SK150596A3 - Agonists and antagonists of human interleukin-10 - Google Patents

Abstract

Agonists and antagonists of human IL-10 are provided by this invention which are based upon modification of the termini of mature human IL-10. Also provided are compositions and methods for supplying or inhibiting the biological activity of human IL-10. Such compositions may be useful in the treatment of diseases characterized by inappropriate Th responses. Nucleic acids encoding the agonists and antagonists, recombinant vectors and transformed host cells comprising such nucleic acids, and methods for making the agonists and antagonists using the transformed host cells are also provided.

Description

Technical field

The present invention relates to human interleukin-10 agonists, to a process for their preparation and use. These agonists are formed by substitution or deletion of carboxy- or amino-amino acids in adult human interleukin-10.

BACKGROUND OF THE INVENTION

Interleukin-10 (IL-10) is a cytokine capable of mediating a number of actions or effects. IL-10 has been isolated from both murine and human cells and is involved in controlling the immune response of various classes or sets of CD4 ⁺ T helper (Th) cells. These Th cells can be subdivided into a variety of sets, which deplete their cytokine production profiles. Two of these pools are called Th1 and Th2 cells.

Th1 T cell clones consist of interleukin-2 (IL-2) and gamma interferon (IFN-γ), whereas Th2 T cell clones secrete IL-10, interleukin-4 (IL-4) and interleukin-5 (IL-5) , generally after activation by antigens and lectins. Both classes of Th cell clones produce cytokines such as tumor necrosis factor-α (TNF'-α), interleukin-3 (IL-3) and granulocyte-macrophage colony stimulation factor (GM-CSF). The third category of Th cells (ThO) consists simultaneously of IL-2, IFN-γ, IL-4, IL-5, TNF-α, IL-3 and GM-CSF.

Different types of Th1 and Th2 cytokine production by cells partly reflect their roles in response to various pathogens. For example, Th1 cells are involved in successful cellular responses to a variety of intercellular pathogens. They are also involved in delayed-type hypersensitivity reactions. Th2 cells are associated with humoral responses that are characterized by antibody production. In most situations, the immune system develops a Th response that is most effective in eliminating a particular antigen or pathogen, but not always.

For example: leishmaniasis is characterized by a defective Thl response. This defect can be demonstrated using in vitro assays, such as the assay described by Clerici et al. [J. Clin. Invest. 84: 1983 (1989)]. Using one such in vitro assay, it has been shown that a Th1 response defect can be attributed to endogenous levels of IL-10, since Th1 function can be corrected by the addition of neutralizing antibodies against IL-10.

Since leishmaniasis and other diseases are characterized by a defective Th1 response attributable to the inappropriate action of endogenous IL-10, there is a need for IL-10 agonists and antagonists to treat such diseases.

SUMMARY OF THE INVENTION

The present invention provides a human IL-10 agonist that includes adult human IL-10 modified by deletion of one to eleven amino-terminal amino acid residues.

The invention also relates to nucleic acids encoding these agonists, recombinant vectors, and transformed host cells containing such nucleic acids, to a method of preparing agonists and to their use.

The term "adult human IL-10" is defined as a protein without a leader sequence (a) having an amino acid sequence substantially identical to sequence IV as defined herein below

Ser Gly Gin Gly Thr Gin Ser Glu Asn Ser Cys Thr His Phe Pro

5 10 15

Gly Asn Leu For Asn Met

25 30

Val Lys Thr Phe Phe Gin Met

40 45

Lys Glu Ser Phu Leu Glu Asp Phe

55 60

Leu Ser Glu Met I Gin Phe Tyr Leu Glu Glu Val Met Pro Gin Ala

70

Glu Asn Gin Asp For Asp Lys Ala His Val Asn Ser Leu Gly Glu

90 95

Asn Leu Lys Thr Arg Leu Arg Arg Leu Arg Arg Arg Cys His Arg Phe Leu

100 105 110

For Cys Glu Asn Lys Ser Lys Ala Glu Gin Val Lys Asn Ala Phe

115 120 125

Asn Lys Leu Gin Glu Lys Gly White Tyr Lys Ala Met Ser Glu Phe Asp

130 135 140 Phe He Asn Tyr Glu Ala Tyr Met Thr Met Lys Arg Asn 145 150 155 160 (IV), and (b) has the biological activity common to native IL-10. This includes natural allelic variants and other variants having one or more conservative amino acid substitutions [Grantham, Science 185: 862 (1974)] that do not substantially impair biological activity. Such conservative substitutions include groups of synonymous amino acids, e.g. as described in U.S. Pat. No. 5,017,691 to Lee et al.

More or less extensive deletions may also be performed. One or more amino acid residues may be deleted, including about 12 carboxyterminal residues. Preferably, about 8 terminal residues are deleted, more preferably 3 or 4 terminal residues.

Surprisingly, it has been found that up to 11 amino acid residues can be deleted from the amino terminus of adult human IL-10. These truncated variants, which may have different pharmacokinetic properties compared to IL-10 alone, have adult human IL-10 biological activity as measured by the MC / 9 mast cell stimulation assay. Therefore, they are useful in the treatment of all indications susceptible to treatment with IL-10 alone. They are also useful for some other purposes, e.g. for affinity purification.

Because they have the biological activity of human IL-10 but have a shortened amino acid sequence, these variants are also referred to herein as "human IL-10 agonists".

It is generally accepted that the cysteine residue at position 12 is essential for biological activity. Indeed, deletion of the first 12 residues, including this cysteine residue, resulted in a variant that had no biological activity. Therefore, amino-terminal deletions are limited to the deletion of one or more of the first 11 residues.

Nucleic acids encoding IL-10 agonists are also part of the present invention. Those of skill in the art will recognize that due to the degeneracy of the genetic code, there are many different nucleic acids that can encode each agonist and antagonist. In particular, the codons used may be selected based on convenient construction and optimal expression in prokaryotic and eukaryolic systems.

Preferably, agonist-encoding nucleic acids are prepared using a polymerase chain reaction (PCR) [Saiki et al., Science 239: 487 (1988)], as exemplified by Daugherty et al. [Nucleic Acid Res. 19: 2471 (1991)], to modify the cDNK encoding human IL-10. Such cDNK is well known in the art and can be prepared using standard methods described e.g. in International Patent Application Publication No. WO 91/00349. Clones containing sequences encoding human IL-10 are also deposited at the American Type Culture Collection (ATCC), Rockville, Maryland, under numbers 68191 and 68192.

Alternatively, the DNA may be modified using well-known directed mutagenesis techniques. See e.g. Gillman et al., Gene 8: 81 (1979), Roberts et al., Nature 328: 731 (1987) or Innis (ed.), 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, N Y.

The nucleic acids of the invention can also be synthesized chemically using e.g. the solid phase phosphoamide method of Matteucci et al. [J. Am. Chem. Soc. 103: 3185 (1981)], the methods of Yoo et al. [J. Biol. Chem. 764: 17078 (1989)] or other well known methods.

Recombinant vectors containing these nucleic acids are also part of this invention as well as host cells transformed with these vectors and a method for preparing agonists.

Insertion of the DNA encoding one of the agonists into one of a variety of known expression vectors is readily accomplished if the ends of the DNA and the vector contain compatible restriction sites. If this is not possible, it may be necessary to modify the ends of these DNAs and / or the vector by back-digging the overlapping regions of the single-stranded DNA created by restriction endonuclease digestion to create a blunt end or to achieve the same result by filling the single-stranded ends with the appropriate DNA polymerase.

Alternatively, any desired site can be generated by ligating nucleotide sequences (linkers) to these termini. These linkers may contain specific oligonucleotide sequences that define the desired restriction site. The cleaved vector and DNA fragments can, if necessary, be modified by homopolymeric extension or PCR.

Agonists can be chemically synthesized by a suitable method, such as solely solid phase synthesis, partially solid phase methods, fragment condensation, or classical solution synthesis. Chemically synthesized polypeptides are preferably prepared by solid phase peptide synthesis, e.g. as described by Merrifield [J. Am. Chem. Soc. 85: 2149 (1963), Science 232: 341 (1986)] and Atherton et al., (Solid Phase Peptide Synthesis: A Practical Approach, 1989, IRL Press, Oxford).

Any agonist prepared by any method can be purified using HPLC, gel filtration, ion exchange and partition chromatography, countercurrent separation or other well known methods.

The pharmaceutical compositions may be prepared by admixing one or more IL-10 agonists or pharmaceutically acceptable salts thereof with a pharmaceutically acceptable carrier.

Suitable pharmaceutical carriers can be any compatible non-toxic substances which are suitable for administering the compositions of the invention to a patient.

The carrier may comprise water, alcohol, fats, waxes, and inert solids. A pharmaceutically acceptable adjuvant (buffering agent, dispersing agent) may also be incorporated into the pharmaceutical composition. In general, compositions useful for parenteral administration of such drugs are well known, e.g. Remington's Pharmaceutical Science, 18th Edition (Mack Publishing Company, Easton, P.A., 1990). Single-dose packaging is often preferred, e.g. in sterile form.

The administration of the agonists is preferably parenterally, by intraperitoneal, intravenous, subcutaneous or intramuscular injection or infusion, or any other acceptable systemic route. Alternatively, the agonist may be administered by an implantable or injectable drug delivery system. Urquhart et al., Ann. Rev. Pharmacol. Toxicol. 24: 199 (1984), Lewis, ed., Controlled Release of Pesticides and Pharmaceuticals, 1981, Plenum Press, New York, New York, U.S. Pat. U.S. Patent Nos. 3,773,991 and 3,270,960]. Oral administration may also be accomplished by administering well known formulations that protect the agonist from gastrointestinal proteases. See also Langer, Science 249: 1527 (1990).

Agonists can also be administered by standard gene therapy techniques, including e.g. direct injection of nucleic acid into tissues, use of recombinant viral vectors or liposomes, and implantation of transfected cells. See e.g. Rosenberg, J. Clin. Oncol. 10: 1992.

Agonists may be administered alone or in combination with one or more other agents commonly used to treat conditions characterized by a defective Th response. Insulin, cyclosporin, prednisone or azathioprm may be administered together with an agonist, e.g. when used as a replacement for IL-10 for the treatment or prevention of insulin dependent diabetes mellitus (see co-pending U.S. application Ser. No. 07 / 955,523, Oct. 1, 1992).

The co-administration of one or more agents may be concurrent (together with) or sequential (before or after) with respect to administration of the agonist or antagonist. All agents administered must have the patient at sufficient levels to be pharmaceutically effective. Typically, when the second agent is administered for about half-life of the first agent, administration of the two agents is considered to be common.

Determination of the appropriate agonist dosage for a particular situation is within the skill of the art. Generally, treatment is initiated at lower doses than optimal. Thereafter, the dosage is increased with slight variations until the optimum effect under the conditions is achieved. If desired, it may be appropriate to divide the total daily dose and administer it in portions.

An effective amount is a dose that results in a demonstrable improvement in one or more clinical parameters or in a statistically significant improvement in response in one or more known Th functions; some of them, such as IL-2 formation, are described above. This response can be measured in vitro using blood cells taken from a patient, e.g. as described in Clerici et al., supra. Such an in vitro assay may be performed prior to initiation of treatment to provide a baseline reference with which an improved response can be compared.

The actual amount and number of doses of agonists and their pharmaceutically acceptable salts to a particular patient is regulated at the discretion of the attending physician, taking into account factors such as the age, condition and size of the patient and the degree of symptom (s) being treated.

DETAILED DESCRIPTION OF THE INVENTION

The present invention can be explained by the following examples. Unless otherwise specified, the percentages given below for solids in solids, liquids in liquids, respectively. solids in liquids are based on the weight / weight, volume / volume, resp. weight / volume.

Reagents and general methods

Restriction endonucleases were obtained from Boehringer Mannheim (Indianopobs, IN), while the DNA ligation kit was purchased from Takara Biochem., Inc. (Berkley, CA). Taq polymerase and Pfu polymerase were obtained from Stratagene (La Joba, CA). Recombinant human IL-10 (hIL-10) was prepared in a standard manner in Chinese hamster ovary (CHO) cells, essentially as described in Tsujimoto et al. [J. Biochem. 106: 23 (1989)]. Tissue culture medium, fetal bovine serum and glutamine were obtained from Gibco-BRL (Gaithesburg, MD). Oligonucleotide primers were synthesized by standard methods using an Applied Biosystems 380A, 380B or 394 DNA synthesizer (Foster City, CA).

Standard recombinant DNA methods are performed essentially as described by Sambrook et al. n Molecular Cloning: A Laboratory Manual, 2nd Edition, 1989, Cold Spring Harbor Laboratory Press, Plainview, New York.

transfection

Transient expression was performed as follows. COS (ATCC CRL 1651) bob cells maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum, 6 mM glutamine and penicillin / streptomycin. By electroporation using a Bio-Rad Gene Pulser ^R (Richmond, CA).

Bob cells released from the culture dishes by trypsin-EDTA treatment and suspended in fresh culture medium. About 5 x 10 ⁶ cells in a volume of 250 μΐ were mixed with 5 µg of plasmid DNA and then electroporated at a voltage set at 0.2 V and a capacity set at 960 mFD:

After electroporation, the bob cells were transferred to 10 cm culture dishes and cultured in 5% CO 2 at 37 ° C for 6 hours in 10 ml serum containing DMEM. When cells were attached to the dishes, the medium was removed by aspiration and replaced with serum-free medium. After 72 hours, the conditioned medium was collected for analysis.

Aminoterminal modification

To generate N-terminal variants of human IL-10, modified cDNK fragments corresponding to the PstI / BglII region of the hIL-10 wild-type cDNA were synthesized by PCR using a primer pair without a DNA template. The resulting bob fragments used to replace the corresponding region of the hIL-10 wild-type DNA in the pSV vector. Sports. Thus, variants were generated in which 7 (variant ΝΔ7), 10 (variant ΝΔ10), 11 (variant ΝΔ11) and 12 (variant ΝΔ12) amino acids were deleted from the N-terminus of wild-type hIL-10. The primer pairs used to generate each variant with consecutive sequence numbers defining their sequences, are as follows:

mutant: Primer (end): Sequence number ΝΔ7 C3352CC (5 ') XI C3355CC (3 ') XII ΝΔ10 C3353CC (5 ') XIII C3354CC (3 ') XIV ΝΔ11 C3483CC (5 ') XV C3485CC (3 ') XVI ΝΔ12 C3484CC (5 ') XVII C3486CC (3 ') XVIII

GACGACGGTG GCTGCAGCCG CCACCATGCA CAGCTCAGCA CTGCTCTGTT GCCTGGTCCT 60 CCTGACTGGG GTGAGGGCCT CTGAGAACAG C 91 (XI)

GGCATCTCGG AGATCTCGAA GCATGTTAGG CAGGTTGCCT GGGAAGTGGG TGCAGCTGTT 61 CTCAGAGGCC CTCACCCCAG TCAGGAGGAC 90 (ΧΠ)

GACGACGGTG GCTGCAGCCG CCACCATGCA CAGCTCAGCA CTGCTCTGTT GCCTGGTCCT 60 CCTGATCTGGG GTGAGGGCCA GC 82 (ΧΙΠ)

GGCATCTCGG AGATCTCGAA GCATGTTAGG CAGGTTGCCTGGGAAGTGGG TGCAGCTGTT 60 CCTCACCCCA GTCAGGAGGA C 81 (XIV)

GACGACGGTG GCTGCAGCCG CCACCATGCA CAGCTCAGCA CTGCTCTGTT GCCTGGTCCT 60 CCTGATCTGGG GTGAGGGCCT GC 82 (XV)

GGCATCTCGG AGATCTCGAA GCATGTTAGG GAGGTTGCCT GGGAAGTGGG TGCAGCTGTT 60 CACCCCAGTC AGGAGGAC 78 (xvi)

GACGACGGTG GCTGCAGCCG CCACCATGCA CAGCTCAGCA CTGCTCTGTT GCCTGGTCCT 60 CCTGATCTGGG GTGAGGGCCA C 81 (XVII)

GGCATCTCGG AGATCTCGAA GCATGTTAGG CAGGTTGCCT GGGAAGTGGG TGCAGCTGTT 60 CCCAGTCAGG AGGAC 75 (xin).

PCR was performed using 10 pmoles of each primer of the indicated primer pairs, as described above for the synthesis of C-terminal mutant antagonists. The PCR mixture was worked up by phenol-CHCl3 extraction, ethanol precipitation and then sequentially digested with Bgffl. and Song. The restriction digestion products were subjected to agarose gel electrophoresis as described above, and DNA fragments having the expected sizes were excised from the gel and obtained by phenol-CHCl3 extraction and ethanol precipitation.

After getting out of the gel they were Song! Bgl I restriction fragments of the hIL-10 variants used to replace the corresponding region of the hIL-10 wild-type DNA in pSV. Sport of the vector after digestion of this Ps / Bgl I region by digestion and ligation of the replacement fragment. The hIL10 mutant cDNKs in the pSV.Sport-based vector were propagated, verified and used as described above.

The resulting variants ΝΔ7, ΝΔ10, ΝΔ11 resp. ΝΔ12 had the amino acid sequences defined by residues 8-160, 11-160, 12-160, respectively. 13-160 of sequence IV, supra.

Metabolic labeling

COS cells were transfected as described above with the pSV.Sport expression vector carrying cDNK inserts encoding human IL-10; K157E, CA3 or ΟΔ4 antagonists; or agonist variants of ΝΔ7, ΝΔ10, ΝΔ11 or ΝΔ12. The bob cells are then incubated in 10 cm culture dishes in 5% CO 2 at 37 ° C for 48-72 hours in serum containing culture medium. After this incubation, the bean culture plates were washed twice with phosphate salt buffer (PBS) and incubated in 5% CO ₂ at 37 ° C for 30 minutes with 8 ml / dish of DMEM without methionine and supplemented with dialyzed FBS and glutamine. Media was removed from each well by aspiration and <3 µ replaced by 500 µΐ of methionine-free medium containing 250-300 µCi S-methionine (DuPont NEN, Boston, MA; specific activity 43.3 mCi / ml).

Bob cells incubated in 5% CO ₂ at 37 ° C for 5 hours, then 10 μΐ of a 1.5 mg / ml L-methionine stock solution was added to the dishes and incubated for 30 minutes. The labeled conditioned medium was collected and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis [SDS PAGE; Laemmli, Nature 227/680 (1970)] in 10 to 20% non-reducing gels and bob gels dried and autoradiographed using standard methods and Kodak XAR film.

Autoradiography showed various labeled bands for human EL-10; K157E, ΟΔ3 and ΟΔ4 antagonists; and agon7 and ΝΔ10 agonists, all of whom migrovabs with apparent molecular weights of about 16 to 18 kilodaltons. Under identical cell transfection and culture conditions, all three antagonists, carboxyterminal mutants of human IL-10, were expressed at a slightly reduced level of about 2-4 fold less than IL-10. The ot7 amino-terminal agonist variant expression was comparable to IL-10, while the ΝΔ10 variant was expressed at a level about four-fold lower than IL-10. The expression of variants ΝΔ11 and ΝΔ12 was too low to be detected by this method.

Claims (10)

PATENT CLAIMS A human IL-10 agonist comprising adult human IL-10 modified by deletion of from one to eleven of amino terminal residues. The agonist of claim 1, wherein 7, 10 or 11 amino acid residues have been deleted. 3. Nucleic acid encoding a human IL-10 agonist comprising an adult human 11-10 modified by deletion of one to eleven of the amino terminal residues. The nucleic acid of claim 3, encoding a human IL-10 agonist in which 7, 10 or 11 amino acid residues have been deleted. A recombinant vector comprising the nucleic acid of claim 3, which is capable of directing expression of the nucleic acid. A host cell comprising the recombinant vector of claim 5. 7. A method of preparing a human IL-10 agonist, comprising adult human IL-10 modified by deletion from one to eleven of amino terminal residues, wherein the host cells of claim 6 are cultured under conditions where the nucleic acid is expressed. The method of claim 7, wherein the nucleic acid encodes a human IL-10 agonist in which 7, 10 or 11 amino acid residues have been deleted. 9. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of a human IL-10 agonist comprising adult human IL-10 modified by deletion of from one to eleven of the amino-terminal amino acid residues. 10; Use of a human IL-10 agonist, which comprises adult human IL-10 modified by replacing the lysine residue at position 157 with an acidic amino acid residue or deleting three or four amino acid residues in the carboxyterminal region, for the manufacture of a medicament for inhibiting the biological activity of IL-10.