US6565848B1 - Cadherin-like asymmetry protein-1, and methods for its use - Google Patents
Cadherin-like asymmetry protein-1, and methods for its use Download PDFInfo
- Publication number
- US6565848B1 US6565848B1 US09/546,934 US54693400A US6565848B1 US 6565848 B1 US6565848 B1 US 6565848B1 US 54693400 A US54693400 A US 54693400A US 6565848 B1 US6565848 B1 US 6565848B1
- Authority
- US
- United States
- Prior art keywords
- leu
- clasp
- ser
- lys
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to molecules involved in cell-cell interactions in the immune system.
- the invention relates to a cell surface protein that contains certain classical cadherin characteristics, but it exhibits an apical distribution pattern on the surface of lymphocytes.
- the membrane location of this molecule correlates with the contact interface between T and B cells, and antibodies against an extracellular domain of this protein disrupt T cell/B cell interactions.
- T H helper T cells
- T H helper T cells
- T H respond to antigen stimulation by producing lymphokines which “help” or activate other effector cell types in the immune system.
- T H activate B cells to secrete antibodies which function as the major effector molecule in humoral immune responses.
- Antibodies neutralize foreign antigens and cooperate with other effector cells in mediating antibody-dependent cellular cytotoxicity.
- T H regulate cellular immune responses by stimulating another T cell subset to develop into antigen-specific cytotoxic effector cells, which directly kill antigen-expressing target cells.
- T H are distinguished from cytotoxic T lymphocytes (CTL) and B cells by their expression of a cell surface glycoprotein marker termed CD4.
- CTL cytotoxic T lymphocytes
- T H 1 type 1 helper T cells
- IL-2 interleukin-2
- ⁇ -IFN ⁇ -interferon
- T H 2 type 2 helper T cells
- T H 1 appear to be involved in promoting the activation and proliferation of other T cell subsets such as CTL
- T H 2 specifically regulate B cell proliferation and differentiation, antibody synthesis, and antibody class switching.
- CTL express the CD8 surface marker. Unlike most T H , these cells display cytolytic activity by direct contact with target cells, although they are also capable of producing certain lymphokines. In vivo, these cells are particularly important in situations where an antibody response alone is inadequate. There is a preponderance of experimental evidence that cellular immune responses play a principal role in the defense against viral infections and cancer.
- TCR T cell receptor
- Cellular polarity reflects specialization of the cell surface membrane into domains that allow cells to assess and respond quickly to their environment (Drubin and Nelson, 1996, Cell 84: 335-44). In the immune system, migrating T lymphocytes exhibit functional polarity (Negulescu et al., 1996, Immunity 4: 421-30). Cells that encounter antigen at their leading edge readily activate, whereas those that encounter antigen at the uropod do so much more poorly.
- TCR density does not seem to be greater at the cell's leading edge prior to antigen activation, other molecule(s) may be responsible for this intrinsic polarity.
- cytoplasmic molecules display polar distribution in lymphocytes before antigen activation.
- spectrin, ankyrin, and the microtubule-organizing center (“MTOC”) demarcate a structural pole in T cells that has been suggested to be important in the directional delivery of signaling molecules after cell-cell coupling (Geiger et al., 1982, J. Cell Biol. 95: 13743; Gregorio et al., 1994, J. Cell Biol. 125: 345-58; Kupfer et al., 1986, J. Exp. Med.
- a novel mammalian cell surface molecule is provided, designated cadherin-like asymmetry protein-1 (Clasp-1).
- Clasp-1 cadherin-like asymmetry protein-1
- polynucleotides comprising coding sequences for Clasp-1, polynucleotides that selectively hybridize to Clasp-1 coding sequences, expression vectors containing such polynucleotides, genetically-engineered host cells containing such polynucleotides, Clasp-1 polypeptides, Clasp-1 fusion proteins, therapeutic compositions, Clasp-1 domain mutants, antibodies specific for Clasp-1, methods for detecting the expression of Clasp-1, and methods of inhibiting an immune response by interfering with Clasp-1 function.
- a wide variety of uses are encompassed by the invention, including but not limited to, treatment of autoimmune diseases and hypersensitivities, prevention of transplantation rejection responses, and augmentation of immune responsiveness in immunodeficiency states.
- Clasp-1 is expressed in lymphoid tissues and the brain, but is undetectable in most major adult organs. In particular, Clasp-1 is expressed in both T and B cells, as well as macrophages.
- the cell surface distribution pattern of Clasp-1 in lymphocytes is apical, and it is localized at the pole associated with the leading edge of the cell. More importantly, Clasp-1 is concentrated at the interface between T cell/B cell clusters, and antibodies directed to its extracellular domain inhibit T cell/B cell interactions.
- FIG. 1 a Clasp-1 amino acid sequence (SEQ ID NO:1).
- the 3.9 kb open reading frame (ORF) is flanked by multiple stop codons in all three reading frames and a polyadenylation signal (AATAAA) located 620 bp downstream of the translation termination codon.
- the sequences corresponding to the original degenerate PCR primers are marked by arrows.
- the propeptide extends from amino acid residues 1-120 ending in the putative cadherin processing signal RAQR (Pigott and Power, 1993 , The Adhesion Molecule Facts Book , Academic Press Limited) (triangle).
- the extracellular domain contains four potential N-glycosylation sites (hexagons) and a cluster of cysteines (double underlines) before the 20 amino acid residue transmembrane domain (shade and double-underline) typical of classical cadherins (Hofman and Stoffel, 1993, Biol. Chem. Hoppe-Seyler 374: 166).
- the cytoplasmic domain contains a CRK-SH3 binding domain (Knudsen et al., 1994, J. Biol. Chem.
- FIG. 1 b Schematic domain structure of Clasp-1.
- Clasp-1 contains a signal peptide (S) terminating in the cadherin proteolytic processing signal at amino acid residue #120.
- the extracellular domain (EC) has four glycosylation sites (hexagons) and a cluster of cysteines (“C's”) typical of cadherins.
- the transmembrane domain (TM) is followed by a cadherin-like domain (CAD) which contains the CRK-SH3 binding domain (pentagon) and tyrosine phosphorylation sites (star), and a coiled/coil domain (“C/C”).
- FIG. 2 Cadherin sequence motifs.
- the cadherin sequence motifs are composed of four stretches of conserved cadherin amino acid sequences (A-D) which re separated by nearly identical numbers of amino acids (in parentheses). Motif A is also the CRK-SH3 binding domain and is similar to the E-cadherin sequence.
- FIG. 3 a Clasp-1 is predominantly expressed in lymphoid tissues and in the brain. Ten ⁇ g of total RNA were loaded and probed with the Clasp-1 cDNA sequence to reveal a 13 kb band, suggesting that the 5′ untranslated region was very long, or that it was a polycistronic message. The initiation methionine is predicted from the Kozak consensus sequence. Lane: 1) thymus, 2) spleen, 3) small intestine, 4) skin, 5) muscle, 6) lymph node, 7) lung, 8) liver, 9) kidney, 10) heart, 11) colon,. 12) bone marrow, 13) brain. Clasp-1 is found in the thymus, spleen, lymph node and the brain.
- FIG. 3 b Clasp-1 is expressed in both T and B lymphocytes. Ten ⁇ g of total RNA were loaded in each lane. Lane: 1) S194 (IgA plasmacytoma), 2) NFS 40 (pre-Bcell), 3) J558L (IgA plasmacytoma), 4) HSIC 5 (pre-B cell), 5) HAFTLJ (pro-granulocytemacrophagecell), 6) Bal 17 (mature B cell), 7) BAC 14 (pre-B cell), 8) 5CC7 (CD4 T cell). Clasp-1 is expressed in most cell lines tested; it is absent in J558 and in low levels in S194, both plasmacytomas.
- FIG. 3 c Clasp-1 protein is about 130 kd molecular weight in both T and B cells.
- Western blots of 2B4 cytoplasm/membrane (lane 1) or nuclei (lane 2) and CH27 cytoplasm/membrane (lane 3) or nuclei (lane 4) were probed with a goat antiserum to the cytoplasmic domain of Clasp-1.
- a 130K Clasp-1 band was seen in both T and B cells in the cytosol/membrane fraction. The same 130 kd band was detected with antisera to the putative extracellular domain of Clasp-1.
- a minor band of 55 kd may represent a degradation product of Clasp-1 or a cross-reactive protein.
- FIGS. 4 a - 4 f Clasp-1 localizes to the MOMA-1 marginal zone and appears to be focally distributed in T and B lymphocytes. Mice were perfusion-fixed. Their spleens were removed, cryoprotected, cryosectioned (7 micron) and probed with rabbit antiserum to Clasp-1-cyto followed by rhodamine-conjugated goat anti-rabbit (red). A second FITC stain (green) was applied to CD3 (FIGS. 4 a , 4 d ), B220 (FIGS. 4 b , 4 e ), or MOMA-1 (FIGS. 4 c , 4 f ). FIGS.
- FIGS. 4 d - 4 f are high power views (63 ⁇ objective).
- Low power views showed that anti-Clasp-1 antiserum stained cells in the peri-arteriolar lymphocyte sheath (PALS).
- the T cell zone, B cell zone, marginal zone, and central arterioles are labeled by T, B, M, and c respectively.
- staining was mostly punctate except for a few scattered cells with dendritic morphology.
- the dominant staining was dendritic and heavily concentrated in the marginal zone (FIG. 4 e , arrow).
- FIG. 4 g Clasp-1 forms an apical cap on the surface of B220 positive spleen B cells.
- Spleen cell suspensions were cytospun onto poly-L-lysine coated glass slides, fixed in periodate-lysine-paraformaldehyde(McLean and Nakane, 1974, J. Histochem. Cytochem. 22: 1077-83), stained with goat anti-Clasp-EC12A (plus biotin conjugated mouse monoclonal anti-goat, followed by PE-conjugated strepavidin) and anti-B220-FITC. While most B cells were Clasp-1 negative, when Clasp-1 was present, it was organized into a membrane surface apical domain.
- FIG. 4 h Clasp-1 forms an apical cap or ring in CD3-positive splenic T cells.
- Spleen cell suspensions were cytospun onto poly-L-lysine coated glass slides, fixed in periodate-lysine-paraformaldehyde, permeabilized in CSK (Greenberg and Edelman, 1983 Cell 33: 767-79), blocked, and stained with rabbit anti-Clasp-cyto (plus rhodamine conjugated anti-rabbit Fab′2) and anti-CD3-FITC.
- Clasp-1 was organized into a cap or a ring.
- FIG. 4 i Clasp-1 forms an apical cap on the surface of D10 T cells.
- D10 T cells were prepared as described under FIG. 3 g above, and stained with goat anti-Clasp-EC12A (plus biotin conjugated mouse monoclonal anti-goat, followed by PE-conjugated strepavidin) and anti-CD3-FITC.
- Clasp-1 formed a membrane apical domain.
- FIGS. 4 j : and 4 k Clasp-1 is located on the same side of the cell as the MTOC.
- D10 and 2B4 T cells were prepared as described under FIG. 4 h above, and stained with rabbit anti-Clasp-cyto (plus rhodamine conjugated anti-rabbit Fab′2), monoclonal rat anti- ⁇ -tubulin (YOL 1/34, plus FITC-conjugated mouse anti-rat Fab′2), and counterstained with DAPI.
- the MTOC green was always located between the Clasp-1 surface and the nucleus.
- FIG. 5 a Clasp-1 in productive and non-productive T-B cell interactions.
- 3A9 and 5b HEL TCR transgenic splenocytes were cultured in the presence of HEL peptide for 10 hours. Cells were cytospun, fixed, permeabilized and stained for Clasp-1 (red) and CD3 (green). The corresponding phase-contrast (PC) picture is adjacent to each set.
- FIG. 5 a Productive T-B cell couples were followed by T cell blast transformation (note the loss of condensed chromatin and nuclear border in the phase contrast picture of the T cells). All pairs show accumulation of Clasp-1 at the cell-cell interface.
- FIG. 5 b In non-productive T-B interaction (T cell was not undergoing blast transformation), Clasp-1 was not facing the cell-cell interface.
- FIG. 6 a Goat anti-Clasp-EC12 blocks T-B cell coupling.
- 2B4 T cell hybridoma with specificity for moth cytochrome c (MCC) in the context of I-E k was mixed with CH27 B cell loaded with MCC peptide.
- Gamma-bind (Pharmacia, NJ) purified goat anti-Clasp-EC12 or preimmune serum was added at 0, 50,150 and 300 ⁇ g/ml. At 150 ⁇ g/ml, goat anti-Clasp-EC12 inhibited cell conjugate formation maximally, while pre-immune serum had minimal effect even up to 450 ⁇ g/ml. More than 100 cell couples were counted per sample.
- FIG. 6 b Goat anti-Clasp-EC12 blocks T cell activation.
- 2B4 T cell hybridoma with specificity for moth cytochrome c (MCC) in the context of I-E k was mixed with CH27 B cell loaded with MCC peptide.
- Gamma-bind (Pharmacia, NJ) purified goat anti-Clasp-EC12 or pre-immune serum was added at 0, 125, 500 and 1,000 ⁇ g/ml.
- IL-2 levels were measured after 48 hours of co-incubation and found to diminish in a dose dependent fashion.
- Pre-immune serum did not inhibit T cell activation as measured by IL-2 stimulation. Samples were performed in triplicate.
- FIG. 7 shows the cytoskeletal associations of CLASP-1.
- Whole cell lysates of 2B4 cell lysates were run on 10% PAGE-SDS gel.
- the activated cells were treated with PMA and ionomycine 75 minutes prior to lysis.
- the insoluble fraction contained cytoskeletal associated proteins.
- Lane A is resting 2B4 cells; lane B activated 2B4 cells; lane C activated cells in the presence of nocodazole; and lane D activated cells in the presence of cytochalasinD.
- FIG. 8 is a graph depicting the production of IL2 by stimulated 2B4 T cells after presentation of MCC antigen by CH27 cells.
- FIG. 9 is a graph depicting the production of IL2 by T cells stimulated with CH27 B cells, where the CH27 cells were transfected with deletion mutants of CLASP-1.
- the amino acid sequence of mouse CLASP-1 is provided as SEQ ID NO:1.
- the nucleotide sequence of the mouse CLASP-1 cDNA is provided in SEQ ID NO:2, which also shows the position of the start and stop of translation, and the encoded polypeptide.
- the nucleotide sequence of human CLASP-1 is provided as SEQ ID NO:3, with the encoded polypeptide, which is also shown in SEQ ID NO:4.
- Nucleic acid molecules that comprise mammalian Clasp-1 coding sequences and polypeptide encoded by the sequences are provided.
- mouse and human Clasp-1 cDNA molecules were isolated, and their nucleotide and deduced amino acid sequences characterized. While Clasp-1 shares sequence homology with cadherin-encoding genes from different species, both the nucleotide coding sequences and the deduced amino acid sequences of Clasp-1 are unique.
- the present invention relates to novel proteins that function in cells of the immune system, e.g. T cells and B cells, as well as non-immune cells.
- the CLASP-1 proteins function in a variety of cellular processes, including interactions between immune system cells. Of particular interest is the role of CLASP-1 in the activation of T cells, and in antigen presentation. CLASP-1 is believed to be involved in the organization, establishment and maintenance of the “immunological synapse” (Dustin et al. (1998) Cell 94:667; Dustin et al. (1996) J. Immunol . 157:2014).
- the CLASP-1 protein is believed to be a component of the lymphocyte organelle called the “immune gateway” that creates a docking site or portal for cell-cell contact during antigen presentation. It is believed that the cytoplasmic domains organize a patch at the leading edge of T cells. When T cells engage with an antigen presenting cell, the CLASP-1 molecules engage to dock the two cells and organize the immune synapse. Data indicates that the CLASP-1 further has a role in signal transduction within T cells, although this may additional role may be not be a necessary component for its role when expressed by an antigen presenting cell.
- CLASP-1 has been found to be associated with the cytoskeleton of T cells, which association is upregulated in response to activation of the T cells, e.g. antigen stimulation, pharmacologic stimulation, etc.
- An aspect of this cytoskeletal association is the binding of CLASP-1 to ankyrin through its C-terminus.
- CLASP-1 contains a number of predicted protein interaction domains in the cytoplasmic tail.
- these include an SH3 domain (residues 847-859); a first SH2 domain (residues 923-935); a second SH2 domain (residues 951-962); a PTB motif and third SH2 domain (residues 1035-1053); and a PTB motif (residues 1255-1269).
- the PTB domain phosphotyrosine-binding
- cytoplasmic docking proteins see Kavanaugh et al. (1995) Science 268(5214):1177-9.
- PTB domains are found primarily as components of docking proteins that recruit additional signaling proteins to the vicinity of an activated receptor.
- any nucleotide sequence that encodes an amino acid sequence of a Clasp-1 gene product can be used to generate recombinant molecules that direct the expression of Clasp-1 polypeptides.
- the invention also provides isolated or purified nucleic acids consisting of at least 8 nucleotides (i.e., a hybridizable portion) of a Clasp-1 sequence or its complement; in other embodiments, the nucleic acids consist of at least 25 (continuous) nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides of a Clasp-1 sequence, or a full-length Clasp-1 coding sequence. In another embodiment, the nucleic acids are smaller than 35, 200 or 500 nucleotides in length. Nucleic acids can be single or double stranded. The invention also relates to nucleic acids that selectively hybridize to or complementary to the foregoing sequences.
- nucleic acids are provided that comprise a sequence complementary to at least 10, 25, 50, 100, or 200 nucleotides or the entire coding region of a Clasp-1 coding sequence. Such nucleotides may encode one or more of the functional domains of CLASP-1. Other nucleic acids of the invention may correspond to intron sequence of CLASP-1, which find use, for example, as probes for genomic copies, in the construction of targeting vectors, and the like.
- CLASP-1 polynucleotides of interest encode deletion mutants, which mutants may provide a dominant negative phenotype when transfected into appropriate cells.
- an internal cytoplasmic deletion of amino acid residues SEQ ID NO:1, 846-997, including the cadherin homology domain; or a C-terminal cytoplasmic deletion of residues SEQ ID NO:1 1011-1289 have a dominant negative phenotype in transfected T cells.
- Such mutations find use in mapping studies, e.g. for protein/protein interactions with CLASP-1; drug screening assays; determination of signaling pathways; and the like. T cells transfected with these dominant negative mutants had a decreased ability to be activated in response to antigenic stimulation.
- deletion mutation constructs did not have a dominant negative effect on antigen presentation, although they did not raise the antigen presenting efficiency to the extent that was found with the full length CLASP-1 coding sequence. Expression of the full-length CLASP-1 causes an increase in the ability of appropriate cells to present antigen.
- a nucleic acid that hybridizes to a Clasp-1 nucleic acid (e.g., having SEQ ID NO:2, or SEQ ID NO:3) or its complement, or to a nucleic acid encoding a Clasp-1 derivative.
- hybridization may be performed under condition of low, moderate or high stringency.
- the hybridization may utilize the region of the provided sequences.
- a nucleic acid may be determined to hybridize under stringent conditions to a probe selected from nucleotides 1 to approximately 3990 of SEQ ID NO:3.
- Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ⁇ g/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 ⁇ 10 6 cpm 32 P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 40° C., and then washed for 1.5 h at 55° C. in a solution containing 2 ⁇ SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60° C.
- Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68° C. and reexposed to film.
- Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).
- procedures using such conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65° C. in buffer composed of 6 ⁇ SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 ⁇ g/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65° C. in prehybridization mixture containing 100 ⁇ g/ml denatured salmon sperm DNA and 5-20 ⁇ 10 6 cpm of 32 P-labeled probe. Washing of filters is done at 37° C.
- Examples of procedures using such conditions of moderate stringency are as follows: Filters containing DNA are pretreated for 6 h at 55° C. in a solution containing 6 ⁇ SSC,. 5 ⁇ Denhart's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution and 5-20 ⁇ 10 6 cpm 32 P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 55° C., and then washed twice for 30 minutes at 60° C. in a solution containing 1 ⁇ SSC and 0.1% SDS. Filters are blotted dry and exposed for autoradiography. Other conditions of moderate stringency which may be used are well-known in the art. Washing of filters is done at 37° C. for 1 h in a solution containing 2 ⁇ SSC, 0.1% SDS.
- labeled DNA probes made from nucleic acid fragments corresponding to any partial cDNA disclosed herein may be used to screen a cDNA library derived from lymphoid cells or brain cells. More specifically, oligonucleotides corresponding to either the 5′ or 3′ terminus of the cDNA sequence may be used to obtain longer nucleotide sequences. Briefly, the library may be plated out to yield a maximum of 30,000 pfu for each 150 mm plate. Approximately 40 plates may be screened. The plates are incubated at 37° C.
- Nylon filters are placed onto the soft top agarose and after 60 seconds, the filters are peeled off and floated on a DNA denaturing solution consisting of 0.4N sodium hydroxide. The filters are then immersed in neutralizing solution consisting of 1 M Tris-HCl, pH 7.5, before being allowed to air dry.
- the filters are prehybridized in hybridization buffer such as casein buffer containing 10% dextran sulfate, 0.5M NaCl, 50 mM Tris-HCl, pH 7.5, 0.1% sodium pyrophosphate, 1% casein, 1% SDS, and denatured salmon sperm DNA at 0.5 mg/ml for 6 hours at 60° C.
- hybridization buffer such as casein buffer containing 10% dextran sulfate, 0.5M NaCl, 50 mM Tris-HCl, pH 7.5, 0.1% sodium pyrophosphate, 1% casein, 1% SDS, and denatured salmon sperm DNA at 0.5 mg/ml for 6 hours at 60° C.
- the radiolabelled probe is then denatured by heating to 95° C. for 2 minutes and then added to the prehybridization solution containing the filters.
- the filters are hybridized at 60° C. for 16 hours.
- the filters are then washed in 1 ⁇ wash mix (10 ⁇ wash mix contains 3M NaCl, 0.6M Tris base, and O.02M EDTA) twice for 5 minutes each at room temperature, then in 1 ⁇ wash mix containing 1% SDS at 60° C. for 30 minutes, and finally in 0.3 ⁇ wash mix containing 0.1% SDS at 60° C. for 30 minutes.
- the filters are then air dried and exposed to x-ray film for autoradiography. After developing, the film is aligned with the filters to select a positive plaque.
- the agar plug containing the plaques will be removed and placed in lambda dilution buffer containing 0.1M NaCl, 0.01M magnesium sulfate, 0.035M Tris HCl, pH 7.5, 0.01% gelatin.
- the phage may then be replated and rescreened to obtain single, well isolated positive plaques.
- Positive plaques may be isolated and the CDNA clones sequenced using primers based on the known cDNA sequence. This step may be repeated until a full length cDNA is obtained.
- RACE Rapid Amplification of cDNA Ends
- RACE Rapid Amplification of cDNA Ends
- 5′-RACE-Ready RNA synthesized from human tissues containing a unique anchor sequence is commercially available (Clontech).
- PCR is carried out on 5′-RACE-Ready cDNA using the provided anchor primer and the 3′ primer.
- a secondary PCR reaction is then carried out using the anchored primer and a nested 3′ primer according to the manufacturer's instructions.
- the full length cDNA sequence may be translated into amino acid sequence and examined for certain landmarks such as a continuous open reading frame flanked by translation initiation and termination sites, a cadherin-like domain, an SH3 binding domain, and finally overall structural similarity to the Clasp-1 gene disclosed herein.
- Clasp-1 polynucleotides encode Clasp-1 polypeptides, mutant polypeptides, peptide fragments of Clasp-1 including the functional domains previously described, Clasp-1 fusion proteins or functional equivalents thereof including fusions to marker sequences such as FLAG, green fluorescent proteins, etc. as known in the art, deletion mutants which may be dominant negative mutations; etc.
- DNA sequences which encode substantially the same or,a functionally equivalent amino acid sequence may be used in the practice of the invention for the expression of the Clasp-1 protein.
- DNA sequences include those which are capable of hybridizing to the mouse Clasp-1 sequence or its complementary sequence under low, moderate or high stringent conditions as described above.
- Altered DNA sequences which may be used in accordance with the invention include deletions, additions or substitutions of different nucleotide residues resulting in a sequence that encodes the same or a functionally equivalent gene product.
- the gene product itself may contain deletions, additions or substitutions of amino acid residues within a Clasp-1 sequence, which result in a silent change thus producing a functionally equivalent Clasp-1 protein.
- conservative amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
- negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine, histidine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include the following: glycine, asparagine, glutamine, serine, threonine, tyrosine; and amino acids with nonpolar head groups include alanine, valine, isoleucine, leucine, phenylalanine, proline, methionine, tryptophan.
- the DNA sequences of the invention may be engineered in order to alter a Clasp-1 coding sequence for a variety of ends, including but not limited to, alterations which modify processing and expression of the gene product.
- mutations may be introduced using techniques which are well known in the art, e.g., site-directed mutagenesis, deletions, to insert new restriction sites, to alter glycosylation patterns, phosphorylation, etc.
- a large number of Clasp-1 mutant polypeptides can be constructed by rearranging the nucleotide sequences that encode the Clasp-1 extracellular, transmembrane and cytoplasmic domains. Such mutations may have a dominant negative phenotype in certain cells.
- a Clasp-1 or a modified Clasp-1 sequence may be ligated to a heterologous sequence to encode a fusion protein.
- a chimeric Clasp-1 protein expressing a heterologous epitope that is recognized by a commercially available antibody, e.g. FLAG; or may encode a detectable label, e.g. green fluorescent protein.
- a fusion protein may also be engineered to contain a cleavage site located between a Clasp-1 sequence and the heterologous protein sequence, so that the Clasp-1 may be cleaved away from the heterologous moiety.
- an endogenous Clasp-1 gene within a cell population may be modified by inserting a heterologous DNA regulatory element into the genome of the cell line such that the inserted regulatory element is operatively linked with the endogenous Clasp-1 gene.
- a heterologous DNA regulatory element for example, an endogenous Clasp-1 gene which is normally “transcriptionally silent”, i.e., an Clasp-1 gene which is normally not expressed, or is expressed only at very low levels in a cell population, may be activated by inserting a regulatory element which is capable of promoting the expression of a normally expressed gene product in the cells.
- a transcriptionally silent, endogenous Clasp-1 gene may be activated by insertion of a promiscuous regulatory element that works across cell types.
- a heterologous regulatory element may be inserted into a cell line population, such that it is operatively linked with an endogenous Clasp-1 gene, using techniques, such as targeted homologous recombination, which are well known to those of skill in the art, (see e.g., in Chappel, U.S. Pat. No. 5,272,071; PCT publication No. WO 91/06667, published May 16, 1991).
- the coding sequence of Clasp-1 could be synthesized in whole or in part, using chemical methods well known in the art.
- chemical methods See, e.g., Caruthers et al., 1980 , Nuc. Acids Res. Symp. Ser . 7:215-233; Crea and Horn, 180 , Nuc. Acids Res . 9(10):2331; Matteucci and Caruthers, 1980 , Tetrahedron Letter 21:719; and Chow and Kempe, 1981 , Nuc. Acids Res . 9(12):2807-2817.)
- the protein itself could be produced using chemical methods to synthesize a Clasp-1 amino acid sequence in whole or in part.
- peptides can be synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography. (See Creighton, 1983 , Proteins Structures And Molecular Pnnciples , W. H. Freeman and Co., N.Y. pp. 50-60). The composition of the synthetic polypeptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, 1983 , Proteins, Structures and Molecular Principles , W. H. Freeman and Co., N.Y., pp. 34-49).
- Clasp-1 gene products as well as host cells or cell lines transfected or transformed with recombinant Clasp-1 expression vectors can be used for a variety of purposes. These include, but are not limited to, generating antibodies (i.e., monoclonal or polyclonal) that competitively inhibit activity of Clasp-1 proteins and neutralize its activity; antibodies that activate Clasp-1 function and antibodies that detect its presence on the cell surface or in solution. Anti-Clasp-1 antibodies may be used in detecting and quantifying expression of Clasp-1 levels in cells and tissues such as lymphocytes and macrophages, as well as isolating Clasp-1-positive cells from a cell mixture.
- an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- Clasp-1 gene products as well as host cells or cell lines transfected or transformed with recombinant Clasp-1 expression vectors can be used for a variety of purposes. These include, but are not limited to,
- a variety of host-expression vector systems may be utilized to express the Clasp-1 coding sequence. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the Clasp-1 coding sequence; yeast transformed with recombinant yeast expression vectors containing the Clasp-1 coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the Clasp-1 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the Clasp-1 coding sequence; or animal cell systems.
- microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA
- any of a number of suitable transcription and translation elements may be used in the expression vector.
- inducible promoters such as pL of bacteriophage ⁇ , plac, ptrp, ptac (ptrp-lac hybrid promoter; cytomegalovirus promoter) and the like may be used;
- promoters such as the baculovirus polyhedron promoter may be used;
- promoters derived from the genome of plant cells e.g., heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll ⁇ / ⁇ binding protein
- plant viruses e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV
- a number of expression vectors may be advantageously selected depending upon the use intended for the expressed Clasp-1 product.
- vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
- Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which the Clasp-1 coding sequence may be ligated into the vector in frame with the lacZ coding region so that a hybrid protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res.
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase.(GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can be purified easily from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.
- yeast a number of vectors containing constitutive or inducible promoters may be used.
- Current Protocols in Molecular Biology Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol.153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. 11, IRL Press, Wash., D.C., Ch.
- the expression of the Clasp-1-coding sequence may be driven by any of a number of promoters.
- viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et al., 1987, EMBO J. 3:17-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J.
- An alternative expression system which could be used to express Clasp-1 is an insect system.
- Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes.
- the virus grows in Spodoptera frugiperda cells.
- the Clasp-1 coding sequence may be cloned into non-essential regions (e.g., the polyhedron gene) of the virus and placed under control of an AcNPV promoter (e.g., the polyhedron promoter).
- the Clasp-1 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
- This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing Clasp-1 in infected hosts. (e.g., See Logan & Shenk, 1984, Proc.
- the vaccinia 7.5K promoter may be used.
- Regulatable expression vectors such as the tetracycline repressible vectors may also be used to express a coding sequence in a controlled fashion.
- Specific initiation signals may also be required for efficient translation of inserted Clasp-1 coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire Clasp-1 gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the Clasp-1 coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the Clasp-1 coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol. 153:516-544).
- a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
- modifications e.g., glycosylation
- processing e.g., cleavage
- protein products may be important for the function of the protein.
- the presence of several consensus N-glycosylation sites in the Clasp-1 extracellulardomain support the possibility that proper modification may be important for Clasp-1 function.
- Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
- eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
- mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38, etc.
- cell lines which stably express Clasp-1 may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with the Clasp-1 DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then switched to a selective medium.
- expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
- This method may advantageously be used to engineer cell lines which express the Clasp-1 protein on the cell surface. Such engineered cell lines are particularly useful in screening for molecules or drugs that affect Clasp-1 function.
- a number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase(Lowy, et al., 1980, Cell 22:817) genes which can be employed in tk ⁇ , hgprt ⁇ or aprt ⁇ cells, respectively.
- antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981), Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G418 (Colberre-Garapin, et al., 1981, J. Mol. Biol.
- trpB which allows cells to utilize indole in place of tryptophan
- hisD which allows cells to utilize histinol in place of histidine
- ODC ornithine decarboxylase
- DFMO McConlogue L., 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.
- glutamine synthetase Bebbington et al., 1992, Biotech 10: 169.
- the host cells which contain the coding sequence and which express a biologically active Clasp-1 gene product or fragments thereof may be identified by at least four general approaches; (a) DNA-DNA or DNA-RNA hybridization; (b) the presence or absence of “marker” gene functions; (c) assessing the level of transcription as measured by the expression of Clasp-1 mRNA transcripts in the host cell; and (d) detection of the gene product as measured by immunoassay or by its biological activity. Prior to the identification of gene expression, the host cells may be first mutagenized in an effort to increase the level of expression of Clasp-1, especially in cell lines that produce low amounts of Clasp-1.
- the presence of the Clasp-1 coding sequence inserted in the expression vector can be detected by DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide sequences that are homologous to the Clasp-1 coding sequence, respectively, or portions or derivatives thereof.
- the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain “marker” gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.).
- certain “marker” gene functions e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.
- certain “marker” gene functions e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.
- a marker gene can be placed in tandem with the Clasp-1 sequence under the control of the same or different promoter used to control the expression of the Clasp-1 coding sequence. Expression of the marker in
- transcriptional activity for the Clasp-1 coding region can be assessed by hybridization assays.
- RNA can be isolated and analyzed by Northern blot using a probe homologous to the Clasp-1 coding sequence or particular. portions thereof.
- total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
- reverse transcription-polymerase chain reactions may be used to detect low levels of gene expression.
- Clasp-1 protein product can be assessed immunologically, for example by Western blots, immunoassays such as radioimmuno-precipitation, enzyme-linked immunoassays and the like. This can be achieved by using an anti-Clasp-1 antibody.
- Clasp-1 protein may be expressed as a fusion protein with green-fluorescent protein to facilitate its detection in cells (U.S. Pat. Nos. 5,491,084; 5,804,387; 5,777,079).
- the Clasp-1 protein and/or cell lines that express Clasp-1 may be used to screen for antibodies, peptides, small molecules, natural and synthetic compounds or other cell bound or soluble molecules that bind to the Clasp-1 protein resulting in stimulation or inhibition of Clasp-1 function.
- anti-Clasp-1 antibodies may be used to inhibit or stimulate Clasp-1 function and to detect its presence.
- screening of peptide libraries with recombinantly expressed soluble Clasp-1 protein or cell lines expressing Clasp-1 protein may be useful for identification of therapeutic molecules that function by inhibiting or stimulating the biological activity of Clasp-1.
- the uses of the Clasp-1 protein and engineered cell lines, described in the subsections below, may be employed equally well for homologous Clasp-1 genes in various species.
- cell lines have been engineered to express the extracellular domain of Clasp-1 fused to another molecule such as GST.
- Clasp-1 or its extracellular domain may be fused to an immunoglobulin constant region (Hollenbaugh and Aruffo, 1992, Current Protocols in Immunology, Unit 10.19; Aruffo et al., 1990,. Cell 61:1303) to produce a soluble molecule with increased half life.
- the soluble protein or fusion protein may be used in binding assays, affinity chromatography, immunoprecipitation, Western blot, and the like. Synthetic compounds, natural products, and other sources of potentially biologically active materials can be screened in assays that are well known in the art.
- Random peptide libraries consisting of all possible combinations of amino acids attached to a solid phase support may be used to identify peptides that are able to bind to a specific domain of Clasp-1 (Lam, K. S. et al., 1991, Nature 354: 82-84).
- the screening of peptide libraries may have therapeutic value in the discovery of pharmaceutical agents that stimulate or inhibit the biological activity of Clasp-1.
- Identification of molecules that are able to bind to the Clasp-1 protein may be accomplished by screening a peptide library with recombinant soluble Clasp-1 protein. Methods for expression and purification of Clasp-1 may be used to express recombinant full length Clasp-1 or fragments of Clasp-1 depending on the functional domains of interest. Such domains include Clasp-1 extracellular domain, transmembrane domain, cytoplasmic domain, SH2 domain, SH3 domain and coiled/coil domain. In a specific embodiment, a portion of the Clasp-1 extracellular domain corresponding to amino acid residues #131-327 is shown to contain a binding site that interacts with itself or other proteins.
- Clasp-1 protein may be conjugated to enzymes such as alkaline phosphatase or horseradish peroxidase or to other reagents such as fluorescent labels which may include fluorescein isothiocyanate (FITC), phycoerythrin (PE) or rhodamine. Conjugation of any given label to Clasp-1 may be performed using techniques that are well known in the art.
- Clasp-1 expression vectors may be engineered to express a chimeric Clasp-1 protein containing an epitope for which a commercially available antibody exist. The epitope-specific antibody may be tagged with a detectable label using methods well known in the art including an enzyme, a fluorescent dye or colored or magnetic beads.
- the “tagged” Clasp-1 conjugate is incubated with the random peptide library for minutes to one hour at 22° C. to allow complex formation between Clasp-1 and peptide species within the library. The library is then washed to remove any unbound protein. If Clasp-1 has been conjugated to alkaline phosphatase or horseradish peroxidase the whole library is poured into a petri dish containing substrates for either alkaline phosphatase or peroxidase, for example, 5-bromo4-chloro-3-indoylphosphate (BCIP) or 3,3′,4,4′′-diaminobenzidine (DAB), respectively.
- BCIP 5-bromo4-chloro-3-indoylphosphate
- DAB 3,3′,4,4′′-diaminobenzidine
- the peptide/solid phase-Clasp-1 complex changes color, and can be easily identified and isolated physically under a dissecting microscope with a micromanipulator. If a fluorescenttagged Clasp-1 molecule has been used, complexes may be isolated by fluorescence activated sorting. If a chimeric Clasp-1 protein expressing a heterologous epitope has been used, detection of the peptide/Clasp-1 complex may be accomplished by using a labeled epitope-specific antibody. Once isolated, the identity of the peptide attached to the solid phase support may be determined by peptide sequencing.
- soluble Clasp-1 molecules in another embodiment, it is possible to detect peptides that bind to cell-associated Clasp-1 using intact cells.
- the use of intact cells is preferred for use with cell surface molecules.
- Methods for generating cell lines expressing Clasp-1 are described above.
- the cells used in this technique may be either live or fixed cells.
- the cells may be incubated with the random peptide library and bind to certain peptides in the library to form a “rosette” between the target cells and the relevant solid phase support/peptide.
- the rosette can thereafter be isolated by differential centrifugation or removed physically under a dissecting microscope. Techniques for screening combinatorial libraries are known in the art (Gallop et al., 1994, J. Med. Chem., 37:1233; Gordon, 1994, J. Med. Chem., 37:1385).
- Clasp-1 molecules can be reconstituted into liposomes where label or “tag” can be attached.
- antibodies to epitopes of the natural and recombinantly produced Clasp-1 protein include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, humanized, a complementarity determining region, Fab fragments, F(ab′) 2 and fragments produced by an Fab expression library as well as anti-idiotypic antibodies.
- Antibodies that compete for Clasp-1 binding are especially preferred for diagnostics and therapeutics.
- a peptide To mount an antibody response, a peptide must contain both a T and B cell epitope.
- a T cell epitope binds an MHC class II molecule and be recognized by an existing T cell receptor (TCR). Additional amino acid sequence is needed for the B cell epitope. Generally a peptide of about 15-20 amino acids satisfies both of these requirements.
- BSA bovine serum albumin
- KLH keyhole limpet hemocyanin
- OVA ovalbumin
- N-terminal (and in the case of soluble proteins, C-terminal) regions of the protein are often more easily accessible to antibody binding.
- hydrophilic residues needed for MHC Class II binding hydrophilic sequences are more likely to be accessible to antibody recognition.
- Monoclonal antibodies that bind Clasp-1 may be radioactively labeled allowing one to follow their location and distribution in the body after injection. Radioisotope tagged antibodies may be used as a non-invasive diagnostic tool for imaging de novo lymphoid tumors and metastases that express Clasp-1.
- Immunotoxins may also be designed which target cytotoxic agents to specific sites in the body.
- high affinity Clasp-1 specific monoclonal antibodies may be covalently complexed to bacterial or plant toxins, such as diphtheria toxin or ricin.
- a general method of preparation of antibody/hybrid molecules may involve use of thiol-crosslinking reagents such as SPDP, which attack the primary amino groups on the antibody and by disulfide exchange, attach the toxin to the antibody.
- SPDP thiol-crosslinking reagents
- the hybrid antibodies may be used to specifically eliminate Clasp-1 expressing lymphocytes.
- various host animals may be immunized by injection with the recombinant or naturally purified Clasp-1 protein, fusion protein or peptides, including but not limited to goats, rabbits, mice, rats, hamsters, etc.
- adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.
- BCG Bacilli Calmette-Guerin
- Corynebacterium parvum bacilli Calmette-Guerin
- Monoclonal antibodies to Clasp-1 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72; Cote et al., 1983, Proc. Natl. Acad. Sci. USA, 80:2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
- Hybridomas may be screened using enzyme-linked immunosorbent assays (ELISA) in order to detect cultures secreting antibodies specific for refolded recombinant Clasp-1.
- Cultures may also be screened by ELISA to identify those cultures secreting antibodies specific for mammalian-produced Clasp-1. Confirmation of antibody specificity may be obtained by western blot using the same antigens. Subsequent ELISA testing may use recombinant Clasp-1 fragments to identify the specific portion of the Clasp-1 molecule with which a monoclonal antibody binds.
- Additional testing may be used to identify monoclonal antibodies with desired functional characteristics such as staining of histological sections, immunoprecipitation of Clasp-1, inhibition of Clasp-1 binding or stimulation of Clasp-1 to transmit an intracellular signal. Determination of the monoclonal antibody isotype may be accomplished by ELISA, thus providing additional information concerning purification or function.
- Antibody fragments which contain specific binding sites of Clasp-1 may be generated by known techniques.
- such fragments include, but are not limited to, the F(ab′) 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab′) 2 fragments.
- Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to Clasp-1.
- Anti-Clasp-1 antibodies may be used to identify, isolate, inhibit or eliminate Clasp-1-expressing cells.
- a Clasp-1 polynucleotide or fragments thereof may be used for diagnostic and/or therapeutic purposes.
- a Clasp-1 polynucleotide may be used to detect the expression of Clasp-1 as a lymphocyte marker.
- a Clasp-1 polynucleotide may be used to detect Clasp-1 gene expression or aberrant Clasp-1 gene expression in disease states. Included in the scope of the invention are oligonucleotide sequences, such as antisense RNA and DNA molecules and ribozymes, that function to inhibit expression of Clasp-1.
- Clasp-1 polynucleotide may be used to construct transgenic and knockout animals for screening of Clasp-1 agonists and antagonists.
- the Clasp-1 gene products can also be expressed in transgenic animals.
- Animals of any species including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, sheep, and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate Clasp-1 transgenic animals.
- transgenic refers to animals expressing Clasp-1 gene sequences from a different species (e.g., mice expressing human Clasp-1 gene sequences), as well as animals that have been genetically engineered to overexpress endogenous (i.e., same species) Clasp-1 sequences or animals that have been genetically engineered to no longer express endogenous Clasp-1 gene sequences (i.e., “knock-out” animals), and their progeny.
- Any technique known in the art may be used to introduce a Clasp-1 transgene into animals to produce the founder lines of transgenic animals.
- Such techniques include, but are not limited to pronuclear microinjection (Hoppe and Wagner, 1989, U.S. Pat. No. 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten, et al., 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting in embryonic stem cells (Thompson, et al., 1989, Cell 56:313-321); electroporation of embryos (Lo, 1983, Mol. Cell. Biol.
- transgenic animal clones containing a Clasp-1 transgene for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal or adult cells induced to quiescence (Campbell, et al., 1996, Nature 380:64-66; Wilmut, et al., Nature 385:810-813).
- the present invention provides for transgenic animals that carry a Clasp-1 transgene in all their cells, as well as animals that carry the transgene in some, but not all their cells, i.e., mosaic animals.
- the transgene may be integrated as a single transgene or in concatamers, e.g., head-to-head tandems or head-to-tail tandems.
- the transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko, et al., 1992, Proc. Natl. Acad. Sci. USA 89:6232-6236).
- the regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.
- gene targeting is preferred.
- vectors containing some nucleotide sequences homologous to the endogenous Clasp-1 gene, which sequences may include intron sequences of Clasp-1 are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous Clasp-1 gene.
- the transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous Clasp-1 gene in only that cell type, by following, for example, the teaching of Gu, et al. (1994, Science 265: 103-106).
- the regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.
- the expression of the recombinant Clasp-1 gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to assay whether integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques that include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and RT-PCR (reverse transcriptase PCR). Samples of Clasp-1 gene-expressing tissue, may also be evaluated immunocytochemically using antibodies specific for the Clasp-1 transgene product.
- a Clasp-1 polynucleotide may have a number of uses in the diagnosis of diseases or disorders resulting from aberrant expression of Clasp-1 such as immunodeficient states.
- the Clasp-1 DNA sequence may be used in hybridization assays of biopsies or autopsies to detect abnormalities of Clasp-1 expression; e.g., Southern or Northern analysis, including in situ hybridization assays and PCR.
- PCR primers of 15-30 nucleotides may be used.
- a preferred length of a PCR primer is about 18-22 nucleotides. However, the length of primers may be adjusted by one skilled in the art.
- a Clasp-1 probe a polynucleotide of 300-500 nucleotides is preferred.
- Various hybridization techniques are well known in the art, and are in fact the basis of many commercially available diagnostic kits.
- a Clasp-1 polynucleotide may be useful in the treatment of various abnormal conditions.
- gene therapy can be used to treat conditions in which the cells do not express normal Clasp-1 or express abnormal/inactive Clasp-1.
- the polynucleotide encoding a Clasp-1 is intended to replace or act in the place of a functionally deficient endogenous gene.
- abnormal conditions characterized by pverexpression can be treated using the gene therapy techniques described below.
- nucleic acids comprising a sequence encoding a Clasp-1 protein or functional derivative thereof, are administered to promote Clasp-1 function, by way of gene therapy.
- Gene therapy refers to therapy performed by the administration of a nucleic acid to a subject.
- the nucleic acid produces its encoded protein that mediates a therapeutic effect by promoting Clasp-1 function.
- the therapeutic composition comprises a Clasp-1 nucleic acid that is part of an expression vector that encodes a Clasp-1 protein or fragment or chimeric protein thereof in a suitable host.
- a nucleic acid has a promoter operably linked to the Clasp-1 coding region, said promoter being inducible or constitutive, and, optionally, tissue-specific.
- a nucleic acid molecule is used in which the Clasp-1 coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the Clasp-1 nucleic acid (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435438).
- Delivery of the nucleic acid into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid-carrying vector, or indirect, in which case, cells are first transformed with the nucleic acid in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
- the nucleic acid is directly administered in vivo, where it is expressed to produce the encoded product.
- This can be accomplished by any of numerous methods known in the art, e.g., by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by infection using a defective or attenuated retroviral or other viral vector (see U.S. Pat. No.
- microparticle bombardment e.g., a gene gun; Biolistic, Dupont
- coating lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering it in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see e.g., Wu and Wu, 1987, J. Biol. Chem. 262:44294432) (which can be used to target cell types specifically expressing the receptors), etc.
- a nucleic acid-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
- the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180 dated Apr. 16,1992; WO 92/22635 dated Dec. 23, 1992; WO92/20316 dated Nov. 26, 1992; WO93/14188 dated Jul. 22, 1993; WO 93/20221 dated Oct. 14, 1993).
- the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435438).
- a viral vector that contains the Clasp-1 nucleic acid is used.
- a retroviral vector can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These retroviral vectors have been modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA.
- the Clasp-1 nucleic acid to be used in gene therapy is cloned into the vector, which facilitates delivery of the gene into a patient.
- retroviral vectors More detail about retroviral vectors can be found in Boesen et al., 1994, Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
- Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., 1994, J. Clin. Invest. 93:644-651; Kiem et al., 1994, Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:110-114.
- Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson (1993, Current Opinion in Genetics and Development 3:499-503) present a review of adenovirus-based gene therapy.
- Adeno-associated virus has also been proposed for use in gene therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300.
- Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection.
- the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.
- the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
- introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc.
- Numerous techniques are known in the art for the introduction of foreign genes into cells (see e.g., Loeffler and Behr, 1993, Meth. Enzymol. 217:599-618; Cohen et al., 1993, Meth. Enzymol.
- the technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
- the resulting recombinant cells can be delivered to a patient by various methods known in the art.
- epithelial cells are injected, e.g., subcutaneously.
- recombinant skin cells may be applied as a skin graft onto the patient.
- Recombinant blood cells e.g., hematopoietic stem or progenitor cells
- the amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
- Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.
- the cell used for gene therapy is autologous to the patient.
- the nucleic acid to be introduced for purposes of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription.
- Oligonucleotide sequences that include anti-sense RNA and DNA molecules and ribozymes that function to inhibit the translation of a Clasp-1 mRNA are within the scope of the invention. Such molecules are useful in cases where downregulation of Clasp-1 expression is desired.
- Anti-sense RNA and DNA molecules act to directly block the translation of mRNA by binding to targeted mRNA and preventing protein translation.
- antisense DNA oligodeoxyribonucleotides derived from the translation initiation site, e.g., between ⁇ 10 and +10 regions of a Clasp-1 nucleotide sequence, are preferred.
- the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosyl
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of Clasp-1 RNA sequences.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
- Endogenous target gene expression can also be reduced by inactivating or “knocking out” the target gene or its promoter using targeted homologous recombination (e.g., see Smithies, et al., 1985, Nature 317:230-234; Thomas and Capecchi, 1987, Cell 51:503-512; Thompson, et al., 1989, Cell 5:313-321; each of which is incorporated by reference herein in its entirety).
- targeted homologous recombination e.g., see Smithies, et al., 1985, Nature 317:230-234; Thomas and Capecchi, 1987, Cell 51:503-512; Thompson, et al., 1989, Cell 5:313-321; each of which is incorporated by reference herein in its entirety).
- a mutant, non-functional target gene flanked by DNA homologous to the endogenous target gene (either the coding regions or regulatory regions of the target gene) can be used, With or without a selectable marker and/or a negative selectable marker, to transfect cells that express the target gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the target gene.
- ES embryonic stem
- endogenous target gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the target gene (i.e., the target gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the target gene in target cells in the body.
- deoxyribonucleotide sequences complementary to the regulatory region of the target gene i.e., the target gene promoter and/or enhancers
- triple helical structures that prevent transcription of the target gene in target cells in the body.
- Nucleic acid molecules to be used in triplex helix formation for the inhibition of transcription should be single stranded and composed of deoxynucleotides.
- the base composition of these oligonucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines to be present on one'strand of a duplex.
- Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix.
- the pyrimidine-rich molecules provide base complementarily to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand.
- nucleic acid molecules may be chosen that are purine-rich, for example, contain a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex.
- the potential sequences that can be targeted for triple helix formation may be increased by creating a so called “switchback” nucleic acid molecule.
- Switchback molecules are synthesized in an alternating 5′-3′, 3′-5′ manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.
- RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule.
- DNA sequences may be incorporated into a wide variety of vectors which contain suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
- antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
- DNA molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy- nucleotides to the 5′and/or 3′ ends of the molecule or the use of phosphorothioate or 2′O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
- Methods for introducing polynucleotides into such cells or tissue include methods for in vitro introduction of polynucleotides such as the insertion of naked polynucleotide, i.e., by injection into tissue, the introduction of a Clasp-1 polynucleotide in a cell ex vivo, the use of a vector such as a virus, (retrovirus, adenovirus, adeno-associated virus, etc.), phage or plasmid, etc. or techniques such as electroporation or calcium phosphate precipitation.
- the subject gene may be employed for producing all or portions of Clasp-1 polypeptides.
- Fragments of interest include glycosylation sites, which may affect the stability and/or activity of the polypeptide, the protein interaction sites, etc.
- Such domains will usually include at least about 20 amino acids of the provided sequence, more usually at least about 50 amino acids, and may include 100 amino acids or more, up to the complete domain.
- Binding contacts may be comprised of non-contiguous sequences, which are brought into proximity by the tertiary structure of the protein. The sequence of such fragments may be modified through manipulation of the coding sequence, as described above. Truncations may be performed at the carboxy or amino terminus of the fragment, e.g. to determine the minimum sequence required for biological activity.
- a polypeptide of particular interest comprises the mature portion of the Clasp-1 protein, i.e. the fragment that remain after cleavage of the signal peptide, or the propeptide sequence. Determination of this cleavage site may be determined experimentally, by producing the polypeptide in an expression system capable such cleavage, and then determining the terminus of the mature protein. Alternatively, the cleavage site may be determined by deduction, after comparison with known cleavage sites. For example, the cleavage site of the mouse Clasp-1 polypeptide is between residue 120 and 121. In the human homolog, a putative cleavage site (arg pro gin arg) is between residues 104 and 105.
- Assays for the biological activity of the protein or fragments thereof may be determined as described in the art. Numerous in vitro assays for determining lymphocyte activation are known in the art, or as provided in the Examples. Inhibition of cellular adhesion and cell-cell contacts, is determined through in vivo or in vitro models (for reviews, see Fukuda (1995) Bioorg Med Chem 3(3):207-215; Zanetta et al. (1994) Histol Histopathol 9(2):385412).
- the protein may be isolated and purified in accordance with conventional ways.
- a lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique.
- the purified protein will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.
- the Clasp-1 protein is expressed in lymphocytes, and is specifically localized at the interface of T cell-B cell interactions. Therefore, a soluble Clasp-1, a Clasp-1 fragment containing an extracellular domain or an anti-Clasp-1 antibody may be used to inhibit T cell-B cell interactions, thereby inhibiting an immune response. It is believed that the involvement of Clasp-1 in T cell-B cell contact occurs prior to B cell activation by the T H , thus inhibition of Clasp-1 binding can interfere with an early stage of the immune response.
- Autoimmune disorders that may be treated by disrupting Clasp-1 function, include, but are not limited to, multiple sclerosis, juvenile diabetes, rheumatoid arthritis, pemphigus, pemphigoid, epidermolysis bullosa acquista, lupus, Rh incompatibility, etc.
- Clasp-1 contains domains capable of transducing an intracellular signal
- cell surface Clasp-1 may be triggered by an anti-Clasp-1 antibody or soluble Clasp-1 or a fragment thereof in order to enhance the activation state of a lymphocyte.
- a Clasp-1 polypeptide, a fragment thereof or an anti-Clasp-1 antibody may be administered to a subject per se or in the form of a pharmaceutical or therapeutic composition.
- Pharmaceutical compositions comprising the proteins of the invention may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the protein or active peptides into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- proteins of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
- Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, oral or pulmonary administration.
- the proteins of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution; Ringer's solution, or physiological saline buffer.
- physiologically compatible buffers such as Hanks's solution; Ringer's solution, or physiological saline buffer.
- the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the proteins may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art.
- compositions can be readily formulated by combining the proteins with pharmaceutically acceptable carriers well known in the art.
- pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the proteins to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
- suitable excipients include fillers such as sugars, such as lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents.
- disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- solid dosage forms may be sugar-coated or enteric-coated using standard techniques.
- suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added.
- the proteins may take the form of tablets, lozenges, etc. formulated in conventional manner.
- the proteins for use according to the present invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the proteins may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g, containing conventional suppository bases such as cocoa butter or other glycerides.
- the proteins may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
- the proteins may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- Liposomes and emulsions are well known examples of delivery vehicles that may be used to deliver the proteins or peptides of the invention.
- Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity.
- the proteins may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent.
- sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the proteins for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
- proteins and peptides of the invention may contain charged side chains or termini, they may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts.
- Pharmaceutically acceptable salts are those salts which substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
- Clasp-1 polypeptides, Clasp-1 fragments and anti-Clasp-1 antibodies will generally be used in an amount effective to achieve the intended purpose.
- the proteins of the invention, or pharmaceutical compositions thereof are administered or applied in a therapeutically effective amount.
- therapeutically effective amount is meant an amount effective ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
- a therapeutically effective dose can be estimated initially from in vitro assays.
- a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC 50 as determined in cell culture (i.e., the concentration of test compound that inhibits 50% of Clasp-1 binding interactions). Such information can be used to more accurately determine useful doses in humans.
- Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
- Dosage amount and interval may be adjusted individually to provide plasma levels of the proteins which are sufficient to maintain therapeutic effect.
- Usual patient dosages for administration by injection range from about 0.1 to 5 mg/kg/day, preferably from about 0.5 to 1 mg/kg/day.
- Therapeutically effective serum levels may be achieved by administering multiple doses each day.
- the effective local concentration of the proteins may not be related to plasma concentration.
- One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
- the amount of Clasp-1 administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
- the therapy may be repeated intermittently while symptoms detectable or even when they are not detectable.
- the therapy may be provided alone or in combination with other drugs.
- the drugs that may be used in combination with Clasp-1 or fragments thereof include, but are not limited to, steroid and non-steroid immunosuppressive agents.
- a therapeutically effective dose of the proteins described herein will provide therapeutic benefit without causing substantial toxicity.
- Toxicity of the proteins described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD 50 (the dose lethal to 50% of the population) or the LD 100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index.
- the data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human.
- the dosage of the proteins described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- In vitro studies may use purified Clasp-1 macromolecules to screen large compound libraries for inhibitory drugs; or the purified target molecule may be used for a rational drug design program, which requires first determining the structure of the target or, the structure of the macromolecular target in association with its customary substrate or ligand. This information is then used to design inhibitory compounds which must be synthesized and tested further. Test results are used to refine the molecular models and drug design process in an iterative fashion until a lead compound emerges.
- Drug screening may be performed using an in vitro model, a genetically altered cell, or purified protein, including the use of mutant proteins, such as those provided herein.
- assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
- the purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions.
- agent as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of RAB.
- agent e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of RAB.
- a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
- one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
- Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
- Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
- the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
- Candidate agents are obtained from a wide variety of sources including libraries. of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
- the screening assay is a binding assay
- the label can directly or indirectly provide a detectable signal.
- Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
- Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
- the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
- reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
- the compounds having the desired biological activity may be administered in a an acceptable carrier to a host for treatment of fungal infection, or prevention of infection, etc.
- the inhibitory agents may be administered in a variety of ways. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways.
- the concentration of therapeutically active compound in the formulation may vary from about 0.01-100 wt. %.
- oligonucleotide primers were designed on the basis of a highly conserved cytoplasmic domain of classical cadherins corresponding to sequences TAPPYD and FKKLAD.
- the 5′ sense primer had the sequence of GGMTTCCACNGCNCCNCCNTA(CT)GA(SEQ ID NO:5) and the 3′ anti-sense primer had the sequence of GCTCTAGATCNGCNA(AG)(CT)TT(CT)TT(AG)M(SEQ ID NO:6).
- RNA was prepared from mouse thymocytes according to the method of Chomczynski and Sacchi (1987, Anal. Biochem. 162: 156-59), and the RNA was primed with oligo dT and reverse transcribed with MMTV reverse transcriptase (BRL, NY) according to the method of Suzuki et al., (1988, Cell Regul. 2: 807-16).
- the CDNA was then used for hot start (Ampli-wax, Perkin Elmer, CA) Polymerase Chain Reaction (PCR) in Promega PCR buffer (Promega, WI) containing Mg (1.5-3.0 mM), 1 ⁇ g primer each, 2.5 units of AmpliTaq (Perkin Elmer, CA).
- the Perkin Elmer Thermocycler (Perkin Elmer, CA) was set to 94° C. for a 30 second denaturation, 37° C. for a 2 minute annealing, and ramped over 2 minutes to 65° C., which was maintained for a 3 minute extension reaction, for 35 cycles.
- the PCR products were resolved in 3% NuSieve agarose (FMC, ME): 1% agarose (BRL, NY). The band of predicted size was excised, purified using Sephaglas (Pharmacia, NJ), and reamplified for 20 rounds using the same program.
- the final product was gel purified, digested with EcoR1 and Xba1 (New England Biolabs, MA), and cloned into pBluescript KS (Stratagene, La Jolla, Calif.) at the corresponding sites, and its nucleotide sequence determined. Half of the PCR clones sequenced were identical. A representative clone was used to screen a mouse neonatal thymus library to obtain a complete cDNA sequence designated Clasp-1.
- oligonucleotides corresponding to consensus sequences of cadherins and other adhesion molecule families were made for use in PCR of cDNA prepared from mouse thymocytes.
- a sequence that accounted for half of the clones and displayed several features of classical cadherins was isolated (FIGS. 1 a - 1 b ).
- the full length cDNA clone contains an open reading frame that encodes a 1,289 amino acid type I transmembrane protein which shares a number of cadherin features, including the cadherin proteolytic processing signal (Pigott and Power, 1993 , The Adhesion Molecule Facts Book , Academic Press Limited), glycosylation sites, a cluster of cysteines proximal to the transmembrane domain (Hofman and Stoffel, 1993, Biol. Chem. Hoppe-Seyler 374: 166), and a cytoplasmic domain that exhibits several cadherin sequence motifs (FIG. 2 ).
- the processed polypeptide begins at amino acid residue #121 after the amino acid sequence RAQR (FIG. 1 a ). This gene was named Clasp-1 for cadherin-like asymmetry protein.
- Clasp-1 may provide a direct interaction between signal transduction pathways and the cytoskeleton. FASTA searches of Clasp-1 (Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444-48; Ladunga et al., 1996, J. Mol. Biol. 259: 840-54) revealed similarities with two cDNAs of unknown function, the rat RNTRG (GenBank X68101) and a putative C.
- Clasp-1 is a cell surface cadherin-like protein that contains domains known to be involved in signal transduction pathways.
- the sequences encoding human CLASP-1 were identified by hybridization with the mouse sequence.
- the human CLASP-1 sequence is provided as SEQ ID NO:3.
- a CLASP-1-specific DNA fragment (HC. 1) was generated by PCR from a human CLASP-1 cDNA clone (SEQ ID NO:, using primers HC1S5′ and HC1-EC12-IgE (spanning nucleotides 1119-2154 of the cDNA).
- Probe HC1.1 is 1036 bp long and it recognizes five bands (approximately sized at 1.6 kb, 2.8 kb, 7 kb, 9 kb, and 14 kb) in HindII digested genomic DNA. HC1.1 recognizes 6 same bands (approximately sized at 1.2 kb, 1.9 kb, 2.2 kb, 7 kb, 9 kb, and 12 kb) in EcoRI digested genomic DNA and BAC 5 DNA.
- Intron-Exon Analysis were defined by sequencing Bacterial Artificial Chromosomes containing genomic DNA corresponding to human CLASP-1 (BACs). BACs were sequenced using primers derived from exon sequences corresponding to the CLASP-1 cDNA. Each exon/intron boundary is referenced by sequence, and exact nucleotide location of introns. Not all of the sequence from sequencing reactions on BACs produced sequence matching the cDNA. These nucleotide sequences that did not match the exon sequence for CLASP-1 were considered to be intron sequences. The two nucleotides spanning the intron/exon boundary are indicated in the table below.
- Th1 cells (5CC7), pro-GMB cells (HAFTLJ), pre-B cells (NFS40, HSIC5, BAC14), mature B cells (BALL 17), and plasmacytomas (S194, J598L) were maintained as cultured cell lines. RNA were extracted from these cells for Northern blot analysis.
- Northern blot analysis Ten micrograms ( ⁇ g) total RNA from each cell sample were loaded onto a 1% agarose formaldehyde gel, transferred onto BioBlot nitrocellulose paper (Costar, MA) and crossli,ked with Stratalink (Stratagene, La Jolla, Calif.). Prehybridization and hybridization were performed in 50% formamide, 25 mM sodium phosphate (pH 6.5), 1 ⁇ Denhardt's solution, 200 ⁇ g/ml herring sperm DNA, and 5 ⁇ SSC, at 65° C.
- Probes corresponding to the coding sequence of Clasp-1 were prepared using Ready-To-Go Labeling Kit (Pharmacia, NJ) according to the manufacturer's instructions, and desalted using pasteur pipet G-50 Sephadex column in TEN (10 mM Tris-HCl, pH 8, 1 mM EDTA, and 100 mM NaCl). The final wash of the blots was in 0.1 ⁇ SCC at 60° C. Autoradiography was performed on Kodak XOMAT film at ⁇ 80° C. with an enhancing screen.
- Cytospin and immuno fluorescence Cells were cytospun (Cytospin 1, Shandon]) onto poly-L-lysine (Sigma #P2636, MA) slides, fixed in periodate-lysine-paraformaldehyde (McLean and Nakane, 1974, J. Histochem. Cytochem. 22: 1077-83). Primary antibodies were added at 20-30 ⁇ g/ml in 10% normal donkey serum, TBS-C (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM CaCl 2 ), and 0.4% saponin, and incubated overnight at 4° C. After washing, secondary antibodies (Jackson immunoresearch, PA) were added and incubated at 37° C.
- the first step was Gamma-bind purified goat antisera in 10% normal mouse serum, 10% normal rat serum, TBS-C for overnight at 4° C. in a humidifying chamber; the second step was biotin-conjugated monoclonal anti-goat antibody (Sigma, MO) at 1/50 dilution for 2 hours at room temperature; and the last step 5 was strepavidin-PE (Molecular Probes, OR) at 1/50 for 1 hour at room temperature. A FITC-conjugated anti-B200 or anti-CD3 antibody was also added at the last step.
- Sections were incubated in 100 ⁇ l of the primary antibody in TBS-C+25% normal goat serum overnight at 4° C. and washed three times in TBS-C.
- One hundred ⁇ l of a secondary antibody (Jackson Immunoresearch, PA) was added for two hours at room temperature. Stained sections were examined under Nikon Biophot or Zeiss Axiophot fluorescent microscope and photographs were taken using Kodak Elite ASA 100.
- lymphoid tissues thymus, spleen, lymph nodes and bone marrow
- a 13 kb Clasp-1 transcript was detected.
- the same transcript was also observed in the brain, but was missing from the liver, lung, muscle, kidney, and skin (FIG. 3 a ).
- Further analysis in lymphoid cell lines indicated that the Clasp-1 transcript was present in lymphocytes of both T and B cell lineage (FIG. 3 b ).
- the transcript was either absent or minimally expressed in several plasmacytoma lines (S194 and J558L), suggesting that the gene may be turned off in terminally differentiated B cells.
- Immunostaining of spleen cryosections with an anti-Clasp-1 antiserum revealed that protein expression was most prominent in the marginal zone of the spleen (FIG. 4 c , M), and in the T (FIG. 4 a , T) and B (FIG. 4 b , B) cell zones of the periarterial lymphatic sheaths (PALS).
- Anti-Clasp-1 antibody also stained macrophages in the MOMA-1 subregion of the marginal zone, an important site for T cell-dependent humoral response (Claassen et al., 1986, Eur. J. Immunol.
- T cells (D10) grown in the absence of antigen also exhibited the same surface polar distribution (FIG. 4 i ), as well as B cells (CH27, FIG. 4 j ), indicating that the apical grouping was not the result of antigen-induced crosslinking, but was an inherent property of Clasp-1 itself.
- T cells (D10 and 2B4) were stained for both ⁇ -tubulin (green) and Clasp-1 (red).
- the apical Clasp-1 structure was always observed on the same side of the nucleus (blue) as the microtubule-organizing center (FIG. 4 k ). For most cell types examined, the centrisome was always on the same side of the nucleus as the leading edge, indicating that Clasp-1 pole was associated with the leading edge.
- HEL 46-61 peptide:I-A k transgenic for TCR to hen egg lysozyme
- T-B cell pairs were observed by 4 hours, and by 10 hours more than 95% of the tight T-B cell pairs demonstrated early blast transformation (loss of nuclear membrane definition and heterochromatin).
- Clasp-1 was always found at the cell-cell interface (FIG. 5 a ), while in non-productive cell pairs, Clasp-1 was oriented randomly relative to the cell-cell interface (FIG. 5 b ). Cultures with non-activating peptide did not show any evidence of T cell activation or specific orientation.
- CLASP-1-specific DNA fragment (HC1.3) was generated by PCR from the human CLASP-1 cDNA clone, using primers C1S18 and 115CR (spanning nucleotides 4116-5067 of the cDNA). The fragment was labeled by incorporation of radioactive 32 p dCTP. The labeled DNA fragment was used as a probe on a human Multiple Tissue Northern (Clontech MTN Blot, #7780-1). A single band was clearly detected migrating at approximately 7.5 kb in brain, heart thymus spleen and peripheral blood lymphocytes (PBL). Slight expression was detected in colon, kidney, liver, small intestine, placenta, and lung.
- PBL peripheral blood lymphocytes
- a Northern blot with RNA from multiple hematopoietic cell lines was hybridized with the same hCLASP-1 probe.
- a similarly migrating 7.5 kb band is detected in Jurkat (T-cell derived), MV4-11 (myelomonocyte-derived), THP (monocyte-derived), and 9D10 (B-cell derived.
- Weak expression was also detected in the mouse cell lines CH27 (B cell lymphoma) and 3A9 (T-cell hybridoma).
- a coding sequence for amino acid residues 121-327 of Clasp-1 was cloned into pGEX4T-1 (Pharmacia, NJ) at the BamH1/Not 1 site and it was referred to as GST-Clasp-EC12A.
- GST-Clasp-cyto was a construct that contained DNA encoding amino acid residues 969-1289 of Clasp-1 cloned into pGEX4T-3 (Pharmacia, NJ) at the Notl/EcoRI sites.
- Fusion proteins were expressed and purified according to instructions from Pharmacia using glutathione-Sepharose columns (Pharmacia, NJ) and used as immunogens for the generation of rabbit and goat antisera.
- Antibodies MOMA-1 (Kraal and Janse, 1986, Immunology 58: 665-669) and ER-TR-9 (van Vliet et al., 1985, J. Histochem. Cytochem. 33: 4044) were used as described.
- Anti-CD4-FITC, CD8-FITC, CD3-FITC, CD45R (B220)-FITC antibodies were purchased from Caltag, CA.
- YOL 1/34 was purchased from Sera-Tec, (NC).
- Antibodies were generated against Clasp-1 fusion proteins.
- Western blot analysis was performed using extracts from CH 27 (a mature B cell line) and 2B4 (a T cell hybridoma)
- antibodies raised against GST-fusion proteins containing either the extracellular domain (Clasp-EC12A) or the cytoplasmic domain (Clasp-cyto) identified a band of about 130 kD molecular weight, which was consistent with the deduced molecular weight of 134 kD (FIG. 3 c ) of Clasp-1.
- the distribution of CLASP-1 on the surface of a T cell changes with stimulation.
- T cell clones 2B4 was stimulated with PMA and ionomycin, after 30 minutes there was a sharp redistribution of the CLASP-1 uropedal distribution.
- the CLASP-1 cap structure was found to be co-incident with staining for CD3 on the T cell surface.
- the CLASP-1 protein in the T cell becomes associated with the cytoskeleton after stimulation. After 60 minutes, when the T cells were stimulated with PMA and ionomycin, there was a significant increase in the amount of CLASP-1 in the cytoskeletal, insoluble fraction. This change in cytoskeletal association was almost completely disrupted by the presence of nocodazole; and was also disrupted to a lesser extent by the presence of cytochalasin D (shown in FIG. 7 ). Nocodazole did not affect the c-capping of CLASP-1 by anti-CD3 antibody. These data demonstrates the involvement of microtubules in the resdistribution of CLASP-1.
- the chemokine RANTES activates T cells through the cAMP pathway to reorganize cellular morphology via cytoskeletal changes, as well as surface receptors using a microfilament dependent process.
- RANTES treatment causes CD44 and CLASP-1 to redistribute in the T cell.
- the cell line D10 was transfected with a CLASP-1 protein fused to green fluorescent protein. It was found that chemical activation of D10 cells caused a loss of the “hand mirror” morphology, and CLASP-1 expression to become more diffuse.
- Oligos The following oligos were synthesized (Gibco BRL, ROckville, Md. to build the Clasp-1 deletion constructs: (MP) SEQ ID NO:11 GGMGCTTCAGCACTTCTA; (AB) SEQ ID NO:12 GGGGTACCTTCCATTTTCCAGTA; (CD/COIL) SEQ ID NO:13 GGGGTACCCCTAAGCTGACAGGG; (COIL) SEQ ID NO:14 CCACTAGTCAGCTTAGGCTCTTT; and 3′ SPE, SEQ ID NO:15 CCACTAGTMCCTCCGCACTGGA.
- Plasmid construction Expression vectors containing deletions of Clasp-1 cDNA were constructed in pBJI neo (Lin et al. (1990). This vector has been modified by addition into the multiple cloning site a linker containing an Spel site followed by a FLAG tag, including a stop codon. Full-length Clasp-1 cDNA was cloned into pBJI neo-FLAG as an XhoI-Spel fragment. Deletion of the cadherin homology regon of the cytoplasmic domain was accomplished by two separate PCR amplifications of full-length cDNA using the MP and AB oligos, and the CD/COIL and 3′SPE oligos.
- Stable transformants were isolated by selection with 0.4 mg/ml G418 sulfate (Geneticin®; Gibco BRL).
- 2B4 T cell hybridomas expressing the full-length and deletion constructs were stimulated in two ways. First, 10 5 cells/well were incubated at 37° for 18 hours in a 96-well plate coated with various concentrations of anti-CD3 (145-2C11, Pharmingen, San Diego Calif.). Alternatively, 10 5 cells/well were mixed with 10 4 untransfected CH27 cells and various concentrations of moth cytochrome C (MCC) 82-103 peptide followed by incubation at 37° for 18 hours in a 96 well plate.
- MCC moth cytochrome C
- CH27 lymphomas expressing the constructs were tested by using 5 ⁇ 10 4 transfected CH27 to present MCC 82-103 peptide to 10 5 untransfected 2B4 cells (incubated at 37° for 18 hours in a 96 well plate).
- IL2 production was tested by assaying the supernatants with an IL2 sandwich ELISA (Pharmingen, San Diego Calif.) and the non-isotopic DELFIA system (EG&G Wallac, Wellesley Mass.).
- CLASP-1 contains a number of predicted protein interaction domains in the cytoplasmic tail. Using the amino acid numbering from the mouse protein sequence (SEQ ID NO:1), these include an SH3 domain (residues 847-859); a first SH2 domain (residues 923-935); a second SH2 domain (residues 951-962); a PTB motif and third SH2 domain (residues 1035-1053); and a PTB motif (residues 1255-1269).
- the PTB domain (phosphotyrosine-binding) is found in cytoplasmic docking proteins (see Kavanaugh et al. (1995) Science 268(5214):1177-9). These PTB domains are found primarily as components of docking proteins that recruit additional signaling proteins to the vicinity of an activated receptor.
- Two deletion mutants were made in the coding sequence of mCLASP-1.
- the internal cytoplasmic deletion deleted amino acid residues 846-997, including the cadherin homology domain.
- These constructs additionally added a FLAG sequence to provide a molecular tag for the proteins. The effects of these constructs were studied on transfection into the T cell clone 2B4.
- the cells that were transfected with the internal cytoplasmic deletion had a disrupted CLASP-1 morphology. Both the internal and C-terminal deletion mutants. lacked the ability to respond to the MCC antigen presented to the transfected T cell, as measured by production of IL-2, indicating that the deletion mutants had a dominant negative phenotype (shown in FIG. 8 ).
- the C-terminal deletion mutant could be activated by high levels of plate-bound anti-CD3, although the internal deletion could not be activated under these conditions.
- transfected T cells were then tested on plates containing both CD3 and anti-CLASP-1 antibody, in order to determine whether the mutants were blocking activation by failing to properly redistribute.
- anti-CLASP-1 does not affect anti-CD3 stimulation.
- the addition of CLASP-1 antibody did not rescue IL-2 production from CLASP-1 deletion mutant transfectants.
- the deletion mutants retained the ability to co-cap with CD3.
- CH27 cells also had a disrupted morphology when expressing either of the deletion mutants.
- the ability of the B cells to act as antigen presenting cells was tested. It was found that the deletion mutation constructs did not have a dominant negative effect on antigen presentation, although they did not raise the antigen presenting efficiency to the extent that the full length contructs were able to (shown in FIG. 9 ).
- the monoclonal antibody EC12A (anti-CLASP-1) was used to determine the effects of blocking CLASP-1 interactions.
- addition of EC12A blocked conjugation between the two cell types. This block could be overcome at high concentrations of antibody, which may be attributed to cross-linking by the antibody.
- the 5C.C7 lymphocyte cell line was analyzed for expression of CLASP-1 and CTLA-4. It was found that the two proteins were similarly distributed in the cells.
- n A,T,C or G 16 atctnttgtg catactaaag aaaaataaa tacaaatatt gttt 44 17 51 DNA H. sapiens 17 tagtatcaga ttatagaagg tatgtttttttt ttatactctc gaaattaaca t 51 18 44 DNA H. sapiens 18 aaagtgccaa gcccctgaag gtgagccaag tcagcaaagg gacc 44 19 47 DNA H.
- sapiens 29 gtcccactta caagtaagtg ctgccaattt taattaatgc tgttgttaa acca 54 30 51 DNA H. sapiens misc_feature (1)...(51) n A,T,C or G 30 ttcacctctg ctgggaaarr cgctgttctn tggaaangag agagcctggg t 51 31 49 DNA H. sapiens 31 gaaacggaga ttatctgag gtgattagca aggcttggtc atttaccat 49 32 45 DNA H.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Rheumatology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Neurosurgery (AREA)
- Endocrinology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Obesity (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Emergency Medicine (AREA)
- Pain & Pain Management (AREA)
- Dermatology (AREA)
- Hematology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
splice junction | ||
(with reference to the | ||
nucleotides of the cDNA | ||
sequence found on either side | Sequence | Junction sequence |
of the junction, SEQ ID NO: 3) | Reference | (the exon sequence is in capitals, the intron in lower case) |
SEQ ID NO: 3 pos 148/149 | SEQ ID NO: 16 | ATCTNTTGTGCATACTaaagaaaaaataaatacaaatattgttt |
SEQ ID NO: 3 pos 340/341 | SEQ ID NO: 17 | TAGTATCAGATTATAGAAGgtatgttttttttatactctcgaaattaacat |
SEQ ID NO: 3 pos 642/643 | SEQ ID NO: 18 | AAAGTGCCAAGCCCCTGAAGgtgagccaagtcagcaaagggacc |
SEQ ID NO: 3 pos 1161/1162 | SEQ ID NO: 19 | ATTTCATCCGCTCTTGTAAGgtaacatgacatgcaagcagtttcagt |
SEQ ID NO: 3 pos. 1464/1465 | SEQ ID NO: 20 | CAGTAAAGCATGTCCTAAAGgtaagaatttaaagatggtcctttaactgt |
SEQ ID NO: 3 pos. 1683/1684 | SEQ ID NO: 21 | GCGTTGCCAGATTTCTCAAGgtacagttatatgagatcgcagttctattc |
SEQ ID NO: 3 pos. 1962/1963 | SEQ JD NO: 22 | ganaggangatcacttacTGGCTCTCTGTATCGATCATCAAATGA |
SEQ ID NO: 3 pos. 2085/2086 | SEQ ID NO: 23 | ACTTCTCGGAGCAGAATTCCnttagaaggtttgcgcaaatcat |
SEQ ID NO: 3 pos. 2202/2203 | SEQ ID NO: 24 | CTGNCAATACATCTAATCAGgtacgtttgcacaatatgtcacatttctatgtt |
SEQ ID NO: 3 pos. 2311/2312 | SEQ ID NO: 25 | AAGATGTTTTAAATTCNTAGcaggtacttgagatcttctgagaacactta |
SEQ ID NO: 3 pos. 2618/2619 | SEQ ID NO: 26 | GACTTCTTCAGCATCTTGGAgtaagttttagagttgatgacttaacacttttttc |
SEQ ID NO: 3 pos. 2893/2894 | SEQ ID NO: 27 | TTAGACAATACCATGACCAGtaagtaaactgaaataataggaacaagatg |
SEQ ID NO: 3 pos. 3144/3145 | SEQ ID NO: 28 | TTGAGACTGTTTGTATGCAAGgtaaggatctccaggtttcaatgaagtttag |
SEQ ID NO: 3 pos. 3327/3328 | SEQ ID NO: 29 | GTCCCACTTACAAgtaagtgctgccaattttaattaatgctgttgttaaaacca |
SEQ ID NO: 3 pos. 3622/3623 | SEQ ID NO: 30 | TTCACCTCTGCTGGGAAARRcgctgttctntggaaangagagagcctgggt |
SEQ ID NO: 3 pos. 3657/3658 | SEQ ID NO: 31 | GAAACGGAGATTTATCTGAGgtgattagcaaggcttggtcatttaccat |
SEQ ID NO: 3 pos. 3879/3880 | SEQ ID NO: 32 | cttcngaagaaggagcgatgAAAGAGGATTCTGGAATGCAAGATA |
SEQ ID NO: 3 pos. 3918/3919 | SEQ ID NO: 33 | AGATACACCATACAATGAGgttagaccaaaattatctcatgtacagtaacc |
SEQ ID NO: 3 pos. 4511/4512 | SEQ ID NO: 34 | AAGCGGCGGACGATNCTGNCAAgtnggtgcaggtagccgggccacac |
Claims (14)
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/546,934 US6565848B1 (en) | 1998-10-02 | 2000-04-11 | Cadherin-like asymmetry protein-1, and methods for its use |
PCT/US2001/011900 WO2001085908A2 (en) | 2000-04-11 | 2001-04-11 | Clasp-1 transmembrane protein |
AU2001251558A AU2001251558A1 (en) | 2000-04-11 | 2001-04-11 | Clasp-1 transmembrane protein |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10296498P | 1998-10-02 | 1998-10-02 | |
US41132899A | 1999-10-01 | 1999-10-01 | |
US09/546,934 US6565848B1 (en) | 1998-10-02 | 2000-04-11 | Cadherin-like asymmetry protein-1, and methods for its use |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US41132899A Continuation-In-Part | 1998-10-02 | 1999-10-01 |
Publications (1)
Publication Number | Publication Date |
---|---|
US6565848B1 true US6565848B1 (en) | 2003-05-20 |
Family
ID=22292641
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/546,934 Expired - Fee Related US6565848B1 (en) | 1998-10-02 | 2000-04-11 | Cadherin-like asymmetry protein-1, and methods for its use |
Country Status (6)
Country | Link |
---|---|
US (1) | US6565848B1 (en) |
EP (1) | EP1117675A4 (en) |
JP (1) | JP2002526094A (en) |
AU (1) | AU761425B2 (en) |
CA (1) | CA2344266A1 (en) |
WO (1) | WO2000020434A1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002031117A2 (en) * | 2000-10-13 | 2002-04-18 | Arbor Vita Corporation | Clasp-2 transmembrane proteins |
WO2003025120A2 (en) * | 2001-08-03 | 2003-03-27 | Arbor Vita Corporation | Clasp membrane proteins |
US20040047880A1 (en) * | 2000-10-03 | 2004-03-11 | De Bolle Xavier Thomas | Component for vaccine |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1169449A2 (en) * | 1999-04-14 | 2002-01-09 | Arbor Vita Corporation | Clasp-2 transmembrane proteins |
AU5269800A (en) | 1999-05-14 | 2000-12-05 | Arbor Vita Corporation | Molecular interactions in allergy cells |
US7459308B2 (en) | 1999-10-21 | 2008-12-02 | Arbor Vita Corporation | Nucleic acid molecule encoding a CLASP-2 transmembrane protein |
WO2001042294A2 (en) * | 1999-12-13 | 2001-06-14 | Arbor Vita Corporation | Clasp-4 transmembrane protein |
EP1238078A2 (en) * | 1999-12-13 | 2002-09-11 | Arbor Vita Corporation | Clasp-4 transmembrane protein |
WO2001085908A2 (en) * | 2000-04-11 | 2001-11-15 | The Board Of Trustees Of The Leland Stanford Junior University | Clasp-1 transmembrane protein |
-
1999
- 1999-10-01 JP JP2000574545A patent/JP2002526094A/en not_active Withdrawn
- 1999-10-01 CA CA002344266A patent/CA2344266A1/en not_active Abandoned
- 1999-10-01 AU AU62854/99A patent/AU761425B2/en not_active Ceased
- 1999-10-01 EP EP99950129A patent/EP1117675A4/en not_active Withdrawn
- 1999-10-01 WO PCT/US1999/022996 patent/WO2000020434A1/en not_active Application Discontinuation
-
2000
- 2000-04-11 US US09/546,934 patent/US6565848B1/en not_active Expired - Fee Related
Non-Patent Citations (17)
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040047880A1 (en) * | 2000-10-03 | 2004-03-11 | De Bolle Xavier Thomas | Component for vaccine |
WO2002031117A2 (en) * | 2000-10-13 | 2002-04-18 | Arbor Vita Corporation | Clasp-2 transmembrane proteins |
WO2002031117A3 (en) * | 2000-10-13 | 2004-11-11 | Arbor Vita Corp | Clasp-2 transmembrane proteins |
WO2003025120A2 (en) * | 2001-08-03 | 2003-03-27 | Arbor Vita Corporation | Clasp membrane proteins |
WO2003025120A3 (en) * | 2001-08-03 | 2004-10-21 | Arbor Vita Corp | Clasp membrane proteins |
Also Published As
Publication number | Publication date |
---|---|
EP1117675A4 (en) | 2005-01-12 |
EP1117675A1 (en) | 2001-07-25 |
JP2002526094A (en) | 2002-08-20 |
WO2000020434A9 (en) | 2000-08-24 |
WO2000020434A1 (en) | 2000-04-13 |
CA2344266A1 (en) | 2000-04-13 |
AU761425B2 (en) | 2003-06-05 |
AU6285499A (en) | 2000-04-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20110123548A1 (en) | Compositions and methods for the treatment and diagnosis of immune disorders | |
US20040176296A1 (en) | Novel ITALY, LOR-2, STRIFE, TRASH, BDSF, LRSG, and STMST protein and nucleic acid molecules and uses therefor | |
US20070196370A1 (en) | Type 2 cytokine receptor and nucleic acids encoding same | |
US20020169283A1 (en) | Clasp-7 transmembrane protein | |
WO1999032611A1 (en) | A lipase expressed in endothelial cells and methods for its use | |
WO2001059118A1 (en) | 43239, a gpcr-like molecule and uses thereof | |
US6565848B1 (en) | Cadherin-like asymmetry protein-1, and methods for its use | |
US20020102267A1 (en) | CLASP-5 transmembrane protein | |
WO2000061747A9 (en) | Clasp-2 transmembrane proteins | |
JP2003529350A (en) | Polypeptides and nucleic acids encoding the same | |
US20020076784A1 (en) | 40322, a novel human dynamin | |
JP2002516079A (en) | Novel secreted and membrane-associated proteins and uses therefor | |
US20020086382A1 (en) | Clasp-3 transmembrane protein | |
WO2002031117A2 (en) | Clasp-2 transmembrane proteins | |
US20030103992A1 (en) | Clasp membrane proteins | |
US7459308B2 (en) | Nucleic acid molecule encoding a CLASP-2 transmembrane protein | |
JP2004535751A (en) | CLASP-2 transmembrane protein | |
EP1238078A2 (en) | Clasp-4 transmembrane protein | |
US20020068302A1 (en) | Clasp-4 transmembrane protein | |
WO2001042294A2 (en) | Clasp-4 transmembrane protein | |
US20050053953A1 (en) | Novel human genes and proteins encoded thereby | |
WO2001085908A2 (en) | Clasp-1 transmembrane protein | |
US20060090212A1 (en) | Novel human genes and proteins encoded thereby | |
TW200307688A (en) | A nucleic acid encoding a G-protein-coupled receptor, and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: HOWARD HUGHES MEDICAL INSTITUTE, THE, MARYLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DAVIS, MARK M.;REEL/FRAME:011176/0585 Effective date: 20000608 Owner name: BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HOWARD HUGHES MEDICAL INSTITUTE, THE;REEL/FRAME:011176/0377 Effective date: 20000608 Owner name: BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LU, PETER S.;REEL/FRAME:011176/0519 Effective date: 20000828 |
|
FEPP | Fee payment procedure |
Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
CC | Certificate of correction | ||
FPAY | Fee payment |
Year of fee payment: 4 |
|
AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF Free format text: EXECUTIVE ORDER 9424, CONFIRMATORY LICENSE;ASSIGNOR:STANFORD UNIVERSITY;REEL/FRAME:021876/0235 Effective date: 20030528 |
|
REMI | Maintenance fee reminder mailed | ||
LAPS | Lapse for failure to pay maintenance fees | ||
STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20110520 |
|
CC | Certificate of correction |