US5817512A - Encapsidated recombinant viral nucleic acid and methods of making and using same - Google Patents
Encapsidated recombinant viral nucleic acid and methods of making and using same Download PDFInfo
- Publication number
- US5817512A US5817512A US08/389,459 US38945995A US5817512A US 5817512 A US5817512 A US 5817512A US 38945995 A US38945995 A US 38945995A US 5817512 A US5817512 A US 5817512A
- Authority
- US
- United States
- Prior art keywords
- fragment
- nucleic acid
- poliovirus
- protein
- recombinant poliovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6075—Viral proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32611—Poliovirus
- C12N2770/32622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32611—Poliovirus
- C12N2770/32634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32611—Poliovirus
- C12N2770/32641—Use of virus, viral particle or viral elements as a vector
- C12N2770/32643—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to methods of encapsidating a recombinant viral nucleic acid having a foreign nucleotide sequence substituted for the nuclcotide sequence of the virus encoding at least a portion of a protein necessary for encapsidation. More particularly, the invention relates to methods and compositions for generating an immune response in a subject by using such a recombinant virus.
- Poliovirus is an attractive candidate system for delivery of antigens to the mucosal immune system because of several biological features inherent to the virus.
- the pathogenesis of the poliovirus is well-studied and the important features identified.
- the poliovirus is naturally transmitted by an oral-fecal route and is stable in the harsh conditions of the intestinal tract. Primary replication occurs in the oropharynx and gastro-intestinal tract, with subsequent spread to the lymph nodes. Horstmann, D. M. et al. (1959) JAMA 170:1-8.
- the attenuated strains of poliovirus are safe for humans, and are routinely administered to the general population in the form of the Sabin oral vaccine.
- the incorporation of foreign genes into the attenuated strains would be an attractive feature that should pose no more of a health risk than that associated with administration of the attenuated vaccines alone.
- the entire poliovirus has been cloned, the nucleic acid sequence determined, and the viral proteins identified. An infectious cDNA is also available for poliovirus which has allowed further genetic manipulation of the virus. Further, previous studies using the attenuated vaccine strains of poliovirus have demonstrated that a long-lasting systemic and mucosal immunity is generated after administration of the vaccine. Sanders, D. Y.
- HIV human immunodeficiency virus
- Most HIV vaccines developed to date have been designed to preferentially stimulate the systemic humoral immune system and have relied on immunization with purified, whole human immunodeficiency virus type 1 (HIV-1) and HIV-1 proteins (Haynes, B. F. (May 1993) Science 260:1279-1286.), or infection with a recombinant virus or microbe which expresses HIV-1 proteins (McGhee, J. R., and Mestecky, J. (1992) AIDS Res. Rev. 2:289-312).
- the formation of the capsid around the poliovirus genome is believed to be the result of interactions between capsid proteins and the poliovirus genome. Therefore, it is likely that the yield of encapsidated viruses obtained by Percy et al. consisted of a mixture of encapsidated poliovirus replicons and encapsidated nucleic acid from the type 3 poliovirus.
- the encapsidated type 3 poliovirus most likely represents a greater proportion of the encapsidated viruses than does the encapsidated poliovirus replicons.
- the Percy et al. method of encapsidating a poliovirus replicon is, therefore, an inefficient system for producing encapsidated recombinant poliovirus nucleic acid.
- a method of encapsidating a recombinant poliovirus genome which results in a stock of encapsidated viruses substantially composed of the recombinant poliovirus genome.
- Such a method would enable the efficient production of encapsidated poliovirus nucleic acid for use in compositions for stimulating an immune response to foreign proteins encoded by the recombinant poliovirus genome.
- the present invention pertains to methods of encapsidating a recombinant poliovirus nucleic acid to obtain a yield of encapsidated viruses which substantially comprises encapsidated recombinant poliovirus nucleic acid.
- the methods of encapsidating a recombinant poliovirus nucleic acid include providing a recombinant poliovirus nucleic acid which lacks the nucleotide sequence encoding at least a portion of a protein necessary for encapsidation and an expression vector lacking an infectious poliovirus genome, the nucleic acid of which encodes at least a portion of one protein necessary for encapsidation; contacting a host cell with the recombinant poliovirus nucleic acid and the expression vector under conditions appropriate for introduction of the recombinant poliovirus nucleic acid and the expression vector into the host cell; and obtaining a yield of encapsidated viruses which substantially comprises an encapsidated recombinant poliovirus nucleic acid.
- the nucleic acid of the expression vector does not interact with the capsid proteins or portions of capsid proteins which it encodes, thereby allowing encapsidation of the recombinant poliovirus nucleic acid and avoiding encapsidation of the nucleic acid of the expression vector.
- the invention further pertains to encapsidated recombinant poliovirus nucleic acids produced by the methods of this invention.
- the methods of encapsidating a recombinant poliovirus nucleic acid include providing a recombinant poliovirus nucleic acid in which the VP2 and VP3 genes of the P1 capsid precursor region of the poliovirus genome are replaced by a foreign nucleotide sequence encoding, in an expressible form, a protein or fragment thereof, such as an immunogenic protein or fragment thereof.
- immunogenic proteins which can be encoded by the foreign nucleotide sequence include human immunodeficiency virus type 1 proteins and tumor-associated antigens.
- a host cell e.g., a mammalian host cell
- this recombinant poliovirus nucleic acid and an expression vector lacking an infectious poliovirus genome such as a vaccinia virus, which encodes the poliovirus P1 capsid precursor protein.
- the expression vector nucleic acid e.g., vaccinia viral nucleic acid nucleic acid
- a yield of encapsidated viruses which substantially comprises encapsidated poliovirus nucleic acid is obtained.
- the resulting encapsidated recombinant poliovirus nucleic acid is able to direct expression of the foreign protein or fragment thereof.
- the methods of encapsidating a recombinant poliovirus nucleic acid include providing a recombinant poliovirus nucleic acid in which the entire P1 capsid precursor region of the poliovirus genome is replaced by a foreign nucleotide sequence encoding, in an expressible form, a protein or fragment thereof, such as an immunogenic protein or fragment thereof.
- a host cell e.g., a mammalian host cell
- an infectious poliovirus genome such as a vaccinia virus
- the upper size limit of the foreign nucleotide which can be inserted into the poliovirus nucleic acid is increased, thereby allowing expression of entire proteins, as well as fragments or portions of proteins.
- the present invention also pertains to encapsidated recombinant poliovirus nucleic acids which lack the entire P1 capsid precursor region.
- the present invention further pertains to compositions for stimulating an immune response to an immunogenic protein or fragment thereof and a method for stimulating the immune response by administering the compositions to a subject.
- the compositions typically contain an encapsidatcd recombinant poliovirus nucleic acid, in a physiologically acceptable carrier, which encodes an immunogenic protein or fragment thereof and directs expression of the immunogenic protein, or fragment thereof.
- the compositions are administered to a subject in an amount effective to stimulate an immune response to the immunogenic protein or fragment thereof, e.g., in an amount effective to stimulate the production of antibodies against the immunogenic protein or fragment thereof in the subject.
- the invention still further pertains to methods for generating cells that produce a foreign protein or fragment thereof.
- These methods include contacting host cells with an encapsidated recombinant poliovirus nucleic acid having a foreign nucleotide sequence substituted for the nucleotide sequence which encodes at least a portion of a protein necessary for encapsidating the recombinant poliovirus nucleic acid and an expression vector lacking an infectious poliovirus genome but which encodes and directs expression of at least a portion of a protein necessary for encapsidation of the recombinant poliovirus nucleic acid and directs expression of at least a portion of a protein necessary for encapsidating the recombinant poliovirus nucleic acid and maintaining the cultured host cells under conditions appropriate for introduction of the recombinant poliovirus nucleic acid and the expression vector into the host cells, thereby generating modified cells which produce a foreign protein or fragment thereof.
- modified cells
- FIG. 1 shows a schematic of the translation and proteolytic processing of the poliovirus polyprotein.
- FIGS. 2A, 2B, and 2C show chimeric HIV-1-poliovirus genomes containing regions of the HIV-1 gag orpol gene substituted for the poliovirus P1 gene.
- FIG. 3 shows an SDS-polyacrylamide gel on which 3D pol and HIV-1-P1 fusion protein expression from cells infected with VV-P1 and transfected with recombinant poliovirus RNA was analyzed.
- FIGS. 4A, 4B, and 4C show SDS-polyacrylamide gels on which poliovirus- and HIV-1-specific protein expression from cells infected with recombinant poliovirus RNA which were encapsidated and serially passaged with capsid proteins provided by VV-P1 were analyzed.
- FIG. 5 shows a Northern blot analysis of RNA isolated from a stock of encapsidated recombinant poliovirus nucleic acid.
- FIG. 6 shows an SDS-polyacrylamide gel on which the neutralization of the poliovirus nucleic acid encapsidated by VV-P 1 with anti-poliovirus antibodies was analyzed.
- FIGS. 7A, 7B, and 7C show SDS-polyacrylamide gels on which poliovirus- and HIV-1-specific protein expression from cells infected with a stock of poliovirus nucleic acid encapsidated by type 1 Sabin poliovirus was analyzed.
- FIGS. 8A, 8B, and 8C show total anti-poliovirus IgG levels in serum from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 9A, 9B, and 9C show anti-poliovirus IgA levels in saliva from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 10A and 10B show anti-poliovirus IgA in vaginal lavages after intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 11A, 11B, and 11C show anti-poliovirus IgA in feces from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 12A, 12B, and 12C show anti-HIV-1-Gag IgG in serum from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 13A, 13B, and 13C show anti-HIV-1-Gag IgA in saliva from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 14A and 14B show anti-HIV-1-Gag IgA in vaginal lavages from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 15A, 15B, and 15C show anti-HIV-1-Gag IgA in feces from mice after intragastric, intrarectal, and intramuscular administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIG. 16 shows anti-poliovirus IgG from serum of a pigtail macaque after intrarectal administration of an encapsidated recombinant poliovirus nucleic acid encoding and expressing at least a portion of the gag protein of human immunodeficiency virus type 1.
- FIGS. 17A, 17B, and 17C show recombinant poliovirus nucleic acids which contain the complete gag gene of HIV-1.
- FIGS. 18A and 18B show an analysis of protein expression from cells transfected with RNA derived from recombinant poliovirus nucleic acid containing the gag gene of HIV-1.
- FIGS. 19A and 19B show quantitation of recombinant poliovirus RNA from transfected cells by Northern blot.
- FIG. 20 shows an analysis of poliovirus and HIV-1 specific protein expression from cells infected with recombinant poliovirus nucleic acid encapsidated in trans using VV-P1.
- FIGS. 21 A and 21B show an analysis of protein expression from cells infected with normalized amounts of encapsidated recombinant poliovirus nucleic acid stocks and material derived from serial passage of equivalent amounts of encapsidated recombinant poliovirus nucleic acid virus stocks with VV-P1.
- FIG. 22 shows an analysis of protein expression from cells infected with material derived from the serial passage of encapsidated recombinant poliovirus nucleic acid with wild-type poliovirus.
- FIGS. 23A, 23B, and 23C show construction of recombinant poliovirus nucleic acid containing the gene for carcinoembryonic antigen.
- FIGS. 24A and 24B show expression, in transfected cells, of carcinoembryonic protein encoded by recombinant poliovirus nucleic acid containing the gene for carcinoembryonic antigen.
- FIGS. 25A, 25B, and 25C show an analysis of poliovirus and carcinoembryonic expression from cells infected with recombinant poliovirus nucleic acid containing the gene for carcinoembryonic antigen; the recombinant poliovirus nucleic acid was encapsidated and serially passaged with capsid proteins provided by VV-P1.
- FIGS. 26A and 26B show antibody response to encapsidated recombinant poliovirus nucleic acid expressing carcinoembryonic antigen.
- the genome of poliovirus has been cloned and the nucleic acid sequence determined.
- the genomic RNA molecule is 7433 nucleotides long, polyadenylated at the 3' end and has a small covalently attached viral protein (VPg) at the 5' terminus.
- Poliovirus genome occurs via the translation of a single protein (polyprotein) which is subsequently processed by virus encoded proteases (2A and 3C) to give the mature structural (capsid) and nonstructural proteins.
- Poliovirus replication is catalyzed by the virus-encoded RNA-dependent RNA polymerase (3D pol ), which copies the genomic RNA to give a complementary RNA molecule, which then serves as a template for further RNA production. Koch, F. and Koch, G.
- FIG. 1 is a figure from Nicklin, M. J. H. et al. (1986) Bio/Technology 4:33-42.
- the coding region and translation product of poliovirus RNA is divided into three primary regions (P1, P2, and P3), indicated at the top of the figure.
- the RNA is represented by a solid line and relevant nucleotide numbers are indicated by arrows.
- Protein products are indicated by waved lines. Cleavage sites are mapped onto the polyprotein (top waved line) as filled symbols; open symbols represent the corresponding sites which are not cleaved.
- a poliovirus-specific protein, 3C pro is the protease responsible for the majority of the protease cleavages. Hanecak, R. et al.
- a second, minor cleavage by 2A pro occurs within the 3D pol to give 3C' and 3D'.
- Another role of the 2A pro is the shut offofhost cell protein synthesis by inducing the cleavage of a cellular protein required for cap-dependent translation. Bernstein, H. D. et al. (1985) MoL Cell Biol. 5:2913-2923; Krausslich, H. G. et al. (1987) J Virol. 61:2711-2718; Lloyd, R. E. etal. (1988) J. Virol. 62:4216-4223.
- poliovirus types based on reactivity to antibodies. Koch, F. and Koch, G. The Molecular Biology of Poliovirus (Springer-Verlag, Vienna 1985). These three serological types, designated as type I, type II, and type III, have been further distinguished as having numerous nucleotide differences in both the non-coding regions and the protein coding regions. All three strains are suitable for use in the present invention. In addition, there are also available attenuated versions of all three strains of poliovirus. These include the Sabin type I, Sabin type II, and Sabin type III attenuated strains of poliovirus that are routinely given to the population in the form of an oral vaccine. These strains can also be used in the present invention.
- the recombinant poliovirus nucleic acid of the present invention lacks the nucleotide sequence encoding at least a portion or a protein necessary for encapsidation of the recombinant poliovirus nucleic acid.
- the nucleotide sequence that is absent from the recombinant poliovirus nucleic acid can be any sequence at least a portion of which encodes at least a portion of a protein necessary for encapsidation, and the lack of which does not interfere with the ability of the poliovirus nucleic acid to replicate or to translate, in the correct reading frame, the single polyprotein through which expression of the entire poliovirus genome occurs.
- the recombinant poliovirus nucleic acid can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the poliovirus genome is comprised of RNA which replicates in the absence of a DNA intermediate, it is typically introduced into a cell in the form of RNA. This avoids integration of the poliovirus genome into that of the host cell.
- Proteins or portions of proteins necessary for encapsidation of a recombinant poliovirus nucleic acid include, for example, proteins or portions of proteins that are part of the capsid structure.
- proteins are the proteins encoded by the VP1, VP2, VP3, and VP4 genes of the poliovirus P1 capsid precursor region, the Vpg protein, and those proteins that are necessary for proper processing of structural proteins of the capsid structure, such as the proteases responsible for cleaving the viral polyprotein.
- the nucleotide sequence lacking from the recombinant poliovirus nucleic acid can be the result of a deletion of poliovirus nucleotide sequences or a deletion of poliovirus nucleotide sequences and insertion of a foreign nucleotide sequence in the place of the deleted sequences.
- the nucleotide sequence lacking from the recombinant poliovirus nucleic acid is the P1 region of the poliovirus genome or a portion thereof, which is replaced by a foreign gene.
- the phrase "which lacks the entire P1 capsid precursor region" when used to refer to a recombinant poliovirus nucleic acid is intended to include recombinant poliovirus nucleic acids in which the nucleotide sequence encoding the P1 capsid precursor protein has been deleted or altered such that the proteins which are normally encoded by this nucleotide sequence are not expressed or are expressed in a form which does not function normally.
- the proteins that are normally encoded by the P1 capsid precursor region of the poliovirus genome include the proteins encoded by the VP 1, VP2, VP3, and VP4 genes.
- a recombinant poliovirus nucleic acid which lacks the entire P1 capsid precursor region therefore, either does not include a nucleotide sequence which encodes the proteins encoded by the VP1, VP2, VP3, and VP4 genes or includes a nucleotide sequence which encodes, in unexpressible form or in expressible but not functional form, the proteins encoded by the VP1, VP2, VP3, and VP4 genes.
- recombinant poliovirus nucleic acids which lack the entire P1 capsid precursor region can include nucleotide sequences which encode amino acids which are included in the proteins encoded by the VP1, VP2, VP3, and VP4 genes so long as the nucleotide sequence encoding these amino acids of the capsid proteins do not encode the capsid proteins in expressible form or if in expressible form, not functional form.
- the entire P1 capsid precursor region of the poliovirus genome with the exception of a nucleotide sequence which encodes the first two amino acids (i.e., Met-Gly) of the poliovirus P1 capsid precursor protein, is deleted and replaced with a foreign nucleotide sequence.
- a nucleotide sequence which encodes the first two amino acids (i.e., Met-Gly) of the poliovirus P1 capsid precursor protein is deleted and replaced with a foreign nucleotide sequence.
- nucleotide sequences from the poliovirus genome e.g., nucleotide sequences which encode amino acid sequences which provide cleavage sites for poliovirus enzymes, e.g., 2A protease, or nucleotide sequences which encode other proteins required for proper processing of a protein encoded by the poliovirus nucleic acid, can be included in recombinant poliovirus nucleic acids which lack the entire P1 capsid precursor region.
- nucleotide sequences which encode amino acids which are used as spacers within the poliovirus polyprotein to provide an amino acid sequence of the proper length and of the proper sequence for processing of the poliovirus polyprotein can also be included in recombinant poliovirus nucleic acids which lack the entire P1 capsid precursor region.
- the foreign nucleotide sequence (or gene) which is substituted for a poliovirus nucleotide sequence preferably is one that encodes, in an expressible form, a foreign protein or fragment thereof.
- foreign genes that can be inserted into the deleted region of the poliovirus nucleic acid can be those that encode immunogenic proteins.
- Such immunogenic proteins include, for example, tumor-associated antigens, e.g., human tumor-associated antigens, such as carcinoembryonic antigen (CEA), the ganglioside antigens GM2, GD2, and GD3 from melanoma cells, the antigen Jen CRG from colorectal and lung cancer cells, synthetic peptides of immunoglobulin epitope from B cell malignancies, antigens which are products of oncogenes such as erb, neu, and sis, or any other tumor-associated antigen, antigens obtained from various pathogens, such as hepatitis B surface antigen, influenza virus hemaglutinin and neuraminidase, human immunodeficiency viral proteins, such as gag, pol, and env, respiratory syncycial virus G protein, and the VP4 and VP1 proteins of rotavirus, bacterial antigens such as fragments of tetanus toxin, diphtheria toxin,
- portions of the foreign genes which encode immunogenic proteins can be inserted into the deleted region of the poliovirus nucleic acid.
- These genes can encode linear polypeptides consisting of B and T cell epitopes. As these are the epitopes with which B and T cells interact, the polypeptides stimulate an immune response. It is also possible to insert chimeric foreign genes into the deleted region of the poliovirus nucleic acid which encode fusion proteins or peptides consisting of both B cell and T cell epitopes. Similarly, any foreign nucleotide sequence encoding an antigen from an infectious agent can be inserted into the deleted region of the poliovirus nucleic acid.
- the foreign gene inserted into the deleted region of the poliovirus nucleic acid can also encode, in an expressible form, immunological response modifiers such as interleukins (e.g. interleukin-1, interleukin-2, interleukin-6, etc.), tumor necrosis factor (e.g. tumor necrosis factor- ⁇ , tumor necrosis factor- ⁇ ), or additional cytokines (granulocyte-monocyte colony stimulating factor, interferon- ⁇ ).
- interleukins e.g. interleukin-1, interleukin-2, interleukin-6, etc.
- tumor necrosis factor e.g. tumor necrosis factor- ⁇ , tumor necrosis factor- ⁇
- additional cytokines granulocyte-monocyte colony stimulating factor, interferon- ⁇ .
- lymphokines or cytokines the encapsidated poliovirus nucleic acid encoding the lymphokine or cytokine provides for limited expression (by the length of time it takes for the replication of the genome
- genes encoding antisense nucleic acid such as antisense RNA, or genes encoding ribozymes (RNA molecules with endonuclease or polymerase activities) can be inserted into the deleted region of the poliovirus nucleic acid.
- the antisense RNA or ribozymes can be used to modulate gene expression or act as anti-viral agents.
- herpes simplex thymidine kinase which can be used for tumor therapy
- SV40 T antigen which can be used for cell immortalization
- protein products from herpes simplex virus e.g., ICP-27
- adeno-associated virus e.g., Rep
- Foreign genes encoding, in an expressible form, cell surface proteins, secretory proteins, or proteins necessary for proper cellular function which supplement a nonexistent, deficient, or nonfunctional cellular supply of the protein can also be inserted into the deleted region of the poliovirus nucleic acid.
- the nucleic acid of genes encoding secretory proteins comprises a structural gene encoding the desired protein in a form suitable for processing and secretion by the target cell.
- the gene can be one that encodes appropriate signal sequences which provide for cellular secretion of the product.
- the signal sequence can be the natural sequence of the protein or exogenous sequences. In some cases, however, the signal sequence can interfere with the production of the desired protein.
- nucleotide sequence which encodes the signal sequence of the protein can be removed. See Example 7, below.
- the structural gene is linked to appropriate genetic regulatory elements required for expression of the gene product by the target cell. These include a promoter and optionally an enhancer element along with the regulatory elements necessary for expression of the gene and secretion of the gene encoded product.
- the foreign genes that are substituted for the capsid genes of the P1 capsid precursor region of the poliovirus genome are the gag (SEQ ID NO: 3; the sequence of the corresponding gag protein is represented by SEQ ID NO: 4), pol (SEQ ID NO: 5; the sequence of the corresponding pol protein is represented by SEQ ID NO: 6), or env (SEQ ID NO: 7; the sequence of the corresponding env protein is represented by SEQ ID NO: 8) genes, or portions thereof, of the human immunodeficiency virus type 1 (HIV-1). See Example 5, below. Portions of these genes are typically inserted in the poliovirus between nucleotides 1174 and 2956.
- the entire genes are typically inserted in the poliovirus between nucleotides 743 and 3359.
- the translational reading frame is thus conserved between the HIV-1 genes and the poliovirus genes.
- the chimeric HIV-1-poliovirus RNA genomes replicate and express the appropriate HIV-1-P1 fusion proteins upon transfection into tissue culture. Choi, W. S. et al. (June 1991) J. Virol. 65(6): 2875-2883.
- foreign genes encoding tumor-associated antigens or portions thereof, such as carcinoembryonic antigen or portions thereof can be substituted for the capsid genes of the P1 capsid precursor region of the poliovirus genome. See Example 7, below.
- essential poliovirus capsid proteins are provided by an expression vector which is introduced into the host cell along with the recombinant poliovirus nucleic acid.
- the expression vectors can be introduced into the host cell prior to, concurrently with, or subsequent to the introduction of the recombinant poliovirus nucleic acid.
- nonencapsidated recombinant poliovirus nucleic acid can be delivered directly to target cells, e.g., by direct injection into, for example, muscle cells (see, for example, Acsadi et al. (1991) Nature 332:815-818; Wolff et al.
- the expression vector is introduced into the host cell prior to the introduction of the recombinant poliovirus nucleic acid.
- the introduction of the expression vector into the host cell prior to the introduction of the recombinant poliovirus nucleic acid allows the initial expression of the protein or portion of the protein necessary for encapsidation by the expression vector.
- Previous studies have established that the replication and expression of the poliovirus genes in cells results in the shutoff of host cell protein synthesis which is accomplished by the 2A pro protein of poliovirus.
- the expression vector in order for efficient encapsidation, the expression vector must express the protein necessary for encapsidation. In order for this to occur, the expression vector is generally introduced into the cell prior to the addition of the recombinant poliovirus nucleic acid.
- Expression vectors suitable for use in the present invention include plasmids and viruses, the nucleic acids of which encode at least a portion of a protein necessary for encapsidation of the recombinant poliovirus nucleic acid and direct expression of the nucleotide sequence encoding at least a portion of a protein necessary for encapsidation of the recombinant poliovirus nucleic acid.
- the nucleic acid of the expression vectors of the present invention does not substantially associate with poliovirus capsid proteins or portions thereof.
- expression vectors of the present invention when introduced into a host cell along with the recombinant poliovirus nucleic acid, result in a host cell yield of encapsidated viruses which is substantially composed of encapsidated recombinant poliovirus nucleic acid.
- the phrases "substantially composed” or “substantially comprises” when used to refer to a yield of encapsidated recombinant poliovirus nucleic acids is intended to include a yield of encapsidated recombinant poliovirus nucleic acid which is greater than a yield of encapsidated recombinant poliovirus nucleic acid which is generated through the use of an expression vector which encodes poliovirus capsid proteins but also includes an infectious poliovirus genome.
- Infectious poliovirus genomes can compete with the recombinant poliovirus nucleic acid for poliovirus capsid proteins, thereby decreasing the yield of encapsidated recombinant poliovirus nucleic acid.
- the nucleic acid of the expression vector encodes and directs expression of the nucleotide sequence coding for a capsid protein which the recombinant poliovirus nucleic acid is not capable of expressing.
- the expression vector can encode the entire P1 capsid precursor protein.
- Plasmid expression vectors can typically be designed and constructed such that they contain a gene encoding, in an expressible form, a protein or a portion of a protein necessary for encapsidation of the recombinant poliovirus nucleic acid. Generally, construction of such plasmids can be performed using standard methods, such as those described in Sambrook, J. et al. Molecular Cloning: A Laboratory Manual, 2nd edition (CSHL Press, Cold Spring Harbor, N. Y. 1989). A plasmid expression vector which expresses a protein or a portion of a protein necessary for encapsidation of the poliovirus nucleic acid is constructed by first positioning the gene to be inserted (e.g.
- the promoter sequence consists of a cellular or viral DNA sequence which has been previously demonstrated to attract the necessary host cell components required for initiation of transcription. Examples of such promoter sequences include the long terminal repeat (LTR) regions of Rous Sarcoma Virus, the origin of replication for the SV40 tumor virus (SV4-ori), and the promoter sequence for the CMV (cytomegalovirus) immediate early protein. Plasmids containing these promoter sequences are available from a number of companies which sell molecular biology products (e.g. Promega (Madison, Wis.), Stratagene Cloning Systems (LaJolla, Calif.), and Clontech (Palo Alto, Calif.).
- LTR long terminal repeat
- CMV cytomegalovirus
- Plasmid expression vectors typically requires excision of a DNA fragment containing the gene to be inserted and ligation of this DNA fragment into an expression plasmid cut with restriction enzymes that are compatible with those contained on the 5' and 3' ends of the gene to be inserted. Following ligation of the DNA in vitro, the plasmid is transformed into E. coli and the resulting bacteria is plated onto an agar plate containing an appropriate selective antibiotic. The E. coli colonies are then grown and the plasmid DNA characterized for the insertion of the particular gene. To confirm that the gene has been ligated into the plasmid, the DNA sequence of the plasmid containing the insert is determined. The plasmid expression vector can be transfected into tissue culture cells using standard techniques and the protein encoded by the inserted gene expressed.
- plasmid expression vectors are introduced into a host cell vary depending on certain factors. These factors include, for example, the size of the nucleic acid of the plasmid, the type of host cell, and the desired efficiency of transfection.
- transfection methods include, for example, calcium phosphate-mediated uptake of nucleic acids by a host cell and DEAE-dextran facilitated uptake of nucleic acid by a host cell.
- nucleic acids can be introduced into cells through electroporation, (Neumann, E. et al. (1982) EMBO J.
- viral expression vectors can be designed and constructed such that they contain a foreign gene encoding a foreign protein or fragment thereof and the regulatory elements necessary for expressing the foreign protein.
- Viruses suitable for use in the method of this invention include viruses that contain nucleic acid that does not substantially associate with poliovirus capsid proteins. Examples of such viruses include retroviruses, adenoviruses, herpes virus, and Sindbis virus. Retroviruses, upon introduction into a host cell, establish a continuous cell line expressing a foreign protein. Adenoviruses are large DNA viruses which have a host range in human cells similar to that of poliovirus.
- Sindbis virus is an RNA virus that replicates, like poliovirus, in the cytoplasm of cells and, therefore, offers a convenient system for expressing poliovirus capsid proteins.
- a preferred viral expression vector is a vaccinia virus.
- Vaccinia virus is a DNA virus which replicates in the cell cytoplasm and has a similar host range to that of poliovirus.
- vaccinia virus can accommodate large amounts of foreign DNA and can replicate efficiently in the same cell in which poliovirus replicates.
- a preferred nucleotide sequence that is inserted in the vaccinia is the nucleotide sequence encoding and expressing, upon infection of a host cell, the poliovirus P1 capsid precursor polyprotein.
- this vaccinia viral vector is described by Ansardi, D. C. et al. (Apr. 1991) J. Virol. 65(4): 2088-2092. Briefly, type I Mahoney poliovirus cDNA sequences were digested with restriction enzyme Nde I, releasing sequences corresponding to poliovirus nucleotides 3382-6427 from the plasmid and deleting the P2 and much of the P3 encoding regions.
- Two synthetic oligonucleotides (5'-TAT-TAG-TAG-ATC-TG (SEQ ID NO: 1)) and 5'-T-ACA-GAT-GTA-CTA-A (SEQ ID NO: 2)) were annealed together and ligated into the Nde I digested DNA.
- the inserted synthetic sequence is places two translational termination codons (TAG) immediately downstream from the codon for the synthetic P1 carboxy terminal tyrosine residue.
- TAG translational termination codons
- the engineered poliovirus sequences encode an authentic P1 protein with a carboxy terminus identical to that generated when 2A pro releases the P1 polyprotein from the nascent poliovirus polypeptide.
- the entry of viral expression vectors into host cells generally requires addition of the virus to the host cell media followed by an incubation period during which the virus enters the cell.
- Incubation conditions such as the length of incubation and the temperature under which the incubation is carried out, vary depending on the type of host cell and the type of viral expression vector used. Determination of these parameters is well known to those having ordinary skill in the art.
- the incubation conditions for the infection of cells with viruses typically involves the incubation of the virus in serum-free medium (minimal volume) with the tissue culture cells at 37° C. for a minimum of thirty minutes.
- a compound to facilitate the interaction of the virus with the host cell is added. Examples of such infection facilitators include polybrine and DEAE.
- a host cell useful in the present invention is one into which both a recombinant poliovirus nucleic acid and an expression vector can be introduced.
- Common host cells are mammalian host cells, such as, for example, HeLa cells (ATCC Accession No. CCL 2), HeLa S3 (ATCC Accession No. CCL 2.2), the African Green Monkey cells designated BSC-40 cells, which are derived from BSC-1 cells (ATCC Accession No. CCL 26), and HEp-2 cells (ATCC Accession No. CCL 23).
- Other useful host cells include chicken cells. Because the recombinant poliovirus nucleic acid is encapsidated prior to serial passage, host cells for such serial passage are preferably permissive for poliovirus replication.
- Cells that are permissive for poliovirus replication are cells that become infected with the recombinant poliovirus nucleic acid, allow viral nucleic acid replication, expression of viral proteins, and formation of progeny virus particles.
- poliovirus causes the host cell to lyse.
- the poliovirus may not act in a lytic fashion.
- Nonpermissive cells can be adapted to become permissive cells, and such cells are intended to be included in the category of host cells which can be used in this invention.
- the mouse cell line L929 a cell line normally nonpermissive for poliovirus replication, has been adapted to be permissive for poliovirus replication by transfection with the gene encoding the poliovirus receptor.
- the encapsidated recombinant poliovirus nucleic acid of the invention can be used as a vaccine in the form of a composition for stimulating a mucosal as well as a systemic immune response to the foreign protein encoded and expressed by the encapsidated recombinant poliovirus nucleic acid in a subject.
- a composition for stimulating a mucosal as well as a systemic immune response to the foreign protein encoded and expressed by the encapsidated recombinant poliovirus nucleic acid in a subject.
- genes encoding proteins that can be inserted into the poliovirus nucleic acid are described above.
- the mucosal immune response is an important immune response because it offers a first line of defense against infectious agents, such an human immunodeficiency virus, which can enter host cells via mucosal cells.
- At least a portion of a capsid protein of the encapsidated recombinant poliovirus nucleic acid is supplied by an expression vector which lacks an infectious poliovirus genome.
- Expression vectors suitable for supplying a capsid protein or a portion thereof are described above.
- the subject Upon administration of the encapsidated recombinant poliovirus nucleic acid, the subject generally responds to the immunizations by producing both anti-poliovirus antibodies and antibodies to the foreign protein or fragmemt thereof which is expressed by the recombinant poliovirus nucleic acid.
- the antibodies produced against the foreign protein or fragment thereof provide protection against the disease or detrimental condition caused by the source of the protein or fragment thereof, e.g., virus, bacteria, or tumor cell.
- the protection against disease or detrimental conditions offered by these antibodies is greater than the protection offered by the subject's immune system absent administration of the recombinant poliovirus nucleic acids of the invention.
- the recombinant poliovirus nucleic acid in either its DNA or RNA form, can also be used in a composition for stimulating a systemic and a mucosal immune response in a subject. Administration of the RNA form of the recombinant poliovirus nucleic acid is preferred as it typically does not integrate into the host cell genome.
- the encapsidated recombinant poliovirus nucleic acid or the non-encapsidated recombinant poliovirus nucleic acid can be administered to a subject in a physiologically acceptable carrier and in an amount effective to stimulate an immune response to at least the foreign protein or fragment thereof which is encoded (and its expression directed) by the recombinant poliovirus nucleic acid.
- a subject is immunized through an initial series of injections (or administration through one of the other routes described below) and subsequently given boosters to increase the protection afforded by the original series of administrations.
- the initial series of injections and the subsequent boosters are administered in such doses and over such a period of time as is necessary to stimulate an immune response in a subject.
- Physiologically acceptable carriers suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the composition should typically be sterile and fluid to the extent that easy syringability exists.
- the composition should further be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- a coating such as lecithin
- surfactants for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- Sterile injectable solutions can be prepared by incorporating the encapsidated recombinant poliovirus nucleic acid in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- the protein can be orally administered, for example, with an inert diluent or an assimilable edible carrier.
- the protein and other ingredients can also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet.
- the active compound can be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- physiologically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
- solvents dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
- the use of such media and agents for physiologically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated.
- Subjects who can be treated by the method of this invention include living organisms, e.g., mammals.
- subjects who can be treated by the method of this invention are susceptible to diseases, e.g., infectious diseases, cancer, or are susceptible to a detrimental condition which can be treated by the methods described herein, e.g., a detrimental condition resulting from a nonexistent, deficient, or nonfunctional supply of a protein which is normally produced in the subject.
- Infectious agents which initiate a variety of diseases include microorganisms such as viruses and bacteria. Examples of subjects include humans, monkeys, dogs, cats, rats, and mice.
- the amount of the immunogenic composition which can stimulate an immune response in a subject can be determined on an individual basis and is typically based, at least in part, on consideration of the activity of the specific immunogenic composition used. Further, the effective amounts of the immunogenic composition can vary according to the age, sex, and weight of the subject being treated. Thus, an effective amount of the immunogenic composition can be determined by one of ordinary skill in the art employing such factors as described above using no more than routine experimentation.
- the immunogenic composition is administered through a route which allows the composition to perform its intended function of stimulating an immune response to the protein encoded by the recombinant poliovirus nucleic acid.
- routes of administration which can be used in this method include parenteral (subcutaneous, intravenous, intramuscular, intra-arterial, intraperitoneal, intrathecal, intracardiac, and intrasternal), enteral administration (i.e. administration via the digestive tract, e.g. oral, intragastric, and intrarectal administration), and mucosal administration. It is important to note that the vaccine strains of poliovirus are routinely tested for attenuation by intramuscular and intracerebral injection into monkeys.
- the immunogenic composition can be coated with or in a material to protect it from the natural conditions which can detrimentally affect its ability to perform its intended function.
- Cells that produce the encapsidated poliovirus nucleic acids of the present invention can be introduced into a subject, thereby stimulating an immune response to the foreign protein or fragment thereof encoded by the recombinant poliovirus nucleic acid.
- the cells that are introduced into the subject are first removed from the subject and contacted ex vivo with both the recombinant poliovirus nucleic acid and an expression vector as described above to generate modified cells that produce the foreign protein or fragment thereof.
- the modified cells that produce the foreign protein or fragment thereof can then be reintroduced into the subject by, for example, injection or implantation.
- Examples of cells that can be modified by this method and injected into a subject include peripheral blood mononuclear cells, such as B cells, T cells, monocytes and macrophages. Other cells, such as cutaneous cells and mucosal cells can be modified and implanted into a subject. Methods of introducing the recombinant poliovirus nucleic acid and the expression vectors of the invention are described above.
- HeLa (human cervical carcinoma) and BSC-40 cells African green monkey kidney cells) were grown in DMEM supplemented with 5% A- ⁇ newborn calf serum and 5% fetal calf serum (complete medium).
- the stock of the poliovirus type 1 Mahoney used in this study was derived from transfection of an infectious cDNA clone obtained from B. Semler, University of California at Irvine. Semler, B. L. et al. (1984) Nucleic Acids Res. 12:5123-5141.
- the stock of type 1 Sabin poliovirus was obtained from the American Type Culture Collection (ATCC Accession No. VR-192).
- Wild-type vaccinia virus (wt VV) strain WR and the recombinant vaccinia virus VV-P1, which express the poliovirus P1 capsid precursor protein, have been previously described.
- Antisera to HIV-1 reverse transcriptase (RT) and HIV-1 p25/24 Gag were obtained through the AIDS Research and Reference Reagent Program (Rockville, Md.). Pooled AIDS patient sera was obtained from the Center for AIDS Research, University of Alabama at Birmingham.
- Reaction mixtures (100 ⁇ l) contained 1 to 5 ⁇ g of linearized DNA template, 5 ⁇ transcription buffer (100 mM Tris pH 7.7!, 50 mM MgCl 2 , 20 mM spermidine, 250 mM NaCl), 10 mM dithiotheritol, 2mM each GTP, UTP, ATP, and CTP, 40 U of recombinant RNasin (Promega, Madison, Wis.), and approximately 5 ⁇ g of purified T7 RNA polymerase per reaction mixture. After 60 min at 37° C., 5% of the in vitro-synthesized RNA was analyzed by agarose gel electrophoresis.
- HeLa cells were infected with 20 PFU of VV-P1 (a recombinant virus which expresses the poliovirus capsid precursor protein P1) or wild type (wt) VV per cell. After 2 hours of infection, the cells were transfected (by using DEAE-dextran 500,000 Da! as a facilitator) with RNA transcribed in vitro from the chimeric HIV-1 poliovirus genomes as previously described. Choi, W. S. et al. (1991) J. Virol. 65:2875-2883. The cultures were harvested at 24 hours posttransfection.
- the cells were lysed with Triton X-100 at a concentration of 1%, treated with RNase A, and clarified by low-speed centrifugation at 14,000 ⁇ g for 20 min at 4° C. as described previously. Li, G. et al. (1991) J. Virol. 65:6714-6723. The supernatants were adjusted to 0.25% sodium dodecyl sulfate (SDS), overlaid on a 30% sucrose cushion (30% sucrose, 30 mM Tris pH 8.0!, 1% Triton X-100, 0.1M NaCl), and centrifuged in a Beckman SW55Ti rotor at 45,000 rpm for 1.5 h.
- SDS sodium dodecyl sulfate
- the pelleting procedure described above has been demonstrated to be effective for the removal of infectious vaccinia virus to below detectable levels.
- the supernatant was discarded, and the pellet was washed by recentrifugation for an additional 1.5 hours in a low salt buffer (30 mM Tris pH 8.0!, 0.1 M NaCl).
- the pellets were then resuspended in complete DMEM and designated passage 1 of the recombinant poliovirus nucleic acids encapsidated by VV-P 1.
- BSC-40 cells were infected with 20 PFU of VV-P1 per cell. At 2 hours postinfection, the cells were infected with passage 1 of the encapsidated recombinant poliovirus nucleic acids. The cultures were harvested at 24 hours postinfection by three successive freeze-thaws, sonicated, and clarified by centrifugation at 14,000 ⁇ g for 20 min. The supernatants were then stored at -70° C. or used immediately for additional passages following the same procedure.
- RNA from a stock of recombinant poliovirus nucleic acids encapsidated by VV-P1 was analyzed by Northern (RNA) blotting.
- Stocks of encapsidated recombinant poliovirus nucleic acids at passage 14 and a high-titer stock of type 1 Mahoney poliovirus were subjected to RNase A treatment and overlaid on 30% sucrose cushion (30% sucrose, 30 mM Tris pH 8.0!, 1% Triton X-100, 0.1M NaCl). The samples were centrifuged in a Beckman SW55Ti rotor at 45,000 rpm for 1.5 h.
- RNA was then transferred from the gel to a nitrocellulose filter by capillary elution (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press, N.Y.)) and cross-linked by using a UV Stratalinker (Stratagene, LaJolla, Calif.).
- UV Stratalinker Stratagene, LaJolla, Calif.
- the conditions used for prehybridization, hybridization, and washing of RNA immobilized on filters were previously described (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press, N.Y.)).
- the blot was prehybridized in hybridization buffer (50% deionized formamide, 6 ⁇ SSC 1 ⁇ SSC is 0.15M NaCl plus 0.015 M sodium citrate!, 1% SDS, 0.1% Tween 20, 100 ⁇ g of yeast tRNA per ml).
- hybridization buffer containing 10 6 cpm of a 32 P! UTP-labeled riboprobe complementary to nucleotides 671 to 1174 of the poliovirus genome (Choi, W. S. et al (1991) J. Virol. 65:2875-2883) per ml.
- the blot was washed two times with 0.1 ⁇ SSC-0.1% SDS at room temperature and one time at 65° C. The blot was then exposed to X-ray film with an intensifying screen.
- encapsidated recombinant poliovirus nucleic acids at passage 9 were pelleted by ultracentrifugation and resuspended in 250 ⁇ l of phosphate-buffered saline (pH 7.0)-0.1% bovine serum albumin. Samples were preincubated with 25 ⁇ l of either rabbit anti-poliovirus type 1 Mahoney antisera or preimmune sera per sample at 37° C. for 2 hours. Neutralization experiments were conducted on the basis of the results of preliminary experiments analyzing the capacity of anti-poliovirus antisera to prevent infection of cells by 10 6 total PFU of poliovirus under the experimental conditions. The preincubated samples were then analyzed for protein expression by infection of BSC-40 cells which were metabolically labeled at 6 hours postinfection followed by immunoprecipitation of viral proteins.
- BSC-40 cells were coinfected with 10 PFU of type 1 Sabin poliovirus and a stock of encapsidated recombinant poliovirus nucleic acids (passage 14) per cell.
- the infected cells were harvested at 24 hours postinfection by three successive freeze-thaws, sonicated and clarified by centrifugation at 14,000 ⁇ g for 20 minutes as described previously (Li, G., et al. J. Virol. 65:6714-6723). Approximately one-half of the supernatant was used for serial passaging by reinfection of BSC-40 cells. After 24 hours, the cultures were harvested as described above, and the procedure was repeated for an additional 10 serial passages.
- FIG. 2 shows chimeric HIV-1-poliovirus genomes containing regions of the HIV-1 gag or pol gene substituted for the poliovirus P1 gene. Details of the construction of plasmids pT7-IC-GAG 1 and pT7-IC-POL have been described by Choi et al.
- pT7IC-NheI-gag pT7IC-NheI-pol
- pT7-IC-G 2 a unique SmaI site was created at nucleotide 1580 of the infectious cDNA or poliovirus, and the HIV-1 gag sequences were subcloned between nucleotides 1580 and 2470. Insertion of the HIV-1 genes maintains the translational reading frame with VP4 and VP1. In vitro transcription from these plasmids generates full-length RNA transcripts (linearized with SalI).
- VV-P1 a recombinant vaccinia virus which expresses the poliovirus capsid precursor protein P1 upon infection was used, since recent studies have shown that in cells coinfected with VV-P1 and poliovirus, P1 protein expressed from VV-P1 can enter the encapsidation pathways of wild type poliovirus.
- FIG. 3 shows an analysis of 3D pol and HIV-1-P1 fusion protein expression from cells infected with VV-P1 and transfected with recombinant poliovirus nucleic acid RNAs.
- Cells were infected with VV-P1 at a multiplicity of infection of 20. At 2 hours postinfection, cells were transfected with RNA derived from in vitro transcription of the designated plasmids.
- a protein of molecular mass 72 kDa corresponding to the 3CD protein of poliovirus, was immunoprecipitated by anti-3D pol antibodies from cells transfected with the recombinant poliovirus RNA but not from mock-transfected cells.
- the 3CD protein which is a fusion protein between the 3C pol and 3D pol proteins of poliovirus, is predominately detected upon incubation of lysates from poliovirus infected cells with 3D pol antisera to determine whether the appropriate HIV-1-P1 fusion proteins were also expressed, the extracts were incubated with pooled AIDS patient sera (gag) or rabbit anti-RT antibodies (Pol).
- HIV-1-Gag-P1 fusion proteins corresponding to the predicted molecular masses 80 and 95 kDa were detected from cells transfected with RNA genomes derived by in vitro transcription of pT7-IC-GAG 1 and pT7-IC-GAG 2, respectively.
- an HIV-1 Pol-P 1 fusion protein of the predicted molecular mass 85 kDa was immunoprecipitated from cells transfected with RNA derived from the in vitro transcription of pT7-IC-POL.
- the recombinant poliovirus RNA's were transfected into either VV-P1 or wt VV-infected cells, and the encapsidation genomes were isolated as described in Materials and Methods I. The pelleted material was then used to reinfect cells. This procedure was followed by metabolic labeling of viral proteins and incubation with anti-3D pol or HIV-1-antisera (FIGS. 4A and 4B).
- FIGS. 4A and 4B show an analysis of poliovirus- and HIV-1-specific protein expression from cells infected with recombinant poliovirus nucleic acids which were encapsidated and serially passaged with capsid proteins provided by VV-P1.
- Cells were infected with VV-P1 or wt VV at a multiplicity of infection of 20 and transfected with RNA derived from in vitro transcription of the designated plasmids.
- the cells were harvested for isolation of encapsidated genomes as described in Materials and Methods 1.
- the pelleted material was used to reinfect cells, which were metabolically labeled, and cell lysates were incubated with the designated antibodies. Immunoreactive proteins were analyzed on SDS-polyacrylamide gels.
- FIG. 4A Lanes: 1 and 5, cells infected with pelleted material derived from cells infected with wt VV and transfected with RNA derived from pT7-IC-GAG 1; 2 and 6, cells infected with pelleted material derived from cells infected with VV-P1 and transfected with RNA derived from pT7-IC-GAG 1; 3 and 7, cells infected with pelleted material derived from cells infected with wt VV and transfected with RNA derived from pT7-IC-GAG 2; 4 and 8, cells infected with pelleted material derived from cells infected with VV-P1 and transfected with RNA derived from pT7-IC-GAG2.
- FIG. 4B Lanes: 1 and 3, cells infected with pelleted material derived from cells infected with wt VV and transfected with RNA derived from pT7-IC-POL; 2 and 4, cells infected with pelleted material derived from cells infected with VV-P 1 and transfected with RNA derived from PT7-IC-POL.
- the poliovirus 3CD protein was immunoprecipitated from cells infected with pelleted material derived from transfection of the recombinant poliovirus RNA into VV-P1 infected cells.
- the molecular masses of the HIV-1-P1 fusion proteins immunoprecipitated from the infected cells were consistent with the predicted molecular masses and those observed from expression of the recombinant poliovirus nucleic acid in transfected cells (FIG. 2).
- No 3D pol or HIV-1-P1 proteins were detected from cells infected with material derived from transfection of the chimeric genomes into wt VV-infected cells, demonstrating a requirement for the poliovirus P1 protein for encapsidation of the recombinant poliovirus nucleic acid.
- passage 1 stock of the encapsidated recombinant poliovirus nucleic acid was used to infect cells that had been previously infected with VV-P 1.
- the encapsidated recombinant poliovirus nucleic acids were isolated as described in Materials and Methods I and subsequently used to reinfect cells which had been previously infected with VV-P1; this procedure was repeated for an additional nine passages.
- the stocks of serially passaged recombinant poliovirus RNA are referred to as vIC-GAG 1, vIC-GAG 2, or vIC-POL.
- FIG. 4C stocks of the encapsidated recombinant poliovirus nucleic acids were also used to infect cells which had been previously infected with VV-P1 for serial passage of the encapsidated genomes as described in Materials and Methods I.
- Cells were infected with serially passaged stocks of recombinant poliovirus nucleic acids at passage 9 and metabolically labeled, and cell extracts were incubated with the designated antibodies (ab).
- Immunoreactive proteins were analyzed on SDS-polyacrylamide gels. Lanes: 1, cells infected with wild-type poliovirus; 2 and 5, cells infected with vIC-GAG 1; 3 and 6, Cells infected with vIC-GAG2; 4 and 7, cells infected with vIC-POL. The positions of molecular mass standards are indicated.
- the poliovirus 3CD protein was immunoprecipitated from cells infected with poliovirus and the encapsidated recombinant poliovirus nucleic acids.
- the HIV-1-Gag-P1 and HIV-1-Pol-P1 fusion proteins were also immunoprecipitated from cells infected with the serially passaged recombinant poliovirus nucleic acids.
- no immunoreactive proteins were detected from cells which were infected with VV-P1 alone and immunoprecipitated with the same antisera (FIG. 3).
- FIG. 5 shows a Northern blot analysis of RNA isolated from a stock of encapsidated recombinant poliovirus nucleic acids.
- Virions were isolated by ultracentrifugation from a stock of vIC-GAG 1 at passage 14 and from type 1 Mahoney poliovirus. The isolated virions were disrupted, and the RNA was precipitated, separated in a formaldehyde-agarose gel, and transferred to nitrocellulose.
- RNA isolated from vIC-GAG 1 was compared with RNA isolated from type 1 Mahoney poliovirions. The migration of the RNA isolated from vIC-GAG 1 was slightly faster than that of the wild-type poliovirus RNA, consistent with the predicted 7.0-kb size for RNA from pT7-IC-GAG 1 versus the 7.5-kb size for wild-type poliovirus RNA. Furthermore, a single predominant RNA species from vIC-GAG 1 was detected, indicating that no significant deletions of the RNA had occurred during the serial passages.
- FIG. 6 shows neutralization of recombinant poliovirus nucleic acids encapsidated by VV-P1 with anti-poliovirus antibodies.
- Cells were infected with a passage 9 stock of vIC-GAG 1 that had been preincubated with anti-poliovirus type 1 antisera or preimmune sera as described in Materials and Methods I.
- Infected cells were metabolically labeled, cell lysates were incubated with anti-3D pol antibodies (lanes 1 to 3) or pooled AIDS patient sera (lanes 4 and 5), and immunoreactive proteins were analyzed on SDS-polyacrylamide gels. Lanes: 1, cells infected with wild-type poliovirus (no neutralization); 2 and 4, cells infected with vIC-GAG 1 which had been preincubated with preimmune sera: 3 and 5, cells infected with vIC-GAG 1 which had been preincubated with anti-poliovirus type 1 antisera. The positions of molecular mass standards are indicated.
- Poliovirus capsid proteins were detected from cells infected with type 1 Sabin poliovirus alone and from cells infected with material derived from passaging vIC-GAG 1 with type 1 Sabin poliovirus. No HIV-1 specific proteins were detected from cells infected with type 1 Sabin poliovirus alone. A slight cross-reactivity of the HIV-1-Gag-P1 fusion protein with anti-poliovirus antisera was detected in extracts of cells infected with material derived from passaging vIC-GAG 1 with type 1 Sabin poliovirus (FIG. 7A).
- HIV-1-Gag-P1 fusion protein was clearly detected from cells with type 1 Sabin poliovirus after incubation with pooled AIDS patient sera, some cross-reactivity of the poliovirus capsid proteins were also detected (FIG. 7B).
- the HIV-1-Gag-P1 fusion protein had been immunoprecipitated from extracts of cells infected with material derived from passaging vIC-Gag 1 with type 1 Sabin poliovirus, the extracts were incubated with rabbit anti-p24 antiserum (FIG. 7C).
- HIV-1-Gag-P1 fusion protein was evident from cells infected with material derived from passaging vIC-GAG 1 with type 1 Sabin poliovirus but not from cells infected with type 1 Sabin alone. Furthermore, HIV-1-Gap-P1 fusion protein expression was detected after each serial passage (1 to 10) of vIC-GAG 1 with type 1 Sabin poliovirus.
- the doses were 2.5 ⁇ 10 5 virus PFU poliovirus/mouse for systemic immunization (intramuscular) and 2.5 ⁇ 10 6 PFU poliovirus/mouse for oral immunization. It is important to note that the titer refers only to the type II Lansing in the virus preparation, since the encapsidated recombinant poliovirus nucleic acid alone does not form plaques due to deletion of the P1 capsids.
- the antigen was resuspended in 0.5 ml of RPMI 1640 and administered by means of an animal feeding tube (Moldoveanu et al. (1993) J. Infect. Dis. 167:84-90).
- Intrarectal immunization was accomplished by application of a small dose of virus in solution (10 ⁇ l/mouse intrarectally). Serum, saliva, fecal extract and vaginal lavage were collected before immunization, and two weeks after the initial dose of the virus.
- Biological fluids were collected two weeks after the primary immunization, and one week after the secondary immunization.
- the methods for obtaining biological fluids are as follows:
- Blood was collected from the tail vein with heparinized glass capillary tubes before and at selected times after immunization. The blood was centrifuged and plasma collected and stored at -70° C.
- Stimulated saliva was collected with capillary tubes after injection with carbamyl-choline (1-2 ⁇ g/mouse). Two ⁇ g each of soybean trypsin inhibitor and phenylmethylsulfonyl fluoride (PMSF) was added to the sample followed by clarification by centrifugation at 800 ⁇ g for 15 minutes. Sodium azide (0.1% final concentration) and FCS (1% final concentration) was added after clarification and the sample stored at -70° C. until the assay.
- PMSF phenylmethylsulfonyl fluoride
- Vaginal lavages were performed in mice by applying approximately 50 ⁇ l sterile PBS into the vagina and then aspirating the outcoming fluid.
- Intestinal lavages were performed according to the methods previously described by Elson et al. (Elson, C. O. et al. (1984) J. Immunol. Meth. 67:101-108).
- four doses of 0.5 ml lavage solution (isoosmotic for mouse gastrointestinal secretion) was administered at 15 minute intervals using an intubation needle.
- 0.1 ⁇ g of polycarbine was administered by intraperitoneal injection to the anesthetized mouse. Over the next 10 to 15 minutes the discharge of intestinal contents was collected into a petri dish containing a 5 ml solution of 0.1 mg/ml trypsin soybean inhibitor and 5 mM EDTA.
- the solid material was removed by centrifugation (650 ⁇ g for 10 minutes at 4° C.) and the supernatant collected. Thirty ⁇ l of 100 mM PMSF was then added followed by further clarification at 27,000 ⁇ g for 20 minutes at 4° C. An aliquot of 10 ⁇ l of 0.1% sodium azide and 10% fetal calf serum was added before storage at -70° C.
- Fecal Extract was prepared as previously described (Keller, R., and Dwyer, J. E. (1968) J. Immunol. 101: 192-202).
- An ELISA was used for determining antigen-specific antibodies as well as for total levels of immunoglobulins.
- the assay was performed in 96-well polystyrene microtiter plates (Dynatech, Alexandria, Va.). For coating, purified poliovirus (1 ⁇ g/well) or HIV specific proteins, or solid phase adsorbed, and affinity-purified polyclonal goat IgG antibodies specific for mouse IgG, IgA or IgM (Southern Biotechnology Associates, Birmingham, Ala. (SBA)(1 ⁇ g/well)) were employed. Dilutions of serum or secretions were incubated overnight at 4° C.
- mice To calibrate the total level of mouse IgA, IgG, IgM levels, purified mouse myeloma proteins served as standards.
- the optical densities were converted to ELISA units, using calibration curves obtained from optical density values obtained from reference pools of sera or secretions.
- the calibration curves were constructed using a computer program on either 4-parameter logistic or weighed logit-log models. End point titration values were an alternative way of expressing the results.
- the fold increase values were calculated by dividing post-immunization by pre-immunization values expressed in ELISA units.
- FIGS. 8A, 8B, and 8C show serum anti-poliovirus antibodies (designated total IgG, representing predominantly IgG, with minor contribution of IgM and IgA) for animals immunized via the intragastric, intrarectal, or intramuscular route.
- the samples from each of the 5 animals within the group were pooled, and the ELISA was used to determine the amounts of anti-poliovirus antibodies at a 1:20 dilution.
- a very slight increase in the anti-poliovirus antibodies present in the serum of mice immunized via the intragastric route was observed at Day 45 post booster immunization when compared to the pre-immune levels at Day 0.
- a clear increase in the serum anti-poliovirus antibodies was observed in the animals immunized via the intragastric or intramuscular route at Day 14 and Day 45 post booster immunization.
- the levels at Day 14 and 45 post booster immunization were approximately 5-fold over that observed for the background levels at Day 0.
- FIGS. 9A, 9B, and 9C IgA anti-poliovirus antibodies present in the saliva of animals immunized with the encapsidated recombinant poliovirus nucleic acids were analyzed. In this case, there was a clear increase in the levels of IgA anti-poliovirus antibodies in animals immunized via the intragastric, intrarectal, or intramuscular route at Day 14 and 45 post booster immunization.
- FIGS. 10A and 10B IgA anti-poliovirus antibodies from the vaginal lavage samples taken from mice immunized via the intrarectal or intramuscular route were analyzed.
- IgA anti-poliovirus antibodies were present in extracts from feces obtained from animals immunized via the intragastric, intrarectal or intramuscular route. In all cases, there was an increase of the IgA anti-poliovirus antibodies at Day 21, Day 14 post booster immunization and Day 45 post booster immunization.
- FIGS. 12A, 12B, and 12C show the serum levels of total IgG (representing IgG as the major species and IgM and IgA as the minor species) anti-HIV-1-gag antibodies in the serum of animals immunized via the intragastric, intrarectal, or intramuscular route. No consistent increase in the levels of serum antibodies directed against HIV-1-gag antibodies in animals immunized via the intragastric or intrarectal route was observed. This is represented by the fact that there was no increase in the levels above that observed at Day 0 (pre-immune) value.
- FIGS. 13A, 13B, and 13C IgA anti-HIV-1-gag antibodies present in the saliva of animals immunized via the intragastric, intrarectal or intramuscular route.
- the highest levels of IgA anti-HIV-1-gag antibodies in the saliva were found at Day 45 post booster immunization.
- FIGS. 14A and 14B show a similar pattern for the samples obtained from vaginal lavage of animals immunized via the intrarectal or intramuscular route.
- a pigtail macaque was immunized with 5 ⁇ 10 8 PFU of a virus stock of type I attenuated poliovirus containing the encapsidated recombinant nucleic acid from pT7IC-Gag #2 (FIG. 2).
- intrarectal immunization was performed because of the high concentration of gut associated lymphoid tissue in the rectum of primates.
- the virus was deposited in a volume of 1 ml using a syringe filter with soft plastic tubing and inserted 1 inch into the rectum.
- the analysis of the anti-poliovirus and anti-gag antibodies was as described in Example 2 except that anti-monkey-specific reagents were substituted for anti-murine-specific reagents.
- Serum from the macaque prior to immunization (Day 0), 12 days post primary immunization (12 pp), 27 days post primary immunization (27 pp) were collected.
- a second administration of virus consisting of 1 ml of 5 ⁇ 10 8 PFU given intrarectally and 2.5 ⁇ 10 7 PFU of virus administered intranasally at 27 days post primary immunization.
- HeLa T4 and BSC-40 African green monkey kidney/cell line derived from BSC 1 cells
- cell monolayers were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% fetal calf serum and 1 ⁇ GMS-G supplement (complete medium).
- DMEM Dulbecco's modified Eagle's medium
- the stock of the poliovirus type 1 Mahoney was derived from transfection of an infectious cDNA clone of poliovirus obtained from B Semler, University of California at Irvine (Semler, B. L. et al. (1984) Nucleic Acids Res. 12:5123-5141).
- the stock of poliovirus type 1 Sabin was obtained from American Type Culture Collection.
- the recombinant vaccinia virus VV-P1 which expresses the poliovirus P1 capsid precursor protein upon infection, has also been previously described (Ansardi, D. C. et al. (1991) J. Virol. 65:2088-2092). Antisera (recombinant) to HIV-1 p25/24 Gag (Steimer, K. S. et al. (1986) Virol. 150:283-290) and a recombinant vaccinia virus vVKI (Karacostas, V. K. et al. (1989) Proc. Natl. Acad. Sci.
- the amplified DNA fragment was precipitated and digested with SnaBI and BstEII. After digestion of the plasmid pT7-IC-Sac I with SnaBI and BstEII, the PCR fragment was ligated into the plasmid. The resultant plasmid was designated pT7-IC-Sac I-SnaBI.
- nucleotides 345 to 1837 were amplified from the plasmid pHXB2 (Ratner, L. et al. (1985) Nature 313:277-284) by PCR using the following DNA primers: 5'-GGA-GAG-AGA-TGG-GAG-CTC-GAG-CGT-C-3' (SEQ ID NO: 11), and 5'-GCC- CCC-CTA-TAC-GTA-TTG-TG-3' (SEQ ID NO: 12).
- the DNA fragment was ligated into the plasmid pT7-IC-Sac I-SnaBI after digestion of the fragment DNA and pT7-IC-Sac I-SnaBI with Sac I and SnaBI DNA sequencing confirmed that the translational reading frame was maintained between the foreign gene and poliovirus.
- the final construct was designated as pT7-IC-Pr55 gag .
- a second recombinant poliovirus nucleic acid containing the HIV-1 gag gene was constructed to position nucleotides 1-949 of the poliovirus genome 5' to the HIV-1 gag gene.
- the following primers were designed to amplify a DNA fragment from the plasmid pT7-IC from a unique EcoRi site, located upstream of the T7 RNA polymerase promoter, to nucleotide 949: 5'-CCA-GTG-AAT-TCC-TAA-TAC-GAC-TCA-CTA-TAG-GTT-AAA-ACA-GC-3' (SEQ ID NO: 13) and 5'-CTC-TAT-CCT-GAG-CTC-CAT-ATG-TGT-CGA-GCA-GTT-TTT-GGT-TTA-GCA-TTG-3' (SEQ ID NO: 14).
- primers were designed to include a 2A protease cleavage site (tyrosine-glycine amino acid pair (underlined) preceded by six wild-type amino acids: Thr-Lys-Asp-Leu-Thr-Thr-Tyr-Gly) (SEQ ID NO: 15), corresponding to the authentic 2A cleavage site in the 3DP pol gene at nucleotide 6430 in the poliovirus genome, followed by a Sac I restriction site at the 3' end of the VP4 gene in the amplified fragment.
- the DNA fragment was ligated into pT7-IC-Pr55 gag after digestion with EcoRI and Sac I.
- the final construct was designated pT7-IC-Pr55 gag (VP4/2A).
- pT7-IC-Gag 1 The construction and characterization of the pT7-IC-Gag 1 has been described in previous studies (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719). Briefly, pT7-IC-Gag 1 was constructed by substitution of nucleotides 718 to 1549 of the HIV-1 gag gene (amplified using PCR) for the P1 coding region between nucleotides 1174 and 2470 in the infectious cDNA plasmid pT7-IC. This substitution encompasses most of the VP2 and VP3 capsid sequences while maintaining the VP4 and VP1 coding regions.
- the cells were transfected using the DEAE-Dextran method with RNA transcribed from the chimeric genomes in vitro as previously described (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883; Pal-Ghosh, R. et al. (1993) J. Virol. 67:4621-4629; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719).
- the cultures were harvested at 24 hours post-transfection by detergent lysis, overlaid on a 30% sucrose cushion (30% sucrose, 30 mM Tris pH 8 0, 1% Triton X-100, 0.1M NaCI), and centrifuged in a Beckman SW55Ti rotor at 55,000 rpms for 1.5 hours (Ansardi, D. C. et al. (1993) J. Virol. 67:3684-3690; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719). The supernatant was discarded and the pellet washed under the same conditions in a low salt buffer (30 mM Tris pH 8.0, 0.1M NaCl) for an additional 1.5 hours. The pellets were then resuspended in complete DMEM and used for serial passage immediately or stored at -70° C. until used.
- BSC-40 cells were first infected with 10-20 PFU/cell of VV-P1. At 2 hours post-infection, the cells were infected with passage 1 of the encapsidated recombinant poliovirus nucleic acid. The cultures were harvested at 24 hours post-infection by three successive freeze/thaws, sonicated, and clarified by low speed centrifugation at 14,000 ⁇ g for 20 minutes. The supernatants were then stored at -70° C. or used immediately for additional passages following the same procedure.
- the immunoprecipitates were collected by addition of 100 ⁇ l protein A-Sepharose (10% weight/volume in RIPA buffer). After a 1 hour incubation at room temperature, the protein A-Sepharose beads were collected by brief centrifugation and washed 3 times with RIPA buffer. The bound material was eluted by boiling 5 minutes in gel sample buffer (62.5 mM Tris pH 6.8, 2% SDS, 20% glycerol, 0.05% bromophenol blue, and 0.7M 13-mercaptoethanol). The proteins were analyzed by SDS-polyacrylamide gel electrophoresis and radiolabeled proteins were visualized by fluorography using sodium salicylate as previously described (Ansardi, D. C. et al.
- RNA was isolated from virions (Ricco-Hesse, R. M. et al. (1987) Virol. 160:311-322) which had been concentrated through a sucrose cushion as previously described (Ansardi, D. C. et al. (1993) J. Virol. 67:3684-3690; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719).
- the RNA was denatured and spotted onto nitrocellulose using a dot blot apparatus according to established protocols (Sambrook, J. et al. Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
- the RNA was immobilized onto the nitrocellulose by baking in a vacuum oven at 80° C. for 1 hour.
- RNA immobilized onto nitrocellulose were as described previously (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883; Pal-Ghosh, R. et al. (1993) J. Virol. 67:4621-4629; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719). Briefly, the blot was prehybridized in hybridization buffer (50% deionized formamide, 6X SSC, 1% SDS, 0.1% Tween 20, and 100 ⁇ g/mL yeast tRNA).
- hybridization buffer 50% deionized formamide, 6X SSC, 1% SDS, 0.1% Tween 20, and 100 ⁇ g/mL yeast tRNA).
- the blot was then incubated in hybridization buffer containing 1 ⁇ 10 6 cpm/mL of a 32 P! labeled riboprobe complementary to nucleotides 671-1174 of the poliovirus genome (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883; Pal-Ghosh, R. et al. (1993) J. Virol. 67:4621-4629; Porter, D. C. et al. (1993) J. Virol. 67:3712-3719). After hybridization, the blot was washed two times with 0.1 ⁇ SSC 0.1% SDS at room temperature and at 65° C. The blot was then exposed to X-ray film with an intensifying screen. The levels of RNA from each sample were quantitated by phosphorimagery (Molecular Dynamics).
- Virus stocks of encapsidated recombinant poliovirus nucleic acid containing HIV-1 gag gene were serially passaged with wild-type poliovirus as previously described (Morrow, C. D. et al. (1994) "New Approaches for Mucosal Vaccines for AIDS: Encapsidation and Serial Passage of Poliovirus Replicons that Express HIV-1 Proteins Upon Infection" AIDS Res. and Human Retroviruses 10(2); Porter, D. C. et al. (1993) J. Virol. 67:3712-3719).
- BSC-40 cells were co-infected with 10 PFU/cell of type 1 Sabin poliovirus and a virus stock of encapsidated recombinant poliovirus nucleic acid at pass 21.
- the infected cells were harvested at 24 hours post-infection by three successive freeze/thaws, sonicated, and clarified by low speed centrifugation. Approximately one-half of the supernatant was used for serial passaging by re-infection of BSC-40 cells. After 24 hours, the cultures were harvested as described above and the procedure was repeated for an additional 2 serial passages.
- the complete gag gene of HIV-1 was substituted for the P1 capsid coding sequences.
- the plasmid pT7-IC (FIG. 17A), which contains the promoter sequences for T7 RNA polymerase positioned 5' to the complete poliovirus CDNA, was used (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883).
- a unique Sal I restriction site is located after the poly (A) tract that can be used to linearize the cDNA before in vitro transcription; the RNA transcripts from this cDNA are infectious upon transfection into tissue culture cells (Choi, W.
- pT7-IC-Sac I-SnaBI was then used for insertion of the HIV-1 gag gene.
- pT7-IC-Pr55 gag (FIG. 17B) was constructed by insertion of the complete HIV-1 gag gene from nucleotides 345 to 1837; the Sac I and SnaBI restriction sites were introduced at the 5' and 3' ends of the gene. Substitution of the entire P1 region from the translational start site of poliovirus to the 2A protease (3386), which autocatalytically cleaves from the polyprotein upon translation (Toyoda, H. et al. (1986) Cell 45:761-770), results in expression of Pr55 gag protein after proteolytic processing of the polyprotein.
- Naturally occurring defective interfering (DI) genomes of poliovirus contain heterologous deletions of the P1 coding region that encompass the VP3, VP1 and VP2 capsid sequences. All known poliovirus D1 genomes maintain an intact VP4 coding region (Kuge, S. et al. (1986) J. Mol. Biol. 192:473-487). A second recombinant poliovirus nucleic acid was generated in which the gag gene was substituted in frame for the VP2, VP3 and VP1 capsid sequences, from nucleotides 949 to 3359 to maintain the VP4 coding region.
- DI Naturally occurring defective interfering
- a DNA fragment was amplified by PCR from the plasmid pT7-IC containing sequences encoding VP4 followed by the codons for eight amino acids containing a tyrosine-glycine amino acid pair.
- Substitution of the EcoRI to Sac I fragment into pT7-IC-Pr55 gag results in the final plasmid, pT7-IC-Pr55 gag (VP4/2A), which contains the VP4 coding sequences fused in-frame at the 5' end of the complete gag gene (FIG. 17C).
- the insertion of HIV-1 gag gene sequences maintains the translational reading frame with poliovirus.
- Poliovirus and HIV-1-specific protein expression from the recombinant poliovirus nucleic acids which contain the HIV-1 gag gene was analyzed after transfection of recombinant poliovirus RNA into cells which had been previously infected with VV-P1 (FIGS. 18A and 18B). Briefly, Cells were infected with VV-P1 at a multiplicity of infection of 5. At 2 hours post infection, the cells were transfected with RNA derived from in vitro transcription of the designated plasmids. Cells were metabolically labeled, and cell extracts were incubated with the antibodies indicated and immunoreactive proteins were analyzed on SDS-polyacrylamide gels: (FIG.
- Lane 1 Lane 1
- Lane 2 Lane 2
- Lane 3 cells transfected with RNA derived from pT7-IC-Pr55 gag (VP4/2A); Lane 4, cells transfected with RNA derived from pT7-IC-Gag 1; Lane 5, cells infected with type 1 Mahoney poliovirus at a multiplicity of infection of 30.
- Lane 1 mock-transfected cells; Lane 2, cells transfected with RNA derived from pT7-IC-Pr55 gag ; Lane 3, cells transfected with RNA derived from pT7-IC-Pr55 gag (VP4/2A); Lane 4, cells infected with vVK1 at a multiplicity of infection of 10; Lane 5, cells transfected with RNA derived from pT7-IC-Gag 1.
- the molecular mass standards and positions of relevant proteins are indicated.
- the 3CD protein which is a fusion between the 3C pro and 3D pol proteins, is the predominant 3D containing viral protein detected from poliovirus-infected cells (Porter, D. C. et al (1993) Virus. Res. 29:241-254).
- the 3CD protein was also immunoprecipitated from cells transfected with RNA derived from pT7-IC-Gag I (FIG. 18A, lane 4), which was used as a positive control for transfections in these studies (Porter, D. C. et al. (1993) J. Virol. 3712-3719).
- RNA derived from the recombinant poliovirus nucleic acid was also analyzed by Northern blot (FIGS. 19A and 19B).
- HeLa T4 cells were transfected with RNA transcribed in vitro from pT7-IC-Pr55 gag , pT7-IC-Pr55 gag (VP4/2A) and pT7-IC-Gag 1.
- total cellular RNA was prepared, separated in a 1% formaldehyde-agarose gel, blotted onto nitrocellulose and analyzed using a riboprobe complementary to nucleotides 671-1174 of the poliovirus genome.
- FIG. 19A The order of the samples is indicated.
- the asterisk indicates the migration of RNA of the expected size which was derived from pT7-IC-Gag 1 (Porter, D. C. et al. (1993) J. Virol. 67:3712-3719).
- the radioactivity of the Northern blot was quantitated using phosphorimagery.
- RNA from pT7-IC-Pr55 gag and pT7-IC-Pr55 gag (VP4/2A) transfected cells was slightly faster on the formaldehyde-agarose gel than RNA from pT7-IC-Gag 1, which is consistent with the predicted 6.3-6.4 kb size for RNA from pT7-IC-Pr55 gag and pT7-IC-Pr55 gag (VP4/2A) versus the 7.0 kb size for RNA from pT7-IC-Gag 1 (FIG. 19A).
- Cells were infected with VV-P1 and then transfected with RNA transcribed in vitro from pT7-IC-Pr55 gag , pT7-IC-Pr55 gag (VP4/2A) and pT7-IC-Gag 1.
- the encapsidated recombinant poliovirus genomes were passaged in cells which had been previously infected with VV-P1 for a total of 21 serial passes.
- vIC-Pr55 gag and vIC-Pr55 gag are referred to as vIC-Pr55 gag and vIC-Pr55 gag (VP4/2A), respectively.
- the encapsidated recombinant poliovirus genomes were subsequently serially passaged in VV-P1-infected cells for 21 serial passes.
- Cells were infected with virus stocks at pass 21 and metabolically labeled.
- Cell lysates were incubated with the designated antibodies and immunoreactive proteins were analyzed SDS-polyacrylamide gel; Lanes 1 and 6, mock-infected cells; Lanes 2 and 7, cells infected with vIC-Pr55 gag ; Lanes 3 and 8, cells infected with vIC-Pr55 gag (VP4/2A); Lanes 4 and 9, cells infected with vIC-Gagl; Lane 5, cells infected with type 1 Mahoney poliovirus; Lane 10, cells infected with vVK1.
- the molecular mass standards and positions of relevant proteins are indicated.
- RNA from each of the recombinant poliovirus nucleic acids resulted in similar levels of replication and protein expression
- detection of reduced levels of protein expression from cells infected with vIC-Pr55 gag as compared to vIC-Pr55 gag (VP4/2A) could be the result of a difference in infectivity (i.e., interaction with receptor, uncoating) between the recombinant poliovirus nucleic acids.
- RNA was isolated from equivalent amounts of vIC-Pr55 gag and vIC-Pr55 gag (VP4/2A) virus stocks, which had been serially passaged with VV-P1 for 21 passes.
- RNA samples Serial dilutions of the RNA were then spotted onto nitrocellulose and analyzed using a riboprobe as described in Materials and Methods II. Quantitation of the radioactivity from each sample by phosphorimagery indicated values from vIC-Pr55 gag (VP4/2A) virus stocks which were approximately 15 times higher than the values obtained for RNA from vIC-Pr55 gag . The results of these studies corroborate the differences in expression of 3CD and HIV-1 Gag protein observed for the recombinant poliovirus nucleic acids.
- recombinant poliovirus nucleic acids might have differences in infectious potential
- cells were infected with equivalent amounts of encapsidated recombinant poliovirus nucleic acids, as determined by RNA hybridization, and metabolically labeled followed by immunoprecipitation with anti-3D pol antibodies (FIG. 21 A).
- Equivalent amounts of a 72 kDa protein, corresponding to the 3CD protein, were detected from each of the recombinant poliovirus nucleic acid virus stocks. Quantitation of the radioactivity from each sample by phosphorimagery confirmed that the levels of 3CD were similar.
- cells were infected with normalized amounts of encapsidated poliovirus nucleic acid virus stocks and metabolically labeled.
- Cells lysates were incubated with the designated antibodies and immunoreactive proteins were analyzed on an SDS-polyacrylamide gel: Lane 1, mock infected cells; Lane 2, cells infected with vIC-Pr55 gag recombinant poliovirus stock; Lane 3, cells infected with vIC-Pr55 gag (VP4/2A) recombinant poliovirus stock; Lane 4, cells infected with vIC-Gag1 recombinant poliovirus stock.
- FIG. 21 A cells were infected with normalized amounts of encapsidated poliovirus nucleic acid virus stocks and metabolically labeled.
- Cells lysates were incubated with the designated antibodies and immunoreactive proteins were analyzed on an SDS-polyacrylamide gel: Lane 1, mock infected cells; Lane 2, cells infected with vIC-P
- Cells lysates were incubated with the designated antibodies and immunoreactive proteins were analyzed on an SDS-polyacrylamide gel; Lane U, mock-infected cells; Lane 1, cells infected with material from pass 1 of vIC-Pr55 gag with VV-P1; Lane 3 cells infected with material from pass 1 of vIC-Pr55 gag (VP4/2A) with VV-P1; Lane 4, cells infected with material from pass 2 of vIC-Pr55 gag (VP4/2A) with VV-P1; Lane 5, cells infected with material from pass 1 of vIC-Gag 1 with VV-P1; Lane 6, cells infected with material from pass 2 of viC-Gag 1 with VV-P1; Lane 7, cells infected with type 1 Mahoney poliovirus. The molecular mass standards and positions of relevant proteins are indicated.
- RNA isolated from the vIC-Pr55 gag virus stock at pass 21 was attributable to differences in the efficiency of encapsidation of RNA which contains the VP4 coding sequences versus the encapsidation of RNA which has a complete deletion of the P1 region, cells which had been previously infected with VV-P1 were infected with normalized amounts of each of the encapsidated recombinant poliovirus nucleic acid virus stocks.
- Cells were infected from each of the serial passages and metabolically labeled.
- the cell lysates incubated with the designated antibody and immunoreactive proteins were analyzed on an SDS-polyacrylamide gel: Lane U, uninfected cells; Lanes 1, 2 and 3, cells infected with material derived from the indicated passes of vIC-Pr55 gag with type 1 Sabin poliovirus; Lanes 4, 5 and 6, cells infected with material derived from the indicated passes of vIC-PR55 gag (VP4/2A) with type 1 Sabin poliovirus; Lanes 7, 8 and 9, cells infected with material derived from the indicated passes of vIC-Gag 1 with type 1 Sabin poliovirus; Lane PV, cells infected with type 1 Sabin poliovirus.
- Each passage is denoted as follows: P1, pass 1; P2, pass 2; and P3, pass 3. The molecular mass standards and positions of relevant proteins are indicated.
- No HIV-1-specific protein was cells infected with type 1 Sabin poliovirus alone (FIG. 22, lane PV); the 80 kDa gag-P1 fusion protein was detected from cells infected with material from passages 1, 2 and 3 of the vIC-Gag 1 recombinant poliovirus nucleic acid and wild-type poliovirus (FIG. 22, lanes 7-9) (Porter, D. C. et al. (1993)J. Virol. 67:3712-3719).
- vIC-Pr55 gag FIG. 22, lanes 1-3
- vIC-Pr55 gag VP4/2A
- first poliovirus genome which contains the complete 1.5 kb gag gene of HIV-1 substituted for the entire P1 region
- second poliovirus genome in which the gag gene is positioned 3' to the VP4 coding region of the P1 capsid region are described herein.
- Transfection of RNA from each of the constructs into cells resulted in similar levels of protein expression and RNA replication. Both genomes were encapsidated upon transfection into cells previously infected with VV-P1 .
- Serial passage of the recombinant poliovirus nucleic acids with VV-P1 resulted in the production of virus stocks of each of the encapsidated genomes.
- VP4 coding region was not absolutely required for RNA encapsidation, it was evident that recombinant poliovirus nucleic acids which contain a complete substitution of the P1 region with the HIV-1gag gene were encapsidated less efficiently than recombinant poliovirus nucleic acids which maintain the VP4 coding sequences (nucleotides 743 to 949) positioned 5' to the gag gene.
- RNA derived from each of the encapsidated recombinant poliovirus nucleic acid virus stocks after 21 serial passes with VV-P1 was isolated and quantitated by nucleic acid hybridization, the RNA from vIC-Pr55 gag (VP4/2A) and vIC-Gag 1 recombinant poliovirus nucleic acid virus stocks, which contained VP4, were present at levels that were 15 and 50 times higher, respectively, than RNA from vIC-Pr55 gag virus stocks.
- VP4 is not required for encapsidation, the presence of VP4 might enhance RNA encapsidation.
- the foreign protein is expressed as a polyprotein which is processed by 2A pro .
- the foreign protein is expressed as a polyprotein which is processed by 2A pro .
- Preliminary experiments have demonstrated the 55 kDa HIV-1 Gag protein expressed from poliovirus recombinant poliovirus nucleic acids is biologically active (i.e. formation of virus-like particles). If the exact protein sequence is required for protein function, the desired protein can be expressed using internal ribosomal entry sites positioned within the recombinant poliovirus nucleic acid.
- PCR primers 5'-CCA-GTG-AAT-TCC-TAA-TAC-GAC-TAC-CTA-TAG-GTT-AAA-ACA-GC-3' (5' primer) (SEQ ID NO: 18) and 5'-GA-TGA-ACC-CTC-GAG-ACC-CAT-TAT-G-3' (3' primer) (SEQ ID NO: 19).
- a second set of PCR primers were designed to amplify a region of the poliovirus genome from 3370 to 6117.
- the PCR primers were designed so that a unique SnaBI restriction site would be created 12 nuclcotides from the end of the P1 gene, resulting in an additional four amino acids upstream from the tyrosine-glycine cleavage site.
- the PCR product was digested with SnaBI and BglII, which cuts at nucleotide 5601 in the poliovirus genome.
- PCR primers used were as follows: 5'-CCA-CCA-AGT-ACG-TAA-CCA-CAT-ATG-G (5' primer) (SEQ ID NO: 20) and 5'-GTG-AGG-ACTG-CT-GG-3' (3' primer) (SEQ ID NO: 21).
- PCR reactions were extracted successively with phenol:chloroform (1:1) and chloroform:isoamyl alcohol (24:1), and then DNA was precipitated with ethanol. After collection of the precipitate by centrifugation, the DNA was dried and resuspended in water. The DNA was then digested with the appropriate restriction endonuclease enzymes at the 5' and 3' end of the PCR-amplified products.
- PCR was used to amplify a region from the CEA cDNA.
- the primers used for this PCR reaction were as follows: 5'-CAC-CAC-TGC-CCT-CGA-GAA-GCT-CAC-TAT-TG-3' (5' primer) (SEQ ID NO: 22) and 5'-CAC-CAC-TGC-CCT-CGA-GAA-GCT-CAC-TAT-TG-3' (3' primer) (SEQ ID NO: 23).
- the DNA primers were chosen to create an XhoI site at the 5' end and a SnaBI site at the 3' terminus of the amplified DNA.
- the length of the amplified DNA was approximately 100 base pairs less than that of the full-length amplified product for the CEA DNA, corresponding to a loss of 34 amino acids from the amino terminus representing the signal sequence.
- the conditions for PCR and isolation of the amplified product are as described in Materials and Methods III. Prior to ligation, the amplified product was digested with XhoI and SnaBI.
- the plasmid pT7-IC was digested with EcoRI and BglII.
- this 5.8-kilobase fragment was ligated with the PCR-amplified products from nucleotides 1-743 (EcoRI-XhoI), the CEA gene (XhoI-SnaBI), and the PCR-amplified product containing poliovirus nucleotides 3370 (SnaBI) to 5601 (BglII). After incubation at 15° C.
- Plasmids isolated from individual colonies were screened for the desired insert by restriction enzyme digestion. The final plasmid was designated pT7-IC-CEA-sig - .
- HeLa cells were purchased from the American Type Culture Collection and were maintained in monolayer culture in DMEM (GIBCO/BRL) supplemented with 5% fetal bovine serum. BSC-40 cells were maintained in DMEM with 5% fetal bovine serum as described previously (Ansardi, D. A. et al. (1991) J. Virol. 65:2088-2092).
- the vaccinia viruses used for these studies were grown in TK-143-B cells (American Type Culture Collection) and were concentrated for experimental use as previously described (Ansardi, D. A. et al. (1991) J. Virol. 65:2088-2092).
- the titers of vaccinia virus were determined by plaque assay on BSC-40 cell monolayers.
- the recombinant vaccinia virus used for the encapsidation experiments (VV-P1) was constructed as described previously (Ansardi, D. A. et al. (1991) J. Virol. 65:2088-2092).
- the recombinant vaccinia virus which expresses the CEA has been previously described (Kantor, J. et al. (1992) J. Natl. Cancer Inst.84:1084-1091; Kantor, J. et al. (1992) Cancer Res. 52:6917-6925).
- DEAE-dextran molecular mass, 500 kDa
- the cells were first infected with vaccinia virus for 2 h prior to transfection. After the 2 hour infection period, the cells were washed once with DMEM without methionine-cysteine or leucine (depending on the metabolic label), and incubated in this medium for an additional 45 min to 1 hour.
- CEA-specific monoclonal antibody (Col-1) at a concentration of 3 ⁇ g/ml was used.
- the cells and medium were harvested by directly adding Triton X-100 to the medium, at a final concentration of 1%.
- the medium-cell lysate was clarified in a microcentrifuge for 20 min at 14,000 ⁇ g.
- the clarified lysate was treated with 20 ⁇ g/ml of RNase A at 37° C. for 15 min, then diluted to 4 ml with 30 mM Tris-HCl (pH 8.0, 0.1M NaCl, 1% Triton X-100), and overlaid on a 0.5 ml-sucrose cushion (30% sucrose, 30 mM Tris-HCl pH 8.0, 1M NaCl, 0.1% BSA) in SW 55 tubes.
- the sucrose cushion was centrifuged at 45,000 rpm for 2 h. Pelleted material was washed with PBS-0.1% BSA and recentrifuged at 45,000 rpm for 2 h. The final pellet was resuspended in 0.6 ml complete medium. BSC-40 cells were infected for 2 hours with 20 PFUs/cell of VV-P1 , and 0.25 ml of the 0.6 ml was used to infect cells infected with VV-P1; after 24 hours, the cells and media were harvested. This was designated Pass 1.
- BSC-40 cells were infected with 20 PFUs of VV-P1 /cell. At 2 hours posttransfection, the cells were infected with Pass 1 of the encapsidated recombinant poliovirus nucleic acids. The cultures were harvested at 24 hours postinfection by three successive freeze-thaws, sonicated, and clarified by centrifugation at 14,000 -g for 20 min. The supernatants were stored at ⁇ 70° C. or used immediately for additional passages, following the same procedure.
- encapsidated recombinant poliovirus nucleic acids have the capacity to infect cells, but lack capsid proteins, they cannot form plaques and therefore virus titers cannot be quantified by traditional assays.
- a method to estimate the titer of the encapsidated recombinant poliovirus nucleic acids by comparison with wild-type poliovirus of known titer was used.
- the resulting titer is then expressed in infectious units of recombinant poliovirus nucleic acids, since the infection of cells with the recombinant poliovirus nucleic acids does not lead to plaque formation due to the absence of P1 capsid genes. It was determined experimentally that the infectivity of equal amounts of infectious units of encapsidated recombinant poliovirus nucleic acids correlates with equal amounts of PFUs of wild-type poliovirus.
- the encapsidated recombinant poliovirus nucleic acids contain a type I Mahoney capsid. Since the type I strain of poliovirus does not infect mice, transgenic mice (designated as Tg PVR1) which express the receptor for poliovirus and are susceptible to poliovirus and are susceptible to poliovirus infection (Ren, R. et al. (1990) Cell 63:353-362) were used. Mice (4-5-week old) were immunized by i.m. infection at monthly intervals with recombinant poliovirus nucleic acids expressing CEA; each mouse received 3 doses containing approximately 3 ⁇ 10 4 infectious units/mouse in 50 ⁇ l sterile PBS.
- VV-P1 the recombinant poliovirus nucleic acid preparations were incubated with anti-vaccinia virus antibodies (Lee Biomolecular, San Diego, Calif.). The complete removal of residual VV-P1 was confirmed by the lack of vaccinia virus plaques after a 3-day plaque assay. Blood was collected from the tail veins of mice before and at selected times after immunization, centrifuged, and the plasma was collected and frozen until assay. ELISA was used for the determination of antigen-specific antibodies.
- the assays were performed in 96-well polystyrene microtiter plates (Dynatech, Alexandria, Va.) coated with recombinant CEA or whole poliovirus type I at a concentration of 5 and 1 ⁇ g/ml, respectively.
- the CEA used for these studies was expressed in E. coli, using a pET vector with a 6-histidine affinity tag to facilitate purification (Novagen).
- the majority of the CEA product isolated from the nickel column used for purification was an 80-kDa protein corresponding to the nonglycosylated CEA.
- the poliovirus type I (Sabin) used was grown in tissue culture cells and purified by centrifugation (Ansardi, D. A. et al.
- the starting plasmid for the experiments described herein contains the full-length infectious poliovirus CDNA positioned downstream from a phage T7 promoter, designated pT7-IC (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883) (FIG. 23A).
- the poliovirus capsid proteins (VP4, VP3, VP2, and VP1) are encoded in the P1 region of the poliovirus genome; the viral proteinase 2A and viral proteins 2B and 2C are encoded in the P2 region; and the viral proteins 3AB, 3C, and 3D (RNA polymerase) are encoded in the P3 region.
- FIG. 23B is a schematic of the CEA protein
- the signal sequence of the CEA protein consists of 34 amino acids (black box).
- the signal peptidase cleavage site occurs between the alanine and lysine amino acids.
- the codon for the carboxyl terminal isoleucine amino acid is followed by a TAA termination codon.
- PCR was used to amplify the CEA-gene encoding amino acids from the lysine at the amino terminus of signal-minus CEA to the isoleucine at the COOH terminus of CEA as shown in FIG. 23B.
- XhoI and SnaBI restriction endonuclease sites were positioned within the PCR primers.
- the final construct encodes the first two amino acids of the poliovirus P1 protein (Met-Gly) followed by two amino acids, leucine and glutamic acid (encoded by the XhoI restriction site) followed by the lysine amino acid of the signal-minus CEA protein.
- the CEA gene was positioned so that nine amino acids will be spaced between the C-terminal isoleucine of CEA and the tyrosine-glycine cleavage site for the 2A proteinase; the leucine amino acid required for 2A cleavage is boxed in FIG. 23C.
- RNA transcripts for transfection.
- Transfection of the in vitro RNA transcript into tissue culture cells results in translation and replication of the RNA, which leads to production of infectious poliovirus. It has been found that the infectivity of the RNA derived from this plasmid is in the range of 10 6 PFUs/ ⁇ g transfected RNA (Choi, W. S. et al. (1991) J. Virol. 65:2875-2883).
- RNA containing full-length CEA was not replication competent. It was possible that the signal sequence (amino acids 1-34) of the CEA protein was directing the CEA-P2-P3 fusion protein to the endoplasmic reticulum and in doing so prevented replication of the RNA. To test this possibility, the CEA gene was engineered to remove the first 34 amino acids of the CEA protein, which has been postulated to be the signal sequence (Oikawa, S. et al. (1987) Biochim. Biophys. Acta. 142:511-518; Thompson, J. et al. (1988) Tumor Biol. 9:63-83).
- PCR was used to amplify a region from amino acids 35-688 of the CEA gene that was then subcloned into the poliovirus recombinant poliovirus nucleic acid.
- the resulting DNA encoded the first two amino acids of the poliovirus P1 protein (Met-Gly) followed by two amino acids (Leu-Glu) derived from the XhoI restriction endonuclease site, followed by amino acid 35 (Lys) of the CEA protein.
- the isoleucine in CEA was fused to an additional nine amino acids (Tyr-Val-Thr-Lys-Asp-Leu-Thr-Thr-Tyr) in the predicted protein product.
- a leucine residue at the P4 position was included for optimal 2A autocatalytic cleavage (Harris, K. S. et al. (1990) Semin. Virol. 1:323-333).
- RNA transcripts were transfected into cells previously infected with VV-P1.
- sig - CEA signal-minus CEA gene
- a recombinant poliovirus nucleic acid which contains the HIV-1 gag gene (corresponding to the capsid, p24 protein) positioned between nucleotides 1174 and 2470 of the poliovirus genome was used. Cells were also infected with poliovirus to serve as a control in these experiments.
- Lane 1 mock transfected cells; Lane 2, cells transfected with RNA derived from clone 1 of PT7-IC-CEA-sig - ; Lane 3, cells transfected with RNA derived from clone 2 of pT7-IC-CEA-sig - ; Lane 4, cells transfected with RNA derived from clone 3 of pT7-IC-CEA-sig - ; Lane 5, cells transfected with RNA derived from clone 4 of pT7-IC-CEA-sig - ; Lane 6, cells transfected with RNA derived from clone 5 of pT7-IC-CEA-sig - ; Lane 7, cells transfected with RNA derived from transcription of pT7-IC-Gag 1; Lane 8, cells infected with either poliovirus (FIG.
- FIG. 24A or rV-CEA (FIG. 24B).
- the migration of the molecular mass markers is noted.
- the migration of 3CD (FIG. 24A) and glycosylated and unglycosylated forms of CEA (FIG. 24B) are also noted.
- the 3CD protein from cells transfected with RNA derived from five individual clones of pT7-IC-CEA-sig - was detected.
- the levels of 3CD expression in this experiment were comparable to those of cells transfected with RNA derived from in vitro transcription of pT7-IC-Gag 1, which was known from previous studies to be replication competent (Porter, D. C. et al. (1993) J. Virol. 67:3712-3719; FIG. 24A).
- CEA protein was expressed in the transfected cells.
- the lysates were also incubated with the Col-1 antibody to immunoprecipitate CEA-related proteins (FIG. 24B). Since the CEA protein should not be glycosylated, it was expected that the CEA product would be approximately 80 kDa in molecular mass. In each of the transfections with RNA derived the five independent clones, an 80-kDa protein was immunoprecipitated; this protein was not detected in cells transfected with recombinant poliovirus nucleic acids containing the HIV-1 gag gene.
- the concentrated material was used to infect cells that had been infected previously with either wild-type vaccinia virus or VV-P1 (passage 1). This coinfection was allowed to proceed overnight, after which extracts of the cells were generated by repeated freezing and thawing. The freeze-thaw extracts were clarified and used to repeat the coinfection procedure. This process was repeated for an additional nine serial passages to generate stocks of the encapsidated recombinant poliovirus nucleic acids. For the experiment shown in FIGS. 25A-C, the lysates from Pass 10 material were used to infect BSC-40 cells.
- the cells were starved for 30 min in methionine-cysteine-free DMEM, and then were metabolically labeled for an additional 90 min.
- the cell lysates were then analyzed by immunoprecipitation with either anti-3D pol antibody (FIG. 25A) or antibody to the CEA protein (Col-1, FIG. 25B). The origins of the samples in the lanes for FIGS.
- 25A and 25B are as follows: Lane 1, cells that were infected with wild-type vaccinia virus and then mock-transfected; Lane 2, cells that were infected with VV-P1 and then mock-transfected; Lane 3, cells that were infected with wild-type vaccinia virus and then transfected with RNA derived from in vitro transcription of pT7-IC-CEA-sig - ; Lane 4, cells that were infected with VV-P1 and then transfected with RNA derived from pT7-IC-CEA-sig - ; Lane 5, cells that were infected with wild-type vaccinia virus and then transfected with RNA derived from pT7-IC-CEA-sig - (a second independent clone); Lane 6, cells were infected with VV-P1 and then transfected with RNA derived from pT7-IC-CEA-sig - (a second independent clone); Lane 7, cells that were infected with wild-type vac
- FIG. 25A the migration of the molecular mass markers is noted.
- FIG. 25A the migration of 3CD protein is noted
- FIG. 25B the migrations of the glycosylated (gly) and nonglycosylated (sig - ) forms of CEA are noted.
- a protein of molecular mass 80 kDa was immunoprecipitated from cells infected with the extracts originating from cells transfected with the RNA derived from pT7-IC-CEA sig - which has been passaged in the presence of VV-P1, but not in the presence of wild-type virus.
- no Col-1 immunoreactive material was detected in cells infected with the RNA derived from pT7-IC-Gag 1, although this RNA was encapsidated in cells in the presence of VV-P1 (FIG. 25A).
- One of these proteins corresponded to the unglycosylated protein of a smaller molecular mass of approximately 80 kDa, while a protein of a smaller molecular mass, corresponding to approximately 52 kDa, was also immunoprecipitated.
- This protein is believed to represent a breakdown product of the CEA protein that was not detected previously because of the relatively few methionine or cysteine amino acids found in the CEA protein.
- a third protein of approximately 180 kDa was also immunoprecipitated, suggesting that glycosylated CEA protein might be produced in cells infected with the encapsidated recombinant poliovirus nucleic acids at low levels.
- mice that express the receptor for poliovirus and are susceptible to infection with poliovirus were used (Ren, R. et al. (1990) Cell 63:353-362). The mice were bred in a germ-free environment until use in the experiments. The four mice used in the experiment were bled prior to i.m. immunization with approximately 10 4 infectious units of the encapsidated recombinant poliovirus nucleic acid which expresses CEA.
- the serum samples from the mice at each of the pre- and postimmune time points were pooled and assayed using a solid-phase ELISA with whole poliovirus or recombinant CEA expressed in E. coli as the coating solution.
- the results are presented as absorbance 414-nm values at a fixed dilution and as end point titration values for anti-CEA (FIG. 26A) an antipoliovirus (FIG. 26B).
- end point titer had increased from 1:25 (preimmune) to 1:6400 (FIG. 26A).
- RNA recombinant poliovirus nucleic acids which express the CEA protein when infected is described herein.
- a recombinant poliovirus nucleic acid encoding the signal-minus CEA protein was replication competent and expressed nonglycosylated CEA protein when transfected into cells.
- stocks of encapsidated recombinant poliovirus nucleic acids containing the signal-minus CEA gene were generated.
- encapsidated poliovirus recombinant poliovirus nucleic acids as a vaccine vehicle has several distinguishing features: (a) this is one of the few vector systems based entirely on an RNA virus. Since poliovirus replication does not involve DNA intermediates, in contrast to retroviruses, the possibility of recombination in the host cell DNA is virtually eliminated; (b) infection of cells with encapsidated recombinant poliovirus nucleic acids results in an amplification of the recombinant poliovirus nucleic acid RNA and preferential expression of the foreign gene over cellular gene products since poliovirus has evolved mechanisms to promote the synthesis of its own viral proteins (Ehrenfeld, E. et al.
- the encapsidated poliovirus recombinant poliovirus nucleic acids are noninfectious because they do not encode the viral P1 capsid proteins.
- the recombinant poliovirus nucleic acid requires capsid proteins to be propagated and transmitted from cell to cell. Infection of cells or an animal with the encapsidated recombinant poliovirus nucleic acids alone then results in a single round of infection without a chance for further spread. Because of this feature, the encapsidated recombinant poliovirus nucleic acids can be exploited to deliver nucleic acids to cells without risk of viral spread.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 23 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TATTAGTAGATCTG14 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TACAGATGTACTAA14 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 845 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 20..845 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGG52 GlnAsnTyrProIleValGlnAsnIleGlnGly 1510 CAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTA100 GlnMetValHisGlnAlaIleSerProArgThrLeuAsnAlaTrpVal 152025 AAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTT148 LysValValGluGluLysAlaPheSerProGluValIleProMetPhe 303540 TCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTA196 SerAlaLeuSerGluGlyAlaThrProGlnAspLeuAsnThrMetLeu 455055 AACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACC244 AsnThrValGlyGlyHisGlnAlaAlaMetGlnMetLeuLysGluThr 60657075 ATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCA292 IleAsnGluGluAlaAlaGluTrpAspArgValHisProValHisAla 808590 GGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATA340 GlyProIleAlaProGlyGlnMetArgGluProArgGlySerAspIle 95100105 GCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAAT388 AlaGlyThrThrSerThrLeuGlnGluGlnIleGlyTrpMetThrAsn 110115120 AATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTG436 AsnProProIleProValGlyGluIleTyrLysArgTrpIleIleLeu 125130135 GGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGAC484 GlyLeuAsnLysIleValArgMetTyrSerProThrSerIleLeuAsp 140145150155 ATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTC532 IleArgGlnGlyProLysGluProPheArgAspTyrValAspArgPhe 160165170 TATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGG580 TyrLysThrLeuArgAlaGluGlnAlaSerGlnGluValLysAsnTrp 175180185 ATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACT628 MetThrGluThrLeuLeuValGlnAsnAlaAsnProAspCysLysThr 190195200 ATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACA676 IleLeuLysAlaLeuGlyProAlaAlaThrLeuGluGluMetMetThr 205210215 GCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCT724 AlaCysGlnGlyValGlyGlyProGlyHisLysAlaArgValLeuAla 220225230235 GAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGA772 GluAlaMetSerGlnValThrAsnSerAlaThrIleMetMetGlnArg 240245250 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGC820 GlyAsnPheArgAsnGlnArgLysIleValLysCysPheAsnCysGly 255260265 AAAGAAGGGCACACAGCCAGAAAGT845 LysGluGlyHisThrAlaArgLys 270275 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 275 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GlnAsnTyrProIleValGlnAsnIleGlnGlyGlnMetValHisGln 151015 AlaIleSerProArgThrLeuAsnAlaTrpValLysValValGluGlu 202530 LysAlaPheSerProGluValIleProMetPheSerAlaLeuSerGlu 354045 GlyAlaThrProGlnAspLeuAsnThrMetLeuAsnThrValGlyGly 505560 HisGlnAlaAlaMetGlnMetLeuLysGluThrIleAsnGluGluAla 65707580 AlaGluTrpAspArgValHisProValHisAlaGlyProIleAlaPro 859095 GlyGlnMetArgGluProArgGlySerAspIleAlaGlyThrThrSer 100105110 ThrLeuGlnGluGlnIleGlyTrpMetThrAsnAsnProProIlePro 115120125 ValGlyGluIleTyrLysArgTrpIleIleLeuGlyLeuAsnLysIle 130135140 ValArgMetTyrSerProThrSerIleLeuAspIleArgGlnGlyPro 145150155160 LysGluProPheArgAspTyrValAspArgPheTyrLysThrLeuArg 165170175 AlaGluGlnAlaSerGlnGluValLysAsnTrpMetThrGluThrLeu 180185190 LeuValGlnAsnAlaAsnProAspCysLysThrIleLeuLysAlaLeu 195200205 GlyProAlaAlaThrLeuGluGluMetMetThrAlaCysGlnGlyVal 210215220 GlyGlyProGlyHisLysAlaArgValLeuAlaGluAlaMetSerGln 225230235240 ValThrAsnSerAlaThrIleMetMetGlnArgGlyAsnPheArgAsn 245250255 GlnArgLysIleValLysCysPheAsnCysGlyLysGluGlyHisThr 260265270 AlaArgLys 275 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 948 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 4..946 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: AACCAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATT48 GlnTrpProLeuThrGluGluLysIleLysAlaLeuValGluIle 151015 TGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAA96 CysThrGluMetGluLysGluGlyLysIleSerLysIleGlyProGlu 202530 AATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACT144 AsnProTyrAsnThrProValPheAlaIleLysLysLysAspSerThr 354045 AAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAA192 LysTrpArgLysLeuValAspPheArgGluLeuAsnLysArgThrGln 505560 GACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAA240 AspPheTrpGluValGlnLeuGlyIleProHisProAlaGlyLeuLys 657075 AAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCA288 LysLysLysSerValThrValLeuAspValGlyAspAlaTyrPheSer 80859095 GTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCT336 ValProLeuAspGluAspPheArgLysTyrThrAlaPheThrIlePro 100105110 AGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTT384 SerIleAsnAsnGluThrProGlyIleArgTyrGlnTyrAsnValLeu 115120125 CCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACA432 ProGlnGlyTrpLysGlySerProAlaIlePheGlnSerSerMetThr 130135140 AAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTAT480 LysIleLeuGluProPheArgLysGlnAsnProAspIleValIleTyr 145150155 CAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAG528 GlnTyrMetAspAspLeuTyrValGlySerAspLeuGluIleGlyGln 160165170175 CATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGA576 HisArgThrLysIleGluGluLeuArgGlnHisLeuLeuArgTrpGly 180185190 CTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGG624 LeuThrThrProAspLysLysHisGlnLysGluProProPheLeuTrp 195200205 ATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTG672 MetGlyTyrGluLeuHisProAspLysTrpThrValGlnProIleVal 210215220 CTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTG720 LeuProGluLysAspSerTrpThrValAsnAspIleGlnLysLeuVal 225230235 GGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGG768 GlyLysLeuAsnTrpAlaSerGlnIleTyrProGlyIleLysValArg 240245250255 CAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATA816 GlnLeuCysLysLeuLeuArgGlyThrLysAlaLeuThrGluValIle 260265270 CCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATT864 ProLeuThrGluGluAlaGluLeuGluLeuAlaGluAsnArgGluIle 275280285 CTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTA912 LeuLysGluProValHisGlyValTyrTyrAspProSerLysAspLeu 290295300 ATAGCAGAAATACAGAAGCAGGGGCAAGGCCTCGAG948 IleAlaGluIleGlnLysGlnGlyGlnGly 305310 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 314 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GlnTrpProLeuThrGluGluLysIleLysAlaLeuValGluIleCys 151015 ThrGluMetGluLysGluGlyLysIleSerLysIleGlyProGluAsn 202530 ProTyrAsnThrProValPheAlaIleLysLysLysAspSerThrLys 354045 TrpArgLysLeuValAspPheArgGluLeuAsnLysArgThrGlnAsp 505560 PheTrpGluValGlnLeuGlyIleProHisProAlaGlyLeuLysLys 65707580 LysLysSerValThrValLeuAspValGlyAspAlaTyrPheSerVal 859095 ProLeuAspGluAspPheArgLysTyrThrAlaPheThrIleProSer 100105110 IleAsnAsnGluThrProGlyIleArgTyrGlnTyrAsnValLeuPro 115120125 GlnGlyTrpLysGlySerProAlaIlePheGlnSerSerMetThrLys 130135140 IleLeuGluProPheArgLysGlnAsnProAspIleValIleTyrGln 145150155160 TyrMetAspAspLeuTyrValGlySerAspLeuGluIleGlyGlnHis 165170175 ArgThrLysIleGluGluLeuArgGlnHisLeuLeuArgTrpGlyLeu 180185190 ThrThrProAspLysLysHisGlnLysGluProProPheLeuTrpMet 195200205 GlyTyrGluLeuHisProAspLysTrpThrValGlnProIleValLeu 210215220 ProGluLysAspSerTrpThrValAsnAspIleGlnLysLeuValGly 225230235240 LysLeuAsnTrpAlaSerGlnIleTyrProGlyIleLysValArgGln 245250255 LeuCysLysLeuLeuArgGlyThrLysAlaLeuThrGluValIlePro 260265270 LeuThrGluGluAlaGluLeuGluLeuAlaGluAsnArgGluIleLeu 275280285 LysGluProValHisGlyValTyrTyrAspProSerLysAspLeuIle 290295300 AlaGluIleGlnLysGlnGlyGlnGlyLeu 305310 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1568 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 7..1565 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GGGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGT48 CysProLysValSerPheGluProIleProIleHisTyrCys 1510 GCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAAT96 AlaProAlaGlyPheAlaIleLeuLysCysAsnAsnLysThrPheAsn 15202530 GGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGA144 GlyThrGlyProCysThrAsnValSerThrValGlnCysThrHisGly 354045 ATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCA192 IleArgProValValSerThrGlnLeuLeuLeuAsnGlySerLeuAla 505560 GAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAA240 GluGluGluValValIleArgSerValAsnPheThrAspAsnAlaLys 657075 ACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGA288 ThrIleIleValGlnLeuAsnThrSerValGluIleAsnCysThrArg 808590 CCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGG336 ProAsnAsnAsnThrArgLysArgIleArgIleGlnArgGlyProGly 95100105110 AGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACAT384 ArgAlaPheValThrIleGlyLysIleGlyAsnMetArgGlnAlaHis 115120125 TGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGAT432 CysAsnIleSerArgAlaLysTrpAsnAsnThrLeuLysGlnIleAsp 130135140 AGCAAATTAAGAGAACAATTCGGAAATAATAAAACAATAATCTTTAAG480 SerLysLeuArgGluGlnPheGlyAsnAsnLysThrIleIlePheLys 145150155 CAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGT528 GlnSerSerGlyGlyAspProGluIleValThrHisSerPheAsnCys 160165170 GGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACT576 GlyGlyGluPhePheTyrCysAsnSerThrGlnLeuPheAsnSerThr 175180185190 TGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGA624 TrpPheAsnSerThrTrpSerThrGluGlySerAsnAsnThrGluGly 195200205 AGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATG672 SerAspThrIleThrLeuProCysArgIleLysGlnIleIleAsnMet 210215220 TGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAA720 TrpGlnLysValGlyLysAlaMetTyrAlaProProIleSerGlyGln 225230235 ATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGT768 IleArgCysSerSerAsnIleThrGlyLeuLeuLeuThrArgAspGly 240245250 GGTAATAGCAACAATGAGTCCGAGATCTTCAGACTTGGAGGAGGAGAT816 GlyAsnSerAsnAsnGluSerGluIlePheArgLeuGlyGlyGlyAsp 255260265270 ATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA864 MetArgAspAsnTrpArgSerGluLeuTyrLysTyrLysValValLys 275280285 ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTG912 IleGluProLeuGlyValAlaProThrLysAlaLysArgArgValVal 290295300 CAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTC960 GlnArgGluLysArgAlaValGlyIleGlyAlaLeuPheLeuGlyPhe 305310315 TTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACG1008 LeuGlyAlaAlaGlySerThrMetGlyAlaAlaSerMetThrLeuThr 320325330 GTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAAT1056 ValGlnAlaArgGlnLeuLeuSerGlyIleValGlnGlnGlnAsnAsn 335340345350 TTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTC1104 LeuLeuArgAlaIleGluAlaGlnGlnHisLeuLeuGlnLeuThrVal 355360365 TGGGGCATCAAGCAGCTCCAAGCAAGAATCCTAGCTGTGGAAAGATAC1152 TrpGlyIleLysGlnLeuGlnAlaArgIleLeuAlaValGluArgTyr 370375380 CTAAAGGATCAACAGCTCCTAGGGATTTGGGGTTGCTCTGGAAAACTC1200 LeuLysAspGlnGlnLeuLeuGlyIleTrpGlyCysSerGlyLysLeu 385390395 ATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCT1248 IleCysThrThrAlaValProTrpAsnAlaSerTrpSerAsnLysSer 400405410 CTGGAACAGATCTGGAATCACACGACCTGGATGGAGTGGGACAGAGAA1296 LeuGluGlnIleTrpAsnHisThrThrTrpMetGluTrpAspArgGlu 415420425430 ATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAA1344 IleAsnAsnTyrThrSerLeuIleHisSerLeuIleGluGluSerGln 435440445 AACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGG1392 AsnGlnGlnGluLysAsnGluGlnGluLeuLeuGluLeuAspLysTrp 450455460 GCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATA1440 AlaSerLeuTrpAsnTrpPheAsnIleThrAsnTrpLeuTrpTyrIle 465470475 AAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTT1488 LysLeuPheIleMetIleValGlyGlyLeuValGlyLeuArgIleVal 480485490 TTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCA1536 PheAlaValLeuSerIleValAsnArgValArgGlnGlyTyrSerPro 495500505510 TTATCGTTTCAGACCCACCTCCCAATCTCGAG1568 LeuSerPheGlnThrHisLeuProIle 515 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 519 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CysProLysValSerPheGluProIleProIleHisTyrCysAlaPro 151015 AlaGlyPheAlaIleLeuLysCysAsnAsnLysThrPheAsnGlyThr 202530 GlyProCysThrAsnValSerThrValGlnCysThrHisGlyIleArg 354045 ProValValSerThrGlnLeuLeuLeuAsnGlySerLeuAlaGluGlu 505560 GluValValIleArgSerValAsnPheThrAspAsnAlaLysThrIle 65707580 IleValGlnLeuAsnThrSerValGluIleAsnCysThrArgProAsn 859095 AsnAsnThrArgLysArgIleArgIleGlnArgGlyProGlyArgAla 100105110 PheValThrIleGlyLysIleGlyAsnMetArgGlnAlaHisCysAsn 115120125 IleSerArgAlaLysTrpAsnAsnThrLeuLysGlnIleAspSerLys 130135140 LeuArgGluGlnPheGlyAsnAsnLysThrIleIlePheLysGlnSer 145150155160 SerGlyGlyAspProGluIleValThrHisSerPheAsnCysGlyGly 165170175 GluPhePheTyrCysAsnSerThrGlnLeuPheAsnSerThrTrpPhe 180185190 AsnSerThrTrpSerThrGluGlySerAsnAsnThrGluGlySerAsp 195200205 ThrIleThrLeuProCysArgIleLysGlnIleIleAsnMetTrpGln 210215220 LysValGlyLysAlaMetTyrAlaProProIleSerGlyGlnIleArg 225230235240 CysSerSerAsnIleThrGlyLeuLeuLeuThrArgAspGlyGlyAsn 245250255 SerAsnAsnGluSerGluIlePheArgLeuGlyGlyGlyAspMetArg 260265270 AspAsnTrpArgSerGluLeuTyrLysTyrLysValValLysIleGlu 275280285 ProLeuGlyValAlaProThrLysAlaLysArgArgValValGlnArg 290295300 GluLysArgAlaValGlyIleGlyAlaLeuPheLeuGlyPheLeuGly 305310315320 AlaAlaGlySerThrMetGlyAlaAlaSerMetThrLeuThrValGln 325330335 AlaArgGlnLeuLeuSerGlyIleValGlnGlnGlnAsnAsnLeuLeu 340345350 ArgAlaIleGluAlaGlnGlnHisLeuLeuGlnLeuThrValTrpGly 355360365 IleLysGlnLeuGlnAlaArgIleLeuAlaValGluArgTyrLeuLys 370375380 AspGlnGlnLeuLeuGlyIleTrpGlyCysSerGlyLysLeuIleCys 385390395400 ThrThrAlaValProTrpAsnAlaSerTrpSerAsnLysSerLeuGlu 405410415 GlnIleTrpAsnHisThrThrTrpMetGluTrpAspArgGluIleAsn 420425430 AsnTyrThrSerLeuIleHisSerLeuIleGluGluSerGlnAsnGln 435440445 GlnGluLysAsnGluGlnGluLeuLeuGluLeuAspLysTrpAlaSer 450455460 LeuTrpAsnTrpPheAsnIleThrAsnTrpLeuTrpTyrIleLysLeu 465470475480 PheIleMetIleValGlyGlyLeuValGlyLeuArgIleValPheAla 485490495 ValLeuSerIleValAsnArgValArgGlnGlyTyrSerProLeuSer 500505510 PheGlnThrHisLeuProIle 515 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CACCCCTCTCCTACGTAACCAAGGATC27 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GTACTGGTCACCATATTGGTCAAC24 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GGAGAGAGATGGGAGCTCGAGCGTC25 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GCCCCCCTATACGTATTGTG20 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CCAGTGAATTCCTAATACGACTCACTATAGGTTAAAACAGC41 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CTCTATCCTGAGCTCCATATGTGTCGAGCAGTTTTTGGTTTAGCATTG48 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: ThrLysAspLeuThrThrTyrGly 15 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2220 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..2203 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CGACCAGCAGACCAGACAGTCACAGCAGCCTTGACAAAACGTTCCTGG48 ArgProAlaAspGlnThrValThrAlaAlaLeuThrLysArgSerTrp 151015 AACTCAAGCACTTCTCCACAGAGGAGGACAGAGCAGACAGCAGAGACC96 AsnSerSerThrSerProGlnArgArgThrGluGlnThrAlaGluThr 202530 ATGGAGTCTCCCTCGGCCCCTCCCCACAGATGGTGCATCCCCTGGCAG144 MetGluSerProSerAlaProProHisArgTrpCysIleProTrpGln 354045 AGGCTCCTGCTCACAGCCTCACTTCTAACCTTCTGGAACCCGCCCACC192 ArgLeuLeuLeuThrAlaSerLeuLeuThrPheTrpAsnProProThr 505560 ACTGCCAAGCTCACTATTGAATCCACGCCGTTCAATGTCGCAGAGGGG240 ThrAlaLysLeuThrIleGluSerThrProPheAsnValAlaGluGly 65707580 AAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGC288 LysGluValLeuLeuLeuValHisAsnLeuProGlnHisLeuPheGly 859095 TACAGCTGGTACAAAGGTGAAAGAGTGGATGGCAACCGTCAAATTATA336 TyrSerTrpTyrLysGlyGluArgValAspGlyAsnArgGlnIleIle 100105110 GGATATGTAATAGGAACTCAACAAGCTACCCCAGGGCCCGCATACAGT384 GlyTyrValIleGlyThrGlnGlnAlaThrProGlyProAlaTyrSer 115120125 GGTCGAGAGATAATATACCCCAATGCATCCCTGCTGATCCAGAACATC432 GlyArgGluIleIleTyrProAsnAlaSerLeuLeuIleGlnAsnIle 130135140 ATCCAGAATGACACAGGATTCTACACCCTACACGTCATAAAGTCAGAT480 IleGlnAsnAspThrGlyPheTyrThrLeuHisValIleLysSerAsp 145150155160 CTTGTGAATGAAGAAGCAACTGGCCAGTTCCGGGTATACCCGGAGCTG528 LeuValAsnGluGluAlaThrGlyGlnPheArgValTyrProGluLeu 165170175 CCCAAGCCCTCCATCTCCAGCAACAACTCCAAACCCGTGGAGGACAAG576 ProLysProSerIleSerSerAsnAsnSerLysProValGluAspLys 180185190 GATGCTGTGGCCTTCACCTGTGAACCTGAGACTCAGGACGCAACCTAC624 AspAlaValAlaPheThrCysGluProGluThrGlnAspAlaThrTyr 195200205 CTGTGGTGGGTAAACAATCAGAGCCTCCCGGTCAGTCCCAGGCTGCAG672 LeuTrpTrpValAsnAsnGlnSerLeuProValSerProArgLeuGln 210215220 CTGTCCAATGGCAACAGGACCCTCACTCTATTCAATGTCACAAGAAAT720 LeuSerAsnGlyAsnArgThrLeuThrLeuPheAsnValThrArgAsn 225230235240 GACACAGCAAGCTACAAATGTGAAACCCAGAACCCAGTGAGTGCCAGG768 AspThrAlaSerTyrLysCysGluThrGlnAsnProValSerAlaArg 245250255 CGCAGTGATTCAGTCATCCTGAATGTCCTCTATGGCCCGGATGCCCCC816 ArgSerAspSerValIleLeuAsnValLeuTyrGlyProAspAlaPro 260265270 ACCATTTCCCCTCTAAACACATCTTACAGATCAGGGGAAAATCTGAAC864 ThrIleSerProLeuAsnThrSerTyrArgSerGlyGluAsnLeuAsn 275280285 CTCTCCTGCCATGCAGCCTCTAACCCACCTGCACAGTACTCTTGGTTT912 LeuSerCysHisAlaAlaSerAsnProProAlaGlnTyrSerTrpPhe 290295300 GTCAATGGGACTTTCCAGCAATCCACCCAAGAGCTCTTTATCCCCAAC960 ValAsnGlyThrPheGlnGlnSerThrGlnGluLeuPheIleProAsn 305310315320 ATCACTGTGAATAATAGTGGATCCTATACGTGCCAAGCCCATAACTCA1008 IleThrValAsnAsnSerGlySerTyrThrCysGlnAlaHisAsnSer 325330335 GACACTGGCCTCAATAGGACCACAGTCACGACGATCACAGTCTATGCA1056 AspThrGlyLeuAsnArgThrThrValThrThrIleThrValTyrAla 340345350 GAGCCACCCAAACCCTTCATCACCAGCAACAACTCCAACCCCGTGGAG1104 GluProProLysProPheIleThrSerAsnAsnSerAsnProValGlu 355360365 GATGAGGATGCTGTAGCCTTAACCTGTGAACCTGAGATTCAGAACACA1152 AspGluAspAlaValAlaLeuThrCysGluProGluIleGlnAsnThr 370375380 ACCTACCTGTGGTGGGTAAATAATCAGAGCCTCCCGGTCAGTCCCAGG1200 ThrTyrLeuTrpTrpValAsnAsnGlnSerLeuProValSerProArg 385390395400 CTGCAGCTGTCCAATGACAACAGGACCCTCACTCTACTCAGTGTCACA1248 LeuGlnLeuSerAsnAspAsnArgThrLeuThrLeuLeuSerValThr 405410415 AGGAATGATGTAGGACCCTATGAGTGTGGAATCCAGAACGAATTAAGT1296 ArgAsnAspValGlyProTyrGluCysGlyIleGlnAsnGluLeuSer 420425430 GTTGACCACAGCGACCCAGTCATCCTGAATGTCCTCTATGGCCCAGAC1344 ValAspHisSerAspProValIleLeuAsnValLeuTyrGlyProAsp 435440445 GACCCCACCATTTCCCCCTCATACACCTATTACCGTCCAGGGGTGAAC1392 AspProThrIleSerProSerTyrThrTyrTyrArgProGlyValAsn 450455460 CTCAGCCTCTCCTGCCATGCAGCCTCTAACCCACCTGCACAGTATTCT1440 LeuSerLeuSerCysHisAlaAlaSerAsnProProAlaGlnTyrSer 465470475480 TGGCTGATTGATGGGAACATCCAGCAACACACACAAGAGCTCTTTATC1488 TrpLeuIleAspGlyAsnIleGlnGlnHisThrGlnGluLeuPheIle 485490495 TCCAACATCACTGAGAAGAACAGCGGACTCTATACCTGCCAGGCCAAT1536 SerAsnIleThrGluLysAsnSerGlyLeuTyrThrCysGlnAlaAsn 500505510 AACTCAGCCAGTGGCCACAGCAGGACTACAGTCAAGACAATCACAGTC1584 AsnSerAlaSerGlyHisSerArgThrThrValLysThrIleThrVal 515520525 TCTGCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAAACCC1632 SerAlaGluLeuProLysProSerIleSerSerAsnAsnSerLysPro 530535540 GTGGAGGACAAGGATGCTGTGGCCTTCACCTGTGAACCTGAGGCTCAG1680 ValGluAspLysAspAlaValAlaPheThrCysGluProGluAlaGln 545550555560 AACACAACCTACCTGTGGTGGGTAAATGGTCAGAGCCTCCCAGTCAGT1728 AsnThrThrTyrLeuTrpTrpValAsnGlyGlnSerLeuProValSer 565570575 CCCAGGCTGCAGCTGTCCAATGGCAACAGGACCCTCACTCTATTCAAT1776 ProArgLeuGlnLeuSerAsnGlyAsnArgThrLeuThrLeuPheAsn 580585590 GTCACAAGAAATGACGCAAGAGCCTATGTATGTGGAATCCAGAACTCA1824 ValThrArgAsnAspAlaArgAlaTyrValCysGlyIleGlnAsnSer 595600605 GTGAGTGCAAACCGCAGTGACCCAGTCACCCTGGATGTCCTCTATGGG1872 ValSerAlaAsnArgSerAspProValThrLeuAspValLeuTyrGly 610615620 CCGGACACCCCCATCATTTCCCCCCCAGACTCGTCTTACCTTTCGGGA1920 ProAspThrProIleIleSerProProAspSerSerTyrLeuSerGly 625630635640 GCGAACCTCAACCTCTCCTGCCACTCGGCCTCTAACCCATCCCCGCAG1968 AlaAsnLeuAsnLeuSerCysHisSerAlaSerAsnProSerProGln 645650655 TATTCTTGGCGTATCAATGGGATACCGCAGCAACACACACAAGTTCTC2016 TyrSerTrpArgIleAsnGlyIleProGlnGlnHisThrGlnValLeu 660665670 TTTATCGCCAAAATCACGCCAAATAATAACGGGACCTATGCCTGTTTT2064 PheIleAlaLysIleThrProAsnAsnAsnGlyThrTyrAlaCysPhe 675680685 GTCTCTAACTTGGCTACTGGCCGCAATAATTCCATAGTCAAGAGCATC2112 ValSerAsnLeuAlaThrGlyArgAsnAsnSerIleValLysSerIle 690695700 ACAGTCTCTGCATCTGGAACTTCTCCTGGTCTCTCAGCTGGGGCCACT2160 ThrValSerAlaSerGlyThrSerProGlyLeuSerAlaGlyAlaThr 705710715720 GTCGGCATCATGATTGGAGTGCTGGTTGGGGTTGCTCTGATA2202 ValGlyIleMetIleGlyValLeuValGlyValAlaLeuIle 725730 TAGCAGCCCTGGTGTAGT2220 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 734 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: ArgProAlaAspGlnThrValThrAlaAlaLeuThrLysArgSerTrp 151015 AsnSerSerThrSerProGlnArgArgThrGluGlnThrAlaGluThr 202530 MetGluSerProSerAlaProProHisArgTrpCysIleProTrpGln 354045 ArgLeuLeuLeuThrAlaSerLeuLeuThrPheTrpAsnProProThr 505560 ThrAlaLysLeuThrIleGluSerThrProPheAsnValAlaGluGly 65707580 LysGluValLeuLeuLeuValHisAsnLeuProGlnHisLeuPheGly 859095 TyrSerTrpTyrLysGlyGluArgValAspGlyAsnArgGlnIleIle 100105110 GlyTyrValIleGlyThrGlnGlnAlaThrProGlyProAlaTyrSer 115120125 GlyArgGluIleIleTyrProAsnAlaSerLeuLeuIleGlnAsnIle 130135140 IleGlnAsnAspThrGlyPheTyrThrLeuHisValIleLysSerAsp 145150155160 LeuValAsnGluGluAlaThrGlyGlnPheArgValTyrProGluLeu 165170175 ProLysProSerIleSerSerAsnAsnSerLysProValGluAspLys 180185190 AspAlaValAlaPheThrCysGluProGluThrGlnAspAlaThrTyr 195200205 LeuTrpTrpValAsnAsnGlnSerLeuProValSerProArgLeuGln 210215220 LeuSerAsnGlyAsnArgThrLeuThrLeuPheAsnValThrArgAsn 225230235240 AspThrAlaSerTyrLysCysGluThrGlnAsnProValSerAlaArg 245250255 ArgSerAspSerValIleLeuAsnValLeuTyrGlyProAspAlaPro 260265270 ThrIleSerProLeuAsnThrSerTyrArgSerGlyGluAsnLeuAsn 275280285 LeuSerCysHisAlaAlaSerAsnProProAlaGlnTyrSerTrpPhe 290295300 ValAsnGlyThrPheGlnGlnSerThrGlnGluLeuPheIleProAsn 305310315320 IleThrValAsnAsnSerGlySerTyrThrCysGlnAlaHisAsnSer 325330335 AspThrGlyLeuAsnArgThrThrValThrThrIleThrValTyrAla 340345350 GluProProLysProPheIleThrSerAsnAsnSerAsnProValGlu 355360365 AspGluAspAlaValAlaLeuThrCysGluProGluIleGlnAsnThr 370375380 ThrTyrLeuTrpTrpValAsnAsnGlnSerLeuProValSerProArg 385390395400 LeuGlnLeuSerAsnAspAsnArgThrLeuThrLeuLeuSerValThr 405410415 ArgAsnAspValGlyProTyrGluCysGlyIleGlnAsnGluLeuSer 420425430 ValAspHisSerAspProValIleLeuAsnValLeuTyrGlyProAsp 435440445 AspProThrIleSerProSerTyrThrTyrTyrArgProGlyValAsn 450455460 LeuSerLeuSerCysHisAlaAlaSerAsnProProAlaGlnTyrSer 465470475480 TrpLeuIleAspGlyAsnIleGlnGlnHisThrGlnGluLeuPheIle 485490495 SerAsnIleThrGluLysAsnSerGlyLeuTyrThrCysGlnAlaAsn 500505510 AsnSerAlaSerGlyHisSerArgThrThrValLysThrIleThrVal 515520525 SerAlaGluLeuProLysProSerIleSerSerAsnAsnSerLysPro 530535540 ValGluAspLysAspAlaValAlaPheThrCysGluProGluAlaGln 545550555560 AsnThrThrTyrLeuTrpTrpValAsnGlyGlnSerLeuProValSer 565570575 ProArgLeuGlnLeuSerAsnGlyAsnArgThrLeuThrLeuPheAsn 580585590 ValThrArgAsnAspAlaArgAlaTyrValCysGlyIleGlnAsnSer 595600605 ValSerAlaAsnArgSerAspProValThrLeuAspValLeuTyrGly 610615620 ProAspThrProIleIleSerProProAspSerSerTyrLeuSerGly 625630635640 AlaAsnLeuAsnLeuSerCysHisSerAlaSerAsnProSerProGln 645650655 TyrSerTrpArgIleAsnGlyIleProGlnGlnHisThrGlnValLeu 660665670 PheIleAlaLysIleThrProAsnAsnAsnGlyThrTyrAlaCysPhe 675680685 ValSerAsnLeuAlaThrGlyArgAsnAsnSerIleValLysSerIle 690695700 ThrValSerAlaSerGlyThrSerProGlyLeuSerAlaGlyAlaThr 705710715720 ValGlyIleMetIleGlyValLeuValGlyValAlaLeuIle 725730 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: CCAGTGAATTCCTAATACGACTACCTATAGGTTAAAACAGC41 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GATGAACCCTCGAGACCCATTATG24 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: CCACCAAGTACGTAACCACATATGG25 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: GTGAGGACTGCTGG14 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: CACCACTGCCCTCGAGAAGCTCACTATTG29 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: CACCACTGCCCTCGAGAAGCTCACTATTG29 __________________________________________________________________________
Claims (37)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/389,459 US5817512A (en) | 1993-07-01 | 1995-02-15 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
| US08/589,446 US5614413A (en) | 1993-07-01 | 1996-01-22 | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| AU49784/96A AU4978496A (en) | 1993-07-01 | 1996-02-13 | Encapsidated recombinant poliovirus nucleic acid |
| PCT/US1996/001895 WO1996025173A1 (en) | 1993-07-01 | 1996-02-13 | Encapsidated recombinant poliovirus nucleic acid |
| EP96906392A EP0809513A4 (en) | 1993-07-01 | 1996-02-13 | NUCLEIC ACID OF RECOMBINANT ENCAPSIDE POLIOVIRUS |
| US08/987,867 US6063384A (en) | 1993-07-01 | 1997-12-09 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
| US09/756,551 US20020051768A1 (en) | 1993-07-01 | 2001-01-08 | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US8700993A | 1993-07-01 | 1993-07-01 | |
| US08/389,459 US5817512A (en) | 1993-07-01 | 1995-02-15 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
Related Parent Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US8700993A Continuation-In-Part | 1993-07-01 | 1993-07-01 | |
| US8700993A Continuation | 1993-07-01 | 1993-07-01 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/987,867 Division US6063384A (en) | 1993-07-01 | 1997-12-09 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
| US08/987,867 Continuation US6063384A (en) | 1993-07-01 | 1997-12-09 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5817512A true US5817512A (en) | 1998-10-06 |
Family
ID=22202371
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/389,459 Expired - Fee Related US5817512A (en) | 1993-07-01 | 1995-02-15 | Encapsidated recombinant viral nucleic acid and methods of making and using same |
| US08/444,882 Expired - Fee Related US5622705A (en) | 1993-07-01 | 1995-05-19 | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/444,882 Expired - Fee Related US5622705A (en) | 1993-07-01 | 1995-05-19 | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US5817512A (en) |
| CA (1) | CA2125344A1 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6228580B1 (en) * | 1995-07-31 | 2001-05-08 | Genset | Nucleic acid detection method using nucleotide probes enabling both specific capture and detection |
| US20020051768A1 (en) * | 1993-07-01 | 2002-05-02 | Morrow Casey D. | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| US20030040498A1 (en) * | 2001-03-14 | 2003-02-27 | Ansardi David Calvert | Oncolytic RNA replicons |
| US20030162733A1 (en) * | 2000-11-27 | 2003-08-28 | Haynes Joel R. | Nucleic acid adjuvants |
| US6680169B2 (en) | 2000-04-14 | 2004-01-20 | University Of Alabama Research Foundation | Poliovirus replicons encoding therapeutic agents and uses thereof |
| US20040045050A1 (en) * | 1998-05-22 | 2004-03-04 | Lada Rasochova | Methods and materials for transformation |
| WO2005040365A1 (en) * | 2003-10-23 | 2005-05-06 | Nmk Research, Llc | Immunogenic composition and method of developing a vaccine based on portions of the hiv matrix protein |
| US20070048860A1 (en) * | 1997-10-10 | 2007-03-01 | The Government Of The Usa, As Represented By The Secretary, Department Of Health And Human Services | Carcinoembryonic antigen (CEA) peptides |
| WO2014043518A1 (en) | 2012-09-14 | 2014-03-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use |
| US20140134204A1 (en) * | 2011-04-04 | 2014-05-15 | University Of Iowa Research Foundation | Methods of improving vaccine immunogenicity |
| US9753036B2 (en) | 2014-04-29 | 2017-09-05 | Edp Biotech Corporation | Methods and compositions for screening and detecting biomarkers |
| CN109414023A (en) * | 2016-06-29 | 2019-03-01 | 杜克大学 | With the composition and method of chimeric poliovirus activated viral antigen presenting cell |
| EP4137150A1 (en) | 2015-08-03 | 2023-02-22 | The United States of America, as represented by the Secretary, Department of Health and Human Services | Brachyury deletion mutants, non-yeast vectors encoding brachyury deletion mutants, and their use |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5614413A (en) * | 1993-07-01 | 1997-03-25 | The Uab Research Foundation | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| US5939262A (en) * | 1996-07-03 | 1999-08-17 | Ambion, Inc. | Ribonuclease resistant RNA preparation and utilization |
| US5677124A (en) * | 1996-07-03 | 1997-10-14 | Ambion, Inc. | Ribonuclease resistant viral RNA standards |
| US7935805B1 (en) * | 1998-12-31 | 2011-05-03 | Novartis Vaccines & Diagnostics, Inc | Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof |
| CA2358385C (en) | 1998-12-31 | 2013-08-06 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| AU2001261724A1 (en) * | 2000-05-19 | 2001-12-03 | The Board Of Trustees Of The Leland Stanford Junior University | Viral vectors useful in induction of humoral or cellular immunity |
| EP2550362B1 (en) | 2010-03-25 | 2017-01-04 | Oregon Health&Science University | Cmv glycoproteins and recombinant vectors |
| SI2691530T1 (en) | 2011-06-10 | 2018-08-31 | Oregon Health & Science University | CMV glycoproteins and recombinant vectors |
| US20130189754A1 (en) | 2011-09-12 | 2013-07-25 | International Aids Vaccine Initiative | Immunoselection of recombinant vesicular stomatitis virus expressing hiv-1 proteins by broadly neutralizing antibodies |
| US9402894B2 (en) | 2011-10-27 | 2016-08-02 | International Aids Vaccine Initiative | Viral particles derived from an enveloped virus |
| EP2679596B1 (en) | 2012-06-27 | 2017-04-12 | International Aids Vaccine Initiative | HIV-1 env glycoprotein variant |
| WO2014026033A1 (en) | 2012-08-08 | 2014-02-13 | University Of Florida Research Foundation, Inc. | Cross-reactive t cell epitopes of hiv, siv, and fiv for vaccines in humans and cats |
| EP2848937A1 (en) | 2013-09-05 | 2015-03-18 | International Aids Vaccine Initiative | Methods of identifying novel HIV-1 immunogens |
| US10058604B2 (en) | 2013-10-07 | 2018-08-28 | International Aids Vaccine Initiative | Soluble HIV-1 envelope glycoprotein trimers |
| EP3069730A3 (en) | 2015-03-20 | 2017-03-15 | International Aids Vaccine Initiative | Soluble hiv-1 envelope glycoprotein trimers |
| US9931394B2 (en) | 2015-03-23 | 2018-04-03 | International Aids Vaccine Initiative | Soluble HIV-1 envelope glycoprotein trimers |
| EP3432901B1 (en) * | 2016-03-21 | 2021-09-01 | Duke University | Sequential anti-cancer treatment |
| US20220387529A1 (en) * | 2019-11-04 | 2022-12-08 | Duke University | Treatment for primary and metastatic cancer |
-
1994
- 1994-06-07 CA CA002125344A patent/CA2125344A1/en not_active Abandoned
-
1995
- 1995-02-15 US US08/389,459 patent/US5817512A/en not_active Expired - Fee Related
- 1995-05-19 US US08/444,882 patent/US5622705A/en not_active Expired - Fee Related
Non-Patent Citations (41)
| Title |
|---|
| Ansardi, D.C. et al. (1991) "Coinfection with Recombinant Vaccinia Viruses Expressing Poliovirus P1 and P3 Proteins Results in Polyprotein Processing and Formation of Empty Capsid Structures" J. Virol. 65(4):2088-2092. |
| Ansardi, D.C. et al. (1991) Coinfection with Recombinant Vaccinia Viruses Expressing Poliovirus P1 and P3 Proteins Results in Polyprotein Processing and Formation of Empty Capsid Structures J. Virol. 65(4):2088 2092. * |
| Ansardi, D.C. et al. (1992) "Myristylation of Polivirus Capsid Precursor P1 Is Required for Assembly of Subviral Particles" J. Virol. 66(7):4556-4563;. |
| Ansardi, D.C. et al. (1992) Myristylation of Polivirus Capsid Precursor P1 Is Required for Assembly of Subviral Particles J. Virol. 66(7):4556 4563;. * |
| Ansardi, D.C. et al. (1993) "Complementation of a Poliovirus Defective Genome by a Recombinant Vaccinia Virus Which Provides Poliovirus P1 Capsid Precursor in trans" J. Virol. 67(6):3684-3690. |
| Ansardi, D.C. et al. (1993) Complementation of a Poliovirus Defective Genome by a Recombinant Vaccinia Virus Which Provides Poliovirus P1 Capsid Precursor in trans J. Virol. 67(6):3684 3690. * |
| Ansardi, D.C. et al. (1994) "Characterization Poliovirus Repilicons Encoding Carcinoembryonic Antigen" Cancer Research 54:6359-6364. |
| Ansardi, D.C. et al. (1994) Characterization Poliovirus Repilicons Encoding Carcinoembryonic Antigen Cancer Research 54:6359 6364. * |
| Ansardi, D.C. et al. (Mar. 13 18, 1993) Molecular Analysis of Poliovirus Assembly Using Recombinant Vaccinia Viruses to Complement A Poliovirus Genome With A Capsid Gene Deletion J. Cell Biochem. Suppl. 17 (D); p. 22. * |
| Ansardi, D.C. et al. (Mar. 13-18, 1993) "Molecular Analysis of Poliovirus Assembly Using Recombinant Vaccinia Viruses to Complement A Poliovirus Genome With A Capsid Gene Deletion" J. Cell Biochem. Suppl. 17 (D); p. 22. |
| Choi et al. Expression of human immunodeficiency virus type 1 (HIV 1) gag, pol, and env proteins from chimeric HIV 1 poliovirus minireplicons J. Virol. vol. 65 2875 2883, 1991. * |
| Choi et al. Expression of human immunodeficiency virus type 1 (HIV-1) gag, pol, and env proteins from chimeric HIV-1-poliovirus minireplicons J. Virol. vol. 65 2875-2883, 1991. |
| Choi, W.S. et al. (1991) "Expression of Human Immunodeficieny Virus Type 1 (HIV-1) gag, pol, and env Proteins from Chimeric HIV-1-Poliovirus Minireplicons"J. Virol 65(6):2875-2883. |
| Choi, W.S. et al. (1991) Expression of Human Immunodeficieny Virus Type 1 (HIV 1) gag, pol, and env Proteins from Chimeric HIV 1 Poliovirus Minireplicons J. Virol 65(6):2875 2883. * |
| Evans, D.J. et al. (1989) "An Engineered Poliovirus Chimaera Elicits Boradly Reactive HIV-1 Neutralizing Antibodies" Nature 339:385-388;. |
| Evans, D.J. et al. (1989) An Engineered Poliovirus Chimaera Elicits Boradly Reactive HIV 1 Neutralizing Antibodies Nature 339:385 388;. * |
| Fox No winners against AIDS Biotechnology vol. 12 128, 1994. * |
| Haynes, B.F. (1993) "Scientific and Social Issues of Human Immunodeficiency Virus Vaccine Development" Science 260: 1279-1286. |
| Haynes, B.F. (1993) Scientific and Social Issues of Human Immunodeficiency Virus Vaccine Development Science 260: 1279 1286. * |
| Jenkins, O. et al. (1990) "An Anitgen Chimera of Polivirus Induces Antibodies against Human Papillomavirus Type 16" J. Virol. 64(3):1201-1206. |
| Jenkins, O. et al. (1990) An Anitgen Chimera of Polivirus Induces Antibodies against Human Papillomavirus Type 16 J. Virol. 64(3):1201 1206. * |
| Kantor et al. Antitumor activity and immune responses inducted by a recombinant carcinoembryonic antigen vaccinia virus vaccine J. Natl. Cancer Institute vol. 84 1084 1091, 1992. * |
| Kantor et al. Antitumor activity and immune responses inducted by a recombinant carcinoembryonic antigen-vaccinia virus vaccine J. Natl. Cancer Institute vol. 84 1084-1091, 1992. |
| Knuth et al. Cellular and humoral immune responses against cancer: implications for cancer vaccines Current Opinion in Immunol. vol. 3 659 664 1991. * |
| Knuth et al. Cellular and humoral immune responses against cancer: implications for cancer vaccines Current Opinion in Immunol. vol. 3 659-664 1991. |
| McGhee, J.R. and Mestecky, J. (1992) "The Mucosal Immune System in HIV Infection and Prospects for Mucosal Immunity to AIDS" in AIDS Research Reviews, W.C. Koff et al. (eds.), New York: Marcel Dekker, Inc., 2:Ch. 15, 289-312. |
| McGhee, J.R. and Mestecky, J. (1992) The Mucosal Immune System in HIV Infection and Prospects for Mucosal Immunity to AIDS in AIDS Research Reviews , W.C. Koff et al. (eds.), New York: Marcel Dekker, Inc., 2:Ch. 15, 289 312. * |
| Moldoveanu, Z. et al. (1995) "Immune Response s Induced by Administration of Encapsidated Poliovirus Replicons Which Express HIV-1 gag and env Proteins" FASEB J. 9(3):A214, No. 1247. |
| Moldoveanu, Z. et al. (1995) Immune Response s Induced by Administration of Encapsidated Poliovirus Replicons Which Express HIV 1 gag and env Proteins FASEB J. 9(3):A214, No. 1247. * |
| Morrow, C.D. et al. (1994) "New Approaches for Mucosal Vaccines for AIDS: Encapisadation and Serial Passage of Poliovirus Repilicons that Express HIV-1 Proteins on Infection" AIDS Research and Human Retroviruses 10 Suppl. 1:S61-S66. |
| Morrow, C.D. et al. (1994) New Approaches for Mucosal Vaccines for AIDS: Encapisadation and Serial Passage of Poliovirus Repilicons that Express HIV 1 Proteins on Infection AIDS Research and Human Retroviruses 10 Suppl. 1:S61 S66. * |
| Percy, N. et al. (1992) "A Poliovirus Replicon Containing the Chloramphenicol Acetytranferase Gene Can Be Used To Study the Replicon and Encapsidation of Poliovirus RNA" J. Virol. 66(8):5040-5046. |
| Percy, N. et al. (1992) A Poliovirus Replicon Containing the Chloramphenicol Acetytranferase Gene Can Be Used To Study the Replicon and Encapsidation of Poliovirus RNA J. Virol. 66(8):5040 5046. * |
| Porter, D. et al., "Encapsidation of Poliovirus Replicons Encoding the Complete Human Immunodeficiency Virus Type 1 gag Gene by Using a Complementation System Which Provides the P1 Capsid Protein in trans," Journal of Virology, vol. 69, No. 3, 1548-1555 (Mar. 1995). |
| Porter, D. et al., Encapsidation of Poliovirus Replicons Encoding the Complete Human Immunodeficiency Virus Type 1 gag Gene by Using a Complementation System Which Provides the P1 Capsid Protein in trans, Journal of Virology , vol. 69, No. 3, 1548 1555 (Mar. 1995). * |
| Porter, D.C. et al. (1993) "Encapsidation of Genetically Engineered Poliovirus Minireplicons Which Express Human Immunodeficiency Virus Type 1 Gag and Pol Proteins upon Infection" J. Virol. 67(7):3712-3719. |
| Porter, D.C. et al. (1993) "Expression of Poliovirus P3 Proteins Using a Recombinant Vaccinia Virus Results in Proteolytically Active 3CD Precursor Protein Without Further Processing to 3Cpro and 3Dpol " Virus Research 29:241-254. |
| Porter, D.C. et al. (1993) Encapsidation of Genetically Engineered Poliovirus Minireplicons Which Express Human Immunodeficiency Virus Type 1 Gag and Pol Proteins upon Infection J. Virol. 67(7):3712 3719. * |
| Porter, D.C. et al. (1993) Expression of Poliovirus P3 Proteins Using a Recombinant Vaccinia Virus Results in Proteolytically Active 3CD Precursor Protein Without Further Processing to 3C pro and 3D pol Virus Research 29:241 254. * |
| Porter, D.C. et al. (Mar. 13 18, 1993) Encapsidation of Chimeric HIV 1 Poliovirus Minireplicons J. Cell Biochem. Suppl. 17 (D): p. 26. * |
| Porter, D.C. et al. (Mar. 13-18, 1993) "Encapsidation of Chimeric HIV-1-Poliovirus Minireplicons"J. Cell Biochem. Suppl. 17 (D): p. 26. |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020051768A1 (en) * | 1993-07-01 | 2002-05-02 | Morrow Casey D. | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same |
| US6228580B1 (en) * | 1995-07-31 | 2001-05-08 | Genset | Nucleic acid detection method using nucleotide probes enabling both specific capture and detection |
| US20070048860A1 (en) * | 1997-10-10 | 2007-03-01 | The Government Of The Usa, As Represented By The Secretary, Department Of Health And Human Services | Carcinoembryonic antigen (CEA) peptides |
| US20090106855A1 (en) * | 1998-05-22 | 2009-04-23 | Lada Rasochova | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
| US20040045050A1 (en) * | 1998-05-22 | 2004-03-04 | Lada Rasochova | Methods and materials for transformation |
| US10308946B2 (en) | 1998-05-22 | 2019-06-04 | Wisconsin Alumni Research Foundation | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
| US6680169B2 (en) | 2000-04-14 | 2004-01-20 | University Of Alabama Research Foundation | Poliovirus replicons encoding therapeutic agents and uses thereof |
| US20030162733A1 (en) * | 2000-11-27 | 2003-08-28 | Haynes Joel R. | Nucleic acid adjuvants |
| US20060019921A1 (en) * | 2000-11-27 | 2006-01-26 | Haynes Joel R | Nucleic acid adjuvants |
| US20030040498A1 (en) * | 2001-03-14 | 2003-02-27 | Ansardi David Calvert | Oncolytic RNA replicons |
| US20090136542A1 (en) * | 2003-10-23 | 2009-05-28 | Karp Nelson M | Immunogenic composition and method of developing a vaccine based on portions of the HIV matrix protein |
| US20090028890A1 (en) * | 2003-10-23 | 2009-01-29 | Karp Nelson M | Immunogenic composition and method of developing a vaccine based on portions of the HIV matrix protein |
| US20050112140A1 (en) * | 2003-10-23 | 2005-05-26 | Nmk Research, Llc | Immunogenic composition and method of developing a vaccine based on portions of the HIV matrix protein |
| US7611712B2 (en) | 2003-10-23 | 2009-11-03 | Nelson M. Karp | Immunogenic compositions capable of eliciting Th1 immune responses comprising an HIV-1 MA myristate binding site polypeptide |
| US7718180B2 (en) | 2003-10-23 | 2010-05-18 | Karp Nelson M | Immunizing compositions comprising nucleic acids encoding the HIV-1 matrix protein myristate binding site |
| US7790177B2 (en) | 2003-10-23 | 2010-09-07 | Karp Nelson M | Immunizing compositions comprising recombinant attenuated self-replicating viral RNA replicons encoding an epitope obtained from the HIV-1 matrix protein myrstate binding site |
| AU2004283288B2 (en) * | 2003-10-23 | 2010-09-09 | Karp, Nelson M. M.D. | Immunogenic composition and method of developing a vaccine based on portions of the HIV matrix protein |
| RU2403915C2 (en) * | 2003-10-23 | 2010-11-20 | Нелсон М. КАРП | Immunogenic composition and method of development of vaccine based on hiv matrix protein regions |
| WO2005040365A1 (en) * | 2003-10-23 | 2005-05-06 | Nmk Research, Llc | Immunogenic composition and method of developing a vaccine based on portions of the hiv matrix protein |
| US20140134204A1 (en) * | 2011-04-04 | 2014-05-15 | University Of Iowa Research Foundation | Methods of improving vaccine immunogenicity |
| AU2012240231B2 (en) * | 2011-04-04 | 2017-05-25 | University Of Iowa Research Foundation | Methods of improving vaccine immunogenicity |
| US10059746B2 (en) * | 2011-04-04 | 2018-08-28 | University Of Iowa Research Foundation | Methods of improving vaccine immunogenicity |
| WO2014043518A1 (en) | 2012-09-14 | 2014-03-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use |
| US9753036B2 (en) | 2014-04-29 | 2017-09-05 | Edp Biotech Corporation | Methods and compositions for screening and detecting biomarkers |
| EP4137150A1 (en) | 2015-08-03 | 2023-02-22 | The United States of America, as represented by the Secretary, Department of Health and Human Services | Brachyury deletion mutants, non-yeast vectors encoding brachyury deletion mutants, and their use |
| CN109414023A (en) * | 2016-06-29 | 2019-03-01 | 杜克大学 | With the composition and method of chimeric poliovirus activated viral antigen presenting cell |
| US11331343B2 (en) * | 2016-06-29 | 2022-05-17 | Duke University | Compositions and methods for activating antigen presenting cells with chimeric poliovirus |
Also Published As
| Publication number | Publication date |
|---|---|
| US5622705A (en) | 1997-04-22 |
| CA2125344A1 (en) | 1995-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5817512A (en) | Encapsidated recombinant viral nucleic acid and methods of making and using same | |
| US5614413A (en) | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same | |
| CN111603557B (en) | Envelope replacement type viral vector vaccine and construction method thereof | |
| JP3967374B2 (en) | Synchronous in vivo gene expression | |
| DK1756287T3 (en) | A synergistic attenuation of vesicular stomatitis virus, vectors, and immunogenic compositions thereof thereof | |
| Porta et al. | The development of cowpea mosaic virus as a potential source of novel vaccines | |
| CN102834507B (en) | For generating the construct of sky picornavirus housing | |
| KR19990087126A (en) | Synthetic Human Immunodeficiency Virus Gene | |
| Ansardi et al. | Characterization of poliovirus replicons encoding carcinoembryonic antigen | |
| MX2007014038A (en) | Vaccine composition. | |
| Moldoveanu et al. | Immune responses induced by administration of encapsidated poliovirus replicons which express HIV-1 gag and envelope proteins | |
| AU719034B2 (en) | Genetically altered feline immunodeficiency viruses and their use as an effective vaccine against feline immunodeficiency virus infection | |
| KR100347220B1 (en) | Recombinant adenovirus HIV vaccines | |
| Porter et al. | Release of virus-like particles from cells infected with poliovirus replicons which express human immunodeficiency virus type 1 Gag | |
| Sanz-Parra et al. | Analysis of the B and T cell response in guinea pigs induced with recombinant vaccinia expressing foot-and-mouth disease virus structural proteins | |
| US20020051768A1 (en) | Encapsidated recombinant poliovirus nucleic acid and methods of making and using same | |
| US6696289B1 (en) | Replication-competent recombinant Sabin type 1 strain of poliovirus | |
| ANDERSON et al. | Poliovirus replicons that express the Gag or the envelope surface protein of simian immunodeficiency virus SIVsmmPBj14 | |
| AU766264B2 (en) | Viral chimeras comprised of caev and hiv-1 genetic elements | |
| Binder et al. | Genetic stability of attenuated mengovirus vectors with duplicate primary cleavage sequences | |
| EP0997529B1 (en) | Feline immunodeficiency virus strain FIV-141 and uses thereof | |
| JP2005519959A (en) | Methods for inducing an enhanced immune response against HIV | |
| US20030124146A1 (en) | Recombinant Rhabdoviruses as live-viral vaccines | |
| US20030091590A1 (en) | Recombinant rhabdoviruses as live-viral vaccines | |
| JP2002501369A (en) | FIV vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: UAB RESEARCH FOUNDATION, THE Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MORROW, CASEY D.;PORTER, DONNA C.;REEL/FRAME:007400/0936 Effective date: 19950323 |
|
| AS | Assignment |
Owner name: UAB RESEARCH FOUNDATION, THE, ALABAMA Free format text: RECORD TO CORRECT SERIAL NUMBER AND THE SPELLING IN THE ADDRESS OF THE ASSIGNEE ON A PREVIOUSLY RECORDED DOCUMENT AT REEL 7400 FRAME 936.;ASSIGNORS:MORROW, CASEY D.;PORTER, DONNA C.;REEL/FRAME:007783/0853 Effective date: 19950323 |
|
| AS | Assignment |
Owner name: UAB RESEARCH FOUNDATION, THE, ALABAMA Free format text: CORRECTED ASSIGNMENT;ASSIGNORS:MORROW, CASEY D.;PORTER, DONNA C.;REEL/FRAME:008594/0127 Effective date: 19950323 |
|
| CC | Certificate of correction | ||
| FEPP | Fee payment procedure |
Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| REFU | Refund |
Free format text: REFUND - PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: R283); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| SULP | Surcharge for late payment | ||
| REMI | Maintenance fee reminder mailed | ||
| LAPS | Lapse for failure to pay maintenance fees | ||
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20061006 |
|
| AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE UNIVERSITY OF ALABAMA AT BIRMINGHAM;REEL/FRAME:020919/0126 Effective date: 20010717 |