JP2002501369A - FIV vaccine - Google Patents

Abstract

(57) Summary Vaccine preparations for FIV-related diseases, comprising FIPV polynucleotides having a dysfunctional pol gene, FIPV polynucleotide fragments, and their use in the prevention and / or treatment of FIV-related diseases.

Description

DETAILED DESCRIPTION OF THE INVENTION                              FIV vaccineTechnical field   The present invention provides a feline immunodeficiency provirus (FI) comprising a dysfunctional pol gene region. PV) a polynucleotide fragment and a recombinant comprising the FIVP polynucleotide fragment And a host cell containing the FIPV polynucleotide fragment, Feline immunodeficiency virus (FIV) vaccine containing FIPV polynucleotide fragment And a method for treating a FIV-related disease, comprising the FIPV polynucleotide fragment, Pharmaceutical compositions used as prophylactic and / or therapeutic agents in cats I do.Background art   Feline immunodeficiency virus (FIV) is a type of retrovirus. This is Is a lentivirus involved in wasting immunodeficiency syndrome in chicks (Pedersen   N. C. Et al., Science (1987), 235, 790-793). .   Lentiviruses naturally exhibit large molecular and biological variations . One factor in the occurrence of such natural mutations is the replication of viral genomic RNA into DNA. Low fidelity of viral enzyme reverse transcriptase during the manufacturing process (Preston et al., Science 242: 1168- 1171 (1988), Roberts et al., Science 242: 11. 71-1173 (1988)). As a result, various FIV mutant strains were found. I have.   To date, various FIV mutant isolates have been described, of which Some have undergone molecular cloning. Of these strains, isolated in the United States The two strains were Petaluma strains (Olmsted et al., Proc. Nat. l. Acad. Sci USA 86: 8088-8092 (1989), T. albott et al., Proc. Na tl. Acad. Sci. USA 86: 5743-5747 (1989). ｝ And the San Diego strain {Phillips et al. Virol. 64: 4605-4613 (1990)}, one in the UK {Harbour et al., V et. Rec. 122: 84-86 (1988)} and two types in Japan {I J. Shida et al. Am. Vet. Med. Assoc. 194: 221-22 5 (1989), Miyazawa et al., Arch. Virol. 108: 59 ６８68 (1989)}, which are the D of strains grown in vitro. It was obtained from NA. One of these strains, the above-mentioned Olmsted Another F14 clone is available in the GenBank database under accession number M25381. Has been deposited.   For the determination of molecular characteristics and heterogeneity between FIV isolates, see Maki et al., {Arch. Virol. 123: 29-45 {1992}. FIV Protein or envelope (ENV) protein and virus particle core (GAG) protein Synthesis of DNA clones from white and use to detect and prevent FIV This is described in International Patent Application Publication No. WO 92/15684.   Sero-epidemiological research reveals that the virus occurs worldwide { Furuya et al., Jpn. J. Vet. Sci. 52: 891-893 (1990) Gruffydd-Jones et al., Vet. Rec. 123: 569-570 , (1988), Ishida et al., Jpn. J. Vet. Sci. 52:45 3-454 (1990); Ishida et al., Jpn. J. Vet. Sci. 5 0: 39-44 (1988), Ishida et al. AM. Vet. Med. Assoc. 194: 221-225 (1989); Z. Vet. J. 37: 41-43 (1989)}.   FIV is composed of the antigenic protein group (GAG), which is the main viral structural protein, and POL The protein of the polymerase gene and ENV, that is, the protein of the envelope gene It has a complex genomic structure. The gag gene is Trix, the capsid protein and the nucleocapsid protein Genes include protease, reverse transcriptase, dUTPase and integrase Code. The env gene encodes surface and transmembrane envelope glycoproteins You. In addition to structural and enzymatic proteins, FIV contains at least three more Genes (Vif, ORFA, Rev) exist (Miyazawa T., A rch. Virol. (1994), Vol. 134, 221-234). Les Like other members of the Torovirus, the integrated genome of FIV contains U5, R and U Bounded by a long terminal repeat (LTR) containing three domains. Similarly, basic configuration requirements The elementary gag, ppl and env are encoded in a genome of about 9500 base pairs. Relo. In addition to these general elements, FIV has several short reading frames (sORFs). Code). For details of the gene analysis mechanism of FIV, see John H. E lder and Tom R.S. Phillips, Conclusion, “Infecttipu s Agents and Disease (Infectious Agents and Diseases) Volume 2, 36 Pp. 1-374 (1994).   Controlling FIV infection by vaccination is a long-sought goal It is.   International Patent Application Publication No. WO 94/20622 discloses neutralizing antibodies against FIV. Vaccine against FIV comprising a polypeptide fragment of an inducible FIV surface protein Is provided. Producing DNA vaccine against FIV infection Possibility of using virus FIV DNA and its practical use Is not mentioned at all.   The development of a preventive FIV vaccine has proven difficult (Hosie) M. J. And Yamamoto J. et al. K. (1995) Feline immunology and immunity Failure (Willett BJ and Jarrett 0. Eds.) Sford University Press, New York, pp. 263-278). Many FIV particles For the development of a constitutively releasing cell line (FL4) First success (Yamamoto JK et al. (1991) Inter-Viro. logic, 32, 361-375). An inactivated window based on this cell line First protective effect against FIV infection with Lus vaccine and whole cell vaccine However, the spectrum for obtaining this protective effect was limited later. (Hosie MJ et al., (1995) J. Virol. 69, 1253-1255). This suggests that the reported strategy is Not so good for a variety of antigenically distinct natural isolates of FIV that are not easy to breed It is not a use. In particular, FIV subunit vaccines Not obtained to date. In animals immunized with glycoproteins purified from virus particles , A decrease in viral load was observed after the load test (Hosie MJ et al., (1996) Vaccine Vol. 14, 405-411), recombinant protein Studies using white as an immunogen promoted early infection rather than reduced load. (Hosie MJ, et al., (1992) Vet. Immunol. Pa. thol. Vol. 35, 191-198; Siebellink K. et al. H. J . Et al., (1995) J. Mol. Virol. Vol. 69, 3704-3711) .   Genetic immunity to elicit an immune response is described in Tang D. et al. C. By others 1 992, Nature (London) Vol. 356, 152-154 Was the first to be reported. General considerations for genetic immunity are further described in Ha ssett D.S. E. FIG. And Whiton J. et al. L. By Trends . Microbiol. (1996) Vol. Report on pages 4, 307-312 Was told. Prophylactic immunity has been achieved in viral host systems using DNA inoculation (Fynan EF et al., (1993) Proc. Natl. Acad. S. ci. USA Vol. 90, 11478-11482; Webster R . G. FIG. Et al., (1994) Vaccine Vol. 12, 1495-1498 page). However, in previous attempts, individual viral genes or A plasmid containing a combination of genes was used, This was limited to non-replicating vectors. Expression of FIV ENV protein in cats Attempts to prevent infections by lentiviruses such as FIV {Cuisinier AM et al., (1996), Fort, Colorado Collins, 3rd International Fline Retrov irth Research Symposium (3rd International Cat Retro Wi Lus Research Symposium)}.   The problems outlined above include vaccination with lentivirus, especially FIV vaccines. Raises the need to consider alternative methods of inoculation It is.   Dysfunctional reverse transcriptase during the manufacture and use of vaccines against FIV-related diseases The use of FIV pol region deletion mutants containing the (RT) gene region It is not taught in the prior art.   It can be obtained as a stable and high titer virus by DNA delivery. Delivery of virus derivatives that have been comprehensively disabled, It is likely that the virus vaccine will be used.   The present invention seeks to mitigate the disadvantages associated with the prior art.Disclosure of the invention   According to a first embodiment of the present invention, a functionally competent reverse transcriptase (RT ) Or a functional RT fragment thereof containing a dysfunctional pol gene that is substantially incapable of encoding. Vaccine containing feline immunodeficiency provirus (FIPV) polynucleotide A formulation is obtained.   A “FIPV” polynucleotide is a FIV capable of integration into the host cell genome. As a polynucleotide fragment. A host cell containing the FIPV of the present invention comprises: FI other than a functionally responsive RT or a functionally responsive fragment thereof V protein can be produced. As such, the host cell of the FIPV of the present invention is a non-infectious FI V virus particles, ie, FIV particles that are substantially incapable of replicating. You.   "Dysfunctional pol gene" refers to native RT or functionally equivalent thereto. This is a pol gene that cannot substantially encode a pol gene. For this reason, "the malfunction p The term “ol gene” means that the pol gene is an in-frame deletion, insertion or substitution (or Other changes in the DNA sequence, such as the sequence, cause the pol gene to normally function Responsive RT or its functionally responsive equivalent polypeptide product It means that it has been modified so that it cannot be expressed.   The pol gene of the present invention, which cannot substantially encode a functionally responsive RT, A dysfunction can result from any of several methods. (I) In-frame RT coding for the pol gene from wild-type FIPV genome Whole domain deletion. For example, depending on the FIPV or FIV wild type of interest. Thus, deletion of a nucleotide sequence from a wild-type FIPV or FIV genome Nucleotides around 2337 ± 12 bases to nucleotides 4013 ± 12 bases Can happen between One example of a FIV clone in which a deletion can occur is the F14 clone of FIV. It is a loan. Using this clone, the nucleotides Causing deletion of the entire in-frame RT coding region during Can be. Affects the expression of FIV or other gene products obtained from the FIPV genome In-frame deletions should be as described above to avoid interference. Must. (Ii) In-frame RT coding of the pol gene of the wild-type FIPV genome Deletion of part of the domain. "Part of the in-frame RT coding domain" is R Deletion from the T coding region may result in encoding RT or a fragment thereof. And / or sufficient to allow expression and produced by FIV or FIPV. Poly with substantially no physiological activity due to the physiological activity of the functional RT produced Means nucleotide fragment. The deletion portion of RT is, for example, 1-2 or It may include deletions of fewer nucleotides. RT gene of pol gene Such deletions in the coding domain can be made using recombinant DNA technology. Achievement can do. Thus, the translation ORF of the RT is changed, for example, wild-type F Found under native conditions, such as RT from the pol gene of IPV or FIV Proteins that lack the physiological function or functional eligibility of RT can be produced. In addition, those skilled in the art will recognize that the translation ORF of the RT domain of the pol gene Such deletions result in functionally competent RT, truncated RT, any RT or A dysfunctional po that cannot substantially encode it even with its polypeptide fragment It will also be appreciated that the l gene can also occur. If produced, such proteins White / polypeptide enzyme RT typically lacks typical functional qualifications You. (Iii) RT domain of the pol gene described in (i) or (ii) above Deletion of all or part of an in leaves a "gap" in the pol gene. One gene or one gene fragment, or multiple genes or multiple A suitable polynucleotide fragment, such as a fragment, can be inserted into this "gap". You. For gene insertion, for example, ν feline interferon or other Polypeptides that can enhance the immune response of feline cytokines, including Genes that express the peptide may be included. Suitable marker genes include, for example, E. coli. enzyme-labeled genes such as the lac-Z gene obtained from E. coli, Genes labeled with antibiotics such as syn and neomycin, but not limited to these. It is not something to be done. Usually, when a marker gene is present, it is used for RT deletion. It is. Substantial adverse effects or long-term side effects in recipient animals In order to avoid this, the FIPV or FIV variants of the invention It can be used as a marker gene.   Preferably, the whole or one RT domain of the pol gene obtained from FIPV is used. The “gap” created by the deletion of the part is filled by the polynucleotide insert. Rather, the truncation of the deletion site is replaced using conventional recombinant DNA technology. Be combined. One of skill in the art will appreciate that some of the pol gene RT coding regions or Was left after the entire deletion A "gap" is defined as a nonsense nucleotide sequence or an anti-yance sequence. Obviously, it may be padded with nucleotide sequences. In both cases, this Imperfect RT that can be produced from a polynucleotide fragment containing such a sequence It must not be functional. (Iv) In addition, using recombinant DNA technology, RT coding region It is also possible to generate nucleotide inserts at the appropriate restriction enzyme sites. this Such an insert may result in a dysfunctional RT having substantially no RT activity or a disruption thereof. Pieces can be produced. For example, when using the FIVF14 clone, p ol gene's RT coding region Pad restriction site (nucleotide 3540- A stop codon may be inserted into the RT region at a suitable insertion site such as 3547). No. In this way, a non-functional fragment of RT is produced.   “Functionally responsive reverse transcriptase” refers to the functionality of RT, ie, In the genome of a host cell or host organism, such as a cat, the ribose nucleic acid is replicated and Reverse transcriptase with RT functionality that can be converted to oxyribose nucleic acid format is there. Thus, the FIPV of the present invention comprising a dysfunctional pol gene is substantially Unable to produce infectious FIV particles.   Preferably, the FIPV polynucleotide is located within the RT domain of the pol gene. Vaccine formulations having deletions, more preferably having in-frame deletions, are provided. It is.   Preferably, at least one type of nucleic acid is contained in the RT region in the RT domain of the pol gene. Defective FIPV poly having in-frame deletions and / or insertions containing nucleotides A nucleotide fragment is obtained. This deletion is located upstream and / or below the RT domain. Flow of FIPV, such as the pol gene product and other FIPV gene products It must have no substantial effect on the coding sequence for other gene products. No. That is, other genes that normally have an immunogenic function and are expressed from FIPV The product substantially retains its immunogenic function. The deletion depends on the FIV isolated , Pol 4013 ± 1 from around nucleotide 2337 ± 12 bases of RT domain of gene It can be caused between around two bases. This deletion allows the single RT fragment ( Or a plurality of RT fragments thereof). And its coding sequence upstream or downstream is virtually unaffected As long as it is of any size, it may be of any size. This deletion corresponds to the pol gene Starting from any suitable restriction enzyme site located in the RT region Wear. However, in all FIPVs such as Nco1, Pac 1 and Sph 1, If not, a deletion starting from a unique restriction site within the RT domain of the pol gene It is preferable to cause loss. At least in the RT region of the FIV F14 clone Preferred examples of a restriction enzyme site that is a starting position that seems to be unique include And the Pac 1 site located at nucleotides 3540 to 3547 thereof. You. One of skill in the art would have similar enzyme restriction sites in the RT domain of the pol gene. It is to be understood that other FIV or FIPV isolates are also encompassed by the present invention. .   Preferably, the pol gene has a polynucleotide fragment deletion in the RT domain. This deletion corresponds to nucleotides 3497 to 3595 of the RT domain. Is obtained.   In a further embodiment of the invention, the defective FIVP comprises a virus in the host cell genome. Expression of a FIV protein other than functional RT or a functional fragment thereof Recombinant nucleic acid comprising a replication defective FIPV, subject to the restriction by regulatory sequences allowing production It can form part of a molecule.   Integration and / or production of FIV proteins other than functional RT or a functional fragment thereof The control sequences that enable production may or may not be associated with appropriate enhancer sequences. Promoter sequence. Suitable promoters include Norimin eJ. Et al., (1992) Vet. Med. Sci. 51 (1) 189- And the like, as outlined on page 191, including prokaryote, eukaryote and / or Or including a promoter obtained or derived from a viral source Is also good. Promo One example is the cytomegalovirus (CMV) promoter, e.g. Itomegalovirus (HCMV) early phase (IE) IE) Promoter region, Rous sarcoma virus (RSV), long terminal repeat (LTR), Co leukemia virus (FeLV) LTR, African green monkey (SIV AGM) A similar immunodeficiency virus from the LTR, including the SV40 early promoter region However, the present invention is not limited to this.   Defective F with a dysfunctional pol gene (i.e., located within its 5 'LTR) The natural promoter sequence of IPV can also form part of the recombinant nucleic acid molecule of the present invention. Will be apparent to those skilled in the art.   Thus, the FIPV of the present invention is capable of enclosing the genome of a suitable FIV isolate. Take the DNA and transfer it to a suitable vector such as a pGEM vector or λ vector Can be obtained by inserting A suitable FIV clone is Olm sted R. A. Et al. (1989) Proc. Natl. Acad. Sci, (USA), Vpl. 86, 8088-8092, FIV-Peta This is the F14 clone of Petaluma. This FIV clone was using appropriate restriction enzymes such as co1, Sph1, Bae1 Pac1 The linearized and then linearized vector is, for example, precipitated, followed by the appropriate exonuclease. A suitable exonuclease, such as Bal31, for a desired time under nuclease digestion conditions (Maniatis et al., Molecular C loning-a Laboratory Manual Laboratory Manual); Cold Spring Harbor Laboratory ory Press, 1st edition (1989), p. 135). After further purification, Appropriate exonuclease digestion by organic solvent extraction and alcohol precipitation The nucleic acid molecule that has been Suitable for nucleic acid ligation such as bacterial host cells such as E. coli It can be recycled with its product used to transform the host cell. like this The clone obtained in this manner is then used for the polymerase chain reaction (PC R) The size and location of the amplified and deleted pol gene in the RT domain (ie, (In the frame or not) to determine the properties.   An appropriately sized deletion region is the 235 salt of the pol gene of the FIV Petaluma strain. It turned out to be a base pair region. A Pac 1 restriction enzyme site was found in this. .   Deletions are usually due to all defective FIPV integrated into the host cell genome being FIPV. Upon expression of a protein or polypeptide encoded by To elicit an immune response (such as a killer T cell response) in a host animal such as a cat In the RT domain of the pol gene at a position where sufficient immunogenic function can be maintained Need to happen.   Primer up to 60 nucleotide bases in length, preferably about 20-60 nucleobases Use primers of any acceptable length, such as primers of base length Using NA sequence analysis, suitable clones containing the deletion region of the present invention were further characterized. Can be specified. More preferably, the primer is a 20-30 nucleobase. It is of a tide length.   If the desired FIV clone can be provided in a suitable host cell, The choice of the vector is not critical. The host cell is a recombinant vector -A cell in which molecule replication can take place. The host cell is at least as described above. At least still other polypeptides, such as fragments capable of increasing or eliciting an immune response The vector or at least one other vector so that the fragment can be expressed. A cell that can also recognize regulatory sequences. For example, the appropriately cloned FIP of the present invention When the preventive and / or therapeutic effects of V increase, for example, feline gamma interferon (ΓIFN) coding vector and other cytokine coding vectors Yet another vector encoding the appropriate adjuvant protein or polypeptide Can also be used as a component of the vaccine or pharmaceutical composition of the present invention. Wear. International Patent Application Publication No. WO 96/03435 includes a feline gamma interfero To provide services, Is a polynucleotide fragment encoding cat gamma interferon and its vector Includes the provision of International Patent Application Publication No. WO 96/03435 Polynucleotide fragments as described in the above publications are compatible with the defective FIPV of the present invention. It can be administered to animals as needed together with the vector to be loaded.   For example, vectors used in bacteria such as pBR322, 325 and 328 The various pUC vectors, a. o. PUC 8, 9, 18, 19 specific expression vector PGEM, pGEX and Bluescript®, bacteria Ophage-based vectors; λ-gtWes, Charon 28, M13-inducible Phage-derived phage, vectors containing SV40-based viral sequences, papillomavirus, Adenovirus or polyomavirus {Rodriquez, R.A. L. And And Denhardt, D.A. T. , Ed. Vectors: A survey of molecular cloning vectors and the ir uses (survey on molecular cloning vectors and their uses), Bu terworths (1988), Lenstra et al., Arch. Virol . 110: Pages 1 to 24 (1990)} and various vectors at this stage Is well known.   A nucleic acid component under the control of a control sequence that allows expression of a defective FIPV by the nucleic acid molecule All recombinant molecules, including offspring, are considered to be part of the present invention.   Thus, in yet another embodiment of the present invention, the functional RT or Is capable of expressing a viral protein of FIPV that cannot substantially express its functional fragment Under the control of control sequences, a vector containing the defective FIPV in recombinant form is obtained. You.   In yet another embodiment of the present invention, the functional RT or functional Of regulatory sequence capable of expressing a viral protein of FIPV that cannot substantially express fragments Below, a dysfunctional FIVP or host cell comprising the invention is obtained.   The host cell may be a bacterial-based vector such as PBR322, or pG322. In combination with a bacterial expression vector such as EX, or a bacteriophage, Escherichia coli, Bacillus subtilus and And cells derived from bacteria such as Lactobacillus species. Host details Vesicles are yeast cells, for example, in combination with yeast-specific vector molecules. Or insect cells {L in combination with a vector or recombinant baculovirus uckow et al. Bio-technology 6: 47-55 (1988)} For example, Ti plasmid-based vectors or plant virus vectors (Bar ton, K .; A. Combination with Cell 32: 1033 (1983) Derived from eukaryotes such as higher eukaryotes such as plant cells Cells, chiney in combination with various vectors or recombinant viruses Mammals such as hamster ovary cells (CHO) or Crandell cat kidney cells And the like.   Under the control of the promoter sequence or uncontrolled by the promoter sequence, In the viral genome, FIPV fragments according to the invention may be cloned. Thus, as a means for transporting FIPV fragments to target cells, virus Can be used. Such a recombinant virus is called a vector virus. It is. The integration site may be a site in the gene that is not essential for the virus or an intergenic region. It may be a middle part. Viruses that are often used as vectors are Xinia virus (Panicali et al .; Proc. Natl. Acad. Sc i. USA, 79: 4927 (1982), Herpes virus (European patent application) Publication No. 0473210 A2), retroviruses (Valerio, D. et al. Other; B aum, S.M. J. Dicke K .; A. Lotzova, E .; And Pluz nik, D .; H. (Eds. ) 、 Experimental Haematolo gy today-1988, Springer Veriag, New York C: 92-99 (1989) and Baculovirus @ Luckow et al .; B io-technology 6: 47-55 (1988)}.   The present invention also relates to a FIPV fragment or a protein encoded by the nucleic acid sequence. A recombinant nucleic acid encoding a FIPV fragment under the control of a control sequence capable of expressing white Also includes viral vectors containing the offspring.   As another example, in vivo or in vitro form of cells obtained from said animal Transfection (and then returning these cells to the animal) results in a defective FIPV vector of the invention. The oligonucleotide may be administered directly to the cells of the animal. Defect FIPV, muscle, skin Alternatively, it can be delivered to various cells of the animal body, such as blood cells. Shi Using a suitable loading means such as a syringe, for example, the FI PV can be provided. The method of administering the naked defective FIPV of the present invention directly to the body The method is described in International Patent Application Publication No. WO 90/11092, especially pages 35-43. It is described in.   The defective FIPV polynucleotides of the present invention may themselves be used as pharmaceuticals. Can be administered to animals as an acceptable salt.   Polynucleotide salt: a pharmaceutically acceptable polynucleotide disclosed herein. The administration of such salts is within the scope of the present invention. Such salts include organic bases and And non-toxic pharmaceutically acceptable bases, including inorganic bases. Is it an inorganic base Salts derived from sodium, potassium, lithium, ammonium, potassium Lucium, magnesium and the like. Pharmaceutically acceptable non-toxic organic bases Salts derived from primary, secondary and tertiary amines, basic amino acids, etc. Is mentioned. Still other pharmaceutical salts are described in S.A. M. Berge et al., Journa l of Pharmaceutical Sciences 66: 1-19 Page (1977).   Polynucleotides for injection are prepared in unit dosage form in ampules or in multidose containers It is possible. The polynucleotide may be an oily or, preferably, an aqueous vehicle. It can be in the form of a suspension, solution or emulsion therein. Or poly Nucleotide salts are preferred at the time of delivery, such as sterile pyrogen-free water. Reconstitute using the right vehicle It may be in a freeze-dried state. Freeze for both aqueous and oily and reconstitution The amount required to properly adjust the pH of the injection solution, including the dried one, It contains reagents, preferably buffers. For parenteral use, particularly where the formulation is for intravenous administration If targeted, control the concentration of the entire solute to make the formulation isotonic, hypotonic Alternatively, it is necessary to make it slightly isotonic. Sugars used to control tonicity Nonionic materials such as sucrose are particularly preferred. These forms are Formulation, such as, starch or sugar, glycerin or saline solution It may contain a formulating agent. Unit dose The compositions, whether liquid or solid, contain the polynucleotide material in an amount of 0.1%. 1 % To 99%.   In yet another embodiment of the present invention, a defective FIPV polynucleotide fragment of the present invention is provided. A vaccine against FIV containing pieces is obtained. This FIPV fragment is a bare FIP V polynucleotide fragment, that is, restricted to a vector format such as a plasmid format. However, the shape of the FIPV polynucleotide fragment may be different. Vaccine of the present invention Optionally, an immunogen such as a cytokine such as feline gamma interferon Includes other polynucleotide fragments encoding yet other active compounds May be. This polynucleotide fragment, for example, other plasmid vectors, Still other vector formats as described herein may be used. is there Alternatively, the polynucleotide may be in the form of naked DNA. Such naked DNA is bound to the microparticles or in a suitable holding solution such as saline. Can exist. Alternatively, FIP in the state of a vector or host cell V polynucleotide fragments can also be utilized.   The vaccine comprises a dysfunctional FIPV polynucleotide as described herein. Otide fragments are used to express genes whose gene product retains immunogenic function by expression. In combination with yet another vector to be loaded, or with yet another polynucleotide fragment. It may be included together. In the vaccine of the present invention Still other polynucleotide fragments suitable for use in International Patent Application Publication No. WO 96/03435, such as vectors encoding feron You can select from those listed in the issue.   In a preferred presentation format, the vaccine may also include an adjuvant. A Adjuvants generally include substances that boost non-specifically to the immune response of the host. No. Many different adjuvants are well known in the art. Adjuvant Examples are as described in International Patent Application Publication No. WO 90/11092. Freund Complete Adjuvant, Freund Incomplete Adjuvant, Liposo Water-in-oil mainly composed of oil, niosome, mineral oil and non-mineral oil Drop emulsion adjuvants, cytokines such as Sato Y. Other (199 6 years), Science Vol. 273, 352-354: Krieg A . M. (1996) Trends in Microbiol. 4, 73-77 Page for CpG dinucleotide-containing plasmid DNA such as And short immunostimulatory polynucleotide sequences. Furthermore, the present invention Adjuvants used in the field include poly (lactide-coglycolide) Containing reagents capable of forming microspheres (1-10 μm) An encapsulator, wherein the polynucleotide is not degraded To facilitate the introduction of polynucleotides such as DNA into cells. Facilitat capable of interacting with polynucleotides ing agent). The following ticks are suitable Cationic lipid vectors include It is.   1,3-di-oleoyloxy-2- (6-carboxy-spermyl (spe rmyl))-Propylamide (DOSPER), N- [1- (2,3-Diolei) Ruoxy) propyl] -N, N, N-trimethylammonium methylsulfate DO (DOTAP),   N- [1- (2,3-dioleyloxy) propyl)]-N, N, N -Trimethyl ammonium chloride (DOTMA),   (N, N, N ', N'-tetramethyl-N, N'-bis (2-hydroxyethyl Ru) -2,3-oleoyloxy-1,4-butanediammonium iodide,   Bupivacaine-HCl,   Nonionic polyoxypropylene / polyoxyethylene block copolymer,   Polyvinyl polymer and the like.   Such a cationic lipid vector is prepared by using L-dioleylphosphatidylethanol Mixed with other reagents such as ureaamine (DOPE) A membrane vehicle can be formed.   The vaccine may contain a so-called "vehicle". Vehicle is A compound or substrate to which a FIPV polynucleotide fragment can bind without binding. You. Typical “vehicle” compounds include gold particles and silica particles such as glass. No. Therefore, it has been described in the prior art (Williams R . S. Et al. (1991) Proc. Natl. Acad. Sci. USA 88 Pp. 2726-2730; Fynan E. et al. F. Et al. (1993) Proc. N atl. Acad Sci. USA Vol. 90, 11478-11482 ), High-speed irradiation method using gold particles coated with polynucleotide Which microprojectile bombardment method can be used to transfer the FIPV polynucleotides of the invention to the appropriate Can be introduced into cells.   Also, one or more suitable surfactants, such as, for example, Span or Tween It may contain an active compound or an emulsifier.   In yet another embodiment of the invention, a FIPV port as described herein. The use of the oligonucleotide fragments for the prevention and / or treatment of FIV-related diseases FIV vaccine production requires less FIV, including defective FIPV, as described above. It produces at least one cell-mediated immunity. Preferably, prevention of FIV infection and / or Or manufacture of a therapeutic FIV vaccine Use FIPV polynucleotide fragments in naked or vector format. Most favorable Preferably, this use is in cats.   In yet another aspect of the invention, optionally, the animal comprises a defective FIPV polynucleotide. A method of treating an animal comprising administering a vaccine composition comprising an otide fragment is provided. It is. Preferably, the animal is a cat. Originally, this vaccine preparation was administered orally. (E.g. enteric-coated tablets), can be formulated for parenteral injection or other administration It is.   Also, according to the present invention, naked or vector format as described herein A defective FIVP polynucleotide fragment and a suitable carrier or adjuvant. And a method for preparing an FIV virus vaccine, comprising mixing   The mode of administration of the vaccine of the invention is such that the virus of the invention is administered to the subject in an immunoprotective amount. This can be done by any suitable route for delivery. However, this Is preferably administered parenterally via the intramuscular or deep subcutaneous route. Sutra Via buccal or other parenteral routes, such as intradermal, intranasal or intravenous administration Other modes of administration may be used as needed.   Generally, this vaccine is usually injected into an injectable carrier such as saline or hot water. Provided as a formulation containing a carrier or excipient. This formulation is compatible with conventional It can be prepared by steps.   However, specific dose levels for individual recipient animals Age, overall health, gender, time of administration, route of administration, synergy with other medications, It depends on a variety of factors, including the desired degree of prevention. Also Of course, if necessary, the administration may be repeated at appropriate intervals.   According to still another aspect of the present invention, there is provided use as a drug for a FIPV-related disease. A FIPV that cannot substantially encode a functional RT or a functional RT fragment thereof Thus, a polynucleotide fragment is obtained. Lack of pol gene RT domain This deletion can cause It will be appreciated by those skilled in the art that in-frame deletions may be as described in the specification. Will be obvious. As described herein, this aspect of the invention may be utilized. To generate an insert into the deletion site for the FIPV of the present invention. People will understand.   In still another embodiment of the present invention, a method for preventing and / or treating an FIV-related disease. Use of FIPV containing a dysfunctional pol gene during vaccine production. Preferred Alternatively, the pol gene has its RT domain, as described herein. Has a deletion such as an in-frame deletion. One of ordinary skill in the art will appreciate the FIPV of the present invention. To generate an insert at the deletion site, as described herein. It will be appreciated that it can be used in this manner.   Hereinafter, embodiments of the present invention will be described with reference to the drawings and examples.BRIEF DESCRIPTION OF THE FIGURES   Figure 1: ΔRT site (3496-3595) (sequence ID No. 5) Pac FIV F14 (Petaluma) showing the I, Ncol and Sph I sites Strain) nucleotide sequence.   Figure 2: Cat v-interferon.   FIG. 3: Synthesis of CMVΔRT.   Figure 4: Sequence of SstI fragment in CMVΔRT (SEQ ID NO: 6).   Figure 5: Genomic map of the FIV RT deletion mutant.   Figure 6: a) Trial after 7 weeks of load test-6 (a) and b) Trial after 6 weeks of load test The peripheral blood virus load in row-6 (b) was 2 × 10⁶Exists in PBMC Expressed as the mean (+/- 2 SEM) of the first log-transformed maximum likelihood estimate of infected cells. It is.   Figure 7: Hind III-Not in plasmid pRSV-y-IFN   It is a sequence of an I fragment (sequence ID No. 7).BEST MODE FOR CARRYING OUT THE INVENTION [Induction and characterization of defective FIV provirus] (wrap up)   A region homologous to the "binding" domain of human immunodeficiency virus RT, By introducing a deletion around the unique Pacl restriction site in the RT domain of Thus, the F14 clone of FIV-Petaluma was modified. 33-codon, Clones with in-frame deletions were identified and designated FIV-ART. This Lawns were characterized in vitro by transfection into fibroblasts. Transfection After entry: (1) syncytia are formed within 3 days; (2) cell lysates are Show the expression of glycoprotein and Gag protein; (3) 100,000 × g Antigen is pelleted from the culture solution by heart separation, where particles are formed (4) RT activity above background was not observed in the culture. (5) Unlike medium transfected from wild-type FIV-F14, No infectious virus was detected. [Method] 1. Introduction of FIV-specific cytotoxic T cells   3 weeks, 6 weeks, 10 weeks, 12 weeks, 16 weeks after vector delivery and Twenty weeks later and on the day of the stress test, 5 ml of peripheral venous blood was collected and an equal volume of Alsev was collected. er solution (Scottish Antibody Production Un it, Carluke, UK) and Ficoll-Paque (Pharm acid LKB, Biotechnology Inc. , Piscataw ay, NJ), and virus-specific lymphocyte toxicity was determined. Immunity Alternatively, skin biopsy samples (4) from all cats under general anesthesia prior to the stress test mm diameter), induced a fibroblast cell line, 10% fetal bovine serum (FBS), L-gluta Min 2 mM, penicillin 100 IU, streptomycin 100 μg, human epidermis Minimum essential medium supplemented with growth factor 10 ng / ml (Sigma, Poole, UK) Ribonucleoside and MEM in alpha medium (MEM) And deoxyribonucleosides (Biological Industries, (Paisley, UK).   sodium[⁵¹Cr] chromate (Amersham International) nal, Aylesbury, UK) / 10⁶Autologous cells labeled with 50 μCi Or fresh PBM using allogeneic skin fibroblast target cells at 37 ° C. for 18 hours. C. The virus-specific effector CTL present in C is detected, washed three times and then IV / Glasgow-14 or FIV / Petaluma, respectively. Recombinant vaccinia wie expressing either the gag or env gene product 5-10 plaque forming units per cell / cell or wild-type vaccinia virus , 37 ° C for 1 hour. Wash off unbound virus and remove cells. For 2 hours to allow optimal expression of FIV Gag and Env products I made it. Next, 1 × 10 3^FourIn addition to the target cells, Providing effectors triples standard microcytotoxicity testing went. As described above, target (E: T) ratios of 50, 25, 12.5 and 6. 25: 1 (Flynn et al., 1996, supra). 2. Isolation of FIV   Ficoll-Hypaque (Phar) was obtained from venous peripheral blood treated with heparin. macia LKB, Biotechnology Inc., Piscata peripheral blood mononuclear cells (PBMC) were isolated by centrifugation on the same way (NJ). Next In Hosie M. J. And Flynn J. et al. N. (1996); Vi rol. 70, pages 7561 to 7568).⁶Pieces Of PMBC were co-cultured. ELISA (IDEXX Laboratory) s, Portland, ME) at intervals by FIV in culture supernatant samples.   The presence or absence of p24 was tested and evaluated after maintaining the culture for 21 days. there were. 3. Quantitative virus isolation   Heparin processing by Ficoll-Paque separation (Pharmacia) Infectious virus load on peripheral blood mononuclear cells (PBMC) isolated from treated peripheral blood Was measured, frozen and stored in liquid nitrogen. 10% fetal calf serum (Imperi al Laboratories), glutamine 2 mmol / l, penicillin 1 00IU, streptomycin 100 mg / ml (both Gibco BRL ) And 2-mercaptoethanol (Sigma Chemical Co.) 5 × 10^-Fivemol / l of 1.5 ml of RPMI-1640 medium (Gibc 5 × 10 in o)^Five24 wells loaded with two Miyazawa-1 cells , Gradually reduce the number (2 × 10⁶, 2 × 10^Five, 2 × 10^Four, 2 × 1 0^Three, 2 × 10^Two, 20 and 2) PBMC were repeatedly co-cultured. Twice a week In each case, 0.5 ml of the culture supernatant was removed and replaced with a fresh medium. On the 14th day The harvested culture supernatants were tested for FIV p24 production by ELISA (FIV Antigen detection kit, IDEXX). [Example 1: Construction of deletion in RT]   Next to the proviral sequence in the vector pGEM-7Zf + (Promega) FIV / Petalum in contact with about 9 kb of feline genomic DNA before characterization a (above Olmsted et al., 1989), cloned the R gene of the pol gene. Contains a unique Pac 1 site in the T region (nucleotides 3540-3547) You. The linearized plasmid is purified by precipitation and then 30 bp / min (Man iatis T .; Bal31 under the conditions calculated to allow the other speeds. Digested with exonuclease. Phenol / chloroform extraction and ethanol Recycling of exonuclease digested DNA by ligation after purification by precipitation The product was used to transform coli DS941 (Meaden et al Gene) (1994), Vol. 41, 97-101). Pac 1 copy In the 235 bp region of the pol surrounding the Clones were checked by the enzyme chain reaction (PCR) amplification. Inside a large frame One clone with a deletion of 99 bp (ΔRT) (SEQ ID NO: 5) was Characterized by DNA sequencing using the R primer. (1) TGTGATATAGCCTTAAGAGC (3429-3448) ( Sequence ID. No. 1) and (2) TACCATGTTTCTGCTCCTGG (3645-3664) ( Sequence ID No. 2)   This clone was designated as FIV-ΔRT (FIG. 1) (sequence ID No. 5). [Example 2: Determination of properties of FIV-ΔRT]   FIV-ΔRT (50 μg plasmid DNA) by calcium phosphate co-precipitation Was transfected into CrFK cells. The parental F14 plasmid served as a positive control. 3 Days later, syncytia were observed in the transfected medium, but mock transfected cells (such as DNA) No) was not observed. This indicates that cells expressing the deleted provirus Suggest that it can fuse with adjacent cells. This is probably a functional envelope. Probably because it could produce rope glycoprotein. This syncytium is F Easily stained by immunofluorescence using pooled sera from IV infected cats Was.   By enzyme-linked immunosorbent assay (ELISA) and immunoblot, virus Protein production was also investigated. F14 or ΔRT (Table 1) Commercial antigen ELI SA ("Petcheck"; IDEXX Laboratories, USA) 6 days after transfection with E. coli, a large amount of Gag capsid protein (p24) was added to the culture supernatant. Was detected. SDS PA using serum pooled from FIV infected cats Analyze other viral proteins in cell lysates by GE and immunoblot did. Gag precursor and mature (capsid) protein, plus envelope surface Glycoprotein was observed.   According to the detection results by ELISA and immunoblot, cells were The above capsid antigen could be pelletized from the supernatant. in this way, Defective provirus was still able to perform antigen particle synthesis .   RT activity was measured in the culture supernatant. Culture corresponding to wild-type F14 Cells transfected with FIV-ΔRT, while background level No higher activity was observed (Table 1).   ΔRT culture by passage of cells or supernatant to fresh CrFK cell monolayer It was confirmed that no infectious virus was present. Seven days later, syncytium is completely shaped Not formed and p24 in culture inoculated with supernatant obtained from ΔRT transfected cells Antigen or RT activity was observed. On the other hand, cells transfected with wild-type FIV In the supernatant obtained, infection occurred rapidly. In cultures inoculated with ΔRT transfected cells Even occasionally, syncytia were observed. This is probably due to individuals from initial exposure to DNA. It is presumed that they are gathered around each transfected cell. [Example 3: Configuration of CMV-ΔRT]   The region from the 5 'LTR to the primer binding site of F14ΔRT was Replaced with the earliest promoter from gallovirus. This procedure involves DNA inoculation Of FIV antigen expression in later tissues and reversion to replication provirus It is designed to both reduce the risk of CMVΔ Designated as RT, the configuration was achieved as follows:   The restriction sites of the endonucleases Sal I and Sst I were mapped . F14ΔRT was converted to an intermediate (AR) having a unique Sst I site as shown in FIG. T-Sal / Sst). This allows Sal I and S Digest plasmid F14ΔRT using stI and re-purify the resulting fragment mixture. Combined; coli (DS941), ΔRT-Sal / S The relationship between the structure where st is predicted and Identified the loan. Next, a CMV sequence was introduced upstream of the Sst I site.   PC surrounding the FIV sequence from the primer binding site to downstream of the Sst I site The R product was purified from Taq polymerase (Perkin Elmer) by Saiki et al. (1 985) Using the method of Science 230, pp. 1350-1354, Derived from the F14 plasmid. Coordination of the primer F14 provirus used 356-376 (sequence ID No. 3) and 1963-1980 (sequence ID No. 3) No. When） was further composed of another Sal I “tail”, The sequence was as follows: GATCGTCGACCGTTGGCGCCCCGAACA GGACT (5 ') and GATCGTCGACTTATAAATCCAATA GTTT (3 '). This PCR product was transferred to the plasmid vector pIC19R (Mars h et al. (1984), Gene 32, 481-485). To obtain pPBSGAG. Next, FI obtained from pPBSGAG The V sequence was released as a SalI fragment and the SIC fragment of pIC20H (Marsh et al., Supra) was released. Cloning into the alI site gave pPBSSal. Of these FIV sequences Bgl II-K previously obtained from the expression vector pcDNA3 (Invitrogen) As a pn I fragment, the CMV IE promoter was cloned, and pCMVPB S was obtained. Next, the Sst I fragment obtained from this clone (from the primer binding site Including the IE promoter and FIV sequence up to the proviral Sst I site) , Was cloned into the SstI site of ΔRT-Sal / Sst. CMV IE D obtained from within the promoter to a point downstream of the Sst I site of the FIV provirus The NA sequence was confirmed by direct sequencing.   FIG. 4 shows the sequence of the SstI fragment in CMVΔRT (sequence ID No. 6). The FIV sequence downstream of the Sst I site is identical to that of F14ΔRT. [Example 4: Configuration of pRSV-y-IFN]   Argyle D. J. Et al. (1995) (DNA Sequence 5, Cat γ-interferon cDN, as described in pp. 169-171). A: cDN in pCR-ScriptSK (+) (Stratagene) It was available as an A clone. This cDNA sequence was converted to the restriction enzyme HindII. I and NotI (sequence ID No. 7), excised and pRc / RSV expression vector (Invitrogen) to generate the pRSV-γIFN plasmid. Was. Example 5: FIV DNA immunization trial-protection of vaccinated cats (procedure)   DNA immunization protects cats from infection by feline immunodeficiency virus (FIV) The efficacy was determined. Twenty 12-week-old kittens were randomly divided into four groups of five. Contact The DNA used for the seed was plasmid ΔRT alone or a cat γ-IFND NA was combined as follows:Group No. Cat No. Plasmid Group 1 A481-485 100 μg ΔRT Group 2 A486-490 100 μg ΔRT +                                   100 μg pRSV-γ-IFN Group 3 A491-495 100 μg pRSV-γ-IFN Group 4 A496-500 without DNA   In each of the four places, in the amount of 100 μg of DNA in 200 μl of PBS, at week 0, 1 Cats were injected intramuscularly with test DNA at weeks 0 and 23. About these cats 25 Feline feeling of FIV-Petaluma derived from F-14 molecular clone 50% dyeing dose (CID₅₀), An intraperitoneal load test was performed on week 26, and Q201 cells (Willett et al. (1991 Year) AIDS, Vol. 5, 1469-1475). (result)   Hossie M. J. O. Jarrett (1990), AIDS 4, 2 According to the method described on pages 15 to 220, the viral envelope proteins (V3 and TM) from the two peptides showing two immunodominant epitopes. Epidemiological Assay (ELISA) (Hosie MJ and Flynn JN, (1996) Virol. 70, 7561-7568). Three weeks after the inoculation of Kuching and three, six, nine and twelve weeks after the stress test, The antibody response was measured by a protocol.   FIV Env and GaG proteins during the immunization schedule and on the day of challenge Cytotoxic T cells (CTL) activity against {M. J. You And Flynn J. et al. N. (1996)}. (Antibody response)   No antibody detected by peptide ELISA (above) before the day of the loading test Was. Therefore, all antibody responses after challenge were considered equivalent to infection. I was able to. The results are summarized in Table 2. (Cytotoxic T cell response (CTL response)   The above Hossie M. J. And Flynn J. et al. N. (1996) method Of all cats immunized with the ΔRT plasmid (A481-A485) In fresh peripheral blood, three weeks after vector delivery, FIV Gag- and And Env-specific effector-CTL activity were detected. This response is based on autologous target cells Was observed only at Therefore, this response was restricted to MHC It appears to be. Furthermore, when the specificity of the response was confirmed, wild-type vaccinia Target cells infected with ils were not recognized. The FIF Gag-specific response is (A481 and And the Env-characteristics observed at an E: T ratio of 50: 1. It looked equivalent to heterolytic levels and levels ranging from 20-54%. This response pattern Immunized with an inactivated whole virus vaccine based on the FL4 cell line. Responses were similar to those observed in the peripheral blood of mice. However, WIV inactivated The specific lysis level observed with the irs vaccine is usually Slightly lower than the level detected with Sumid, the CTL response was Predominantly towards Env {Flynn et al. (1995) AIDS Res. Human Retro. 11, 1107-1113, Hosi above e and Flynn, (1996)}.   Simultaneous immunization with the ΔRT plasmid and the feline γ-IFN plasmid resulted in 3 out of 5 cats (A486, A488 and A490) High (up to 73% specific lysis) Gag-specific lysis was induced and of 5 cats Env-specific lysis was induced in two animals (A487 and A489). However The response did not appear to be completely MHC-restricted. This is This is because the target cells of the species were also observed to be considerably lysed. Wild type waxy Autologous target cells infected with near virus were recognized in 3 out of 5 cats Further supported the non-specific nature of the observed cytolytic response. γ-IFN Immunization with the plasmid alone resulted in three out of five cats (A491-A493). Produces a FIV-specific cytolytic response in either autologous or allogeneic target cells Was. Furthermore, when using target cells infected with wild-type vaccinia virus, High levels of lysis were observed in two cats (A492 and A493). this These results demonstrate the in vivo delivery of the cat γ-IFN plasmid to cats. Suggests that a non-specific cellular immune response, such as NK-type activity, is generated is there.   No FIV-specific immune response was detected in control cats immunized with PBS alone Was.   Immunized with the ΔRT plasmid by 6 weeks after vector delivery Significant levels (> 10% specific lysis) of FIV Gag-specific in 4 out of 5 cats Different CTL activity was detectable, and three of these cats had significant levels of Env- It also had specific CTL activity. However, the level detected was 3 weeks after immunization Was lower than the level observed. Immunization with ΔRT and γ-IFN plasmids In the group, no FIV-specific CTL activity was detected. Similarly, γ-I No CTL activity was detected in the control groups immunized with FN alone or PBS. Only One exception was A491, which showed a response to FIV Gag and Env. Was.   Ten weeks after immunization, the CTL response detected in the group immunized with ΔRT further decreased. , FIV Gag-specific activity can be detected in only one cat (A484), and Env -Specific activity could only be detected in another cat (A482). At this point, the Gag- Differential lysis was observed in two cats immunized with ΔRT and γ-IFN and showed Env-specific Activity was observed with A490. However, the level observed is as of week 3 It was lower than the value in. No activity was observed in the control cats. At this point, the test cats were boosted again and developed a FIV-specific CTL response in peripheral blood of 2 Analyzed after a week.   Week 10 boosts were performed with FIV in 3 out of 5 cats immunized in the ΔRT configuration.   There was an effect of increasing Gag-specific CTL activity. In addition, two cats A specific response was detected. Similar effect in cats immunized with ΔRT and γ-IFN Was observed and two cats were boosted with Gag-specific CTL activity. A490 Maintained a similar level of Env-specific lysis as the value observed at 10 weeks. versus In the control cats, negligible FIV-specific lysis was recorded.   The tests performed at Weeks 16 and 20 were not particularly remarkable, and IV / Petaluma with 25 CID₅₀In the test performed on the day of the load test in Level (12-15% specific lysis) of Gag-specific CTL activity Negligible activity was observed in 2 out of 5 mice immunized with ΔRT and γ-IFN Found in cats. (Result of virus detection)   Attempt to isolate virus from PBMC after immunization, but before and on the day of the load test Of the mutant provirus during this period It turned out that there was no throwback. After the stress test, the cats Was monitored for infection. By 9 weeks after the stress test, no DNA was administered. Five out of five cats in the control group were infected, and five cats were inoculated with cat γ-IFN DNA Five of them became infected. In contrast, in the group inoculated with ΔRT DNA, Proof of the effect was recognized (Table 3). Isolate virus from 5 cats in group 1. The virus could not be isolated in 3 out of 5 cats in group 2 cats Was. In addition, PRT was inoculated with ΔRT and used for virus-infected cat MYA cells. The viral load, measured by quantitative co-culture of BMC, was determined for the two control cats. It was lower than the virus load (Table 4).   From the various parameters measured, infection and virus load were found after the load test. The results obtained in each group were compared using the clinical score evaluation system. (Table 5a). The clinical scores were the same for the groups immunized with ΔRT and ΔRT + y-IFN. Significantly lower compared to their appropriate control group (p <0.05 and 0. 0, respectively). 005, Table 5b). This indicates that FIV DNA immunization is compatible with feline γ-IFN DN. A was found to elicit increased protective immunity. Example 6: Shortened FIVΔRT immunization schedule   Investigating whether the above-mentioned immunization schedule can be shortened without compromising prophylaxis To do so, a second experiment was performed. In this experiment, two groups of five cats were FI VΔRT + IFN-γ or IFN-γ alone at weeks 0, 4, and 8 Seeded. As in the first trial, this measure gives a broad spectrum of cytolytic activity. Was induced, but no detectable antibody response was observed in the same series of assays. Did not. After 12 weeks of stress test, Seronegative was maintained in two out of five inoculated individuals, and the virus was Although it could not be isolated (Tables 6 (a) and 6 (b)), IFN-γ alone In the control group, all individuals were seropositive and positive for virus isolation. Therefore, no contradiction was found with the results of the first trial. Again, immunoblo The set analysis fully validated these findings. Will in the second trial 6 weeks after the stress test, FIVΔRT + IFN-γ In sown individuals, significantly lower viral load compared to individuals inoculated with IFN-γ. It was found to occur (P = 0.027).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 31/14 C12N 5/00 B C12N 5/10 A61K 37/66 (72) Inventor Jarrett James Oswald UK G62 8NA Milne Gavy Drum Clog Avenue 4

Claims (1)

[Claims] 1. Substantially encodes a functionally responsive RT or a functional RT fragment thereof Wakuchi containing FIPV polynucleotide containing inoperable dysfunctional pol gene Formulation. 2. FIPV polynucleotide has a deletion in the RT domain of the pol gene The preparation according to claim 1, wherein 3. The deletion in the RT domain of the pol gene is an in-frame deletion. 3. The preparation according to claim 1 or 2. 4. Further comprising a polynucleotide fragment encoding a cytokine, A formulation according to any of the preceding claims. 5. The polynucleotide fragment encoding the cytokine is a pol gene 5. The formulation of claim 4, wherein the formulation is located at the site of an in-frame deletion within the RT domain of. 6. The method according to claim 4 or 5, wherein the cytokine is feline interferon-7. The listed formulation. 7. FIPV polynucleotide is restricted to RT domain of pol gene The formulation according to any one of claims 1 to 6, which has a deletion at an enzyme site. 8. FIPV polynucleotides are selected from Nco1, Pac1 and Sph1. The formulation of claim 7, wherein the formulation has a deletion at a selected restriction enzyme site. 9. The method according to any of the preceding claims, wherein the FIPV polynucleotide is naked. The listed formulation. 10. 9. The method of claim 1, wherein the FIPV polynucleotide fragment is in a vector state. The preparation according to any one of the above. 11. The formulation according to any of the preceding claims, further comprising an adjuvant. 12. 12. The FIPV polynucleotide is in a salt state. The vaccine preparation according to any one of the above. 13. Functional RT or its function used as a drug for FIV-related diseases A FIPV polynucleotide fragment that is substantially incapable of encoding the RT fragment. 14． RT domain of pol gene used as drug for FIV-related diseases A FIPV polynucleotide fragment having a deletion in it. 15. RT domain of pol gene used as drug for FIV-related diseases A FIPV polynucleotide fragment having an in-frame deletion within. 16. Encodes a cytokine used as a drug for FIV-related diseases Polynuk. 16. The method according to any of claims 13 to 15, further comprising a reotide fragment. Polynucleotide fragment as indicated. 17． Polynucleotides encoding cytokines are useful for FIV-related diseases Flake of polynucleotide fragment encoding FIPV used as drug 17. The polynucleotide fragment according to claim 16, wherein the polynucleotide fragment is located at a site of deletion within the genome. 18. In the manufacture of vaccines for the prevention and / or treatment of FIV-related diseases Use of a FIPV containing a dysfunctional pol gene. 19. 19. The pol gene according to claim 18, wherein the pol gene has a deletion in its RT domain. Use of. 20. Claims wherein the pol gene has an in-frame deletion in its RT domain. Item 18. The use according to Item 18 or 19. 21. An enzyme whose pol gene is selected from Pac1, Nco1, and Sph1 21. Use according to any of claims 18 or 20, which has a deletion at the elementary restriction site. 22. A vaccine preparation according to any one of claims 1 to 12, or claim 24. To a mammal in a nontoxic effective amount. A method of vaccination against a FIV-related disease in a mammal, comprising: 23. Vaccine formulation has an in-frame deletion in the RT domain of the pol gene 23. The method of claim 22, comprising a FIPV fragment. 24. In-frame deletion in the RT region of the RT domain in the pol gene and FIPV polynucleotide fragment comprising / or insertion. 25. In the pol gene, at least one of 25. The polynucleotide of claim 24 comprising an in-frame insertion having nucleotides. Pide fragments. 26. At least one nucleotide further comprises the RT domain of the pol gene. Encoding a cytokine at the site of an in-frame deletion of a protein The FIPV polynucleotide fragment according to claim 24 or 25, which is a fragment. 27. 27. The method of claim 24, wherein the cytokine is feline interferon-γ. The polynucleotide fragment according to any one of the above.