US5648240A - MHC II analog from Staphylococcus aureus - Google Patents

MHC II analog from Staphylococcus aureus Download PDF

Info

Publication number
US5648240A
US5648240A US08/248,021 US24802194A US5648240A US 5648240 A US5648240 A US 5648240A US 24802194 A US24802194 A US 24802194A US 5648240 A US5648240 A US 5648240A
Authority
US
United States
Prior art keywords
seq
dna
protein
mhc
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/248,021
Inventor
Magnus Hook
Klas Jonsson
Joseph M. Patti
Sivashankarappa Gurusiddappa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Texas A&M University
Original Assignee
Texas A&M University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Texas A&M University filed Critical Texas A&M University
Priority to US08/248,021 priority Critical patent/US5648240A/en
Assigned to TEXAS A & M UNIVERSITY reassignment TEXAS A & M UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GURUSIDDAPPA, SIVASHANKARAPPA, HOOK, MAGNUS, PATTI, JOSEPH M., JONSSON, KLAS
Application granted granted Critical
Publication of US5648240A publication Critical patent/US5648240A/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/82Proteins from microorganisms
    • Y10S530/825Bacteria

Definitions

  • Staphylococci are the leading cause of osteomyelitis, septic arthritis, endocarditis, wound and foreign body infections. What constitutes the challenge in the treatment of staphylococcal infections is that staphylococci may resist treatment with conventional antimicrobial agents because of difficulties in achieving and maintaining therapeutically active concentrations of antibiotics in tissues which are either poorly vascularized (like bone) or harbor colonies of bacteria where diffusion is impaired (such as biofilms on surgical implants).
  • S. aureus strains associate with several other adhesive eukaryotic proteins (many of which belong to the family of adhesive matrix proteins)--laminin (Lopes et al., Science 229:275-277 (1985)), vitronectin (Chhatwal, G. S., et al, Infect Immun. 55:1878-1883 (1987)), bone sialoprotein (Ryden, C., et al., Eur. J. Biochem. 184:331-336 (1989)), proteoglycans (Ryden et al., 1989), endothelial cell membrane protein (Tompkins, D.C., et al., J. Clin. Invest.
  • An object of the present invention is to provide the nucleotide sequence of an MHC II-antigen protein analog gene from Staphylococcus aureus.
  • a further object of the present invention is the provision of the amino acid sequence of an MHC II-antigen protein analog from Staphylococcus aureus.
  • Another object of the present invention is to provide a vaccine for inhibiting staphylococcal infections.
  • An additional object of the present invention is to provide a method for using the MHC II-antigen protein analog from Staphylococcus aureus as an in vivo vaccine for inhibiting staphylococcal infections.
  • a further object of the present invention is to provide a method for using derivatives of the MHC II-antigen protein analog from Staphylococcus aureus as an in vivo vaccine for inhibiting staphylococcal infections.
  • An additional object of the present invention is a method for vaccine production in humans or in animals.
  • nucleotide sequence for gene for the MHC II-antigen protein analog from Staphylococcus aureus and the amino acid sequence for the MHC II-antigen protein analog from Staphylococcus aureus.
  • an in vivo vaccine comprising the entire MHC II antigen protein, or fragments of the protein, alone or in combination with other S. aureus antigens, necessary for the elicitation of therapeutically active antibodies.
  • derivatives of the MHC II-antigen protein analog from Staphylococcus to be used as an in vivo vaccine comprising an intact version of the polypeptide, or biologically active subfragments, alone or in a mixture with other antigens from Gram-positive organisms.
  • a method for using the MHC II-antigen protein analog from Staphylococcus or its derivatives as an in vivo vaccine comprising the steps of expression of the MHC II antigen analog protein in a recombinant system, purification to homogeneity, and immunization using the protein in a pharmaceutically acceptable dispensing agent.
  • Different routes of immunization may be used and various adjuvants may be added so that optimal dosage can be achieved.
  • multiple injections will be used.
  • passive immunization of affected individuals is used if needed.
  • FIG. 1 shows the gene encoding the MHC II-antigen like staphylococcal protein as well as the protein based on the deduced amino acid sequence.
  • the gene is comprised of 2070 nucleotides and codes for a signal sequence (S) that is 30 amino acids long, a segment with a unique sequence (U), and six repeated segments of 100 amino acids each.
  • S signal sequence
  • U segment with a unique sequence
  • the six segments contain a subsegment that is 30 amino acids in length and that has a high degree of similarity with various MHC class II antigens.
  • FIGS. 2A-2K show the entire nucleotide sequence of the gene and the deduced amino acid sequence. Nucleic acid sequence IDs numbers 1 and 2 are indicated.
  • FIG. 3 represents a comparison of the subsegment of the repeat units in the staphylococcal protein and various MHC II sequences. Amino acid Sequence IDs 3 through 8 are indicated.
  • FIG. 4 illustrates the MHC II-antigen like staphylococcal protein gene introduced into the pQE expression vector and used to express the recombinant protein.
  • FIG. 5A, FIG. 5B, and FIG. 5C show the binding of radiolabelled fibronectin and a radiolabelled synthetic peptide (mimicking a vitronectin (Vn) sequence) to the native protein purified as shown, as well as to recombinant version of the protein expressed in E. coli.
  • Lane 1 shows native S. aureus LiCl purified protein
  • lane 2 is sonicated recombinant E. coli clone
  • lane 3 is sonicated E. coli without S. aureus gene.
  • extracellular matrix proteins refers to four general families of macromolecules--collagens, structural glycoproteins, proteoglycans and elastins--that provide support and modulate cellular behavior.
  • MHC Class II antigens or “MHC II antigens” as used herein refers to cell-surface molecules that are responsible for rapid graft rejections and are required for antigen presentation to T-cells.
  • in vivo vaccine refers to immunization of animals with proteins so as to elicit a humoral and cellular response that protects against later exposure to the pathogen.
  • autoimmune diseases refers to an abnormal response against self-antigens.
  • Staphylococcus aureus can bind a number of different extracellular matrix proteins. Recent studies have shown that one particular Staphylococcus protein has the capacity of binding several different matrix proteins. This staphylococcal protein has been found to occur in two different forms, a 68 kD form and a 70 kD form. The gene encoding this staphylococcal protein has been cloned and sequenced. Comparison with existing data bases (Gen Bank EMBL) show that this staphylococcal protein has a high degree of homology with eukaryotic MHC Class II antigens.
  • this protein functionally resembles an MHC II antigen in that it binds synthetic peptides.
  • this protein in addition to mediating bacterial adhesion to extracellular matrix proteins, one may expect this protein to play a role in staphylococcal infections by suppressing the immune system of the host. Therefore, this protein, or derivatives thereof, are useful as important vaccine components for protection against staphylococcal infections.
  • nucleotide sequence (SEQ ID NO:1) that codes for a gene that is transcribed and translated into an MHC II-antigen like staphylococcal protein.
  • amino acid sequence of the MHC II-antigen like staphylococcal protein having the formula of SEQ ID NO:2.
  • an in vivo vaccine against staphylococcal infections comprises an MHC II antigen protein analog which elicits a humoral and cellular response protects against later exposure to the antigen.
  • a method for using the in vivo vaccine involves the steps of expression of the MHC II antigen analog protein in a recombinant system, purification to homogeneity, and immunization using the protein in a pharmaceutically acceptable dispensing agent. Different routes of immunization may be used and various adjuvants may be added so that optimal dosage can be achieved. In order to obtain sufficient levels of antigen in the body, multiple injections will be used. Additionally, passive immunization of affected individuals is used if needed.
  • the S. aureus clinical isolates were provided by the Department of Orthopedics, Bowman Gray School of Medicine, Winston-Salem, N.C., and the Clinical Pathology Laboratory, School of Medicine, University of Alabama at Birmingham (Homonylo-McGavin, M., et.al., Infect. Immun. 61:2479-2485 (1993)).
  • E-coli DH-5 ⁇ (Hanahan, D., J. Mol. Biol. 166:557-580 (1983)) and M15 (Henco, K., The QIAexpressionist, DIAGEN GmbH, Dusseldorf (1991)) were used as bacterial hosts.
  • the plasmid vectors were BluescriptSK(+) (Stratagene Cloning Systems, La Jolla, Calif.) and pQE30 (Henco, K., The QIAexpressionist, DIAGEN GmbH, Dusseldorf (1991)). Chromosomal DNA was prepared from S. aureus FDA 574 as previously described (Marmur, J., J. Mol. Biol. 3:208-218 (1961)).
  • E. coli clones of the strain DH-5 ⁇ were grown in Luria broth (LB), supplemented with ampicillin (100 ⁇ g/ml).
  • the E. coli clone pQE20 (fusion of the pQE30 with the gene of the broad spectrum adhesin), was grown in LB supplemented with ampicillin at a concentration of 100 ⁇ g/ml and kanamycin at a concentration of 25 ⁇ g/ml.
  • the clone was induced for expression of the recombinant gene with 1 mM isoprophyl ⁇ -thiogalactoside (IPTG) for 4 hours.
  • IPTG isoprophyl ⁇ -thiogalactoside
  • S. aureus FDA 574 was grown in LB over night at 37° C. for the subsequent purification of the broad spectrum adhesin.
  • the S. aureus clinical isolates were grown 15 hours in either Tryptic Soy Broth or LB.
  • S. aureus cells were harvested by centrifugation, boiled in PBS 2% sodium dodecylsulfate (SDS) and 5% 2-mercaptoethanol for 3 minutes and loaded onto a SDS-polyacrylamide gel (PAGE) for electrophoresis.
  • SDS sodium dodecylsulfate
  • PAGE SDS-polyacrylamide gel
  • Iodination of ligands were conducted by either the chloramine-T method of Hunter (Hunter, H. and K. M. Wier, Handbook of Experimental Immunology, p. 14.1-14.40 (1968)) or the lactoperoxidase method (Morrison, M., and G. S. Bayse, Biochemistry 9:2995-3000 (1970)) using Enzymobeads (Bio-Rad Laboratories, Hercules, Calif.).
  • Proteins were fractionated by SDS-PAGE using a gradient gel of 3 to 15% acrylamide or a 10% acrylamide SDS-PAGE gel and the buffer system of Laemmli (Nature 227:680-685 (1970)). The proteins were transferred to Immobilon PTM (Millipore, Bedford, Mass.) membranes with the Bio-Rad Trans BlotTM apparatus and the transfer buffer of Towbin et al. (Towbin, H., et al., PNAS 76:4350-54 (1979)). Additional protein binding sites on the membranes were blocked by incubation for 2 hours to 15 hours in phosphobuffered saline (PBS) containing 3% (wt/vol) bovine serum albumin (BSA).
  • PBS phosphobuffered saline
  • BSA bovine serum albumin
  • Membranes were then incubated overnight at 4° C. with gentle agitation in a solution containing 5 ⁇ 10 5 -6 ⁇ 10 7 cpm of 125 I-labeled ligand or in PBS containing 0.1% BSA. Subsequently, the membranes were washed extensively with PBS containing 0.1% TweenTM, air dried, and exposed to Fuji RX-100 X-ray film for anywhere from 12 to 36 hours.
  • LiCl purified protein from S. aureus FDA 574 was blotted to Immobilon PTM and N-terminal sequenced in the Core Facility at Baylor College of Medicine, Houston, Tex.
  • Peptide fragments derived from the broad spectrum adhesin of S. aureus strain Newman were obtained by cleaving the protein with trypsin and purified on FPLC.
  • the N-terminal sequence of the purified peptides were sequenced according to the method in the University of Alabama at Birmingham Cancer Center Protein Analysis and Peptide Synthesis Core Facility.
  • This OMP-70 sequence was not the complete sequence and contained only the four hundred first nucleotides of a gene coding for a putative 70 kD outer surface protein, however, this sequence coded for nearly the same amino acids obtained from peptide sequences derived from the broad spectrum adhesin implicating that the two proteins were very closely related.
  • a 400 nucleotide fragment obtained from the PCR reaction was cloned into Bluescript. DNA was sequenced using the Sanger method (Sanger, F. et.al., PNAS 74:5463-5467 (1978)) with the SequenaseTM DNA sequencing kit (U.S.
  • thermocycling sequencing method using Circum Vent Thermal Cycle Dideoxy DNA Sequencing Kit (New England BioLabs, Beverly, Mass.).
  • sequence coding for the 10 amino acids after the putative signal sequence corresponded exactly to the amino acid sequence obtained from the N-terminal sequence of the LiCl purified protein of S. aureus FDA 574.
  • Additional lambda-gt 11 clones were isolated by using a random prime labeled gene fragment from the cloned 400 bp fragment as a probe in a plaque hybridization assay. The plaques were detected with the ECL system by Amersham. DNA from the lambda plaques were cloned into the Bluescript vector and sequenced with the above mentioned DNA sequencing methods. Various oligonucleotides corresponding to sequences from the Bluescript clones were used as DNA sequencing primers.
  • the primers contain the restriction cleavage sites Bam HI and Sal I respectively (underlined).
  • isogenic mutants are constructed and compared with its parent strains in animals models. Histopathological as well as bacteriological analysis is performed.
  • the gene for the broad spectrum adhesin is inactivated in clinical isolates. Then the mutant as well as the parent strain is tested in an animal model for the disease. In the second type of mutant, the intact gene is introduced into an S. aureus strain that lacks the gene and this transformed strain is compared to its parent strain in the appropriate animal model.
  • allele replacement shuttle vectors containing a temperature sensitive origin of replication, is constructed and introduced in E. coli.
  • the gene for the broad spectrum adhesin is insertionally inactivated by a resistant marker.
  • the shuttle vector is then introduced into the S. aureus strain of interest where the insertionally inactivated gene can recombine into the S. aureus chromosome after raising the temperature of the growth medium.
  • Example 8 The animal models in Example 8 are used for the evaluation of inactivated (deleted) versions of the MHC II analog.
  • the intact MHC II analog as well as various deletions of MHC II and its peptides are used in vaccination trials in the animal models.
  • the MHC II analog is tested in microtiter well assays with macrophages and CD4 T-helper cells.
  • the peptide presenting macrophages/monocytes with their MHC II molecules are "fed” with peptide and mixed with T-helper cells as well as analog.
  • the proliferation of the CD4 T-helper cells is stopped when the analog interferes with the peptide presentation.
  • Macropages fed with the Vn peptide activates the T-helper cells.
  • a determination of whether the analog can interfere in this cell assay system is made. Cell assays of this type are easily visualized under a microscope.
  • Studies of the secretion of cytokines from the T-cells are also conducted using the cell assay.
  • the assay is useful in this context because T-cells produce cytokines when they are stimulated. Secretion levels can be measured by using antibodies directed against the cytokines in microtiter well assays.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Staphylococcus aureus can bind a number of different extracellular matrix proteins. Recent studies have shown that one particular Staphylococcus protein has the capacity of binding several different matrix proteins. The gene encoding this staphylococcal protein has been cloned and sequenced and the nucleic acid and amino acid sequences are provided as a feature of the present invention. This staphylococcal protein has a high degree of homology with eukaryotic MHC Class II antigens. Further analyses of the binding specificities of this protein reveal that it functionally resembles an MHC II antigen in that it binds synthetic peptides. Additionally, the present invention provides a vaccine and an in vivo vaccine against staphylococcal infections, and methods for using same.

Description

The United States government has certain rights in the present invention pursuant to Grant No. HL-47313 from the National Institutes of Health.
BACKGROUND OF THE INVENTION
Development of new antimicrobial agents and improved public health conditions have not substantially reduced the frequency of infections caused by Staphylococcus aureus. Staphylococci are the leading cause of osteomyelitis, septic arthritis, endocarditis, wound and foreign body infections. What constitutes the challenge in the treatment of staphylococcal infections is that staphylococci may resist treatment with conventional antimicrobial agents because of difficulties in achieving and maintaining therapeutically active concentrations of antibiotics in tissues which are either poorly vascularized (like bone) or harbor colonies of bacteria where diffusion is impaired (such as biofilms on surgical implants). Paradoxically, advances in the field of medical therapy have contributed to a steady increase of in the number of infections caused by coagulase-positive and -negative staphylococci by creating more situations in which these opportunistic pathogens find a suitable environment to multiply.
First described by Ogston more than a century ago, S. aureus has remained a mysterious pathogen. It is obvious that its virulence is multifactorial, and related to the production of a wide variety of extracellular and cell surface bound pathogenicity factors. The relative importance of these factors may vary depending on the site and stage of an infection, and various models have been proposed to explain the roles of individual factors. The most effective way to prevent an infection is early in the process of infection, before bacteria manage to multiply.
The concept of preventing infection by interfering with the initial microbial adherence to the host tissue is in this context particularly appealing. The molecular mechanisms of microbial adherence have been extensively studied for many Gram-negative bacteria, and only in the last decade shed some light on possible adhesion mechanisms of Gram-positive bacteria. Historically speaking, the association of S. aureus with fibrinogen (mediated by what was subsequently termed clumping factor, or less correctly, bound coagulase) described by Much in 1908 appears to be the first description of a putative adherence mechanism.
When Kuusela described binding of S. aureus cells to the then newly rediscovered fibronectin, a new chapter in the study of S. aureus adherence was opened (Kuusela, P., et al., Nature 276:718-720 (1978)). Soon, many other observations followed, indicating that 1) fibronectin may be recognized by many different bacteria, both Gram-positive and Gram-negative, and 2) in addition to fibronectin, many other connective tissue proteins are recognized and bound by bacteria. Currently the rate of description of new interactions between bacteria and connective tissue components, or eukaryotic cell surface components like integrins, seems to be limited only by the rate at which these components are discovered.
In addition to fibrinogen and fibronectin, S. aureus strains associate with several other adhesive eukaryotic proteins (many of which belong to the family of adhesive matrix proteins)--laminin (Lopes et al., Science 229:275-277 (1985)), vitronectin (Chhatwal, G. S., et al, Infect Immun. 55:1878-1883 (1987)), bone sialoprotein (Ryden, C., et al., Eur. J. Biochem. 184:331-336 (1989)), proteoglycans (Ryden et al., 1989), endothelial cell membrane protein (Tompkins, D.C., et al., J. Clin. Invest. 85:1323-1327 (1990)) and collagens. These interactions have mostly been studied in systems in which either soluble host proteins or microparticles coated with these proteins are incubated with bacteria. Indications that these bacteria-protein interactions play a role in virulence have been demonstrated in only few instances. Progress in this field has been relatively slow and may require a detailed knowledge of the bacterial components that serve as receptors for the matrix proteins.
As reported in the Apr. 15, 1994 edition of Science, for several years now, medical microbiologists have been tracking an alarming trend in microbial infection. It has been found that antibiotics that once killed bacterial pathogens with ease are becoming ineffective. This is the result of the remarkable ability of bacteria eventually to develop resistance to virtually every antibiotic medical research has utilized against them. Particularly worrisome is the relative dearth of new antibiotics on the horizon. And of the new antibiotics proposed, few employ novel modes of action that would be more difficult for bacteria to circumvent. Researchers and manufacturers have assumed that they have solved the problem of bacterial infection--after all, the market consists of over 100 antibiotics--and many pharmaceutical firms and research organizations have abandoned work on antibiotics or refused to fund these projects.
There are today strains of Staphylococcus which often cause fatal hospital infections that are immune to all but one existing antibiotic. It is predicted that it will not be long before that final barrier will fall.
SUMMARY OF THE INVENTION
An object of the present invention is to provide the nucleotide sequence of an MHC II-antigen protein analog gene from Staphylococcus aureus.
A further object of the present invention is the provision of the amino acid sequence of an MHC II-antigen protein analog from Staphylococcus aureus.
Another object of the present invention is to provide a vaccine for inhibiting staphylococcal infections.
An additional object of the present invention is to provide a method for using the MHC II-antigen protein analog from Staphylococcus aureus as an in vivo vaccine for inhibiting staphylococcal infections.
A further object of the present invention is to provide a method for using derivatives of the MHC II-antigen protein analog from Staphylococcus aureus as an in vivo vaccine for inhibiting staphylococcal infections.
An additional object of the present invention is a method for vaccine production in humans or in animals.
Thus, in accomplishing the foregoing objects, there is provided in accordance with one aspect of the present invention the nucleotide sequence for gene for the MHC II-antigen protein analog from Staphylococcus aureus, and the amino acid sequence for the MHC II-antigen protein analog from Staphylococcus aureus.
In accomplishing an additional object, there further is provided in accordance with the present invention an in vivo vaccine comprising the entire MHC II antigen protein, or fragments of the protein, alone or in combination with other S. aureus antigens, necessary for the elicitation of therapeutically active antibodies.
In a specific embodiment of the present invention, there is provided derivatives of the MHC II-antigen protein analog from Staphylococcus to be used as an in vivo vaccine comprising an intact version of the polypeptide, or biologically active subfragments, alone or in a mixture with other antigens from Gram-positive organisms.
In an additional embodiment of the present invention, there is provided a method for using the MHC II-antigen protein analog from Staphylococcus or its derivatives as an in vivo vaccine comprising the steps of expression of the MHC II antigen analog protein in a recombinant system, purification to homogeneity, and immunization using the protein in a pharmaceutically acceptable dispensing agent. Different routes of immunization may be used and various adjuvants may be added so that optimal dosage can be achieved. In order to obtain sufficient levels of antigen in the body, multiple injections will be used. Additionally, passive immunization of affected individuals is used if needed.
Other and further objects, features and advantages will be apparent and the invention more readily understood from a reading of the following specification and by reference to the accompanying drawings forming a part thereof, wherein the examples of the presently preferred embodiments of the invention are given for the purposes of disclosure.
DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the gene encoding the MHC II-antigen like staphylococcal protein as well as the protein based on the deduced amino acid sequence. The gene is comprised of 2070 nucleotides and codes for a signal sequence (S) that is 30 amino acids long, a segment with a unique sequence (U), and six repeated segments of 100 amino acids each. The six segments contain a subsegment that is 30 amino acids in length and that has a high degree of similarity with various MHC class II antigens.
FIGS. 2A-2K show the entire nucleotide sequence of the gene and the deduced amino acid sequence. Nucleic acid sequence IDs numbers 1 and 2 are indicated.
FIG. 3 represents a comparison of the subsegment of the repeat units in the staphylococcal protein and various MHC II sequences. Amino acid Sequence IDs 3 through 8 are indicated.
FIG. 4 illustrates the MHC II-antigen like staphylococcal protein gene introduced into the pQE expression vector and used to express the recombinant protein.
FIG. 5A, FIG. 5B, and FIG. 5C show the binding of radiolabelled fibronectin and a radiolabelled synthetic peptide (mimicking a vitronectin (Vn) sequence) to the native protein purified as shown, as well as to recombinant version of the protein expressed in E. coli. Lane 1 shows native S. aureus LiCl purified protein, lane 2 is sonicated recombinant E. coli clone and lane 3 is sonicated E. coli without S. aureus gene.
DETAILED DESCRIPTION OF THE INVENTION
It will be readily apparent to one skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
As used herein, the term "extracellular matrix proteins" refers to four general families of macromolecules--collagens, structural glycoproteins, proteoglycans and elastins--that provide support and modulate cellular behavior.
The term "MHC Class II antigens" or "MHC II antigens" as used herein refers to cell-surface molecules that are responsible for rapid graft rejections and are required for antigen presentation to T-cells.
As used herein, the term "in vivo vaccine" refers to immunization of animals with proteins so as to elicit a humoral and cellular response that protects against later exposure to the pathogen.
As used herein, fie term "autoimmune diseases" refers to an abnormal response against self-antigens.
Staphylococcus aureus can bind a number of different extracellular matrix proteins. Recent studies have shown that one particular Staphylococcus protein has the capacity of binding several different matrix proteins. This staphylococcal protein has been found to occur in two different forms, a 68 kD form and a 70 kD form. The gene encoding this staphylococcal protein has been cloned and sequenced. Comparison with existing data bases (Gen Bank EMBL) show that this staphylococcal protein has a high degree of homology with eukaryotic MHC Class II antigens.
Further analyses of the binding specificities of this protein reveal that it functionally resembles an MHC II antigen in that it binds synthetic peptides. Thus, in addition to mediating bacterial adhesion to extracellular matrix proteins, one may expect this protein to play a role in staphylococcal infections by suppressing the immune system of the host. Therefore, this protein, or derivatives thereof, are useful as important vaccine components for protection against staphylococcal infections.
In one embodiment of the present invention there is a nucleotide sequence (SEQ ID NO:1) that codes for a gene that is transcribed and translated into an MHC II-antigen like staphylococcal protein. There is further provided the amino acid sequence of the MHC II-antigen like staphylococcal protein having the formula of SEQ ID NO:2.
In another embodiment of the present invention, an in vivo vaccine against staphylococcal infections is provided. This vaccine comprises an MHC II antigen protein analog which elicits a humoral and cellular response protects against later exposure to the antigen.
Moreover, a method for using the in vivo vaccine is provided. The method involves the steps of expression of the MHC II antigen analog protein in a recombinant system, purification to homogeneity, and immunization using the protein in a pharmaceutically acceptable dispensing agent. Different routes of immunization may be used and various adjuvants may be added so that optimal dosage can be achieved. In order to obtain sufficient levels of antigen in the body, multiple injections will be used. Additionally, passive immunization of affected individuals is used if needed.
The following examples are offered by way of illustration and are not intended to limit the invention in any manner.
EXAMPLE 1 Bacterial strains and plasmids
The S. aureus clinical isolates were provided by the Department of Orthopedics, Bowman Gray School of Medicine, Winston-Salem, N.C., and the Clinical Pathology Laboratory, School of Medicine, University of Alabama at Birmingham (Homonylo-McGavin, M., et.al., Infect. Immun. 61:2479-2485 (1993)).
E-coli DH-5α (Hanahan, D., J. Mol. Biol. 166:557-580 (1983)) and M15 (Henco, K., The QIAexpressionist, DIAGEN GmbH, Dusseldorf (1991)) were used as bacterial hosts. The plasmid vectors were BluescriptSK(+) (Stratagene Cloning Systems, La Jolla, Calif.) and pQE30 (Henco, K., The QIAexpressionist, DIAGEN GmbH, Dusseldorf (1991)). Chromosomal DNA was prepared from S. aureus FDA 574 as previously described (Marmur, J., J. Mol. Biol. 3:208-218 (1961)).
EXAMPLE 2 Media and growth conditions
E. coli clones of the strain DH-5α were grown in Luria broth (LB), supplemented with ampicillin (100 μg/ml). The E. coli clone pQE20 (fusion of the pQE30 with the gene of the broad spectrum adhesin), was grown in LB supplemented with ampicillin at a concentration of 100 μg/ml and kanamycin at a concentration of 25 μg/ml. The clone was induced for expression of the recombinant gene with 1 mM isoprophyl β-thiogalactoside (IPTG) for 4 hours.
S. aureus FDA 574 was grown in LB over night at 37° C. for the subsequent purification of the broad spectrum adhesin. The S. aureus clinical isolates were grown 15 hours in either Tryptic Soy Broth or LB.
EXAMPLE 3 Solubilization of S. aureus proteins
Overnight cultures of S. aureus cells were harvested by centrifugation, boiled in PBS 2% sodium dodecylsulfate (SDS) and 5% 2-mercaptoethanol for 3 minutes and loaded onto a SDS-polyacrylamide gel (PAGE) for electrophoresis.
EXAMPLE 4 Lithium chloride extraction of the extracellular matrix protein with broad specificity
Overnight grown bacterial cultures of S. aureus FDA 574 were harvested by centrifugation (3,600×g, 20 min) and resuspended in 1/10 volume of 1M LiCl (pH 6.0). The cell suspension was incubated at 45° C. for 2 hours with gentle agitation. Subsequently, the cells were removed by centrifugation (3,600×g 30 min), and the supernatant containing the solubilized protein was collected. The protein was precipitated from the LiCl extracts by addition of ammonium sulfate to a final concentration of 60% (wt/vol), followed by gentle stirring overnight at 4° C. The precipitated protein was recovered by centrifugation (15000×g, 30 min), and the pellet was resuspended in a minimal volume of 10 mM Tris-HCl, pH 7.5.
EXAMPLE 5 Iodination of ligands
Iodination of ligands were conducted by either the chloramine-T method of Hunter (Hunter, H. and K. M. Wier, Handbook of Experimental Immunology, p. 14.1-14.40 (1968)) or the lactoperoxidase method (Morrison, M., and G. S. Bayse, Biochemistry 9:2995-3000 (1970)) using Enzymobeads (Bio-Rad Laboratories, Hercules, Calif.).
EXAMPLE 6 Detection of the broad spectrum component by Western blotting
Proteins were fractionated by SDS-PAGE using a gradient gel of 3 to 15% acrylamide or a 10% acrylamide SDS-PAGE gel and the buffer system of Laemmli (Nature 227:680-685 (1970)). The proteins were transferred to Immobilon P™ (Millipore, Bedford, Mass.) membranes with the Bio-Rad Trans Blot™ apparatus and the transfer buffer of Towbin et al. (Towbin, H., et al., PNAS 76:4350-54 (1979)). Additional protein binding sites on the membranes were blocked by incubation for 2 hours to 15 hours in phosphobuffered saline (PBS) containing 3% (wt/vol) bovine serum albumin (BSA). Membranes were then incubated overnight at 4° C. with gentle agitation in a solution containing 5×105 -6×107 cpm of 125 I-labeled ligand or in PBS containing 0.1% BSA. Subsequently, the membranes were washed extensively with PBS containing 0.1% Tween™, air dried, and exposed to Fuji RX-100 X-ray film for anywhere from 12 to 36 hours.
EXAMPLE 6 Amino acid sequencing
LiCl purified protein from S. aureus FDA 574 was blotted to Immobilon P™ and N-terminal sequenced in the Core Facility at Baylor College of Medicine, Houston, Tex. Peptide fragments derived from the broad spectrum adhesin of S. aureus strain Newman were obtained by cleaving the protein with trypsin and purified on FPLC. The N-terminal sequence of the purified peptides were sequenced according to the method in the University of Alabama at Birmingham Cancer Center Protein Analysis and Peptide Synthesis Core Facility.
EXAMPLE 7 Cloning and DNA sequencing
Polyclonal antibodies raised in rabbits against purified S. aureus (FDA 574) broad spectrum adhesin were used to screen a lambda-gt 11 gene library (CLONTECH Laboratories, Inc., Palo Alto, Calif.) of the S. aureus FDA 574 strain. One clone with a 5.7 kb insert was detected and was subsequently used as a template for Polymerase Chain Reaction (PCR) analysis using a primer pair with sequences derived from the S. aureus 25923 OMP-70 sequence (SwissProt Database #P21223). This OMP-70 sequence was not the complete sequence and contained only the four hundred first nucleotides of a gene coding for a putative 70 kD outer surface protein, however, this sequence coded for nearly the same amino acids obtained from peptide sequences derived from the broad spectrum adhesin implicating that the two proteins were very closely related. A 400 nucleotide fragment obtained from the PCR reaction was cloned into Bluescript. DNA was sequenced using the Sanger method (Sanger, F. et.al., PNAS 74:5463-5467 (1978)) with the Sequenase™ DNA sequencing kit (U.S. Biochemical, Cleveland, Ohio) and the thermocycling sequencing method using Circum Vent Thermal Cycle Dideoxy DNA Sequencing Kit (New England BioLabs, Beverly, Mass.). The sequence coding for the 10 amino acids after the putative signal sequence corresponded exactly to the amino acid sequence obtained from the N-terminal sequence of the LiCl purified protein of S. aureus FDA 574.
Additional lambda-gt 11 clones were isolated by using a random prime labeled gene fragment from the cloned 400 bp fragment as a probe in a plaque hybridization assay. The plaques were detected with the ECL system by Amersham. DNA from the lambda plaques were cloned into the Bluescript vector and sequenced with the above mentioned DNA sequencing methods. Various oligonucleotides corresponding to sequences from the Bluescript clones were used as DNA sequencing primers.
The construction of the recombinant plasmid pQE20, containing the gene for the broad spectrum adhesin fused to the 6 histidine residues tag of pQE30, was obtained by inserting a 2 kb DNA fragment amplified from chromosomal S. aureus FDA 574 DNA into the cleavage sites Bam HI/Sal I of plasmid pQE 30. The primers ZPCR6 5'CGGGATCCGCAGCTAAGCAAATAGATA (SEQ ID NO:24) 3' and ZPCR9 5'GCGTCGACGCGGCAAATCACTTCAAGT (SEQ ID NO:25) were used in the PCR reaction. The primers contain the restriction cleavage sites Bam HI and Sal I respectively (underlined).
EXAMPLE 8 Evaluation of the MHC II-antigen protein analog gene from Staphylococcus aureus as a virulence factor
In order to evaluate the importance of the broad spectrum adhesin as a virulence factor in staphylococcal-induced diseases such as septic arthritis osteomyelitis and endocarditis, isogenic mutants are constructed and compared with its parent strains in animals models. Histopathological as well as bacteriological analysis is performed.
In the first class of mutants, the gene for the broad spectrum adhesin is inactivated in clinical isolates. Then the mutant as well as the parent strain is tested in an animal model for the disease. In the second type of mutant, the intact gene is introduced into an S. aureus strain that lacks the gene and this transformed strain is compared to its parent strain in the appropriate animal model.
Methods: For the first class of mutations, allele replacement shuttle vectors, containing a temperature sensitive origin of replication, is constructed and introduced in E. coli. In these constructions, the gene for the broad spectrum adhesin is insertionally inactivated by a resistant marker. The shuttle vector is then introduced into the S. aureus strain of interest where the insertionally inactivated gene can recombine into the S. aureus chromosome after raising the temperature of the growth medium. A detailed description of this methodology is described in Patti, J., et al., Infection and Immunity, 62:152-61 (1994).
EXAMPLE 9 Evaluation of inactivated versions of the MHC H-antigen protein analog gene from Staphylococcus aureus as a potential vaccine
The animal models in Example 8 are used for the evaluation of inactivated (deleted) versions of the MHC II analog. The intact MHC II analog as well as various deletions of MHC II and its peptides are used in vaccination trials in the animal models.
Methods: Different parts of the gene are expressed and the gene products are tested for their binding capacity to the different extracellular matrix proteins. Synthetic peptides mimicking the 30 amino acid subsegments of the MHC II molecules are also used. For example, the minimal stretch of amino acids in the broad spectrum adhesin for binding to the various extracellular proteins is characterized, and the binding capacity of the synthetic peptides are compared to it. Further, modifications of the synthetic peptides are made by conventional means and tested for higher binding capacity. All these different constructions are then used to immunize animals, and the antibodies are tested for inhibitory capacity of the binding of S. aureus to various extracellular matrix proteins. The animals are then challenged with the clinical S. aureus isolates and evaluated for the incidence of infection by histopathological examination and bacteriological analysis of the tissues.
EXAMPLE 10 The ability of the MHC II analog to interfere with MHC II dependent antigen
The MHC II analog is tested in microtiter well assays with macrophages and CD4 T-helper cells. The peptide presenting macrophages/monocytes with their MHC II molecules are "fed" with peptide and mixed with T-helper cells as well as analog. The proliferation of the CD4 T-helper cells is stopped when the analog interferes with the peptide presentation. Macropages fed with the Vn peptide activates the T-helper cells. A determination of whether the analog can interfere in this cell assay system is made. Cell assays of this type are easily visualized under a microscope. Studies of the secretion of cytokines from the T-cells are also conducted using the cell assay. The assay is useful in this context because T-cells produce cytokines when they are stimulated. Secretion levels can be measured by using antibodies directed against the cytokines in microtiter well assays.
All patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
One skilled in the art will appreciate readily that the present invention is will adapted to carry out the objects and attain the ends and advantages mentioned as well as those inherent therein. The sequences, methods, procedures and techniques described herein are presently representative of the preferred embodiments and are intended to be exemplary and ar not intended as limitations of the scope. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention or defined by the scope of the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 25                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 2433 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
AAAAAATAGAGAAAGTCTGGCTATAATTAAGTTGCAATCACGAATTATCATAAAAAAGGA60            
GTGATAATTTATGAAATTTAAGTCATTGATTACAACAACATTAGCATTAGGCGTTATAGC120           
ATCAACAGGAGCAAACTTAGATACTAACGAAGCATCTGCCGCAGCTAAGCAAATAGATAA180           
ATCATCAAGTTCATTACACCATGGATATTCTAAAATACAGATTCCATATACAATCACTGT240           
GAATGGTACAAGCCAAAACATTTTATCAAGCTTAACATTTAATAAGAATCAACAAATTAG300           
TTATAAAGATATAGAGAATAAAGTTAAATCAGTTTTATACTTTAATAGAGGTATTAGTGA360           
TATCGATTTAAGACTTTCTAAGCAAGCAAAATACACGGTTCATTTTAAGAATGGAACAAA420           
AAGAGTTGTCGATTTGAAAGCAGGCATTCACACAGCTGACTTAATCAATACAAGTGACAT480           
TAAAGCAATTAGTGTTAACGTAGATACTAAAAAGCAAGTGAAAGATAAAGAGGCAAAAGC540           
AAATGTTCAAGTGCCGTATACAATCACTGTGAATGGTACAAGCCAAAACATTTTATCAAA600           
CTTAACATTTAAAAAGAATCAGCAAATTAGTTATAAAGATTTAGAGAATAATGTAAAATC660           
AGTTTTAAAATCAAACAGAGGTATAACTGATGTAGATTTAAGACTTTCAAAACAAGCGAA720           
ATTTACAGTTAATTTTAAAAATGGCACGAAAAAAGTTATCGATTTGAAAGCAGGCATTTA780           
TACAGCGAACTTAATCAATACAGGCGGTATTAAAAATATCAATATAAATGTAGAAACTAA840           
AAAGCAAGCGAAAGATAAAGAAGCAAAAGTAAATAATCAAGTGCCATATTCAATTAATTT900           
AAATGGTACAACAACTAATATTCAATCTAATTTAGCATTTTCAAATAAACCTTGGACAAA960           
TTACAAAAATTTAACAACAAAGGTAAAATCAGTATTGAAATCTGACAGAGGCGTTAGTGA1020          
ACGTGATTTGAAACACGCAAAGAAAGCGTATTACACTGTTTACTTTAAAAATGGTGGTAA1080          
AAGAGTGATACATTTAAACTCGAATATTTATACAGCTAACTTAGTTCATGCGAAAGATGT1140          
TAAGAGAATTGAAGTTACTGTAAAAACAGTTTCGAAAGTAAAAGCGGAGCGTTATGTACC1200          
ATATACAATTGCAGTAAATGGAGCATCAAATCCAACTTTATCAGATTTAAAATTTACAGG1260          
TGACTCACGTGTAAGCTACAGTGATATCAAGAAAAAAGTTAAATCAGTATTGAAACATGA1320          
TAGAGGTATCGGTGAACGTGAATTAAAATATGCCGAAAAAGCAACTTATACAGTACATTT1380          
TAAAAATGGAACAAAAAAAGTGATTAATTTAAACTCTAATATTAGTCAACTGAATCTGCT1440          
TTATGTCAAAGATATTAAAAATATAGATATCGATGTTAAAACTGGGGCAAAAGCGAAAGT1500          
CTATAGCTATGTACCATACACAATCGCAGTAAATGGGACAACAACACCTATTGCATCAAA1560          
ACTAAAACTTTCGAATAAACAATTAATTGGTTATCAAGATTTAAATAAAAAAGTTAAATC1620          
AGTTTTAAAACATGATAGAGGTATCAATGATATTGAATTGAAATTTGCGAAACAAGCAAA1680          
GTATACTATACACTTTAAAAATGGAAAGACACAAGTCGTTGACCTTAAATCAGATATCTT1740          
TACAAGAAATTTATTCAGTGTCAAAGATATTAAAAAGATTGATATTAATGTGAAACAACA1800          
ATCTAAATCTAATAAAGCGCTTAATAAAGTGACTAACAAAGCGACTAAAGTGAAGTTTCC1860          
AGTAACGATAAATGGATTTTCAAATTTAGTTTCAAATGAATTTGCGTTTTTACATCCACA1920          
TAAAATAACAACAAACGACTTGAATGCTAAACTTAGACTAGCGTTACGAAGCGATCAAGG1980          
TATTACTAAACATGATATTGGACTTTCTGAACGCACTGTGTATAAAGTGTATTTTAAAGA2040          
CGGATCATCAAAATTAGAAGACTTAAAAGCTGCGAAACAAGATTCAAAAGTATTTAAAGC2100          
AACTGACATTAAAAAAGTAGACATTGAAATTAAATTTTAATCTTTAATTTTATATTAAGG2160          
CATCTCACAATAGTGGGGTGCCTTTTACATTTGTAGAGATGTGATACTTGAAGTGATTTG2220          
CCGCACGTTTGATAAATTTATCTAAGGCATATCAAGTTATGTTAGGAGAGATGTATAAAA2280          
CTAATTAGGTATAGCGATTGACAAGTTGCTGAATAAAATATATCTTTTGATGCTTTGAAA2340          
GAAGGAATAATTTTAAAAATAAAAAACCAATAATCCGAGTCATACTCATCAGATTATTGG2400          
TTGAAATTAATTATCTTAAGTCATCAATTCTTT2433                                     
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 689 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetLysPheLysSerLeuIleThrThrThrLeuAlaLeuGlyValIle                          
151015                                                                    
AlaSerThrGlyAlaAsnLeuAspThrAsnGluAlaSerAlaAlaAla                          
202530                                                                    
LysGlnIleAspLysSerSerSerSerLeuHisHisGlyTyrSerLys                          
354045                                                                    
IleGlnIleProTyrThrIleThrValAsnGlyThrSerGlnAsnIle                          
505560                                                                    
LeuSerSerLeuThrPheAsnLysAsnGlnGlnIleSerTyrLysAsp                          
65707580                                                                  
IleGluAsnLysValLysSerValLeuTyrPheAsnArgGlyIleSer                          
859095                                                                    
AspIleAspLeuArgLeuSerLysGlnAlaLysTyrThrValHisPhe                          
100105110                                                                 
LysAsnGlyThrLysArgValValAspLeuLysAlaGlyIleHisThr                          
115120125                                                                 
AlaAspLeuIleAsnThrSerAspIleLysAlaIleSerValAsnVal                          
130135140                                                                 
AspThrLysLysGlnValLysAspLysGluAlaLysAlaAsnValGln                          
145150155160                                                              
ValProTyrThrIleThrValAsnGlyThrSerGlnAsnIleLeuSer                          
165170175                                                                 
AsnLeuThrPheLysLysAsnGlnGlnIleSerTyrLysAspLeuGlu                          
180185190                                                                 
AsnAsnValLysSerValLeuLysSerAsnArgGlyIleThrAspVal                          
195200205                                                                 
AspLeuArgLeuSerLysGlnAlaLysPheThrValAsnPheLysAsn                          
210215220                                                                 
GlyThrLysLysValIleAspLeuLysAlaGlyIleTyrThrAlaAsn                          
225230235240                                                              
LeuIleAsnThrGlyGlyIleLysAsnIleAsnIleAsnValGluThr                          
245250255                                                                 
LysLysGlnAlaLysAspLysGluAlaLysValAsnAsnGlnValPro                          
260265270                                                                 
TyrSerIleAsnLeuAsnGlyThrThrThrAsnIleGlnSerAsnLeu                          
275280285                                                                 
AlaPheSerAsnLysProTrpThrAsnTyrLysAsnLeuThrThrLys                          
290295300                                                                 
ValLysSerValLeuLysSerAspArgGlyValSerGluArgAspLeu                          
305310315320                                                              
LysHisAlaLysLysAlaTyrTyrThrValTyrPheLysAsnGlyGly                          
325330335                                                                 
LysArgValIleHisLeuAsnSerAsnIleTyrThrAlaAsnLeuVal                          
340345350                                                                 
HisAlaLysAspValLysArgIleGluValThrValLysThrValSer                          
355360365                                                                 
LysValLysAlaGluArgTyrValProTyrThrIleAlaValAsnGly                          
370375380                                                                 
AlaSerAsnProThrLeuSerAspLeuLysPheThrGlyAspSerArg                          
385390395400                                                              
ValSerTyrSerAspIleLysLysLysValLysSerValLeuLysHis                          
405410415                                                                 
AspArgGlyIleGlyGluArgGluLeuLysTyrAlaGluLysAlaThr                          
420425430                                                                 
TyrThrValHisPheLysAsnGlyThrLysLysValIleAsnLeuAsn                          
435440445                                                                 
SerAsnIleSerGlnLeuAsnLeuLeuTyrValLysAspIleLysAsn                          
450455460                                                                 
IleAspIleAspValLysThrGlyAlaLysAlaLysValTyrSerTyr                          
465470475480                                                              
ValProTyrThrIleAlaValAsnGlyThrThrThrProIleAlaSer                          
485490495                                                                 
LysLeuLysLeuSerAsnLysGlnLeuIleGlyTyrGlnAspLeuAsn                          
500505510                                                                 
LysLysValLysSerValLeuLysHisAspArgGlyIleAsnAspIle                          
515520525                                                                 
GluLeuLysPheAlaLysGlnAlaLysTyrThrIleHisPheLysAsn                          
530535540                                                                 
GlyLysThrGlnValValAspLeuLysSerAspIlePheThrArgAsn                          
545550555560                                                              
LeuPheSerValLysAspIleLysLysIleAspIleAsnValLysGln                          
565570575                                                                 
GlnSerLysSerAsnLysAlaLeuAsnLysValThrAsnLysAlaThr                          
580585590                                                                 
LysValLysPheProValThrIleAsnGlyPheSerAsnLeuValSer                          
595600605                                                                 
AsnGluPheAlaPheLeuHisProHisLysIleThrThrAsnAspLeu                          
610615620                                                                 
AsnAlaLysLeuArgLeuAlaLeuArgSerAspGlnGlyIleThrLys                          
625630635640                                                              
HisAspIleGlyLeuSerGluArgThrValTyrLysValTyrPheLys                          
645650655                                                                 
AspGlySerSerLysLeuGluAspLeuLysAlaAlaLysGlnAspSer                          
660665670                                                                 
LysValPheLysAlaThrAspIleLysLysValAspIleGluIleLys                          
675680685                                                                 
Phe                                                                       
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
AspIleAspLeuArgLeuSerLysGlnAlaLysTyrThrValHisPhe                          
151015                                                                    
LysAsnGlyThrLysArgValValAspLeuLysAlaGlyIleHis                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
AspValAspLeuArgLeuSerLysGlnAlaLysPheThrValAsnPhe                          
151015                                                                    
LysAsnGlyThrLysLysValIleAspLeuLysAlaGlyIleTyr                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
GluArgAspLeuLysHisAlaLysLysAlaTyrTyrThrValTyrPhe                          
151015                                                                    
LysAsnGlyGlyLysArgValIleHisLeuAsnSerAsnIleTyr                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 32 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
GlyGluArgGluLeuLysTyrAlaGluLysAlaThrTyrThrValHis                          
151015                                                                    
PheLysAsnGlyThrLysLysValIleAsnLeuAsnSerAsnIleSer                          
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
AspIleGluLeuLysPheAlaLysGlnAlaLysTyrThrIleHisPhe                          
151015                                                                    
LysAsnGlyLysThrGlnValValAspLeuLysSerAspIlePhe                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
LysHisAspIleGlyLeuSerGluArgThrValTyrLysValTyrPhe                          
151015                                                                    
LysAspGlySerSerLysLeuGluAspLeuLysAlaAlaLysGln                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
GlnGlnAspLysTyrGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgPheLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
GlnGlnAspLysTyrGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgPheLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
GlnGlnAspLysTyrGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgPheLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
GlyAspThrGlnProArgPheLeuGluGlnAlaLysCysGluCysHis                          
151015                                                                    
PheLeuAsnGlyThrGluArgValTrpAsnLeu                                         
2025                                                                      
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
AspThrGlnProArgPheLeuLysGlnAspLysPheGluCysHisPhe                          
151015                                                                    
PheAsnGlyThrGluArgValArgTyrLeuHisArgGlyIleTyr                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
GlyAspThrGlnProArgPheLeuGluGlnAlaLysCysGluCysHis                          
151015                                                                    
PheLeuAsnGlyThrGluArgValTrpAsnLeu                                         
2025                                                                      
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
ArgPheLeuLysGlnAspLysPheGluCysHisPhePheAsnGlyThr                          
151015                                                                    
GluArgValArgTyrLeuHisArgGlyIleTyr                                         
2025                                                                      
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
LysGlnAspLysPheGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgTyrLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
LysGlnAspLysPheGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgTyrLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
LysGlnAspLysPheGluCysTyrPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgTyrLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
AspThrArgProArgPheLeuGlnGlnAspLysTyrGluCysHisPhe                          
151015                                                                    
PheAsnGlyThrGluArgValArgPheLeuHisArgGlyIleTyr                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
AspThrArgProArgPheLeuGlnGlnAspLysTyrGluCysHisPhe                          
151015                                                                    
PheAsnGlyThrGluArgValArgPheLeuHisArgAspIleTyr                             
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
LysGlnGluLysTyrGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgPheLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
LysGlnAspLysTyrGluCysHisPhePheAsnGlyThrGluArgVal                          
151015                                                                    
ArgTyrLeuHisArgGlyIleTyr                                                  
20                                                                        
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
ArgPheLeuGluGlnAlaLysHisGluCysHisPheTyrAsnGlyThr                          
151015                                                                    
GlnArgValArgPheLeuLeuArgGlnIleHis                                         
2025                                                                      
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
CGGGATCCGCAGCTAAGCAAATAGATA27                                             
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
GCGTCGACGCGGCAAATCACTTCAAGT27                                             
__________________________________________________________________________

Claims (23)

We claim:
1. A DNA segment comprising an isolated gene encoding a Staphylococcus aureus broad spectrum adhesin that has a molecular weight of about 70 kDa as determined by SDS gel electrophoresis, said adhesin capable of binding fibronectin or vitronectin wherein said adhesin comprises a MHC II mimicking unit of about 30 amino acids.
2. The DNA of SEQ ID NO:1 or fragment thereof that encodes a protein or peptide that is capable of binding fibronectin or vitronectin or that comprises a MHC II mimicking unit of about 30 amino acids.
3. The DNA of claim 2 that encodes a protein or peptide that encompasses a MHC II mimicking unit.
4. The DNA of claim 2 that encodes a protein or peptide that binds to fibronectin or vitronectin.
5. The DNA of claim 2, comprising a gene that encodes a protein of about 689 amino acids in length.
6. The DNA of claim 2, positioned under the control of a promoter.
7. A recombinant vector comprising the DNA segment of claim 2.
8. The vector of claim 7, further defined as pQE20.
9. A recombinant host cell transformed with the vector of claim 7.
10. The recombinant host cell of claim 9, further defined as a bacterial host cell.
11. The recombinant host cell of claim 10, wherein the bacterial host cell is E. coli.
12. The recombinant host cell of claim 9, that expresses the polypeptide encoded by the DNA of claim 2.
13. A fragment of the DNA sequence of SEQ ID NO:1 that hybridizes to the DNA sequence of claim 2.
14. The DNA of claim 13, wherein the segment is SEQ ID NO:1.
15. The DNA of claim 13, that is the complement of SEQ ID NO:1.
16. The DNA of claim 13, wherein the segment comprises residues 71 to 2134 of FIG. 2.
17. The DNA of claim 13, which encodes an amino acid sequence set forth by any one of SEQ ID NOS:2, 3, 4, 5, 6, 7, or 8.
18. An isolated nucleic acid composition comprising the DNA sequence of SEQ ID NO:1 or the complement thereof in a suitable buffer.
19. A composition comprising a protein or polypeptide encoded by the DNA of claim 2 and a pharmaceutically acceptable excipient.
20. The composition of claim 19, comprising a peptide that consists of the amino sequence of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
21. A method of inducing an immune response in an animal comprising administering to an animal an immunogenic composition comprising the composition of claim 19 and a pharmaceutically acceptable dispensing agent.
22. A method of making a MHC II-antigen protein analog comprising the steps of inserting the DNA of SEQ ID NO:1 in a suitable expression vector and culturing a host cell transformed with said vector under conditions to produce said MHC II-antigen protein analog.
23. A method of inducing an immune response to Staphylococcus aureus comprising the steps of administering to an individual suspected of being susceptible to or having a staphylococcal infection a pharmaceutically acceptable composition in accordance with claim 19.
US08/248,021 1994-05-24 1994-05-24 MHC II analog from Staphylococcus aureus Expired - Lifetime US5648240A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/248,021 US5648240A (en) 1994-05-24 1994-05-24 MHC II analog from Staphylococcus aureus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/248,021 US5648240A (en) 1994-05-24 1994-05-24 MHC II analog from Staphylococcus aureus

Publications (1)

Publication Number Publication Date
US5648240A true US5648240A (en) 1997-07-15

Family

ID=22937325

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/248,021 Expired - Lifetime US5648240A (en) 1994-05-24 1994-05-24 MHC II analog from Staphylococcus aureus

Country Status (1)

Country Link
US (1) US5648240A (en)

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012131A1 (en) * 1998-08-31 2000-03-09 Inhibitex, Inc. Multicomponent vaccines
WO2000012132A1 (en) * 1998-08-31 2000-03-09 Inhibitex, Inc. Staphylococcal immunotherapeutics via donor selection and donor stimulation
US6086895A (en) * 1988-05-20 2000-07-11 Alfa Laval Agri International Fibronectin binding protein
WO2002034788A1 (en) * 2000-10-20 2002-05-02 Inhibitex, Inc. Monoclonal antibodies to the map protein and method of use in treating or preventing infections
US20020159997A1 (en) * 1998-08-31 2002-10-31 Patti Joseph M. Staphylococcal immunotherapeutics via donor selection and donor stimulation
WO2002077010A3 (en) * 2001-01-10 2003-04-03 Texas A & M Univ Sys Method of preventing t-cell mediated responses by map proteins
US20030105020A1 (en) * 2001-11-16 2003-06-05 Jan-Ingmar Flock Use of a composition
US20030153022A1 (en) * 2001-11-05 2003-08-14 Patti Joseph M. Monoclonal antibodies to the fibronectin binding protein and method of use in treating or preventing infections
US6703025B1 (en) 1998-08-31 2004-03-09 Inhibitex, Inc. Multicomponent vaccines
WO2005001025A2 (en) 2003-05-06 2005-01-06 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US20050037947A1 (en) * 2003-05-06 2005-02-17 Bitonti Alan J. Inhibition of drug binding to serum albumin
US20050147618A1 (en) * 2003-05-06 2005-07-07 Rivera Daniel S. Clotting factor-Fc chimeric proteins to treat hemophilia
US20050260194A1 (en) * 2003-05-06 2005-11-24 Peters Robert T Immunoglobulin chimeric monomer-dimer hybrids
US6979446B2 (en) 2001-01-26 2005-12-27 Inhibitex, Inc. Monoclonal antibodies to the ClfA protein and method of use in treating or preventing infections
US20070087014A1 (en) * 2003-03-07 2007-04-19 Wyeth Polysaccharide-staphylococcal surface adhesin carrier protein conjugates for immunization against nosocomial infections
WO2007113222A2 (en) 2006-03-30 2007-10-11 Glaxosmithkline Biologicals S.A. Immunogenic composition
WO2007095057A3 (en) * 2006-02-10 2007-11-01 Us Gov Health & Human Serv Use of eap protein for treating and preventing autoimmune neuroinflammatory diseases
US20090081663A1 (en) * 2007-04-19 2009-03-26 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
WO2010042481A1 (en) 2008-10-06 2010-04-15 University Of Chicago Compositions and methods related to bacterial eap, emp, and/or adsa proteins
WO2011005341A2 (en) 2009-04-03 2011-01-13 University Of Chicago Compositions and methods related to protein a (spa) variants
US20110027265A1 (en) * 2007-08-31 2011-02-03 The University Of Chicago Methods and Compositions Related to Immunizing Against Staphylococcal Lung Diseases and Conditions
WO2011015590A1 (en) 2009-08-05 2011-02-10 Glaxosmithkline Biologicals S.A. Immunogenic composition comprising variants of staphylococcal clumping factor a
EP2298340A1 (en) 2004-09-22 2011-03-23 GlaxoSmithKline Biologicals S.A. Immunogenic composition for use in vaccination against staphylococcei
US7955590B2 (en) 1999-07-21 2011-06-07 Merck Patent Gmbh Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US20110206676A1 (en) * 2008-07-29 2011-08-25 University Of Chicago Compositions and methods related to staphylococcal bacterium proteins
WO2011127032A1 (en) 2010-04-05 2011-10-13 University Of Chicago Compositions and methods related to protein a (spa) antibodies as an enhancer of immune response
WO2012003474A2 (en) 2010-07-02 2012-01-05 The University Of Chicago Compositions and methods related to protein a (spa) variants
WO2012034067A1 (en) 2010-09-09 2012-03-15 The University Of Chicago Methods and compositions involving protective staphylococcal antigens
WO2013025834A2 (en) 2011-08-15 2013-02-21 The University Of Chicago Compositions and methods related to antibodies to staphylococcal protein a
WO2013162746A1 (en) 2012-04-26 2013-10-31 University Of Chicago Staphylococcal coagulase antigens and methods of their use
WO2013162751A1 (en) 2012-04-26 2013-10-31 University Of Chicago Compositions and methods related to antibodies that neutralize coagulase activity during staphylococcus aureus disease
US8945588B2 (en) 2011-05-06 2015-02-03 The University Of Chicago Methods and compositions involving protective staphylococcal antigens, such as EBH polypeptides
US9181329B2 (en) 2007-08-31 2015-11-10 The University Of Chicago Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions
WO2021067785A1 (en) 2019-10-02 2021-04-08 Janssen Vaccines & Prevention B.V Staphylococcus peptides and methods of use
US11642398B2 (en) 2013-03-15 2023-05-09 Bioverativ Therapeutics Inc. Factor IX polypeptide formulations
US12514914B2 (en) 2019-05-14 2026-01-06 The University Of Chicago Methods and compositions comprising Staphylococcus protein a (SpA) variants
US12528882B2 (en) 2019-09-13 2026-01-20 The University Of Chicago Methods and compositions for treating staphylococcal infections

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4425330A (en) * 1981-05-20 1984-01-10 Cornell Research Foundation, Inc. Bovine mastitis vaccine and method for detecting efficacy thereof
WO1985005037A1 (en) * 1984-05-02 1985-11-21 Syn-Tek Ab Adhesin antigens, antibodies and dna fragment encoding the antigen, methods and means for diagnosis and immunization etc.
EP0294349A2 (en) * 1987-06-01 1988-12-07 Alfa-Laval Agri International Ab A fibronectin binding protein as well as its preparation
EP0342173A2 (en) * 1988-05-06 1989-11-15 Staffan Normark Fibronectin binding protein as well as its preparation
EP0343137A1 (en) * 1988-05-20 1989-11-23 Alfa-Laval Agri International Ab Fibronectin binding protein
US5034515A (en) * 1987-09-22 1991-07-23 Wisconsin Alumni Research Foundation Staphylococcal fibronectin receptor, monoclonal antibodies thereto and methods of use
WO1992002555A1 (en) * 1990-08-10 1992-02-20 Alfa-Laval Agri International Aktiebolag A fibronectin binding peptide
WO1992007002A1 (en) * 1990-10-22 1992-04-30 Alfa-Laval Agri International Aktiebolag A collagen binding protein as well as its preparation
US5198215A (en) * 1987-06-22 1993-03-30 Noordzee Laboratorium N.V. Composition for controlling mastitis in ruminants, method for its preparation and method of treatment of ruminants
WO1994006830A1 (en) * 1992-09-21 1994-03-31 Alfa-Laval Agri International Aktiebolag Fibrinogen binding protein

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4425330A (en) * 1981-05-20 1984-01-10 Cornell Research Foundation, Inc. Bovine mastitis vaccine and method for detecting efficacy thereof
WO1985005037A1 (en) * 1984-05-02 1985-11-21 Syn-Tek Ab Adhesin antigens, antibodies and dna fragment encoding the antigen, methods and means for diagnosis and immunization etc.
US4795803A (en) * 1984-05-02 1989-01-03 Syn-Tek Ab Adhesin antigens, antibodies and DNA fragment encoding the antigen, methods and means for diagnosis and immunization etc.
EP0294349A2 (en) * 1987-06-01 1988-12-07 Alfa-Laval Agri International Ab A fibronectin binding protein as well as its preparation
US5198215A (en) * 1987-06-22 1993-03-30 Noordzee Laboratorium N.V. Composition for controlling mastitis in ruminants, method for its preparation and method of treatment of ruminants
US5034515A (en) * 1987-09-22 1991-07-23 Wisconsin Alumni Research Foundation Staphylococcal fibronectin receptor, monoclonal antibodies thereto and methods of use
EP0342173A2 (en) * 1988-05-06 1989-11-15 Staffan Normark Fibronectin binding protein as well as its preparation
EP0343137A1 (en) * 1988-05-20 1989-11-23 Alfa-Laval Agri International Ab Fibronectin binding protein
WO1992002555A1 (en) * 1990-08-10 1992-02-20 Alfa-Laval Agri International Aktiebolag A fibronectin binding peptide
WO1992007002A1 (en) * 1990-10-22 1992-04-30 Alfa-Laval Agri International Aktiebolag A collagen binding protein as well as its preparation
WO1994006830A1 (en) * 1992-09-21 1994-03-31 Alfa-Laval Agri International Aktiebolag Fibrinogen binding protein

Non-Patent Citations (115)

* Cited by examiner, † Cited by third party
Title
Abou Zeid, Infection and Immunity, 59:2712 2718, 1991. *
Abou-Zeid, Infection and Immunity, 59:2712-2718, 1991.
Arroyo, Molecular Microbiology, 6:853 862, 1992. *
Arroyo, Molecular Microbiology, 6:853-862, 1992.
Beachey, The Journal of Infectious Diseases, 143:325, 1981. *
Becker, Cardiovascular Research, 21:813, 1987. *
Braude, A. I. et al. (eds), Infectious Disease and Medical Microbilogy , pp. 236 242, W.B. Saunders Co., 1986. *
Braude, A. I. et al. (eds), Infectious Disease and Medical Microbilogy, pp. 236-242, W.B. Saunders Co., 1986.
Bremwell, Infection and Immunity, 59:2615, 1991. *
Buxton, Microbial Pathogenesis, 8:441 448, 1990. *
Buxton, Microbial Pathogenesis, 8:441-448, 1990.
Caparon, Infection and Immunity, 59:1811 1817, 1991. *
Caparon, Infection and Immunity, 59:1811-1817, 1991.
Chhatival, Infect. Immun., 55:1878 1883, 1987. *
Chhatival, Infect. Immun., 55:1878-1883, 1987.
Chhatwall, Infection and Immunity, 58:3015 3019, 1990. *
Chhatwall, Infection and Immunity, 58:3015-3019, 1990.
Chin & Marx, Science, Apr. 15, 1994. *
Ciborowski, J. Med. Microbiol., 37:376 381, 1992. *
Ciborowski, J. Med. Microbiol., 37:376-381, 1992.
Esperson, Infection and Immunity, 37:526 531, 1982. *
Esperson, Infection and Immunity, 37:526-531, 1982.
Finlay, Current Biology, 2:815 820, 1990. *
Finlay, Current Biology, 2:815-820, 1990.
Flock, The EMBO Journal, 6:2351 2357, 1987. *
Flock, The EMBO Journal, 6:2351-2357, 1987.
Foster, Vaccine, 9:221 227, 1991. *
Foster, Vaccine, 9:221-227, 1991.
Froman, The Journal of Biological Chemistry, 262:6564 6571, 1987. *
Froman, The Journal of Biological Chemistry, 262:6564-6571, 1987.
Haapasalo, Infection and Immunity, 60:2058 2065, 1992. *
Haapasalo, Infection and Immunity, 60:2058-2065, 1992.
Hanahan, J. Mol. Biol., 166:557 580, 1983. *
Hanahan, J. Mol. Biol., 166:557-580, 1983.
Hanski, Infection and Immunity, 60:5119 5125, 1992. *
Hanski, Infection and Immunity, 60:5119-5125, 1992.
Hanski, Proc. Natl. Acad. Sci., 89:6172 6176, 1992. *
Hanski, Proc. Natl. Acad. Sci., 89:6172-6176, 1992.
Harrowe, J. Clin. Invest., 85:1324 1327, 1990. *
Harrowe, J. Clin. Invest., 85:1324-1327, 1990.
Hasty, Infection and Immunity, 60:2147 2152, 1992. *
Hasty, Infection and Immunity, 60:2147-2152, 1992.
Holderbaum, Collagen Rel. Res., 5:261 271, 1985. *
Holderbaum, Collagen Rel. Res., 5:261-271, 1985.
Holderbaum, Infection and Immunity, 54:359 364, 1986. *
Holderbaum, Infection and Immunity, 54:359-364, 1986.
Homonylo McGavin et al., Infect. Immunol., 61:2479 2485, 1993. *
Homonylo-McGavin et al., Infect. Immunol., 61:2479-2485, 1993.
Joh, Biochemistry, 33:6086 6092, 1994. *
Joh, Biochemistry, 33:6086-6092, 1994.
Jonsson, K. et al., J. B. C. 270:2145 21460, Staphylococcus aureus expresses a major histocompatibility complex class II analog . Sep. 15, 1995. *
Jonsson, K. et al., J. B. C. 270:2145-21460, "Staphylococcus aureus expresses a major histocompatibility complex class II analog". Sep. 15, 1995.
Kuusela et al., Nature, 276:718 720, 1978. *
Kuusela et al., Nature, 276:718-720, 1978.
Kuypers, Infection and Immunity, 57:2306 2312, 1989. *
Kuypers, Infection and Immunity, 57:2306-2312, 1989.
Laemnli, Nature, 227:680 685, 1970. *
Laemnli, Nature, 227:680-685, 1970.
Lopes et al., Science, 229:275 277, 1985. *
Lopes et al., Science, 229:275-277, 1985.
Lowrance, The Journal of clinical Investigation, 86:7 13, 1990. *
Lowrance, The Journal of clinical Investigation, 86:7-13, 1990.
Mamo, Vaccination against Staphylococcus . . . , Jul. 1993. *
Marmur, J. Mol. Biol., 3:208 218, 1961. *
Marmur, J. Mol. Biol., 3:208-218, 1961.
McGavin, Infection and Immunity, 61:2479 2485, 1993. *
McGavin, Infection and Immunity, 61:2479-2485, 1993.
McGavin, The Journal of Biological Chemistry, 266:8343 8347, 1991. *
McGavin, The Journal of Biological Chemistry, 266:8343-8347, 1991.
McGavin, The Journal of Biological Chemistry, 268:23946 23953, 1993. *
McGavin, The Journal of Biological Chemistry, 268:23946-23953, 1993.
Morrison & Bayse, Biochemistry, 9:2995 3000, 1970. *
Morrison & Bayse, Biochemistry, 9:2995-3000, 1970.
Nelson, Flem. Vet. J., 62:111 125, 19. *
Nelson, Flem. Vet. J., 62:111-125, 19.
Patti, Biochemistry, 32:11428 11435, 1993. *
Patti, Biochemistry, 32:11428-11435, 1993.
Patti, Infect. Immunity, 62:152 161, 1994. *
Patti, Infect. Immunity, 62:152-161, 1994.
Proctor, Reviews of Infec. Diseases, 9:335 340, 1987. *
Proctor, Reviews of Infec. Diseases, 9:335-340, 1987.
Projan, S. et al., Nuc. Acids Res. 17:3305 (1989), "Nucleotide sequence of the beta-hemolysin gene of Staphylococcus aureus".
Projan, S. et al., Nuc. Acids Res. 17:3305 (1989), Nucleotide sequence of the beta hemolysin gene of Staphylococcus aureus . *
Raja, Infection and Immunity, 58:2593 2598, 1990. *
Raja, Infection and Immunity, 58:2593-2598, 1990.
Rosalska, Scand, J. Immunol., 37:575 580, 1993. *
Rosalska, Scand, J. Immunol., 37:575-580, 1993.
Ryden, Eur. J. Biochem., 184:331 336, 1989. *
Ryden, Eur. J. Biochem., 184:331-336, 1989.
Ryden, The Journal of Biological Chemistry, 258:3396 3401, 1983. *
Ryden, The Journal of Biological Chemistry, 258:3396-3401, 1983.
Sanger, PNAS, 74:5463 5467, 1977. *
Sanger, PNAS, 74:5463-5467, 1977.
Sansonetti, Med. Microbiol. Immunol., 182:223 232, 1993. *
Sansonetti, Med. Microbiol. Immunol., 182:223-232, 1993.
Schennings, Microbial Pathogenesis, 15:227 236, 1993. *
Schennings, Microbial Pathogenesis, 15:227-236, 1993.
Signas, Proc. Natl, Acad. Sci., 86:699 703, 1989. *
Signas, Proc. Natl, Acad. Sci., 86:699-703, 1989.
Svanborg Eden, Scan. J. Infect. Dis., 33:72 78, 1982. *
Svanborg-Eden, Scan. J. Infect. Dis., 33:72-78, 1982.
Talay, Infection and Immunity, 60:3837 3844, 1992. *
Talay, Infection and Immunity, 60:3837-3844, 1992.
The QIAexpressionist, 2nd edition, Summer 1992, pp. 7 23. Published by QIAGEN, INC. Chatsworth, CA. 1992. *
The QIAexpressionist, 2nd edition, Summer 1992, pp. 7-23. Published by QIAGEN, INC. Chatsworth, CA. 1992.
Towbin, PNAS, 76:4350 54, 1979. *
Towbin, PNAS, 76:4350-54, 1979.
Turnidge, Drugs, 45:353 366, 1993. *
Turnidge, Drugs, 45:353-366, 1993.
Wadstrom, The Staphylococci, pp. 37 52, 1991. *
Wadstrom, The Staphylococci, pp. 37-52, 1991.
Weir, D. M. (ed), Handbook of Experimental Immunology, 2nd edition, Chapter 17, pp. 17.1 17.8, Radioimmunoassay by W. M. Hunter. Blackwell Scientific Publications, Oxford. 1973. *
Weir, D. M. (ed), Handbook of Experimental Immunology, 2nd edition, Chapter 17, pp. 17.1-17.8, "Radioimmunoassay" by W. M. Hunter. Blackwell Scientific Publications, Oxford. 1973.
Westerlund, Molecular Microbiology, 9:687 694, 1993. *
Westerlund, Molecular Microbiology, 9:687-694, 1993.

Cited By (109)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6086895A (en) * 1988-05-20 2000-07-11 Alfa Laval Agri International Fibronectin binding protein
WO2000012132A1 (en) * 1998-08-31 2000-03-09 Inhibitex, Inc. Staphylococcal immunotherapeutics via donor selection and donor stimulation
US20020159997A1 (en) * 1998-08-31 2002-10-31 Patti Joseph M. Staphylococcal immunotherapeutics via donor selection and donor stimulation
WO2000012131A1 (en) * 1998-08-31 2000-03-09 Inhibitex, Inc. Multicomponent vaccines
CN1314450C (en) * 1998-08-31 2007-05-09 英希比泰克斯公司 multicomponent vaccine
US7045131B2 (en) * 1998-08-31 2006-05-16 Inhibitex, Inc. Staphylococcal immunotherapeutics via donor selection and donor stimulation
US6692739B1 (en) 1998-08-31 2004-02-17 Inhibitex, Inc. Staphylococcal immunotherapeutics via donor selection and donor stimulation
US6703025B1 (en) 1998-08-31 2004-03-09 Inhibitex, Inc. Multicomponent vaccines
US8043608B2 (en) 1999-07-21 2011-10-25 Merck Patent Gmbh Methods of using Fc-cytokine fusion proteins
US7955590B2 (en) 1999-07-21 2011-06-07 Merck Patent Gmbh Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
WO2002034788A1 (en) * 2000-10-20 2002-05-02 Inhibitex, Inc. Monoclonal antibodies to the map protein and method of use in treating or preventing infections
US20020164337A1 (en) * 2000-10-20 2002-11-07 Patti Joseph M. Monoclonal antibodies to the map protein and method of use in treating or preventing infections
US20030108564A1 (en) * 2001-01-10 2003-06-12 Eric Brown Method of preventing T cell-mediated responses by the use of the major histocompatibility complex class II analog protein (map protein) from Staphylococcus aureus
US7153515B2 (en) 2001-01-10 2006-12-26 The Texas A&M University System Method of preventing T cell-mediated responses by the use of the major histocompatibility complex class II analog protein (map protein) from Staphylococcus aureus
US20070092533A1 (en) * 2001-01-10 2007-04-26 Eric Brown Method of preventing T cell-mediated responses by the use of the major histocompatibility complex class II analog protein (map protein) from Staphylococcus aureus
WO2002077010A3 (en) * 2001-01-10 2003-04-03 Texas A & M Univ Sys Method of preventing t-cell mediated responses by map proteins
US6979446B2 (en) 2001-01-26 2005-12-27 Inhibitex, Inc. Monoclonal antibodies to the ClfA protein and method of use in treating or preventing infections
US7115264B2 (en) 2001-11-05 2006-10-03 Inhibitex Monoclonal antibodies to the fibronectin binding protein and method of use in treating or preventing infections
US20030153022A1 (en) * 2001-11-05 2003-08-14 Patti Joseph M. Monoclonal antibodies to the fibronectin binding protein and method of use in treating or preventing infections
US20080234189A1 (en) * 2001-11-16 2008-09-25 Jan-Ingmar Flock Use of a composition
US20030105020A1 (en) * 2001-11-16 2003-06-05 Jan-Ingmar Flock Use of a composition
US20070141077A1 (en) * 2003-03-07 2007-06-21 Wyeth Holdings Corporation Polysaccharide-staphylococcal surface adhesin carrier protein conjugates for immunization against nosocomial infections
US9296795B2 (en) 2003-03-07 2016-03-29 Wyeth Holdings, Llc. Polysaccharide-staphylococcal surface adhesin carrier protein conjugates for immunization against nosocomial infections
US8377451B2 (en) 2003-03-07 2013-02-19 Wyeth Holdings Corporation Polysaccharide-staphylococcal surface adhesin carrier protein conjugates for immunization against nosocomial infections
US20070087014A1 (en) * 2003-03-07 2007-04-19 Wyeth Polysaccharide-staphylococcal surface adhesin carrier protein conjugates for immunization against nosocomial infections
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US20050037947A1 (en) * 2003-05-06 2005-02-17 Bitonti Alan J. Inhibition of drug binding to serum albumin
WO2005001025A2 (en) 2003-05-06 2005-01-06 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8815250B2 (en) 2003-05-06 2014-08-26 Biogen Idec Hemophilia Inc. Clotting factor-Fc chimeric proteins to treat hemophilia
US7348004B2 (en) 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8449884B2 (en) 2003-05-06 2013-05-28 Syntonix Pharmaceuticals, Inc. Clotting factor-fc chimeric proteins to treat hemophilia
US7404956B2 (en) 2003-05-06 2008-07-29 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US20050260194A1 (en) * 2003-05-06 2005-11-24 Peters Robert T Immunoglobulin chimeric monomer-dimer hybrids
US20080249288A1 (en) * 2003-05-06 2008-10-09 Syntonix Pharmaceuticals, Inc. Methods for Chemically Synthesizing Immunoglobulin Chimeric Proteins
US11401322B2 (en) 2003-05-06 2022-08-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP2174946A1 (en) 2003-05-06 2010-04-14 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
EP3978508A1 (en) 2003-05-06 2022-04-06 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7820162B2 (en) 2003-05-06 2010-10-26 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US7862820B2 (en) 2003-05-06 2011-01-04 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US11168125B2 (en) 2003-05-06 2021-11-09 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9725496B1 (en) 2003-05-06 2017-08-08 Bioverative Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9636416B2 (en) 2003-05-06 2017-05-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8329182B2 (en) 2003-05-06 2012-12-11 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8932830B2 (en) 2003-05-06 2015-01-13 Biogen Idec Hemophilia, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US20050027109A1 (en) * 2003-05-06 2005-02-03 Mezo Adam R. Methods for chemically synthesizing immunoglobulin chimeric proteins
US20050032174A1 (en) * 2003-05-06 2005-02-10 Peters Robert T. Immunoglobulin chimeric monomer-dimer hybrids
US20050147618A1 (en) * 2003-05-06 2005-07-07 Rivera Daniel S. Clotting factor-Fc chimeric proteins to treat hemophilia
US20070172928A1 (en) * 2003-05-06 2007-07-26 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US20110182919A1 (en) * 2003-05-06 2011-07-28 Peters Robert T Immunoglobulin Chimeric Monomer-Dimer Hybrids
US20110182896A1 (en) * 2003-05-06 2011-07-28 Syntonix Pharmaceuticals, Inc. CLOTTING FACTOR-Fc CHIMERIC PROTEINS TO TREAT HEMOPHILIA
EP2357196A2 (en) 2003-05-06 2011-08-17 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP3103809A1 (en) 2003-05-06 2016-12-14 Biogen Hemophilia Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP2361932A1 (en) 2003-05-06 2011-08-31 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
EP2305295A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2305294A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2893938A1 (en) 2004-09-22 2015-07-15 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against Staphylococcei
EP2305296A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2298340A1 (en) 2004-09-22 2011-03-23 GlaxoSmithKline Biologicals S.A. Immunogenic composition for use in vaccination against staphylococcei
WO2007095057A3 (en) * 2006-02-10 2007-11-01 Us Gov Health & Human Serv Use of eap protein for treating and preventing autoimmune neuroinflammatory diseases
EP3141261A1 (en) 2006-03-30 2017-03-15 GlaxoSmithKline Biologicals S.A. Immunogenic composition
EP2476434A1 (en) 2006-03-30 2012-07-18 GlaxoSmithKline Biologicals S.A. Immunogenic composition
EP2476433A1 (en) 2006-03-30 2012-07-18 GlaxoSmithKline Biologicals S.A. Immunogenic composition
WO2007113222A2 (en) 2006-03-30 2007-10-11 Glaxosmithkline Biologicals S.A. Immunogenic composition
US8017337B2 (en) 2007-04-19 2011-09-13 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US20110151466A1 (en) * 2007-04-19 2011-06-23 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8512954B2 (en) 2007-04-19 2013-08-20 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8557974B2 (en) 2007-04-19 2013-10-15 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8557524B2 (en) 2007-04-19 2013-10-15 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US20090081663A1 (en) * 2007-04-19 2009-03-26 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US9074260B2 (en) 2007-04-19 2015-07-07 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8362228B2 (en) 2007-04-19 2013-01-29 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US9181329B2 (en) 2007-08-31 2015-11-10 The University Of Chicago Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions
US20110027265A1 (en) * 2007-08-31 2011-02-03 The University Of Chicago Methods and Compositions Related to Immunizing Against Staphylococcal Lung Diseases and Conditions
US8840906B2 (en) 2007-08-31 2014-09-23 The University Of Chicago Methods and compositions related to immunizing against Staphylococcal lung disease and conditions
US11639379B2 (en) 2007-08-31 2023-05-02 The University Of Chicago Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions
US8758765B2 (en) 2008-07-29 2014-06-24 The University Of Chicago Compositions and methods related to Staphylococcal bacterium proteins
US20110206676A1 (en) * 2008-07-29 2011-08-25 University Of Chicago Compositions and methods related to staphylococcal bacterium proteins
WO2010042481A1 (en) 2008-10-06 2010-04-15 University Of Chicago Compositions and methods related to bacterial eap, emp, and/or adsa proteins
EP3002293A1 (en) 2009-04-03 2016-04-06 The University of Chicago Compositions and methods related to protein a (spa) variants
US9567379B2 (en) 2009-04-03 2017-02-14 The University Of Chicago Compositions and methods related to protein A (SpA) variants
WO2011005341A2 (en) 2009-04-03 2011-01-13 University Of Chicago Compositions and methods related to protein a (spa) variants
US9212219B2 (en) 2009-04-03 2015-12-15 The University Of Chicago Compositions and methods related to protein A (SpA) antibodies as an enhancer of immune response
US9907850B2 (en) 2009-04-03 2018-03-06 The University Of Chicago Compositions and methods related to protein A (SpA) antibodies as an enhancer of immune response
EP3281947A1 (en) 2009-04-03 2018-02-14 The University of Chicago Compositions and methods related to protein a (spa) variants
WO2011015590A1 (en) 2009-08-05 2011-02-10 Glaxosmithkline Biologicals S.A. Immunogenic composition comprising variants of staphylococcal clumping factor a
US8808699B2 (en) 2010-04-05 2014-08-19 The University Of Chicago Compositions and methods related to protein A (SpA) antibodies as an enhancer of immune response
WO2011127032A1 (en) 2010-04-05 2011-10-13 University Of Chicago Compositions and methods related to protein a (spa) antibodies as an enhancer of immune response
US11939358B2 (en) 2010-07-02 2024-03-26 The University Of Chicago Compositions and methods related to protein A (SpA) variants
US10464971B2 (en) 2010-07-02 2019-11-05 The University Of Chicago Compositions and methods related to Protein A (SpA) Variants
US9315554B2 (en) 2010-07-02 2016-04-19 The University Of Chicago Compositions and methods related to protein A (SpA) variants
US8821894B2 (en) 2010-07-02 2014-09-02 The University Of Chicago Compositions and methods related to protein A (SpA) variants
WO2012003474A2 (en) 2010-07-02 2012-01-05 The University Of Chicago Compositions and methods related to protein a (spa) variants
US11059866B2 (en) 2010-07-02 2021-07-13 The University Of Chicago Compositions and methods related to protein A (SpA) variants
WO2012034067A1 (en) 2010-09-09 2012-03-15 The University Of Chicago Methods and compositions involving protective staphylococcal antigens
US9095540B2 (en) 2010-09-09 2015-08-04 The University Of Chicago Methods and compositions involving protective staphylococcal antigens
US8945588B2 (en) 2011-05-06 2015-02-03 The University Of Chicago Methods and compositions involving protective staphylococcal antigens, such as EBH polypeptides
US9556281B2 (en) 2011-08-15 2017-01-31 The University Of Chicago Compositions and methods related to antibodies to staphylococcal protein A
US10047149B2 (en) 2011-08-15 2018-08-14 The University Of Chicago Compositions and methods related to antibodies to Staphylococcal protein A
WO2013025834A2 (en) 2011-08-15 2013-02-21 The University Of Chicago Compositions and methods related to antibodies to staphylococcal protein a
US10857220B2 (en) 2012-04-26 2020-12-08 The University Of Chicago Staphylococcal coagulase antigens and methods of their use
EP3805395A1 (en) 2012-04-26 2021-04-14 University Of Chicago Staphylococcal coagulase antigens and methods of their use
US9968668B2 (en) 2012-04-26 2018-05-15 The University Of Chicago Staphylococcal coagulase antigens and methods of their use
US9701738B2 (en) 2012-04-26 2017-07-11 The University Of Chicago Compositions and methods related to antibodies that neutralize coagulase activity during Staphylococcus aureus disease
WO2013162751A1 (en) 2012-04-26 2013-10-31 University Of Chicago Compositions and methods related to antibodies that neutralize coagulase activity during staphylococcus aureus disease
WO2013162746A1 (en) 2012-04-26 2013-10-31 University Of Chicago Staphylococcal coagulase antigens and methods of their use
US11642398B2 (en) 2013-03-15 2023-05-09 Bioverativ Therapeutics Inc. Factor IX polypeptide formulations
US12514914B2 (en) 2019-05-14 2026-01-06 The University Of Chicago Methods and compositions comprising Staphylococcus protein a (SpA) variants
US12528882B2 (en) 2019-09-13 2026-01-20 The University Of Chicago Methods and compositions for treating staphylococcal infections
WO2021067785A1 (en) 2019-10-02 2021-04-08 Janssen Vaccines & Prevention B.V Staphylococcus peptides and methods of use

Similar Documents

Publication Publication Date Title
US5648240A (en) MHC II analog from Staphylococcus aureus
JP4714342B2 (en) Polypeptides and polynucleotides derived from coagulase negative Staphylococcus
US20100272743A1 (en) Staphylococcus epidermidis nucleic acids and proteins
JP3077993B2 (en) Fibronectin binding protein and its production
US8067015B2 (en) Methods and compositions for the treatment and prevention of Staphylococcus and other bacterial infections
US20040175731A1 (en) Methods and products for treating staphylococcal infections
WO2001034809A2 (en) Staphylococcus epidermidis nucleic acids and proteins
JPH11514870A (en) Novel saliva binding protein
US6733758B1 (en) Fibrinogen binding protein originating from coagulase-negative staphylococcus
CA2446294A1 (en) Surface proteins from gram-positive bacteria having highly conserved motifs and antibodies that recognize them
JP2000502898A (en) Components of the Staphylococcus signal transduction system
JPH10505752A (en) Methods and compositions for identifying streptococci containing cysteine proteases or fragments thereof
US6544516B1 (en) Treatment and diagnosis of infections of gram positive cocci
US6617128B2 (en) Nucleic acid molecules encoding proteins which impart the adhesion of neisseria cells to human cells
JPH11506018A (en) Two-component signal transduction system protein from Staphylococcus aureus
US20040038327A1 (en) Antibodies to polypeptides from coagulase-negative staphylococci
KR100382239B1 (en) Staphylococcal enterotoxin SEC-SER, expression vector and host cell, production method thereof, and manufacturing method of vaccine
US20040014178A1 (en) Von willebrand factor-binding proteins from staphylococci
JP2000500326A (en) Fibronectin binding protein B compound
JP2000502561A (en) Staphylococcus aureus new TCSTS response regulator
JP2000502563A (en) Two-component signal transduction system from Staphylococcus aureus
JPH11505130A (en) Novel cell surface protein compounds
JP2000504207A (en) Two-component signal transduction response regulator polypeptide from Staphylococcus aureus
JP2000503529A (en) Components of the Staphylococcus signal transduction system
JP2000507088A (en) Novel TCTS response modulator of Staphylococcus aureus

Legal Events

Date Code Title Description
AS Assignment

Owner name: TEXAS A & M UNIVERSITY, TEXAS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HOOK, MAGNUS;JONSSON, KLAS;PATTI, JOSEPH M.;AND OTHERS;REEL/FRAME:007294/0705;SIGNING DATES FROM 19940914 TO 19940922

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAT HOLDER CLAIMS SMALL ENTITY STATUS - SMALL BUSINESS (ORIGINAL EVENT CODE: SM02); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 8

SULP Surcharge for late payment

Year of fee payment: 7

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 12