1999) "High-Efficiancy Intracellurlar Magnetic Labeling With Novel Superpapamagnetic-Tat Peptide Conjugates" Bioconjugate Chemistry, vol. 10 pp. 186-191.
Joy, A.K. et al. (1999) Can HIV Infection Be Prevented With a Vaccine? Drugs R&D 6:431-440.
Jul. 7, 2008 Final Office Action issued in connection with U.S. Appl. No. 10/489,040.
Jun. 11, 2003 Supplementary European Search Report for App. No. EP00944801.
Jun. 15, 2009 Office Action issued in connection with U.S. Appl. No. 10/489,040.
Labranche, C. et al. (1994) "Biological, Molecular, and Structural Analysis of a Cytopathic Variant From a Molecularly Cloned Simian Immunodeficiency Virus" J. Virol. 68:5509-5522.
Labranche, C. et al. (1994) "ERRATUM Biological, Molecular, and Structural Analysis of a Cytopathic Variant From a Molecularly Cloned Simian Immunodeficiency Virus" J. Virol. 68:7665-7667.
Letvin, N. et al., (1997). "Potent, protective anti-HIV immune generated by bimodal HIV envelope DNA plus protein vaccination," PNAS, 94:9378-9383.
Letvin, N. L. (1998) "Progress in the Development of an HIV-1 Vaccine" Science 280:1875-1880.
Leung, L. et al., (2003). "Immunogenicity of HIV-1 and Gag in baboons using a DNA prime/protein boost regimen," AIDS, 18:991-1001.
Maerz, A.L. eta l. (2001) "Functional Analysis of the Disulfide-Bonded Loop/Chain Reversal Region of Human Immunodeficiency Virus Type 1 gp41 Reveals a Critical Role in gp120-gp41 Association" J. Virol. 75(14):6635-6644.
Mar. 23, 2007 Non-Final Office Action issued in connection with U.S. Appl. No. 10/489,040.
Mar. 5, 2003 Supplementary European Search Report for Application No. EP 00 94 4801.
Mar. 9, 2007 Non-Final Office Action issued in connection with U.S. Appl. No. 10/780,993.
May 12, 2004 International Search Report for International PCT Application No. PCT/US02/28332, filed Sep. 6, 2002.
May 13, 2009 Notice of Allowance and Fees Due, including a Notice of Allowability, issued in connection with U.S. Appl. No. 11/261,390.
May 19, 2006 Non-Final Office Action issued in connection with U.S. Appl. No. 10/489,040.
McInerney, T. et al. (1998) "Mutation-Directed Chemical Cross-Linking of Human Immunodeficiency Virus Type 1 gp41 Oligomers" J. Virol. 72:1523-1533.
Mitchell, et al. (1998) "Inactivation of a Common Epitope Responsible for the Induction of Antibody-Dependent Enhancement of HIV" AIDS 12:147-156.
Moore, et al. (1994) "Probing the Structure of the Human Immunodeficiency Virus Surface Glycoprotein Gp120 With a Panel of Monoclonal Antibodies" J. Virol. 68:469-484.
Moore, et al. (1994b) "Immunological Evidence for Interactions Between the First, Second, and Fifth Conserved Domains to the Gp120 Surface Glycoprotein of Human Immunodeficiency Virus Type 1" J. Virol. 68(11):6836-6847.
Murphy, F.A. (1996) in Fields Virology, 3rd Edition, Fileds, B.N. et al. eds., Lippincott-Raven Publishers, Philadelphia, 40-41.
Nakashe, J. et al., (2001) "Rectal Immunization With Antigen-Containing Microspheres Induces Stronger Th2 Responses Than Oral Immunization: A New Method for Vaccination" Vaccine, Butterworth Scientific Guildford, GB, 20 (3-4):377-384.
Notification Concerning Transmittal of International Preliminary Report on Patentability issued Jan. 8, 2009 including an International Preliminary Report on Patentability dated Dec. 22, 2008 in connection with International Publication No. PCT/US2007/014388.
Notification Concerning Transmittal of International Preliminary Report on Patentability issued Jan. 8, 2009 including an International Preliminary Report on Patentability dated Dec. 22, 2008 in connection with PCT International Publication No. PCT/US2007/014389.
Notification Concerning Transmittal of International Preliminary Report on Patentability issued May 7, 2009 including an International Preliminary Report on Patentability dated Apr. 28, 2009 in connection with PCT International Publication No. PCT/US2007/022227.
Notification of Transmittal of the International Search Report and the Written Opinion of the International Searching Authority, or the Declaration issued Sep. 12, 2008 in connection with PCT International Application No. PCT/US07/14389.
Notification of Transmittal of the International Search Report and the Written Opinion of the International Searching Authority, or the Declaration issued Sep. 12, 2008 in connection with PCT International Application No. PCT/US08/02325.
Notification of Transmittal of the International Search Report and the Written Opinion of the International Searching Authority, or the Declaration, including the International Search Report and the Written Opinion, issued Sep. 15, 2008 in connection with PCT International Application No. PCT/US07/22227.
Nov. 17, 2008 Office Action issued in connection with U.S. Appl. No. 10/489,040.
Oct. 5, 2006 Non-Final Office Action issued in connection with U.S. Appl. No. 10/510,268.
Oct. 5, 2006 Non-Final Office Action issued in connection with U.S. Appl. No. 10/780,993.
Official Action issued Oct. 14, 2008 in connection with Japanese Application No. 2003-5269342 (English translation).
Parker, Carole, et al. (2001) "Fine Definition of the Epitope on the Gp41 Glycoprotein of Human Immunodeficiency Virus Type 1 for the Neutralizing Monoclonal Antibody 2F5" J. of Virol. 75 (22):10906-10911.
Parren, et al. (1997) "HIV-1 Antibody-Debris or Virion?" Nat. Med. 3:366-367.
Parren, et al. (1998) "Neutralization of Human Immunodeficiency Virus Type 1 by Antibody to gp120 Is Determined Primarily by Occupancy of Sites on the Virion Irrespective of Epitope Specificity" J. Virol. 72:3512-3519.
PCT International Preliminary Examination Report issued Jun. 17, 2004 for International Application Publication No. WO 2004/050856.
PCT International Preliminary Examination Report issued Mar. 20, 2003 for International Application Publication No. WO 03/022869 A2.
PCT International Preliminary Examination Report issued Oct. 23, 2003 for International Application Publication No. WO 03/087757 A2.
Reitter, et al. (1998) "A Role for Carbohydrates in Immune Evasion in AIDS" Nat. Med. 4:679-684.
Rickman et al. (1991) "Use of Adjuvant Containing Mycobacterial Cell Wall Skeleton, Monophosphoryl Lipid A, and Aqualene in Malaria Circumporozoite Proein Vaccine" The Lancet, vol. 337, pp. 998-1001.
Sanders et al. (2002) "The Mannose-Dependent Epitope for Neutralizing Antibody 2G12 on Human Immunodeficiency Virus Type 1 Glycoprotein gp120," Journal of Virology, pp. 7293-7305.
Sanders et al., "Evolution of the HIV-1 Envelope Glycoproteins with a Disulfide Bond Between GP120 and GP41," Retrovirology, vol. 1, No. 1, Mar. 9, 2004, p. 3.
Sanders et al., "Stabilization of the Soluble, Cleaved, Trimeric Form of the Envelope Glycoprotein Complex of Human Immunodeficiency Virus Type 1," Journal of Virology, vol. 76, No. 17, Sep. 1, 2002, pp. 8875-8889.
Sanders et al., "Variable-Loop-Deleted Variants of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Can Be Stabilized by an Intermolecular Disulfide Bond Between the GP120 and GP41 Subunits," Journal of Virology, vol. 74, No. 11, Jun. 1, 2000, pp. 5091-5100.
Sanders R. et al., (2002) "Stabilization of the Soluble, Cleaved, Trimeric Form of the Envelope Glycoprotein Complex of Human Immunodeficiency Virus Type 1" Journal of Virology, 76 (17):8875-8889.
Sanders, R. (2000) "Variable-Loop-Deleted Variants of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Can Be Stabilized by an Intermolecular Disulfide Bond Between the Gp120 and Gp41 Subunits." J. of Virol. 74(11):5091-5100.
Sanders, R.W. et al., (2004). "Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41," Retrovirology, 1:3.
Schuelke N. et al., (2004). "Immunogenicity of Disulfide-stabilized HIV-1 envelope trimers," Int. Conf. AIDS, abstract No. ThPpA2084.
Schulke et al. (2002) "Oligomeric and Conformational Properties of a Proteolytically Mature, Disulfide-Stabilized Human Immunodeficiency Virus Type 1 gp140 Envelope Glycoprotein" J. of Virology, 76 (15):7760-7776.
Schülke et al., "Oligomeric and Conformational Properties of a Proteolytically Mature, Disulfide-Stabilized Human Immunodeficiency virus Type 1 GP140 Envelope Glycoprotein," Journal of Virology, vol. 76, No. 15, Aug. 1, 2002, pp. 7760-7776.
Schulz, et al. (1992) "Conserved Structural Features in the Interaction Between Retroviral Surface and Transmembrane Glycoproteins?" AIDS Res. Hum. Retrovirus 8(9):1571-1580.
Sep. 7, 2000 International Search Report for Application No. PCT/US00/17267, filed Jun. 23, 2000.
Sep. 7, 2005 Non-Final Office Action issued in connection with U.S. Appl. No. 10/489,040.
Stamatatos, L. et al. (1994) "Differential Regulation of Cellular Tropism and Sensitivity to Soluble CD4 Neutralization by the Envelope gp120 of Human Immunodeficiency Virus Type 1" J. Virol. 68:4973-4979.
Trkola A. et al. (1996) "Human Monoclonal Antibody 2g12 Defines a Distinctive Neutralization Epitope on the gp120 Glycoprotein of Human Immunodeficiency Virus Type 1" J. Virol.70:1100-1108.
U.S. Appl. No. 09/340,992, filed Jun. 25, 1999, Binley et al.
U.S. Appl. No. 10/117,366, filed Apr. 5, 2002, Binley et al.
U.S. Appl. No. 60/141,168, filed Jun. 25, 1999, Binley et al.
U.S. Appl. No. 60/317,764, filed Sep. 6, 2001, Binley et al.
U.S. Appl. No. 60/317,775, filed Sep. 6, 2001, Moore et al.
U.S. Appl. No. 60/317,909, filed Sep. 6, 2001, Binley et al.
U.S. Appl. No. 60/317,910, filed Sep. 6, 2001, Moore et al.
U.S. Appl. No. 60/370,264, filed Apr. 5, 2000, Moore et al.
U.S. Appl. No. 60/370,410, filed Apr. 5, 2002, Binley et al.
U.S. Appl. No. 60/580,229, filed Mar. 5, 2004, Schülke and Olson.
Written Opinion of the International Searching Authority issued by the International Searching Authority (ISA/US) on Sep. 15, 2008 in connection with International Application No. PCT/US2007/022227.
Yang et al., "Characterization of Stable, Soluble Trimers Containing Complete Ectodomains of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins," Journal of Virology, vol. 74, No. 12, Jun. 1, 2009, pp. 5716-5725.

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10463729B2 (en) 2008-10-10 2019-11-05 Beth Israel Deaconess Medical Center, Inc. Biochemically stabilized HIV-1 env trimer vaccine
US10653770B2 (en) 2008-10-10 2020-05-19 Beth Israel Deaconess Medical Center, Inc. Biochemically stabilized HIV-1 Env trimer vaccine
US9950060B2 (en) 2008-10-10 2018-04-24 Beth Israel Deaconess Medical Center Biochemically stabilized HIV-1 Env trimer vaccine
US11229696B2 (en) 2008-10-10 2022-01-25 Beth Israel Deaconess Medical Center, Inc. Biochemically stabilized HIV-1 Env trimer vaccine
US10307478B2 (en) 2008-10-10 2019-06-04 Beth Israel Deaconess Medical Center, Inc. Biochemically stabilized HIV-1 Env trimer vaccine
US9707289B2 (en) 2008-10-10 2017-07-18 Children's Medical Center Corporation Biochemically stabilized HIV-1 ENV trimer vaccine
US20130039927A1 (en) * 2010-02-12 2013-02-14 University Of Rochester Antigenic mimics of discontinuous epitopes of pathogen recognized by broadly neutralizing antibodies
US8961977B2 (en) * 2010-02-12 2015-02-24 University Of Rochester Antigenic mimics of discontinuous epitopes of pathogen recognized by broadly neutralizing antibodies
US9637522B2 (en) 2012-05-23 2017-05-02 The Board Of Trustees Of The Leland Stanford Junior University Influenza vaccine constructs
WO2013177444A3 (fr) * 2012-05-23 2014-04-10 The Board Of Trustees Of The Leland Stanford Junior University Constructions de vaccins contre la grippe
US20150183836A1 (en) * 2012-08-03 2015-07-02 Dana-Farber Cancer Institute, Inc. Compositions and Methods for Conformationally Stabilizing Primate Immunodeficiency Virus Envelope Glycoprotein Trimers
US11149069B2 (en) * 2012-08-03 2021-10-19 Dana-Farber Cancer Institute, Inc. Compositions and methods for conformationally stabilizing primate immunodeficiency virus envelope glycoprotein trimers
US10160788B2 (en) 2013-01-07 2018-12-25 Beth Israel Deaconess Medical Center, Inc. Stabilized human immunodeficiency virus (HIV) envelope (ENV) trimer vaccines and methods of using same
US11059863B2 (en) 2013-01-07 2021-07-13 Beth Israel Deaconess Medical Center, Inc. Stabilized human immunodeficiency virus (HIV) envelope (ENV) trimer vaccines and methods of using same
US9932370B2 (en) 2013-01-07 2018-04-03 Beth Israel Deaconess Medical Center, Inc. Stabilized mosaic human immunodeficiency virus type 1 (HIV-1) GP140 envelope (ENV) trimers
US10716845B2 (en) 2013-10-04 2020-07-21 Beth Israel Deaconess Medical Center, Inc. Stabilized human immunodeficiency virus (HIV) clade C envelope (Env) trimer vaccines and methods of using same
WO2015051270A1 (fr) * 2013-10-04 2015-04-09 Beth Israel Deaconess Medical Center, Inc. Vaccins de trimères d'enveloppe (env) de clade c du virus de l'immunodéficience humaine (vih) stabilisés et procédés d'utilisation de ceux-ci
EP2873423A2 (fr) 2013-10-07 2015-05-20 International Aids Vaccine Initiative Trimères de glycoprotéines d'enveloppe du vih -1 soluble
US11207400B2 (en) 2014-09-26 2021-12-28 Janssen Vaccines & Prevention B.V. Compositions and methods for inducing protective immunity against human immunodeficiency virus infection
US10137191B2 (en) 2014-09-26 2018-11-27 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against human immunodeficiency virus infection
US10471137B2 (en) 2014-09-26 2019-11-12 Janssen Vaccines & Prevention B.V. Methods for inducing protective immunity against human immunodeficiency virus infection
US10005819B2 (en) 2015-03-16 2018-06-26 The Catholic University Of America Method of purifying authentic trimeric HIV-1 GP140 envelope glycoproteins comprising a long linker and tag
US9975924B2 (en) 2015-03-16 2018-05-22 The Catholic University Of America Approach to produce HIV-1 GP140 envelope protein trimers
US9944679B2 (en) 2015-03-16 2018-04-17 The Catholic University Of America Authentic trimeric HIV-1 envelope glycoproteins comprising a long linker and tag
US9850288B2 (en) 2015-03-16 2017-12-26 The Catholic University Of America Method of purifying authentic trimeric HIV-1 envelope glycoproteins comprising a long linker and tag
US9834583B2 (en) 2015-03-16 2017-12-05 The Catholic University Of America Authentic trimeric HIV-1 GP140 envelope glycoproteins comprising a long linker and tag
US9580477B2 (en) * 2015-03-16 2017-02-28 The Catholic University Of America Approach to produce HIV-1 GP140 envelope protein trimers
US10407470B2 (en) 2015-03-16 2019-09-10 The Catholic University Of America Method of inducing an immune response against human immunodeficiency virus comprising administering immunogenic compositions comprising authentic trimeric HIV-1 envelope glycoproteins containing a long linker and tag
EP3069730A2 (fr) 2015-03-20 2016-09-21 International Aids Vaccine Initiative Trimères de glycoprotéines de l'enveloppe du vih-1 soluble
EP3072901A1 (fr) 2015-03-23 2016-09-28 International Aids Vaccine Initiative Trimères de glycoprotéines de l'enveloppe du vih-1 soluble
US10369214B2 (en) 2015-12-15 2019-08-06 Janssen Vaccines & Prevention B.V. Synthetic human immunodeficiency virus (HIV) envelope antigen, vectors, and compositions thereof
US11896663B2 (en) 2015-12-15 2024-02-13 Janssen Vaccines & Prevention B.V. Immunodeficiency virus type 1 (HIV-1) mutant envelope proteins
US10973907B2 (en) 2015-12-15 2021-04-13 Janssen Vaccines & Prevention B.V. Recombinant adenoviruses encoding mosaic human immunodeficiency virus (HIV) Env, Gag, and Pol antigens
US20230016284A1 (en) * 2016-03-23 2023-01-19 International Aids Vaccine Initiative, Inc. Immunogenic trimers
US20170362280A1 (en) * 2016-06-16 2017-12-21 Janssen Vaccines & Prevention B.V. Hiv vaccine formulation
US11603389B2 (en) 2016-06-16 2023-03-14 Janssen Vaccines & Prevention B.V. HIV vaccine formulation
US10934328B2 (en) 2016-06-16 2021-03-02 Janssen Vaccines & Prevention B.V. HIV vaccine formulation
US10273268B2 (en) * 2016-06-16 2019-04-30 Janssen Vaccines & Prevention B.V. HIV vaccine formulation
CN109219448A (zh) * 2016-06-16 2019-01-15 扬森疫苗与预防公司 Hiv疫苗配制品
US10307477B2 (en) 2016-09-02 2019-06-04 Janssen Vaccines & Prevention B.V. Methods for inducing an immune response against human immunodeficiency virus infection in subjects undergoing antiretroviral treatment
US10525123B2 (en) 2016-09-02 2020-01-07 Janssen Vaccines & Prevention B.V. Methods for inducing an immune response against human immunodeficiency virus infection in subjects undergoing antiretroviral treatment
US11365222B2 (en) 2016-09-15 2022-06-21 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US10793607B2 (en) 2016-09-15 2020-10-06 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US11820796B2 (en) 2016-09-15 2023-11-21 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US11230572B2 (en) 2016-10-17 2022-01-25 Beth Israel Deaconess Medical Center, Inc. Signature-based human immunodeficiency virus (HIV) envelope (Env) trimer vaccines and methods of using the same
US11229693B2 (en) 2017-06-15 2022-01-25 Janssen Vaccines & Prevention B.V. Poxvirus vectors encoding HIV antigens, and methods of use thereof
US11723970B2 (en) 2017-06-15 2023-08-15 Janssen Vaccines & Prevention B. V. Poxvirus vectors encoding HIV antigens, and methods of use thereof
US10968254B2 (en) 2017-07-19 2021-04-06 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
US11732010B2 (en) 2017-07-19 2023-08-22 Janssen Vaccines & Prevention B.V. Trimer stabilizing HIV envelope protein mutations
WO2019236736A1 (fr) * 2018-06-05 2019-12-12 International Aids Vaccine Initiative Nanoparticule de ferritine affichant un trimère de vih

Also Published As

Publication number Publication date
US20100041875A1 (en) 2010-02-18
WO2008063331A9 (fr) 2008-08-07
CA2667358A1 (fr) 2008-05-29
EP2073840A4 (fr) 2010-10-27
US20110250220A1 (en) 2011-10-13
WO2008063331A2 (fr) 2008-05-29
EP2073840A2 (fr) 2009-07-01
WO2008063331A3 (fr) 2008-11-06

Similar Documents

Publication Publication Date Title
US7939083B2 (en) Soluble, stabilized, proteolytically cleaved, trimeric HIV-1 gp140 proteins comprising modifications in the N-terminus of the gp41 ectodomain
Zhang et al. A multiclade env–gag VLP mRNA vaccine elicits tier-2 HIV-1-neutralizing antibodies and reduces the risk of heterologous SHIV infection in macaques
US11939356B2 (en) Self-assembling insect ferritin nanoparticles
Beddows et al. Evaluating the immunogenicity of a disulfide-stabilized, cleaved, trimeric form of the envelope glycoprotein complex of human immunodeficiency virus type 1
Beddows et al. A comparative immunogenicity study in rabbits of disulfide-stabilized, proteolytically cleaved, soluble trimeric human immunodeficiency virus type 1 gp140, trimeric cleavage-defective gp140 and monomeric gp120
US6815201B2 (en) HIV-1 gp120 V1/V2 domain epitopes capable of generating neutralizing antibodies
AP1282A (en) HIV envelope polypeptides and vaccine.
AU2002335709B2 (en) Human Immunodeficiency Virus Envelope Clycoprotein Mutants and Uses Thereof
US20110076298A1 (en) Soluble stabilized trimeric hiv env proteins and uses thereof
Xiang et al. Epitope mapping and characterization of a novel CD4-induced human monoclonal antibody capable of neutralizing primary HIV-1 strains
US20180194809A1 (en) Engineered outer domain (eod) of hiv gp120, mutants and use thereof
US11814413B2 (en) Compositions comprising modified HIV envelopes
Srivastava et al. Role of neutralizing antibodies in protective immunity against HIV
Srivastava et al. Neutralizing antibody responses to HIV: role in protective immunity and challenges for vaccine design
Lin et al. Designing immunogens to elicit broadly neutralizing antibodies to the HIV-1 envelope glycoprotein
US10568969B2 (en) Immunogenic polypeptides
Wu et al. Soluble CD4 broadens neutralization of V3-directed monoclonal antibodies and guinea pig vaccine sera against HIV-1 subtype B and C reference viruses
WO2004053100A2 (fr) Polypeptides gp120 du virus de l'immunodeficience humaine mutants immunogenes, et leurs procedes d'utilisation
WO2019018475A1 (fr) Variants modifiés d'env du vih-1 pour la présentation d'épitopes quaternaires
WO2017139392A1 (fr) Protéines d'enveloppe du vih-1 recombinantes et leur utilisation
EP3104884B1 (fr) Nouvel antigène vaccinal non-vih issu du microbiote vaginal, apte à induire une réponse d'anticorps protecteurs neutralisants muqueux contre l'infection à vih
Biron et al. A Modern Biopharmaceutical to Treat AIDS–Challenges in Designing HIV Env Immunogens for Developing a Vaccine
EP2392351A1 (fr) Inhibiteur de la réplication du vih et son utilisation
Couto Synthetic antibodies targeting HIV-1 infectivity
Devitt et al. Analysis of the exposure of induced HIV glycoprotein epitopes in a potential HIV pseudovirion vaccine

Legal Events

Date Code Title Description
AS Assignment

Owner name: CORNELL RESEARCH FOUNDATION, INC.,NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEY, ANTU K.;MOORE, JOHN P.;REEL/FRAME:020706/0431

Effective date: 20071205

Owner name: PROGENICS PHARMACEUTICALS, INC.,NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLSON, WILLIAM C.;IYER, SAI PRASAD N.;KANG, KENNETH;AND OTHERS;SIGNING DATES FROM 20071029 TO 20080228;REEL/FRAME:020715/0529

Owner name: CORNELL RESEARCH FOUNDATION, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEY, ANTU K.;MOORE, JOHN P.;REEL/FRAME:020706/0431

Effective date: 20071205

Owner name: PROGENICS PHARMACEUTICALS, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLSON, WILLIAM C.;IYER, SAI PRASAD N.;KANG, KENNETH;AND OTHERS;SIGNING DATES FROM 20071029 TO 20080228;REEL/FRAME:020715/0529

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:CORNELL UNIVERSITY;REEL/FRAME:023140/0047

Effective date: 20090819

AS Assignment

Owner name: CORNELL RESEARCH FOUNDATION, INC.,NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEY, ANTU K.;MOORE, JOHN P.;SIGNING DATES FROM 20090527 TO 20090529;REEL/FRAME:023343/0840

Owner name: PROGENICS PHARMACEUTICALS, INC.,NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLSON, WILLIAM C.;IYER, SAI PRASAD N.;KANG, YUN (KENNETH);AND OTHERS;SIGNING DATES FROM 20090529 TO 20090928;REEL/FRAME:023347/0727

Owner name: CORNELL RESEARCH FOUNDATION, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEY, ANTU K.;MOORE, JOHN P.;SIGNING DATES FROM 20090527 TO 20090529;REEL/FRAME:023343/0840

Owner name: PROGENICS PHARMACEUTICALS, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLSON, WILLIAM C.;IYER, SAI PRASAD N.;KANG, YUN (KENNETH);AND OTHERS;SIGNING DATES FROM 20090529 TO 20090928;REEL/FRAME:023347/0727

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20150510

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:CORNELL UNIVERSITY;REEL/FRAME:045044/0508

Effective date: 20180129