US5227158A - Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon - Google Patents
Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon Download PDFInfo
- Publication number
- US5227158A US5227158A US07/712,284 US71228491A US5227158A US 5227158 A US5227158 A US 5227158A US 71228491 A US71228491 A US 71228491A US 5227158 A US5227158 A US 5227158A
- Authority
- US
- United States
- Prior art keywords
- ifn
- hgf
- human
- hepatocyte
- hepatocyte growth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/21—Interferons [IFN]
- A61K38/217—IFN-gamma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
Definitions
- the present invention concerns the hepatocyte growth factor-(HGF-) induced stimulation of hepatocyte regeneration. More particularly, the present invention relates to the synergistic interaction of HGF and gamma-interferon (IFN- ⁇ ) in such stimulation.
- HGF- hepatocyte growth factor-(HGF-) induced stimulation of hepatocyte regeneration. More particularly, the present invention relates to the synergistic interaction of HGF and gamma-interferon (IFN- ⁇ ) in such stimulation.
- IFN- ⁇ gamma-interferon
- liver damage occurs in a number of acute and chronic clinical conditions, including fulminant hepatic failure, hepatitis, partial hepatectomy, cirrhosis, hepatocyte transplant, transplant of artificial liver. In many instances, liver regeneration is vital to the survival of patients.
- Liver cells have a good ability to regenerate. It is known that following partial hepatectomy, the liver size is usually restored to its exact original mass within about six days. Liver (hepatocyte) regeneration is believed to be controlled by various growth stimulatory and growth inhibitory cytokines of autocrine or paracrine origin, however, the exact role and action mechanism of these factors is far from entirely understood.
- HGF hepatocyte growth factor
- HGF human HGF
- hHGF is more effective in the stimulation of cultured hepatocyte proliferation than human epidermal growth factor (hEGF) or insulin, and the effect of hHGF with the maximal effects of hEGF and insulin is "additive or synergistic".
- hEGF human epidermal growth factor
- insulin insulin
- the effect of hHGF with the maximal effects of hEGF and insulin is "additive or synergistic”.
- Zarnegar et al., Cancer Research 49, 3314-3320 (1989) described the purification of a polypeptide growth factor, called human hepatopoietin A (HPTA) having very similar properties to hHGF as characterized in earlier publications. As the authors do not disclose the amino acid sequences of their purified proteins, the degree of the structural similarity between the two factors can not be determined.
- N-terminal amino acid sequence of rabbit HPTA was described by Zarnegar et al., Biochem. Biophys. Res. Comm. 163, 1370-1376 (1989).
- the hHGF cDNA encodes a 728 amino acids polypeptide (pre-pro hHGF) having a molecular mass (M r ) of about 82,000, and a heterodimeric structure, composed of a large ⁇ -subunit of 440 amino acids (M r 69,000) and a small ⁇ -subunit of 234 amino acids (M r 34,000).
- pre-pro hHGF 728 amino acids polypeptide
- M r molecular mass
- M r 69,000 amino acids
- M r 34,000 small ⁇ -subunit of 234 amino acids
- an interchain S-S bridge is formed between Cys 487 of the ⁇ -chain and Cys 604 in the ⁇ -chain (see Nakamura et al., Nature, Supra).
- the N-terminus of the ⁇ -chain is preceded by 54 amino acids, starting with a methionine group. This segment includes a signal sequence and the prosequence.
- the ⁇ -chain starts at amino acid (aa) 55, and contains four Kringle domains.
- the Kringle 1 domain extends from about aa 128 to about aa 206
- the Kringle 2 domain is between about aa 211 and about aa 288
- the Kringle 3 domain is defined as extending from about aa 303 to about aa 383
- the Kringle 4 domain extends from about aa 391 to about aa 464 of the ⁇ -chain.
- the HGF ⁇ -chain includes a serine-protease like domain.
- HGF contains four putative glycosylation sites, which are located at positions 294 and 402 of the ⁇ -chain and at positions 566 and 653 of the ⁇ -chain.
- IFN- ⁇ Gamma interferon
- IFN- ⁇ Gamma interferon
- IFN- ⁇ was originally produced upon mitogenic induction of lymphocytes. The recombinant production of IFN- ⁇ was first reported by Gray, Goeddel and co-workers [Gray et al., Nature 295, 503-508 (1982)], and is subject of U.S. Pat. Nos. 4,762,791, 4,929,544, 4,727,138 and 4,925,793.
- the recombinant IFN- ⁇ of Gray and Goeddel as produced in E. coli consisted of 146 amino acids, the N-terminal portion of the molecule commencing with the sequence CysTyrCys. It has later been found that the native IFN- ⁇ (i.e., that arising from mitogen induction of human peripheral blood lymphocytes and subsequent purification) is a polypeptide which lacks the CysTyrCys N-terminus assigned by Gray et al., Supra.
- IFN- ⁇ exhibits a synergistic effect with IFN- ⁇ or IFN- ⁇ in assays for cells growth inhibition [EP 107,498, Czarnieski et al., J. Virology 49 (1984)], with lymphotoxin (EP 128,009), and with IL-2 (U.S. Pat. No. 5,082,658).
- Synergistic cytotoxic compositions comprising human interferon and TNF are disclosed in the U.S. Pat. No. 4,650,674.
- liver regeneration did not occur or was not satisfactory.
- IFN- ⁇ synergizes with HGF to enhance the proliferation of primary rat hepatocytes.
- the present invention is based on the recognition of the surprising synergism of HGF and IFN- ⁇ , in particular in cooperating to enhance the proliferation of hepatocytes.
- the present invention concerns a method of enhancing the biological activity of HGF by administering a biologically effective amount of HGF and a synergistically effective amount of IFN- ⁇ to a patient in need.
- the present invention concerns a method of enhancing hepatocyte proliferation comprising administering to a mammalian patient in need of such treatment and exhibiting elevated serum levels of endogenous hepatocyte growth factor (HGF), gamma interferon (IFN- ⁇ ) in an amount effective in inducing accelerated hepatocyte proliferation.
- HGF hepatocyte growth factor
- IFN- ⁇ gamma interferon
- the present invention relates to a method of enhancing the mitogenic activity of HGF on hepatocytes comprising administering to a mammalian patient in need of hepatocyte growth stimulation and exhibiting elevated serum levels of endogenous HGF, a synergistically effective amount of IFN- ⁇ .
- the invention concerns a method of enhancing hepatocyte proliferation comprising administering to a mammalian patient in need of such treatment HGF in an amount effective in inducing hepatocyte proliferation and a synergistically effective amount of IFN- ⁇ .
- the present invention relates to a method for stimulating hepatocyte growth in a mammalian patient in need of such treatment, comprising:
- the present invention further relates to a composition for use in the stimulation of hepatocyte regeneration comprising a therapeutically effective amount of HGF and a synergistic amount of IFN- ⁇ .
- the invention concerns a method for compensating the effect of growth inhibitors on HGF-induced hepatocyte proliferation, comprising administering to a mammalian patient in need of hepatocyte growth stimulation IFN- ⁇ in an amount synergizing with HGF.
- the growth inhibitor is, for example, a member of the TGF- ⁇ superfamily.
- FIG. 1 illustrates the synergistic effect of IFN- ⁇ and HGF to increase hepatocyte proliferation in primary rat hepatocyte cell cultures.
- FIG. 2 shows the results obtained with IFN- ⁇ and IFN- ⁇ and HGF under similar conditions to those shown in FIG. 1.
- FIG. 3 illustrates the inhibitory effect of TGF- ⁇ on HGF induced proliferation of hepatocytes.
- FIG. 4 illustrates the effect of IFN- ⁇ on TGF- ⁇ inhibition of HGF activity.
- FIG. 5 illustrates the effect of IFN- ⁇ on the inhibition of HGF activity by activin.
- FIG. 6 shows the construction of the general expression vector pSVI6B5 into which any gene encoding a desired polypeptide may be conveniently inserted.
- Hepatocyte growth factor has been detected in a number of different tissues, including liver, lung, kidney brain, thymus, etc. Although HGF is primarily known as a potent mitogen for hepatocytes, its biological activity is not limited to hepatic cells. In in vitro tests, HGF has been found to be cytotoxic to mouse Sarcoma 180 cells and human mouth epidermal carcinoma (KB) cells [Higashiu et al., BBRC 170(1), 397-404, 1990], and mitogenic for various epithelial, endothelial and melanocyte cell lines. As used herein, the term "hepatocyte growth factor” or "HGF” is used to refer to all forms of hepatocyte growth factors that exhibit biological activity.
- the term specifically includes hepatocyte growth factors exhibiting hepatocyte growth promoting activity in standard assays, for example as described in Proc. Natl. Acad. Sci. USA. 80, 7229 (1983).
- the term specifically includes human and non-human, such as rat HGF, in mature, pre, pre-pro, or pro forms, purified from natural source, chemically synthesized or recombinantly produced.
- human hepatocyte growth factor refers to a polypeptide encoded by the cDNA sequence published by Miyazawa, et al., Supra, or Nakamura et al., Nature, Supra, including its single- and double-chain, mature, pre, pre-pro, and pro forms, purified from natural source, chemically synthesized or recombinantly produced (see also SEQ. ID. NO: 2).
- the sequences reported by Miyazawa et al. and Nakamura et al. differ in 14 amino acids. The reason for the differences is not entirely clear; polymorphism or cloning artifacts are among the possibilities.
- HGF human growth factor
- hHGF a variant in which 5 amino acids are deleted in the first kringle domain of native human hHGF, which was first identified and described by Seki et al., Supra.
- HGF and hHGF
- HGF include various amino acid sequence variants of such HGF polypeptides, which may be naturally occurring alleles (which will not require manipulation of the HGF DNA) or predetermined mutant forms made by mutating the DNA, either to arrive to an allele or a variant not found in nature, provided that such variants maintain the biological activity in kind of native human HGF.
- Such mutations typically involve substitution, deletion and/or insertion of one or more amino acids in the native amino acid sequence.
- the amino acid changes also may result in further modifications of HGF upon expression in recombinant hosts, e.g. introducing or moving sites of glycosylation.
- gamma interferon or “IFN- ⁇ ” refers variously to all forms of (human and non-human animal) gamma interferon as are known to be biologically active in accepted gamma interferon assays, such as by inhibition of virus replication in a suitable cell line (inhibition of encephalomyocarditis virus replication in human lung carcinoma cell line A549 for human IFN- ⁇ ), induction of class II antigens, heat lability, other antiviral, antitumor or immunoregulatory assays, or neutralization by antibodies having immunoreactivity for gamma interferon but not alpha- or beta-interferon, and is meant to include gamma-interferon in a mature, pro, met or des(1-3) (also referred to as desCysTyrCys IFN- ⁇ ) form, whether obtained from natural source, chemically synthesized or produced by techniques of recombinant DNA technology.
- des(1-3) also referred to as desCysTy
- IFN- ⁇ is known to have a narrow host range, therefore, IFN- ⁇ homologous to the animal to be treated should be used.
- the desCysTyrCys variant of the sequence shown, for example, in U.S. Pat. No. 4,717,138, and its counterpart EP 77,670 is preferably employed, and optionally the C-terminal variant in which the last 4 residues are deleted in post-translational processing.
- a "therapeutically effective amount” or HGF refers to an amount effective in stimulating hepatocyte DNA synthesis in the presence of a synergistic amount of IFN- ⁇ .
- hepatocyte growth inhibitor is used to refer to factors inhibiting hepatocyte growth in vivo or in vitro in standard assays, such as those based upon monitoring hepatocyte DNA synthesis or liver weight.
- hepatocyte growth inhibitor specifically includes members of the TGF- ⁇ superfamily, e.g. TGF- ⁇ and activin (dimers of inhibin beta A or beta B chains).
- TGF- ⁇ as used throughout the specification and claims includes various sub-types of TGF- ⁇ , e.g. TGF- ⁇ 1 , - ⁇ 2 and - ⁇ 3 having hepatocyte growth inhibitory effect.
- Hepatocyte proliferation and the effect of growth promoting and growth inhibiting factors are conveniently tested in primary cultures of hepatocytes.
- Adult rat hepatocytes in primary culture have been extensively used to search for factors that regulate hepatocyte proliferation, accordingly, techniques for isolating and culturing rat hepatocytes are well known in the art.
- Human hepatocytes can, for example, be obtained from whole liver perfusion on organs deemed unacceptable for transplantation, pare-downs of adult livers used for transplantation in children, fetal livers and liver remnants removed at surgery for other indications. Human hepatocytes can be cultured similarly to the methods established for preparing primary cultures of normal rat hepatocytes.
- Hepatocyte DNA synthesis can, for example, be assayed by measuring incorporation of [ 3 H]thymidine into DNA, with appropriate hydroxyurea controls for replicative synthesis. Nuclear labelling is confirmed by autoradiography.
- a method for measuring hepatocyte DNA synthesis in primary culture of hepatocytes with or without aphidicolin is described by Nakamura et al., in Biochem. Biophys. Res. Comm. 122(3), 140-1459 (1984), and in J. Biochem. 94, 1029-1035 (1983). A modified version of this technique is disclosed in the Example.
- HGF and IFN- ⁇ on hepatocyte growth can also be tested in animal models of liver dysfunction and regeneration, such as in rats following partial hepatectomy, or carbon tetrachloride caused hepatic injury, in D-galactosamine induced acute liver failure models, etc.
- IFN- ⁇ and HGF are usually administered in the form of pharmaceutical compositions comprising an effective amount of the active ingredient in admixture with a suitable pharmaceutically acceptable vehicle and optionally other pharmaceutically acceptable additives.
- composition refers to preparations which are in such form as to permit the biological activity of the active ingredients to be unequivocally effective, and which contain no additional components which are toxic to the subjects to which the composition would be administered.
- “Pharmaceutically acceptable” excipients are those which can reasonably be administered to a subject mammal to provide an effective dose of the active ingredient employed.
- HGF and IFN- ⁇ may be administered to a subject mammal, preferably human, via any of the accepted modes of administration for agents which exhibit such activity. These methods include subcutaneus and, preferably, parenteral administration. Examples of parenteral administration routes are intravenous, intrapulmonary, intraarterial, intramuscular, and intraperitoneal administration, the intravenous route being preferred. Administration may be continuous or bolus dosing in sufficient amounts to maintain therapeutically effective/synergistic levels.
- HGF and IFN- ⁇ may be combined in vitro before administration or separately administered simultaneously or in tandem, in either order.
- HGF and IFN- ⁇ are typically formulated in the form of injectable solutions, suspensions or emulsions, in admixture with a suitable pharmaceutically acceptable vehicle and optionally other pharmaceutically acceptable additives.
- suitable pharmaceutically acceptable vehicles include saline, dextrose solution, Ringer's solution, etc., but non-aqueous vehicles may also be used.
- IFN- ⁇ is preferably liquid, and is ordinarily a physiological salt solution or dextrose solution, together with conventional stabilizers and/or excipients.
- IFN- ⁇ compositions may also be provided as lyophilized powders.
- a typical formulation may contain IFN- ⁇ (20 ⁇ 10 6 U) at 1.0 or 0.2 mg/ml, 0.27 mg/ml succinic acid, and disodium succinate hexahydrate 0.73 ml/injection at pH 5.0.
- Preferred IFN- ⁇ formulations are disclosed in co-pending U.S. Pat. Ser. No 07/514,392, filed Apr. 25, 1990.
- the determination of the synergistically effective amounts and the amounts effective in inducing accelerated hepatocyte proliferation is well within the skill of the practicing physician.
- the actual dose for both HGF and IFN- ⁇ will depend on the medical condition to be treated, the pathological condition and clinical tolerance of the patient involved, the properties of the IFN- ⁇ and HGF preparations employed, including their activity and biological half-life, etc. It will be appreciated that the practitioner will adjust the dose in line with clinical experience.
- Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known in the art, for example, CaPO 4 and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
- Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride as described by Cohen, S.N. Proc. Natl. Acad. Sci. USA 69, 2110 (1972); Mandel et al., J. Mol. Biol. 53, 154 (1970); and more recently Liljestrom et al., Gene 40, 241-246 (1985), is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham, F.
- Plasmids are designated by lower case p followed by capital letters and/or numbers.
- the starting plasmids used in the construction of the expression plasmid described in the Example are commercially, available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids in accord with published procedures.
- other equivalent plasmids are known in the art, and will be apparent to the ordinary artisan.
- Selection genes may contain a selection gene, also termed a selectable marker.
- a selection gene encodes a protein, sometimes referred to as a secondary protein, necessary for the survival or growth of a host cell transformed with the vector.
- suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin.
- DHFR dihydrofolate reductase
- thymidine kinase thymidine kinase
- neomycin thymidine kinase
- CHO dhfr - cells and mouse ltk - cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
- An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media. Therefore, direct selection of those cells requires cell growth in the absence of supplemental nutrients.
- a second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Mol. Appl. Genet. 1, 327 (1982), myocophenolic acid, Mulligan, R.C. and Berg, P., Science 209, 1422 (1980), or hygromycin, Sugden, B. et al., Mol. Cel., Biol. 5, 410-413 (1985). In the following Example the direct selection for DHFR production was used.
- Amplification refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent, e.g. methotrexate (MTX) which inactivates DHFR. Amplification or the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater MTX to the media. Amplification of a desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene so that cointegration can occur.
- MTX methotrexate
- Suitable host cells for expressing the hHGF encoding DNA include: monkey kidney CVI line transformed by SV40 (COS-7m ATCC CRL 1665); human embryonic kidney line (293, Graham, F.L. et al., J. Gen. Virol. 36, 59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10)1 chinese hamster ovary-cells-DHFR (described by Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77, 4216 (1980), etc.
- the host cells may be transformed with hHGF expression vectors and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes.
- the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinary skilled artisan.
- the plasmid pSVI6B5 which is a broadly applicable parental vector for expression of different polypeptides was derived from plasmid pSVI6B-tPA, as shown in FIG. 6.
- pSVI6B5 transformed E. coli strain ATCC No. 68,151; SEQ. ID. NO: 1 carries polylinker regions in place of the t-PA cDNA in pSVI6B-tPA. These polylinker regions provide convenient, unique restriction endonuclease recognition sites that can be used to introduce any sequence that encodes a polypeptide of interest.
- pSVI6B5 was generated in four steps. The first three steps involved the removal of the BamHI, HindIII, and SalI restriction sites, respectively, from pSVI6B-tPA; as a consequence, upon replacement of the t-PA cDNA by the polylinker in the last step, the polylinker sites for these enzymes were unique in the resulting parental expression plasmid.
- a detailed description of the construction of pSVI6B5 is provided in application Ser. No. 07/441,514, filed Nov. 22, 1989, now abandoned.
- HGF3 hHGF cDNA clone isolated from a human leukocyte library as described by Seki et al., Supra, was cloned into the expression vector pSVI6B5.
- the complete amino acid sequence of human leukocyte HGF is shown as SEQ. ID. NO: 2.
- CHO-dhfr - cells Urlaub et al., Proc. Natl. cad. Sci. USA 77, 4216-4220 (1980)
- the latter plasmid encodes DHFR, thereby conferring methotrexate resistance on the transfected cells and allowing for selection of hHGF expressing transformants.
- the transformed dhfr - cells were selected by growth in glycine-, hypoxanthine- and thymidine-deficient medium. Colonies that arose on this selection medium were isolated using cotton swabs and propagated in the same medium to several generations. After cell growth, the cells were amplified and selected with increasing amounts of methotrexate using standard techniques. Clones that could grow in selective media, and therefore incorporated the transfected DHFR containing plasmid, were screened for the presence of secreted HGF. HGF activity in the media of these clones was assayed with the mitogenic assay described hereinbelow.
- HGF activity in culture media may also be measured by incorporation of 125 I-labelled deoxyuridine into rat hepatocyte in primary culture as described by Nakamura et al., Nature 342, 440-443 (1989). hHGF was purified essentially as described by Nakamura et al., Supra.
- HGF activity was assayed essentially following the method described by Nakamura et al. in Proc. Natl. Acad. Sci. USA 80, 7229 (1983).
- the assay media had the following composition:
- Hepatocytes were isolated and purified from Wistar rats weighing 150-180 grams each, by method of standard perfusion collagenase [Seglen, P.O., Methods in Cell Biology 13, 29-83 (1976)], washed in assay media 3 ⁇ , and resuspended in the assay media at a concentration of 1 ⁇ 10 5 cells/ml. 100 ⁇ l of the cell suspension were added to each well of a 96 well flat bottom microtiter plate. Appropriate dilutions of HGF or an other test compound were added to the cells in 100 ⁇ l volumes. The plates were incubated at 37° C. for 48 hours.
- the rate of DNA synthesis was determined by pulse-labeling cultured cells with 3 H-thymidine (1 ⁇ Ci/well) for 12 hours. The cells were then harvested onto glass fiber filters using automated cell harvester (Ph D harvester, Cambridge Biotech), the glass fiber filters were transferred to counting vials, and 3 H incorporation expressed in cpms, was measured using liquid scintillation spectrometry.
- the suppressive effect of activin was also reversed by IFN- ⁇ .
- the activin concentration was 10 ng/ml
- the IFN- ⁇ concentration varied between 0 and 1000 units/ml.
- the results show that at concentrations exceeding about 10 units/ml, IFN- ⁇ reversed the suppressive effect of activin, and enhanced the hepatocyte growth stimulating activity of HGF.
- E. coli 294 strain transformed with the plasmid PSVI6B5 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., USA (ATCC) on Oct. 25, 1989, and was assigned the ATCC Accession No. 68,151.
- ATCC American Type Culture Collection
- the deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture for 30 years from the date of deposit.
- the organism will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the synergistic interaction of hepatocyte growth factor (HGF) and gamma-interferon (IFN-γ) in the stimulation of hepatocyte growth. Accordingly, the invention concerns a method of enhancing the biological activity of HGF by administering a biologically effective amount of HGF and a synergistically effective amount of IFN-γ to a patient in need.
Description
The present invention concerns the hepatocyte growth factor-(HGF-) induced stimulation of hepatocyte regeneration. More particularly, the present invention relates to the synergistic interaction of HGF and gamma-interferon (IFN-γ) in such stimulation.
Liver damage occurs in a number of acute and chronic clinical conditions, including fulminant hepatic failure, hepatitis, partial hepatectomy, cirrhosis, hepatocyte transplant, transplant of artificial liver. In many instances, liver regeneration is vital to the survival of patients.
Liver cells have a good ability to regenerate. It is known that following partial hepatectomy, the liver size is usually restored to its exact original mass within about six days. Liver (hepatocyte) regeneration is believed to be controlled by various growth stimulatory and growth inhibitory cytokines of autocrine or paracrine origin, however, the exact role and action mechanism of these factors is far from entirely understood.
In vitro, DNA synthesis in isolated hepatocytes has been shown to be stimulated by growth factors such as insulin-like growth factor-I (IGF1), epidermal growth factor (EGF), type α transforming growth factor (TGF-α) and to be inhibited by members of the type β transforming growth factor (TGF-β) family, and transferrin (activin). Most recently, a further protein, named hepatocyte growth factor (HGF) has been shown to be a complete mitogen for primary hepatocytes. The observation that the level of HGF in the serum rapidly increases following experimental damage to the liver and in patients with fulminate hepatic failure suggests that it may be an important mediator of liver regeneration in vivo.
HGF was purified by Nakamura et al. from the serum of partially hepatectomized rats [Biochem. Biophys. Res. Comm. 122:1450-1459 (1984)]. Subsequently, HGF was purified from rat platelets, and its subunit structure was determined [Nakamura et al, Proc. Natl. Acad. Sci. USA. 83. 6489-6493 (1986); and Nakamura et al., FEBS Letters 224, 311-316 (1987)]. The purification of human HGF (hHGF) from human plasma was first described by Gohda et al., J. Clin. Invest. 81, 414-419 (1988). According to the results reported by Gohda et al. hHGF is more effective in the stimulation of cultured hepatocyte proliferation than human epidermal growth factor (hEGF) or insulin, and the effect of hHGF with the maximal effects of hEGF and insulin is "additive or synergistic". Similarly, Zarnegar et al., Cancer Research 49, 3314-3320 (1989) described the purification of a polypeptide growth factor, called human hepatopoietin A (HPTA) having very similar properties to hHGF as characterized in earlier publications. As the authors do not disclose the amino acid sequences of their purified proteins, the degree of the structural similarity between the two factors can not be determined.
Using partial amino acid sequence generated from hHGF purified from human plasma, the molecular cloning and expression of hHGF, including the nucleotide sequence of hHGF cDNA and the deduced amino acid sequence of the hHGF protein, have been reported by Miyazawa et al., Biochem. Byophys. Res. Comm. 163, 967-973 (1989) and Nakamura et al., Nature 342, 440-443 (1989). The reported sequences differ in several positions. Nakamura et al., Supra describe the effect of hHGF and hEGF as being additive.
The N-terminal amino acid sequence of rabbit HPTA was described by Zarnegar et al., Biochem. Biophys. Res. Comm. 163, 1370-1376 (1989).
The hHGF cDNA encodes a 728 amino acids polypeptide (pre-pro hHGF) having a molecular mass (Mr) of about 82,000, and a heterodimeric structure, composed of a large α-subunit of 440 amino acids (Mr 69,000) and a small β-subunit of 234 amino acids (Mr 34,000). The nucleotide sequence of the hEGF cDNA reveals that both the α- and the β-chains are contained in a single open reading frame coding for a pre-pro precursor protein. In the predicted primary structure of mature hHGF, an interchain S-S bridge is formed between Cys 487 of the α-chain and Cys 604 in the β-chain (see Nakamura et al., Nature, Supra). The N-terminus of the α-chain is preceded by 54 amino acids, starting with a methionine group. This segment includes a signal sequence and the prosequence. The α-chain starts at amino acid (aa) 55, and contains four Kringle domains. The Kringle 1 domain extends from about aa 128 to about aa 206, the Kringle 2 domain is between about aa 211 and about aa 288, the Kringle 3 domain is defined as extending from about aa 303 to about aa 383, and the Kringle 4 domain extends from about aa 391 to about aa 464 of the α-chain. It will be understood that the definition of the various Kringle domains is based on their homology with kringle-like domains of other proteins (prothrombin, plasminogen), therefore, the above limits are only approximate. The HGF β-chain includes a serine-protease like domain. In a portion of cDNA isolated from human leukocytes in-frame deletion of 15 base pairs was observed. Transient expression of the cDNA sequence in COS-1 cells revealed that the encoded HGF molecule lacking 5 amino acids in the Kringle 1 domain was fully functional [Seki et al, Biochem. and Biophys. Res. Commun. 172, 321-327 (1990)]. This variant is referred to as "delta5 HGF". HGF contains four putative glycosylation sites, which are located at positions 294 and 402 of the α-chain and at positions 566 and 653 of the β-chain.
Gamma interferon (IFN-γ), which is also referred to as immune interferon, is a member of the interferon family, which exhibits the antiviral and anti-proliferative properties characteristic of interferons-α, and -β but, in contrast to those interferons, is pH 2 labile. IFN-γ was originally produced upon mitogenic induction of lymphocytes. The recombinant production of IFN-γ was first reported by Gray, Goeddel and co-workers [Gray et al., Nature 295, 503-508 (1982)], and is subject of U.S. Pat. Nos. 4,762,791, 4,929,544, 4,727,138 and 4,925,793. The recombinant IFN-γ of Gray and Goeddel as produced in E. coli, consisted of 146 amino acids, the N-terminal portion of the molecule commencing with the sequence CysTyrCys. It has later been found that the native IFN-γ (i.e., that arising from mitogen induction of human peripheral blood lymphocytes and subsequent purification) is a polypeptide which lacks the CysTyrCys N-terminus assigned by Gray et al., Supra.
It has previously been shown that IFN-γ exhibits a synergistic effect with IFN-α or IFN-β in assays for cells growth inhibition [EP 107,498, Czarnieski et al., J. Virology 49 (1984)], with lymphotoxin (EP 128,009), and with IL-2 (U.S. Pat. No. 5,082,658). Synergistic cytotoxic compositions comprising human interferon and TNF are disclosed in the U.S. Pat. No. 4,650,674.
We have found that although in certain clinical conditions resulting in liver damage, such as fulminate hepatic failure large concentrations of HGF were detected in the patients' sera, in many instances liver regeneration did not occur or was not satisfactory. In examining the effects of various proteins on the activity of recombinant HGF (rHGF), we have further found that IFN-γ synergizes with HGF to enhance the proliferation of primary rat hepatocytes.
The present invention is based on the recognition of the surprising synergism of HGF and IFN-γ, in particular in cooperating to enhance the proliferation of hepatocytes.
In one aspect, the present invention concerns a method of enhancing the biological activity of HGF by administering a biologically effective amount of HGF and a synergistically effective amount of IFN-γ to a patient in need.
In another aspect, the present invention concerns a method of enhancing hepatocyte proliferation comprising administering to a mammalian patient in need of such treatment and exhibiting elevated serum levels of endogenous hepatocyte growth factor (HGF), gamma interferon (IFN-γ) in an amount effective in inducing accelerated hepatocyte proliferation.
In still another aspect, the present invention relates to a method of enhancing the mitogenic activity of HGF on hepatocytes comprising administering to a mammalian patient in need of hepatocyte growth stimulation and exhibiting elevated serum levels of endogenous HGF, a synergistically effective amount of IFN-γ.
In a further aspect, the invention concerns a method of enhancing hepatocyte proliferation comprising administering to a mammalian patient in need of such treatment HGF in an amount effective in inducing hepatocyte proliferation and a synergistically effective amount of IFN-γ.
In a still further aspect, the present invention relates to a method for stimulating hepatocyte growth in a mammalian patient in need of such treatment, comprising:
a) determining the HGF concentration in the serum of said patient,
b) comparing said HGF concentration with the normal HGF concentration in the serum of the same mammalian species, and
c) administering a syngergistic amount of IFN-γ to said patient if said HGF concentration is higher than said normal HGF concentration, or
e) administering a therapeutically effective amount of HGF and a synergistic amount of IFN-γ to said patient if said HGF concentration is the same or lower than said normal HGF concentration.
The present invention further relates to a composition for use in the stimulation of hepatocyte regeneration comprising a therapeutically effective amount of HGF and a synergistic amount of IFN-γ.
In a further aspect, the invention concerns a method for compensating the effect of growth inhibitors on HGF-induced hepatocyte proliferation, comprising administering to a mammalian patient in need of hepatocyte growth stimulation IFN-γ in an amount synergizing with HGF. The growth inhibitor is, for example, a member of the TGF-β superfamily.
FIG. 1 illustrates the synergistic effect of IFN-γ and HGF to increase hepatocyte proliferation in primary rat hepatocyte cell cultures.
FIG. 2 shows the results obtained with IFN-β and IFN-α and HGF under similar conditions to those shown in FIG. 1.
FIG. 3 illustrates the inhibitory effect of TGF-β on HGF induced proliferation of hepatocytes.
FIG. 4 illustrates the effect of IFN-γ on TGF-β inhibition of HGF activity.
FIG. 5 illustrates the effect of IFN-γ on the inhibition of HGF activity by activin.
FIG. 6 shows the construction of the general expression vector pSVI6B5 into which any gene encoding a desired polypeptide may be conveniently inserted.
Hepatocyte growth factor (HGF) has been detected in a number of different tissues, including liver, lung, kidney brain, thymus, etc. Although HGF is primarily known as a potent mitogen for hepatocytes, its biological activity is not limited to hepatic cells. In in vitro tests, HGF has been found to be cytotoxic to mouse Sarcoma 180 cells and human mouth epidermal carcinoma (KB) cells [Higashiu et al., BBRC 170(1), 397-404, 1990], and mitogenic for various epithelial, endothelial and melanocyte cell lines. As used herein, the term "hepatocyte growth factor" or "HGF" is used to refer to all forms of hepatocyte growth factors that exhibit biological activity. The term specifically includes hepatocyte growth factors exhibiting hepatocyte growth promoting activity in standard assays, for example as described in Proc. Natl. Acad. Sci. USA. 80, 7229 (1983). The term specifically includes human and non-human, such as rat HGF, in mature, pre, pre-pro, or pro forms, purified from natural source, chemically synthesized or recombinantly produced.
The term "human hepatocyte growth factor" or "hHGF" refers to a polypeptide encoded by the cDNA sequence published by Miyazawa, et al., Supra, or Nakamura et al., Nature, Supra, including its single- and double-chain, mature, pre, pre-pro, and pro forms, purified from natural source, chemically synthesized or recombinantly produced (see also SEQ. ID. NO: 2). The sequences reported by Miyazawa et al. and Nakamura et al. differ in 14 amino acids. The reason for the differences is not entirely clear; polymorphism or cloning artifacts are among the possibilities. Both sequences are specifically encompassed by the term "hHGF" as defined for the purpose of the present invention. The term specifically includes "delta5 hHGF", a variant in which 5 amino acids are deleted in the first kringle domain of native human hHGF, which was first identified and described by Seki et al., Supra. Both terms ("HGF" and "hHGF") include various amino acid sequence variants of such HGF polypeptides, which may be naturally occurring alleles (which will not require manipulation of the HGF DNA) or predetermined mutant forms made by mutating the DNA, either to arrive to an allele or a variant not found in nature, provided that such variants maintain the biological activity in kind of native human HGF. Such mutations typically involve substitution, deletion and/or insertion of one or more amino acids in the native amino acid sequence. The amino acid changes also may result in further modifications of HGF upon expression in recombinant hosts, e.g. introducing or moving sites of glycosylation.
As used herein, "gamma interferon" or "IFN-γ" refers variously to all forms of (human and non-human animal) gamma interferon as are known to be biologically active in accepted gamma interferon assays, such as by inhibition of virus replication in a suitable cell line (inhibition of encephalomyocarditis virus replication in human lung carcinoma cell line A549 for human IFN-γ), induction of class II antigens, heat lability, other antiviral, antitumor or immunoregulatory assays, or neutralization by antibodies having immunoreactivity for gamma interferon but not alpha- or beta-interferon, and is meant to include gamma-interferon in a mature, pro, met or des(1-3) (also referred to as desCysTyrCys IFN-γ) form, whether obtained from natural source, chemically synthesized or produced by techniques of recombinant DNA technology. A complete description of the preparation of recombinant human gamma interferon (hIFN-γ) including its cDNA and amino acid sequences is shown in the United States Patents cited hereinabove (e.g. U.S. Pat. No. 4,762,791). CysTyrCys-lacking recombinant human gamma interferons, including variously truncated derivatives are, for example, disclosed in European Publication No. 146,354. Non-human animal interferons, including IFN-γ, are, for example, disclosed in European Publication No. 88,622. The term includes variously glycosylated forms and other variants and derivatives of such interferons, whether known in the art or will become available in the future. Examples of such variants are alleles, and the products of site directed mutagenesis in which residues are deleted, inserted and/or substituted (see, for example European Publication No. 146,354 referred to above).
IFN-γ is known to have a narrow host range, therefore, IFN-γ homologous to the animal to be treated should be used. In human therapy, the desCysTyrCys variant of the sequence shown, for example, in U.S. Pat. No. 4,717,138, and its counterpart EP 77,670 is preferably employed, and optionally the C-terminal variant in which the last 4 residues are deleted in post-translational processing.
The terms "synergism", "synergistic", synergistically effective" in the context of this invention are defined according to the art accepted definition (Goodman et al., "The Pharmacological Basis of Therapeutics", MacMillan Publishing Company, Inc., New York, 1980). This is most easily seen in terms of constructing an isobologram which plots the dosage levels required for a specific identical biological response of each of two ingredients along the X and Y axes. While simply additive effects would generate a straight line as one ingredient diminishes and the other increases, synergistic effects can be recognized by the generation of a concave curve, such that only a small increase in one component compensates for a drastic decrease in the amount of the other.
In a pharmacological sense, in the context of the present invention, a "therapeutically effective amount" or HGF refers to an amount effective in stimulating hepatocyte DNA synthesis in the presence of a synergistic amount of IFN-γ.
The term "hepatocyte growth inhibitor" is used to refer to factors inhibiting hepatocyte growth in vivo or in vitro in standard assays, such as those based upon monitoring hepatocyte DNA synthesis or liver weight. The term "hepatocyte growth inhibitor" specifically includes members of the TGF-β superfamily, e.g. TGF-β and activin (dimers of inhibin betaA or betaB chains).
The term "TGF-β" as used throughout the specification and claims includes various sub-types of TGF-β, e.g. TGF-β1, -β2 and -β3 having hepatocyte growth inhibitory effect.
Hepatocyte proliferation and the effect of growth promoting and growth inhibiting factors are conveniently tested in primary cultures of hepatocytes. Adult rat hepatocytes in primary culture have been extensively used to search for factors that regulate hepatocyte proliferation, accordingly, techniques for isolating and culturing rat hepatocytes are well known in the art. Human hepatocytes can, for example, be obtained from whole liver perfusion on organs deemed unacceptable for transplantation, pare-downs of adult livers used for transplantation in children, fetal livers and liver remnants removed at surgery for other indications. Human hepatocytes can be cultured similarly to the methods established for preparing primary cultures of normal rat hepatocytes.
Hepatocyte DNA synthesis can, for example, be assayed by measuring incorporation of [3 H]thymidine into DNA, with appropriate hydroxyurea controls for replicative synthesis. Nuclear labelling is confirmed by autoradiography. A method for measuring hepatocyte DNA synthesis in primary culture of hepatocytes with or without aphidicolin is described by Nakamura et al., in Biochem. Biophys. Res. Comm. 122(3), 140-1459 (1984), and in J. Biochem. 94, 1029-1035 (1983). A modified version of this technique is disclosed in the Example.
The effect of HGF and IFN-γ on hepatocyte growth can also be tested in animal models of liver dysfunction and regeneration, such as in rats following partial hepatectomy, or carbon tetrachloride caused hepatic injury, in D-galactosamine induced acute liver failure models, etc.
IFN-γ and HGF are usually administered in the form of pharmaceutical compositions comprising an effective amount of the active ingredient in admixture with a suitable pharmaceutically acceptable vehicle and optionally other pharmaceutically acceptable additives.
The term "pharmaceutical composition" refers to preparations which are in such form as to permit the biological activity of the active ingredients to be unequivocally effective, and which contain no additional components which are toxic to the subjects to which the composition would be administered.
"Pharmaceutically acceptable" excipients (vehicles, additives) are those which can reasonably be administered to a subject mammal to provide an effective dose of the active ingredient employed.
HGF and IFN-γ may be administered to a subject mammal, preferably human, via any of the accepted modes of administration for agents which exhibit such activity. These methods include subcutaneus and, preferably, parenteral administration. Examples of parenteral administration routes are intravenous, intrapulmonary, intraarterial, intramuscular, and intraperitoneal administration, the intravenous route being preferred. Administration may be continuous or bolus dosing in sufficient amounts to maintain therapeutically effective/synergistic levels.
HGF and IFN-γ may be combined in vitro before administration or separately administered simultaneously or in tandem, in either order.
The compounds are usually administered as pharmaceutical compositions, usually formulated in dosage forms by methods known in the art; for example, see Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., 15th Edition 1975. For parenteral administration, HGF and IFN-γ are typically formulated in the form of injectable solutions, suspensions or emulsions, in admixture with a suitable pharmaceutically acceptable vehicle and optionally other pharmaceutically acceptable additives. Typical vehicles include saline, dextrose solution, Ringer's solution, etc., but non-aqueous vehicles may also be used.
The formulation of IFN-γ is preferably liquid, and is ordinarily a physiological salt solution or dextrose solution, together with conventional stabilizers and/or excipients. IFN-γ compositions may also be provided as lyophilized powders. A typical formulation may contain IFN-γ (20×106 U) at 1.0 or 0.2 mg/ml, 0.27 mg/ml succinic acid, and disodium succinate hexahydrate 0.73 ml/injection at pH 5.0. Preferred IFN-γ formulations are disclosed in co-pending U.S. Pat. Ser. No 07/514,392, filed Apr. 25, 1990.
The determination of the synergistically effective amounts and the amounts effective in inducing accelerated hepatocyte proliferation is well within the skill of the practicing physician. The actual dose for both HGF and IFN-γ will depend on the medical condition to be treated, the pathological condition and clinical tolerance of the patient involved, the properties of the IFN-γ and HGF preparations employed, including their activity and biological half-life, etc. It will be appreciated that the practitioner will adjust the dose in line with clinical experience.
In order to simplify the following example, the definitions of certain terms is given hereinbelow.
"Transfection" refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known in the art, for example, CaPO4 and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride as described by Cohen, S.N. Proc. Natl. Acad. Sci. USA 69, 2110 (1972); Mandel et al., J. Mol. Biol. 53, 154 (1970); and more recently Liljestrom et al., Gene 40, 241-246 (1985), is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham, F. and van der Eb, A., Virology 52, 456-457 (1978) is preferred. General aspects of mammalian host cell system transformations have been described by Axel in U.S. Pat. No. 4,399,216 issued Aug. 16, 1983. Transformations in yeast are typically carried out according to the method of Van Solingen, P., et al., J. Bact. 130, 946 (1977), and Hsiao, C.L. et al., Proc. Natl. Acad. Sci. USA 76, 3829 (1979). However, other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion may also be used.
"Plasmids" are designated by lower case p followed by capital letters and/or numbers. The starting plasmids used in the construction of the expression plasmid described in the Example are commercially, available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids in accord with published procedures. In addition, other equivalent plasmids are known in the art, and will be apparent to the ordinary artisan.
Expression vectors (plasmids) may contain a selection gene, also termed a selectable marker. A selection gene encodes a protein, sometimes referred to as a secondary protein, necessary for the survival or growth of a host cell transformed with the vector. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimens. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are: CHO dhfr- cells and mouse ltk- cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media. Therefore, direct selection of those cells requires cell growth in the absence of supplemental nutrients.
A second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Mol. Appl. Genet. 1, 327 (1982), myocophenolic acid, Mulligan, R.C. and Berg, P., Science 209, 1422 (1980), or hygromycin, Sugden, B. et al., Mol. Cel., Biol. 5, 410-413 (1985). In the following Example the direct selection for DHFR production was used.
"Amplification" refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent, e.g. methotrexate (MTX) which inactivates DHFR. Amplification or the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater MTX to the media. Amplification of a desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene so that cointegration can occur. One ensures that the cell requires more DHFR, which requirement is met by replication of the selection gene, by selecting only for cells that can grow in successive rounds of ever-greater MTX concentration. So long as the gene encoding a desired heterologous protein has cointegrated with the amplifiable gene, replication of this gene gives rise to replication of the gene encoding the desired protein. The result is that increased copies of the gene, i.e. an amplified gene, encoding the desired heterologous protein express more of the desired heterologous protein. Essentially this procedure was followed during the hHGF expression, as shown in the following Example.
Suitable host cells for expressing the hHGF encoding DNA include: monkey kidney CVI line transformed by SV40 (COS-7m ATCC CRL 1665); human embryonic kidney line (293, Graham, F.L. et al., J. Gen. Virol. 36, 59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10)1 chinese hamster ovary-cells-DHFR (described by Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77, 4216 (1980), etc.
The host cells may be transformed with hHGF expression vectors and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinary skilled artisan.
Further details of the invention are illustrated in the following non-limiting example.
The plasmid pSVI6B5, which is a broadly applicable parental vector for expression of different polypeptides was derived from plasmid pSVI6B-tPA, as shown in FIG. 6. pSVI6B5 (transformed E. coli strain ATCC No. 68,151; SEQ. ID. NO: 1) carries polylinker regions in place of the t-PA cDNA in pSVI6B-tPA. These polylinker regions provide convenient, unique restriction endonuclease recognition sites that can be used to introduce any sequence that encodes a polypeptide of interest.
As illustrated in FIG. 6, pSVI6B5 was generated in four steps. The first three steps involved the removal of the BamHI, HindIII, and SalI restriction sites, respectively, from pSVI6B-tPA; as a consequence, upon replacement of the t-PA cDNA by the polylinker in the last step, the polylinker sites for these enzymes were unique in the resulting parental expression plasmid. A detailed description of the construction of pSVI6B5 is provided in application Ser. No. 07/441,514, filed Nov. 22, 1989, now abandoned.
An hHGF cDNA clone (HLC3) isolated from a human leukocyte library as described by Seki et al., Supra, was cloned into the expression vector pSVI6B5. The complete amino acid sequence of human leukocyte HGF is shown as SEQ. ID. NO: 2.
CHO-dhfr- cells (Urlaub et al., Proc. Natl. cad. Sci. USA 77, 4216-4220 (1980)) Were contransfected with the above-described pSVI6B5-based hHGF expression vector and with a dhfr selection vector pFD11 (Simonsen and Levinson, Proc. Natl. Acad. Sci. USA 80, 2495-2499 (1983)) using the general procedure of Graham and van des Eb, Virology 52, 456-467 (1973)). The latter plasmid encodes DHFR, thereby conferring methotrexate resistance on the transfected cells and allowing for selection of hHGF expressing transformants. The transformed dhfr- cells were selected by growth in glycine-, hypoxanthine- and thymidine-deficient medium. Colonies that arose on this selection medium were isolated using cotton swabs and propagated in the same medium to several generations. After cell growth, the cells were amplified and selected with increasing amounts of methotrexate using standard techniques. Clones that could grow in selective media, and therefore incorporated the transfected DHFR containing plasmid, were screened for the presence of secreted HGF. HGF activity in the media of these clones was assayed with the mitogenic assay described hereinbelow. Alternatively, HGF activity in culture media may also be measured by incorporation of 125 I-labelled deoxyuridine into rat hepatocyte in primary culture as described by Nakamura et al., Nature 342, 440-443 (1989). hHGF was purified essentially as described by Nakamura et al., Supra.
HGF activity was assayed essentially following the method described by Nakamura et al. in Proc. Natl. Acad. Sci. USA 80, 7229 (1983).
The assay media had the following composition:
Williams Media E (Gibco)
1×Pen/Strep (100 Units/ml penicillin - 100 μg/ml streptomycin)
1×glutamine (2 mM)
1×trace elements (10,000×stock from Phase 7)
10 μg/ml transferrin
1 μg/ml aprotinin
Hepatocytes were isolated and purified from Wistar rats weighing 150-180 grams each, by method of standard perfusion collagenase [Seglen, P.O., Methods in Cell Biology 13, 29-83 (1976)], washed in assay media 3×, and resuspended in the assay media at a concentration of 1×105 cells/ml. 100 μl of the cell suspension were added to each well of a 96 well flat bottom microtiter plate. Appropriate dilutions of HGF or an other test compound were added to the cells in 100 μl volumes. The plates were incubated at 37° C. for 48 hours. The rate of DNA synthesis was determined by pulse-labeling cultured cells with 3 H-thymidine (1 μCi/well) for 12 hours. The cells were then harvested onto glass fiber filters using automated cell harvester (Ph D harvester, Cambridge Biotech), the glass fiber filters were transferred to counting vials, and 3 H incorporation expressed in cpms, was measured using liquid scintillation spectrometry.
1. We have examined the effects of IFN-γ on hepatocyte proliferation. The results set forth in FIG. 1 show that IFN-γ alone has no mitogenic effect. Various combinations of HGF and IFN-γ were found to act synergistically in enhancing hepatocyte proliferation in the above-described primary rat hepatocyte cell cultures. The effect of tandem administration or HGF and IFN-γ has also been investigated. As shown in FIG. 1, the synergy was independent of time of addition of either HGF or IFN-γ.
2. The test results illustrated in FIGS. 2 and 3 show that IFN-β failed to synergize with HGF, whereas the synergism between IFN-α and HGF was, at best, marginal.
3. It was found that as little as 150 pg of TGF-β, added at the initiation of culture, produced profound suppression of the HGF induced proliferation of primary rat hepatocytes (FIG. 3).
4. As shown in FIG. 4, 250 U (100 ng) of IFN-γ completely reversed the suppressive effect of 150 pg TGF-β. Higher concentrations of IFN-γ were required to overcome the effect of higher concentrations of TGF-β.
5. As illustrated in FIG. 5, the suppressive effect of activin, another member of the TGF-β family, was also reversed by IFN-γ. In this experiment, the activin concentration was 10 ng/ml, and the IFN-γ concentration varied between 0 and 1000 units/ml. The results show that at concentrations exceeding about 10 units/ml, IFN-γ reversed the suppressive effect of activin, and enhanced the hepatocyte growth stimulating activity of HGF.
E. coli 294 strain transformed with the plasmid PSVI6B5 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., USA (ATCC) on Oct. 25, 1989, and was assigned the ATCC Accession No. 68,151. The deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture for 30 years from the date of deposit. The organism will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, which assures permanent and unrestricted availability of the progeny of the cultures to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 U.S.C. 112 and the Commissioner's rules pursuant thereto (including 37 CFR 1.14 with particular reference to OG 638).
The foregoing written description is considered to be sufficient to enable one skilled in the art to practice the invention. The deposit of material herein does not constitute an admission that the written description is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope hereof.
Although the foregoing refers to particular preferred embodiments, it will be understood that the present invention is not so limited. It will occur to those ordinarily skilled in the art that various modifications may be made to the disclosed embodiments without diverting from the overall concept of the invention. All such modifications are intended to be within the scope of the present invention.
All citations cited throughout the specification and the references cited therein, are hereby expressly incorporated by reference.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4454 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TTCGAGCTCGCCCGACATTGATTATTGACTA GAGTCGATCGACAGCTGTG50 GAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCA100 GAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAG150 TCCCCAGGCTCCCCAGCAGGCAGAAGTAT GCAAAGCATGCATCTCAATTA200 GTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTC250 CGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATT300 TATGCAGAGGCCGAGGCCGCCTCGG CCTCTGAGCTATTCCAGAAGTAGTG350 AGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTAGCTTATCCGG400 CCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTCAGGTAA450 GTACCGCCTATAGAGTCTATA GGCCCACCCCCTTGGCTTGGCCCACCCCC500 TTGGCTTCGTTAGAACGCGGCTACAATTAATACATAACCTTTTGGATCGA550 TCCTACTGACACTGACATCCACTTTTTCTTTTTCTCCACAGGTGTCCACT600 CCCAGGTCCAACTGCACC TCGGTTCGCGAAGCTAGCTTGGGCTGCATCGA650 TTGAATTCCCCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTCGATGGC700 CGCCATGGCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGC750 AATAGCATCACAAA TTTCACAAATAAAGCATTTTTTTCACTGCATTCTAG800 TTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATC850 GGGAATTAATTCGGCGCAGCACCATGGCCTGAAATAACCTCTGAAAGAGG900 AACTTGGTTA GGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGT950 GTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATG1000 CAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGG1050 CTCCC CAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAA1100 CCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGT1150 TCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGA1200 GGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCT1250 TTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGTTAACAGCTTGGCACTGG1300 CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT1350 AATCGCCTTGCAGCACATCCCCCCTTCGCCAGCTGGCGTAATAGCGAAGA1400 GGCCCGCACCGATCGCCCTTCCCAACAGTTGCGTAGCCTGAATGGCGAAT1450 GGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACA C1500 CGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGC1550 GCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGC1600 CCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGC CACGTTCG1650 CCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGA1700 TTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGG1750 TTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTT TCGCCCTTTGACGT1800 TGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACA1850 CTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGAT1900 TTCGGCCTATTGGTTAAAAAATGAGCTGAT TTAACAAAAATTTAACGCGA1950 ATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACA2000 ATCTGCTCTGATGCCGCATAGTTAAGCCAACTCCGCTATCGCTACGTGAC2050 TGGGTCATGGCTGCGCCCCGACA CCCGCCAACACCCGCTGACGCGCCCTG2100 ACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCT2150 CCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCG2200 AGGCAGTATTCTTGAAG ACGAAAGGGCCTCGTGATACGCCTATTTTTATA2250 GGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTC2300 GGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCA2350 AATATGTATC CGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATA2400 TTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTC2450 CCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTG2500 GTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACAT2550 CGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAG2600 AACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTA2650 TTATCCCGTGATGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTA2700 TTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTA2750 CGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGT2800 GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGA2850 GCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATC2900 GTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACA CC2950 ACGATGCCAGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGA3000 ACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGG3050 ATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCT GGCTGGTTT3100 ATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGC3150 AGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGA3200 CGGGGAGTCAGGCAACTATGGATGAACGAAATAGA CAGATCGCTGAGATA3250 GGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATA3300 TATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGG3350 TGAAGATCCTTTTTGATAATCTCATGACC AAAATCCCTTAACGTGAGTTT3400 TCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTG3450 AGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCAC3500 CGCTACCAGCGGTGGTTTGTTT GCCGGATCAAGAGCTACCAACTCTTTTT3550 CCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCT3600 AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTA3650 CATACCTCGCTCTGCT AATCCTGTTACCAGTGGCTGCTGCCAGTGGCGAT3700 AAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGC3750 GCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGC3800 GAACGACCTA CACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGC3850 GCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAG3900 GGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGT3950 ATC TTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTT4000 TTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGC4050 GGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCT4100 TTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG4150 TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGT4200 GAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGC425 0 GTTGGCCGATTCATTAATCCAGCTGGCACGACAGGTTTCCCGACTGGAAA4300 GCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGC4350 ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAA TTG4400 TGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAA4450 TTAA4454 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 858 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GlyLeuArgAlaAs pTrpLeuPheXaaAlaLeuThrProAsnArg 151015 IleLeuSerProArgHisLeuLeuGlnArgAspProProAlaArg 20 2530 ProAlaAlaProCysGlyXaaProAsnSerCysGlnProCysCys 354045 CysSerMetSerSerCysIleSerSerCysSer ProSerProSer 505560 ProMetGlnArgAspLysGlyLysGluGluIleGlnPheMetAsn 6570 75 SerLysAsnGlnGlnArgLeuProXaaSerLysXaaIleGlnHis 808590 XaaArgXaaLysProLysLysXaaIleLeuGlnThrAsnValLeu 95100105 IleAspValLeuGlyIleLysAspPheHisSerLeuAlaArgLeu 110115120 LeuPheLeuIleLy sGlnGluAsnAsnAlaSerGlySerProSer 125130135 IleAlaCysGlnValGluXaaLysLysAsnLeuAlaMetAsnLeu 140 145150 ThrSerMetLysThrLysThrThrLeuGluThrAlaSerLeuVal 155160165 LysAspAlaAlaThrArgGluGlnTyrLeuSer LeuArgValAla 170175180 SerAsnValSerProGlyValProXaaTyrHisThrAsnThrAla 185190 195 PheCysLeuArgAlaIleGlyValLysThrTyrArgLysThrThr 200205210 ValGluIleLeuGluGlyLysLysGlyAspProGlyValSerGln 215220225 AlaIleGlnArgTyrAlaThrLysSerValThrPheLeuSerVal 230235240 GlnLysLeuAsnAl aXaaProAlaMetGlyArgValIleGluVal 245250255 SerTrpIleIleGlnAsnGlnAlaArgPheValSerAlaGlyIle 260 265270 IleArgHisHisThrGlyThrAsnSerCysLeuLysAspIlePro 275280285 ThrArgAlaLeuMetIleIleIleAlaAlaIle ProMetAlaSer 290295300 ArgGlyHisGlyAlaIleLeuLeuThrLeuThrProAlaGlySer 305310 315 ThrValGlnLeuLysHisAlaLeuThrIleLeuXaaMetThrLeu 320325330 MetPheLeuTrpLysGlnLeuAsnAlaSerLysValLysGluLys 335340345 AlaThrGlyAlaLeuSerIleProPheGlyMetGluPheHisVal 350355360 SerValGlyIleLe uSerIleLeuThrSerMetThrXaaLeuLeu 365370375 LysIleSerSerAlaArgThrTyrGluLysIleThrAlaGluIle 380 385390 GlnMetGlyLeuAsnHisProGlyValLeuProLeuIleGlnThr 395400405 SerGluLeuAlaThrAlaProLysPheGlnThr ValIleCysHis 410415420 MetAspLysIleValIleValGlyMetAlaLysIleIleTrpAla 425430 435 ThrTyrProLysGlnAspLeuAspXaaHisValGlnCysGlyThr 440445450 ArgThrTrpLysThrTyrIleValIleSerSerGlyAsnGlnMet 455460465 GlnValSerXaaMetArgIleThrAlaGluIleGlnMetMetMet 470475480 LeuMetAspProGl yAlaThrArgGluIleHisSerPheLeuGly 485490495 IleIleAlaLeuPheLeuValValLysValIleProHisLeuGln 500 505510 XaaSerIleXaaThrIleProXaaTyrLeuValProLysArgAsn 515520525 AsnCysGluLeuXaaMetGlyPheGlnHisGlu GlnThrXaaAsp 530535540 GlyTrpLeuValXaaAspThrGluIleAsnIleSerAlaGluAsp 545550 555 HisXaaXaaArgArgValGlyPheLeuLeuHisAspSerValSer 560565570 LeuLeuGluThrXaaLysIleMetLysLeuGlyLeuGluPheMet 575580585 MetSerThrGluGluGluMetArgAsnAlaAsnArgPheSerMet 590595600 PheProSerTrpTy rMetAlaLeuLysAspGlnIleTrpPheXaa 605610615 XaaSerLeuProGlyLeuLeuSerTrpMetIleLeuLeuValArg 620 625630 LeuIleTyrLeuIleMetAspAlaGlnPheLeuLysArgProVal 635640645 AlaValPheMetAlaGlyAlaThrLeuAspXaa SerThrMetMet 650655660 AlaTyrTyrGluTrpHisIleSerIleXaaTrpGluMetArgAsn 665670 675 AlaAlaSerIleIleGluGlyArgXaaLeuXaaMetSerLeuLys 680685690 TyrValLeuGlyLeuLysArgLeuAspGlnAspHisValArgGly 695700705 IleMetValAlaHisLeuPheValSerAsnIleLysXaaGluTrp 710715720 PheLeuValSerLe uPheLeuValValAspValProPheGlnIle 725730735 ValLeuValPheLeuSerGluXaaHisIleMetGlnAsnGlyTyr 740 745750 ThrLysLeuPheXaaHisIleArgTyrHisSerHisSerXaaSer 755760765 LysCysValXaaSerThrHisGlnTyrAsnCys LeuLeuHisGlu 770775780 AspPheArgGluCysGlyIleXaaAsnValThrTyrAsnAsnPro 785790 795 LysThrThrThrGlyGluSerCysLeuLeuLysPheSerLeuMet 800805810 PheMetGlyValPheCysCysPheValCysGlnCysTyrPheVal 815820825 AsnValGluValAsnXaaGlyThrCysLysCysAsnAsnIleSer 830835840 ProGluAspThrXa aMetAspXaaLysAsnThrGlnValTyrLeu 845850855 LeuAspAsp 858
Claims (17)
1. A method of enhancing hepatocyte proliferation comprising administering to a mammalian patient in need of such treatment exogenous native sequence human hepatocyte growth factor (hHGF) in an amount effective in inducing hepatocyte proliferation and a synergistically effective amount of gamma interferon (IFN-γ).
2. The method of claim 1 wherein said exogenous hHFG is administered prior to IFN-γ administration.
3. The method of claim 1 wherein said exogenous hHFG is administered following IFN-γ administration.
4. The method of claim 1 wherein said exogenous hHFG and IFN-γ are administered simultaneously.
5. The method of claim 4 wherein said exogenous hHFG and IFN-γ are administered in a single pharmaceutical composition in admixture with at least one pharmaceutically acceptable excipient.
6. The method of claim 1 wherein said patient was subject to acute or chronic liver injury.
7. The method of claim 6 wherein said patient is human and said IFN-γ is human IFN-γ.
8. The method of claim 7 wherein said IFN-γ is human desCysTyrCys IFN-γ.
9. The method of claim 7 wherein said patient was subject to partial hepatectomy.
10. The method of claim 9 wherein said human IFN-γ is administered within about 6 days following partial hepatectomy.
11. The method of claim 10 wherein said human IFN-γ is administered within about 24 hours following partial hepatectomy.
12. The method of claim 10 wherein said human IFN-γ is administered as a liquid pharmaceutical formulation.
13. A method of stimulating hepatocyte growth in a mammalian patient in need of such treatment, comprising:
a) determining the hepatocyte growth factor (HGF) concentration in the serum of said patient,
b) comparing said HGF concentration with the normal HGF concentration in the serum of the same mammalian species, and
c) administering a synergistic amount of IFN-γ to said patient if said HGF concentration is higher than said normal HGF concentration, or
e) administering a therapeutically effective amount of native sequence human hepatocyte growth factor (hHGF) and a synergistic amount of IFN-γ to said patient if said HGF concentration is the same or lower than said normal HGF concentration.
14. A composition for use in the stimulation of hepatocyte regeneration comprising a therapeutically effective amount of native sequence human hepatocyte growth factor (hHGF) and a synergistic amount of gamma interferon (IFN-γ).
15. The composition of claim 14 comprising from about 100 U to about 1000 U of IFN-γ.
16. The composition of claim 15 further comprising at least one pharmaceutically acceptable excipient.
17. A method of enhancing the hepatocyte growth stimulating activity of hepatocyte growth factor (HGF), comprising administering to a mammalian patient native sequence human hepatocyte growth factor (hHGF) and a synergistically effective amount of gamma interferon (IFN-γ).
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US07/712,284 US5227158A (en) | 1991-06-10 | 1991-06-10 | Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon |
| DK92912541.7T DK0606210T3 (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma interferon |
| JP5500867A JPH06508148A (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation by hepatocyte growth factor and γ-interferon |
| PCT/US1992/004227 WO1992022321A1 (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon |
| EP92912541A EP0606210B1 (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon |
| CA002109434A CA2109434A1 (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon |
| AT92912541T ATE151292T1 (en) | 1991-06-10 | 1992-05-19 | PROMOTING HEPATOCYT GROWTH WITH HEPATOCYT GROWTH FACTOR AND GAMMA INTERFERON |
| DE69218956T DE69218956T2 (en) | 1991-06-10 | 1992-05-19 | PROMOTING HEPATOCYT GROWTH WITH HEPATOCYT GROWTH FACTOR AND GAMMA INTERFERON |
| ES92912541T ES2101849T3 (en) | 1991-06-10 | 1992-05-19 | STIMULATION OF THE GROWTH OF HEPATOCITOS WITH GROWTH FACTOR OF HEPATOCITOS OR GAMMA INTERFERED. |
| AU21441/92A AU655653B2 (en) | 1991-06-10 | 1992-05-19 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon |
| ZA923980A ZA923980B (en) | 1991-06-10 | 1992-06-01 | Hepatocyte Growth stimulation |
| GR970401257T GR3023613T3 (en) | 1991-06-10 | 1997-05-30 | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon. |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US07/712,284 US5227158A (en) | 1991-06-10 | 1991-06-10 | Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5227158A true US5227158A (en) | 1993-07-13 |
Family
ID=24861484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US07/712,284 Expired - Lifetime US5227158A (en) | 1991-06-10 | 1991-06-10 | Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US5227158A (en) |
| EP (1) | EP0606210B1 (en) |
| JP (1) | JPH06508148A (en) |
| AT (1) | ATE151292T1 (en) |
| AU (1) | AU655653B2 (en) |
| CA (1) | CA2109434A1 (en) |
| DE (1) | DE69218956T2 (en) |
| DK (1) | DK0606210T3 (en) |
| ES (1) | ES2101849T3 (en) |
| GR (1) | GR3023613T3 (en) |
| WO (1) | WO1992022321A1 (en) |
| ZA (1) | ZA923980B (en) |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5362716A (en) * | 1989-12-27 | 1994-11-08 | The United States Of America As Represented By The Department Of Health And Human Services | Methods for stimulating hematopoietic progenitors using hepatocyte growth factor and lymphokines |
| US5464815A (en) * | 1993-09-08 | 1995-11-07 | Genentech, Inc. | Inhibition of heparin-binding |
| US5646036A (en) * | 1995-06-02 | 1997-07-08 | Genentech, Inc. | Nucleic acids encoding hepatocyte growth factor receptor antagonist antibodies |
| US5654404A (en) * | 1992-09-16 | 1997-08-05 | Genentech, Inc. | Protection against liver damage by HGF |
| WO1997037113A1 (en) * | 1996-03-29 | 1997-10-09 | Hetian Tang | Rotary vane engine |
| US5684136A (en) * | 1992-05-18 | 1997-11-04 | Genentech, Inc. | Chimeric hepatocyte growth factor (HGF) ligand variants |
| US5686292A (en) * | 1995-06-02 | 1997-11-11 | Genentech, Inc. | Hepatocyte growth factor receptor antagonist antibodies and uses thereof |
| US5696086A (en) * | 1994-11-03 | 1997-12-09 | Genentech, Inc. | Methods and kits using macrophage stimulating protein |
| US5770704A (en) * | 1992-05-18 | 1998-06-23 | Genentech, Inc. | Receptor activation with inactive hepatocyte growth factor ligands |
| US5855918A (en) * | 1995-09-12 | 1999-01-05 | Genentech, Inc. | Cystic fibrosis therapy |
| US6099841A (en) * | 1996-07-03 | 2000-08-08 | Genentech, Inc. | Hepatocyte growth factor receptor agonists and uses thereof |
| US6133234A (en) * | 1995-10-05 | 2000-10-17 | Genentech, Inc. | Methods and compositions for treating vascular stenosis |
| US6133231A (en) * | 1995-10-05 | 2000-10-17 | Genentech, Inc. | Angiogenesis using hepatocyte growth factor |
| US6214344B1 (en) | 1995-06-02 | 2001-04-10 | Genetech, Inc. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US6280739B1 (en) | 1996-04-18 | 2001-08-28 | Genetics Institute, Inc. | Method of inhibiting angiogenesis using secreted proteins |
| US20020136721A1 (en) * | 1998-02-17 | 2002-09-26 | Schwall Ralph H. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US20020160974A1 (en) * | 2001-01-09 | 2002-10-31 | Banchereau Jacques F. | Methods for treating autoimmune diseases in a subject and in vitro diagnostic assays |
| US6699837B2 (en) * | 1993-09-17 | 2004-03-02 | Toshikazu Nakamura | Treatment of neurons with HGF |
| US20040170613A1 (en) * | 2002-06-05 | 2004-09-02 | Genentech, Inc. | Compositions and methods for liver growth and liver protection |
| US20050227324A1 (en) * | 2003-12-19 | 2005-10-13 | Genentech, Inc. | Monovalent antibody fragments useful as therapeutics |
| US20050244959A1 (en) * | 2004-03-30 | 2005-11-03 | Anne Corlu | Methods for inducing active hepatocytes proliferation, kits using such methods and uses of said kits |
| US20060093606A1 (en) * | 2004-07-20 | 2006-05-04 | Genentech, Inc. | Compositions and methods of using angiopoietin-like 4 protein |
| US20060134104A1 (en) * | 2004-08-05 | 2006-06-22 | Genentech, Inc. | Humanized anti-cmet antagonists |
| US20080008701A1 (en) * | 2006-07-07 | 2008-01-10 | Washington State University Research Foundation | C-met receptor regulation by angiotensin iv (at4) receptor ligands |
| US20080293634A1 (en) * | 2006-07-07 | 2008-11-27 | Harding Joseph W | C-met receptor regulation by angiotensin iv (at4) receptor ligands |
| US20090226455A1 (en) * | 2008-03-06 | 2009-09-10 | Genentech, Inc. | Combination therapy with c-met and her antagonists |
| US7737115B2 (en) | 2005-04-15 | 2010-06-15 | Genetech, Inc. | HGF beta chain variants |
| EP2311880A2 (en) | 2005-01-05 | 2011-04-20 | Biogen Idec MA Inc. | Cripto binding molecules |
| EP2385069A2 (en) | 2003-11-12 | 2011-11-09 | Biogen Idec MA Inc. | Neonatal Fc rReceptor (FcRn)- binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
| US8084200B2 (en) | 2002-11-15 | 2011-12-27 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| WO2012006635A1 (en) | 2010-07-09 | 2012-01-12 | Biogen Idec Hemophilia Inc. | Processable single chain molecules and polypeptides made using same |
| WO2013012733A1 (en) | 2011-07-15 | 2013-01-24 | Biogen Idec Ma Inc. | Heterodimeric fc regions, binding molecules comprising same, and methods relating thereto |
| WO2013106577A2 (en) | 2012-01-10 | 2013-07-18 | Biogen Idec Ma Inc. | Enhancement of transport of therapeutic molecules across the blood brain barrier |
| WO2016127000A1 (en) | 2015-02-04 | 2016-08-11 | Bristol-Myers Squibb Company | Methods of selecting therapeutic molecules |
| US9487589B2 (en) | 2011-06-30 | 2016-11-08 | Genentech, Inc. | Anti-c-met-antibody formulations |
| US10240207B2 (en) | 2014-03-24 | 2019-03-26 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with HGF expression |
| RU2720451C1 (en) * | 2019-05-06 | 2020-04-29 | Анастасия Юрьевна Лаптиёва | Method of stimulating postresection proliferation of hepatocytes by intrahepatic introduction of cyanocobalamin |
| US11077132B2 (en) | 2015-02-04 | 2021-08-03 | F. Hoffmann-La Roche Ag | Tau antisense oligomers and uses thereof |
| US11168125B2 (en) | 2003-05-06 | 2021-11-09 | Bioverativ Therapeutics Inc. | Immunoglobulin chimeric monomer-dimer hybrids |
| US11642398B2 (en) | 2013-03-15 | 2023-05-09 | Bioverativ Therapeutics Inc. | Factor IX polypeptide formulations |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4855238A (en) * | 1983-12-16 | 1989-08-08 | Genentech, Inc. | Recombinant gamma interferons having enhanced stability and methods therefor |
| US4973478A (en) * | 1987-07-20 | 1990-11-27 | Allelix Biopharmaceuticals, Inc. | Treating inflammation with hepatocyte stimulating factor interferon β2 |
| US5004805A (en) * | 1986-07-14 | 1991-04-02 | Shuji Hashimoto | Hepatocyte growth factor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0294160A1 (en) * | 1987-06-02 | 1988-12-07 | Schering Corporation | Treatment of chronic type b hepatitis with a combination of recombinant human alpha and gamma interferons |
| AU2855189A (en) * | 1988-01-25 | 1989-07-27 | Baker Cummins Dermatologicals, Inc. | Method of treating fibrotic disorders |
-
1991
- 1991-06-10 US US07/712,284 patent/US5227158A/en not_active Expired - Lifetime
-
1992
- 1992-05-19 JP JP5500867A patent/JPH06508148A/en active Pending
- 1992-05-19 WO PCT/US1992/004227 patent/WO1992022321A1/en not_active Ceased
- 1992-05-19 DE DE69218956T patent/DE69218956T2/en not_active Expired - Lifetime
- 1992-05-19 ES ES92912541T patent/ES2101849T3/en not_active Expired - Lifetime
- 1992-05-19 AT AT92912541T patent/ATE151292T1/en active
- 1992-05-19 EP EP92912541A patent/EP0606210B1/en not_active Expired - Lifetime
- 1992-05-19 CA CA002109434A patent/CA2109434A1/en not_active Abandoned
- 1992-05-19 DK DK92912541.7T patent/DK0606210T3/en active
- 1992-05-19 AU AU21441/92A patent/AU655653B2/en not_active Expired
- 1992-06-01 ZA ZA923980A patent/ZA923980B/en unknown
-
1997
- 1997-05-30 GR GR970401257T patent/GR3023613T3/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4855238A (en) * | 1983-12-16 | 1989-08-08 | Genentech, Inc. | Recombinant gamma interferons having enhanced stability and methods therefor |
| US5004805A (en) * | 1986-07-14 | 1991-04-02 | Shuji Hashimoto | Hepatocyte growth factor |
| US4973478A (en) * | 1987-07-20 | 1990-11-27 | Allelix Biopharmaceuticals, Inc. | Treating inflammation with hepatocyte stimulating factor interferon β2 |
Non-Patent Citations (24)
| Title |
|---|
| Caselmann et al. (1989) Gastroenterology 96:449 455. * |
| Caselmann et al. (1989) Gastroenterology 96:449-455. |
| Gauldie et al., Proc. Natl. Acad. Sci. USA 84, 7251 (1987). * |
| Gohda et al., J. Clin. Invest. 81, 414 (1988). * |
| Ichikara et al., Mol. Cell. Biochem. 43, 145 (1982). * |
| McGowan et al., J. Cell. Physiol. 108, 353 (1981). * |
| Michalopoulos et al., Cancer Res. 42, 4673 (1982). * |
| Miyazawa et al., Biochem. Biophys. Res. Comm. 163, 967 (1989). * |
| Nakamura et al., Biochem. Biophys. Res. Comm. 122, 1450 (1984). * |
| Nakamura et al., Biochim. Biophys. Acta 678, 91 (1981). * |
| Nakamura et al., FEBS Letters 224, 311 (1987). * |
| Nakamura et al., in Proc. Natl. Acad. Sci. USA 80, 7229 (1983). * |
| Nakamura et al., J. Biochem. (Tokyo) 94, 1029 (1982). * |
| Nakamura et al., J. Biol. Chem. 255, 7533 (1980). * |
| Nakamura et al., Nature 342, 440 (1989). * |
| Noda et al., J. Biol. Chem. 258, 1520 (1983). * |
| Quiroga et al. (1988) J. Interferon Res. 8:755 763. * |
| Quiroga et al. (1988) J. Interferon Res. 8:755-763. |
| Richman et al., Proc. Natl. Acad. Sci. USA 73, 3589 (1976). * |
| Seki, et al., Biochem. Biophys. Res. Comm. 172, 321 (1990). * |
| Tanaka et al., J. Biochem. 84, 937 (1978). * |
| Tomita et al., Exp. Cell Res. 135, 363 (1981). * |
| Zarnegar and Michalopoulos, Cancer Research 49, 3314 (1989). * |
| Zarnegar et al., Biochem. Biophys. Res. Comm. 163, 1370 (1989). * |
Cited By (72)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5362716A (en) * | 1989-12-27 | 1994-11-08 | The United States Of America As Represented By The Department Of Health And Human Services | Methods for stimulating hematopoietic progenitors using hepatocyte growth factor and lymphokines |
| US5888965A (en) * | 1989-12-27 | 1999-03-30 | The United States Of America As Represented By The Department Of Health And Human Services | Method of stimulating bone marrow regeneration |
| US5684136A (en) * | 1992-05-18 | 1997-11-04 | Genentech, Inc. | Chimeric hepatocyte growth factor (HGF) ligand variants |
| US5763584A (en) * | 1992-05-18 | 1998-06-09 | Genentech, Inc. | Receptor activation with hepatocyte growth factor agonists |
| US5770704A (en) * | 1992-05-18 | 1998-06-23 | Genentech, Inc. | Receptor activation with inactive hepatocyte growth factor ligands |
| US5654404A (en) * | 1992-09-16 | 1997-08-05 | Genentech, Inc. | Protection against liver damage by HGF |
| US5851989A (en) * | 1993-09-08 | 1998-12-22 | Genentech, Inc. | Method of extending the plasma half-life of vascular endothelial cell growth factor |
| US5464815A (en) * | 1993-09-08 | 1995-11-07 | Genentech, Inc. | Inhibition of heparin-binding |
| US5849689A (en) * | 1993-09-08 | 1998-12-15 | Genentech, Inc. | Method of extending the plasma half-life of deletion variants of hepatocyte growth factor |
| US6699837B2 (en) * | 1993-09-17 | 2004-03-02 | Toshikazu Nakamura | Treatment of neurons with HGF |
| US5696086A (en) * | 1994-11-03 | 1997-12-09 | Genentech, Inc. | Methods and kits using macrophage stimulating protein |
| US6214344B1 (en) | 1995-06-02 | 2001-04-10 | Genetech, Inc. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US6468529B1 (en) | 1995-06-02 | 2002-10-22 | Genentech, Inc. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US5686292A (en) * | 1995-06-02 | 1997-11-11 | Genentech, Inc. | Hepatocyte growth factor receptor antagonist antibodies and uses thereof |
| US20090148457A1 (en) * | 1995-06-02 | 2009-06-11 | Genentech, Inc. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US5646036A (en) * | 1995-06-02 | 1997-07-08 | Genentech, Inc. | Nucleic acids encoding hepatocyte growth factor receptor antagonist antibodies |
| US6207152B1 (en) | 1995-06-02 | 2001-03-27 | Genentech, Inc. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US6033688A (en) * | 1995-09-12 | 2000-03-07 | Genentech, Inc. | Cystic fibrosis therapy |
| US5855918A (en) * | 1995-09-12 | 1999-01-05 | Genentech, Inc. | Cystic fibrosis therapy |
| US6133234A (en) * | 1995-10-05 | 2000-10-17 | Genentech, Inc. | Methods and compositions for treating vascular stenosis |
| US6133231A (en) * | 1995-10-05 | 2000-10-17 | Genentech, Inc. | Angiogenesis using hepatocyte growth factor |
| US20050250686A1 (en) * | 1995-10-05 | 2005-11-10 | Napoleone Ferrara | Angiogenesis using hepatocyte growth factor |
| WO1997037113A1 (en) * | 1996-03-29 | 1997-10-09 | Hetian Tang | Rotary vane engine |
| AU713585B2 (en) * | 1996-03-29 | 1999-12-02 | Hetian Tang | Rotary vane engine |
| US6280739B1 (en) | 1996-04-18 | 2001-08-28 | Genetics Institute, Inc. | Method of inhibiting angiogenesis using secreted proteins |
| US6099841A (en) * | 1996-07-03 | 2000-08-08 | Genentech, Inc. | Hepatocyte growth factor receptor agonists and uses thereof |
| US20020136721A1 (en) * | 1998-02-17 | 2002-09-26 | Schwall Ralph H. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US20030118587A1 (en) * | 1998-02-17 | 2003-06-26 | Schwall Ralph H. | Hepatocyte growth factor receptor antagonists and uses thereof |
| US20020160974A1 (en) * | 2001-01-09 | 2002-10-31 | Banchereau Jacques F. | Methods for treating autoimmune diseases in a subject and in vitro diagnostic assays |
| US20040067232A1 (en) * | 2001-01-09 | 2004-04-08 | Banchereau Jacques F. | Methods for treating autoimmune diseases in a subject and in vitro diagnostic assays |
| US7544357B2 (en) | 2001-01-09 | 2009-06-09 | Baylor Research Institute | Methods for treating autoimmune diseases in a subject and in vitro diagnostic assays |
| US7700571B2 (en) | 2002-06-05 | 2010-04-20 | Genentech, Inc. | Compositions and methods for liver growth and liver protection |
| EP2430923A1 (en) | 2002-06-05 | 2012-03-21 | Genentech, Inc. | Compositions and methods for liver growth and liver protection |
| US20070122394A1 (en) * | 2002-06-05 | 2007-05-31 | Genentech, Inc. | Compositions and Methods for Liver Growth and Liver Protection |
| US7709455B2 (en) | 2002-06-05 | 2010-05-04 | Genentech, Inc. | Compositions and methods for liver growth and liver protection |
| US20040170613A1 (en) * | 2002-06-05 | 2004-09-02 | Genentech, Inc. | Compositions and methods for liver growth and liver protection |
| US8084200B2 (en) | 2002-11-15 | 2011-12-27 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| US11168125B2 (en) | 2003-05-06 | 2021-11-09 | Bioverativ Therapeutics Inc. | Immunoglobulin chimeric monomer-dimer hybrids |
| EP2385069A2 (en) | 2003-11-12 | 2011-11-09 | Biogen Idec MA Inc. | Neonatal Fc rReceptor (FcRn)- binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
| US20110200596A1 (en) * | 2003-12-19 | 2011-08-18 | Genentech, Inc. | Monovalent antibody fragments useful as therapeutics |
| US20050227324A1 (en) * | 2003-12-19 | 2005-10-13 | Genentech, Inc. | Monovalent antibody fragments useful as therapeutics |
| US20050244959A1 (en) * | 2004-03-30 | 2005-11-03 | Anne Corlu | Methods for inducing active hepatocytes proliferation, kits using such methods and uses of said kits |
| US7371384B2 (en) | 2004-07-20 | 2008-05-13 | Genentech, Inc. | Compositions and methods of using angiopoietin-like 4 protein antibody |
| US20070054856A1 (en) * | 2004-07-20 | 2007-03-08 | Hanspeter Gerber | Compositions and methods of using angiopoietin-like 4 protein |
| US20060093606A1 (en) * | 2004-07-20 | 2006-05-04 | Genentech, Inc. | Compositions and methods of using angiopoietin-like 4 protein |
| US8633155B2 (en) | 2004-07-20 | 2014-01-21 | Genentech, Inc. | Methods of using angiopoietin-like 4 protein to stimulate proliferation of pre-adipocytes |
| US7476724B2 (en) | 2004-08-05 | 2009-01-13 | Genentech, Inc. | Humanized anti-cmet antibodies |
| US20060134104A1 (en) * | 2004-08-05 | 2006-06-22 | Genentech, Inc. | Humanized anti-cmet antagonists |
| EP2311881A2 (en) | 2005-01-05 | 2011-04-20 | Biogen Idec MA Inc. | Cripto binding molecules |
| EP2311880A2 (en) | 2005-01-05 | 2011-04-20 | Biogen Idec MA Inc. | Cripto binding molecules |
| US8110377B2 (en) | 2005-04-15 | 2012-02-07 | Genentech, Inc. | HGF β chain variants |
| US7737115B2 (en) | 2005-04-15 | 2010-06-15 | Genetech, Inc. | HGF beta chain variants |
| US7910555B2 (en) | 2006-07-07 | 2011-03-22 | Washington State University Research Foundation | C-Met receptor regulation by angiotensin IV (AT4 ) receptor ligands |
| US8236761B2 (en) | 2006-07-07 | 2012-08-07 | Washington State University Research Foundation | C-Met receptor regulation by angiotensin IV (AT4) receptor ligands |
| US20080293634A1 (en) * | 2006-07-07 | 2008-11-27 | Harding Joseph W | C-met receptor regulation by angiotensin iv (at4) receptor ligands |
| US20080008701A1 (en) * | 2006-07-07 | 2008-01-10 | Washington State University Research Foundation | C-met receptor regulation by angiotensin iv (at4) receptor ligands |
| US20090226455A1 (en) * | 2008-03-06 | 2009-09-10 | Genentech, Inc. | Combination therapy with c-met and her antagonists |
| WO2012006635A1 (en) | 2010-07-09 | 2012-01-12 | Biogen Idec Hemophilia Inc. | Processable single chain molecules and polypeptides made using same |
| US10927362B2 (en) | 2010-07-09 | 2021-02-23 | Bioverativ Therapeutics Inc. | Processable single chain molecules and polypeptides made using same |
| US9856468B2 (en) | 2010-07-09 | 2018-01-02 | Bioverativ Therapeutics Inc. | Processable single chain molecules and polypeptides made using same |
| US10968442B2 (en) | 2010-07-09 | 2021-04-06 | Bioverativ Therapeutics Inc. | Chimeric clotting factors |
| EP3560962A1 (en) | 2010-07-09 | 2019-10-30 | Bioverativ Therapeutics Inc. | Processable single chain molecules and polypeptides made using same |
| US9487589B2 (en) | 2011-06-30 | 2016-11-08 | Genentech, Inc. | Anti-c-met-antibody formulations |
| WO2013012733A1 (en) | 2011-07-15 | 2013-01-24 | Biogen Idec Ma Inc. | Heterodimeric fc regions, binding molecules comprising same, and methods relating thereto |
| WO2013106577A2 (en) | 2012-01-10 | 2013-07-18 | Biogen Idec Ma Inc. | Enhancement of transport of therapeutic molecules across the blood brain barrier |
| US11642398B2 (en) | 2013-03-15 | 2023-05-09 | Bioverativ Therapeutics Inc. | Factor IX polypeptide formulations |
| US10240207B2 (en) | 2014-03-24 | 2019-03-26 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with HGF expression |
| US11077132B2 (en) | 2015-02-04 | 2021-08-03 | F. Hoffmann-La Roche Ag | Tau antisense oligomers and uses thereof |
| WO2016127000A1 (en) | 2015-02-04 | 2016-08-11 | Bristol-Myers Squibb Company | Methods of selecting therapeutic molecules |
| EP3954993A1 (en) | 2015-02-04 | 2022-02-16 | Bristol-Myers Squibb Company | Methods of selecting therapeutic molecules |
| US11761951B2 (en) | 2015-02-04 | 2023-09-19 | Bristol-Myers Squibb Company | Methods of selecting therapeutic molecules |
| RU2720451C1 (en) * | 2019-05-06 | 2020-04-29 | Анастасия Юрьевна Лаптиёва | Method of stimulating postresection proliferation of hepatocytes by intrahepatic introduction of cyanocobalamin |
Also Published As
| Publication number | Publication date |
|---|---|
| EP0606210A1 (en) | 1994-07-20 |
| DE69218956T2 (en) | 1997-07-31 |
| AU2144192A (en) | 1993-01-12 |
| EP0606210B1 (en) | 1997-04-09 |
| WO1992022321A1 (en) | 1992-12-23 |
| CA2109434A1 (en) | 1992-12-11 |
| DE69218956D1 (en) | 1997-05-15 |
| JPH06508148A (en) | 1994-09-14 |
| AU655653B2 (en) | 1995-01-05 |
| ZA923980B (en) | 1993-12-01 |
| DK0606210T3 (en) | 1997-05-05 |
| ES2101849T3 (en) | 1997-07-16 |
| ATE151292T1 (en) | 1997-04-15 |
| GR3023613T3 (en) | 1997-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0606210B1 (en) | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon | |
| EP0412149B1 (en) | Use of il-7 in providing medications for stimulation of platelet production | |
| US7803361B2 (en) | Therapeutic use of interleukin-2 mutants | |
| EP0911033B1 (en) | Use of consensus interferon for reducing the side effects of interferon treatment in viral hepatitis. | |
| US6348192B1 (en) | Interleukin-2 mutein expressed from mammalian cells | |
| ES2204922T3 (en) | ANTI-BANK GENE THERAPY BY MODULATION OF THE IMMUNE AND / OR INFLAMMATORY RESPONSE. | |
| JP4637913B2 (en) | Human interferon beta mutant | |
| KR20010075661A (en) | Methods and compositions for the prevention and treatment of anemia | |
| SK150596A3 (en) | Agonists and antagonists of human interleukin-10 | |
| Leslie et al. | Heparin-binding EGF-like growth factor is a mitogen for rat alveolar type II cells. | |
| KR20140063657A (en) | Hcv immunotherapy | |
| WO2002015926A1 (en) | c-mpl LIGAND-CONTAINING MEDICINAL COMPOSITIONS FOR INCREASING PLATELETS AND ERYTHROCYTES | |
| US6248560B1 (en) | Analogs of macrophage stimulating protein | |
| CA2522322A1 (en) | Agent for treating diabetes mellitus | |
| Tetsuya et al. | A high-level and regulatable production system for recombinant glycoproteins using a human interferon-α promoter-based expression vector | |
| EP0449949A1 (en) | Use of interleukin-4 for lowering blood-cholesterol levels | |
| HK1018595B (en) | Use of consensus interferon for reducing the side effects of interferon treatment in viral hepatitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: GENENTECH, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNOR:JARDIEU, PAULA M.;REEL/FRAME:005754/0283 Effective date: 19910610 |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| FPAY | Fee payment |
Year of fee payment: 12 |