US5677144A - Recombinant DNA encoding CCK 2, a receptor tyrosine kinase - Google Patents

Recombinant DNA encoding CCK 2, a receptor tyrosine kinase Download PDF

Info

Publication number
US5677144A
US5677144A US08/336,343 US33634394A US5677144A US 5677144 A US5677144 A US 5677144A US 33634394 A US33634394 A US 33634394A US 5677144 A US5677144 A US 5677144A
Authority
US
United States
Prior art keywords
mck
nucleic acid
acid molecule
cck
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/336,343
Inventor
Axel Ullrich
Frauke Hildegard Elisabeth Alves
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=22547060&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US5677144(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Priority to US08/336,343 priority Critical patent/US5677144A/en
Assigned to MAX PLANCK GESELLSCHAFT ZUR FORDERUNG DER WISSENSCHAFTEN reassignment MAX PLANCK GESELLSCHAFT ZUR FORDERUNG DER WISSENSCHAFTEN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ULLRICH, AXEL, ALVES, FRAUKE HILDEGARD ELISABETH
Application granted granted Critical
Publication of US5677144A publication Critical patent/US5677144A/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1027Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against receptors, cell-surface antigens or cell-surface determinants
    • A61K51/103Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against receptors, cell-surface antigens or cell-surface determinants against receptors for growth factors or receptors for growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/027Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus

Definitions

  • the present invention relates to the novel family of receptor tyrosine kinases, herein referred to as MCK-10, to nucleotide sequences and expression vectors encoding MCK-10, and to methods of inhibiting MCK-10 activity.
  • MCK-10 novel family of receptor tyrosine kinases
  • the invention relates to differentially spliced isoforms of MCK-10 and to other members of the MCK-10 receptor tyrosine kinase family such as CCK-2.
  • Genetically engineered host cells that express MCK-10 may be used to evaluate and screen drugs involved in MCK-10 activation and regulation.
  • the invention relates to the use of such drugs for modulating the activity of MCK-10.
  • Such drugs may be used in the treatment of proliferative disorders such as cancers and in the treatment of nervous system disorders.
  • Receptor tyrosine kinases comprise a large family of transmembrane receptors which are comprised of an extracellular ligand-binding domain and an intracellular tyrosine-kinase domain responsible for mediating receptor activity.
  • the receptor tyrosine kinases are involved in a variety of normal cellular responses which include proliferation, alterations in gene expression, and changes in cell shape.
  • the binding of ligand to its cognate receptor induces the formation of receptor dimers leading to activation of receptor kinase activity.
  • the activation of kinase activity results in phosphorylation of multiple cellular substrates involved in the cascade of events leading to cellular responses such as cell proliferation.
  • growth factor receptors are often found amplified and/or overexpressed in cancer cells as exemplified by the observation that the EGF receptor is often found amplified or overexpressed in squamous cell carcinomas and glioblastomas.
  • amplification and overexpression of the met gene, encoding the HGF receptor has been detected in stomach carcinomas.
  • DDR diaminoacetyrosine kinases
  • MCK-10 mouse homologue of MCK-10 has recently been cloned and characterized (Zerlin, M. et al., 1993, Oncogene, 8: 2731-2739).
  • novel receptor tyrosine kinase receptors whose expression is associated with proliferative diseases such as cancer, will provide opportunities for development of novel diagnostic reagents.
  • identification of aberrantly expressed receptor tyrosine kinases will lead to the development of therapeutic applications designed to inhibit the activity of that receptor, which may be useful for treatment of proliferative diseases such as cancer.
  • the present invention relates to a novel family of receptor tyrosine kinases, herein referred to as MCK-10 (mammary carcinoma kinase 10), to nucleotide sequences and expression vectors encoding MCK-10, and to methods of inhibiting MCK-10 activity.
  • MCK-10 mammary carcinoma kinase 10
  • the invention is based on the isolation of cDNA clones from a human mammary carcinoma cDNA library encoding the MCK-10 receptor tyrosine kinase.
  • the invention also relates to differentially spliced isoforms of MCK-10 and to other members of the MCK-10 family of receptor tyrosine kinases. More specifically, the invention relates to members of the MCK-10 family of receptors tyrosine kinases that are defined, herein, as those receptors demonstrating 80% homology at the amino acid level in substantial stretches of DNA sequences with MCK-10. In addition, members of the MCK-10 family of tyrosine kinase receptors are defined as those receptors containing an intracellular tyrosine kinase domain and consensus sequences near the extracellular N-terminus of the protein for the discoidin I like family of proteins.
  • the invention as it relates to the members of the MCK-10 family of receptor tyrosine kinases, is based on the isolation and characterization of a cDNA, herein referred to as CCK-2, encoding a member of the MCK-10 family of receptor tyrosine kinases.
  • MCK-10 is expressed in a variety of normal tissues including brain tissue.
  • MCK-10 family of receptors share homology with the TrK neurotropin tyrosine kinase receptor, indicating that MCK-10 agonists and/or antagonists can be useful for treatment of nervous system disorders.
  • the present invention relates to inhibitors of MCK-10 or CCK-2 receptor activity which may have therapeutic value in the treatment of proliferative diseases such as cancer.
  • Modulators of MCK-10 or CCK-2 receptor kinase activity may include antibodies to epitopes of recombinantly expressed MCK-10 or CCK-2 receptor which may regulate the activity of the receptor.
  • MCK-10 or CCK-2 anti-sense oligonucleotides may be designed to inhibit synthesis of the encoded proteins through inhibition of translation.
  • random peptide libraries may be screened using recombinantly produced MCK-10 or CCK-2 protein to identify peptides, synthetic compounds, and natural products that may act as agonists and/or antagonists of the biological activity of the receptors through binding to the ligand binding sites or other functional domains of the MCK-10 or CCK-2 receptor.
  • mutated forms of MCK-10 and CCK-2 having a dominant negative effect, may be expressed in targeted cell populations to regulate the activity of the endogenously expressed receptors.
  • the MCK-10 or CCK-2 coding sequence may be used for diagnostic purposes for detection of aberrant expression of these genes.
  • the MCK-10 or CCK-2 DNA sequence may be used in hybridization assays of biopsied tissue to diagnose abnormalities in gene expression.
  • FIGS. 1A, 1B, 1C, 1D, 1E, 1F, and 1G Human MCK-10-3 nucleotide sequence (SEQ ID NO:1) and deduced amino acid sequence (SEQ ID NO:2). Regions of interest include the signal sequence (amino acids (aa) 1-18); the Discoidin I-like domain (aa 31-185); the putative precursor cleavage site (aa 304-307); the transmembrane region (aa 418-439); the alternatively spliced sequence I (aa 505-541); the alternatively spliced sequence II (aa 666-671); and the peptide antibody recognition sequences: NT ⁇ :aa 26-42, NT ⁇ :aa 309-321, CT ⁇ :aa 902-919.
  • signal sequence amino acids (aa) 1-18
  • the Discoidin I-like domain aa 31-185
  • the putative precursor cleavage site aa 304-307
  • FIG. 2A MCK-10 splice variants.
  • FIG. 2B Alignment of MCK-10, MCK-10-2 and MCK-10-1 (SEQ ID NOS:15-18).
  • the NPXY motif (SEQ ID NO:19) in the insertion region of the MCK-10-1 is underlined with thin and the putative SH3 binding site with solid bars.
  • the TYAXPXXXPG sequence (SEQ ID NO:8) is overlined.
  • FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G and 3H Human CCK-2 nucleotide sequence (SEQ ID NO:3), complementary strand (SEQ ID NO:5), and deduced amino acid sequence (SEQ ID NO:4).
  • FIGS. 4A and 4B Comparison of deduced CCK-2 and MCK-10-2 amino acid sequences.
  • the discoidin I-like domain is boxed with consensus residues of the discoidin I motif shaded.
  • N-linked glycosylation sites of CCK-2 are indicated with solid triangles, and tyrosine residues that are possible autophosphorylation and substrate attachment sites are marked by open triangles.
  • the RXRR protease cleavage motif (SEQ ID NO:20) is underlined and the putative transmembrane region is overlined with a solid bar. Asterisks indicate the consensus residues of the ATP-binding site.
  • Positions of MCK-10-1 and MCK-10-2 alternative splice insertions are indicated by arrows.
  • FIG. 4C Schematic structures of CCK-2 and MCK-10.
  • the percent amino acid identity between CCK-2 and MCK-10 is indicated for the discoidin I domain, part of the extracellular domain (ECD), the juxtamembrane domain (JM), and the tyrosine kinase region (TK).
  • TM transmembrane region.
  • CT carboxyl-terminal tail. The arrowhead indicates the location of the predicted protease cleavage site RXRR, which divides the MCK-10 protein into N-terminal ⁇ and C-terminal ⁇ fragments.
  • FIG. 4D Putative SH3 domain binding site in MCK-10-1. Established and predicted SH3 binding sites of various proteins are compared (SEQ ID NO:21-33). X: non-conserved position. *: strong preference for hydrophobic residues. P: invariable position for proline. p: position with preference for proline.
  • FIG. 5A Northern blot analysis of MCK-10 mRNA in different human tissues. Three micrograms of poly (A) + RNA are loaded per lane. The blot is hybridized with a cDNA restriction fragment corresponding to nucleotide 278 to 1983 of MCK-10-2 (FIGS. 1A, 1B and 1C) (excluding the 111 bp insertion). As a control, the blot was rehybridized with a glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe (lower panel).
  • GPDH glyceraldehyde phosphate dehydrogenase
  • FIG. 5B Northern blot analysis of MCK-10 gene in various human breast cancer cell lines. Samples containing three micrograms of poly (A) + RNA isolated from different human breast cancer cell lines were analyzed. The position of 28S and 18S ribosomal RNAs is indicated, the lower panel shows the rehybridization with a GAPDH cDNA probe.
  • FIG. 5C Northern blot analysis of MCK-10 mRNA in different human tissues and cell lines of tumor origin. Size markers are indicating 28S and 18S ribosomal RNAs (upper panel). Rehybridization is performed with a GAPDH cDNA probe (lower panel).
  • FIG. 5D Northern blot analysis of CCK-2 and MCK-10 mRNA. Expression of CCK-2 and MCK-10 mRNA in different human carcinoma cell lines is shown. Three micrograms of poly (A) + RNA were loaded per lane. The blots were hybridized with a cDNA restriction fragment corresponding to the extracellular region of CCK-2 (upper panel) and MCK-10 (middle panel). RNA markers of sizes are indicated in kb. In order to calibrate relative quantities of loaded RNAs, the blots are rehybridized with a GAPDH cDNA probe (lower panel).
  • FIG. 6A Tyrosine phosphorylation of overexpressed MCK-10.
  • the coding cDNAs of MCK-10-1 and MCK-10-2 were cloned into an expression vector and transiently overexpressed in the 293 cell line (human embryonic kidney fibroblasts, ATCC CRL 1573). Portions of cell lysate from either MCK-10-1 or -2 transfected cells or control plasmid transfected cells (mock) were separated on a 10% polyacrylamide gel and transferred to nitrocellulose and probed with anti-phosphotyrosine antibodies ( ⁇ PY). The incubation of cells with 1 mM sodium ortho-vanadate 90 min. prior to lysis is indicated by ⁇ ; (left panel).
  • FIG. 6B Distinct glycosylation of overexpressed MCK-10 splice variants.
  • 293 cells were transfected with MCK-10-1 and -2 as before, metabolically labeled with 35 S!-L-methionine and treated with 10 ⁇ g/ml tunicamycin overnight as indicated (+), lysed and immunoprecipitated with antisera generated against the N-terminal and C-terminal peptides of MCK-10 ( ⁇ MCK-10-N and ⁇ MCK-10-C). The autoradiograph of the SDS-PAGE analysis is shown. Molecular size markers are indicated in kD.
  • FIG. 6C Transient overexpression of CCK-2 and MCK-10 receptor proteins.
  • the coding MCK-10-2 and CCK-2 cDNA coding regions were cloned into a cytomegalovirus-based expression vector and transiently overexpressed in the human embryonic kidney fibroblast 293 cell line.
  • Cell lysates from either MCK-10-2 or CCK-2-transfected cells or control plasmid-transfected cells were separated on a 7.5% polyacrylamide gel, transferred to nitrocellulose, and probed with antiphosphotyrosine antibody ( ⁇ PY). Incubation of cells with 1 mM sodium orthovanadate 90 minutes prior to lysis is indicated by ⁇ .
  • FIG. 6D Identification of MCK-10 protein isoforms in human carcinoma cell lines.
  • the glycoprotein fraction of equal amounts of cell lysates was bound to concanavalin-A-Sepharose and, after elution, separated by SDS-PAGE.
  • the gel was blotted to nitrocellulose and probed with the polyclonal antibody ⁇ MCK-10-N. Lysates of MCK-10-1 and MCK-10-2 overexpressing 293 cells were used as controls. Molecular size markers are indicated in kDa.
  • FIGS. 7A, 7B, 7C, 7D, 7E, 7F, 7G and 7H CCK-2 and MCK-10 gene transcripts in sections of human adenocarcinomas.
  • Adjacent sections of papillary adenocarcinoma of the ovary (FIGS. 7A-7D) and bronchioalveolar adenocarcinoma of the lung (FIGS. 7E-7H) were analyzed by in situ hybridization using antisense MCK-10 and CCK-2 probes.
  • Tumor cells are indicated by long arrows (FIGS. 7C, 7D) infiltrating the connective tissue as indicated by short arrows (FIGS. 7A, 7B).
  • FIGS. 7A, 7E show bright-field illumination of respective adjacent sections.
  • the present invention relates to a novel family of receptor tyrosine kinases referred to herein as MCK-10.
  • the invention relates to differentially spliced isoforms of MCK-10 and to additional members of the MCK-10 family of receptor tyrosine kinases such as the CCK-2 gene described herein.
  • the invention is based, in part, on the isolation of a cDNA clone encoding the MCK-10 receptor tyrosine kinase and the discovery of differentially spliced isoforms of MCK-10.
  • the invention also relates to the isolation of a cDNA encoding on additional member of MCK-10 receptor tyrosine kinase family, herein referred to as CCK-2.
  • results from Northern Blot analysis and in situ hybridization indicates that MCK-10 is expressed in epithelial cells.
  • MCK-10 expression can be detected in a wide variety of cancer cells lines and in all tested tumors.
  • the invention relates to, expression and production of MCK-10 protein, as well as to inhibitors of MCK-10 receptor activity which may have therapeutic value in the treatment of diseases such as cancer.
  • MCK-10 is expressed in brain tissue.
  • the MCK-10 gene product shares homology with the TrK neurotropin receptor tyrosine kinase. Therefore, the invention relates to modulators of MCK-10 activity that may be used for treatment of neurological disorders.
  • nucleotide coding sequence and deduced amino acid sequence of the human MCK-10 gene is depicted in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ. ID NOS: 1-2).
  • any nucleotide sequence which encodes the amino acid sequence of the MCK-10 gene product can be used to generate recombinant molecules which direct the expression of MCK-10.
  • nucleotide sequences which selectively hybridize to the MCK-10 nucleotide sequence shown in FIG. 1A, 1B, 1C, 1D, 1E, 1F and 1G may also be used to express gene products with MCK-10 activity.
  • all such variants of the MCK-10 nucleotide sequence will be referred to as the MCK-10 DNA sequence.
  • the human MCK-10 gene was isolated by performing a polymerase chain reaction (PCR) in combination with two degenerate oligonucleotide primer pools that were designed on the basis of highly conserved sequences within the kinase domain of receptor tyrosine kinases corresponding to the amino acid sequence HRDLAA (SEQ ID NO:6) (sense primer) and SDVWS/FY (SEQ ID NO:7) (antisense primer) (Hanks et al., 1988).
  • PCR polymerase chain reaction
  • MCK-10 mammary carcinoma kinase 10
  • MCK-10 mammary carcinoma kinase 10
  • the PCR fragment was used to screen a lambda gt11 library of human fetal brain cDNA (Clontech). Several overlapping clones were identified. The composite of these cDNA clones is depicted in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G.
  • MCK-10-1 and MCK-10-2 which encoded the entire MCK-10 protein but contained a shorter 5' untranslated region starting at position 278 of the MCK-10 sequence (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G). Sequences analysis of the two clones revealed complete identity with the exception of 111 additional nucleotides within the juxtamembrane domain, between nucleotides 1832 and 1943.
  • One of the clones isolated from the human fetal brain library contained an additional 18 nucleotides in the tyrosine kinase domain.
  • MCK-10 splice isoforms have been designated MCK-10-1 (with the additional 111 bp), MCK-10-2 (without any insertions), MCK-10-3 (with the additional 111 bp and 18 bp), and MCK-10-4 (with the additional 18 bp) (FIG. 2).
  • MCK-10 have all of the characteristics of a receptor PTK: the initiation codon is followed by a stretch of essentially hydrophobic amino acids, which may serve as a signal peptide. Amino acids 418-439 are also hydrophobic in nature, with the characteristics of a transmembrane region. The extracellular domain encompasses 4 consensus N-glycosylation sites (AsnXSer/Thr) and 7 cysteine residues.
  • the extracellular region is shorter than that of the insulin receptor family and shows no homology to other receptor tyrosine kinases, but contains near the N-terminus an approximately 150 amino acid long region with remarkable homology to discoidin I, a lectin of the slime mold Dictyostelium discoideum (Poole et al. 1981, J. Mol. Biol. 153: 273-289; Alexander et al., 1992, Differentiation 51: 149-161).
  • a role for this motif in cell-cell interaction is suggested by its previous identification in coagulation factors V and VIII, which mediate aggregation of platelets by binding to anionic lipids on the cell surface (Gilbert et al., 1991 J. Biol. Chem.
  • MCK-10 contains the consensus sequence RXRR (SEQ ID NO:20) at position 304-307, which represents a possible cleavage signal for the endopeptidase furin suggesting that MCK-10 is synthesized as a precursor polypeptide.
  • RXRR consensus sequence
  • the unglycosylated primary translation products of MCK-10-1 and MCK-10-2 proreceptors, with predicted molecular weights of 101.13 and 97.17 kD, respectively, can thus be subdivided into a 34.31 kD ⁇ subunit and 66.84 or 62.88 kD ⁇ -subunits that contain the tyrosine kinase homology and alternative splice sites.
  • the consensus sequence for an ATP-binding motif is located at positions 617-627 (FIGS. 1A, 1B and 1C).
  • the ATP binding domain is 176 amino acids (including the additional 37 amino acids) further from the transmembrane domain than any other tyrosine kinase.
  • the additional 37 amino acids are located in the long and proline/glycine-rich juxtamembrane region (JM) and contain an NPAY sequence (where A can be exchanged for any amino acid), which is found in cytoplasmic domains of several cell surface proteins, including RTKs of the EGF and insulin receptor families (Chen et al. 1990, J. Biol: Chem., 265: 3116-3123).
  • TYAXPXXXPG This consensus motif is followed by the sequence TYAXPXXXPG, (SEQ ID NO:8) which is repeated downstream in MCK-10 in the juxtamembrane domain at positions 585-595. Recently it has been shown that this motif is deleted in the cytoplasmic juxtamembrane region of the activin receptor, serine/threonine kinase, resulting in reduced ligand binding affinity (Attisano et al. 1992, Cell, 68: 97-108).
  • the catalytic domain shows the highest homology to the TrkA receptor.
  • the YY-motifs position 802/803 and the tyrosine at position 798, representing putative autophosphorylation sites, characterize MCK-10 as a member of the insulin receptor family (FIGS. 1A, 1B and 1C).
  • MCK-10 shares homology with the Trk neurotrophin receptor subfamily of receptor tyrosine kinase with their characteristic short carboxyl-terminal tail of 9 amino acids.
  • tyrosine residues in the kinase and JM domains of MCK-10-2 are flanked by consensus sequences that suggest a role as autophosphorylation and substrate attachment sites.
  • the sequences flanking Tyr-844 in MCK-10 (YELM) (SEQ ID NO:34) in the COOH-terminal region of the kinase core domain contain the YXXM (SEQ ID NO:35) binding motif for association of the p85 subunit of phosphatidylinositol 3'-kinase (P13-kinase).
  • Another potential substrate binding site is found 12 amino acids upstream at position Tyr 832 in MCK-10-2 (YLSR) (SEQ ID NO:36).
  • Tyr-506 (YSGD) (SEQ ID NO:37) in the JM region of MCK-10-2 could serve as a receptor binding site for SHC, an oncogenic SH2 domain-containing molecule (Obermeier et al. 1993, J. Biol. Chem. 268: 22963-22966), and sequences flanking Tyr 510 (YMEP) (SEQ ID NO:38) in MCK-10 qualify as the binding site for the GTPase-activating protein (GAP) because of similarity to the GAP binding site in the platelet-derived growth factor receptor (PDGF-R).
  • GAP GTPase-activating protein
  • FIG. 6A shows an antiphosphotyrosine immunoblot of crude cell lysates separated by polyacrylamide gel electrophoresis (SDS-PAGE).
  • this cleavage product of MCK-10-2 appeared to be phosphorylated to a higher extent than the 124 kDa precursor, as judged by comparing antiphosphotyrosine and anti-MCK-10-C immunoblots (FIG. 6A).
  • An additional phosphorylated protein of unknown identity with an apparent molecular weight of 165 kDa was readily detected in lysates of MCK-10-1-transfected 293 cells, whereas it was not detected in cells transfected with the shorter isoform.
  • the ⁇ MCK-10-N antibody was used for Western blot analysis.
  • membrane preparations of T-47D breast carcinoma cells, A431 epidermoid carcinoma cells, SW48 and SNU-C2B colon carcinoma cells, and Caki-2 kidney carcinoma cells contained multiple bands that were recognized by the antibody, including proteins with the same apparent molecular weights as those identified in MCK-10-2 and MCK-10-1 overexpressing 293 cells.
  • Hs 294T cells contained a large MCK-10 form of approximately 165 kDa in addition to a shorter band of 72 kDa.
  • FIG. 5A illustrates the levels of expression of MCK-10 in a variety of breast cancer cell lines
  • FIG. 5C presents the levels of MCK-10 expression in different tumor cell lines.
  • MCK-10-2 In situ hybridization analysis with the 5' 1865 bp of MCK-10-2 indicated that MCK-10 was expressed specifically in epithelial cells of various tissues including:
  • tubular cells of renal cell carcinoma are tubular cells of renal cell carcinoma
  • transitional cell carcinoma (a malignant epithelial tumor of the bladder)
  • glioblastoma (a tumor of the neuroepithelial tissue)
  • the in situ hybridization experiments revealed the highest expression of MCK-10 in malignant cells of the ductal breast carcinoma, in the tumor cells of a multi-endocrine tumor, and in the tumor cells of a transitional cell carcinoma of the bladder.
  • the present invention also relates to other members of the MCK-10 family of receptor kinases.
  • Members of the MCK-10 family are defined herein as those proteins coded for by DNA sequences capable of hybridizing to MCK-10 DNA sequences as presented in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G under highly or less highly stringent hybridization conditions.
  • Highly stringent hybridization conditions may be defined as hybridization to filter-bound DNA in 0.5M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1 ⁇ SSC/0.1% SDS at 68° C. (Ausubel F. M.
  • highly stringent conditions such as moderately stringent conditions, may be defined as hybridizations carried out as described above, followed by washing in 0.2 ⁇ SSC/0.1% SDS at 42° C. (Ausubel et al., 1989, supra).
  • highly stringent conditions may refer, i.e., to washing in 6 ⁇ SSC/0.5% sodium pyrophosphate at 37° C. (for 14-base oligos), 48° C.
  • receptors may demonstrate 80% homology at the amino acid level in substantial stretches of DNA sequences.
  • receptors can be defined as those receptors containing an intracellular tyrosine kinase domain and a discoidin I sequence located near the amino-terminal end of the protein.
  • the discoidin I domain is defined as that region of MCK-10 located between amino acid 31-185 as presented in FIG. 4A.
  • CCK-2 novel receptor tyrosine kinases
  • FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G and 3H SEQ ID NOS:3-4.
  • any nucleotide sequence which encodes the amino acid sequence of the CCK-2 gene product can be used to generate recombinant molecules which direct the expression of CCK-2.
  • nucleotide sequences which selectively hybridize to the CCK-2 nucleotide sequence as shown in FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H may also be used to express gene products with CCK-2 activity.
  • CCK-2 sequence revealed significant homology to the extracellular, transmembrane and intracellular region of the MCK-10 receptor indicating that it was a member of the MCK-10 family of receptors.
  • the shared homology between CCK-2 and MCK-10 is depicted in FIG. 4A and 4B.
  • MCK-10 and CCK-2 expression were confirmed and even more clearly demonstrated in various sections of primary human carcinomas. Both receptors were expressed in an apparently mutually exclusive manner in different cell types of the same tumor. CCK-2 was predominantly found in all stromal cells, which provide an environment conducive to proliferation, invasion, and even metastasis of epithelial cells, whereas MCK-10 expression was strongly confined to the neoplastic cells themselves.
  • the distinct expression patterns for MCK-10 and CCK-2 suggest that these closely related receptors are involved in interactions between neoplastic epithelial cells and surrounding stroma during tumor progression, and the presence of the discoidin I motif in their extracellular domains strongly indicates an important role for these receptors in processes involved in cell-cell communications.
  • receptors and generation of cell lines expressing receptors are described by way of example for the MCK-10 gene. However, the principles may be analogously applied to expression and generation of cell lines expressing spliced isoforms of MCK-10 or to other members of the MCK-10 family of receptors, such as CCK-2.
  • MCK-10 nucleotide sequences which encode MCK-10, peptide fragments of MCK-10, MCK-10 fusion proteins or functional equivalents thereof may be used to generate recombinant DNA molecules that direct the expression of MCK-10 protein or a functionally equivalent thereof, in appropriate host cells.
  • nucleotide sequences which hybridize to portions of the MCK-10 sequence may also be used in nucleic acid hybridization assays, Southern and Northern blot analyses, etc.
  • DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence, may be used in the practice of the invention for the cloning and expression of the MCK-10 protein.
  • DNA sequences include those which are capable of hybridizing to the human MCK-10 sequence under stringent conditions.
  • Altered DNA sequences which may be used in accordance with the invention include deletions, additions or substitutions of different nucleotide residues resulting in a sequence that encodes the same or a functionally equivalent gene product. These alterations would in all likelihood be in regions of MCK-10 that do not constitute functionally conserved regions such as the discodin I domain or the tyrosine kinase domain. In contrast, alterations, such as deletions, additions or substitutions of nucleotide residues in functionally conserved MCK-10 regions would possibly result in a nonfunctional MCK-10 receptor.
  • the gene product itself may contain deletions, additions or substitutions of amino acid residues within the MCK-10 sequence, which result in a silent change thus producing a functionally equivalent MCK-10.
  • Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipatic nature of the residues involved.
  • negatively charged amino acids include aspartic acid and glutamic acid
  • positively charged amino acids include lysine and arginine
  • amino acids with uncharged polar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine; phenylalanine, tyrosine.
  • the DNA sequences of the invention may be engineered in order to alter the MCK-10 coding sequence for a variety of ends including but not limited to alterations which modify processing and expression of the gene product.
  • mutations may be introduced using techniques which are well known in the art, e.g. site-directed mutagenesis, to insert new restriction sites, to alter glycosylation patterns, phosphorylation, etc.
  • host cells may over glycosylate the gene product.
  • the MCK-10 or a modified MCK-10 sequence may be ligated to a heterologous sequence to encode a fusion protein.
  • a fusion protein may also be engineered to contain a cleavage site located between the MCK-10 sequence and the heterologous protein sequence, so that the MCK-10 may be cleaved away from the heterologous moiety.
  • the coding sequence of MCK-10 could be synthesized in whole or in part, using chemical methods well known in the art. See, for example, Caruthers, et al., 1980, Nuc. Acids Res. Symp. Ser. 7: 215-233; Crea and Horn, 180, Nuc. Acids Res. 9 (10): 2331; Matteucci and Caruthers, 1980, Tetrahedron Letters 21: 719; and Chow and Kempe, 1981, Nuc. Acids Res. 9(12): 2807-2817.
  • the protein itself could be produced using chemical methods to synthesize the MCK-10 amino acid sequence in whole or in part.
  • peptides can be synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography. (E.g., see Creighton, 1983, Proteins Structures And Molecular Principles, W. H. Freeman and Co., N.Y. pp. 50-60). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, 1983, Proteins, Structures and Molecular Principles, W. H. Freeman and Co., N.Y., pp. 34-49.
  • the nucleotide sequence coding for MCK-10 is inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • the MCK-10 gene products as well as host cells or cell lines transfected or transformed with recombinant MCK-10 expression vectors can be used for a variety of purposes. These include but are not limited to generating antibodies (i.e., monoclonal or polyclonal) that bind to the receptor, including those that competitively inhibit binding of MCK-10 ligand and "neutralize" activity of MCK-10 and the screening and selection of drugs that act via the MCK-10 receptor; etc.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing the MCK-10 coding sequence and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.
  • a variety of host-expression vector systems may be utilized to express the MCK-10 coding sequence. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the MCK-10 coding sequence; yeast transformed with recombinant yeast expression vectors containing the MCK-10 coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the MCK-10 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the MCK-10 coding sequence; or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the MCK-10
  • any of a number of suitable transcription and translation elements may be used in the expression vector.
  • inducible promoters such as pL of bacteriophage ⁇ , plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedrin promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g., heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mamm
  • a number of expression vectors may be advantageously selected depending upon the use intended for the MCK-10 expressed.
  • vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
  • Such vectors include but are not limited to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), in which the MCK-10 coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid AS-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.
  • yeast a number of vectors containing constitutive or inducible promoters may be used.
  • Current Protocols in Molecular Biology Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch.
  • the expression of the MCK-10 coding sequence may be driven by any of a number of promoters.
  • viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310: 511-514), or the coat protein promoter of TMV (Takamatsu et al., 1987, EMBO J. 6: 307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J.
  • An alternative expression system which could be used to express MCK-10 is an insect system.
  • Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • the MCK-10 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
  • Successful insertion of the MCK-10 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene).
  • the MCK-10 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing MCK-10 in infected hosts.
  • a non-essential region of the viral genome e.g., region E1 or E3
  • the vaccinia 7.5K promoter may be used. (See, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA) 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. 79: 4927-4931).
  • Specific initiation signals may also be required for efficient translation of inserted MCK-10 coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire MCK-10 gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the MCK-10 coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the MCK-10 coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol. 153: 516-544).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • modifications e.g., glycosylation
  • processing e.g., cleavage
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38, etc.
  • cell lines which stably express the MCK-10 may be engineered.
  • host cells can be transformed with the MCK-10 DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines which express the MCK-10 on the cell surface. Such engineered cell lines are particularly useful in screening for drugs that affect MCK-10.
  • a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22: 817) genes can be employed in tk - , hgprt - or aprt - cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981), Proc. Natl. Acad. Sci. USA 78: 2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol.
  • hygro which confers resistance to hygromycin
  • trpB which allows cells to utilize indole in place of tryptophan
  • hisD which allows cells to utilize histinol in place of histidine
  • ODC ornithine decarboxylase
  • the host cells which contain the coding sequence and which express the biologically active gene product may be identified by at least four general approaches; (a) DNA-DNA or DNA-RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of MCK-10 mRNA transcripts in the host cell; and (d) detection of the gene product as measured by immunoassay or by its biological activity.
  • the presence of the MCK-10 coding sequence inserted in the expression vector can be detected by DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide sequences that are homologous to the MCK-10 coding sequence, respectively, or portions or derivatives thereof.
  • the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.).
  • certain "marker" gene functions e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.
  • a marker gene can be placed in tandem with the MCK-10 sequence under the control of the same or different promoter used to control the expression of the MCK-10 coding sequence. Expression of the marker in response to induction or selection indicates expression of the MCK-10 coding sequence.
  • transcriptional activity for the MCK-10 coding region can be assessed by hybridization assays.
  • RNA can be isolated and analyzed by Northern blot using a probe homologous to the MCK-10 coding sequence or particular portions thereof.
  • total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
  • the expression of the MCK-10 protein product can be assessed immunologically, for example by Western blots, immunoassays such as radioimmuno-precipitation, enzyme-linked immunoassays and the like.
  • MCK-10 is expressed in a variety of normal tissues, including brain tissue.
  • the MCK-10 receptor tyrosine kinase shares homology with the TrK neurotropin receptor, indicating that modulators of MCK-10 may be used to treat a variety of neurological disorders characterized by one or more of the following symptoms: astasia, aphasia, paralysis, paresa and paralegies.
  • Such nervous system disorders include, but are not limited to, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease (ALS), trauma, damaged or severed nerve injuries, Huntington's chorea, multiple sclerosis, muscular dystrophy syringomiplia, Tabes Dorsalis and cardiovascular accidents.
  • Northern blot analysis and in situ hybridization also indicates that MCK-10 and CCK-2 are expressed in a wide variety of cancer cells and tumor tissue.
  • the present invention relates to inhibitors of MCK-10 and CCK-2 receptor activity which may have therapeutic value in the treatment of proliferative diseases such as cancer.
  • MCK-10 the uses of the expressed receptors and engineered cell lines expressing the receptors is described by way of example for MCK-10.
  • the described uses may be equally applied to expression of MCK-10 spliced isoforms or additional members of the MCK-10 gene family such as CCK-2.
  • the MCK-10 receptor and/or cell lines that express the MCK-10 receptor may be used to screen for antibodies, peptides, or other ligands that act as agonists or antagonists of the MCK-10 receptor.
  • anti-MCK-10 antibodies may be used to inhibit MCK-10 function.
  • screening of peptide libraries with recombinantly expressed soluble MCK-10 protein or cell lines expressing MCK-10 protein may be useful for identification of therapeutic molecules that function by modulating the biological activity of MCK-10.
  • the uses of the MCK-10 receptor and engineered cell lines, described in the subsections below, may be employed equally well for MCK-10 family of receptor tyrosine kinases.
  • engineered cell lines which express the entire MCK-10 coding region or its ligand binding domain may be utilized to screen and identify ligand antagonists as well as agonists. Synthetic compounds, natural products, and other sources of potentially biologically active materials can be screened in a number of ways.
  • Random peptide libraries consisting of all possible combinations of amino acids attached to a solid phase support may be used to identify peptides that are able to bind to the ligand binding site of a given receptor or other functional domains of a receptor such as kinase domains (Lam, K. S. et al., 1991, Nature 354: 82-84).
  • the screening of peptide libraries may have therapeutic value in the discovery of pharmaceutical agents that act to inhibit the biological activity of receptors through their interactions with the given receptor.
  • Identification of molecules that are able to bind to the MCK-10 may be accomplished by screening a peptide library with recombinant soluble MCK-10 protein. Methods for expression and purification of MCK-10 are described in Section 5.2.1 and may be used to express recombinant full length MCK-10 or fragments of MCK-10 depending on the functional domains of interest. For example, the kinase and extracellular ligand binding domains of MCK-10 may be separately expressed and used to screen peptide libraries.
  • MCK-10 protein may be conjugated to enzymes such as alkaline phosphatase or horseradish peroxidase or to other reagents such as fluorescent labels which may include fluorescein isothyiocynate (FITC), phycoerythrin (PE) or rhodamine. Conjugation of any given label, to MCK-10, may be performed using techniques that are routine in the art.
  • MCK-10 expression vectors may be engineered to express a chimeric MCK-10 protein containing an epitope for which a commercially available antibody exist. The epitope specific antibody may be tagged using methods well known in the art including labeling with enzymes, fluorescent dyes or colored or magnetic beads.
  • the "tagged" MCK-10 conjugate is incubated with the random peptide library for 30 minutes to one hour at 22° C. to allow complex formation between MCK-10 and peptide species within the library.
  • the library is then washed to remove any unbound MCK-10 protein. If MCK-10 has been conjugated to alkaline phosphatase or horseradish peroxidase the whole library is poured into a petri dish containing substrates for either alkaline phosphatase or peroxidase, for example, 5-bromo-4-chloro-3-indoyl phosphate (BCIP) or 3,3',4,4"-diamnobenzidine (DAB), respectively.
  • BCIP 5-bromo-4-chloro-3-indoyl phosphate
  • DAB 3,3',4,4"-diamnobenzidine
  • the peptide/solid phase-MCK-10 complex changes color, and can be easily identified and isolated physically under a dissecting microscope with a micromanipulator. If a fluorescent tagged MCK-10 molecule has been used, complexes may be isolated by fluorescent activated sorting. If a chimeric MCK-10 protein expressing a heterologous epitope has been used, detection of the peptide/MCK-10 complex may be accomplished by using a labeled epitope specific antibody. Once isolated, the identity of the peptide attached to the solid phase support may be determined by peptide sequencing.
  • soluble MCK-10 molecules in another embodiment, it is possible to detect peptides that bind to cell surface receptors using intact cells.
  • the use of intact cells is preferred for use with receptors that are multi-subunits or labile or with receptors that require the lipid domain of the cell membrane to be functional.
  • Methods for generating cell lines expressing MCK-10 are described in Sections 5.2.1. and 5.2.2.
  • the cells used in this technique may be either live or fixed cells. The cells will be incubated with the random peptide library and will bind to certain peptides in the library to form a "rosette" between the target cells and the relevant solid phase support/peptide. The rosette can thereafter be isolated by differential centrifugation or removed physically under a dissecting microscope.
  • the receptor molecules can be reconstituted into liposomes where label or "tag" can be attached.
  • antibodies to epitopes of the recombinantly produced MCK-10 receptor include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library.
  • Neutralizing antibodies i.e., those which compete for the ligand binding site of the receptor are especially preferred for diagnostics and therapeutics.
  • Monoclonal antibodies that bind MCK-10 may be radioactively labeled allowing one to follow their location and distribution in the body after injection. Radioactivity tagged antibodies may be used as a non-invasive diagnostic tool for imaging de novo cells of tumors and metastases.
  • Immunotoxins may also be designed which target cytotoxic agents to specific sites in the body.
  • high affinity MCK-10 specific monoclonal antibodies may be covalently complexed to bacterial or plant toxins, such as diphtheria toxin, abrin or ricin.
  • a general method of preparation of antibody/hybrid molecules may involve use of thiol-crosslinking reagents such as SPDP, which attack the primary amino groups on the antibody and by disulfide exchange, attach the toxin to the antibody.
  • SPDP thiol-crosslinking reagents
  • the hybrid antibodies may be used to specifically eliminate MCK-10 expressing tumor cells.
  • various host animals may be immunized by injection with the MCK-10 protein including but not limited to rabbits, mice, rats, etc.
  • Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum bacilli Calmette-Guerin
  • Monoclonal antibodies to MCK-10 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256: 495-497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4: 72; Cote et al., 1983, Proc. Natl. Acad. Sci., 80: 2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Antibody fragments which contain specific binding sites of MCK-10 may be generated by known techniques.
  • such fragments include but are not limited to: the F(ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragments.
  • Fab expression libraries may be constructed (Huse et al., 1989, Science, 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to MCK-10.
  • the MCK-10 coding sequence may be used for diagnostic purposes for detection of MCK-10 expression. Included in the scope of the invention are oligoribonucleotide sequences, that include antisense RNA and DNA molecules and ribozymes that function to inhibit translation of MCK-10. In addition, mutated forms of MCK-10, having a dominant negative effect, may be expressed in targeted cell populations to inhibit the activity of endogenously expressed MCK-10. The uses described below may be equally well adapted for MCK-10 spliced isoform coding sequences and sequences encoding additional members of the MCK-10 family of receptors, such as CCK-2.
  • the MCK-10 DNA may have a number of uses for the diagnosis of diseases resulting from aberrant expression of MCK-10.
  • the MCK-10 DNA sequence may be used in hybridization assays of biopsies or autopsies to diagnose abnormalities of MCK-10 expression; e.g., Southern or Northern analysis, including in situ hybridization assays.
  • oligoribonucleotide sequences that include anti-sense RNA and DNA molecules and ribozymes that function to inhibit the translation of MCK-10 mRNA.
  • Anti-sense RNA and DNA molecules act to directly block the translation of mRNA by binding to targeted mRNA and preventing protein translation.
  • antisense DNA oligodeoxyribonucleotides derived from the translation initiation site, e.g., between -10 and +10 regions of the MCK-10 nucleotide sequence, are preferred.
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
  • the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage.
  • engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of MCK-10 RNA sequences.
  • ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
  • RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • DNA molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribo- or deoxy- nucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
  • Receptor dimerization induced by ligands is thought to provide an allosteric regulatory signal that functions to couple ligand binding to stimulation of kinase activity.
  • Defective receptors can function as dominant negative mutations by suppressing the activation and response of normal receptors by formation of unproductive heterodimers. Therefore, defective receptors can be engineered into recombinant viral vectors and used in gene therapy in individuals that inappropriately express MCK-10.
  • mutant forms of the MCK-10 molecule having a dominant negative effect may be identified by expression in selected cells.
  • Deletion or missense mutants of MCK-10 that retain the ability to form dimers with wild type MCK-10 protein but cannot function in signal transduction may be used to inhibit the biological activity of the endogenous wild type MCK-10.
  • the cytoplasmic kinase domain of MCK-10 may be deleted resulting in a truncated MCK-10 molecule that is still able to undergo dimerization with endogenous wild type receptors but unable to transduce a signal.
  • Recombinant viruses may be engineered to express dominant negative forms of MCK-10 which may be used to inhibit the activity of the wild type endogenous MCK-10. These viruses may be used therapeutically for treatment of diseases resulting from aberrant expression or activity of MCK-10, such as cancers.
  • Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus may be used for delivery of recombinant MCK-10 into the targeted cell population.
  • viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus.
  • Methods which are well known to those skilled in the art can be used to construct those recombinant viral vectors containing MCK-10 coding sequence. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.
  • recombinant MCK-10 molecules can be reconstituted into liposomes for delivery to target cells.
  • AMV avian myeloblastosis virus
  • cDNA was used in a polymerase chain reaction under standard conditions (PCR Technology-Principles and Applications for DNA Amplifications, H. E. Erlich, ed., Stockton Press, New York 1989). The following pool of primers were used for the amplification:
  • the recombinant plasmids were transformed into the competent E. coli strain designated 298.
  • the subcloned PCR products were sequenced by the method of Sanger et al. (Proc. Natl. Acad. Sci. USA 74, 5463-5467) using Sequenase (United States Biochemical, Cleveland, Ohio 44111 USA).
  • One clone, designated MCK-10 was identified as novel RTK.
  • the partial cDNA sequence of the new MCK-10 RTK which was identified by PCR, was used to screen a ⁇ gt11 library from human fetal brain cDNA (Clontech) (complexity of 1 ⁇ 10 10 recombinant phages).
  • a ⁇ gt11 library from human fetal brain cDNA (Clontech) (complexity of 1 ⁇ 10 10 recombinant phages).
  • One million independent phage clones were plated and transferred to nitrocellulose filters following standard procedures (Sambrook, H. J., Molecular Cloning, Cold Spring Harbor Laboratory Press, USA, 1989).
  • the filters were hybridized to the EcoRI/EcoRI fragment of clone MCK-10, which had been radioactively labeled using 50 ⁇ Ci ⁇ 32 P!ATP and the random-primed DNA labeling kit (Boehringer Mannheim).
  • the longest cDNA insert (8) of ⁇ 3500 bp was digested with the restriction enzymes EcoRI/SacI to obtain a 5' end probe of -250 bp. This probe was used to rescreen the human fetal brain library and several overlapping clones were isolated. The composite of the cDNA clones are shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G. Some of the clones had a deletion of 6 amino acids at position 2315 in the MCK-10 sequence.
  • the 1.75 million independent phage clones of a human placenta library, ⁇ ZAP were plated and screened with the 5' end probe (EcoRI/SacI) of clone 8. Two clones were full-length with a shorter 5' end starting at position 278 of the nucleotide sequence shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ ID NO:1). Subcloning of positive bacteriophages clones into pBluescript vector was done by the in vivo excision protocol (Stratagene).
  • FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G SEQ ID NOS:1-2.
  • Different cDNA sequence variations of MCK-10 is presented in FIG. 2A.
  • PolyA + RNA was isolated on an oligo (dT) column (Aviv and Leder, 1972, Proc. Natl. Acad. Sci. USA 69, 1408-1412). The RNA was separated on an agarose gel containing 2.2M formaldehyde and blotted on a nitrocellulose filter (Schleicher and Schuell). 3 ⁇ g of poly A + RNA was loaded per lane. The filters were either hybridized with a 32 P-labeled EcoRI/EcoRI DNA fragment obtained by PCR or by a 1694 bp cDNA fragment of MCK-10-2 (excluding the 111 bp insert) which encompasses the extracellular, transmembrane and juxtamembrane domain. Subsequently, the filter was exposed to x-ray film at -70° C. with an intensifying screen. The results are depicted in FIGS. 5A, 5B and 5C.
  • Antisera was generated against synthetic peptides corresponding to the amino acid sequence of MCK-10-2.
  • ⁇ MCK-10-N antisera was generated against the following N-terminal peptide located between amino acids 26-42 (SEQ ID NO:11)
  • ⁇ MCK-10-c antisera was generated against the following C-terminal peptide located between amino acids 902-919 (SEQ ID NO:12)
  • ⁇ MCK-10- ⁇ antisera was generated against the following peptide near the processing site of ⁇ -subunit of MCK-10 located between amino acids 309-322 (SEQ ID NO:13):
  • ⁇ MCK-10-C2 antisera was generated against the C-terminal peptide located between amino acids 893-909 (SEQ ID NO:14):
  • Peptides were coupled to keyhole limpet hemocyanin and injected with Freunds adjuvant into Chinchilla rabbits. After the second boost, the rabbits were bled and the antisera were tested in immunoprecipitations using lysates of 293 cells transiently overexpressing MCK-10-1 and MCK-10-2.
  • the samples were loaded on a 7.5% polyacrylamide gel and after electrophoresis transferred onto a nitrocellulose filter (Schleicher and Schuell).
  • the blot was probed with the different antibodies as above and developed using the ECL Western blotting detection system according the manufacturer's instructions (Cat no. RPN 2108 Amersham International, UK).
  • SK+ bluescript SK+
  • a single-strand antisense DNA probe was prepared as described by Schnurch and Risau (Development 1991, 111, 1143-1154).
  • the plasmid was linearized at the 3'end of the cDNA and a sense transcript was synthesized using SP6 RNA polymerase (Boehringer).
  • the DNA was degraded using DNase (RNase-free preparation, Boehringer Mannheim).
  • RNA transcript was partially hydrolyzed in 100 nM NaOH for 20 min at 70° C., and the probe was neutralized with the same amount of HCL and purified with a Sephadex-G50 column. After ethanol precipitation the probe was dissolved at a final specific activity of 5 ⁇ 10 5 cpm.
  • a sense probe was prepared using the same method.
  • Sectioning, postfixation and hybridization was essentially performed according to Hogan et al. (1986, Manipulating the Mouse Embryo: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press). 10 ⁇ m thick sections were cut at -18° C. on a Leitz cryostat. For hybridization treatment, no incubation with 0.2M HCL for removing the basic proteins was performed. Sections were incubated with the 35 S-cDNA probe (5 ⁇ 10 4 cpm/ ⁇ l) at 52° C.
  • RTKs receptor tyrosine kinases
  • MCK-10 mammary carcinoma kinase 10
  • tyrosine kinase domain exhibited extensive sequence similarity to the insulin receptor family.
  • the PCR fragment was used to screen a lambda gt11 library of human fetal brain cDNA (Clontech). Several overlapping clones were identified and their composite sequence is shown in FIGS. 1A, 1B and 1C. Furthermore, screening of a human placenta library yielded two cDNA clones which encoded the entire MCK-10 protein but whose 5' nucleotide sequence began at nucleotide 278 in the sequence shown in FIG. 1.
  • MCK-10 has all of the characteristics of a receptor PTK: the initiation codon is followed by a stretch of essentially hydrophobic amino acids, which may serve as a signal peptide.
  • Amino acids 418-439 are also hydrophobic in nature, with the characteristics of a transmembrane region.
  • the extracellular domain encompasses 4 consensus N-glycosylation sites (AsnXSer/Thr) and 7 cysteine residues.
  • the extracellular region is shorter than that of the insulin receptor family and shows no homology to other receptor tyrosine kinases, but contains near the N-terminus the consensus sequences for the discoidin 1 like family (Poole et al. 1981, J. Mol. Biol.
  • the protein backbone of MCK-10-1 and MCK-10-2 proreceptors can thus be subdivided into a 34.31 kD ⁇ subunit, and a 66.84 kD and a 62,88 kD ⁇ -subunit, respectively, that contain the tyrosine kinase homology and alternative splice sites.
  • the consensus sequence for the ATP-binding motif is located at positions 617-627 (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G).
  • the ATP binding domain is 176 amino acids (including the additional 37 amino acids) further from the transmembrane domain than any other tyrosine kinase.
  • the additional 37 amino acids are located in the long and proline/glycine-rich juxtamembrane region and contain an NPAY sequence (where A can be exchanged for any amino acid), which is found in cytoplasmic domains of several cell surface proteins, including RTKs of the EGF and insulin receptor families (Chen et al. 1990, J. Biol.
  • the catalytic domain shows the highest homology to the TrkA receptor.
  • the yy-motifs position 802/803
  • the tyrosine at position 798 representing putative autophosphorylation sites, characterize MCK-10 as a member of the insulin receptor family (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G).
  • MCK-10 shares with the Trk kinases their characteristic short caraboxy-terminal tail of 9 amino acids.
  • MCK-10 Using as a hybridization probe a 5' 1694 bp cDNA fragment of MCK-10 (excluding the 111 base pair insert), which encompasses the extracellular, transmembrane, and juxtamembrane domains, the MCK-10 gene revealed the existence of multiple transcript sizes with a major form of 4.3 kb. The highest expression of MCK-10 mRNA was detected in lung, intermediate levels were found in kidney, colon, stomach, placenta, and brain, low levels in pancreas, and no MCK-10 mRNA was detected in liver (FIG. 5A). MCK-10 mRNA was also detected in a variety of different tumor cell lines as depicted in FIG. 5B and FIG. 5C. Northern blot analysis with the GAPDH gene was carried out as a control.
  • tubular cells of renal cell carcinoma are tubular cells of renal cell carcinoma
  • transitional cell carcinoma (a malignant epithelial tumor of the bladder)
  • glioblastoma (a tumor of the neuroepithelial tissue)
  • MCK-10-1 and MCK-10-2 were cloned into an expression vector.
  • Cells were transfected in duplicate with the two splice variants or a control plasmid and starved overnight. One part was incubated prior to lysis with 1 mM sodium-orthovanadate for 90 min.
  • This agent is known to be a potent inhibitor of phosphotyrosine phosphatases, thereby enhancing the tyrosine phosphorylation of cellular protein.
  • the precursor and the ⁇ -subunit of MCK-10 showed strong tyrosine phosphorylation after orthovanadate treatment, (FIG. 6A, left panel).
  • the MCK-10-1 containing the 37 amino acid insertion, exhibited lower kinase activity than MCK-10-2.
  • Reprobing the same blot with a peptide antibody raised against the MCK-10 C-terminus revealed equal amounts of expressed receptor and a slight shift of MCK-10-1 precursor and ⁇ -subunit due to the additional 37 amino acids of the insertion (FIG. 6A, right panel).
  • transient overexpression experiments demonstrate significant effects of the 37 amino acid insertion on receptor function. Both receptor kinase activity and extracellular glycosylation appeared to be significantly affected by the additional sequences present in MCK-10-1 which may influence ligand binding. Although orthovanadate-induced tyrosine phosphorylation was reduced for both the 124 kD form as well as the 63 kD cleavage product, possibly representing a ⁇ subunit, surprisingly, the MCK-10-1 type receptor was less extensively glycosylated than the MCK-10-2 isoform, which resulted in an approximately equal apparent molecular weight for the mature forms of both variants.
  • the latter phenomenon may be mediated by either or all of the protein binding motifs and may lead, through interaction with cytoskeletal components for which both NXXY and SH3 domain involvement has been suggested (Reszka et al. 1992, J. Cell Biol. 117: 1321-1330; Musacchio et al., 1992, FEBS letters 307: 55-61), to differential sorting, modification, and possibly even cellular localization. Moreover, the resulting differences in extracellular carbohydrate side chain modification pattern may affect ligand binding and therefore autophosphorylation of MCK-10 alternative splice forms.
  • MCK-10 gene products A potentially even greater diversity of MCK-10 gene products than suggested by cDNA cloning results became apparent through immunoblot analysis of human tumor cell lines, which indicated cell line-characteristic quantitative and qualitative differences.
  • the expression pattern complexity revealed by the extracellular domain-specific MCK-10-N antibody may be the result of either differential glycosylation or the existence of additional alternative splicing variants or both.
  • This remarkable complexity of MCK-10 isoforms in tumor cells in conjunction with the presence of a discoidin I domain potentially involved in cell adhesion, and the possibility of SH3 protein-mediated connections with the cytoskeleton suggests an intricately regulated role of MCK-10 in cell-cell interaction and possibly tumor invasion or metastasis.
  • cleavage of the MCK-10 extracellular domain at the RXRR consensus sequence yielding a soluble 54 kD ⁇ -subunit with putative adhesion properties due to the presence of the discoidin I-like domain may represent another regulatory mechanism in tumor progression, when cancer cells adhere to, as well as detach from, the extracellular matrix.
  • Similar post-translational processing by endoprotease cleavage has been shown for cell adhesion molecules such as Ng-CAM (Burgoon et al., 1992, J. Cell Biol. 112: 1017-1029) and for the receptor phosphatases PTP ⁇ and PTP ⁇ , which mediate hemophilic intercellular interactions (Brady-Kalnay et al., 1993, J. Cell Biol. 122: 961-972; Jiang et al., 1993, Mol. Cell Biol. 13: 2942-2951; Sap et al., 1994, Mol Cell Biol. 14: 1-9).
  • the following subsection describes methods for isolation and characterization of the CCK-2 gene, an additional member of the MCK-10 receptor tyrosine kinase gene family.
  • cDNA was synthesized using avian myeloblastosis virus reverse transcriptase and 5 ⁇ g of poly A + RNA prepared from tissue of a primary colonic adenocarcinoma, sigmoid colon, moderately well differentiated grade II, staging pT3, pN1, removed from a 69 year old white female of blood type O, RH positive. The patient had not received therapy.
  • the CCK-2 PCR fragment was used to screen a human placenta library in lambda ZAP.
  • the longest cDNA insert - 1300 bp was digested with the restriction enzymes EcoRI/Ncol to obtain a 5' end probe of 200 bp.
  • Rescreening of the human placenta library yielded in a cDNA clone which encoded the entire CCK-2 protein (subcloning of positive bacteriophages clones into pBluescript vector was done by the in vivo excision protocol (Stratagene)).
  • the DNA sequence and the deduced aminoacid sequence of CCK-2 is shown in FIG. 3 (SEQ ID NOS:3-4).
  • the 5' located 1260 bp of CCK-2 was subcloned into the pBluescript SK + -vector (pBSK + ; Stratagene).
  • pBSK + pBluescript SK + -vector
  • the probe was prepared by labeling the cDNA fragment with ⁇ - 32 PdATP using a random hexanucleotide priming kit (United States Biochemical) and purified with Sephadex-G50 column.
  • RNA transcripts were partially hydrolyzed in 100 nM NaOH for 20 minutes at 70° C., neutralized with the same amount of HCL, and purified with a Sephadex-G50 column. After ethanol precipitation, probes were dissolved at a final specific activity of 5 ⁇ 10 5 cpm. Sense probes for control hybridization were prepared using the same method.
  • the cDNA insert containing the entire open reading frame of CCK-2 was subcloned into a cytomegalovirus promoter-based expression plasmid and semiconfluent human embryonic kidney fibroblast 293 cell line were transfected.
  • Cell lysates from CCK-2-transfected cells were separated on a 7.5% polyacrylamide gel, transferred to nitrocellulose, and probed with the 5E2 monoclonal antibody against antiphosphotyrosine ( ⁇ PY). Incubation of cells with 1 mM sodium orthovanadate was carried out 90 minutes prior to lysis.
  • CCK-2 The nucleotide sequence of the novel receptor, designated CCK-2, is presented in FIGS. 3A, 3B, 3C and 3D (SEQ ID NO:3). Analysis of the CCK-2, nucleotide sequence and encoded amino acid sequence indicated significant homology with MCK-10 throughout the extracellular, transmembrane and intracellular region of the MCK-10 receptor. The regions of homology between CCK-2 and MCK-10 extend into the N-terminus consensus sequence for the discoidin I like family of proteins. (Poole et al. 1981, J. Mol. Biol. 153, 273-289). The homology between CCK-2 and MCK-10-2 is diagramed in FIG. 4A and 4B.
  • CCK-2 displays a serine-rich stretch between amino acids 430 and 470 that includes among other possible phosphorylation sites a potential protein kinase C substrate site at position 433 (EKASRR) (SEQ ID NO:39).
  • proline-rich sequences that flank the 37-residue insertion in MCK-10 are distinct from those in the CCK-2 JM domain and, therefore, may play a role in RTK-characteristic function.
  • Similar putative SH3 domain docking sites have previously been found in tyrosine kinases of the non-receptor type such as Fgr. ack, and Fak (FIG. 4C; Naharro et al., 1984, Science, 233: 63-66; Manser et al., 1993, Nature 363: 364-367; Andre & Becker-Andre, 1993, Biochem. Biophys. Res. Comm. 190: 140-147) but are described here for the first time in RTKs.
  • CCK-2 expression in human tumor cell lines was investigated using Northern blot analysis. While varying levels of 4.3 Kb MCK-10 mRNA expression were detected in epithelial type tumor cell lines T-470, MDA-MB-231, CaKi-2, Caco-2 and SNW-C2B, the CCK-2 probe hybridized predominantly to multiple RNAs in SK-Mel-2, Wi-26VA4, and Wi-38VA13, which expressed only low levels of MCK-10 mRNA (FIG. 5D).
  • CCK-2 was predominantly found in all stromal cells, which provide an environment conducive to proliferation, invasion, and even metastasis of epithelial cells, whereas MCK-10 expression was strongly confined to the neoplastic cells themselves (Liotta et al., 1983, Laboratory Investigation 49: 636-649; Iozzo and Cohen, 1993, Experientia 49: 447-455).
  • MCK-10 mRNA was abundant in epithelial tumor cells of a poorly differentiated, grade III, papillary adenocarcinoma of the ovary, whereas CCK-2 gene expression was only detected in stromal cells within the tumor.
  • Hybridization signals of CCK-2 appeared to be more dispersed, in accordance with the fact that cells of the connective tissue, which contain a large amount of extracellular matrix, are more separated in contrast to tumor epithelia, where cells are closely associated. A similar expression pattern was found in a moderately differentiated, grade II, bronchioalveolar adenocarcinoma of the lung (FIG. 23B). Consistent with the hybridization signal distribution in the ovarian carcinoma, MCK-10 mRNA was restricked to epithelial tumor cells, whereas CCK-2 positive hybridization signals were observed only in stromal cells, although at a lower level than in the ovarian carcinoma.
  • NEP the mouse homologue to MCK-10
  • MCK-10 may promote cell adhesion in a hemophilic manner, similar to the Drosophila homologue of Trk, Dtrk (Pulido et al., 1992, EMBO J. 11: 391-404), by binding to the same receptor expressed in adjacent cells or by interacting heterophilically with other molecules involved in cell-cell interaction, such as CCK-2.
  • CCK-2 and MCK-10 suggest that these closely related receptors are involved in interactions between neoplastic epithelial cells and surrounding stroma during tumor progression, and the presence of the discoidin I motif in their extracellular domains indicates that these receptors play an important role in processes involved in cell-cell communications.
  • ATCC American Type Culture Collection

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Optics & Photonics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

A recombinant nucleic acid molecule encoding a receptor tyrosine kinase identified herein as CCK-2, and specific functional fragments thereof are provided. Also, provided is a nucleic acid encoding a chimeric protein comprising all or a specific part of CCK-2, as well as a process of employing the disclosed nucleic acids to produce the proteins encoded thereby.

Description

This is a continuation-in-part of co-pending U.S. application Ser. No. 08/153,397, filed Nov. 16, 1993 which is incorporated by reference herein in its entirety.
TABLE OF CONTENTS
1. INTRODUCTION
2. BACKGROUND
3. SUMMARY OF THE INVENTION
4. BRIEF DESCRIPTION OF THE FIGURES
5. DETAILED DESCRIPTION
5.1. The MCK-10 Coding Sequence
5.2. The CCK-2 Coding Sequence
5.3. Expression of MCK-10 Receptor and Generation of Cell Lines that Express MCK-10
5.3.1. Expression Systems
5.3.2. Identification of Transfectants or Transformants that Express the MCK-10
5.4. Uses of the MCK-10 Receptor and Engineered Cell Lines
5.4.1. Screening of Peptide Library with MCK-10 Protein or Engineered Cell Lines
5.4.2. Antibody Production and Screening
5.5. Uses of MCK-10 Coding Sequence
5.5.1. Use of MCK-10 Coding Sequence in Diagnostics and Therapeutics
5.5.2. Use of Dominant Negative MCK-10 Mutants in Gene Therapy
6. EXAMPLES: CLONING AND CHARACTERIZATION OF MCK-10
6.1. Materials and Methods
6.1.1. cDNA Cloning and Characterization of MCK-10
6.1.2. Full-Length cDNA Cloning
6.1.3 Northern Blot Analysis of MCK-10
6.1.4. Generation of MCK-10 Specific Antibodies
6.1.5. In Situ Hybridization
6.2. Results
6.2.1. Characterization of MCK-10 Clone
6.2.2. Northern Blot Analysis: Expression of MCK-10 in Various Human Tissues and Cell Lines
6.2.3. In Situ Hybridization
6.2.4. Transient Expression of MCK-10 in 293 Cells
7. EXAMPLES: CLONING AND CHARACTERIZATION OF CCK-2
7.1. Materials and Methods
7.1.1. cDNA Cloning and Characterization of CCK-2
7.1.2. Northern Blot Analysis
7.1.3. In Situ Hybridization
7.1.4. Transient Overexpression of CCK-2 in 293 Cells
7.2. Results
7.2.1. Characterization of CCK-2 Clone
7.2.2. Northern Blot Analysis: Expression of CCK-2 in Various Human Tissues and Cell Lines
7.2.3. In Situ Hybridization
7.2.4. Transient Expression of CCK-2 in 293 Cells
8. DEPOSIT OF MICROORGANISMS
1. INTRODUCTION
The present invention relates to the novel family of receptor tyrosine kinases, herein referred to as MCK-10, to nucleotide sequences and expression vectors encoding MCK-10, and to methods of inhibiting MCK-10 activity. The invention relates to differentially spliced isoforms of MCK-10 and to other members of the MCK-10 receptor tyrosine kinase family such as CCK-2. Genetically engineered host cells that express MCK-10 may be used to evaluate and screen drugs involved in MCK-10 activation and regulation. The invention relates to the use of such drugs for modulating the activity of MCK-10. Such drugs may be used in the treatment of proliferative disorders such as cancers and in the treatment of nervous system disorders.
2. BACKGROUND
Receptor tyrosine kinases comprise a large family of transmembrane receptors which are comprised of an extracellular ligand-binding domain and an intracellular tyrosine-kinase domain responsible for mediating receptor activity. The receptor tyrosine kinases are involved in a variety of normal cellular responses which include proliferation, alterations in gene expression, and changes in cell shape.
The binding of ligand to its cognate receptor induces the formation of receptor dimers leading to activation of receptor kinase activity. The activation of kinase activity results in phosphorylation of multiple cellular substrates involved in the cascade of events leading to cellular responses such as cell proliferation.
Genetic alterations in growth factor mediated signalling pathways have been linked to a number of different diseases, including human cancer. For example, the normal homologs of many oncogenes have been found to encode growth factors or growth factor receptors. This is illustrated by the discovery that the B chain of human PDGF is homologous to the transforming protein of simian sarcoma virus (SSV), the EGF (epidermal growth factor) receptor to erb B; the CSF (colony stimulating factor) receptor to fms; and the NGF (nerve growth factor) receptor to T2k. In addition, growth factor receptors are often found amplified and/or overexpressed in cancer cells as exemplified by the observation that the EGF receptor is often found amplified or overexpressed in squamous cell carcinomas and glioblastomas. Similarly, amplification and overexpression of the met gene, encoding the HGF receptor, has been detected in stomach carcinomas.
Recently, a number of cDNAs have been identified that encode receptor tyrosine kinases. One such clone, referred to as DDR (discoidin domain receptor), was isolated from a breast carcinoma cDNA library (Johnson et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 5677-5681) and is homologous to MCK-10. In addition, a mouse homologue of MCK-10 has recently been cloned and characterized (Zerlin, M. et al., 1993, Oncogene, 8: 2731-2739).
The discovery of novel receptor tyrosine kinase receptors, whose expression is associated with proliferative diseases such as cancer, will provide opportunities for development of novel diagnostic reagents. In addition, the identification of aberrantly expressed receptor tyrosine kinases will lead to the development of therapeutic applications designed to inhibit the activity of that receptor, which may be useful for treatment of proliferative diseases such as cancer.
3. SUMMARY OF THE INVENTION
The present invention relates to a novel family of receptor tyrosine kinases, herein referred to as MCK-10 (mammary carcinoma kinase 10), to nucleotide sequences and expression vectors encoding MCK-10, and to methods of inhibiting MCK-10 activity. The invention is based on the isolation of cDNA clones from a human mammary carcinoma cDNA library encoding the MCK-10 receptor tyrosine kinase.
The invention also relates to differentially spliced isoforms of MCK-10 and to other members of the MCK-10 family of receptor tyrosine kinases. More specifically, the invention relates to members of the MCK-10 family of receptors tyrosine kinases that are defined, herein, as those receptors demonstrating 80% homology at the amino acid level in substantial stretches of DNA sequences with MCK-10. In addition, members of the MCK-10 family of tyrosine kinase receptors are defined as those receptors containing an intracellular tyrosine kinase domain and consensus sequences near the extracellular N-terminus of the protein for the discoidin I like family of proteins. The invention as it relates to the members of the MCK-10 family of receptor tyrosine kinases, is based on the isolation and characterization of a cDNA, herein referred to as CCK-2, encoding a member of the MCK-10 family of receptor tyrosine kinases.
Northern Blot analysis indicates that MCK-10 is expressed in a variety of normal tissues including brain tissue. In addition, the MCK-10 family of receptors share homology with the TrK neurotropin tyrosine kinase receptor, indicating that MCK-10 agonists and/or antagonists can be useful for treatment of nervous system disorders.
Additionally, Northern blot analysis and in situ hybridization indicates that MCK-10 and CCK-2 are expressed in a wide variety of cancer cell lines and tumor tissue. Therefore, the present invention relates to inhibitors of MCK-10 or CCK-2 receptor activity which may have therapeutic value in the treatment of proliferative diseases such as cancer.
Modulators of MCK-10 or CCK-2 receptor kinase activity may include antibodies to epitopes of recombinantly expressed MCK-10 or CCK-2 receptor which may regulate the activity of the receptor. In another embodiment of the invention, MCK-10 or CCK-2 anti-sense oligonucleotides may be designed to inhibit synthesis of the encoded proteins through inhibition of translation. In addition, random peptide libraries may be screened using recombinantly produced MCK-10 or CCK-2 protein to identify peptides, synthetic compounds, and natural products that may act as agonists and/or antagonists of the biological activity of the receptors through binding to the ligand binding sites or other functional domains of the MCK-10 or CCK-2 receptor. In a further embodiment of the invention, mutated forms of MCK-10 and CCK-2, having a dominant negative effect, may be expressed in targeted cell populations to regulate the activity of the endogenously expressed receptors.
Furthermore, the MCK-10 or CCK-2 coding sequence may be used for diagnostic purposes for detection of aberrant expression of these genes. For example the MCK-10 or CCK-2 DNA sequence may be used in hybridization assays of biopsied tissue to diagnose abnormalities in gene expression.
4. BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1A, 1B, 1C, 1D, 1E, 1F, and 1G. Human MCK-10-3 nucleotide sequence (SEQ ID NO:1) and deduced amino acid sequence (SEQ ID NO:2). Regions of interest include the signal sequence (amino acids (aa) 1-18); the Discoidin I-like domain (aa 31-185); the putative precursor cleavage site (aa 304-307); the transmembrane region (aa 418-439); the alternatively spliced sequence I (aa 505-541); the alternatively spliced sequence II (aa 666-671); and the peptide antibody recognition sequences: NTα:aa 26-42, NTβ:aa 309-321, CTβ:aa 902-919.
FIG. 2A. MCK-10 splice variants.
FIG. 2B. Alignment of MCK-10, MCK-10-2 and MCK-10-1 (SEQ ID NOS:15-18). The NPXY motif (SEQ ID NO:19) in the insertion region of the MCK-10-1 is underlined with thin and the putative SH3 binding site with solid bars. The TYAXPXXXPG sequence (SEQ ID NO:8) is overlined.
FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G and 3H. Human CCK-2 nucleotide sequence (SEQ ID NO:3), complementary strand (SEQ ID NO:5), and deduced amino acid sequence (SEQ ID NO:4).
FIGS. 4A and 4B. Comparison of deduced CCK-2 and MCK-10-2 amino acid sequences. The discoidin I-like domain is boxed with consensus residues of the discoidin I motif shaded. N-linked glycosylation sites of CCK-2 are indicated with solid triangles, and tyrosine residues that are possible autophosphorylation and substrate attachment sites are marked by open triangles. The RXRR protease cleavage motif (SEQ ID NO:20) is underlined and the putative transmembrane region is overlined with a solid bar. Asterisks indicate the consensus residues of the ATP-binding site. Positions of MCK-10-1 and MCK-10-2 alternative splice insertions are indicated by arrows.
FIG. 4C. Schematic structures of CCK-2 and MCK-10. The percent amino acid identity between CCK-2 and MCK-10 is indicated for the discoidin I domain, part of the extracellular domain (ECD), the juxtamembrane domain (JM), and the tyrosine kinase region (TK). TM: transmembrane region. CT: carboxyl-terminal tail. The arrowhead indicates the location of the predicted protease cleavage site RXRR, which divides the MCK-10 protein into N-terminal α and C-terminal β fragments.
FIG. 4D. Putative SH3 domain binding site in MCK-10-1. Established and predicted SH3 binding sites of various proteins are compared (SEQ ID NO:21-33). X: non-conserved position. *: strong preference for hydrophobic residues. P: invariable position for proline. p: position with preference for proline.
FIG. 5A. Northern blot analysis of MCK-10 mRNA in different human tissues. Three micrograms of poly (A)+ RNA are loaded per lane. The blot is hybridized with a cDNA restriction fragment corresponding to nucleotide 278 to 1983 of MCK-10-2 (FIGS. 1A, 1B and 1C) (excluding the 111 bp insertion). As a control, the blot was rehybridized with a glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe (lower panel).
FIG. 5B. Northern blot analysis of MCK-10 gene in various human breast cancer cell lines. Samples containing three micrograms of poly (A)+ RNA isolated from different human breast cancer cell lines were analyzed. The position of 28S and 18S ribosomal RNAs is indicated, the lower panel shows the rehybridization with a GAPDH cDNA probe.
FIG. 5C. Northern blot analysis of MCK-10 mRNA in different human tissues and cell lines of tumor origin. Size markers are indicating 28S and 18S ribosomal RNAs (upper panel). Rehybridization is performed with a GAPDH cDNA probe (lower panel).
FIG. 5D. Northern blot analysis of CCK-2 and MCK-10 mRNA. Expression of CCK-2 and MCK-10 mRNA in different human carcinoma cell lines is shown. Three micrograms of poly (A)+ RNA were loaded per lane. The blots were hybridized with a cDNA restriction fragment corresponding to the extracellular region of CCK-2 (upper panel) and MCK-10 (middle panel). RNA markers of sizes are indicated in kb. In order to calibrate relative quantities of loaded RNAs, the blots are rehybridized with a GAPDH cDNA probe (lower panel).
FIG. 6A. Tyrosine phosphorylation of overexpressed MCK-10. The coding cDNAs of MCK-10-1 and MCK-10-2 were cloned into an expression vector and transiently overexpressed in the 293 cell line (human embryonic kidney fibroblasts, ATCC CRL 1573). Portions of cell lysate from either MCK-10-1 or -2 transfected cells or control plasmid transfected cells (mock) were separated on a 10% polyacrylamide gel and transferred to nitrocellulose and probed with anti-phosphotyrosine antibodies (αPY). The incubation of cells with 1 mM sodium ortho-vanadate 90 min. prior to lysis is indicated by ±; (left panel). After removal of the αPY antibody the blot was reprobed with an affinity purified polyclonal antiserum raised against the C-terminal octapeptide of MCK-10 (α MCK-10-C); (right panel). Molecular size markers are indicated in kD.
FIG. 6B. Distinct glycosylation of overexpressed MCK-10 splice variants. 293 cells were transfected with MCK-10-1 and -2 as before, metabolically labeled with 35 S!-L-methionine and treated with 10 μg/ml tunicamycin overnight as indicated (+), lysed and immunoprecipitated with antisera generated against the N-terminal and C-terminal peptides of MCK-10 (α MCK-10-N and α MCK-10-C). The autoradiograph of the SDS-PAGE analysis is shown. Molecular size markers are indicated in kD.
FIG. 6C. Transient overexpression of CCK-2 and MCK-10 receptor proteins. The coding MCK-10-2 and CCK-2 cDNA coding regions were cloned into a cytomegalovirus-based expression vector and transiently overexpressed in the human embryonic kidney fibroblast 293 cell line. Cell lysates from either MCK-10-2 or CCK-2-transfected cells or control plasmid-transfected cells were separated on a 7.5% polyacrylamide gel, transferred to nitrocellulose, and probed with antiphosphotyrosine antibody (αPY). Incubation of cells with 1 mM sodium orthovanadate 90 minutes prior to lysis is indicated by ±.
FIG. 6D. Identification of MCK-10 protein isoforms in human carcinoma cell lines. The glycoprotein fraction of equal amounts of cell lysates was bound to concanavalin-A-Sepharose and, after elution, separated by SDS-PAGE. The gel was blotted to nitrocellulose and probed with the polyclonal antibody αMCK-10-N. Lysates of MCK-10-1 and MCK-10-2 overexpressing 293 cells were used as controls. Molecular size markers are indicated in kDa.
FIGS. 7A, 7B, 7C, 7D, 7E, 7F, 7G and 7H. CCK-2 and MCK-10 gene transcripts in sections of human adenocarcinomas. Adjacent sections of papillary adenocarcinoma of the ovary (FIGS. 7A-7D) and bronchioalveolar adenocarcinoma of the lung (FIGS. 7E-7H) were analyzed by in situ hybridization using antisense MCK-10 and CCK-2 probes. Tumor cells are indicated by long arrows (FIGS. 7C, 7D) infiltrating the connective tissue as indicated by short arrows (FIGS. 7A, 7B). As viewed in dark field, CCK-2 hybridization signals are seen specifically in cells of the connective tissue (FIGS. 7A, 7E), whereas MCK-10 expression is restricted to tumor cells (FIGS. 7C, 7G). FIGS. 7B, 7D, 7F, and 7H show bright-field illumination of respective adjacent sections.
5. DETAILED DESCRIPTION
The present invention relates to a novel family of receptor tyrosine kinases referred to herein as MCK-10. The invention relates to differentially spliced isoforms of MCK-10 and to additional members of the MCK-10 family of receptor tyrosine kinases such as the CCK-2 gene described herein. The invention is based, in part, on the isolation of a cDNA clone encoding the MCK-10 receptor tyrosine kinase and the discovery of differentially spliced isoforms of MCK-10. The invention also relates to the isolation of a cDNA encoding on additional member of MCK-10 receptor tyrosine kinase family, herein referred to as CCK-2.
Results from Northern Blot analysis and in situ hybridization indicates that MCK-10 is expressed in epithelial cells. In addition, MCK-10 expression can be detected in a wide variety of cancer cells lines and in all tested tumors. The invention relates to, expression and production of MCK-10 protein, as well as to inhibitors of MCK-10 receptor activity which may have therapeutic value in the treatment of diseases such as cancer.
Northern Blot analysis also indicates that MCK-10 is expressed in brain tissue. In addition, the MCK-10 gene product shares homology with the TrK neurotropin receptor tyrosine kinase. Therefore, the invention relates to modulators of MCK-10 activity that may be used for treatment of neurological disorders.
For clarity of discussion, the invention is described in the subsections below by way of example for the MCK-10 gene depicted in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G and the CCK-2 gene depicted in FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, and 3H However, the principles may be analogously applied to differentially spliced isoforms of MCK-10 and to other members of the MCK-10 family of receptors.
5.1. The MCK-10 Coding Sequence
The nucleotide coding sequence and deduced amino acid sequence of the human MCK-10 gene is depicted in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ. ID NOS: 1-2). In accordance with the invention, any nucleotide sequence which encodes the amino acid sequence of the MCK-10 gene product can be used to generate recombinant molecules which direct the expression of MCK-10. In additional embodiments of the invention, nucleotide sequences which selectively hybridize to the MCK-10 nucleotide sequence shown in FIG. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ ID NO.: 1) may also be used to express gene products with MCK-10 activity. Hereinafter all such variants of the MCK-10 nucleotide sequence will be referred to as the MCK-10 DNA sequence.
In a specific embodiment described herein, the human MCK-10 gene was isolated by performing a polymerase chain reaction (PCR) in combination with two degenerate oligonucleotide primer pools that were designed on the basis of highly conserved sequences within the kinase domain of receptor tyrosine kinases corresponding to the amino acid sequence HRDLAA (SEQ ID NO:6) (sense primer) and SDVWS/FY (SEQ ID NO:7) (antisense primer) (Hanks et al., 1988). As a template cDNA synthesized by reverse transcription of poly-A RNA from the human mammary carcinoma cell line MCF7, was used. A novel RTK, designated MCK-10 (mammary carcinoma kinase 10) was identified that within the tyrosine kinase domain exhibited extensive sequence similarity to the insulin receptor family. The PCR fragment was used to screen a lambda gt11 library of human fetal brain cDNA (Clontech). Several overlapping clones were identified. The composite of these cDNA clones is depicted in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G. Furthermore, screening of a human placental library yielded two cDNA clones, MCK-10-1 and MCK-10-2, which encoded the entire MCK-10 protein but contained a shorter 5' untranslated region starting at position 278 of the MCK-10 sequence (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G). Sequences analysis of the two clones revealed complete identity with the exception of 111 additional nucleotides within the juxtamembrane domain, between nucleotides 1832 and 1943. One of the clones isolated from the human fetal brain library contained an additional 18 nucleotides in the tyrosine kinase domain. These sequences were in-frame with the MCK-10 open reading frame and did not contain any stop codons. The MCK-10 splice isoforms have been designated MCK-10-1 (with the additional 111 bp), MCK-10-2 (without any insertions), MCK-10-3 (with the additional 111 bp and 18 bp), and MCK-10-4 (with the additional 18 bp) (FIG. 2).
As shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G and FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G and 3H, MCK-10 have all of the characteristics of a receptor PTK: the initiation codon is followed by a stretch of essentially hydrophobic amino acids, which may serve as a signal peptide. Amino acids 418-439 are also hydrophobic in nature, with the characteristics of a transmembrane region. The extracellular domain encompasses 4 consensus N-glycosylation sites (AsnXSer/Thr) and 7 cysteine residues. The extracellular region is shorter than that of the insulin receptor family and shows no homology to other receptor tyrosine kinases, but contains near the N-terminus an approximately 150 amino acid long region with remarkable homology to discoidin I, a lectin of the slime mold Dictyostelium discoideum (Poole et al. 1981, J. Mol. Biol. 153: 273-289; Alexander et al., 1992, Differentiation 51: 149-161). A role for this motif in cell-cell interaction is suggested by its previous identification in coagulation factors V and VIII, which mediate aggregation of platelets by binding to anionic lipids on the cell surface (Gilbert et al., 1991 J. Biol. Chem. 266: 17261-17268). Consistent with a role in cell-cell interaction, another factor sharing this motif, the Xenopus A5 protein, is involved in cell recognition during development of the amphibian nervous system (Takagi et al., 1991 Neuron 7: 295-307).
In addition, MCK-10 contains the consensus sequence RXRR (SEQ ID NO:20) at position 304-307, which represents a possible cleavage signal for the endopeptidase furin suggesting that MCK-10 is synthesized as a precursor polypeptide. The unglycosylated primary translation products of MCK-10-1 and MCK-10-2 proreceptors, with predicted molecular weights of 101.13 and 97.17 kD, respectively, can thus be subdivided into a 34.31 kD α subunit and 66.84 or 62.88 kD β-subunits that contain the tyrosine kinase homology and alternative splice sites.
The consensus sequence for an ATP-binding motif is located at positions 617-627 (FIGS. 1A, 1B and 1C). When compared with other kinases, the ATP binding domain is 176 amino acids (including the additional 37 amino acids) further from the transmembrane domain than any other tyrosine kinase. The additional 37 amino acids are located in the long and proline/glycine-rich juxtamembrane region (JM) and contain an NPAY sequence (where A can be exchanged for any amino acid), which is found in cytoplasmic domains of several cell surface proteins, including RTKs of the EGF and insulin receptor families (Chen et al. 1990, J. Biol: Chem., 265: 3116-3123). This consensus motif is followed by the sequence TYAXPXXXPG, (SEQ ID NO:8) which is repeated downstream in MCK-10 in the juxtamembrane domain at positions 585-595. Recently it has been shown that this motif is deleted in the cytoplasmic juxtamembrane region of the activin receptor, serine/threonine kinase, resulting in reduced ligand binding affinity (Attisano et al. 1992, Cell, 68: 97-108).
In comparison with other RTKs, the catalytic domain shows the highest homology to the TrkA receptor. The YY-motifs (position 802/803) and the tyrosine at position 798, representing putative autophosphorylation sites, characterize MCK-10 as a member of the insulin receptor family (FIGS. 1A, 1B and 1C). MCK-10 shares homology with the Trk neurotrophin receptor subfamily of receptor tyrosine kinase with their characteristic short carboxyl-terminal tail of 9 amino acids.
Several tyrosine residues in the kinase and JM domains of MCK-10-2 are flanked by consensus sequences that suggest a role as autophosphorylation and substrate attachment sites. The sequences flanking Tyr-844 in MCK-10 (YELM) (SEQ ID NO:34) in the COOH-terminal region of the kinase core domain contain the YXXM (SEQ ID NO:35) binding motif for association of the p85 subunit of phosphatidylinositol 3'-kinase (P13-kinase). Another potential substrate binding site is found 12 amino acids upstream at position Tyr 832 in MCK-10-2 (YLSR) (SEQ ID NO:36). Moreover, analogous to TrK, Tyr-506 (YSGD) (SEQ ID NO:37) in the JM region of MCK-10-2 could serve as a receptor binding site for SHC, an oncogenic SH2 domain-containing molecule (Obermeier et al. 1993, J. Biol. Chem. 268: 22963-22966), and sequences flanking Tyr 510 (YMEP) (SEQ ID NO:38) in MCK-10 qualify as the binding site for the GTPase-activating protein (GAP) because of similarity to the GAP binding site in the platelet-derived growth factor receptor (PDGF-R).
To characterize the receptor proteins encoded by MCK-10 cDNAs, the human embryonic kidney cell line 293 was transfected for transient overexpression. Subconfluent cell monolayers were transfected with equal amounts of respective cDNAs which had been cloned into a cytomegalovirus early promoter-based mammalian expression vector (pCMV) and incubated either in the presence of absence of 1 mM orthovanadate for 90 minutes prior to lysis. FIG. 6A shows an antiphosphotyrosine immunoblot of crude cell lysates separated by polyacrylamide gel electrophoresis (SDS-PAGE). In comparison with pCMV vector-transfected controls, two prominent tyrosine-phosphorylated bands were detected in pCMV/MCK-10-2-transfected cells. While based on molecular weight estimates and immunoblot analysis with αMCK-10-C, an antibody directed against a C-terminal peptide (FIG. 6A), the 124 kDa band represented the glycosylated MCK-10 receptor polypeptide, while the 63 kDa band, which was strongly tyrosine-phosphorylated in the MCK-10-2 and to a lesser extent in MCK-10-1-expressing cells, appeared to be a processing product of MCK-10 that included the C-terminal peptide epitope (FIG. 6A). The apparent molecular weight of 63,000 was in agreement with the location of a consensus site for putative proteolytic cleavage by furin in the extracellular region, which indicated that this band represented the β fragment of MCK-10 (FIGS. 6A, 6C and 4B). Detection of a MCK-10-N antibody reactive 54 kD protein, presumably representing the glycosylated extracellular α fragment in conditioned media of transfected NIH 3T3 overexpressing MCK 10-2 and T47D mammary carcinoma cells, supports this interpretation.
Comparison of transiently-expressed MCK-10-2 and MCK-10-1 by immunoblot analysis with the αMCK-10-C antibody revealed approximately equal amounts of a protein doublet for both isoforms (FIG. 6A, right panel) of which only the upper band appeared to be phosphorylated upon stimulation with orthovanadate. The lower band likely represented an intracellular, incompletely glycosylated form of the primary translation product. The antiphosphotyrosine immunoblot further revealed that the 63 kDa putative β subunit was less efficiently phosphorylated than that of MCK-10-2 (FIG. 6A, left panel), although comparable amounts of protein were present. Moreover, this cleavage product of MCK-10-2 appeared to be phosphorylated to a higher extent than the 124 kDa precursor, as judged by comparing antiphosphotyrosine and anti-MCK-10-C immunoblots (FIG. 6A). An additional phosphorylated protein of unknown identity with an apparent molecular weight of 165 kDa was readily detected in lysates of MCK-10-1-transfected 293 cells, whereas it was not detected in cells transfected with the shorter isoform.
In order to examine the extent of MCK-10-2 and MCK-10-1 receptor glycosylation, pCMV expression constructs of both isoforms were transfected into 293 cells and, after metabolic labeling with 35 S!-L-methionine and treatment with tunicamycin, immunoprecipitates obtained with affinity-purified antibodies against either the N- or C-terminus of MCK-10 were analyzed by gel electrophoresis and autoradiography. From tunicamycin-treated cells, both antibodies precipitated 102 kDa MCK-10-2 and 106 kDa MCK-10-1 bands, presumably representing unglycosylated receptor isoforms and processing intermediates from untreated cells (FIG. 6B). Only the antibody directed against the MCK-10 C-terminus efficiently precipitated the fully processed isoforms. Surprisingly, comparison of mature forms and glycosylation intermediates with the major bands from tunicamycin-treated cells indicated that the absence of the 37 amino acid insertion in the MCK-10-1 cytoplasmic domain correlated with more extensive glycosylation of the extracellular portion of the receptor.
To evaluate the expression of MCK-10 in tumor cell lines, the αMCK-10-N antibody was used for Western blot analysis. As shown in FIG. 6D membrane preparations of T-47D breast carcinoma cells, A431 epidermoid carcinoma cells, SW48 and SNU-C2B colon carcinoma cells, and Caki-2 kidney carcinoma cells contained multiple bands that were recognized by the antibody, including proteins with the same apparent molecular weights as those identified in MCK-10-2 and MCK-10-1 overexpressing 293 cells. The melanoma cell line Hs 294T and the breast carcinoma cell lines HBL-100 and MDA-MB-175, however, displayed unique antigen patterns. Interestingly, Hs 294T cells contained a large MCK-10 form of approximately 165 kDa in addition to a shorter band of 72 kDa.
To determine whether the additional 111 nucleotides present in MCK-10-1 and -3 were ubiquitously expressed or expressed only in specific human tissues, a PCR analysis on different human cDNAs using oligonucleotide primers corresponding to sequences flanking the insertion site was carried out. Parallel PCR amplifications were performed on plasmid DNAs of MCK-10-1/MCK-10-2 as controls. Expression of both isoforms were identified in brain, pancreas, placenta, colon, and kidney, and in the cell lines Caki-2 (kidney ca), SW48 (colon ca), and HBL-100 and T-47D (breast ca). The PCR products were subcloned into the Bluescript vector to confirm the nucleotide sequence.
Using a hybridization probe comprising the 5' 1694 bp cDNA fragment of MCK-10 (excluding the 111 bp insert), which encompasses the extracellular, transmembrane, and juxtamembrane domains, the MCK-10 gene revealed the existence of multiple transcript sizes with a major form of 4.3 kb. The highest expression of MCK-10 mRNA was detected in lung, intermediate levels were found in kidney, colon, stomach, placenta and brain, low levels in pancreas, and no MCK-10 mRNA was detected in liver (FIG. 5A). FIG. 5B illustrates the levels of expression of MCK-10 in a variety of breast cancer cell lines and FIG. 5C presents the levels of MCK-10 expression in different tumor cell lines. A summary of the expression patterns of MCK-10 in different cell lines is presented in TABLE 1.
              TABLE 1                                                     
______________________________________                                    
MCK-10 EXPRESSION IN DIFFERENT CELL LINES                                 
______________________________________                                    
BREAST CANCER CELL LINES                                                  
BT-474                      +                                             
T-47D                       ++++                                          
BT-20                       +++                                           
MDA-MB-453                  ++                                            
MDA-MB-468                  ++                                            
MDA-MB-435                  ++                                            
MDA-MB-175                  ++++                                          
MDA-MB-231                  ++                                            
HBL 100                     +                                             
SK-BR-3                     +                                             
MCF-7                       ++                                            
EMBRYONIC LUNG CANCER,CELL LINES, SV40                                    
TRANSFORMED                                                               
WI-38 A13                   +                                             
WI-26 A4                    +                                             
MELANOMA CELL LINES                                                       
SK-Mel-3                    +                                             
Wm 266-4                    +                                             
HS 294T                     ++                                            
COLON CANCER CELL LINES                                                   
Caco-2                      +++                                           
SNU-C2B                     +++                                           
SW48                        ++                                            
KIDNEY CANCER CELL LINE     +++                                           
CAKI-2                                                                    
EPIDERMOID CANCER CELL LINE ++                                            
A431                                                                      
OTHER CANCERS                                                             
rhabdomyosarcoma            ++                                            
Ewing sarcoma               ++                                            
glioblastoma                ++                                            
neuroblastoma               -                                             
hepatoblastoma              +                                             
HEMAPOIETIC CELL LINES                                                    
EB3                         -                                             
CEM                         -                                             
MOLT4                       -                                             
DAUDI                       -                                             
RAJI                        -                                             
MEG01                       -                                             
KG1                         -                                             
K562                        -                                             
______________________________________                                    
In situ hybridization analysis with the 5' 1865 bp of MCK-10-2 indicated that MCK-10 was expressed specifically in epithelial cells of various tissues including:
cuboidal epithelial cells lining the distal kidney tubulus
columnar epithelial cells lining the large bowel tract
deep layer of epithelial cells lining the stomach
epithelial cells lining the mammary ducts
islet cells of the pancreas
epithelial cells of the thyroid gland, which produces thyroid hormones
No detectable MCK-10 expression was observed in connective tissues, endothelial cells, adipocytes, muscle cells, or hemopoietic cells.
MCK-10 expression was also detected in all tumors investigated which included:
adenocarcinoma of the colon
adenocarcinoma of the stomach
adenocarcinoma of the lung
infiltrating ductal carcinoma of the breast
cystadenoma of the ovary
multi endocrine tumor of the pancreas
carcinoid tumor of the pancreas
tubular cells of renal cell carcinoma
transitional cell carcinoma (a malignant epithelial tumor of the bladder)
meningiothelial tumor
medulloblastoma with hyperchromatic atypical nuclei and spare cytoplasm (MCK-10 expression is only seen in cells with well developed cytoplasm)
glioblastoma (a tumor of the neuroepithelial tissue)
The in situ hybridization experiments revealed the highest expression of MCK-10 in malignant cells of the ductal breast carcinoma, in the tumor cells of a multi-endocrine tumor, and in the tumor cells of a transitional cell carcinoma of the bladder.
5.2 The CCK-2 Coding Sequence
The present invention also relates to other members of the MCK-10 family of receptor kinases. Members of the MCK-10 family are defined herein as those proteins coded for by DNA sequences capable of hybridizing to MCK-10 DNA sequences as presented in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G under highly or less highly stringent hybridization conditions. Highly stringent hybridization conditions may be defined as hybridization to filter-bound DNA in 0.5M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. (Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wilsy & Sons, Inc., New York, at p. 2.10.3). Less highly stringent conditions, such as moderately stringent conditions, may be defined as hybridizations carried out as described above, followed by washing in 0.2×SSC/0.1% SDS at 42° C. (Ausubel et al., 1989, supra). In instances wherein the nucleic acid molecules are deoxyoligonucleotides ("oligos"), highly stringent conditions may refer, i.e., to washing in 6×SSC/0.5% sodium pyrophosphate at 37° C. (for 14-base oligos), 48° C. (for 17-base oligos) 55° C. (for 20-base oligos), and 60° C. (for 23-base oligos). Such receptors may demonstrate 80% homology at the amino acid level in substantial stretches of DNA sequences. In addition, such receptors can be defined as those receptors containing an intracellular tyrosine kinase domain and a discoidin I sequence located near the amino-terminal end of the protein. The discoidin I domain is defined as that region of MCK-10 located between amino acid 31-185 as presented in FIG. 4A.
In a specific embodiment of the invention described herein, an additional member of the MCK-10 family of receptor tyrosine kinases was cloned and characterized. The nucleotide coding sequence and deduced amino acid sequence of the novel receptor tyrosine kinase, herein referred to as CCK-2, is presented in FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G and 3H (SEQ ID NOS:3-4). In accordance with the invention, any nucleotide sequence which encodes the amino acid sequence of the CCK-2 gene product can be used to generate recombinant molecules which direct the expression of CCK-2. In additional embodiments of the invention, nucleotide sequences which selectively hybridize to the CCK-2 nucleotide sequence as shown in FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H (SEQ. ID NO.: 3) may also be used to express gene products with CCK-2 activity.
Analysis of the CCK-2 sequence revealed significant homology to the extracellular, transmembrane and intracellular region of the MCK-10 receptor indicating that it was a member of the MCK-10 family of receptors. The shared homology between CCK-2 and MCK-10 is depicted in FIG. 4A and 4B.
Northern Blot hybridization analysis, indicated that MCK-10 mRNA was highly expressed in cell lines of tumor epithelial origin (FIG. 5D). In contrast, CCK-2 mRNA was found to be expressed in fibroblast-like cell types (FIG. 5D). Comparative in situ hybridization studies revealed an even more defined expression pattern in tissue slices. MCK-10 expression was restricted to subsets of epithelial cells, where no CCK-2 hybridization signal was detected, which was particularly evident in the pancreas, where only endocrine cells types of the islets of Langerhans but not exocrine acini exhibited MCK-10 expression (FIG. 7).
The distinct tissue specificity of MCK-10 and CCK-2 expression was confirmed and even more clearly demonstrated in various sections of primary human carcinomas. Both receptors were expressed in an apparently mutually exclusive manner in different cell types of the same tumor. CCK-2 was predominantly found in all stromal cells, which provide an environment conducive to proliferation, invasion, and even metastasis of epithelial cells, whereas MCK-10 expression was strongly confined to the neoplastic cells themselves. The distinct expression patterns for MCK-10 and CCK-2 suggest that these closely related receptors are involved in interactions between neoplastic epithelial cells and surrounding stroma during tumor progression, and the presence of the discoidin I motif in their extracellular domains strongly indicates an important role for these receptors in processes involved in cell-cell communications.
5.3. Expression of MCK-10 Receptor and Generation of Cell Lines that Express MCK-10
For clarity of discussion the expression of receptors and generation of cell lines expressing receptors are described by way of example for the MCK-10 gene. However, the principles may be analogously applied to expression and generation of cell lines expressing spliced isoforms of MCK-10 or to other members of the MCK-10 family of receptors, such as CCK-2.
In accordance with the invention, MCK-10 nucleotide sequences which encode MCK-10, peptide fragments of MCK-10, MCK-10 fusion proteins or functional equivalents thereof may be used to generate recombinant DNA molecules that direct the expression of MCK-10 protein or a functionally equivalent thereof, in appropriate host cells. Alternatively, nucleotide sequences which hybridize to portions of the MCK-10 sequence may also be used in nucleic acid hybridization assays, Southern and Northern blot analyses, etc.
Due to the inherent degeneracy of the genetic code, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence, may be used in the practice of the invention for the cloning and expression of the MCK-10 protein. Such DNA sequences include those which are capable of hybridizing to the human MCK-10 sequence under stringent conditions.
Altered DNA sequences which may be used in accordance with the invention include deletions, additions or substitutions of different nucleotide residues resulting in a sequence that encodes the same or a functionally equivalent gene product. These alterations would in all likelihood be in regions of MCK-10 that do not constitute functionally conserved regions such as the discodin I domain or the tyrosine kinase domain. In contrast, alterations, such as deletions, additions or substitutions of nucleotide residues in functionally conserved MCK-10 regions would possibly result in a nonfunctional MCK-10 receptor. The gene product itself may contain deletions, additions or substitutions of amino acid residues within the MCK-10 sequence, which result in a silent change thus producing a functionally equivalent MCK-10. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipatic nature of the residues involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine; phenylalanine, tyrosine.
The DNA sequences of the invention may be engineered in order to alter the MCK-10 coding sequence for a variety of ends including but not limited to alterations which modify processing and expression of the gene product. For example, mutations may be introduced using techniques which are well known in the art, e.g. site-directed mutagenesis, to insert new restriction sites, to alter glycosylation patterns, phosphorylation, etc. For example, in certain expression systems such as yeast, host cells may over glycosylate the gene product. When using such expression systems it may be preferable to alter the MCK-10 coding sequence to eliminate any N-linked glycosylation site.
In another embodiment of the invention, the MCK-10 or a modified MCK-10 sequence may be ligated to a heterologous sequence to encode a fusion protein. For example, for screening of peptide libraries it may be useful to encode a chimetic MCK-10 protein expressing a heterologous epitope that is recognized by a commercially available antibody. A fusion protein may also be engineered to contain a cleavage site located between the MCK-10 sequence and the heterologous protein sequence, so that the MCK-10 may be cleaved away from the heterologous moiety.
In an alternate embodiment of the invention, the coding sequence of MCK-10 could be synthesized in whole or in part, using chemical methods well known in the art. See, for example, Caruthers, et al., 1980, Nuc. Acids Res. Symp. Ser. 7: 215-233; Crea and Horn, 180, Nuc. Acids Res. 9 (10): 2331; Matteucci and Caruthers, 1980, Tetrahedron Letters 21: 719; and Chow and Kempe, 1981, Nuc. Acids Res. 9(12): 2807-2817. Alternatively, the protein itself could be produced using chemical methods to synthesize the MCK-10 amino acid sequence in whole or in part. For example, peptides can be synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography. (E.g., see Creighton, 1983, Proteins Structures And Molecular Principles, W. H. Freeman and Co., N.Y. pp. 50-60). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, 1983, Proteins, Structures and Molecular Principles, W. H. Freeman and Co., N.Y., pp. 34-49.
In order to express a biologically active MCK-10, the nucleotide sequence coding for MCK-10, or a functional equivalent, is inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. The MCK-10 gene products as well as host cells or cell lines transfected or transformed with recombinant MCK-10 expression vectors can be used for a variety of purposes. These include but are not limited to generating antibodies (i.e., monoclonal or polyclonal) that bind to the receptor, including those that competitively inhibit binding of MCK-10 ligand and "neutralize" activity of MCK-10 and the screening and selection of drugs that act via the MCK-10 receptor; etc.
5.3.1. Expression Systems
Methods which are well known to those skilled in the art can be used to construct expression vectors containing the MCK-10 coding sequence and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.
A variety of host-expression vector systems may be utilized to express the MCK-10 coding sequence. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the MCK-10 coding sequence; yeast transformed with recombinant yeast expression vectors containing the MCK-10 coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the MCK-10 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the MCK-10 coding sequence; or animal cell systems. The expression elements of these systems vary in their strength and specificities. Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used in the expression vector. For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage λ, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedrin promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g., heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter) may be used; when generating cell lines that contain multiple copies of the MCK-10 DNA, SV40-, BPV- and EBV-based vectors may be used with an appropriate selectable marker.
In bacterial systems a number of expression vectors may be advantageously selected depending upon the use intended for the MCK-10 expressed. For example, when large quantities of MCK-10 are to be produced for the generation of antibodies or to screen peptide libraries, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include but are not limited to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), in which the MCK-10 coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid AS-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res. 13: 3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264: 5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.
In yeast, a number of vectors containing constitutive or inducible promoters may be used. For a review see, Current Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al., Cold Spring Harbor Press, Vols. I and II.
In cases where plant expression vectors are used, the expression of the MCK-10 coding sequence may be driven by any of a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310: 511-514), or the coat protein promoter of TMV (Takamatsu et al., 1987, EMBO J. 6: 307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J. 3: 1671-1680; Broglie et al., 1984, Science 224: 838-843); or heat shock promoters, e.g., soybean hsp17.5-E or hsp17.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6: 559-565) may be used. These constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electropotation, etc. For reviews of such techniques see, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.
An alternative expression system which could be used to express MCK-10 is an insect system. In one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The MCK-10 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the MCK-10 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (e.g., see Smith et al., 1983, J. Viol. 46: 584; Smith, U.S. Pat. No. 4,215,051).
In mammalian host cells, a number of viral based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the MCK-10 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing MCK-10 in infected hosts. (e.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. (USA) 81: 3655-3659). Alternatively, the vaccinia 7.5K promoter may be used. (See, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA) 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. 79: 4927-4931).
Specific initiation signals may also be required for efficient translation of inserted MCK-10 coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire MCK-10 gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the MCK-10 coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the MCK-10 coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol. 153: 516-544).
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. The presence of four consensus N-glycosylation sites in the MCK-10 extracellular domain support that proper modification may be important for MCK-10 function. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38, etc.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the MCK-10 may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with the MCK-10 DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the MCK-10 on the cell surface. Such engineered cell lines are particularly useful in screening for drugs that affect MCK-10.
A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22: 817) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981), Proc. Natl. Acad. Sci. USA 78: 2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147) genes. Recently, additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85: 8047); and ODC (ornithine decarboxylase) which confers resistance to the ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine, DFMO (McConlogue L., 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).
5.3.2. Identification of Transfectants or Transformants that Express the MCK-10
The host cells which contain the coding sequence and which express the biologically active gene product may be identified by at least four general approaches; (a) DNA-DNA or DNA-RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of MCK-10 mRNA transcripts in the host cell; and (d) detection of the gene product as measured by immunoassay or by its biological activity.
In the first approach, the presence of the MCK-10 coding sequence inserted in the expression vector can be detected by DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide sequences that are homologous to the MCK-10 coding sequence, respectively, or portions or derivatives thereof.
In the second approach, the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.). For example, if the MCK-10 coding sequence is inserted within a marker gene sequence of the vector, recombinants containing the MCK-10 coding sequence can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with the MCK-10 sequence under the control of the same or different promoter used to control the expression of the MCK-10 coding sequence. Expression of the marker in response to induction or selection indicates expression of the MCK-10 coding sequence.
In the third approach, transcriptional activity for the MCK-10 coding region can be assessed by hybridization assays. For example, RNA can be isolated and analyzed by Northern blot using a probe homologous to the MCK-10 coding sequence or particular portions thereof. Alternatively, total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
In the fourth approach, the expression of the MCK-10 protein product can be assessed immunologically, for example by Western blots, immunoassays such as radioimmuno-precipitation, enzyme-linked immunoassays and the like.
5.4. Uses of the MCK-10 Receptor and Engineered Cell Lines
MCK-10 is expressed in a variety of normal tissues, including brain tissue. The MCK-10 receptor tyrosine kinase shares homology with the TrK neurotropin receptor, indicating that modulators of MCK-10 may be used to treat a variety of neurological disorders characterized by one or more of the following symptoms: astasia, aphasia, paralysis, paresa and paralegies. Such nervous system disorders include, but are not limited to, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease (ALS), trauma, damaged or severed nerve injuries, Huntington's chorea, multiple sclerosis, muscular dystrophy syringomiplia, Tabes Dorsalis and cardiovascular accidents.
Northern blot analysis and in situ hybridization also indicates that MCK-10 and CCK-2 are expressed in a wide variety of cancer cells and tumor tissue. Thus, the present invention relates to inhibitors of MCK-10 and CCK-2 receptor activity which may have therapeutic value in the treatment of proliferative diseases such as cancer.
For clarity of discussion the uses of the expressed receptors and engineered cell lines expressing the receptors is described by way of example for MCK-10. The described uses may be equally applied to expression of MCK-10 spliced isoforms or additional members of the MCK-10 gene family such as CCK-2.
In an embodiment of the invention the MCK-10 receptor and/or cell lines that express the MCK-10 receptor may be used to screen for antibodies, peptides, or other ligands that act as agonists or antagonists of the MCK-10 receptor. For example, anti-MCK-10 antibodies may be used to inhibit MCK-10 function. Alternatively, screening of peptide libraries with recombinantly expressed soluble MCK-10 protein or cell lines expressing MCK-10 protein may be useful for identification of therapeutic molecules that function by modulating the biological activity of MCK-10. The uses of the MCK-10 receptor and engineered cell lines, described in the subsections below, may be employed equally well for MCK-10 family of receptor tyrosine kinases.
In an embodiment of the invention, engineered cell lines which express the entire MCK-10 coding region or its ligand binding domain may be utilized to screen and identify ligand antagonists as well as agonists. Synthetic compounds, natural products, and other sources of potentially biologically active materials can be screened in a number of ways.
5.4.1. Screening of Peptide Library with MCK-10 Protein or Engineered Cell Lines
Random peptide libraries consisting of all possible combinations of amino acids attached to a solid phase support may be used to identify peptides that are able to bind to the ligand binding site of a given receptor or other functional domains of a receptor such as kinase domains (Lam, K. S. et al., 1991, Nature 354: 82-84). The screening of peptide libraries may have therapeutic value in the discovery of pharmaceutical agents that act to inhibit the biological activity of receptors through their interactions with the given receptor.
Identification of molecules that are able to bind to the MCK-10 may be accomplished by screening a peptide library with recombinant soluble MCK-10 protein. Methods for expression and purification of MCK-10 are described in Section 5.2.1 and may be used to express recombinant full length MCK-10 or fragments of MCK-10 depending on the functional domains of interest. For example, the kinase and extracellular ligand binding domains of MCK-10 may be separately expressed and used to screen peptide libraries.
To identify and isolate the peptide/solid phase support that interacts and forms a complex with MCK-10, it is necessary to label or "tag" the MCK-10 molecule. The MCK-10 protein may be conjugated to enzymes such as alkaline phosphatase or horseradish peroxidase or to other reagents such as fluorescent labels which may include fluorescein isothyiocynate (FITC), phycoerythrin (PE) or rhodamine. Conjugation of any given label, to MCK-10, may be performed using techniques that are routine in the art. Alternatively, MCK-10 expression vectors may be engineered to express a chimeric MCK-10 protein containing an epitope for which a commercially available antibody exist. The epitope specific antibody may be tagged using methods well known in the art including labeling with enzymes, fluorescent dyes or colored or magnetic beads.
The "tagged" MCK-10 conjugate is incubated with the random peptide library for 30 minutes to one hour at 22° C. to allow complex formation between MCK-10 and peptide species within the library. The library is then washed to remove any unbound MCK-10 protein. If MCK-10 has been conjugated to alkaline phosphatase or horseradish peroxidase the whole library is poured into a petri dish containing substrates for either alkaline phosphatase or peroxidase, for example, 5-bromo-4-chloro-3-indoyl phosphate (BCIP) or 3,3',4,4"-diamnobenzidine (DAB), respectively. After incubating for several minutes, the peptide/solid phase-MCK-10 complex changes color, and can be easily identified and isolated physically under a dissecting microscope with a micromanipulator. If a fluorescent tagged MCK-10 molecule has been used, complexes may be isolated by fluorescent activated sorting. If a chimeric MCK-10 protein expressing a heterologous epitope has been used, detection of the peptide/MCK-10 complex may be accomplished by using a labeled epitope specific antibody. Once isolated, the identity of the peptide attached to the solid phase support may be determined by peptide sequencing.
In addition to using soluble MCK-10 molecules, in another embodiment, it is possible to detect peptides that bind to cell surface receptors using intact cells. The use of intact cells is preferred for use with receptors that are multi-subunits or labile or with receptors that require the lipid domain of the cell membrane to be functional. Methods for generating cell lines expressing MCK-10 are described in Sections 5.2.1. and 5.2.2. The cells used in this technique may be either live or fixed cells. The cells will be incubated with the random peptide library and will bind to certain peptides in the library to form a "rosette" between the target cells and the relevant solid phase support/peptide. The rosette can thereafter be isolated by differential centrifugation or removed physically under a dissecting microscope.
As an alternative to whole cell assays for membrane bound receptors or receptors that require the lipid domain of the cell membrane to be functional, the receptor molecules can be reconstituted into liposomes where label or "tag" can be attached.
5.4.2. Antibody Production and Screening
Various procedures known in the art may be used for the production of antibodies to epitopes of the recombinantly produced MCK-10 receptor. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library. Neutralizing antibodies i.e., those which compete for the ligand binding site of the receptor are especially preferred for diagnostics and therapeutics.
Monoclonal antibodies that bind MCK-10 may be radioactively labeled allowing one to follow their location and distribution in the body after injection. Radioactivity tagged antibodies may be used as a non-invasive diagnostic tool for imaging de novo cells of tumors and metastases.
Immunotoxins may also be designed which target cytotoxic agents to specific sites in the body. For example, high affinity MCK-10 specific monoclonal antibodies may be covalently complexed to bacterial or plant toxins, such as diphtheria toxin, abrin or ricin. A general method of preparation of antibody/hybrid molecules may involve use of thiol-crosslinking reagents such as SPDP, which attack the primary amino groups on the antibody and by disulfide exchange, attach the toxin to the antibody. The hybrid antibodies may be used to specifically eliminate MCK-10 expressing tumor cells.
For the production of antibodies, various host animals may be immunized by injection with the MCK-10 protein including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.
Monoclonal antibodies to MCK-10 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256: 495-497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4: 72; Cote et al., 1983, Proc. Natl. Acad. Sci., 80: 2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81: 6851-6855; Neuberger et al., 1984, Nature, 312: 604-608; Takeda et al., 1985, Nature, 314: 452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. Alternatively, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce MCK-10-specific single chain antibodies.
Antibody fragments which contain specific binding sites of MCK-10 may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science, 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to MCK-10.
5.5. Uses of MCK-10 Coding Sequence
The MCK-10 coding sequence may be used for diagnostic purposes for detection of MCK-10 expression. Included in the scope of the invention are oligoribonucleotide sequences, that include antisense RNA and DNA molecules and ribozymes that function to inhibit translation of MCK-10. In addition, mutated forms of MCK-10, having a dominant negative effect, may be expressed in targeted cell populations to inhibit the activity of endogenously expressed MCK-10. The uses described below may be equally well adapted for MCK-10 spliced isoform coding sequences and sequences encoding additional members of the MCK-10 family of receptors, such as CCK-2.
5.5.1. Use of MCK-10 Coding Sequence in Diagnostics and Therapeutics
The MCK-10 DNA may have a number of uses for the diagnosis of diseases resulting from aberrant expression of MCK-10. For example, the MCK-10 DNA sequence may be used in hybridization assays of biopsies or autopsies to diagnose abnormalities of MCK-10 expression; e.g., Southern or Northern analysis, including in situ hybridization assays.
Also within the scope of the invention are oligoribonucleotide sequences, that include anti-sense RNA and DNA molecules and ribozymes that function to inhibit the translation of MCK-10 mRNA. Anti-sense RNA and DNA molecules act to directly block the translation of mRNA by binding to targeted mRNA and preventing protein translation. In regard to antisense DNA, oligodeoxyribonucleotides derived from the translation initiation site, e.g., between -10 and +10 regions of the MCK-10 nucleotide sequence, are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. Within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of MCK-10 RNA sequences.
Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
Both anti-sense RNA and DNA molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
Various modifications to the DNA molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribo- or deoxy- nucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
5.5.2. Use of Dominant Negative MCK-10 Mutants in Gene Therapy
Receptor dimerization induced by ligands, is thought to provide an allosteric regulatory signal that functions to couple ligand binding to stimulation of kinase activity. Defective receptors can function as dominant negative mutations by suppressing the activation and response of normal receptors by formation of unproductive heterodimers. Therefore, defective receptors can be engineered into recombinant viral vectors and used in gene therapy in individuals that inappropriately express MCK-10.
In an embodiment of the invention, mutant forms of the MCK-10 molecule having a dominant negative effect may be identified by expression in selected cells. Deletion or missense mutants of MCK-10 that retain the ability to form dimers with wild type MCK-10 protein but cannot function in signal transduction may be used to inhibit the biological activity of the endogenous wild type MCK-10. For example, the cytoplasmic kinase domain of MCK-10 may be deleted resulting in a truncated MCK-10 molecule that is still able to undergo dimerization with endogenous wild type receptors but unable to transduce a signal.
Recombinant viruses may be engineered to express dominant negative forms of MCK-10 which may be used to inhibit the activity of the wild type endogenous MCK-10. These viruses may be used therapeutically for treatment of diseases resulting from aberrant expression or activity of MCK-10, such as cancers.
Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of recombinant MCK-10 into the targeted cell population. Methods which are well known to those skilled in the art can be used to construct those recombinant viral vectors containing MCK-10 coding sequence. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y. Alternatively, recombinant MCK-10 molecules can be reconstituted into liposomes for delivery to target cells.
6. EXAMPLES: CLONING AND CHARACTERIZATION OF MCK-10
The subsection below describes the isolation and characterization of a cDNA clones encoding the novel receptor tyrosine kinase designated MCK-10 and differentially spliced isoforms of MCK-10.
6.1. Materials and Methods 6.1.1. cDNA Cloning and Characterization of MCK-10
Confluent plates of the human breast cancer cell line MCF7 (American Type Culture Collection HTB22) were lysed by treatment with guanidinium-thiocyanate according to Chirgwin et al. (1979, Biochemistry 18: 5294-5299). Total RNA was isolated by CsCl-gradient centrifugation. First-strand cDNA was synthesized from 20 μg total RNA with avian myeloblastosis virus (AMV) reverse transcriptase (Boehringer Mannheim).
cDNA was used in a polymerase chain reaction under standard conditions (PCR Technology-Principles and Applications for DNA Amplifications, H. E. Erlich, ed., Stockton Press, New York 1989). The following pool of primers were used for the amplification:
______________________________________                                    
Sense Primer (SEQ ID NO:9)                                                
corresponding to the amino acid sequence HRDLAA                           
EcoRI                                                                     
5'   GGAATTCC   CAC    AGN  GAC  TTN  GCN  GCN  AG 3'                     
                T      C    A T  C    A    A    C                         
Antisense Primer (SEQ ID NO:10)                                           
corresponding to the amino acid sequence SDVWS                            
F/Y                                                                       
EcoRI                                                                     
3'   TCN    GAC    GTN  TGG  ACN   TTC  CCTTAAGG 5'                       
     G      G                TG    CAT                                    
______________________________________                                    
Thirty-five PCR cycles were carried out using 8 μg (0.8 μg) of the pooled primers. (Annealing 55° C., 1 min; Extension 72° C., 2 min; Denaturation 94° C., 1 min). The reaction product was subjected to polyacrylamide gel electrophoresis. Fragments of the expected size (-210 bp) were isolated, digested with the restriction enzyme EcoRI, and subcloned into the pBluescript vector (Stratagene) using standard techniques (Current Protocols in Molecular Biology, eds. F. M. Ausubel et al., John Wiley & Sons, New York, 1988).
The recombinant plasmids were transformed into the competent E. coli strain designated 298.
The subcloned PCR products were sequenced by the method of Sanger et al. (Proc. Natl. Acad. Sci. USA 74, 5463-5467) using Sequenase (United States Biochemical, Cleveland, Ohio 44111 USA). One clone, designated MCK-10 was identified as novel RTK.
6.1.2. Full-Length cDNA Cloning
The partial cDNA sequence of the new MCK-10 RTK, which was identified by PCR, was used to screen a λgt11 library from human fetal brain cDNA (Clontech) (complexity of 1×1010 recombinant phages). One million independent phage clones were plated and transferred to nitrocellulose filters following standard procedures (Sambrook, H. J., Molecular Cloning, Cold Spring Harbor Laboratory Press, USA, 1989). The filters were hybridized to the EcoRI/EcoRI fragment of clone MCK-10, which had been radioactively labeled using 50 μCi α32 P!ATP and the random-primed DNA labeling kit (Boehringer Mannheim). The longest cDNA insert (8) of ˜3500 bp was digested with the restriction enzymes EcoRI/SacI to obtain a 5' end probe of -250 bp. This probe was used to rescreen the human fetal brain library and several overlapping clones were isolated. The composite of the cDNA clones are shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G. Some of the clones had a deletion of 6 amino acids at position 2315 in the MCK-10 sequence.
The 1.75 million independent phage clones of a human placenta library, λZAP were plated and screened with the 5' end probe (EcoRI/SacI) of clone 8. Two clones were full-length with a shorter 5' end starting at position 278 of the nucleotide sequence shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ ID NO:1). Subcloning of positive bacteriophages clones into pBluescript vector was done by the in vivo excision protocol (Stratagene).
The composite cDNA sequence and the predicted amino acid sequence of MCK-10 are shown in FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G (SEQ ID NOS:1-2). Different cDNA sequence variations of MCK-10 is presented in FIG. 2A.
6.1.3. Northern Blot Analysis of MCK-10
Total RNA was isolated from the following human tissues: lung, pancreas, stomach, kidney, spleen, liver, colon and placenta. RNA was also isolated from various breast cancer cell lines and cell lines of tumor origin.
PolyA+ RNA was isolated on an oligo (dT) column (Aviv and Leder, 1972, Proc. Natl. Acad. Sci. USA 69, 1408-1412). The RNA was separated on an agarose gel containing 2.2M formaldehyde and blotted on a nitrocellulose filter (Schleicher and Schuell). 3 μg of poly A+ RNA was loaded per lane. The filters were either hybridized with a 32 P-labeled EcoRI/EcoRI DNA fragment obtained by PCR or by a 1694 bp cDNA fragment of MCK-10-2 (excluding the 111 bp insert) which encompasses the extracellular, transmembrane and juxtamembrane domain. Subsequently, the filter was exposed to x-ray film at -70° C. with an intensifying screen. The results are depicted in FIGS. 5A, 5B and 5C.
6.1.4. Generation of MCK-10 Specific Antibodies
Antisera was generated against synthetic peptides corresponding to the amino acid sequence of MCK-10-2. αMCK-10-N antisera was generated against the following N-terminal peptide located between amino acids 26-42 (SEQ ID NO:11)
H-F-D-P-A-K-D-C-R-Y-A-L-G-M-Q-D-R-T-I.
αMCK-10-c antisera was generated against the following C-terminal peptide located between amino acids 902-919 (SEQ ID NO:12)
R-P-P-F-S-Q-L-H-R-F-L-A-E-D-A-L-N-T-V.
αMCK-10-β antisera was generated against the following peptide near the processing site of β-subunit of MCK-10 located between amino acids 309-322 (SEQ ID NO:13):
P-A-M-A-W-E-G-E-P-M-R-H-N-L.
αMCK-10-C2 antisera was generated against the C-terminal peptide located between amino acids 893-909 (SEQ ID NO:14):
C-W-S -R-E-S-E-Q-R-P-P-F-S-Q-L-H-R.
Peptides were coupled to keyhole limpet hemocyanin and injected with Freunds adjuvant into Chinchilla rabbits. After the second boost, the rabbits were bled and the antisera were tested in immunoprecipitations using lysates of 293 cells transiently overexpressing MCK-10-1 and MCK-10-2.
The samples were loaded on a 7.5% polyacrylamide gel and after electrophoresis transferred onto a nitrocellulose filter (Schleicher and Schuell). The blot was probed with the different antibodies as above and developed using the ECL Western blotting detection system according the manufacturer's instructions (Cat no. RPN 2108 Amersham International, UK).
6.1.5. In Situ Hybridization
The 5' located cDNA fragment corresponding to nucleotides 278-1983 of clone MCK-10-2, excluding the 111 base pair insert, were subcloned in the bluescript SK+ (Stratagene). For in situ hybridization, a single-strand antisense DNA probe was prepared as described by Schnurch and Risau (Development 1991, 111, 1143-1154). The plasmid was linearized at the 3'end of the cDNA and a sense transcript was synthesized using SP6 RNA polymerase (Boehringer). The DNA was degraded using DNase (RNase-free preparation, Boehringer Mannheim). With the transcript, a random-primed cDNA synthesis with α-35 S ATP (Amersham) was performed by reverse transcription with MMLV reverse transcriptase (BRL). To obtain small cDNA fragments of about 100 bp in average, suitable for in situ hybridization, a high excess of primer was used. Subsequently, the RNA transcript was partially hydrolyzed in 100 nM NaOH for 20 min at 70° C., and the probe was neutralized with the same amount of HCL and purified with a Sephadex-G50 column. After ethanol precipitation the probe was dissolved at a final specific activity of 5×105 cpm. For control hybridization, a sense probe was prepared using the same method.
Sectioning, postfixation and hybridization was essentially performed according to Hogan et al. (1986, Manipulating the Mouse Embryo: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press). 10 μm thick sections were cut at -18° C. on a Leitz cryostat. For hybridization treatment, no incubation with 0.2M HCL for removing the basic proteins was performed. Sections were incubated with the 35 S-cDNA probe (5×104 cpm/μl) at 52° C. in a buffer containing 50% formamide, 300 mM NaCl, 10 mM Tris-HCL, 10 mM NaPO4 (pH 6.8), 5 mM EDTA, 2% Ficoll 400, 0.2% polyvinylpyrrolidone, 0.02% BSA, 10 mg/ml yeast RNA, 10% dextran sulfate, and 10 mM DTT. Posthybridization washing was performed at high stringency (50% formamide, 300 mM NaCl, 10 mM Tris-HCL, 10 mM NaPO4 (pH6.8), 5 mM EDTA, 10 mM DTT at 52° C.). For autoradiography, slides were created with Kodak NTB2 film emulsion and exposed for eight to ten days. After developing, the sections were counterstained with toluidine blue.
6.2. Results 6.2.1. Characterization of MCK-10 Clone
To identify novel receptor tyrosine kinases (RTKs) that are expressed in mammary carcinoma cell lines, we used the polymerase chain reaction in combination with two degenerate oligonucleotide primer pools based on highly conserved sequences within the kinase domain of RTKs, corresponding to the amino acid sequence HRDLAA (SEQ ID NO:6) (sense primer) and SDVWS/FY (SEQ ID NO:7) (antisense primer) (Hanks et al. 1988, Science 241, 42-52), in conjunction with cDNA synthesized by reverse transcription of poly A RNA from the human mammary carcinoma cell line MCF7. We identified a novel RTK, designated MCK-10 (mammary carcinoma kinase 10), that within the tyrosine kinase domain exhibited extensive sequence similarity to the insulin receptor family. The PCR fragment was used to screen a lambda gt11 library of human fetal brain cDNA (Clontech). Several overlapping clones were identified and their composite sequence is shown in FIGS. 1A, 1B and 1C. Furthermore, screening of a human placenta library yielded two cDNA clones which encoded the entire MCK-10 protein but whose 5' nucleotide sequence began at nucleotide 278 in the sequence shown in FIG. 1. Sequence analysis of the two clones revealed complete identity with the exception of 111 additional nucleotides within the juxtamembrane domain, between nucleotides 1832 and 1943. One of the clones isolated from the human fetal brain library contained an additional 18 nucleotides in the tyrosine kinase domain. These sequences were in-frame with the MCK-10 open reading frame and did not contain any stop codons. We designated these MCK-10 splice isoforms MCK-10-1 (with the additional 111 bp), MCK-10-2 (without any insertions), MCK-10-3 (with the additional 111 bp and 18 bp), and MCK-10-4 (with the additional 18 bp). This new receptor tyrosine kinase was recently described by Johnson et al. (1993, Proc. Natl. Acad. Sci. USA, 90, 5677-5681) as DDR.
As shown in FIG. 1, MCK-10 has all of the characteristics of a receptor PTK: the initiation codon is followed by a stretch of essentially hydrophobic amino acids, which may serve as a signal peptide. Amino acids 418-439 are also hydrophobic in nature, with the characteristics of a transmembrane region. The extracellular domain encompasses 4 consensus N-glycosylation sites (AsnXSer/Thr) and 7 cysteine residues. The extracellular region is shorter than that of the insulin receptor family and shows no homology to other receptor tyrosine kinases, but contains near the N-terminus the consensus sequences for the discoidin 1 like family (Poole et al. 1981, J. Mol. Biol. 153, 273-289), which are located as tandem repeats in MGP and BA46, two milk fat globule membrane proteins (Stubbs et al. 1990, proc. Natl. Acad. Sci. USA, 87, 8417-8421, Larocca et al. 1991, Cancer Res. 51, 4994-4998), in the light chains of factor V (Kane et al. 1986, Proc. Natl. Acad. Sci. USA, 83, 6800-6804) and VIII (Toole et al. 1984, Nature, 312, 342-347), and in the A5 protein (Takagi et al. 1987, Dev. Biol., 122, 90-100).
The protein backbone of MCK-10-1 and MCK-10-2 proreceptors, with predicted molecular weights of 101.13 and 97.17 kD, respectively, can thus be subdivided into a 34.31 kD α subunit, and a 66.84 kD and a 62,88 kD β-subunit, respectively, that contain the tyrosine kinase homology and alternative splice sites.
The consensus sequence for the ATP-binding motif is located at positions 617-627 (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G). When compared with other kinases, the ATP binding domain is 176 amino acids (including the additional 37 amino acids) further from the transmembrane domain than any other tyrosine kinase. The additional 37 amino acids are located in the long and proline/glycine-rich juxtamembrane region and contain an NPAY sequence (where A can be exchanged for any amino acid), which is found in cytoplasmic domains of several cell surface proteins, including RTKs of the EGF and insulin receptor families (Chen et al. 1990, J. Biol. Chem., 265, 3116-3123). This consensus motif is followed by the sequence TYAXPXXXPG (SEQ ID NO:8), which is repeated downstream in MCK-10 in the juxtamembrane domain at positions 585-595. Recently it has been shown that this motif is deleted in the cytoplasmic juxtamembrane region of the activin receptor, a serine/threonine kinase, resulting in reduced ligand binding affinity (Attisano et al. 1992, Cell, 68, 97-108).
In comparison with other RTKs, the catalytic domain shows the highest homology to the TrkA receptor. The yy-motifs (position 802/803) and the tyrosine at position 798, representing putative autophosphorylation sites, characterize MCK-10 as a member of the insulin receptor family (FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G). Finally, MCK-10 shares with the Trk kinases their characteristic short caraboxy-terminal tail of 9 amino acids.
To determine whether the additional 111 nucleotides present in MCK-10-1 and -3 were ubiquitously expressed or expressed only in specific human tissues, we performed PCR on different human cDNAs using oligonucleotide primers corresponding to sequences flanking the insertion site. Parallel PCR amplifications were performed on plasmid DNAs of MCK-10-1/MCK-10-2 as controls. Expression of both isoforms was identified in brain, pancreas, placenta, colon, and kidney, and in the cell lines Caki-2 (kidney ca), SW48 (colon ca), and HBL-100 and T-47D (breast ca). The PCR products were subcloned into the Bluescript vector to confirm the nucleotide sequence.
6.2.2. Northern Blot Analysis: Expression of MCK-10 in Various Human Tissues and Cell Lines
Using as a hybridization probe a 5' 1694 bp cDNA fragment of MCK-10 (excluding the 111 base pair insert), which encompasses the extracellular, transmembrane, and juxtamembrane domains, the MCK-10 gene revealed the existence of multiple transcript sizes with a major form of 4.3 kb. The highest expression of MCK-10 mRNA was detected in lung, intermediate levels were found in kidney, colon, stomach, placenta, and brain, low levels in pancreas, and no MCK-10 mRNA was detected in liver (FIG. 5A). MCK-10 mRNA was also detected in a variety of different tumor cell lines as depicted in FIG. 5B and FIG. 5C. Northern blot analysis with the GAPDH gene was carried out as a control.
6.2.3. In Situ Hybridization
To determine which cells in the different human tissues contain MCK-10 transcripts, in situ hybridization of various human tissues and of tissues of different tumors were carried out. Hybridization analyses with the 5' 1694 bp of MCK-10 (excluding the 111 base pair insert) indicated that MCK-10 expression was specifically detected in epithelial cells of various tissues:
cuboidal epithelial cells lining the distal kidney tubulus
columnar epithelial cells lining the large bowl tract
deep layer of epithelial cells lining the stomach
epithelial cells lining the mammary ducts
islet cells of the pancreas
epithelial cells of the thyroid gland, which produces thyroid hormones
No detectable MCK-10 expression was observed in connective tissues, endothelial cells, adipocytes, muscle cells, or hemapoletic cells.
MCK-10 expression was detected in all tumors investigated:
adenocarcinoma of the colon
adenocarcinoma of the stomach
adenocarcinoma of the lung
infiltrating ductal carcinoma of the breast
cystadenoma of the ovary
multi endocrine tumor of the pancreas
carcinoid tumor of the pancreas
tubular cells of renal cell carcinoma
transitional cell carcinoma (a malignant epithelial tumor of the bladder)
meninglothelial tumor
medulloblastoma with hyperchromatic atypical nuclei and spare cytoplasm (MCK-10 expression is only seen in cells with well developed cytoplasm)
glioblastoma (a tumor of the neuroepithelial tissue)
These in situ hybridization experiments revealed the highest expression of MCK-10 in malignant cells of the ductal breast carcinoma, in the tumor cells of a multi endocrine tumor, and in the tumor cells of a transitional cell carcinoma of the bladder.
6.2.4. Transient Expression of MCK-10 in 293 Cells
To analyze the MCK-10 protein in detail, we used the 293 cell system for transient overexpression. The cDNAs of MCK-10-1 and MCK-10-2 were cloned into an expression vector. Cells were transfected in duplicate with the two splice variants or a control plasmid and starved overnight. One part was incubated prior to lysis with 1 mM sodium-orthovanadate for 90 min. This agent is known to be a potent inhibitor of phosphotyrosine phosphatases, thereby enhancing the tyrosine phosphorylation of cellular protein.
The precursor and the β-subunit of MCK-10 showed strong tyrosine phosphorylation after orthovanadate treatment, (FIG. 6A, left panel). Surprisingly, the MCK-10-1, containing the 37 amino acid insertion, exhibited lower kinase activity than MCK-10-2. Reprobing the same blot with a peptide antibody raised against the MCK-10 C-terminus revealed equal amounts of expressed receptor and a slight shift of MCK-10-1 precursor and β-subunit due to the additional 37 amino acids of the insertion (FIG. 6A, right panel).
We further analyzed the N-linked glycosylation of the splice variants. Transfected cells were treated overnight with tunicamycin, which inhibits the maturation of proteins by glycosylation. Two affinity purified antibodies raised against peptide sequence of MCK-10 N- and C-terminus, respectively, were used for subsequent immunoprecipitations. Both antibodies precipitated the predicted 101 kD or 97 kD polypeptides from tunicamycin-treated cells (FIG. 6B). Interestingly, the size of the fully glycosylated forms of MCK-10-1 and MCK-10-2 suggested that the latter was more extensively glycosylated than the putative alternative splice form.
In summary, transient overexpression experiments demonstrate significant effects of the 37 amino acid insertion on receptor function. Both receptor kinase activity and extracellular glycosylation appeared to be significantly affected by the additional sequences present in MCK-10-1 which may influence ligand binding. Although orthovanadate-induced tyrosine phosphorylation was reduced for both the 124 kD form as well as the 63 kD cleavage product, possibly representing a β subunit, surprisingly, the MCK-10-1 type receptor was less extensively glycosylated than the MCK-10-2 isoform, which resulted in an approximately equal apparent molecular weight for the mature forms of both variants. The latter phenomenon may be mediated by either or all of the protein binding motifs and may lead, through interaction with cytoskeletal components for which both NXXY and SH3 domain involvement has been suggested (Reszka et al. 1992, J. Cell Biol. 117: 1321-1330; Musacchio et al., 1992, FEBS letters 307: 55-61), to differential sorting, modification, and possibly even cellular localization. Moreover, the resulting differences in extracellular carbohydrate side chain modification pattern may affect ligand binding and therefore autophosphorylation of MCK-10 alternative splice forms.
A potentially even greater diversity of MCK-10 gene products than suggested by cDNA cloning results became apparent through immunoblot analysis of human tumor cell lines, which indicated cell line-characteristic quantitative and qualitative differences. The expression pattern complexity revealed by the extracellular domain-specific MCK-10-N antibody may be the result of either differential glycosylation or the existence of additional alternative splicing variants or both. This remarkable complexity of MCK-10 isoforms in tumor cells in conjunction with the presence of a discoidin I domain potentially involved in cell adhesion, and the possibility of SH3 protein-mediated connections with the cytoskeleton suggests an intricately regulated role of MCK-10 in cell-cell interaction and possibly tumor invasion or metastasis. Interestingly, cleavage of the MCK-10 extracellular domain at the RXRR consensus sequence, yielding a soluble 54 kD α-subunit with putative adhesion properties due to the presence of the discoidin I-like domain may represent another regulatory mechanism in tumor progression, when cancer cells adhere to, as well as detach from, the extracellular matrix. Similar post-translational processing by endoprotease cleavage has been shown for cell adhesion molecules such as Ng-CAM (Burgoon et al., 1992, J. Cell Biol. 112: 1017-1029) and for the receptor phosphatases PTPμ and PTPκ, which mediate hemophilic intercellular interactions (Brady-Kalnay et al., 1993, J. Cell Biol. 122: 961-972; Jiang et al., 1993, Mol. Cell Biol. 13: 2942-2951; Sap et al., 1994, Mol Cell Biol. 14: 1-9).
7. EXAMPLES: CLONING AND CHARACTERIZATION OF CCK-2
The following subsection describes methods for isolation and characterization of the CCK-2 gene, an additional member of the MCK-10 receptor tyrosine kinase gene family.
7.1. Materials and Methods 7.1.1. cDNA Cloning and Characterization of CCK-2
cDNA was synthesized using avian myeloblastosis virus reverse transcriptase and 5 μg of poly A+ RNA prepared from tissue of a primary colonic adenocarcinoma, sigmoid colon, moderately well differentiated grade II, staging pT3, pN1, removed from a 69 year old white female of blood type O, RH positive. The patient had not received therapy.
The tissue was minced and lysed by treatment with guanidinium-thiocyanate according to Chirgwin, J. M. et al. (1979, Biochemistry 18: 5294-5299). Total RNA was isolated by guanidinium thiocyanate-phenol-chloroform extraction (Chomczyrski et al. 1987, Anal. Biochem. 162: 156-159). Poly A+ RNA was isolated on an oligo-dT column (Aviv and Leder, 1972, Proc. Natl. Acad. Sci. USA 69: 1408-1412).
One tenth of the cDNA was subjected to the polymerase chain reaction using standard conditions (PCR Technology-Principles and Applications for DNA Amplifications, H. E. Erlich, ed. Stockton Press, New York, 1989) and the same pool of primers used for amplification of MCK-10 (See, Section 6.1.1., page 46, lines 4-16). Thirty-five cycles were carried out (Annealing 55° C., 1 min; Extension 72° C., 2 min: Denaturation 94° C. 1 min.). The reaction products were subjected to polyacrylamide gel electrophoresis. Fragments of the expected size were isolated, digested with the restriction enzyme EcoRI, and subcloned into pBluescript vector (Stratagene) using standard techniques (Current Protocols in Molecules Biology, eds. M. Ausubel et al., John Wiley & Sons, New York, 1988). The subcloned PCR products were sequenced by the method of Sanger et al. (1977, Proc. Natl. Acad. Sci. USA 74, 5463-5467) using T7-Polymerase (Boehringer Mannheim).
The CCK-2 PCR fragment was used to screen a human placenta library in lambda ZAP. The longest cDNA insert - 1300 bp was digested with the restriction enzymes EcoRI/Ncol to obtain a 5' end probe of 200 bp. Rescreening of the human placenta library yielded in a cDNA clone which encoded the entire CCK-2 protein (subcloning of positive bacteriophages clones into pBluescript vector was done by the in vivo excision protocol (Stratagene)). The DNA sequence and the deduced aminoacid sequence of CCK-2 is shown in FIG. 3 (SEQ ID NOS:3-4).
7.1.2. Northern Blot Analysis
The 5' located 1260 bp of CCK-2 was subcloned into the pBluescript SK+ -vector (pBSK+ ; Stratagene). For Northern blot analysis, the probe was prepared by labeling the cDNA fragment with α-32 PdATP using a random hexanucleotide priming kit (United States Biochemical) and purified with Sephadex-G50 column.
7.1.3. In Situ Hybridization
For in situ hybridization, single-stranded antisense DNA probes were prepared as described by Schnurch & Risau (1991 Development 111: 1143-1154). The pBSK+ CCK-2 plasmid was linearized at the 3' end of the cDNA by restriction digest with EcoRI and antisense transcripts were synthesized using SP6 RNA polymerase (Boehringer). The DNA was degraded using DNAase (RNAase-free preparation, Boehringer Mannheim). With the transcripts, random-primed cDNA synthesis with α-35 S ATP (Amersham) was performed by reverse transcription with MMLV reverse transcriptase (BRL). A high excess of primer was used to obtain small cDNA fragments of about 100 bp in average. Subsequently, the RNA transcripts were partially hydrolyzed in 100 nM NaOH for 20 minutes at 70° C., neutralized with the same amount of HCL, and purified with a Sephadex-G50 column. After ethanol precipitation, probes were dissolved at a final specific activity of 5×105 cpm. Sense probes for control hybridization were prepared using the same method.
7.1.4. Transient Overexpression of CCK-2 in 293 Cells
The cDNA insert containing the entire open reading frame of CCK-2 was subcloned into a cytomegalovirus promoter-based expression plasmid and semiconfluent human embryonic kidney fibroblast 293 cell line were transfected. Cell lysates from CCK-2-transfected cells were separated on a 7.5% polyacrylamide gel, transferred to nitrocellulose, and probed with the 5E2 monoclonal antibody against antiphosphotyrosine (α PY). Incubation of cells with 1 mM sodium orthovanadate was carried out 90 minutes prior to lysis.
7.2. Results 7.2.1. and Characterization of CCK-2 Clone
An additional member of the MCK-10 receptor tyrosine kinase family was identified using a polymerase chain reaction and cDNA prepared from colonic adenocarcinoma RNA. The nucleotide sequence of the novel receptor, designated CCK-2, is presented in FIGS. 3A, 3B, 3C and 3D (SEQ ID NO:3). Analysis of the CCK-2, nucleotide sequence and encoded amino acid sequence indicated significant homology with MCK-10 throughout the extracellular, transmembrane and intracellular region of the MCK-10 receptor. The regions of homology between CCK-2 and MCK-10 extend into the N-terminus consensus sequence for the discoidin I like family of proteins. (Poole et al. 1981, J. Mol. Biol. 153, 273-289). The homology between CCK-2 and MCK-10-2 is diagramed in FIG. 4A and 4B.
Between the two RTKs, the juxtamembrane region is the region of most extensive sequence divergence. The importance of this region for the signaling capacity of the MCK-10/CCK-2 subclass of RTKs is further emphasized by several structural and functional criteria. CCK-2 displays a serine-rich stretch between amino acids 430 and 470 that includes among other possible phosphorylation sites a potential protein kinase C substrate site at position 433 (EKASRR) (SEQ ID NO:39). While a similar sequence including a serine residue is found at approximately the same location in MCK-10-2 (Ser 448, RRLLSKAERR) (SEQ ID NO:40), the serine content of its JM domain is comparatively lower but instead features a remarkably high number of proline residues. These are arranged in either PXXP (SEQ ID NO:41) or PXXXP (SEQ ID NO:42) repeats, suggesting a random coil structure for this highly hydrophilic region, which is in the likelihood a major domain for interactions with cellular substrates and other regulatory proteins and therefore may be the functional homolog to the C-tail region of the EGF-R, the kinase insertion domain of the PDGF-R, and the auxiliary signal transmission factor IRS-1 of the insulin receptor (for review see Williamson et al., 1994, Biochem J., 297: 249-260). The striking differences between MCK-10 and CCK-2 in this region suggest that determinants within this region define their distinct biological functions. This prediction is supported by the 37 amino acid MCK-10-2 insertion, which includes "signal" motifs for internalization (NPXY) (SEQ ID NO:19) , ligand binding modulation (TYAXPXXXPG) (SEQ ID NO:8), and SH3 domain interaction (PXPPXP) (SEQ ID NO:43). This latter motif is very similar to the SH3 binding site of the murine 3BP2 protein (Ren et al., 1993, Science 259: 1157-1161) and matches the most favorable SH3 binding structure proposed by Yu et al. (1994, Cell 76: 933-945) (FIG. 4C). The alternative splicing of this regulatory sequence may define distinct protein interactions and thereby modulate receptor function and ultimately the response of the cell. Moreover, the proline-rich sequences that flank the 37-residue insertion in MCK-10 are distinct from those in the CCK-2 JM domain and, therefore, may play a role in RTK-characteristic function. Similar putative SH3 domain docking sites have previously been found in tyrosine kinases of the non-receptor type such as Fgr. ack, and Fak (FIG. 4C; Naharro et al., 1984, Science, 233: 63-66; Manser et al., 1993, Nature 363: 364-367; Andre & Becker-Andre, 1993, Biochem. Biophys. Res. Comm. 190: 140-147) but are described here for the first time in RTKs.
7.2.2. Northern Blot Analysis: Expression of CCK-2 in Various Human Tissues and Cell Lines
CCK-2 expression in human tumor cell lines was investigated using Northern blot analysis. While varying levels of 4.3 Kb MCK-10 mRNA expression were detected in epithelial type tumor cell lines T-470, MDA-MB-231, CaKi-2, Caco-2 and SNW-C2B, the CCK-2 probe hybridized predominantly to multiple RNAs in SK-Mel-2, Wi-26VA4, and Wi-38VA13, which expressed only low levels of MCK-10 mRNA (FIG. 5D).
7.2.3. In Situ Hybridization
For a more detailed expression analysis in situ hybridization on human normal and tumor tissues, were performed using single-stranded antisense CCK-2 DNA fragments. In situ hybridization analysis of human carcinomas of different origin revealed a remarkably distinct pattern of CCK-2 and MCK-10 mRNA expression, as demonstrated by in situ hybridization on serial-sections. Both receptors were expressed in an apparently mutually exclusive manner in different cell types of the same tumor. CCK-2 was predominantly found in all stromal cells, which provide an environment conducive to proliferation, invasion, and even metastasis of epithelial cells, whereas MCK-10 expression was strongly confined to the neoplastic cells themselves (Liotta et al., 1983, Laboratory Investigation 49: 636-649; Iozzo and Cohen, 1993, Experientia 49: 447-455). As shown in FIG. 23A, MCK-10 mRNA was abundant in epithelial tumor cells of a poorly differentiated, grade III, papillary adenocarcinoma of the ovary, whereas CCK-2 gene expression was only detected in stromal cells within the tumor. Hybridization signals of CCK-2 appeared to be more dispersed, in accordance with the fact that cells of the connective tissue, which contain a large amount of extracellular matrix, are more separated in contrast to tumor epithelia, where cells are closely associated. A similar expression pattern was found in a moderately differentiated, grade II, bronchioalveolar adenocarcinoma of the lung (FIG. 23B). Consistent with the hybridization signal distribution in the ovarian carcinoma, MCK-10 mRNA was restricked to epithelial tumor cells, whereas CCK-2 positive hybridization signals were observed only in stromal cells, although at a lower level than in the ovarian carcinoma. These findings parallel the observations of Zerlin et al. (1993, Oncogene 8: 2731-2739), who demonstrated that NEP, the mouse homologue to MCK-10, was abundant in embryonic-proliferating neuroepithelial cells and significantly lower or absent in differentiated cells that had migrated away from proliferating zones. The idea that invading cancer cells may use the same signaling system as neuroepithelial cells during embryogenesis further supports a role for MCK-10 in cell recognition mediated proliferation and migration. In normal epithelial and tumor cells MCK-10 may promote cell adhesion in a hemophilic manner, similar to the Drosophila homologue of Trk, Dtrk (Pulido et al., 1992, EMBO J. 11: 391-404), by binding to the same receptor expressed in adjacent cells or by interacting heterophilically with other molecules involved in cell-cell interaction, such as CCK-2.
7.2.4. Transient Expression of CCK-2 in 293 Cells
Transfection of 293 cells with pCMV CCK-2, yielded a single 126 K Da band which was phosphorylated, even in the absence of orthovanadate, presumably representing the glycosylated CCK-2 receptor protein (FIG. 6C).
In summary, the distinct expression pattern of CCK-2 and MCK-10 suggests that these closely related receptors are involved in interactions between neoplastic epithelial cells and surrounding stroma during tumor progression, and the presence of the discoidin I motif in their extracellular domains indicates that these receptors play an important role in processes involved in cell-cell communications.
8. DEPOSIT OF MICROORGANISMS
The following organisms were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852.
______________________________________                                    
Strain Designation                                                        
               Containing                                                 
                         Accession No.                                    
______________________________________                                    
CCK-2          pCCK-2    69468                                            
MCK-10-1       pMCK-10-1 69464                                            
MCK-10-2       pMCK-10-2 69465                                            
MCK-10-3       pMCK-10-3 69466                                            
MCK-10-4       pMCK-10-4 69467                                            
______________________________________                                    
The present invention is not to be limited in scope by the exemplified embodiments or deposited organisms which are intended as illustrations of single aspects of the invention, and any clones, DNA or amino acid sequences which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.
It is also to be understood that all base pair sizes given for nucleotides are approximate and are used for purposes of description.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 43                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 3962 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 321..3077                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
CGGGCCTGAGACTGGGGTGACTGGGACCTAAGAGAATCCTGAGCTGGAGGCCCCCGACAG60            
CTGCTCTCGGGAGCCGCCTCCCGACACCCGAGCCCCGCCGGCGCCTCCCGCTCCCGGCTC120           
CCGGCTCCTGGCTCCCTCCGCCTCCCCCGCCCCTCGCCCCGCCGCCGAAGAGGCCCCGCT180           
CCCGGGTCGGACGCCTGGGTCTGCCGGGAAGAGCGATGAGAGGTGTCTGAAGGTGGCTAT240           
TCACTGAGCGATGGGGTTGGACTTGAAGGAATGCCAAGAGATGCTGCCCCCACCCCCTTA300           
GGCCCGAGGGATCAGGAGCTATGGGACCAGAGGCCCTGTCATCTTTACTG350                     
MetGlyProGluAlaLeuSerSerLeuLeu                                            
1510                                                                      
CTGCTGCTCTTGGTGGCAAGTGGAGATGCTGACATGAAGGGACATTTT398                       
LeuLeuLeuLeuValAlaSerGlyAspAlaAspMetLysGlyHisPhe                          
152025                                                                    
GATCCTGCCAAGTGCCGCTATGCCCTGGGCATGCAGGACCGGACCATC446                       
AspProAlaLysCysArgTyrAlaLeuGlyMetGlnAspArgThrIle                          
303540                                                                    
CCAGACAGTGACATCTCTGCTTCCAGCTCCTGGTCAGATTCCACTGCC494                       
ProAspSerAspIleSerAlaSerSerSerTrpSerAspSerThrAla                          
455055                                                                    
GCCCGCCACAGCAGGTTGGAGAGCAGTGACGGGGATGGGGCCTGGTGC542                       
AlaArgHisSerArgLeuGluSerSerAspGlyAspGlyAlaTrpCys                          
606570                                                                    
CCCGCAGGGTCGGTGTTTCCCAAGGAGGAGGAGTACTTGCAGGTGGAT590                       
ProAlaGlySerValPheProLysGluGluGluTyrLeuGlnValAsp                          
75808590                                                                  
CTACAACGACTCCACCTGGTGGCTCTGGTGGGCACCCAGGGACGGCAT638                       
LeuGlnArgLeuHisLeuValAlaLeuValGlyThrGlnGlyArgHis                          
95100105                                                                  
GCCGGGGGCCTGGGCAAGGAGTTCTCCCGGAGCTACCGGCTGCGTTAC686                       
AlaGlyGlyLeuGlyLysGluPheSerArgSerTyrArgLeuArgTyr                          
110115120                                                                 
TCCCGGGATGGTCGCCGCTGGATGGGCTGGAAGGACCGCTGGGGTCAG734                       
SerArgAspGlyArgArgTrpMetGlyTrpLysAspArgTrpGlyGln                          
125130135                                                                 
GAGGTGATCTCAGGCAATGAGGACCCTGAGGGAGTGGTGCTGAAGGAC782                       
GluValIleSerGlyAsnGluAspProGluGlyValValLeuLysAsp                          
140145150                                                                 
CTTGGGCCCCCCATGGTTGCCCGACTGGTTCGCTTCTACCCCCGGGCT830                       
LeuGlyProProMetValAlaArgLeuValArgPheTyrProArgAla                          
155160165170                                                              
GACCGGGTCATGAGTGTCTGTCTGCGGGTAGAGCTCTATGGCTGCCTC878                       
AspArgValMetSerValCysLeuArgValGluLeuTyrGlyCysLeu                          
175180185                                                                 
TGGAGGGATGGACTCCTGTCTTACACCGCCCCTGTGGGGCAGACAATG926                       
TrpArgAspGlyLeuLeuSerTyrThrAlaProValGlyGlnThrMet                          
190195200                                                                 
TATTTATCTGAGGCCGTGTACCTCAACGACTCCACCTATGACGGACAT974                       
TyrLeuSerGluAlaValTyrLeuAsnAspSerThrTyrAspGlyHis                          
205210215                                                                 
ACCGTGGGCGGACTGCAGTATGGGGGTCTGGGCCAGCTGGCAGATGGT1022                      
ThrValGlyGlyLeuGlnTyrGlyGlyLeuGlyGlnLeuAlaAspGly                          
220225230                                                                 
GTGGTGGGGCTGGATGACTTTAGGAAGAGTCAGGAGCTGCGGGTCTGG1070                      
ValValGlyLeuAspAspPheArgLysSerGlnGluLeuArgValTrp                          
235240245250                                                              
CCAGGCTATGACTATGTGGGATGGAGCAACCACAGCTTCTCCAGTGGC1118                      
ProGlyTyrAspTyrValGlyTrpSerAsnHisSerPheSerSerGly                          
255260265                                                                 
TATGTGGAGATGGAGTTTGAGTTTGACCGGCTGAGGGCCTTCCAGGCT1166                      
TyrValGluMetGluPheGluPheAspArgLeuArgAlaPheGlnAla                          
270275280                                                                 
ATGCAGGTCCACTGTAACAACATGCACACGCTGGGAGCCCGTCTGCCT1214                      
MetGlnValHisCysAsnAsnMetHisThrLeuGlyAlaArgLeuPro                          
285290295                                                                 
GGCGGGGTGGAATGTCGCTTCCGGCGTGGCCCTGCCATGGCCTGGGAG1262                      
GlyGlyValGluCysArgPheArgArgGlyProAlaMetAlaTrpGlu                          
300305310                                                                 
GGGGAGCCCATGCGCCACAACCTAGGGGGCAACCTGGGGGACCCCAGA1310                      
GlyGluProMetArgHisAsnLeuGlyGlyAsnLeuGlyAspProArg                          
315320325330                                                              
GCCCGGGCTGTCTCAGTGCCCCTTGGCGGCCGTGTGGCTCGCTTTCTG1358                      
AlaArgAlaValSerValProLeuGlyGlyArgValAlaArgPheLeu                          
335340345                                                                 
CAGTGCCGCTTCCTCTTTGCGGGGCCCTGGTTACTCTTCAGCGAAATC1406                      
GlnCysArgPheLeuPheAlaGlyProTrpLeuLeuPheSerGluIle                          
350355360                                                                 
TCCTTCATCTCTGATGTGGTGAACAATTCCTCTCCGGCACTGGGAGGC1454                      
SerPheIleSerAspValValAsnAsnSerSerProAlaLeuGlyGly                          
365370375                                                                 
ACCTTCCCGCCAGCCCCCTGGTGGCCGCCTGGCCCACCTCCCACCAAC1502                      
ThrPheProProAlaProTrpTrpProProGlyProProProThrAsn                          
380385390                                                                 
TTCAGCAGCTTGGAGCTGGAGCCCAGAGGCCAGCAGCCCGTGGCCAAG1550                      
PheSerSerLeuGluLeuGluProArgGlyGlnGlnProValAlaLys                          
395400405410                                                              
GCCGAGGGGAGCCCGACCGCCATCCTCATCGGCTGCCTGGTGGCCATC1598                      
AlaGluGlySerProThrAlaIleLeuIleGlyCysLeuValAlaIle                          
415420425                                                                 
ATCCTGCTCCTGCTGCTCATCATTGCCCTCATGCTCTGGCGGCTGCAC1646                      
IleLeuLeuLeuLeuLeuIleIleAlaLeuMetLeuTrpArgLeuHis                          
430435440                                                                 
TGGCGCAGGCTCCTCAGCAAGGCTGAACGGAGGGTGTTGGAAGAGGAG1694                      
TrpArgArgLeuLeuSerLysAlaGluArgArgValLeuGluGluGlu                          
445450455                                                                 
CTGACGGTTCACCTCTCTGTCCCTGGGGACACTATCCTCATCAACAAC1742                      
LeuThrValHisLeuSerValProGlyAspThrIleLeuIleAsnAsn                          
460465470                                                                 
CGCCCAGGTCCTAGAGAGCCACCCCCGTACCAGGAGCCCCGGCCTCGT1790                      
ArgProGlyProArgGluProProProTyrGlnGluProArgProArg                          
475480485490                                                              
GGGAATCCGCCCCACTCCGCTCCCTGTGTCCCCAATGGCTCTGCGTTG1838                      
GlyAsnProProHisSerAlaProCysValProAsnGlySerAlaLeu                          
495500505                                                                 
CTGCTCTCCAATCCAGCCTACCGCCTCCTTCTGGCCACTTACGCCCGT1886                      
LeuLeuSerAsnProAlaTyrArgLeuLeuLeuAlaThrTyrAlaArg                          
510515520                                                                 
CCCCCTCGAGGCCCGGGCCCCCCCACACCCGCCTGGGCCAAACCCACC1934                      
ProProArgGlyProGlyProProThrProAlaTrpAlaLysProThr                          
525530535                                                                 
AACACCCAGGCCTACAGTGGGGACTATATGGAGCCTGAGAAGCCAGGC1982                      
AsnThrGlnAlaTyrSerGlyAspTyrMetGluProGluLysProGly                          
540545550                                                                 
GCCCCGCTTCTGCCCCCACCTCCCCAGAACAGCGTCCCCCATTATGCC2030                      
AlaProLeuLeuProProProProGlnAsnSerValProHisTyrAla                          
555560565570                                                              
GAGGCTGACATTGTTACCCTGCAGGGCGTCACCGGGGGCAACACCTAT2078                      
GluAlaAspIleValThrLeuGlnGlyValThrGlyGlyAsnThrTyr                          
575580585                                                                 
GCTGTGCCTGCACTGCCCCCAGGGGCAGTCGGGGATGGGCCCCCCAGA2126                      
AlaValProAlaLeuProProGlyAlaValGlyAspGlyProProArg                          
590595600                                                                 
GTGGATTTCCCTCGATCTCGACTCCGCTTCAAGGAGAAGCTTGGCGAG2174                      
ValAspPheProArgSerArgLeuArgPheLysGluLysLeuGlyGlu                          
605610615                                                                 
GGCCAGTTTGGGGAGGTGCACCTGTGTGAGGTCGACAGCCCTCAAGAT2222                      
GlyGlnPheGlyGluValHisLeuCysGluValAspSerProGlnAsp                          
620625630                                                                 
CTGGTCAGTCTTGATTTCCCCCTTAATGTGCGTAAGGGACACCCTTTG2270                      
LeuValSerLeuAspPheProLeuAsnValArgLysGlyHisProLeu                          
635640645650                                                              
CTGGTAGCTGTCAAGATCTTACGGCCAGATGCCACCAAGAATGCCAGC2318                      
LeuValAlaValLysIleLeuArgProAspAlaThrLysAsnAlaSer                          
655660665                                                                 
TTCTCCTTGTTCTCCAGGAATGATTTCCTGAAAGAGGTGAAGATCATG2366                      
PheSerLeuPheSerArgAsnAspPheLeuLysGluValLysIleMet                          
670675680                                                                 
TCGAGGCTCAAGGACCCCAACATCATTCGGCTGCTGGGCGTGTGTGTG2414                      
SerArgLeuLysAspProAsnIleIleArgLeuLeuGlyValCysVal                          
685690695                                                                 
CAGGACGACCCCCTCTGCATGATTACTGACTACATGGAGAACGGCGAC2462                      
GlnAspAspProLeuCysMetIleThrAspTyrMetGluAsnGlyAsp                          
700705710                                                                 
CTCAACCAGTTCCTCAGTGCCCACCAGCTGGAGGACAAGGCAGCCGAG2510                      
LeuAsnGlnPheLeuSerAlaHisGlnLeuGluAspLysAlaAlaGlu                          
715720725730                                                              
GGGGCCCCTGGGGACGGGCAGGCTGCGCAGGGGCCCACCATCAGCTAC2558                      
GlyAlaProGlyAspGlyGlnAlaAlaGlnGlyProThrIleSerTyr                          
735740745                                                                 
CCAATGCTGCTGCATGTGGCAGCCCAGATCGCCTCCGGCATGCGCTAT2606                      
ProMetLeuLeuHisValAlaAlaGlnIleAlaSerGlyMetArgTyr                          
750755760                                                                 
CTGGCCACACTCAACTTTGTACATCGGGACCTGGCCACGCGGAACTGC2654                      
LeuAlaThrLeuAsnPheValHisArgAspLeuAlaThrArgAsnCys                          
765770775                                                                 
CTAGTTGGGGAAAATTTCACCATCAAAATCGCAGACTTTGGCATGAGC2702                      
LeuValGlyGluAsnPheThrIleLysIleAlaAspPheGlyMetSer                          
780785790                                                                 
CGGAACCTCTATGCTGGGGACTATTACCGTGTGCAGGGCCGGGCAGTG2750                      
ArgAsnLeuTyrAlaGlyAspTyrTyrArgValGlnGlyArgAlaVal                          
795800805810                                                              
CTGCCCATCCGCTGGATGGCCTGGGAGTGCATCCTCATGGGGAAGTTC2798                      
LeuProIleArgTrpMetAlaTrpGluCysIleLeuMetGlyLysPhe                          
815820825                                                                 
ACGACTGCGAGTGACGTGTGGGCCTTTGGTGTGACCCTGTGGGAGGTG2846                      
ThrThrAlaSerAspValTrpAlaPheGlyValThrLeuTrpGluVal                          
830835840                                                                 
CTGATGCTCTGTAGGGCCCAGCCCTTTGGGCAGCTCACCGACGAGCAG2894                      
LeuMetLeuCysArgAlaGlnProPheGlyGlnLeuThrAspGluGln                          
845850855                                                                 
GTCATCGAGAACGCGGGGGAGTTCTTCCGGGACCAGGGCCGGCAGGTG2942                      
ValIleGluAsnAlaGlyGluPhePheArgAspGlnGlyArgGlnVal                          
860865870                                                                 
TACCTGTCCCGGCCGCCTGCCTGCCCGCAGGGCCTATATGAGCTGATG2990                      
TyrLeuSerArgProProAlaCysProGlnGlyLeuTyrGluLeuMet                          
875880885890                                                              
CTTCGGTGCTGGAGCCGGGAGTCTGAGCAGCGACCACCCTTTTCCCAG3038                      
LeuArgCysTrpSerArgGluSerGluGlnArgProProPheSerGln                          
895900905                                                                 
CTGCATCGGTTCCTGGCAGAGGATGCACTCAACACGGTGTGAATCACAC3087                     
LeuHisArgPheLeuAlaGluAspAlaLeuAsnThrVal                                   
910915                                                                    
ATCCAGCTGCCCCTCCCTCAGGGAGTGATCCAGGGGAAGCCAGTGACACTAAAACAAGAG3147          
GACACAATGGCACCTCTGCCCTTCCCCTCCCGACAGCCCATCACCTCTAATAGAGGCAGT3207          
GAGACTGCAGGTGGGCTGGGCCCACCCAGGGAGCTGATGCCCCTTCTCCCCTTCCTGGAC3267          
ACACTCTCATGTCCCCTTCCTGTTCTTCCTTCCTAGAAGCCCCTGTCGCCCACCCAGCTG3327          
GTCCTGTGGATGGGATCCTCTCCACCCTCCTCTAGCCATCCCTTGGGGAAGGGTGGGGAG3387          
AAATATAGGATAGACACTGGACATGGCCCATTGGAGCACCTGGGCCCCACTGGACAACAC3447          
TGATTCCTGGAGAGGTGGCTGCGCCCCAGCTTCTCTCTCCCTGTCACACACTGGACCCCA3507          
CTGGCTGAGAATCTGGGGGTGAGGAGGACAAGAAGGAGAGGAAAATGTTTCCTTGTGCCT3567          
GCTCCTGTACTTGTCCTCAGCTTGGGCTTCTTCCTCCTCCATCACCTGAAACACTGGACC3627          
TGGGGGTAGCCCCGCCCCAGCCCTCAGTCACCCCCACTTCCCACTTGCAGTCTTGTAGCT3687          
AGAACTTCTCTAAGCCTATACGTTTCTGTGGAGTAAATATTGGGATTGGGGGGAAAGAGG3747          
GAGCAACGGCCCATAGCCTTGGGGTTGGACATCTCTAGTGTAGCTGCCACATTGATTTTT3807          
CTATAATCACTTGGGGTTTGTACATTTTTGGGGGGAGAGACACAGATTTTTACACTAATA3867          
TATGGACCTAGCTTGAGGCAATTTTAATCCCCTGCACTAGGCAGGTAATAATAAAGGTTG3927          
AGTTTTCCACAAAAAAAAAAAAAAAACCGGAATTC3962                                   
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 919 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetGlyProGluAlaLeuSerSerLeuLeuLeuLeuLeuLeuValAla                          
151015                                                                    
SerGlyAspAlaAspMetLysGlyHisPheAspProAlaLysCysArg                          
202530                                                                    
TyrAlaLeuGlyMetGlnAspArgThrIleProAspSerAspIleSer                          
354045                                                                    
AlaSerSerSerTrpSerAspSerThrAlaAlaArgHisSerArgLeu                          
505560                                                                    
GluSerSerAspGlyAspGlyAlaTrpCysProAlaGlySerValPhe                          
65707580                                                                  
ProLysGluGluGluTyrLeuGlnValAspLeuGlnArgLeuHisLeu                          
859095                                                                    
ValAlaLeuValGlyThrGlnGlyArgHisAlaGlyGlyLeuGlyLys                          
100105110                                                                 
GluPheSerArgSerTyrArgLeuArgTyrSerArgAspGlyArgArg                          
115120125                                                                 
TrpMetGlyTrpLysAspArgTrpGlyGlnGluValIleSerGlyAsn                          
130135140                                                                 
GluAspProGluGlyValValLeuLysAspLeuGlyProProMetVal                          
145150155160                                                              
AlaArgLeuValArgPheTyrProArgAlaAspArgValMetSerVal                          
165170175                                                                 
CysLeuArgValGluLeuTyrGlyCysLeuTrpArgAspGlyLeuLeu                          
180185190                                                                 
SerTyrThrAlaProValGlyGlnThrMetTyrLeuSerGluAlaVal                          
195200205                                                                 
TyrLeuAsnAspSerThrTyrAspGlyHisThrValGlyGlyLeuGln                          
210215220                                                                 
TyrGlyGlyLeuGlyGlnLeuAlaAspGlyValValGlyLeuAspAsp                          
225230235240                                                              
PheArgLysSerGlnGluLeuArgValTrpProGlyTyrAspTyrVal                          
245250255                                                                 
GlyTrpSerAsnHisSerPheSerSerGlyTyrValGluMetGluPhe                          
260265270                                                                 
GluPheAspArgLeuArgAlaPheGlnAlaMetGlnValHisCysAsn                          
275280285                                                                 
AsnMetHisThrLeuGlyAlaArgLeuProGlyGlyValGluCysArg                          
290295300                                                                 
PheArgArgGlyProAlaMetAlaTrpGluGlyGluProMetArgHis                          
305310315320                                                              
AsnLeuGlyGlyAsnLeuGlyAspProArgAlaArgAlaValSerVal                          
325330335                                                                 
ProLeuGlyGlyArgValAlaArgPheLeuGlnCysArgPheLeuPhe                          
340345350                                                                 
AlaGlyProTrpLeuLeuPheSerGluIleSerPheIleSerAspVal                          
355360365                                                                 
ValAsnAsnSerSerProAlaLeuGlyGlyThrPheProProAlaPro                          
370375380                                                                 
TrpTrpProProGlyProProProThrAsnPheSerSerLeuGluLeu                          
385390395400                                                              
GluProArgGlyGlnGlnProValAlaLysAlaGluGlySerProThr                          
405410415                                                                 
AlaIleLeuIleGlyCysLeuValAlaIleIleLeuLeuLeuLeuLeu                          
420425430                                                                 
IleIleAlaLeuMetLeuTrpArgLeuHisTrpArgArgLeuLeuSer                          
435440445                                                                 
LysAlaGluArgArgValLeuGluGluGluLeuThrValHisLeuSer                          
450455460                                                                 
ValProGlyAspThrIleLeuIleAsnAsnArgProGlyProArgGlu                          
465470475480                                                              
ProProProTyrGlnGluProArgProArgGlyAsnProProHisSer                          
485490495                                                                 
AlaProCysValProAsnGlySerAlaLeuLeuLeuSerAsnProAla                          
500505510                                                                 
TyrArgLeuLeuLeuAlaThrTyrAlaArgProProArgGlyProGly                          
515520525                                                                 
ProProThrProAlaTrpAlaLysProThrAsnThrGlnAlaTyrSer                          
530535540                                                                 
GlyAspTyrMetGluProGluLysProGlyAlaProLeuLeuProPro                          
545550555560                                                              
ProProGlnAsnSerValProHisTyrAlaGluAlaAspIleValThr                          
565570575                                                                 
LeuGlnGlyValThrGlyGlyAsnThrTyrAlaValProAlaLeuPro                          
580585590                                                                 
ProGlyAlaValGlyAspGlyProProArgValAspPheProArgSer                          
595600605                                                                 
ArgLeuArgPheLysGluLysLeuGlyGluGlyGlnPheGlyGluVal                          
610615620                                                                 
HisLeuCysGluValAspSerProGlnAspLeuValSerLeuAspPhe                          
625630635640                                                              
ProLeuAsnValArgLysGlyHisProLeuLeuValAlaValLysIle                          
645650655                                                                 
LeuArgProAspAlaThrLysAsnAlaSerPheSerLeuPheSerArg                          
660665670                                                                 
AsnAspPheLeuLysGluValLysIleMetSerArgLeuLysAspPro                          
675680685                                                                 
AsnIleIleArgLeuLeuGlyValCysValGlnAspAspProLeuCys                          
690695700                                                                 
MetIleThrAspTyrMetGluAsnGlyAspLeuAsnGlnPheLeuSer                          
705710715720                                                              
AlaHisGlnLeuGluAspLysAlaAlaGluGlyAlaProGlyAspGly                          
725730735                                                                 
GlnAlaAlaGlnGlyProThrIleSerTyrProMetLeuLeuHisVal                          
740745750                                                                 
AlaAlaGlnIleAlaSerGlyMetArgTyrLeuAlaThrLeuAsnPhe                          
755760765                                                                 
ValHisArgAspLeuAlaThrArgAsnCysLeuValGlyGluAsnPhe                          
770775780                                                                 
ThrIleLysIleAlaAspPheGlyMetSerArgAsnLeuTyrAlaGly                          
785790795800                                                              
AspTyrTyrArgValGlnGlyArgAlaValLeuProIleArgTrpMet                          
805810815                                                                 
AlaTrpGluCysIleLeuMetGlyLysPheThrThrAlaSerAspVal                          
820825830                                                                 
TrpAlaPheGlyValThrLeuTrpGluValLeuMetLeuCysArgAla                          
835840845                                                                 
GlnProPheGlyGlnLeuThrAspGluGlnValIleGluAsnAlaGly                          
850855860                                                                 
GluPhePheArgAspGlnGlyArgGlnValTyrLeuSerArgProPro                          
865870875880                                                              
AlaCysProGlnGlyLeuTyrGluLeuMetLeuArgCysTrpSerArg                          
885890895                                                                 
GluSerGluGlnArgProProPheSerGlnLeuHisArgPheLeuAla                          
900905910                                                                 
GluAspAlaLeuAsnThrVal                                                     
915                                                                       
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 3157 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: both                                                    
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 370..2934                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
GCACGAGCGGCACGAGTCCATGATCTCTTTCCATCCTCCCTTTCCTGTTTGCTCACTTCT60            
TTTCTTGCTCATCTTGGAGACTGTGCAATCCCAGATTAACTACAAACAGAGAAGAGCTGG120           
TGATAGCTCCAGAGCTCAGAGAAAGGAGGTCTCTTTACAAGAAGTCTGGCTCTCAAAGCC180           
TCCATCAAGGGAGACCTACAAGTTGCCTGGGGTTCAGTGCTCTAGAAAGTTCCAAGGTTT240           
GTGGCTTGAATTATTCTAAAGAAGCTGAAATAATTGAAGAGAAGCAGAGGCCAGCTGTTT300           
TTGAGGATCCTGCTCCACAGAGAATGCTCTGCACCCGTTGATACTCCAGTTCCAACACCA360           
TCTTCTGAGATGATCCTGATTCCCAGAATGCTCTTGGTGCTGTTCCTG408                       
MetIleLeuIleProArgMetLeuLeuValLeuPheLeu                                   
1510                                                                      
CTGCTGCCTATCTTGAGTTCTGCAAAAGCTCAGGTTAATCCAGCTATA456                       
LeuLeuProIleLeuSerSerAlaLysAlaGlnValAsnProAlaIle                          
152025                                                                    
TGCCGCTATCCTCTGGGCATGTCAGGAGGCCAGATTCCAGATGAGGAC504                       
CysArgTyrProLeuGlyMetSerGlyGlyGlnIleProAspGluAsp                          
30354045                                                                  
ATCACAGCTTCCAGTCAGTGGTCAGAGTCCACAGCTGCCAAATATGGA552                       
IleThrAlaSerSerGlnTrpSerGluSerThrAlaAlaLysTyrGly                          
505560                                                                    
AGGCTGGACTCAGAAGAAGGGGATGGAGCCTGGTGCCCTGAGATTCCA600                       
ArgLeuAspSerGluGluGlyAspGlyAlaTrpCysProGluIlePro                          
657075                                                                    
GTGGAACCTGATGACCTGAAGGAGTTTCTGCAGATTGACTTGCACACC648                       
ValGluProAspAspLeuLysGluPheLeuGlnIleAspLeuHisThr                          
808590                                                                    
CTCCATTTTATCACTCTGGTGGGGACCCAGGGGCGCCATGCAGGAGGT696                       
LeuHisPheIleThrLeuValGlyThrGlnGlyArgHisAlaGlyGly                          
95100105                                                                  
CATGGCATCGAGTTTGCCCCCATGTACAAGATCAATTACAGTCGGGAT744                       
HisGlyIleGluPheAlaProMetTyrLysIleAsnTyrSerArgAsp                          
110115120125                                                              
GGCACTCGCTGGATCTCTTGGCGGAACCGTCATGGGAAACAGGTGCTG792                       
GlyThrArgTrpIleSerTrpArgAsnArgHisGlyLysGlnValLeu                          
130135140                                                                 
GATGGAAATAGTAACCCCTATGACATTTTCCTAAAGGACTTGGAGCCG840                       
AspGlyAsnSerAsnProTyrAspIlePheLeuLysAspLeuGluPro                          
145150155                                                                 
CCCATTGTAGCCAGATTTGTCCGGTTCATTCCAGTCACCGACCACTCC888                       
ProIleValAlaArgPheValArgPheIleProValThrAspHisSer                          
160165170                                                                 
ATGAATGTGTGTATGAGAGTGGAGCTTTACGGCTGTGTCTGGCTAGAT936                       
MetAsnValCysMetArgValGluLeuTyrGlyCysValTrpLeuAsp                          
175180185                                                                 
GGCTTGGTGTCTTACAATGCTCCAGCTGGGCAGCAGTTTGTACTCCCT984                       
GlyLeuValSerTyrAsnAlaProAlaGlyGlnGlnPheValLeuPro                          
190195200205                                                              
GGAGGTTCCATCATTTATCTGAATGATTCTGTCTATGATGGAGCTGTT1032                      
GlyGlySerIleIleTyrLeuAsnAspSerValTyrAspGlyAlaVal                          
210215220                                                                 
GGATACAGCATGACAGAAGGGCTAGGCCAATTGACCGATGGTGTGTCT1080                      
GlyTyrSerMetThrGluGlyLeuGlyGlnLeuThrAspGlyValSer                          
225230235                                                                 
GGCCTGGACGATTTCACCCAGACCCATGAATACCACGTGTGGCCCGGC1128                      
GlyLeuAspAspPheThrGlnThrHisGluTyrHisValTrpProGly                          
240245250                                                                 
TATGACTATGTGGGCTGGCGGAACGAGAGTGCCACCAATGGCTACATT1176                      
TyrAspTyrValGlyTrpArgAsnGluSerAlaThrAsnGlyTyrIle                          
255260265                                                                 
GAGATCATGTTTGAATTTGACCGCATCAGGAATTTCACTACCATGAAG1224                      
GluIleMetPheGluPheAspArgIleArgAsnPheThrThrMetLys                          
270275280285                                                              
GTCCACTGCAACAACATGTTTGCTAAAGGTGTGAAGATCTTTAAGGAG1272                      
ValHisCysAsnAsnMetPheAlaLysGlyValLysIlePheLysGlu                          
290295300                                                                 
GTACAGTGCTACTTCCGCTCTGAAGCCAGTGAGTGGGAACCTAATGCC1320                      
ValGlnCysTyrPheArgSerGluAlaSerGluTrpGluProAsnAla                          
305310315                                                                 
ATTTCCTTCCCCCTTGTCCTGGATGACGTCAACCCCAGTGCTCGGTTT1368                      
IleSerPheProLeuValLeuAspAspValAsnProSerAlaArgPhe                          
320325330                                                                 
GTCACGGTGCCTCTCCACCACCGAATGGCCAGTGCCATCAAGTGTCAA1416                      
ValThrValProLeuHisHisArgMetAlaSerAlaIleLysCysGln                          
335340345                                                                 
TACCATTTTGCAGATACCTGGATGATGTTCAGTGAGATCACCTTCCAA1464                      
TyrHisPheAlaAspThrTrpMetMetPheSerGluIleThrPheGln                          
350355360365                                                              
TCAGATGCTGCAATGTACAACAACTCTGAAGCCCTGCCCACCTCTCCT1512                      
SerAspAlaAlaMetTyrAsnAsnSerGluAlaLeuProThrSerPro                          
370375380                                                                 
ATGGCACCCACAACCTATGATCCAATGCTTAAAGTTGATGACAGCAAC1560                      
MetAlaProThrThrTyrAspProMetLeuLysValAspAspSerAsn                          
385390395                                                                 
ACTCGGATCCTGATTGGCTGCTTGGTGGCCATCATCTTTATCCTCCTG1608                      
ThrArgIleLeuIleGlyCysLeuValAlaIleIlePheIleLeuLeu                          
400405410                                                                 
GCCATCATTGTCATCATCCTCTGGAGGCAGTTCTGGCAGAAAATGCTG1656                      
AlaIleIleValIleIleLeuTrpArgGlnPheTrpGlnLysMetLeu                          
415420425                                                                 
GAGAAGGCTTCTCGGAGGATGCTGGATGATGAAATGACAGTCAGCCTT1704                      
GluLysAlaSerArgArgMetLeuAspAspGluMetThrValSerLeu                          
430435440445                                                              
TCCCTGCCAAGTGATTCTAGCATGTTCAACAATAACCGCTCCTCATCA1752                      
SerLeuProSerAspSerSerMetPheAsnAsnAsnArgSerSerSer                          
450455460                                                                 
CCTAGTGAACAAGGGTCCAACTCGACTTACGATCGCATCTTTCCCCTT1800                      
ProSerGluGlnGlySerAsnSerThrTyrAspArgIlePheProLeu                          
465470475                                                                 
CGCCCTGACTACCAGGAGCCATCCAGGCTGATACGAAAACTCCCAGAA1848                      
ArgProAspTyrGlnGluProSerArgLeuIleArgLysLeuProGlu                          
480485490                                                                 
TTTGCTCCAGGGGAGGAGGAGTCAGGCTGCAGCGGTGTTGTGAAGCCA1896                      
PheAlaProGlyGluGluGluSerGlyCysSerGlyValValLysPro                          
495500505                                                                 
GTCCAGCCCAGTGGCCCTGAGGGGGTGCCCCACTATGCAGAGGCTGAC1944                      
ValGlnProSerGlyProGluGlyValProHisTyrAlaGluAlaAsp                          
510515520525                                                              
ATAGTGAACCTCCAAGGAGTGACAGGAGGCAACACATACTCAGTGCCT1992                      
IleValAsnLeuGlnGlyValThrGlyGlyAsnThrTyrSerValPro                          
530535540                                                                 
GCCGTCACCATGGACCTGCTCTCAGGAAAAGATGTGGCTGTGGAGGAG2040                      
AlaValThrMetAspLeuLeuSerGlyLysAspValAlaValGluGlu                          
545550555                                                                 
TTCCCCAGGAAACTCCTAACTTTCAAAGAGAAGCTGGGAGAAGGACAG2088                      
PheProArgLysLeuLeuThrPheLysGluLysLeuGlyGluGlyGln                          
560565570                                                                 
TTTGGGGAGGTTCATCTCTGTGAAGTGGAGGGAATGGAAAAATTCAAA2136                      
PheGlyGluValHisLeuCysGluValGluGlyMetGluLysPheLys                          
575580585                                                                 
GACAAAGATTTTGCCCTAGATGTCAGTGCCAACCAGCCTGTCCTGGTG2184                      
AspLysAspPheAlaLeuAspValSerAlaAsnGlnProValLeuVal                          
590595600605                                                              
GCTGTGAAAATGCTCCGAGCAGATGCCAACAAGAATGCCAGGAATGAT2232                      
AlaValLysMetLeuArgAlaAspAlaAsnLysAsnAlaArgAsnAsp                          
610615620                                                                 
TTTCTTAAGGAGATAAAGATCATGTCTCGGCTCAAGGACCCAAACATC2280                      
PheLeuLysGluIleLysIleMetSerArgLeuLysAspProAsnIle                          
625630635                                                                 
ATCCATCTATTATCTGTGTGTATCACTGATGACCCTCTCTGTATGATC2328                      
IleHisLeuLeuSerValCysIleThrAspAspProLeuCysMetIle                          
640645650                                                                 
ACTGAATACATGGAGAATGGAGATCTCAATCAGTTTCTTTCCCGCCAC2376                      
ThrGluTyrMetGluAsnGlyAspLeuAsnGlnPheLeuSerArgHis                          
655660665                                                                 
GAGCCCCCTAATTCTTCCTCCAGCGATGTACGCACTGTCAGTTACACC2424                      
GluProProAsnSerSerSerSerAspValArgThrValSerTyrThr                          
670675680685                                                              
AATCTGAAGTTTATGGCTACCCAAATTGCCTCTGGCATGAAGTACCTT2472                      
AsnLeuLysPheMetAlaThrGlnIleAlaSerGlyMetLysTyrLeu                          
690695700                                                                 
TCCTCTCTTAATTTTGTTCACCGAGATCTGGCCACACGAAACTGTTTA2520                      
SerSerLeuAsnPheValHisArgAspLeuAlaThrArgAsnCysLeu                          
705710715                                                                 
GTGGGTAAGAACTACACAATCAAGATAGCTGACTTTGGAATGAGCAGG2568                      
ValGlyLysAsnTyrThrIleLysIleAlaAspPheGlyMetSerArg                          
720725730                                                                 
AACCTGTACAGTGGTGACTATTACCGGATCCAGGGCCGGGCAGTGCTC2616                      
AsnLeuTyrSerGlyAspTyrTyrArgIleGlnGlyArgAlaValLeu                          
735740745                                                                 
CCTATCCGCTGGATGTCTTGGGAGAGTATCTTGCTGGGCAAGTTCACT2664                      
ProIleArgTrpMetSerTrpGluSerIleLeuLeuGlyLysPheThr                          
750755760765                                                              
ACAGCAAGTGATGTGTGGGCCTTTGGGGTTACTTTGTGGGAGACTTTC2712                      
ThrAlaSerAspValTrpAlaPheGlyValThrLeuTrpGluThrPhe                          
770775780                                                                 
ACCTTTTGTCAAGAACAGCCCTATTCCCAGCTGTCAGATGAACAGGTT2760                      
ThrPheCysGlnGluGlnProTyrSerGlnLeuSerAspGluGlnVal                          
785790795                                                                 
ATTGAGAATACTGGAGAGTTCTTCCGAGACCAAGGGAGGCAGACTTAC2808                      
IleGluAsnThrGlyGluPhePheArgAspGlnGlyArgGlnThrTyr                          
800805810                                                                 
CTCCCTCAACCAGCCATTTGTCCTGACTCTGTGTATAAGCTGATGCTC2856                      
LeuProGlnProAlaIleCysProAspSerValTyrLysLeuMetLeu                          
815820825                                                                 
AGCTGCTGGAGAAGAGATACGAAGAACCGTCCCTCATTCCAAGAAATC2904                      
SerCysTrpArgArgAspThrLysAsnArgProSerPheGlnGluIle                          
830835840845                                                              
CACCTTCTGCTCCTTCAACAAGGCGACGAGTGATGCTGTCAGTGCCTGGC2954                    
HisLeuLeuLeuLeuGlnGlnGlyAspGlu                                            
850855                                                                    
CATGTTCCTACGGCTCAGGTCCTCCCTACAAGACCTACCACTCACCCATGCCTATGCCAC3014          
TCCATCTGGACATTTAATGAAACTGAGAGACAGAGGCTTGTTTGCTTTGCCCTCTTTTCC3074          
TGGTCACCCCCACTCCCTACCCCTGACTCATATATACTTTTTTTTTTTACATTAAAGAAC3134          
TAAAAAAAAAAAAAAAAAAGGCG3157                                               
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 855 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
MetIleLeuIleProArgMetLeuLeuValLeuPheLeuLeuLeuPro                          
151015                                                                    
IleLeuSerSerAlaLysAlaGlnValAsnProAlaIleCysArgTyr                          
202530                                                                    
ProLeuGlyMetSerGlyGlyGlnIleProAspGluAspIleThrAla                          
354045                                                                    
SerSerGlnTrpSerGluSerThrAlaAlaLysTyrGlyArgLeuAsp                          
505560                                                                    
SerGluGluGlyAspGlyAlaTrpCysProGluIleProValGluPro                          
65707580                                                                  
AspAspLeuLysGluPheLeuGlnIleAspLeuHisThrLeuHisPhe                          
859095                                                                    
IleThrLeuValGlyThrGlnGlyArgHisAlaGlyGlyHisGlyIle                          
100105110                                                                 
GluPheAlaProMetTyrLysIleAsnTyrSerArgAspGlyThrArg                          
115120125                                                                 
TrpIleSerTrpArgAsnArgHisGlyLysGlnValLeuAspGlyAsn                          
130135140                                                                 
SerAsnProTyrAspIlePheLeuLysAspLeuGluProProIleVal                          
145150155160                                                              
AlaArgPheValArgPheIleProValThrAspHisSerMetAsnVal                          
165170175                                                                 
CysMetArgValGluLeuTyrGlyCysValTrpLeuAspGlyLeuVal                          
180185190                                                                 
SerTyrAsnAlaProAlaGlyGlnGlnPheValLeuProGlyGlySer                          
195200205                                                                 
IleIleTyrLeuAsnAspSerValTyrAspGlyAlaValGlyTyrSer                          
210215220                                                                 
MetThrGluGlyLeuGlyGlnLeuThrAspGlyValSerGlyLeuAsp                          
225230235240                                                              
AspPheThrGlnThrHisGluTyrHisValTrpProGlyTyrAspTyr                          
245250255                                                                 
ValGlyTrpArgAsnGluSerAlaThrAsnGlyTyrIleGluIleMet                          
260265270                                                                 
PheGluPheAspArgIleArgAsnPheThrThrMetLysValHisCys                          
275280285                                                                 
AsnAsnMetPheAlaLysGlyValLysIlePheLysGluValGlnCys                          
290295300                                                                 
TyrPheArgSerGluAlaSerGluTrpGluProAsnAlaIleSerPhe                          
305310315320                                                              
ProLeuValLeuAspAspValAsnProSerAlaArgPheValThrVal                          
325330335                                                                 
ProLeuHisHisArgMetAlaSerAlaIleLysCysGlnTyrHisPhe                          
340345350                                                                 
AlaAspThrTrpMetMetPheSerGluIleThrPheGlnSerAspAla                          
355360365                                                                 
AlaMetTyrAsnAsnSerGluAlaLeuProThrSerProMetAlaPro                          
370375380                                                                 
ThrThrTyrAspProMetLeuLysValAspAspSerAsnThrArgIle                          
385390395400                                                              
LeuIleGlyCysLeuValAlaIleIlePheIleLeuLeuAlaIleIle                          
405410415                                                                 
ValIleIleLeuTrpArgGlnPheTrpGlnLysMetLeuGluLysAla                          
420425430                                                                 
SerArgArgMetLeuAspAspGluMetThrValSerLeuSerLeuPro                          
435440445                                                                 
SerAspSerSerMetPheAsnAsnAsnArgSerSerSerProSerGlu                          
450455460                                                                 
GlnGlySerAsnSerThrTyrAspArgIlePheProLeuArgProAsp                          
465470475480                                                              
TyrGlnGluProSerArgLeuIleArgLysLeuProGluPheAlaPro                          
485490495                                                                 
GlyGluGluGluSerGlyCysSerGlyValValLysProValGlnPro                          
500505510                                                                 
SerGlyProGluGlyValProHisTyrAlaGluAlaAspIleValAsn                          
515520525                                                                 
LeuGlnGlyValThrGlyGlyAsnThrTyrSerValProAlaValThr                          
530535540                                                                 
MetAspLeuLeuSerGlyLysAspValAlaValGluGluPheProArg                          
545550555560                                                              
LysLeuLeuThrPheLysGluLysLeuGlyGluGlyGlnPheGlyGlu                          
565570575                                                                 
ValHisLeuCysGluValGluGlyMetGluLysPheLysAspLysAsp                          
580585590                                                                 
PheAlaLeuAspValSerAlaAsnGlnProValLeuValAlaValLys                          
595600605                                                                 
MetLeuArgAlaAspAlaAsnLysAsnAlaArgAsnAspPheLeuLys                          
610615620                                                                 
GluIleLysIleMetSerArgLeuLysAspProAsnIleIleHisLeu                          
625630635640                                                              
LeuSerValCysIleThrAspAspProLeuCysMetIleThrGluTyr                          
645650655                                                                 
MetGluAsnGlyAspLeuAsnGlnPheLeuSerArgHisGluProPro                          
660665670                                                                 
AsnSerSerSerSerAspValArgThrValSerTyrThrAsnLeuLys                          
675680685                                                                 
PheMetAlaThrGlnIleAlaSerGlyMetLysTyrLeuSerSerLeu                          
690695700                                                                 
AsnPheValHisArgAspLeuAlaThrArgAsnCysLeuValGlyLys                          
705710715720                                                              
AsnTyrThrIleLysIleAlaAspPheGlyMetSerArgAsnLeuTyr                          
725730735                                                                 
SerGlyAspTyrTyrArgIleGlnGlyArgAlaValLeuProIleArg                          
740745750                                                                 
TrpMetSerTrpGluSerIleLeuLeuGlyLysPheThrThrAlaSer                          
755760765                                                                 
AspValTrpAlaPheGlyValThrLeuTrpGluThrPheThrPheCys                          
770775780                                                                 
GlnGluGlnProTyrSerGlnLeuSerAspGluGlnValIleGluAsn                          
785790795800                                                              
ThrGlyGluPhePheArgAspGlnGlyArgGlnThrTyrLeuProGln                          
805810815                                                                 
ProAlaIleCysProAspSerValTyrLysLeuMetLeuSerCysTrp                          
820825830                                                                 
ArgArgAspThrLysAsnArgProSerPheGlnGluIleHisLeuLeu                          
835840845                                                                 
LeuLeuGlnGlnGlyAspGlu                                                     
850855                                                                    
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 3157 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
CGCCTTTTTTTTTTTTTTTTTTAGTTCTTTAATGTAAAAAAAAAAAGTATATATGAGTCA60            
GGGGTAGGGAGTGGGGGTGACCAGGAAAAGAGGGCAAAGCAAACAAGCCTCTGTCTCTCA120           
GTTTCATTAAATGTCCAGATGGAGTGGCATAGGCATGGGTGAGTGGTAGGTCTTGTAGGG180           
AGGACCTGAGCCGTAGGAACATGGCCAGGCACTGACAGCATCACTCGTCGCCTTGTTGAA240           
GGAGCAGAAGGTGGATTTCTTGGAATGAGGGACGGTTCTTCGTATCTCTTCTCCAGCAGC300           
TGAGCATCAGCTTATACACAGAGTCAGGACAAATGGCTGGTTGAGGGAGGTAAGTCTGCC360           
TCCCTTGGTCTCGGAAGAACTCTCCAGTATTCTCAATAACCTGTTCATCTGACAGCTGGG420           
AATAGGGCTGTTCTTGACAAAAGGTGAAAGTCTCCCACAAAGTAACCCCAAAGGCCCACA480           
CATCACTTGCTGTAGTGAACTTGCCCAGCAAGATACTCTCCCAAGACATCCAGCGGATAG540           
GGAGCACTGCCCGGCCCTGGATCCGGTAATAGTCACCACTGTACAGGTTCCTGCTCATTC600           
CAAAGTCAGCTATCTTGATTGTGTAGTTCTTACCCACTAAACAGTTTCGTGTGGCCAGAT660           
CTCGGTGAACAAAATTAAGAGAGGAAAGGTACTTCATGCCAGAGGCAATTTGGGTAGCCA720           
TAAACTTCAGATTGGTGTAACTGACAGTGCGTACATCGCTGGAGGAAGAATTAGGGGGCT780           
CGTGGCGGGAAAGAAACTGATTGAGATCTCCATTCTCCATGTATTCAGTGATCATACAGA840           
GAGGGTCATCAGTGATACACACAGATAATAGATGGATGATGTTTGGGTCCTTGAGCCGAG900           
ACATGATCTTTATCTCCTTAAGAAAATCATTCCTGGCATTCTTGTTGGCATCTGCTCGGA960           
GCATTTTCACAGCCACCAGGACAGGCTGGTTGGCACTGACATCTAGGGCAAAATCTTTGT1020          
CTTTGAATTTTTCCATTCCCTCCACTTCACAGAGATGAACCTCCCCAAACTGTCCTTCTC1080          
CCAGCTTCTCTTTGAAAGTTAGGAGTTTCCTGGGGAACTCCTCCACAGCCACATCTTTTC1140          
CTGAGAGCAGGTCCATGGTGACGGCAGGCACTGAGTATGTGTTGCCTCCTGTCACTCCTT1200          
GGAGGTTCACTATGTCAGCCTCTGCATAGTGGGGCACCCCCTCAGGGCCACTGGGCTGGA1260          
CTGGCTTCACAACACCGCTGCAGCCTGACTCCTCCTCCCCTGGAGCAAATTCTGGGAGTT1320          
TTCGTATCAGCCTGGATGGCTCCTGGTAGTCAGGGCGAAGGGGAAAGATGCGATCGTAAG1380          
TCGAGTTGGACCCTTGTTCACTAGGTGATGAGGAGCGGTTATTGTTGAACATGCTAGAAT1440          
CACTTGGCAGGGAAAGGCTGACTGTCATTTCATCATCCAGCATCCTCCGAGAAGCCTTCT1500          
CCAGCATTTTCTGCCAGAACTGCCTCCAGAGGATGATGACAATGATGGCCAGGAGGATAA1560          
AGATGATGGCCACCAAGCAGCCAATCAGGATCCGAGTGTTGCTGTCATCAACTTTAAGCA1620          
TTGGATCATAGGTTGTGGGTGCCATAGGAGAGGTGGGCAGGGCTTCAGAGTTGTTGTACA1680          
TTGCAGCATCTGATTGGAAGGTGATCTCACTGAACATCATCCAGGTATCTGCAAAATGGT1740          
ATTGACACTTGATGGCACTGGCCATTCGGTGGTGGAGAGGCACCGTGACAAACCGAGCAC1800          
TGGGGTTGACGTCATCCAGGACAAGGGGGAAGGAAATGGCATTAGGTTCCCACTCACTGG1860          
CTTCAGAGCGGAAGTAGCACTGTACCTCCTTAAAGATCTTCACACCTTTAGCAAACATGT1920          
TGTTGCAGTGGACCTTCATGGTAGTGAAATTCCTGATGCGGTCAAATTCAAACATGATCT1980          
CAATGTAGCCATTGGTGGCACTCTCGTTCCGCCAGCCCACATAGTCATAGCCGGGCCACA2040          
CGTGGTATTCATGGGTCTGGGTGAAATCGTCCAGGCCAGACACACCATCGGTCAATTGGC2100          
CTAGCCCTTCTGTCATGCTGTATCCAACAGCTCCATCATAGACAGAATCATTCAGATAAA2160          
TGATGGAACCTCCAGGGAGTACAAACTGCTGCCCAGCTGGAGCATTGTAAGACACCAAGC2220          
CATCTAGCCAGACACAGCCGTAAAGCTCCACTCTCATACACACATTCATGGAGTGGTCGG2280          
TGACTGGAATGAACCGGACAAATCTGGCTACAATGGGCGGCTCCAAGTCCTTTAGGAAAA2340          
TGTCATAGGGGTTACTATTTCCATCCAGCACCTGTTTCCCATGACGGTTCCGCCAAGAGA2400          
TCCAGCGAGTGCCATCCCGACTGTAATTGATCTTGTACATGGGGGCAAACTCGATGCCAT2460          
GACCTCCTGCATGGCGCCCCTGGGTCCCCACCAGAGTGATAAAATGGAGGGTGTGCAAGT2520          
CAATCTGCAGAAACTCCTTCAGGTCATCAGGTTCCACTGGAATCTCAGGGCACCAGGCTC2580          
CATCCCCTTCTTCTGAGTCCAGCCTTCCATATTTGGCAGCTGTGGACTCTGACCACTGAC2640          
TGGAAGCTGTGATGTCCTCATCTGGAATCTGGCCTCCTGACATGCCCAGAGGATAGCGGC2700          
ATATAGCTGGATTAACCTGAGCTTTTGCAGAACTCAAGATAGGCAGCAGCAGGAACAGCA2760          
CCAAGAGCATTCTGGGAATCAGGATCATCTCAGAAGATGGTGTTGGAACTGGAGTATCAA2820          
CGGGTGCAGAGCATTCTCTGTGGAGCAGGATCCTCAAAAACAGCTGGCCTCTGCTTCTCT2880          
TCAATTATTTCAGCTTCTTTAGAATAATTCAAGCCACAAACCTTGGAACTTTCTAGAGCA2940          
CTGAACCCCAGGCAACTTGTAGGTCTCCCTTGATGGAGGCTTTGAGAGCCAGACTTCTTG3000          
TAAAGAGACCTCCTTTCTCTGAGCTCTGGAGCTATCACCAGCTCTTCTCTGTTTGTAGTT3060          
AATCTGGGATTGCACAGTCTCCAAGATGAGCAAGAAAAGAAGTGAGCAAACAGGAAAGGG3120          
AGGATGGAAAGAGATCATGGACTCGTGCCGCTCGTGC3157                                 
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 6 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
HisArgAspLeuAlaAla                                                        
15                                                                        
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 6 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Peptide                                                     
(B) LOCATION: 5                                                           
(D) OTHER INFORMATION: /note="X can be serine or                          
phenylalanine"                                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
SerAspValTrpXaaTyr                                                        
15                                                                        
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 10 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
ThrTyrAlaXaaProXaaXaaXaaProGly                                            
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
GGAATTCCCAYMGNRAYYTNRCNRCNMG28                                            
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
GGAATTCCYWYNSWGGTNTGSAGNST26                                              
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
HisPheAspProAlaLysAspCysArgTyrAlaLeuGlyMetGlnAsp                          
151015                                                                    
ArgThrIle                                                                 
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
ArgProProPheSerGlnLeuHisArgPheLeuAlaGluAspAlaLeu                          
151015                                                                    
AsnThrVal                                                                 
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
ProAlaMetAlaTrpGluGlyGluProMetArgHisAsnLeu                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
CysTrpSerArgGluSerGluGlnArgProProPheSerGlnLeuHis                          
151015                                                                    
Arg                                                                       
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
ProAsnGlySerAlaTyrSerGlyAspTyrMetGluPro                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 50 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
ProAsnGlySerAlaLeuLeuLeuSerAsnProAlaTyrArgLeuLeu                          
151015                                                                    
LeuAlaThrTyrAlaArgProProArgGlyProGlyProProThrPro                          
202530                                                                    
AlaTrpAlaLysProThrAsnThrGlnAlaTyrSerGlyAspTyrMet                          
354045                                                                    
GluPro                                                                    
50                                                                        
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 44 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
LeuValAlaValLysIleLeuArgProAspAlaThrLysAsnAlaArg                          
151015                                                                    
AsnAspPheLeuLysGluValLysIleMetSerArgLeuLysAspPro                          
202530                                                                    
AsnIleIleArgLeuLeuGlyValCysValGlnAsp                                      
3540                                                                      
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 50 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
LeuValAlaValLysIleLeuArgProAspAlaThrLysAsnAlaSer                          
151015                                                                    
PheSerLeuPheSerArgAsnAspPheLeuLysGluValLysIleMet                          
202530                                                                    
SerArgLeuLysAspProAsnIleIleArgLeuLeuGlyValCysVal                          
354045                                                                    
GlnAsp                                                                    
50                                                                        
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
AsnProXaaTyr                                                              
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
ArgXaaArgArg                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
ProArgGlyProGlyProProThrProAlaTrp                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
ProArgValProIleProProArgProThrArg                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
AlaProProLysLysProProArgProGlyAla                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
ArgProArgProLeuProProLeuProProThr                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
ProThrMetProProProLeuProProValPro                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:26:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
ProAlaTyrProProProProValProValPro                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:27:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
AlaProAlaValProProAlaArgProGlySer                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:28:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
GlyAlaProProValProSerArgProGlyAla                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:29:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
ProProArgProLeuProValAlaProGlySer                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:30:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
ProAlaProAlaLeuProProLysProProLys                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:31:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
AlaProLysProMetProProArgProProLeu                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:32:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
ProAlaLeuProProProProArgProValAla                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:33:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 7 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
XaaProXaaProProXaaPro                                                     
15                                                                        
(2) INFORMATION FOR SEQ ID NO:34:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:                                  
TyrGluLeuMet                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:35:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:                                  
TyrXaaXaaMet                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:36:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:                                  
TyrLeuSerArg                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:37:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:                                  
TyrSerGlyAsp                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:38:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:                                  
TyrMetGluPro                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:39:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 6 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:                                  
GluLysAlaSerArgArg                                                        
15                                                                        
(2) INFORMATION FOR SEQ ID NO:40:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 10 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:                                  
ArgArgLeuLeuSerLysAlaGluArgArg                                            
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:41:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:                                  
ProXaaXaaPro                                                              
1                                                                         
(2) INFORMATION FOR SEQ ID NO:42:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:                                  
ProXaaXaaXaaPro                                                           
15                                                                        
(2) INFORMATION FOR SEQ ID NO:43:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 6 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: unknown                                                     
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:                                  
ProXaaProProXaaPro                                                        
15                                                                        
__________________________________________________________________________

Claims (25)

What is claimed is:
1. A recombinant vector containing a nucleotide sequence that encodes a truncated CCK-2 having an amino acid sequence of SEQ ID NO:4.
2. The recombinant vector of claim 1 in which the vector is a retrovirus vector.
3. An engineered cell line that contains the recombinant DNA vector of claim 1 or 2 and expresses truncated CCK-2.
4. An engineered cell line that contains the recombinant vector of claim 2 and produces infectious retrovirus particles expressing truncated CCK-2.
5. A recombinant truncated CCK-2 receptor protein of SEQ ID NO:4, which lacks one or more amino acid residues in the cytoplasmic domain.
6. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes (a) a polypeptide having the amino acid sequence of SEQ ID NO:4; or (b) a nucleic acid molecule having a nucleotide sequence complementary to the nucleotide sequence of a nucleic acid molecule of (a).
7. An isolated nucleic acid molecule that hybridizes under highly stringent conditions to the nucleic acid molecule of claim 6 and encodes a naturally occurring CCK-2 protein.
8. An isolated nucleic acid molecule comprising a nucleotide sequence that hybridizes under stringent conditions to the nucleic acid of claim 6 and encodes a naturally occurring CCK-2 protein, or an extracellular or kinase domain thereof, linked uninterrupted by stop codons to a nucleotide sequence that encodes a heterologous protein or peptide.
9. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3.
10. A nucleic acid molecule encoding (a) a deletion mutant of SEQ ID NO:4 missing one or more amino acids residues of the extracellular, transmembrane, or cytoplasmic domain; or (b) a nucleic acid molecule having a nucleotide sequence complementary to the nucleotide sequence of a nucleic acid molecule of (a).
11. The nucleic acid molecule of claim 10 wherein the missing amino acid residue(s) is in the tyrosine kinase region of the cytoplasmic domain.
12. The nucleic acid molecule of claim 10 wherein the missing amino acid residue(s) is in the Discoidin I-like region of the extracellular domain.
13. A recombinant vector containing the nucleic acid molecule of claim 10 wherein the vector is a retrovirus vector.
14. A genetically engineered cell line that contains the recombinant vector of claim 13.
15. The engineered cell line of claim 14 that produces infectious retrovirus particles.
16. A nucleic acid molecule encoding (a) a polypeptide corresponding to the extracellular, transmembrane, or cytoplasmic domain of SEQ ID NO:4; or (b) a nucleic acid molecule having a nucleotide sequence complementary to the nucleotide sequence of a nucleic acid molecule of (a).
17. The nucleic acid molecule of claim 16 wherein the encoded polypeptide corresponds to the tyrosine kinase region of the cytoplasmic domain.
18. The nucleic acid molecule of claim 16 wherein the encoded polypeptide corresponds to the Discoidin I-like region of the extracellular domain.
19. A recombinant vector containing the nucleic acid molecule of claim 6, 7, 9, 8, 10 or 16.
20. An expression vector containing the nucleic acid molecule of claim 6, 7, 9, 8, 10 or 16 operatively associated with a regulatory nucleotide sequence containing transcriptional and translational regulatory information that controls expression of the nucleic acid molecule in a host cell.
21. A genetically engineered host cell containing the nucleic acid molecule of claim 6, 7, 9, 8, 10 or 16.
22. A genetically engineered host cell containing the nucleic acid molecule of claim 6, 7, 9, 8, 10 or 16 operatively associated with a regulatory nucleotide sequence containing transcriptional and translational regulatory information that controls expression of the nucleic acid molecule in a host cell.
23. A method for producing recombinant CCK-2, comprising:
(a) culturing a host cell transformed with the expression vector of claim 20 and which expresses the CCK-2; and
(b) recovering the CCK-2 gene product from the cell culture.
24. The genetically engineered host cell of claim 22 in which the host cell is prokaryotic.
25. The genetically engineered host cell of claim 22 in which the host cell is eukaryotic.
US08/336,343 1993-11-16 1994-11-08 Recombinant DNA encoding CCK 2, a receptor tyrosine kinase Expired - Fee Related US5677144A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/336,343 US5677144A (en) 1993-11-16 1994-11-08 Recombinant DNA encoding CCK 2, a receptor tyrosine kinase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/153,397 US6051397A (en) 1993-11-16 1993-11-16 DNA encoding MCK-10, a novel receptor tyrosine kinase
US08/336,343 US5677144A (en) 1993-11-16 1994-11-08 Recombinant DNA encoding CCK 2, a receptor tyrosine kinase

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/153,397 Continuation-In-Part US6051397A (en) 1993-11-16 1993-11-16 DNA encoding MCK-10, a novel receptor tyrosine kinase

Publications (1)

Publication Number Publication Date
US5677144A true US5677144A (en) 1997-10-14

Family

ID=22547060

Family Applications (4)

Application Number Title Priority Date Filing Date
US08/153,397 Expired - Fee Related US6051397A (en) 1993-11-16 1993-11-16 DNA encoding MCK-10, a novel receptor tyrosine kinase
US08/336,343 Expired - Fee Related US5677144A (en) 1993-11-16 1994-11-08 Recombinant DNA encoding CCK 2, a receptor tyrosine kinase
US09/551,188 Expired - Fee Related US6897029B1 (en) 1993-11-16 2000-04-17 MCK-10 a novel receptor tyrosine kinase
US11/135,663 Abandoned US20060147372A1 (en) 1993-11-16 2005-05-24 DNA encoding MCK-10, a novel receptor tyrosine kinase

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/153,397 Expired - Fee Related US6051397A (en) 1993-11-16 1993-11-16 DNA encoding MCK-10, a novel receptor tyrosine kinase

Family Applications After (2)

Application Number Title Priority Date Filing Date
US09/551,188 Expired - Fee Related US6897029B1 (en) 1993-11-16 2000-04-17 MCK-10 a novel receptor tyrosine kinase
US11/135,663 Abandoned US20060147372A1 (en) 1993-11-16 2005-05-24 DNA encoding MCK-10, a novel receptor tyrosine kinase

Country Status (10)

Country Link
US (4) US6051397A (en)
EP (1) EP0909315B1 (en)
AT (1) ATE296351T1 (en)
AU (2) AU8143894A (en)
CA (1) CA2187152A1 (en)
DE (1) DE69434385T2 (en)
DK (1) DK0909315T3 (en)
ES (1) ES2242956T3 (en)
PT (1) PT909315E (en)
WO (2) WO1995014088A1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6190853B1 (en) 1998-09-19 2001-02-20 Eastman Kodak Company Photographic elements containing novel yellow couplers
GB2357084A (en) * 1999-12-06 2001-06-13 Amersham Pharm Biotech Uk Ltd A hydrophobic carrier peptide
US6482607B1 (en) * 1998-06-16 2002-11-19 Rmf Dictagene S.A. Expression vector for use in a one-step purification protocol
US20020177166A1 (en) * 2000-07-12 2002-11-28 Medvet Science Pty.Ltd. Binding motif of a receptor
US6627733B2 (en) * 1993-06-14 2003-09-30 Jeffrey D. Johnson Receptor tyrosine kinase with a discoidin-type binding domain
EP1218404A4 (en) * 1999-09-15 2004-04-07 Medvet Science Pty Ltd A binding motif of a receptor
US20040092469A1 (en) * 2000-01-28 2004-05-13 Shiv Srivastava Androgen-regulated PMEPA1 gene and polypeptides
US20040224386A1 (en) * 1993-11-23 2004-11-11 Baker Kevin P. Protein tyrosine kinases
US20070025997A1 (en) * 2002-04-03 2007-02-01 Usha Nagavarapu Use of biomolecular targets in the treatment and visualization of brain tumors
US20080171045A1 (en) * 2006-12-05 2008-07-17 John Lewicki Compositions and Methods for Diagnosing and Treating Cancer
EP1876186A4 (en) * 2005-03-15 2009-01-07 Takeda Pharmaceutical PROPHYLACTIC / THERAPEUTIC AGENT FOR CANCER
US20110142919A1 (en) * 2000-12-04 2011-06-16 Immunotope, Inc. Cytotoxic T-Lymphocyte-Inducing Immunogens for Prevention, Treatment and Diagnosis of Cancer
EP2295575A3 (en) * 2000-12-04 2011-07-06 Immunotope, Inc. Cytotoxic T-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
KR101462329B1 (en) 2013-01-30 2014-11-21 중앙대학교 산학협력단 Composition comprising promoting agent of juxtamembrane 2 in discoidin domain receptor 2 for preventing and treating cancer
US10293056B1 (en) * 2000-05-24 2019-05-21 Board Of Regents, The University Of Texas System Methods and compositions for non-viral gene therapy for treatment of hyperproliferative diseases
US20200283834A1 (en) * 2017-10-06 2020-09-10 The Regents Of The University Of California Rapid in situ detection of dna and rna

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6022694A (en) * 1997-04-04 2000-02-08 Regeneron Pharmaceuticals, Inc. Assay for ligands to tyrosine kinase receptors
US6365355B1 (en) 2000-03-28 2002-04-02 The Regents Of The University Of California Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches
JP2007508801A (en) * 2003-10-24 2007-04-12 エスバテック・アーゲー Methods for identification and / or confirmation of receptor tyrosine kinase inhibitors
US8372845B2 (en) 2010-09-17 2013-02-12 Novartis Ag Pyrazine derivatives as enac blockers
EP2518157A1 (en) 2011-04-26 2012-10-31 Sanofi Test Systems and methods for identifying a compound altering cellular DDR activity
US8809340B2 (en) 2012-03-19 2014-08-19 Novartis Ag Crystalline form
WO2013155365A1 (en) * 2012-04-12 2013-10-17 University Of Maryland Markers for diagnosing amyotrophic lateral sclerosis
ES2715682T3 (en) 2012-12-19 2019-06-05 Novartis Ag Autotaxin Inhibitors
MX368059B (en) 2013-07-18 2019-09-18 Novartis Ag Autotaxin inhibitors comprising a heteroaromatic ring-benzyl-amide-cycle core.
EP3022201A1 (en) 2013-07-18 2016-05-25 Novartis AG Autotaxin inhibitors
EP3134398A1 (en) 2014-04-24 2017-03-01 Novartis Ag Autotaxin inhibitors
CA3160181A1 (en) 2019-12-17 2021-06-24 The Board Of Regents Of The University Of Texas System Novel ddr1 antibodies and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5004606A (en) * 1986-09-24 1991-04-02 Hybritech Incorporated Non-covalent antibody-anthracycline immunocomplexes
NL8900529A (en) 1989-03-03 1990-10-01 Eurodiagnostics B V METHOD AND KIT FOR DETERMINING TYROSINE PHOSPHORYLATING AND DEPHOSPHORLING ACTIVITY.
CA2062377A1 (en) 1991-03-21 1992-09-22 Mariano Barbacid Method for detection of neuroactive substances
GB9314271D0 (en) * 1993-07-09 1993-08-18 Inst Of Cancer The Research Cell growth factor receptors
EP0730646A1 (en) 1993-11-23 1996-09-11 Genentech, Inc. PROTEIN TYROSINE KINASES NAMED Rse

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Karn et al., Oncogene 8(12): 3433 3440, Dec. 1993. *
Karn et al., Oncogene 8(12): 3433-3440, Dec. 1993.

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6627733B2 (en) * 1993-06-14 2003-09-30 Jeffrey D. Johnson Receptor tyrosine kinase with a discoidin-type binding domain
US20040224386A1 (en) * 1993-11-23 2004-11-11 Baker Kevin P. Protein tyrosine kinases
US7033796B2 (en) 1993-11-23 2006-04-25 Genentech, Inc. Nucleic acids encoding protein tyrosine kinases
US6825324B2 (en) * 1993-11-23 2004-11-30 Genentech, Inc. Antibodies to receptor protein tyrosine kinases
US6482607B1 (en) * 1998-06-16 2002-11-19 Rmf Dictagene S.A. Expression vector for use in a one-step purification protocol
RU2241035C2 (en) * 1998-06-16 2004-11-27 РМФ Диктажен С.А. Expressing construction, expressing vector pedii cs150 and method for producing recombinant polypeptide
US6190853B1 (en) 1998-09-19 2001-02-20 Eastman Kodak Company Photographic elements containing novel yellow couplers
EP1218404A4 (en) * 1999-09-15 2004-04-07 Medvet Science Pty Ltd A binding motif of a receptor
GB2357084A (en) * 1999-12-06 2001-06-13 Amersham Pharm Biotech Uk Ltd A hydrophobic carrier peptide
US7537896B2 (en) 2000-01-28 2009-05-26 Henry M. Jackson Foundation For The Advancement Of Military Medicine Androgen-regulated PMEPA1 gene and polypeptides
US20040092469A1 (en) * 2000-01-28 2004-05-13 Shiv Srivastava Androgen-regulated PMEPA1 gene and polypeptides
US20090176722A9 (en) * 2000-01-28 2009-07-09 Shiv Srivastava Androgen-regulated PMEPA1 gene and polypeptides
US10293056B1 (en) * 2000-05-24 2019-05-21 Board Of Regents, The University Of Texas System Methods and compositions for non-viral gene therapy for treatment of hyperproliferative diseases
US20020177166A1 (en) * 2000-07-12 2002-11-28 Medvet Science Pty.Ltd. Binding motif of a receptor
US20110142919A1 (en) * 2000-12-04 2011-06-16 Immunotope, Inc. Cytotoxic T-Lymphocyte-Inducing Immunogens for Prevention, Treatment and Diagnosis of Cancer
EP2295575A3 (en) * 2000-12-04 2011-07-06 Immunotope, Inc. Cytotoxic T-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
US20070025997A1 (en) * 2002-04-03 2007-02-01 Usha Nagavarapu Use of biomolecular targets in the treatment and visualization of brain tumors
US20090142345A1 (en) * 2005-03-15 2009-06-04 Takeda Pharmaceutical Company Limited Prophylactic/therapeutic agent for cancer
EP1876186A4 (en) * 2005-03-15 2009-01-07 Takeda Pharmaceutical PROPHYLACTIC / THERAPEUTIC AGENT FOR CANCER
US20080171045A1 (en) * 2006-12-05 2008-07-17 John Lewicki Compositions and Methods for Diagnosing and Treating Cancer
US8652472B2 (en) 2006-12-05 2014-02-18 Oncomed Pharmaceuticals, Inc. Compositions and methods for diagnosing and treating cancer
KR101462329B1 (en) 2013-01-30 2014-11-21 중앙대학교 산학협력단 Composition comprising promoting agent of juxtamembrane 2 in discoidin domain receptor 2 for preventing and treating cancer
US20200283834A1 (en) * 2017-10-06 2020-09-10 The Regents Of The University Of California Rapid in situ detection of dna and rna

Also Published As

Publication number Publication date
US6897029B1 (en) 2005-05-24
DE69434385D1 (en) 2005-06-30
US20060147372A1 (en) 2006-07-06
ATE296351T1 (en) 2005-06-15
US6051397A (en) 2000-04-18
WO1995014089A2 (en) 1995-05-26
DK0909315T3 (en) 2005-09-12
AU8143894A (en) 1995-06-06
AU8143994A (en) 1995-06-06
WO1995014088A1 (en) 1995-05-26
CA2187152A1 (en) 1995-05-26
EP0909315A2 (en) 1999-04-21
EP0909315B1 (en) 2005-05-25
PT909315E (en) 2005-10-31
ES2242956T3 (en) 2005-11-16
DE69434385T2 (en) 2006-05-24
WO1995014089A3 (en) 1995-06-15

Similar Documents

Publication Publication Date Title
US5677144A (en) Recombinant DNA encoding CCK 2, a receptor tyrosine kinase
US5811098A (en) Antibodies to HER4, human receptor tyrosine kinase
JP4054373B2 (en) Flk-1 is a receptor for vascular endothelial growth factor
US5674691A (en) Method of screening for ligands to a receptor-type tyrosine kinase
US7189396B1 (en) Delivery system using mAb 3E10 and mutants and/or functional fragments thereof
AU732392B2 (en) Ret ligand (retL) for stimulating neural and renal growth
CA2103323A1 (en) Her4 human receptor tyrosine kinase
US5459061A (en) Hybridomas producing monoclonal antibodies which specifically bind to continuous epitope on the human EGF receptor and compete with EGF for binding to the EGF receptor
Haass et al. Pantophysin is a ubiquitously expressed synaptophysin homologue and defines constitutive transport vesicles.
US20120164141A1 (en) Methods and compositions for inducing apoptosis
JPH05500158A (en) Structural changes in the EGF receptor gene in human gliomas
JPH10512440A (en) Cytokine "LERK-7"
JP2003519463A (en) TCL-1b gene, protein, methods related thereto and substances related thereto
JP2011135886A (en) Binding domain in notch and delta proteins
NZ290253A (en) Lerk-5 cytokine, modification of activity of receptor tyrosine kinase
WO1995013387A1 (en) Tie-2, a novel receptor tyrosine kinase
WO1997032020A9 (en) Shc proteins
CA2173217A1 (en) Novel receptor-type phosphotyrosine phosphatase-sigma
US5804412A (en) Nucleic acids encoding sorting nexins and methods of using same
US5504192A (en) Human insulin receptor endocytic code binding protein
JP2001522589A (en) BMOG, a novel protein member of the myelin oligodendrocyte glycoprotein family and its use for immunomodulatory purposes
US6051690A (en) NSP molecules
JPH10507362A (en) HER4 human receptor tyrosine kinase
WO1996037610A2 (en) Cck-4, a receptor tyrosine kinase, and methods for diagnosis and treatment of cck-4 signal transduction disorders
WO1996012019A9 (en) Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family

Legal Events

Date Code Title Description
AS Assignment

Owner name: MAX PLANCK GESELLSCHAFT ZUR FORDERUNG DER WISSENSC

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ULLRICH, AXEL;ALVES, FRAUKE HILDEGARD ELISABETH;REEL/FRAME:008252/0553;SIGNING DATES FROM 19961002 TO 19961028

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20091014