US20230416389A1

US20230416389A1 - Dysfunctional antigen-specific cd8+ t cells in the tumor microenvironment

Info

Publication number: US20230416389A1
Application number: US18/151,112
Authority: US
Inventors: Thomas Gajewski; Jason Williams; Brendan Horton
Original assignee: University of Chicago
Current assignee: University of Chicago
Priority date: 2017-01-17
Filing date: 2023-01-06
Publication date: 2023-12-28
Also published as: US11566077B2; US20200010557A1; CA3049445A1; JP2022184862A; JP2020505342A; CN110740748A; WO2018186924A1; EP3570887A1; EP3570887A4

Abstract

Provided herein are compositions and methods for detecting and/or targeting dysfunctional tumor antigen-specific CD8⁺ T cells in the tumor microenvironment for diagnostic, therapeutic and/or research applications. In particular, dysfunctional tumor antigen-specific CD8⁺ T cells are detected and/or targeted via their expression of cell surface receptors described herein, such as 4-1BB, LAG-3, or additional markers that correlate with 4-1BB and LAG-3 expression, such as markers differentially expressed on the surface of the T cells.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

The present invention is a continuation of U.S. patent application Ser. No. 16/476,219, filed Jul. 5, 2019, now allowed, which is a § 371 National Entry of PCT/US18/14008, filed Jan. 17, 2018, which claims priority to U.S. Provisional Patent Application Ser. No. 62/447,199, filed Jan. 17, 2017, which is incorporated by reference in its entirety.

SEQUENCE LISTING

The text of the computer readable sequence listing filed herewith, titled “35120-303_SEQUENCE_LISTING”, created Jan. 6, 2023, having a file size of 53,909 bytes, is hereby incorporated by reference in its entirety.

FIELD

BACKGROUND

The immune system plays a critical role in protecting the host from cancer (Vesely et al., 2011; incorporated by reference in its entirety). Innate sensing of tumors leads to an adaptive T cell response through the presentation of tumor-associated antigens (TAAs) derived from mutations and epigenetic changes that contribute to carcinogenesis (Gajewski et al., 2013; incorporated by reference in its entirety). Spontaneously-primed CD8+ T cells home to tumor sites in mouse tumor models (Harlin et al., 2009; Fuertes et al., 2011; incorporated by reference in their entireties) and in a subset of patients with advanced cancer (Harlin et al., 2006; incorporated by reference in its entirety). These tumor-infiltrating lymphocytes (TIL) have the ability to recognize tumor antigens and are believed to contribute to tumor control in cancer patients, based on the correlation between activated CD8+ T cell infiltration with improved prognosis and response to immunotherapy (Fridman et al., 2012; Tumeh et al., 2014; incorporated by reference in their entireties). However, without additional manipulation, this endogenous anti-tumor response is usually not sufficient to mediate complete rejection of an established tumor (Gajewski, 2007b; Pardoll, 2012; Baitsch et al., 2011; Gajewski et al., 2006; Larkin et al., 2015). Data accumulated over the past several years have indicated that tumors with spontaneous anti-tumor T cell responses have high expression of immune-inhibitory pathways that subvert the effector phase of the response. These include PD-L1/PD-1 interactions (Pardoll, 2012; incorporated by reference in its entirety), recruitment of CD4+Foxp3+ regulatory T (Treg) cells (Gajewski, 2007a; incorporated by reference in its entirety), and metabolic dysregulation by indoleamine-2,3-dioxygenase (IDO) (Spranger et al., 2013; incorporated by reference in its entirety). However, even when CD8+ T cells specific for tumor antigens are isolated from tumors, away from these extrinsic immune inhibitory factors, they still show altered functional properties ex vivo (Harlin et al., 2006; Baitsch et al., 2011; incorporated by reference in their entireties).
Expression of PD-1 has been described to identify tumor-specific exhausted T cells (Ahmadzadeh et al., 2009; Fourcade et al., 2012; Wu et al., 2014; Gros et al., 2014; incorporated by reference in their entireties). However, T cells expressing PD-1 in the context of chronic infection can still retain effector function (Wherry and Kurachi, 2015; incorporated by reference in its entirety), and PD-1 is not required for the induction of T cell exhaustion (Odorizzi et al., 2015; incorporated by reference in its entirety). In addition to PD-1, several additional co-inhibitory receptors, including CD223 (LAG-3), CD244 (2B4), T-cell immunoreceptor with Ig and ITIM domains (TIGIT), hepatitis A virus cellular receptor 2 (TIM-3), and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), are also be expressed on dysfunctional T cells and expression of a greater number of inhibitory receptors has been correlated with diminished cytokine secretion (in particular IFN-g and TNF-a) as well as proliferative capacity (Blackburn et al., 2009; incorporated by reference in its entirety). Expression of these receptors has been observed in both viral and cancer models, however, a complete analysis of both co-inhibitory and co-stimulatory receptors on the same population is lacking in the tumor setting.

SUMMARY

Provided herein are compositions and methods for detecting and/or targeting dysfunctional tumor antigen-specific CD8⁺ T cells in the tumor microenvironment for diagnostic, therapeutic and/or research applications. In particular, dysfunctional tumor antigen-specific CD8⁺ T cells are detected and/or targeted via their expression of cell surface receptors described herein, such as 4-1BB, LAG-3, or additional markers that correlate with 4-1BB and LAG-3 expression, such as markers differentially expressed on the surface of the T cells (e.g., PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM and Sema7a).
In some embodiments, provided herein are methods of treating a subject with cancer comprising administering an agent that specifically targets dysfunctional tumor antigen-specific CD8⁺ T cells. In some embodiments, the subject suffers from a solid tumor cancer. In some embodiments, the tumor allows T cell infiltration, but is resistant to immunotherapies. In some embodiments, the tumor environment comprises dysfunctional tumor antigen-specific CD8⁺ T cells. In some embodiments, contacting the dysfunctional tumor antigen-specific CD8⁺ T cells with an anti-4-1BB and/or anti-LAG3 agent. In some embodiments, the anti-4-1BB and/or anti-LAG3 agent is an antibody, antibody fragment, or antibody mimetic molecule. In some embodiments, methods further comprise co-administration of an additional therapeutic agent. In some embodiments, the additional therapeutic agent is a chemotherapeutic or an immunotherapeutic agent. In some embodiments, the additional therapeutic agent is an immunotherapeutic agent selected from the list consisting of cell-based therapies, monoclonal antibody (mAb) therapy, cytokine therapy, and adjuvant treatment. In some embodiments, the immunotherapeutic agent is a mAb therapy selected from the list consisting of anti-CTLA-4 monoclonal antibodies and/or anti-PD-L1 monoclonal antibodies. In some embodiments, the immunotherapeutic agent is a cell-based therapy selected from the list consisting of dendritic-cell therapy and T-cell therapy. In some embodiments, the additional therapeutic agent targets one of the markers/receptors listed in Table 2. In some embodiments, the additional therapeutic targets a marker/receptor expressed on the surface of the T cells. In some embodiments, the additional therapeutic targets PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM or Sema7a. In some embodiments, the additional therapeutic agent targets Nrn1, Sema7a, or CRTAM.
In some embodiments, provided herein are methods of treating a subject with cancer comprising administering a therapeutic agent that specifically targets dysfunctional tumor antigen-specific CD8⁺ T cells, wherein the agent targets one of the receptors listed in Table 2. In some embodiments, the therapeutic targets a marker/receptor expressed on the surface of the T cells. In some embodiments, the therapeutic targets PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM or Sema7a. In some embodiments, the therapeutic agent targets Nrn1, Sema7a, or CRTAM. In some embodiments, the therapeutic agent is an antibody, antibody fragment, or antibody mimetic molecule that binds the target marker/receptor. In some embodiments, the therapeutic agent is an anti-Nrn antibody, antibody fragment, or antibody mimetic molecule. In some embodiments, the therapeutic agent is an anti-Sema7a antibody, antibody fragment, or antibody mimetic molecule. In some embodiments, the therapeutic agent is an anti-CRTAM antibody, antibody fragment, or antibody mimetic molecule.
In some embodiments, provided herein are compositions comprising: (a) one or more of an anti-4-1BB agent, an anti-LAG-3 agent, an anti-Nrn1 agent, an anti-Sema7a agent, and an anti-CRTAM agent; and (b) an immunotherapeutic agent, said composition formulated for therapeutic delivery to a subject. In some embodiments, the anti-4-1BB agent, anti-LAG-3 agent, anti-Nrn1 agent, anti-Sema7a agent, and/or anti-CRTAM agent is an antibody, antibody fragment, or antibody mimetic molecule.
In some embodiments, provided herein are compositions comprising: (a) an agent that targets and/or binds one of PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A; and (b) an immunotherapeutic agent, said composition formulated for therapeutic delivery to a subject.
In some embodiments, provided herein are methods comprising: (a) testing CD8⁺ T cells from a cell population to determine whether they co-express LAG-3 and 4-1BB; and (b) administering one or more agents that target and/or bind one of PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A. In some embodiments, the agent is an anti-Nrn1 agent, an anti-Sema7a agent, and an anti-CRTAM agent. In some embodiments, the anti-Nrn1 agent, anti-Sema7a agent, and/or anti-CRTAM agent is an antibody, antibody fragment, or antibody mimetic molecule. In some embodiments, testing is performed in vitro.
In some embodiments, provided herein are methods of identifying dysfunctional T cells by testing said cells for co-expression of 4-1BB and LAG-3. In some embodiments, provided herein are methods of identifying dysfunctional T cells by testing said cells for expression of one or more of the markers/receptors of Table 2 (e.g., a T-cell surface marker/receptor (e.g., PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, TMEM126A).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A-J. Co-expression of 4-1BB and LAG-3 identifies a significant fraction of the CD8⁺ TIL compartment found in progressing tumors. (A) Representative analysis of 4-1BB and LAG-3 expression on CD8⁺ T cells from B16. SIY tumors and the spleen and TdLN from tumor bearing mice on

day

7, 14 and 21 after s.c. tumor inoculation. (B-D) Longitudinal summary of the composition, n=5; four to five independent experiments per time point, (C) absolute cell number, n=5; seven to nine independent experiments per time point, and (D) cellular density of the CD8⁺4-1BB/LAG-3 TIL subpopulations, n=5; two to five independent experiments per time point. Absolute cell numbers were determined by acquiring the complete tumor sample by flow cytometery. (E) Day 14 summary of the proportion of the CD8⁺4-1BB/LAG-3 TIL subpopulations that are Ki67⁺. n=3-5; two independent experiments. (F) Summary of BrdU uptake on day 13 in the CD8⁺4-1BB/LAG-3 TIL subpopulations after a 24 hour BrdU pulse. n=5; three independent experiments. (G-I) Representative flow plots (G and H) and summary (I) of the 4-1BB/LAG-3 populations in other tumor models. Mice were inoculated with 2×10⁶C1498. SIY, MC38. SIY, EL4. SIY, B16 Parental, MC57. SIY or 1969. SIY subcutaneously and analyzed for 4-1BB and LAG-3 expression on day 14 after tumor inoculation. n=3-5; two to 5 independent experiments for each time point. (J) Mice were inoculated on both flanks with 2×10⁶MC57. SIY or B16. SIY, at indicated time points tumors from each mouse were pooled and analyzed for co-expression of 4-1BB and LAG-3 in the CD8⁺ TIL compartment. n=3-5; two independent experiments for each time point. All error bars indicate ±SEM. *:P<0.05, **:P<0.01, ***:P<0.001. A two-way ANOVA with Bonferroni post-hoc test was used for (B, C, D, H) longitudinal studies and Kruskal-Wallis (non-parametric) test was used for (E and F) analysis at one time-point.

FIG. 2A-G. Egr2 and a component of the Egr2-transcriptional network are enriched in 4-1BB⁺LAG-3⁺ CD8⁺ TILs. (A) Representative flow plot and summary of Egr2^EGFPexpression. Egr2^EGFPmice were inoculated with 2×10⁶B16. SIY tumors s.c. CD8⁺ T cells from the tumor, TdLN and spleen were analyzed for Egr2^EGFPexpression on day 7 and day 14. n=4-5; two-independent experiments. (B) Expression of Egr2 target genes (Zheng et al., 2013). CD8⁺ TILs from day 14 tumor bearing mice were sorted based on high or low expression of Egr2^EGFPand analyzed directly for expression of Egr2 targets by qRT-PCR. Two tumors on opposite flanks pooled per mouse. n=3; two independent experiments. (C) Representative flow plots and summary of the 4-1BB/LAG-3 subpopulations in CD8⁺ Egr2GFP^hiand Egr2GFP^loTILs on

day

7 and 14. n=4-5. Two-independent experiments per time point. (D) Expression of Egr2 targets in the 4-1BB⁺LAG-3⁺ and 4-1BB⁻LAG-3 subpopulations. The subpopulations were sorted and analyzed directly for the expression of targets by qRT-PCR. Two tumors on opposite flanks pooled per mouse. n=4; two-independent experiments. (E) Egr2^flox/flox×pLCKCreERT2×YFP-Rosa26 mice given 5 doses of tamoxifen by gavage and inoculated 3 days later with 2×10⁶B16. SIY cells. YFP⁺ or YFP⁻ CD8⁺ TILs were sorted and analyzed for Egr2 transcript directly and after in vitro stimulation. Two tumors on opposite flanks pooled per mouse. n=3; two independent experiments. (F) Representative flow plots and summary of 4-1BB/LAG-3 co-expression in YFP⁺ or YFP⁻ CD8⁺ TILs on

day

7 and 14. n=3; two independent experiments. (G) Expression of Egr3 and Hif1α in Egr2GFP^hiand Egr2GFP^lofrom day 7 CD8⁺ TILs isolated from Egr2GFP mice. n=5; two-independent experiments. Error bars indicate ±SEM. *:P<0.05, **:P<0.01, ***:P<0.001. A two-way ANOVA with Bonferroni post-hoc test was used for longitudinal studies (A and C) and a Mann-Whitney test was used to compute significance in (B, D, E, F and G).

FIG. 3A-H. Co-expression of 4-1BB and LAG-3 identifies tumor antigen-specific TILs in progressing tumors. (A) Representative CDR3β distributions from the different 4-1BB/LAG-3 subpopulations and CD8⁺ T cells isolated from the spleen. Boxed regions represent dominant peaks in the 4-1BB⁺LAG-3⁺ CD8⁺ TIL subpopulation. (B) As a measure of skewness, the Hamming Distance (HD) for each Vβ spectratype was calculated between each TIL subpopulation and CD8⁺ T cell spleen population within the same mouse. As a control the HDs from CD8⁺ splenocyte populations between mice (grey bar) were calculated. n=3; one independent experiment. (C-D) Representative flow analysis of the 4-1BB/LAG-3 subpopulation in H-2K^b/SIY⁺ and H-2K^b/SIY⁻ CD8⁺ TILs on day 14 after B16. SIY and MC38. SIY or (D) MC57. SIY and 1969. SIY tumor inoculation. n=3-4; three to five independent experiments. (E) Summary of the composition of H-2K^b/SIY⁺ and H-2K^b/SIY⁻ CD8⁺ TILs co-expressing 4-1BB and LAG-3 comparing B16. SIY, MC38. SIY, MC57. SIY and 1969. SIY tumors on day 14 after tumor inoculation. n=5; three to four independent experiments. (F-H) On day 7 after tumor inoculation 1×10⁶P14/CD45.2 and 2C/CD45.1/2 Tg T cells were adoptively transferred, via tail vein, into CD45.1 congenic tumor bearing hosts and analyzed for the (F) total number of recovered cells in the tumor, (G and H) profile of 4-1BB and LAG-3 expression in 2C, P14 and host CD8⁺ TILs. n=5; two-independent experiments. All error bars indicate ±SEM. *:P<0.05, **:P<0.01, ***:P<0.001. A Kruskal-Wallis (non-parameteric) test was used for (B) spectratype analysis and (E and F) H-2K^b/SIY analysis. A two-way ANOVA with Bonferroni post-hoc test was used for (H) 2C, Host and P14 composition analysis.

FIG. 4A-G. Co-expression of 4-1BB and LAG-3 but not PD-1 define dysfunctional CD8⁺ TILs with diminished IL-2. (A and B) Sorted cells from day 14 B16. SIY tumor bearing mice were stimulated in vitro with anti-CD3F and anti-CD28 for 12 hours and analyzed for (A) Il-2 transcript by qRT-PCR and (B) IL-2 protein by ELISA. Two tumors on opposite flanks pooled per mouse. n=4-5; three independent experiments. (C) Egr2GFP^hiand Egr2GFP^loTILs were sorted from day 14 B16. SIY tumor bearing Egr2^GFPmice and stimulated in vitro for 12 hours and analyzed for Il-2 transcript by qRT-PCR. Two tumors on opposite flanks pooled per mouse. n=5; two independent experiments. (D) On day 7 after tumor inoculation 1×10⁶2C/CD45.1/2 Tg T cells were transferred into mice, 7 days later host 4-1BB⁺LAG-3⁺ T cells sorted from the tumor and 2C T cells sorted from the tumor or TdLN were stimulated in vitro and analyzed for expression of Il-2 transcript by qRT-PCR. Two tumors on opposite flanks pooled per mouse. n=3; two independent experiments. (E and F) Representative flow analysis of PD-1 expression on 4-1BB/LAG-3 CD8⁺ TIL subpopulations and (F) summary of the composition of the 4-1BB⁻LAG-3⁻PD-1⁺ subpopulation in the CD8⁺ TIL compartment on

day

14 and 21. n=5; three independent experiments. (G) 4-1BB-LAG-3-PD-1+ and LAG-3⁺4-1BB⁺ CD8⁺ TILs were sorted from day 14 tumor bearing mice, stimulated in vitro and analyzed for Il-2 transcript by qRT-PCR. Two tumors on opposite flanks pooled per mouse. n=3; two independent experiments. All error bars indicate ±SEM. *:P<0.05, **:P<0.01, ***:P<0.001 ****:P<0.0001. A Kruskal-Wallis (non-parametric) test was used for analysis of multiple comparisons (A, B, and D) and a Mann-Whitney test was used for pair-wise comparisons (C and G).

FIG. 5A-E. Dysfunctional CD8⁺ TILs retain IFN-7 production, cytolytic capacity and produce Treg-recruiting chemokines. (A) Longitudinal analysis CD8⁺ TIL subpopulation cytokine production capacity. CD8⁺ TIL subpopulations were sorted and stimulated with anti-CD3F and anti-CD28 for 10-12 hours and the concentration of IL-2, IFN-γ and TNF-α was measured. Concentration was normalized to cell number. Two tumors on opposite flanks pooled for

day

7 and 14. n=4-5; two-independent experiments. (B) Ifn-γ Tnf-α and Gzmb transcript levels in the 4-1BB/LAG-3 subpopulations analyzed directly ex vivo. Two tumors on opposite flanks pooled per mouse. n=3-5; three-independent experiments. (C) Representative flow plot and summary of IFN-γ production analyzed directly ex vivo. Briefly, 100 μl of PBS containing 2 mg/mL GolgiPlug was injected intratumorally on day 14 after tumor inoculation. 8 hours later TILs were isolated. All steps were performed on ice with media containing 1 mg/mL GolgiStop until fixation. n=5; two independent experiments. (D) CD8⁺ TIL subpopulations at indicated time points were sorted and plated with 50,000 P815 target cells and 1 μg/mL anti-CD3F. Lysed target cells were measured by positive staining for propidium iodide and/or live/dead fixable viability dye. P815 target cells plated without CTLs were used as a negative control (black bar). Primed OTI cells were used as a positive control. Tumors from 10 mice with 2 tumors on opposite flank were pooled to obtain sufficient quantities of CD8⁺ TILs. Data are representative of three independent experiments. (E) Ccl1 and Ccl22 transcript levels in the 4-1BB/LAG-3 subpopulations analyzed directly ex vivo by qRT-PCR. n=4; two independent experiments. *:P<0.05, **:P<0.01, ***:P<0.001, ****:P<0.0001. A Kruskal-Wallis (non-parametric) test was used for (A-C, E) cytokine/chemokine analysis and a two-way ANOVA with Bonferroni post-hoc test was used for (D) cytolytic assay.

FIG. 6A-D. Dysfunctional CD8⁺ TILs express a wide range of co-inhibitory and co-stimulatory receptors. (B) Gene expression profile of cell surface receptors in the 4-1BB/LAG-3 CD8⁺ TIL subsets. Probe sets that revealed a 1.5-fold increase in the 4-1BB⁺LAG-3⁺ population relative to the 4-1BB-LAG-3⁻PD-1⁻ population are displayed. Columns show the log 2-transformed signal intensity. (C) Longitudinal study of selected up-regulated cell surface receptors. Flow plots are representative of the CD8⁺ TIL subsets on day 14. n=5; two to five independent experiments for each time point. (D) Representative flow plot and summary of KLRG-1 and IL-7Rα expression among the 4-1BB/LAG-3 subpopulations on day 14 after tumor inoculation. n=5; two independent experiments. *:P<0.05, **:P<0.01, ***:P<0.001, ****:P<0.0001. A two-way ANOVA with Bonferroni post-hoc test was used for all analyses.

FIG. 7A-G. Anti-4-1BB and anti-LAG-3 acts synergistically to control tumor outgrowth and restore TIL function. (FIG. 7A) Tumor outgrowth measured in mm². Arrows indicate on which days mice received antibody therapy. Statistical significance at indicate time points is in comparison to anti-4-1BB+anti-LAG-3 treatment. n=5; two independent experiments. (FIG. 7B) Composition of H-2K^b/SIY⁺ CD8⁺ TILs on day 14. Mice received antibody doses (100 μg each) on

days

7, 10, 13 and 16. n=5; two independent experiments. (FIGS. 7C-F) Representative flow plot and summary of NRP1/2B4 (FIGS. 7C and E) and KLRG-1/IL-7Rα (FIGS. 7D and F) expression in H-2K^b/SIY⁺ CD8⁺ TILs without FTY720 (FIGS. 7C and D) and with FTY720 (FIGS. 7E and F) on day 14 after tumor inoculation. Mice received antibody treatment as in (FIGS. 7A and B) and FTY720 was administered at a dose of 25 μg/mouse by gavage starting one day before treatment and continuing one dose per day until analysis (day 6 to day 13). n=5; two-independent experiments. (FIG. 7G) IL-2 production after treatment. Sorted cells from treated or untreated day 14 B16. SIY tumor bearing mice were stimulated in vitro for 12 hours and analyzed for Il-2 transcript by qRT-PCR. Protein concentration was determined by the bead-based LEGENDplex immunoassay and normalized to cell number. Two tumors on opposite flanks pooled per mouse. n=2-3; two independent experiments. A two-way ANOVA with Bonferroni post-hoc test was used for all analyses. *:P<0.05, **:P<0.01, ***:P<0.001.

FIG. 8 . Spectratype graphs used in the analysis in FIG. 3B.

FIG. 9 . CD3+ T cells on day 14 after FTY720 administration.

FIG. 10A-B. Statistical analysis of the cross-study comparison of gene expression profiles. (A) Rank-Rank Hypergeometric plots of each pair-wise comparison. (B) Pair-wise correlation of expression values between each data set. Rho (p) is the spearman rank correlation coefficient.

FIG. 11A-E. Nrn1, CRTAM and Sema7a are regulators of anti-tumor immunity. (FIG. 11A) Tumor growth measured in mm2. Nrn1^−/− or Sema7a^−/−and littermate control mice were engrafted with 2×106 B16. SIY cells subcutaneously. (FIG. 11B) Gene expression analysis of Nrn1 in T cell subsets of the spleen, TdLN and Tumor. (FIG. 11C) Representative flow plot and summary of IFN-g production of WT, Nrn1^−/− or (FIG. 11D) CRTAM ^−/− 2C T cells on day 7. Briefly, on the same day as tumor inoculation, 1×10⁶Cell Trace Violet-labeled 2C T cells were transferred into mice by tail vein injection. On day 7, whole TdLN suspensions were restimulated with SIY peptide for 12 hours and analyzed for cell trace dilution and IFN-g production. (FIG. 11E) Mice that received 1×10⁶

Nrn1

^−/− 2C T cells are more likely to exhibit complete tumor control compared to mice that received the same number of WT 2C T cells. Adoptive transfer of T cells was performed the same way as in (FIG. 11C).

FIG. 12 . Exemplary experimental protocol and data.

DEFINITIONS

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments described herein, some preferred methods, compositions, devices, and materials are described herein. However, before the present materials and methods are described, it is to be understood that this invention is not limited to the particular molecules, compositions, methodologies or protocols herein described, as these may vary in accordance with routine experimentation and optimization. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the embodiments described herein.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. However, in case of conflict, the present specification, including definitions, will control. Accordingly, in the context of the embodiments described herein, the following definitions apply.
As used herein and in the appended claims, the singular forms “a”, “an” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “an antibody” is a reference to one or more antibodies and equivalents thereof known to those skilled in the art, and so forth.
As used herein, the term “comprise” and linguistic variations thereof denote the presence of recited feature(s), element(s), method step(s), etc. without the exclusion of the presence of additional feature(s), element(s), method step(s), etc. Conversely, the term “consisting of” and linguistic variations thereof, denotes the presence of recited feature(s), element(s), method step(s), etc. and excludes any unrecited feature(s), element(s), method step(s), etc., except for ordinarily-associated impurities. The phrase “consisting essentially of” denotes the recited feature(s), element(s), method step(s), etc. and any additional feature(s), element(s), method step(s), etc. that do not materially affect the basic nature of the composition, system, or method. Many embodiments herein are described using open “comprising” language. Such embodiments encompass multiple closed “consisting of” and/or “consisting essentially of” embodiments, which may alternatively be claimed or described using such language.
As used herein, the term “subject” broadly refers to any animal, including but not limited to, human and non-human animals (e.g., dogs, cats, cows, horses, sheep, poultry, fish, crustaceans, etc.). As used herein, the term “patient” typically refers to a subject that is being treated for a disease or condition (e.g., cancer, solid tumor cancer, etc.).
As used herein, an “immune response” refers to the action of a cell of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, neutrophils, etc.) and soluble macromolecules produced by any of these cells or the liver (including antibodies, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from a subject of invading pathogens, cells or tissues infected with pathogens, or cancerous or other abnormal cells.
As used herein, the term “immunoregulator” refers to a substance, an agent, a signaling pathway or a component thereof that regulates an immune response. “Regulating,” “modifying” or “modulating” an immune response refers to any alteration in a cell of the immune system or in the activity of such cell. Such regulation includes stimulation or suppression of the immune system which may be manifested by an increase or decrease in the number of various cell types, an increase or decrease in the activity of these cells, or any other changes which can occur within the immune system. Both inhibitory and stimulatory immunoregulators have been identified, some of which may have enhanced function in the cancer microenvironment.
As used herein, the term “immunotherapy” refers to the treatment or prevention of a disease or condition by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response.
As used herein, “potentiating an endogenous immune response” means increasing the effectiveness or potency of an existing immune response in a subject. This increase in effectiveness and potency may be achieved, for example, by overcoming mechanisms that suppress the endogenous host immune response or by stimulating mechanisms that enhance the endogenous host immune response.
As used herein, the term “antibody” refers to a whole antibody molecule or a fragment thereof (e.g., fragments such as Fab, Fab′, and F(ab′)₂), unless otherwise specified (e.g., “whole antibody,” “antibody fragment”). An antibody may be a polyclonal or monoclonal antibody, a chimeric antibody, a humanized antibody, a human antibody, etc.
A native antibody typically has a tetrameric structure. A tetramer typically comprises two identical pairs of polypeptide chains, each pair having one light chain (in certain embodiments, about 25 kDa) and one heavy chain (in certain embodiments, about 50-70 kDa). In a native antibody, a heavy chain comprises a variable region, V_H, and three constant regions, C_H1, C_H2, and C_H3. The V_Hdomain is at the amino-terminus of the heavy chain, and the C_H3domain is at the carboxy-terminus. In a native antibody, a light chain comprises a variable region, V_L, and a constant region, C_L. The variable region of the light chain is at the amino-terminus of the light chain. In a native antibody, the variable regions of each light/heavy chain pair typically form the antigen binding site. The constant regions are typically responsible for effector function.
In a native antibody, the variable regions typically exhibit the same general structure in which relatively conserved framework regions (FRs) are joined by three hypervariable regions, also called complementarity determining regions (CDRs). The CDRs from the two chains of each pair typically are aligned by the framework regions, which may enable binding to a specific epitope. From N-terminus to C-terminus, both light and heavy chain variable regions typically comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The CDRs on the heavy chain are referred to as H1, H2, and H3, while the CDRs on the light chain are referred to as L1, L2, and L3. Typically, CDR3 is the greatest source of molecular diversity within the antigen-binding site. H3, for example, in certain instances, can be as short as two amino acid residues or greater than 26. The assignment of amino acids to each domain is typically in accordance with the definitions of Kabat et al. (1991) Sequences of Proteins of Immunological Interest (National Institutes of Health, Publication No. 91-3242, vols. 1-3, Bethesda, Md.); Chothia, C., and Lesk, A. M. (1987) J. Mol. Biol. 196:901-917; or Chothia, C. et al. Nature 342:878-883 (1989). In the present application, the term “CDR” refers to a CDR from either the light or heavy chain, unless otherwise specified.
As used herein, the term “heavy chain” refers to a polypeptide comprising sufficient heavy chain variable region sequence to confer antigen specificity either alone or in combination with a light chain.
As used herein, the term “light chain” refers to a polypeptide comprising sufficient light chain variable region sequence to confer antigen specificity either alone or in combination with a heavy chain.
As used herein, when an antibody or other entity “specifically recognizes” or “specifically binds” an antigen or epitope, it preferentially recognizes the antigen in a complex mixture of proteins and/or macromolecules, and binds the antigen or epitope with affinity which is substantially higher than to other entities not displaying the antigen or epitope. In this regard, “affinity which is substantially higher” means affinity that is high enough to enable detection of an antigen or epitope which is distinguished from entities using a desired assay or measurement apparatus. Typically, it means binding affinity having a binding constant (K_a) of at least 10⁷M⁻¹(e.g., >10⁷M⁻¹, >10⁸M⁻¹, >10⁹M⁻¹, >10¹⁰M⁻¹, >10¹¹M⁻¹, >10¹²M⁻¹, >10¹³M⁻¹, etc.). In certain such embodiments, an antibody is capable of binding different antigens so long as the different antigens comprise that particular epitope. In certain instances, for example, homologous proteins from different species may comprise the same epitope.
As used herein, the term “anti-4-1BB antibody” or “4-1BB antibody” refers to an antibody which specifically recognizes an antigen and/or epitope presented by 4-1BB. Similarly, the terms “anti-LAG-3 antibody” and “LAG-3 antibody” refer to an antibody which specifically recognizes an antigen and/or epitope presented by LAG-3, the terms “anti-Nrn1 antibody” and “Nrn1 antibody” refer to an antibody which specifically recognizes an antigen and/or epitope presented by Nrn1, the terms “anti-CRTAM antibody” and “CRTAM antibody” refer to an antibody which specifically recognizes an antigen and/or epitope presented by CRTAM, and the terms “anti-Sema7a antibody” and “Sema7a antibody” refer to an antibody which specifically recognizes an antigen and/or epitope presented by Sema7a. Antibodies that recognize epitopes on other molecular entities may be referred to according to a similar scheme (e.g., anti-CTLA-4, anti-PD-L1, etc.).
As used herein, the term “monoclonal antibody” refers to an antibody which is a member of a substantially homogeneous population of antibodies that specifically bind to the same epitope. In certain embodiments, a monoclonal antibody is secreted by a hybridoma. In certain such embodiments, a hybridoma is produced according to certain methods known to those skilled in the art. See, e.g., Kohler and Milstein (1975) Nature 256: 495-499; herein incorporated by reference in its entirety. In certain embodiments, a monoclonal antibody is produced using recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567). In certain embodiments, a monoclonal antibody refers to an antibody fragment isolated from a phage display library. See, e.g., Clackson et al. (1991) Nature 352: 624-628; and Marks et al. (1991) J. Mol. Biol. 222: 581-597; herein incorporated by reference in their entireties. The modifying word “monoclonal” indicates properties of antibodies obtained from a substantially-homogeneous population of antibodies, and does not limit a method of producing antibodies to a specific method. For various other monoclonal antibody production techniques, see, e.g., Harlow and Lane (1988) Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); herein incorporated by reference in its entirety.
As used herein, the term “antibody fragment” refers to a portion of a full-length antibody, including at least a portion antigen binding region or a variable region. Antibody fragments include, but are not limited to, Fab, Fab′, F(ab′)₂, Fv, scFv, Fd, diabodies, and other antibody fragments that retain at least a portion of the variable region of an intact antibody. See, e.g., Hudson et al. (2003) Nat. Med. 9:129-134; herein incorporated by reference in its entirety. In certain embodiments, antibody fragments are produced by enzymatic or chemical cleavage of intact antibodies (e.g., papain digestion and pepsin digestion of antibody) produced by recombinant DNA techniques, or chemical polypeptide synthesis.
For example, a “Fab” fragment comprises one light chain and the C_H1and variable region of one heavy chain. The heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule. A “Fab′” fragment comprises one light chain and one heavy chain that comprises additional constant region, extending between the C_H1and CH₂domains. An interchain disulfide bond can be formed between two heavy chains of a Fab′ fragment to form a “F(ab′)₂” molecule.
An “Fv” fragment comprises the variable regions from both the heavy and light chains, but lacks the constant regions. A single-chain Fv (scFv) fragment comprises heavy and light chain variable regions connected by a flexible linker to form a single polypeptide chain with an antigen-binding region. Exemplary single chain antibodies are discussed in detail in WO 88/01649 and U.S. Pat. Nos. 4,946,778 and 5,260,203; herein incorporated by reference in their entireties. In certain instances, a single variable region (e.g., a heavy chain variable region or a light chain variable region) may have the ability to recognize and bind antigen.
Other antibody fragments will be understood by skilled artisans.
As used herein, the term “chimeric antibody” refers to an antibody made up of components from at least two different sources. In certain embodiments, a chimeric antibody comprises a portion of an antibody derived from a first species fused to another molecule, e.g., a portion of an antibody derived from a second species. In certain such embodiments, a chimeric antibody comprises a portion of an antibody derived from a non-human animal fused to a portion of an antibody derived from a human. In certain such embodiments, a chimeric antibody comprises all or a portion of a variable region of an antibody derived from a non-human animal fused to a constant region of an antibody derived from a human.
A “humanized” antibody refers to a non-human antibody that has been modified so that it more closely matches (in amino acid sequence) a human antibody. A humanized antibody is thus a type of chimeric antibody. In certain embodiments, amino acid residues outside of the antigen binding residues of the variable region of the non-human antibody are modified. In certain embodiments, a humanized antibody is constructed by replacing all or a portion of a complementarity determining region (CDR) of a human antibody with all or a portion of a CDR from another antibody, such as a non-human antibody, having the desired antigen binding specificity. In certain embodiments, a humanized antibody comprises variable regions in which all or substantially all of the CDRs correspond to CDRs of a non-human antibody and all or substantially all of the framework regions (FRs) correspond to FRs of a human antibody. In certain such embodiments, a humanized antibody further comprises a constant region (Fc) of a human antibody.
The term “human antibody” refers to a monoclonal antibody that contains human antibody sequences and does not contain antibody sequences from a non-human animal. In certain embodiments, a human antibody may contain synthetic sequences not found in native antibodies. The term is not limited by the manner in which the antibodies are made. For example, in various embodiments, a human antibody may be made in a transgenic mouse, by phage display, by human B-lymphocytes, or by recombinant methods.
As used herein, the term “natural antibody” refers to an antibody in which the heavy and light chains of the antibody have been made and paired by the immune system of a multicellular organism. For example, the antibodies produced by the antibody-producing cells isolated from a first animal immunized with an antigen are natural antibodies. Natural antibodies contain naturally-paired heavy and light chains. The term “natural human antibody” refers to an antibody in which the heavy and light chains of the antibody have been made and paired by the immune system of a human subject.
Native human light chains are typically classified as kappa and lambda light chains. Native human heavy chains are typically classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has subclasses, including, but not limited to, IgG1, IgG2, IgG3, and IgG4. IgM has subclasses including, but not limited to, IgM1 and IgM2. IgA has subclasses including, but not limited to, IgA1 and IgA2.
Within native human light and heavy chains, the variable and constant regions are typically joined by a “J” region of about 12 or more amino acids, with the heavy chain also including a “D” region of about 10 more amino acids. See, e.g., Fundamental Immunology (1989) Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y.); herein incorporated by reference in its entirety.
The term “neutralizing antibody” or “antibody that neutralizes” refers to an antibody that reduces at least one activity of a polypeptide comprising the epitope to which the antibody specifically binds. In certain embodiments, a neutralizing antibody reduces an activity in vitro and/or In vivo. In some embodiments, by neutralizing the polypeptide comprising the epitope, the neutralizing antibody inhibits the capacity of the cell displaying the epitope.
As used herein, the term “glycoengineered”, as used herein, includes any manipulation of the glycosylation pattern of a naturally occurring or recombinant protein, polypeptide or a fragment thereof.
The term “antigen-binding site” refers to a portion of an antibody capable of specifically binding an antigen. In certain embodiments, an antigen-binding site is provided by one or more antibody variable regions.
The term “epitope” refers to any polypeptide determinant capable of specifically binding to an immunoglobulin or a T-cell or B-cell receptor. In certain embodiments, an epitope is a region of an antigen that is specifically bound by an antibody. In certain embodiments, an epitope may include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl groups. In certain embodiments, an epitope may have specific three dimensional structural characteristics (e.g., a “conformational” epitope) and/or specific charge characteristics.
An epitope is defined as “the same” as another epitope if a particular antibody specifically binds to both epitopes. In certain embodiments, polypeptides having different primary amino acid sequences may comprise epitopes that are the same. In certain embodiments, epitopes that are the same may have different primary amino acid sequences. Different antibodies are said to bind to the same epitope if they compete for specific binding to that epitope.
A “conservative” amino acid substitution refers to the substitution of an amino acid in a polypeptide with another amino acid having similar properties, such as size or charge. In certain embodiments, a polypeptide comprising a conservative amino acid substitution maintains at least one activity of the unsubstituted polypeptide. A conservative amino acid substitution may encompass non-naturally occurring amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include, but are not limited to, peptidomimetics and other reversed or inverted forms of amino acid moieties. Naturally occurring residues may be divided into classes based on common side chain properties, for example: hydrophobic: norleucine, Met, Ala, Val, Leu, and Ile; neutral hydrophilic: Cys, Ser, Thr, Asn, and Gln; acidic: Asp and Glu; basic: His, Lys, and Arg; residues that influence chain orientation: Gly and Pro; and aromatic: Trp, Tyr, and Phe. Non-conservative substitutions may involve the exchange of a member of one of these classes for a member from another class; whereas conservative substitutions may involve the exchange of a member of one of these classes for another member of that same class.
As used herein, the term “sequence identity” refers to the degree to which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have the same sequential composition of monomer subunits. The term “sequence similarity” refers to the degree with which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences. For example, similar amino acids are those that share the same biophysical characteristics and can be grouped into the families (see above). The “percent sequence identity” (or “percent sequence similarity”) is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window, etc.), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity. For example, if peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity to an optimal comparison window of peptide C. For the purpose of calculating “percent sequence identity” (or “percent sequence similarity”) herein, any gaps in aligned sequences are treated as mismatches at that position.
The term “effective dose” or “effective amount” refers to an amount of an agent, e.g., an antibody, that results in the reduction of symptoms in a patient or results in a desired biological outcome. In certain embodiments, an effective dose or effective amount is sufficient to treat or reduce symptoms of a disease or condition.
As used herein, the terms “administration” and “administering” refer to the act of giving a drug, prodrug, or other agent, or therapeutic to a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs. Exemplary routes of administration to the human body can be through space under the arachnoid membrane of the brain or spinal cord (intrathecal), the eyes (ophthalmic), mouth (oral), skin (topical or transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, rectal, vaginal, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.
The term “treatment” encompasses both therapeutic and prophylactic/preventative measures unless otherwise indicated. Those in need of treatment include, but are not limited to, individuals already having a particular condition as well as individuals who are at risk of acquiring a particular condition or disorder (e.g., those having a genetic or epigenetic predisposition; based on age, gender, lifestyle, etc.). The term “treating” refers to administering an agent to a subject for therapeutic and/or prophylactic/preventative purposes.
A “therapeutic agent” refers to an agent that may be administered In vivo to bring about a therapeutic and/or prophylactic/preventative effect.
A “therapeutic antibody” refers to an antibody that may be administered In vivo to bring about a therapeutic and/or prophylactic/preventative effect.
As used herein, the terms “co-administration” and “co-administering” refer to the administration of at least two agent(s) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s), and/or when co-administration of two or more agents results in sensitization of a subject to beneficial effects of one of the agents via co-administration of the other agent.
As used herein, the term pharmaceutical composition” refers to the combination of an active agent (e.g., binding agent) with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.
The terms “pharmaceutically acceptable” or “pharmacologically acceptable,” as used herein, refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject.
As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintigrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by reference in its entirety.
As used herein, a “diagnostic” or “diagnostic test” includes the detection, identification, or characterization of a disease state or condition of a subject. For example, a disease or condition may be characterized to determine the likelihood that a subject with a disease or condition will respond to a particular therapy, determine the prognosis of a subject with a disease or condition (or its likely progression or regression), determine the effect of a treatment on a subject with a disease or condition, or determine a future treatment course of action.

DETAILED DESCRIPTION

Provided herein are compositions and methods for detecting and/or targeting dysfunctional tumor antigen-specific CD8⁺ T cells in the tumor microenvironment for diagnostic, therapeutic and/or research applications. In particular, dysfunctional tumor antigen-specific CD8⁺ T cells are detected and/or targeted via their expression of cell surface receptors described herein, such as 4-1BB, LAG-3, or additional markers that correlate with 4-1BB and LAG-3 expression, such as markers differentially expressed on the surface of the T cells (e.g., PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM and Sema7a).
Experiments conducted during development of embodiments herein identified markers/receptors that correlate and/or are responsible for tumor antigen-specific CD8⁺ T cell dysfunction. In some embodiments, the markers/receptors are overexpressed in dysfunctional tumor antigen-specific CD8⁺ T cells. In such embodiments, detecting the level (e.g., above a threshold) of such markers provides a diagnostic for detecting tumor antigen-specific CD8⁺ T cell dysfunction. Further, in such embodiments, targeting (e.g., inhibiting (e.g., expression and/or activity of)) such markers/receptors provides a therapeutic. In other embodiments, the markers/receptors are underexpressed in dysfunctional tumor antigen-specific CD8⁺ T cells. In such embodiments, detecting the level (e.g., below a threshold) of such markers provides a diagnostic for detecting tumor antigen-specific CD8⁺ T cell dysfunction. Further, in such embodiments, targeting (e.g., enhancing (e.g., expression and/or activity of)) such markers/receptors provides a therapeutic.
Transcription factor Egr2 is a critical regulator of the anergic state in CD4⁺ T cell clones manipulated in vitro (Zheng et al., 2013; 2012; incorporated by reference in their entireties). Egr2 has also been shown to be involved in negative regulation of T cell activation in several in vivo model systems (Sumitomo et al., 2013; incorporated by reference in its entirety). Egr2 contributes to upregulation of DGKa and -z which act to blunt TCR-mediated Ras pathway activation (Zha et al., 2006; incorporated by reference in its entirety). By comparing gene expression profiling of anergized cells along with Egr2 ChIP-Seq analysis multiple additional Egr2-driven gene targets were identified (Zheng et al., 2013; incorporated by reference in its entirety). These gene targets include 4-1BB (Tnfrsf9 or CD137), Lag3, Nrn1, Sema7a, Crtam, and Rank1, which encode cell surface proteins. 4-1BB is a co-stimulatory molecule transiently expressed after TCR engagement. Lag3 (lymphocyte-activation gene 3 or CD223) is a CD4 homologue and functions as an inhibitory receptor. Expression of 4-1BB and Lag3 is regulated following TCR engagement and continues throughout differentiation. In humans, 4-1BB and LAG-3 are expressed on CD8+ TILs from human melanoma tumors (Gros et al., 2014; Baitsch et al., 2012; incorporated by reference in their entireties). In both mice and humans, either molecule alone are expressed on populations of activated T cells. However, co-expression is more limited and is rarely observed in circulating T cells. The function of CD8+ TILs co-expressing these markers is unknown.
Experiments were conducted during development of embodiments herein to investigate the detailed characteristics of CD8+ TILs expressing 4-1BB and LAG-3 using mouse tumor models. It was found that the co-expression of 4-1BB and LAG-3 was sufficient to identify tumor antigen-specific dysfunctional CD8+ TILs enriched in the expression of Egr2 target genes. These CD8+ TILs failed to make IL-2 following in vitro stimulation, yet still produced IFN-g and Treg-recruiting chemokines and lysed target cells ex vivo, indicating they are not completely functionally inert. Combinatorial treatment with anti-LAG-3/anti-4-1BB restored the function of this population and promoted in situ acquisition of KLRG-1hi effector cells. Additional gene expression profiling provided a complete phenotyping of this T cell subset, which revealed expression of a broad panel of both inhibitory receptors and co-stimulatory receptors (e.g., receptors of Table 2 (e.g. Nrn1, Sema7a, CRTAM, etc.)). Inhibitory receptors and co-stimulatory receptors identified in this profiling that are displayed on the surface of T cells include PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A. These approaches have thus enabled the characterization of the population of tumor antigen-specific CD8+ T cells that arise specifically within the tumor microenvironment having altered functional properties. In some embodiments, this population is a target for immunotherapeutic approaches to restore desired functionality and promote tumor regression. In some embodiments, the receptors/markers identified herein (e.g., 4-1BB, LAG-3, receptors/markers of Table 2 (e.g., surface markers/receptors (e.g. Nrn1, Sema7a, CRTAM, etc.), etc.) etc.) are targeted (e.g., via immunotherapeutic approaches) to restore desired immunoresponsiveness, to promote tumor regression, and/or for the treatment of cancer.
Experiments conducted during development of embodiments herein applied knowledge of Egr2 targets to evaluate applicability of these markers toward understanding dysfunctional T cells within tumors in vivo. The data indeed confirm that co-expression of LAG-3 and 4-1BB is sufficient to identify the majority of tumor antigen-specific CD8⁺ T cells within the tumor microenvironment. Co-expression of these markers was not observed within peripheral lymphoid organs in tumor-bearing mice, indicating that a property unique to the tumor context drives 4-1BB and LAG-3 expression. In addition, acquisition of LAG-3 and 4-1BB expression was not observed within tumors that were undergoing successful rejection, indicating that the acquisition of this phenotype occurs under conditions of incomplete antigen clearance.
In some embodiments, cancer treatment methods described herein comprise administration (or co-administration with one or more additional therapies/therapeutics) of one or more anti-4-1BB and/or anti-LAG-3 agents (e.g., antibodies, antibody fragments, antibody mimetic molecules (e.g., DARPins, affibodies, aptamers, nanobodies, etc.), etc.). In some embodiments, an anti-4-1BB and/or anti-LAG-3 agents is administered to render cancer cells, tumor(s), and/or the tumor microenvironment accessible or susceptible to treatment with additional therapies/therapeutics (e.g., immunotherapeutics). Anti-4-1BB and/or anti-LAG-3 agents that find use in embodiments described herein are not limited by their mechanism of action. Agents may be small molecules, peptide, polypeptides, proteins, nucleic acids (e.g., antisense, RNAi, etc.), antibodies, antibody fragments, etc.
In some embodiments, cancer treatment methods described herein comprise enhancing the activity or expression of a marker/receptor identified herein that negatively correlates with tumor antigen-specific CD8⁺ T cell dysfunction.
Experiments conducted during development of embodiments herein identified receptors/markers that are differentially expressed in dysfunctional CD8+ TILs (See Table 2). Testing of targets of interest identified in that screen demonstrate that at least neuritin 1 (Nrn1), cytotoxic and regulatory t-cell molecule (CRTAM), and Semaphorin 7A (Sema7a) are regulators of anti-tumor immunity, with Nrn1 and CRTAM blockade correlating with increased tumor area, and Sema7a blockade correlating with decreased tumor area.
In some embodiments, cancer treatment methods described herein comprise administration (or co-administration with one or more additional therapies/therapeutics) of agents (e.g., antibodies, antibody fragments, antibody mimetic molecules (e.g., DARPins, affibodies, aptamers, nanobodies, etc.), etc.) that target one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.). In some embodiments, an agent is administered to render cancer cells, tumor(s), and/or the tumor microenvironment accessible or susceptible to treatment with additional therapies/therapeutics (e.g., immunotherapeutics). Agents targeting one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.) that find use in embodiments described herein are not limited by their mechanism of action. Agents may be small molecules, peptide, polypeptides, proteins, nucleic acids (e.g., antisense, RNAi, etc.), antibodies, antibody fragments, etc. In some embodiments, an antagonist of Nrn1 is administered. In some embodiments, an antagonist of CRTAM is administered. In some embodiments, an agonist of Sema7a is administered.
In some embodiments, antibodies, antibody fragments, antibody mimetic molecules (e.g., DARPins, affibodies, aptamers, nanobodies, etc.) targeting 4-1BB, LAG-3 and/or one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.), or fragments thereof, are provided. Such agents may be naked, deriving their effect by target binding (e.g., neutralizing the target), or may be conjugated to a functional moiety (e.g., drug, toxin, effector moiety, etc.).
In some embodiments, a subject is treated with (i) one or more agents (e.g., antibodies, antibody fragments, antibody mimetic molecules (e.g., DARPins, affibodies, aptamers, nanobodies, etc.), etc.) that target 4-1BB, LAG-3 and/or one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.), as well as (ii) one or more additional cancer therapies. Such therapies include chemotherapy, immunotherapy, radiation, surgery, etc. In some embodiments, agents targeting the receptors/markers described herein are co-administered with one or more additional agents for the treatment of cancer.
In some embodiments, exemplary anticancer agents suitable for use in compositions and methods described herein include, but are not limited to: 1) alkaloids, including microtubule inhibitors (e.g., vincristine, vinblastine, and vindesine, etc.), microtubule stabilizers (e.g., paclitaxel (Taxol), and docetaxel, etc.), and chromatin function inhibitors, including topoisomerase inhibitors, such as epipodophyllotoxins (e.g., etoposide (VP-16), and teniposide (VM-26), etc.), and agents that target topoisomerase I (e.g., camptothecin and isirinotecan (CPT-11), etc.); 2) covalent DNA-binding agents (alkylating agents), including nitrogen mustards (e.g., mechlorethamine, chlorambucil, cyclophosphamide, ifosphamide, and busulfan (MYLERAN), etc.), nitrosoureas (e.g., carmustine, lomustine, and semustine, etc.), and other alkylating agents (e.g., dacarbazine, hydroxymethylmelamine, thiotepa, and mitomycin, etc.); 3) noncovalent DNA-binding agents (antitumor antibiotics), including nucleic acid inhibitors (e.g., dactinomycin (actinomycin D), etc.), anthracyclines (e.g., daunorubicin (daunomycin, and cerubidine), doxorubicin (adriamycin), and idarubicin (idamycin), etc.), anthracenediones (e.g., anthracycline analogues, such as mitoxantrone, etc.), bleomycins (BLENOXANE), etc., and plicamycin (mithramycin), etc.; 4) antimetabolites, including antifolates (e.g., methotrexate, FOLEX, and MEXATE, etc.), purine antimetabolites (e.g., 6-mercaptopurine (6-MP, PURINETHOL), 6-thioguanine (6-TG), azathioprine, acyclovir, ganciclovir, chlorodeoxyadenosine, 2-chlorodeoxyadenosine (CdA), and 2′-deoxycoformycin (pentostatin), etc.), pyrimidine antagonists (e.g., fluoropyrimidines (e.g., 5-fluorouracil (ADRUCIL), 5-fluorodeoxyuridine (FdUrd) (floxuridine)) etc.), and cytosine arabinosides (e.g., CYTOSAR (ara-C) and fludarabine, etc.); 5) enzymes, including L-asparaginase, and hydroxyurea, etc.; 6) hormones, including glucocorticoids, antiestrogens (e.g., tamoxifen, etc.), nonsteroidal antiandrogens (e.g., flutamide, etc.), and aromatase inhibitors (e.g., anastrozole (ARIMIDEX), etc.); 7) platinum compounds (e.g., cisplatin and carboplatin, etc.); 8) monoclonal antibodies (e.g., conjugated with anticancer drugs, toxins, and/or radionuclides, etc.; neutralizing antibodies; etc.); 9) biological response modifiers (e.g., interferons (e.g., IFN-.alpha., etc.) and interleukins (e.g., IL-2, etc.), etc.); 10) adoptive immunotherapy; 11) hematopoietic growth factors; 12) agents that induce tumor cell differentiation (e.g., all-trans-retinoic acid, etc.); 13) gene therapy techniques; 14) antisense therapy techniques; 15) tumor vaccines; 16) therapies directed against tumor metastases (e.g., batimastat, etc.); 17) angiogenesis inhibitors; 18) proteosome inhibitors (e.g., VELCADE); 19) inhibitors of acetylation and/or methylation (e.g., HDAC inhibitors); 20) modulators of NF kappa B; 21) inhibitors of cell cycle regulation (e.g., CDK inhibitors); and 22) modulators of p53 protein function.
In some embodiments, agents targeting 4-1BB, LAG-3 and/or one or more receptors/markers of Table 2 (e.g. Nrn1, Sema7a, CRTAM, etc.) are administered to overcome immune invasion of the cancer cells, tumor, tumor microenvironment, etc. In some embodiments, one or more additional cancer immunotherapies are employed (e.g., concurrently or serially) to make use of the immune-responsiveness of the treated cells/tumor. Suitable immunotherapies may include, but are not limited to: cell-based therapies (e.g., dendritic cell or T cell therapy, etc.), monoclonal antibody (mAb) therapy (e.g., naked mAbs, conjugated mAbs), cytokine therapy (e.g., interferons, interleukins, etc.), adjuvant treatment (e.g., polysaccharide-K), etc.
In some embodiments, agents targeting 4-1BB, LAG-3 and/or one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.) are co-administered with agents (e.g., small molecules, peptides, antibodies, antibody fragments, etc.) that target one or more cancer cell or tumor) markers or components. In some embodiments, such co-administration renders the cancer cells, tumor, and/or tumor microenvironment susceptible and/or accessible to the treatment with the additional agent.
In some embodiments, agents for use in the methods and compositions described herein target and/or binds a cancer or tumor cell marker or component, selected from the group including but not limited to, epidermal growth factor receptor (EGFR, EGFR1, ErbB-1, HER1). ErbB-2 (HER2/neu), ErbB-3/HER3, ErbB-4/HER4, EGFR ligand family; insulin-like growth factor receptor (IGFR) family, IGF-binding proteins (IGFBPs), IGFR ligand family (IGF-1R); platelet derived growth factor receptor (PDGFR) family, PDGFR ligand family; fibroblast growth factor receptor (FGFR) family, FGFR ligand family, vascular endothelial growth factor receptor (VEGFR) family, VEGF family; HGF receptor family: TRK receptor family; ephrin (EPH) receptor family: AXL receptor family; leukocyte tyrosine kinase (LTK) receptor family; TIE receptor family, angiopoietin 1, 2; receptor tyrosine kinase-like orphan receptor (ROR) receptor family; discoidin domain receptor (DDR) family; RET receptor family; KLG receptor family; RYK receptor family; MuSK receptor family; Transforming growth factor alpha (TGF-α), TGF-α receptor; Transforming growth factor-beta (TGF-β), TGF-β receptor; Interleukin β receptor alpha2 chain (IL13Ralpha2), Interleukin-6 (IL-6), 1L-6 receptor, interleukin-4, IL-4 receptor, Cytokine receptors, Class I (hematopoietin family) and Class II (interferon/1L-10 family) receptors, tumor necrosis factor (TNF) family, TNF-α, tumor necrosis factor (TNF) receptor superfamily (TNTRSF), death receptor family, TRAIL-receptor; cancer-testis (CT) antigens, lineage-specific antigens, differentiation antigens, alpha-actinin-4, ARTC1, breakpoint cluster region-Abelson (Bcr-abl) fusion products, B-RAF, caspase-5 (CASP-5), caspase-8 (CASP-8), beta-catenin (CTNNB1), cell division cycle 27 (CDC27), cyclin-dependent kinase 4 (CDK4), CDKN2A, COA-1, dek-can fusion protein, EFTUD-2, Elongation factor 2 (ELF2), Ets variant gene 6/acute myeloid leukemia 1 gene ETS (ETC6-AML1) fusion protein, fibronectin (FN), GPNMB, low density lipid receptor/GDP-L fucose: beta-Dgalactose 2-alpha-Lfucosyltraosferase (LDLR/FUT) fusion protein, HLA-A2, MLA-A11, heat shock protein 70-2 mutated (HSP70-2M), KIAA0205, MART2, melanoma ubiquitous mutated 1, 2, 3 (MUM-1, 2, 3), prostatic acid phosphatase (PAP), neo-PAP, Myosin class 1, NFYC, OGT, OS-9, pm1-RARalpha fusion protein, PRDX5, PTPRK, K-ras (KRAS2), N-ras (NRAS), HRAS, RBAF600, SIRT12, SNRPD1, SYT-SSX1 or -SSX2 fusion protein, Triosephosphate Isomerase, BAGE, BAGE-1, BAGE-2, 3, 4, 5, GAGE-1, 2, 3, 4, 5, 6, 7, 8, GnT-V (aberrant N-acetyl glucosaminyl transferase V, MGAT5), HERV-K MEL, KK-LC, KM-HN-1, LAGE, LAGE-1, CTL-recognized antigen on melanoma (CAMEL), MAGE-A1 (MAGE-1). MAGE-A2, MAGE-A3, MAGE-A4, MAGE-AS, MAGE-A6, MAGE-A8, MAGE-A9, MAGE-A10. MAGE-All, MAGE-A12, MAGE-3, MAGE-B1, MAGE-B2, MAGE-B5. MAGE-B6, MAGE-C1, MAGE-C2, mucin 1 (MUC1), MART-1/Melan-A (MLANA), gp100, gp100/Pme117 (SlLV), tyrosinase (TYR), TRP-1, HAGE, NA-88, NY-ESO-1, NY-ESO-1/LAGE-2, SAGE, Sp17. SSX-1, 2, 3, 4, TRP2-1NT2, carcino-embryonic antigen (CEA), Kallikrein 4, mammaglobin-A, OA1, prostate specific antigen (PSA), prostate specific membrane antigen, TRP-1/, 75. TRP-2 adipophilin, interferon inducible protein absent in melanora 2 (AIM-2). BING-4, CPSF, cyclin D1, epithelial cell adhesion molecule (Ep-CAM), EpbA3, fibroblast growth factor-5 (FGF-5), glycoprotein 250 (gp250intestinal carboxyl esterase (iCE), alpha-feto protein (AFP), M-CSF, mdm-2, MUCI, p53 (TP53), PBF, PRAME, PSMA, RAGE-1, RNF43, RU2AS, SOX10, STEAP1, survivin (BIRCS), human telomerase reverse transcriptase (hTERT), telomerase, Wilms' tumor gene (WT1), SYCP1, BRDT, SPANX, XAGE, ADAM2, PAGE-5, LIP1, CTAGE-1, CSAGE, MMA1, CAGE, BORIS, HOM-TES-85, AF15q14, HCA66I, LDHC, MORC, SGY-1, SPO11, TPX1, NY-SAR-35, FTHLI7, NXF2 TDRD1, TEX 15, FATE, TPTE, immunoglobulin idiotypes, Bence-Jones protein, estrogen receptors (ER), androgen receptors (AR), CD40, CD30, CD20, CD19, CD33, CD4, CD25, CD3, cancer antigen 72-4 (CA 72-4), cancer antigen 15-3 (CA 15-3), cancer antigen 27-29 (CA 27-29), cancer antigen 125 (CA 125), cancer antigen 19-9 (CA 19-9), beta-human chorionic gonadotropin, 1-2 microglobulin, squamous cell carcinoma antigen, neuron-specific enolase, heat shock protein gp96. GM2, sargramostim, CTLA-4, 707 alanine proline (707-AP), adenocarcinoma antigen recognized by T cells 4 (ART-4), carcinoembryogenic antigen peptide-1 (CAP-1), calcium-activated chloride channel-2 (CLCA2), cyclophilin B (Cyp-B), human signet ring tumor-2 (HST-2), etc.
Examples of antibodies which can be incorporated into compositions and methods disclosed herein include, but are not limited, to antibodies such as trastuzumab (anti-HER2/neu antibody); Pertuzumab (anti-HER2 mAb); cetuximab (chimeric monoclonal antibody to epidermal growth factor receptor EGFR); panitumumab (anti-EGFR antibody); nimotuzumab (anti-EGFR antibody); Zalutumumab (anti-EGFR mAb); Necitumumab (anti-EGFR mAb); MDX-210 (humanized anti-HER-2 bispecific antibody); MDX-210 (humanized anti-HER-2 bispecific antibody); MDX-447 (humanized anti-EGF receptor bispecific antibody); Rituximab (chimeric murine/human anti-CD20 mAb); Obinutuzumab (anti-CD20 mAb); Ofatumumab (anti-CD20 mAb); Tositumumab-1131 (anti-CD20 mAb); Ibritumomab tiuxetan (anti-CD20 mAb); Bevacizumab (anti-VEGF mAb); Ramucirumab (anti-VEGFR2 mAb); Ranibizumab (anti-VEGF mAb); Aflibercept (extracellular domains of VEGFR1 and VEGFR2 fused to IgG1 Fc); AMG386 (angiopoietin-1 and -2 binding peptide fused to IgG1 Fc); Dalotuzumab (anti-IGF-1R mAb); Gemtuzumab ozogamicin (anti-CD33 mAb); Alemtuzumab (anti-Campath-1/CD52 mAb); Brentuximab vedotin (anti-CD30 mAb): Catumaxomab (bispecific mAb that targets epithelial cell adhesion molecule and CD3); Naptumomab (anti-5T4 mAb); Girentuximab (anti-Carbonic anhydrase ix); or Farletuzumab (anti-folate receptor). Other examples include antibodies such as Panorex™ (17-1A) (murine monoclonal antibody); Panorex (@(17-1A)) (chimeric murine monoclonal antibody); BEC2 (ami-idiotypic mAb, mimics the GD epitope) (with BCG); Oncolym (Lym-1 monoclonal antibody); SMART M195 Ab, humanized 13′ 1 LYM-1 (Oncolym). Ovarex (B43.13, anti-idiotypic mouse mAb); 3622W94 mAb that binds to EGP40 (17-1A) pancarcinoma antigen on adenocarcinomas; Zenapax (SMART Anti-Tac (IL-2 receptor); SMART M195 Ab, humanized Ab, humanized); NovoMAb-G2 (pancarcinoma specific Ab); TNT (chimeric mAb to histone antigens); TNT (chimeric mAb to histone antigens); Gliomab-H (Monoclonals—Humanized Abs); GNI-250 Mab; EMD-72000 (chimeric-EGF antagonist); LymphoCide (humanized IL. L.2 antibody); and MDX-260 bispecific, targets GD-2, ANA Ab, SMART IDIO Ab, SMART ABL 364 Ab, or ImmuRAIT-CEA.
In some embodiments, an agent that finds use in embodiments herein specifically binds a component of a regulatory T cell, myeloid suppressor cell, or dendritic cell. In another aspect, the targeting moiety specifically binds one of the following molecules: CD4; CD25 (IL-2a receptor; IL-2αR); cytotoxic T-lymphocyte antigen-4 (CTLA-4; CD152); Interleukin-10 (IL-10); Transforming growth factor-beta receptor (TGF-βR); Transforming growth factor-beta (TGF-β); Programmed Death-1 (PD-1); Programmed death-1 ligand (PD-L1 or PD-L2); Receptor activator of nuclear factor-κB (RANK); Receptor activator of nuclear factor-κB (RANK) ligand (RANKL); LAG-3; glucocorticoid-induced tumor necrosis factor receptor family-related gene (GITR; TNFRSF18); or Interleukin-4 receptor (IL-4R). In some embodiments, the agent is an agonist that increases the function of the targeted molecule. In other embodiments, the agent is an antagonist that inhibits the function of the targeted molecule.
In some embodiments, an agent that finds use in embodiments herein binds a specific cytokine, cytokine receptor, co-stimulatory molecule, co-inhibitory molecule, or immunomodulatory receptor that modulates the immune system. In another aspect, the targeting moiety specifically binds one of the following molecules: tumor necrosis factor (TNF) superfamily; tumor necrosis factor-α (TNF-α); tumor necrosis factor receptor (TNFR) superfamily; Interleukin-12 (IL-12); IL-12 receptor; 4-1BB (CD137); 4-1BB ligand (4-1BBL; CD137L); OX40 (CD134; TNR4); OX40 ligand (OX40L; CD40; CD40 ligand (CD40L); CTLA-4; Programmed death-1 (PD-1); PD-1 ligand I (PD-L1: B7-H1); or PD-1 ligand 2 (PD-L2; B7-DC); B7 family; B7-1 (CD80); B7-2 (CD86); B7-H3; B7-H4; GITR/AITR: GITRL/AITRL; BTLA; CD70; CD27; LIGHT; HVEM: Toll-like receptor (TLR) ( TLR 1, 2, 3, 4, 5, 6, 7, 8, 9, 10). In some embodiments, the agent is an agonist that increases the function of the targeted molecule. In other embodiments, the agent is an antagonist that inhibits the function of the targeted molecule.
In some embodiments, agents (e.g., immunotherapeutics) targeting 4-1BB, LAG-3 and/or one or more receptors/markers of Table 2 (e.g. PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.) are co-administered (e.g., serially or sequentially) with one or more adjuvants. Suitable adjuvants include, but are not limited to, one or more of: oil emulsions (e.g., Freund's adjuvant); saponin formulations; virosomes and viral-like particles; bacterial and microbial derivatives; immunostimulatory oligonucleotides; ADP-ribosylating toxins and detoxified derivatives; alum; BCG; mineral-containing compositions (e.g., mineral salts, such as aluminium salts and calcium salts, hydroxides, phosphates, sulfates, etc.); bioadhesives and/or mucoadhesives; microparticles; liposomes; polyoxyethylene ether and polyoxyethylene ester formulations; polyphosphazene; muramyl peptides; imidazoquinolone compounds; and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol).
Adjuvants may also include immunomodulators such as cytokines, interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., interferon-.gamma.), macrophage colony stimulating factor, and tumor necrosis factor. In addition to variant B7-DC polypeptides, other co-stimulatory molecules, including other polypeptides of the B7 family, may be administered. Proteinaceous adjuvants may be provided as the full-length polypeptide or an active fragment thereof, or in the form of DNA, such as plasmid DNA.
Pharmaceutical and immunotherapeutic compositions described herein may be delivered by any suitable route of administration (e.g., oral delivery, parenteral delivery, mucous membrane delivery, pulmonary delivery, intravenous delivery, etc.). Appropriate formulations for such delivery routes are understood in the field.
Non-limiting examples of cancers that may be treated with the compositions and methods described herein include, but are not limited to: melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g. clear cell carcinoma), prostate cancer (e.g. hormone refractory prostate adenocarcinoma), pancreatic cancer (e.g., adenocarcinoma), breast cancer, colon cancer, lung cancer (e.g. non-small cell lung cancer), esophageal cancer, squamous cell carcinoma of the head and neck, liver cancer, ovarian cancer, cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma, and other neoplastic malignancies. In some embodiments, the cancer is a solid tumor cancer.
Some embodiments described herein are particularly useful for the treatment of tumors that do not otherwise respond to immunotherapeutic approaches. In some embodiments, provided herein is the treatment of cancers that are non-responsive (or have a reduced response) to T cells or antigen presenting cells (e.g., dendritic cells (e.g., CD103⁺DCs, etc.), etc.). In some embodiments, provided herein is the treatment of cancers that are non-responsive to treatments, despite T cell infiltration. In some embodiments, compositions and methods described herein find use in the treatment of cancers in which T cells are not appropriately primed against tumor-associated antigens. In some embodiments, compositions and methods described herein find use in the treatment of cancers comprising tumors or cells that are defective in recruitment of dendritic cells (e.g., CD103⁺ DCs, etc.). In some embodiments, compositions and methods described herein find use in the treatment of cancers comprising tumors or cells that are defective in production of the chemokine CCL4.
In some embodiments, the therapeutic compositions and methods herein find use with those described in, for example WO 2016/141312; incorporated by reference in its entirety.
In some embodiments, methods are provided for testing sample (e.g., cell, tissue, population of cells, tumor, blood, urine, saliva, etc.) from a subject for one or more biomarkers (e.g., biomarkers of dysfunctional tumor antigen-specific CD8⁺ T cells). Such biomarkers may comprise nucleic acids, small molecules, proteins, peptides, etc., and may be detected using any suitable assay of technique. In some embodiments, provided herein are DNA-, RNA-, small molecule, and/or protein-based diagnostic methods that either directly or indirectly detect the biomarkers of the evasion of immune response or immunotherapy by cancer cells or tumors. The present invention also provides compositions, reagents, and kits for such diagnostic purposes.
In some embodiments, biomarkers are detected at the nucleic acid (e.g., RNA) level. For example, the presence or amount of biomarker nucleic acid (e.g., mRNA) in a sample is determined (e.g., to determine the presence or level of biomarker expression). Biomarker nucleic acid (e.g., RNA, amplified cDNA, etc.) may be detected/quantified using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to nucleic acid sequencing, nucleic acid hybridization, nucleic acid amplification (e.g., by PCR, RT-PCR, qPCR, etc.), micorarray, Southern and Northern blotting, sequencing, etc. Non-amplified or amplified nucleic acids can be detected by any conventional means. For example, in some embodiments, nucleic acids are detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids. Nucleic acid detection reagents may be labeled (e.g., fluorescently) or unlabeled, and may by free in solution or immobilized (e.g., on a bead, well, surface, chip, etc.).
In some embodiments, biomarkers are detected at the protein level. For example, the presence or amount of biomarker protein in a sample is determined (e.g., to determine the presence or level of biomarker expression or localization). In some embodiments, reagents are provided for the detection and/or quantification of biomarker proteins. Suitable reagents include primary antibodies (e.g., that bind to the biomarkers), secondary antibodies (e.g., that bind primary antibodies), antibody fragments, aptamers, etc. Protein detection reagents may be labeled (e.g., fluorescently) or unlabeled, and may by free in solution or immobilized (e.g., on a bead, well, surface, chip, etc.).
In some embodiments, biomarker capture reagents are provided to localize, concentrate, aggregate, etc. a biomarker. For example, in some embodiments a biomarker capture reagent that interacts with the biomarker is linked to a solid support (e.g., a bead, surface, resin, column, and the like) that allows manipulation by the user on a macroscopic scale. Often, the solid support allows the use of a mechanical means to isolate and purify the biomarker from a heterogeneous solution. For example, when linked to a bead, separation is achieved by removing the bead from the heterogeneous solution, e.g., by physical movement. In embodiments in which the bead is magnetic or paramagnetic, a magnetic field is used to achieve physical separation of the capture reagent (and thus the target) from the heterogeneous solution. Magnetic beads used to isolate targets are described in the art, e.g., as described in European Patent Application No. 87309308, incorporated herein in its entirety for all purposes.
Compositions for use in the diagnostic methods or testing steps described herein include, but are not limited to, probes, amplification oligonucleotides, and antibodies. Any of the detection and/or diagnostic reagents used in embodiments described herein may be provided alone or in combination with other compositions in the form of a kit. Kits may include any and all components necessary or sufficient for assays including, but not limited to, the detection reagents, buffers, control reagents (e.g., tissue samples, positive and negative control sample, etc.), solid supports, labels, written and/or pictorial instructions and product information, inhibitors, labeling and/or detection reagents, package environmental controls (e.g., ice, desiccants, etc.), and the like. In some embodiments, the kits provide a sub-set of the required components, wherein it is expected that the user will supply the remaining components. In some embodiments, the kits comprise two or more separate containers wherein each container houses a subset of the components to be delivered.
In some embodiments, a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of expression a biomarker) into data of predictive value for a clinician. In some embodiments, computer analysis combines various data into a single score or value that is predictive and/or diagnostic. The clinician can access the predictive data using any suitable means. Thus, in some preferred embodiments, the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data. The data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject. Contemplated herein are any methods capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information providers, medical personal, and subjects. For example, in some embodiments of the present invention, a sample (e.g., a biopsy, cell, or blood sample) is obtained from a subject and submitted to a profiling service (e.g., clinical lab at a medical facility, third-party testing service, genomic profiling business, etc. to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves and directly send it to a profiling center. In some embodiments, a report is generated (e.g., by a clinician, by a testing center, by a computer or other automated analysis system, etc.). A report may contain test results, diagnoses, and/or treatment recommendations.

EXPERIMENTAL

Materials and Methods

Mice and Tumor Inoculation

Female C57BL/6 mice ranging from 6 to 8 weeks were purchased from Taconic Farms. CD45.1 and Rag2^−/− mice on the C57BL/6 background were obtained from Taconic Farms and bred at the University of Chicago. 2C/Rag2^−/− and P14/Rag2^−/− mice have been previously described (Brown et al., 2006; incorporated by reference in its entirety). pLCK-CreERT2×ROSA-YFP mice were generated and have been described (Evaristo et al., 2016; incorporated by reference in its entirety). B16. SIY.dsRed (Kline et al., 2012; incorporated by reference in its entirety), C1498. SIY. GFP (Zhang et al., 2009; incorporated by reference in its entirety), and MC57. SIY. GFP (Spiotto et al., 2002; incorporated by reference in its entirety) tumor cells were engineered to express either dsRed or GFP in frame with the H2-K^b-restricted model antigen SIYRYYGL. The 1969. SIY. GFP cell line was engineered by retroviral transduction of the 1969 cell line (Diamond et al., 2011; incorporated by reference in its entirety) using the pLEGFP plasmid expressing cDNA for SIYRYYGL (Spiotto et al., 2002; incorporated by reference in its entirety). For experiments, mice 6 to 9 weeks of age and received 2×10⁶tumor cells subcutaneously on either the left flank or both the left and right flank. All mice were maintained according to the National Institute of Health Animal Care guidelines and studied under IACUC-approved protocols.
To generate the targeting construct for the Egr2^EGFPknock-in reporter mice, a 12.6 kb mouse genomic DNA fragment including the egr2 gene was excised with SacII and cloned into a pEasy-Flox vector adjacent to the thymidine kinase (TK) selection marker. A cassette containing IRES2-eGFP and a LoxP-flanked neomycin selection marker was inserted into an Nhel site between the translation stop codon (TGA) and the polyadenylation signal of the egr2 gene. ES cell clones from 129 mice were electroporated and selected for Neomycin resistance. ES cell clones were verified for homologous insertion in the endogenous locus by PCR and southern blot with 5′ and 3′ probes. Mice were backcrossed to C57BL/6 for over 8 generations.

TIL Isolation

Tumors were harvested from mice at the indicated time points. Tumors were dissociated through a 50 m filter and washed with PBS. TILs were further enriched by layering Ficoll-Hypaque beneath the cell suspension followed by centrifugation without breaks for 30 min at 400×g. The buffy-layer was isolated and washed twice with PBS before staining. For isolating specific cell populations by FACS, tumors were pooled when indicated and the cell layer was re-purified by Ficoll-Hypaque centrifugation twice. For day 28 tumors, after Ficoll-Hypaque separation, T cells were further purified by negative bead selection according to manufacturer's instructions (MAGNISORT, eBiosciences). Cells were then washed with PBS, stained at 4° C. for 15 minutes before resuspending in complete DMEM (cDMEM: 10% FBS, 100 U/mL Penicillin-Streptomycin, 1% MEM Non-Essential Amino Acids, 50 μM β-ME, 0.01M MOPS), and were sorted into either RLT lysis buffer (QIAGEN) or cDMEM depending on the experimental assay. Cells sorted into RLT buffer were put directly on dry ice as soon as the sort was finished.

Flow Cytometry and Antibodies

Cell suspensions were washed twice in PBS before staining an FACS buffer (10% FBS, 2 mM EDTA, 0.001% NaN₃). Cells were stained for 30 min on ice and fixed in 1% PFA. Antibodies against the following molecules were used: CD3 (17A2, AX700), 2B4 (2B4, FITC), CD127 (A7R34, PE), OX-40 (OX-86, PE), 4-1BB (17B5, Biotin, APC), CD160 (7H1, PE-Cy7), LAG-3 (C9B7W, PerCPeFluor710), PD-1 (RMP1-30, PE-Cy7), NRP1 (3E12, BV421), GITR (DTA-1, FITC), ICOS (7E.17G9, BV421), KLRG-1 (2F1, eF450, BV605), TIGIT (1G9, APC), TIM-3 (RMT3-23, PE), CD4 (RM4-5, BV605), CD45.1 (A20, FITC), CD45.2 (104, PE), CD8a (53-6.7, BV711). Fixable Viability Dye 506 (eBioscience) was used for live/dead discrimination. Staining of SIY-specific T cells was performed utilizing the SIYRYYGL-Pentamer (PE) (Proimmune); a SIINFEKL-pentamer (PE) was used as a non-specific control. All flow cytometric analysis was conducted on an LSRFortessa (BD) and analyzed using FlowJo software (Tree Star).

Quantitative Real-Time PCR

Total RNA was extracted from sorted cell populations using the RNEasy Micro Kit (QIAGEN) following the manufacturer's protocol. cDNA was synthesized using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to manufacturer's instructions. Transcript levels were determined using primer-probe sets (Tables 1a and 1b) developed through the online ProbeFinder Software and the Universal Probe Library (Roche) with the exception of IL-2 (Mm00434256_m1) and 18S (Hs99999901_s1). To minimize batch effect, when possible, all samples probed for a gene were run on the same 96-well qRT-PCR plate. All primer-probe sets either contained a primer spanning an exon-exon boundary or primers spanning an intron. Expression levels of transcripts were normalized to 18S expression

TABLE 1a

Primer Sequences

#	Wilson	IMGT	Sequence

0	Cβ1.1	TRBC1	CTCAAACAAGGAGACCTTGGGTGG

1	Vβ1	TRVB5	CAGACAGCTCCAAGCTACTTTTAC

2	Vβ2	TRVB1	ATGAGCCAGGGCAGAACCTTGTAC

3	Vβ3	TRVB26	GAAATTCAGTCCTCTGAGGCAGGA

4	Vβ4	TRVB2	CTAAAGCCTGATGACTCGGCCACA

5	Vβ5.1	TRVB12-2	CTTTGGAGCTAGAGGACTCTGCCG

6	Vβ5.2	TRVB12-1	CCTTGGAACTGGAGGACTCTGCTA

7	Vβ6	TRVB19	GCCCAGAAGAACGAGATGGCCGTT

8	Vβ7	TRVB29	GGATTCTGCTAAAACAAACCAGACATCTGT

9	Vβ8.1	TRVB13-3	GCTTCCCTTTCTCAGACAGCTGTA

10	Vβ8.2	TRVB13-2	GCTACCCCCTCTCAGACATCAGTG

11	Vβ8.3	TRVB13-3	GGCTTCTCCCTCTCAGACATCTT

12	Vβ9	TRVB17	CTCTCTCTACATTGGCTCTGCAGG

13	Vβ10	TRVB4	CTTCGAATCAAGTCTGTAGAGCCG

14	Vβ11	TRVB16	TGAAGATCCAGAGCAGCGGGCCCC

15	Vβ12	TRVB15	CCACTCTGAAGATTCAACCTACAGAACCC

16	Vβ13	TRVB14	CAAGATCCAGTCTGCAAAGCAGGG

17	Vβ14	TRVB31	GCACGGAGAAGCTGCTTCTCAGCC

18	Vβ15	TRVB20	GCATATCTTGAAGACAGAGGC

19	Vβ16	TRVB3	CTCTGAAAATCCAACCCACAGCACTGG

20	Vβ17	TRVB24	TCTGAAGAAGACGACTCAGCACTG

21	Vβ18	TRVB30	GCAAGGCCTGGAGACAGCAGTATC

TABLE 1b

Primer/Probe

			Roche
Gene	Primer1	Primer2	Probe #

Lag3	tgctttgggaagctccagt	gctgcagggaagatggac	79

Tnfrsf9	ccggtcttaagcacagacct	gaacggtactggcgtctgtc	108

Egr2	CTACCCGGTGGAAGACCTC	AATGTTGATCATGCCATCTCC		60

Sema7a	tcaatcggctgcaagatgt	cgcagacagctgagtagttcc	15

Crtam	AGATCCAACAACGAGGAGACA	TCATGCAACGCTTAGACTGG	71

Ccl1	tcaccatgaaacccactgc	agcagcagctattggagacc	71

Ngn	caccctagectaacctcaacc	tgaaaacctcctcccctctt	45

Arl3	ctggcagatccagtcctgtt	acccagttcatgccatcct	100

Exph5	atgagggaggagagcggtat	cagcttgttgtccaaatcgtc	67

Fhl2	agaaaaccatcatgccaggt	acaggtgaagcaggtctcgt	74

Nrn1	atcctcgcggtgcaaata	gcccttaaagactgcatcaca	108

Ptgfrn	ccggggagatctcatcaaa	tcgaaggccatgtcatctg	12

Rankl	tgaagacacactacctgactcctg	cccacaatgtgttgcagttc	88

Hif1a	gctgctcactgtgaaggaagt	tggggaatgcattttaccat	2

Egr3	caatctgtaccccgaggaga	ccgatgtccatcacattctct	74

Tnfa	ctgtagcccacgtcgtagc	ttgagatccatgccgttg	25

Gzmb	gctgctcactgtgaaggaagt	tggggaatgcattttaccat	2

Ccl1	tcaccatgaaacccactgc	agcagcagctattggagacc	71

Ccl22	tcttgctgtggcaattcaga	gcagagggtgacggatgtag	74

In Vivo Proliferation Assay

In vivo proliferation was measured by a BrdU pulse 24 hours prior to flow cytometric analysis. Each mouse received 0.8 mg BrdU injected i.p. on day 12 after tumor inoculation. TILs were isolated and surface stain was performed as described above. Following surface staining, cells were fixed and permeabilized using the Foxp3 staining kit (BD), according to manufacturer's protocol, and incubated with 100 μl PBS/DNase solution (300 μg/ml) for 30 minutes at 37° C. Cells were washed and incubated for 30 minutes at room temperature with anti-BrdU (FITC, Bu20a) and then washed with and resuspended in PBS.

In Vitro Stimulation Assays

Tissue culture-treated 96-well round bottom plates were coated with anti-CD3F (1 μg/ml; 2C11) in DPBS overnight at 4° C. or for 2 hours at 37° C. Cells were sorted into cold cDMEM media and put on ice as soon as the sort was finished. Cells were then pelleted, resuspended in 50 μl cDMEM and incubated with soluble anti-CD28 (2 μg/ml; PV-1) for 10-12 hours for a final volume of 100 μl. After stimulation supernatants were removed for ELISA or bead-based immunoassay (LegendPlex), and cells were washed once with DPBS and resuspended in 15 μl of RNAlater Stabilization Solution (QIAGEN) or 300 μl of RLT buffer. Cells were stored at −80° C. until RNA isolation was performed.

Protein Quantification

Measurement of protein concentration was determined either by a standard ELISA or bead-based immunoassay (LEGENDplex, BioLegend). ELISAs were performed according to manufacturer's protocol (Ready-SET-Go ELISA; eBioscience) on supernatants from in vitro stimulations. Absorbance values were obtained at 450 nm using an Emax microplate reader (Molecular Devices) and IL-2 concentration was determined by standard curve. Protein concentration values were normalized to the number of sorted cells plated. LEGENDplex assays were performed according to manufacturer's protocols. IL-2 concentration (FIG. 4B) was confirmed by both methods in separate experiments with no significant difference in IL-2 concentration between the two methods.

Spectratype Analysis and Sequencing

Mice were injected with 2×10⁶B16. SIY.dsRed tumor cells. 14 days later, tumors were harvested and specific CD8⁺ TIL subpopulations were sorted into RLT buffer (QIAGEN) and immediately frozen. cDNA was synthesized from sorted cell populations and CDR3 regions were amplified by PCR with 21 different Vβ-5′ primers paired with a FAM-Cβ1.1 primer (Table 1). Three Vβ PCR reactions did not reach significant amplification for analysis and were removed from the analysis. For sequencing, Cβ-Vβ PCR products were purified using the QIAquick PCR purification kit (QIAGEN) and sequenced at the University of Chicago Genomics Core Facility. Cβ-Vβ PCR products were analyzed by capillary electrophoresis at the University of Chicago Genomics core and CDR3 peaks were aligned using the Liz500 ladder. Spectratype graphs were displayed using the GeneiousR9 software (Kearse et al., 2012). To generate the frequency profile for each Vβ spectratype, the area under each peak was measured using peak studio (fodorlab.uncc.edu/software/peakstudio). The Hamming Distance (Currier and Robinson, 2001; incorporated by reference in its entirety) was calculated between each Vβ spectratype from each CD8⁺ spleen and TIL population within a given mouse. To determine significance between the HD from each comparison the HDs for each Vβ from mice were averaged and a One-Way ANOVA with Dunn's correction for multiple comparisons was performed.

TCR Transgenic T Cell Transfer Experiments

Cell suspensions were generated from spleens and lymph nodes from congenic 2C/Rag2^−/−/CD45.1/2 and/or P14/Rag2^−/−/CD45.2 mice and T cells were purified by CD8⁺ negative selection (Miltenyi Biotechnologies) over magnetic columns according to the manufacturer's protocol. TCR Transgenic (Tg) T cells were washed with PBS, resuspended at a concentration of 10×10⁶/ml and 1×10⁶TCR Tg cells were adoptively transferred into CD45.1 tumor bearing mice by tail vein transfer in a volume of 0.1 mL. After indicated times, 2C T cells and corresponding host CD8⁺ T cells were sorted and stimulated as described above.

In Vitro Cytotoxicity Assay

Per individual experiment, 10 C57BL/6 mice were injected s.c. with 2×10⁶B16. SIY cells on both left and right flanks. On day 14, all 20 tumors were pooled and dissociated using the Tumor Dissociation Kit (Miltenyi Biotec) following the manufacturer's protocol. Tumor cell suspensions were washed 3-5 times with PBS and TILs were enriched for by Ficoll-Hypaque gradient centrifugation. TILs were stained, sorted and put directly on ice. TILs were titrated and added directly to a 96-well plate containing 50,000 P815 mastocytoma cells and 1 μg/mL anti-CD3. For a positive control, OT-I cells were isolated from OT-I/Rag2^−/− mice and stimulated with plate-bound anti-CD3 (0.25 μg/mL), anti-CD28 (2 μg/mL) and 100 U/mL IL-2 for 2-3 days. For a negative control, P815 cells were cultured alone or cultured with naïve CD8⁺ T cells isolated from lymph nodes. After 12 hours of incubation, cells were stained for Thy1, CD45, CD8a, Fixable Viability Dye 450 (eBioscience) and/or propidium Iodide.

Gene Expression Analysis

Total RNA for the CD8⁺ TIL subpopulations was isolated following the manufacturer's protocol (RNEasy Micro Kit: QIAGEN) from sorted cells pooled from 10 mice. Samples were analyzed by the University of Chicago Genomics Facility using Illumina MouseRef8 microarray chips. Two experimental replicates were performed, and the results were log₂transformed and averaged. Probe sets that revealed a 1.5-fold difference abs(log₂(ratio)>1.5)) relative to CD8⁺4-1BB⁻LAG-3⁻PD-1⁻ cells were identified and used for subsequent analysis. The microarray data are available in the Gene Expression Omnibus database (ncbi.nlm.nih.gov/gds) under accession number GSE79919. For cross-study comparisons, log 2-fold change values were extracted using the GEO2R online software from the hypofunctional CD8⁺ TIL data set, GSE79858 ((GSM2107353, GSM2107353 and GSM2107355) versus (GSM2107350, GSM2107351, GSM210732)) and the CD8⁺ T cell exhausted data set, GSE41870 ((GSM1026819, GSM1026820, GSM1026821) versus (GSM1026786, GSM1026787, GSM1026788, GSM1026789)). Upregulated genes showing a 2-fold difference were used for analysis. Multiple genes names with from the GEO2R extracted data were identified and matched to gene names from the Illumina data set. The rank-rank hypergeometric overlap (RRHO) analysis (Plaisier et al., 2010; incorporated by reference in its entirety) was conducted at systems.crump.ucla.edu/rankrank/index.php and the associated Bioconductor package “RRHO” (Rosenblatt and Stein, 2014; incorporated by reference in its entirety).

Gene Ontology Enrichment Analysis

In a pair-wise fashion, shared upregulated genes were used as the input for the ClueGO software with the Cytoscape application (Shannon et al., 2003; incorporated by reference in its entirety). Both the Biological Process and Immune System Process Gene Ontology Annotations were used for analysis. Only pathways with a Bonferroni step down correction p-value >0.01 were considered when generating pathway nodes. Non-redundant pathways with the greatest number of genes found within each node were used as examples in FIG. 6A.

Antibody and FTY720 Treatments

Mice were treated i.p. with 100 μg/mouse of anti-4-1BB (Bio-X-Cell; LOB12.3) antibody and/or 100 μg/mouse anti-LAG-3 (Bio-X-Cell; C9B7W). For tumor outgrowth experiments, mice were treated on day 7, 10, 13 and 16 after tumor inoculation. For ex vivo functional experiments mice were treated on day 7, 10 and 13 and cells were sorted on day 14. For experiments blocking lymph node egress, 25 μg of FTY720 was given by gavage one day prior to first antibody treatment (day 6) and continued every day until endpoint on day 14.

Results

4-1BB and LAG-3 Identify a Major Population of CD8⁺ TILs

To determine whether 4-1BB and LAG-3 could identify dysfunctional CD8⁺ TILs, the expression pattern of LAG-3 and 4-1BB was examined using the well-characterized B16. SIY model of melanoma. On day 7 following tumor inoculation, the 4-1BB⁺LAG-3⁺ population comprised 15.8% of all CD8⁺ TILs. The frequency of this population significantly increased to 44% by day 21. The frequency of 4-1BB⁻LAG-3⁺ (4⁻L⁺) population also increased 1.9-fold from day 7 to day 14 to comprise 25% of the CD8⁺ TIL compartment. In contrast, the frequency of the 4-1BB⁻LAG-3⁻ (4⁻L⁻) population decreased by 2.7-fold by day 21. There was no significant increase in the proportion or number of 4-1BB⁺LAG-3⁻ CD8⁺ TILs within the time frame of the experiment (FIGS. 1A and B). Similar patterns were seen when analyzing absolute numbers of cell subsets (FIGS. 1C and D). Acquisition of these phenotypes was specific for the tumor microenvironment, as they were not observed in the spleen or tumor-draining lymph node (TdLN) (FIG. 1A). These data indicate that the tumor microenvironment preferentially supports the induced co-expression of LAG-3 and 4-1BB.
The selective increase in cell numbers and proportional shift towards the 4-1BB⁻LAG-3⁺ and 4-1BB⁺LAG-3⁺ populations during tumor progression indicated that expansion of these populations was occurring within the tumor microenvironment. CD8⁺ TILs were stained for Ki67 at day 14 after tumor inoculation and analyzed by flow cytometry. 81% of 4-1BB⁻LAG-3⁺ cells and 85% of 4-1BB⁺LAG-3⁺ cells were Ki67⁺ compared to only 32% of the 4-1BB⁻LAG-3⁻ TILs (FIG. 1E). Mice were pulsed with BrdU on day 12, and 24 hours later the CD8⁺ TIL subpopulations were analyzed for BrdU incorporation. Indeed, the 4-1BB⁻LAG-3⁺ and 4-1BB⁺LAG-3⁺ populations incorporated more BrdU compared to the 4-1BB⁻LAG-3 population (FIG. 1F). These data indicate that once CD8⁺ T cells arrive at the tumor site, a fraction of TILs expands within the tumor, and that these expanding TILs are identified by increased expression of 4-1BB and LAG-3.
To determine if upregulation of LAG-3 and 4-1BB was simply a product of the B16. SIY tumor model or if it is a more general feature of CD8⁺ T cells within tumors, T cells from three additional progressively growing tumor models, C1498. SIY, MC38. SIY, EL4. SIY and B16F10 parental were analyzed. TILs were analyzed for expression of 4-1BB and LAG-3 at day 14. We found that the pattern of expression was similar to that seen in CD8⁺ TILs isolated from B16. SIY tumors (FIGS. 1G and I). The results from the B16F10 parental tumor confirm that presence of SIY is not required to see co-expression of 4-1BB and LAG-3. In order to determine whether the 4-1BB⁺LAG-3⁺ TIL subset was generated only in progressing tumors or also in tumors that were rejected, T cell phenotypes in the 1969. SIY and MC57. SIY fibrosarcoma tumor models we analyzed, which are more immunogenic and undergo spontaneous rejection. Distinctly fewer 4-1BB⁺LAG-3⁺ cells were found among the CD8⁺ TIL compartment in the 1969. SIY and MC57. SIY tumors (Figure H and I). Over time, co-expression of 4-1BB and LAG-3 was maintained in B16. SIY tumors but not MC57. SIY tumors (FIG. 1J). These data indicate that the acquisition of the LAG-3⁺4-1BB⁺ TIL phenotype preferentially occurs within the tumor microenvironment and only upon conditions of tumor progression rather than regression.
CD8⁺4-1BB⁺LAG-3⁺ TILs Express Egr2 and Multiple Egr2 Gene Targets
Experiments conducted during development of embodiments herein to determine whether Egr2 expression itself was also characteristic of T cells within the CD8⁺ TIL compartment; an Egr2-IRES-GFP (Egr2^GFP) knock-in reporter mouse was utilized. Approximately 14% of all CD8⁺ TILs were GFP⁺ on both day 7 and day 14 (FIG. 2A). To confirm that Egr2 is faithfully reported, CD8⁺ TILs expressing high and low levels of EGFP were sorted and screened for Egr2 and several Egr2 targets by qRT-PCR. The Egr2-GFP^hipopulation expressed greater levels of Egr2 and many Egr2-target genes previously defined using in vitro anergy models. These include Tnfrsf9, Lag3, Ngn, Sema7a, Crtam, Ccl1 and Nrn1 (FIG. 2B). Expression of 4-1BB and LAG-3 in the Egr2-GFP^hiCD8⁺ TILs was confirmed by flow cytometry. The majority of Egr2-GFP^hicells expressed LAG-3 and/or 4-1BB. The Egr2GFP^locells also showed expression of 4-1BB and LAG-3 on a subpopulation at day 14 (FIG. 2C). This result indicates either that CD8⁺ TILs expressing Egr2 encompass only a subset of the TILs expressing LAG-3 and/or 4-1BB, or that Egr2 is transiently expressed and is subsequently downregulated after the induction of LAG-3 and 4-1BB.
Using Egr2 target genes from in vitro anergic CD4⁺ T cell clones (Zheng et al., 2013; incorporated by reference in its entirety), the Egr2-driven transcriptional program was examined in sorted 4-1BB⁻LAG-3⁻ and 4-1BB⁺LAG-3⁺ cells by qRT-PCR. Of the 43 Egr2 target genes examined, 10 showed detectably increased expression in 4-1BB⁺LAG-3⁺ population, while expression of a similar subset of genes was increased in the 4-1BB⁻LAG-3⁺ population (FIG. 2D). Collectively, these data demonstrate that Egr2 is expressed in a subpopulation of CD8⁺ TILs expressing LAG-3 and/or 4-1BB, and that a subset of known Egr2 targets was detected in these larger T cell populations as a whole.
It was next examined whether Egr2 was required for expression of LAG-3 and 4-1BB among CD8⁺ TIL in vivo. To this end Egr2^flox/flox×pLCK-CreERT2×ROSA-YFP mice were utilized, in which oral tamoxifen administration results in a fraction of the CD8⁺ T cells deleting Egr2 and expressing YFP (FIG. 2E). This allowed comparison of both Egr2-sufficient (YFP⁻) and Egr2-deficient (YFP⁺) CD8⁺ within the same tumor. To determine that Egr2 was in fact deleted from the YFP⁺ fraction, both YFP⁺ and YFP⁻ CD8⁺ TILs were sorted and Egr2 transcripts were measured directly ex vivo and upon ex vivo stimulation. The YFP⁺ CD8⁺ TILs expressed substantially less Egr2 transcripts compared to the YFP⁻ counterparts (FIG. 2E). To determine if Egr2 is required for 4-1BB and LAG-3 expression, CD8⁺ TILs were analyzed at day 7 and 14 after tumor inoculation and compared the YFP⁺ and YFP⁻ populations to mice not treated with tamoxifen. At day 7, the YFP⁺ fraction expressed less 4-1BB and LAG-3 compared to the YFP-population and the WT CD8⁺ TILs. However, expression of 4-1BB and LAG-3 was not significantly different at day 14 (FIG. 2F). This indicates that other transcriptional regulators compensate and contribute to the expression of LAG-3 and 4-1BB, especially at later time points.
Egr3 has been shown to have overlapping function with Egr2 (Safford et al., 2005; incorporated by reference in its entirety) and HIF1α can contribute to 4-1BB expression (Palazón et al., 2012). To investigate whether these transcription factors may compensate for 4-1BB and/or LAG-3 expression we sorted Egr2GFP^hiand Egr2GFP^loCD8⁺ TILs expressing 4-1BB and LAG-3 on day 7 and analyzed expression of Egr3 and HIF1α by qRT-PCR. Egr3 and HIF1α were indeed expressed in both the Egr2GFP^hiand Egr2GFP^lopopulations. It was confirmed differential expression of Egr2 and CCL1 to between the Egr2GFP^hiand Egr2GFP^lopopulations to assure sort purity (FIG. 2G). Together, these data indicate that Egr2 contributes to upregulation of 4-1BB and LAG-3 expression at early time points, but that other transcriptional regulators compensate and drive expression of LAG-3 and 4-1BB as the T cell-tumor interaction progresses.
CD8⁺4-1BB⁺LAG-3⁺ TILs are Oligoclonal and Enriched for Tumor Antigen Specificity
Not all T cells in the tumor microenvironment are specific for tumor-associated antigens, as memory T cells specific for irrelevant antigens are often found among TIL, and non-specific T cell trafficking has been documented in vivo (Harlin et al., 2006; incorporated by reference in its entirety). Experiments conducted during development of embodiments herein to determine whether 4-1BB⁺LAG-3⁺ CD8⁺ TILs are tumor-antigen specific. LAG-3, 4-1BB and Egr2 are upregulated after TCR stimulation and experiments indicate that this population expands within the tumor microenvironment in situ. Three complementary techniques were employed. First, the CD8⁺ TILs were isolated based on LAG-3 and 4-1BB expression by cell sorting and performed TCRβ spectratype analysis. Compared to the 4-1BB⁻LAG-3 TILs and CD8⁺ splenocytes, the 4-1BB⁺LAG-3⁺ TILs had a non-Gaussian distribution and shared one or two dominant peaks (FIG. 3A). Analysis of several Vβs displaying one dominant peak revealed that Vβ7 contained a single CDR3β sequence shared between the 4-1BB⁻LAG-3⁺ and 4-1BB⁺LAG-3⁺ populations, indicating a clonal relationship (FIG. 3A). To measure the oligoclonality of the CDR30 repertoires the Hamming Distance (HD) was calculated for each Vβ between the CD8⁺ TIL subpopulations and the splenic CD8⁺ population within three separate mice (FIG. 8 ). By transforming each spectratype into area under the curve frequency profiles the Hamming Distance computes the changes in frequency and reports a value of comparison between 0 and 1, with 0 indicating a completely identical frequency profile and 1 signifying a completely discordant profile. As a control, the HD of the splenic CD8⁺ populations between different mice was calculated (FIG. 3B, black bar). Since the splenic CD8⁺ spectratypes are largely Gaussian this value represents the HD between two similar distributions. Analysis of the HD between the CD8⁺ TIL subpopulations revealed that the 4-1BB⁺LAG-3⁺ and 4-1BB⁻LAG-3⁺ but not the 4-1BB⁻LAG-3⁻ CDR30 distributions are significantly different (less Gaussian) compared to the splenic CD8⁺ population (FIG. 3B). These data indicate that the 4-1BB⁺LAG-3⁺ and 4-1BB-LAG-3⁺ populations are oligoclonal expanded subsets of TILs, indicating antigen specificity in these subpopulations.
As a second approach, the B16. SIY melanoma and MC38. SIY adenocarcinoma models were utilized. CD8⁺ T cells specific for the H-2K^b-restricted SIY epitope (SIYRYYGL) were monitored. SIYRYYGL/K^bpentamer⁺ (H-2K^b/SIY) cells were found in expanded numbers within B16. SIY and MC38. SIY tumors at day 14 after tumor inoculation (FIG. 3C). Nearly 47% of the H-2K^b/SIY⁺ cells expressed both 4-1BB and LAG-3, in contrast to 32% of the H-2K^b/SIY⁻ population (FIGS. 3C and E). This enrichment of antigen-specific CD8⁺ TILs in the 4-1BB⁺LAG-3⁺ populations indicates that these markers identify tumor antigen-specific TILs. The H-2K^b/SIY⁻ cells also contained significant numbers of 4-1BB⁺LAG-3⁺ cells, which is consistent with the notion that tumor antigens other than SIY are also recognized by subsets of CD8⁺ TILs in vivo (FIG. 3C). H-2K^b/SIY⁺ cells in the spleen or TdLN did not co-express 4-1BB and LAG-3, indicating that this phenotype is acquired within the tumor microenvironment.
These features were also analyzed t in the context of tumor-antigen specific CD8⁺ TILs in two spontaneously rejected tumor models. To this end, H-2K^b/SIY-specific CD8⁺ TILs cells were evaluated from MC57. SIY and 1969. SIY tumors. At day 14 after tumor inoculation, approximately 5% of the H-2K^b/SIY-specific CD8⁺ TILs were found in the 4-1BB⁺LAG-3⁺ fraction. As with the B16. SIY tumors, no H-2K^b/SIY-specific CD8 T cells co-expressed 4-1BB and LAG-3 in the TdLN or spleen (not shown) (FIG. 3D). Unlike the B16. SIY and MC38. SIY tumors, no significant enrichment of 4-1BB⁺LAG-3⁺ H-2K^b/SIY-specific CD8⁺ TILs was observed (FIGS. 3D and E). These data indicate that tumor antigen specificity per se does not determine dysfunctionality, and that this is a feature unique to the microenvironment of progressing tumors.
As a third measure to determine if tumor-antigen specific CD8⁺ T cells acquire the 4-1BB⁺LAG-3⁺ phenotype, congenically marked 2C and P14 transgenic (Tg) T cells, isolated from 2C/Rag2^−/− and P14/Rag2^−/− mice, were transferred into tumor-bearing hosts. The 2C TCR is specific for the SIY model antigen expressed by B16. SIY tumor cells, while P14 is an irrelevant TCR specific for the LCMV-derived gp33_41 epitope; both TCRs are H-2K^b-restricted. 2C and P14 Tg CD8⁺ T cells were transferred via tail vein 7 days after tumor inoculation. Seven days after transfer, tumors and TdLNs were extracted and the phenotypic profile of the transferred populations was analyzed. This system allowed for the analysis of two T cell populations with defined antigen specificities within the same tumor microenvironment, as well as the polyclonal host CD8⁺ T cells. The 2C T cells were more efficiently recruited and expanded within the tumor microenvironment compared to the P14 T cells and encompassed a large fraction of the total CD8⁺ TIL population (FIG. 3F). Of the 2C T cells, nearly all expressed LAG-3 and or 4-1BB while this was true for only a small percentage of the P14 cells (FIGS. 3G and H). Consistent with the SIY-K^bpentamer analysis, the co-expression of LAG-3 and 4-1BB on 2C T cells was not observed in the TdLN. Together, these results demonstrate that the 4-1BB⁺LAG-3⁺ phenotype is a property of tumor antigen-specific TIL under conditions of tumor progression.

CD8⁺ TILs Expressing LAG-3 and 4-1BB Exhibit Defective IL-2 Production Yet Produce IFN-γ and Treg-Recruiting Chemokines

Based on the characteristics of the in vitro T cell anergy model that led to the identification of Egr2 as an important regulator, experiments conducted during development of embodiments herein to determine whether the tumor-antigen specific 4-1BB⁺LAG-3⁺ CD8⁺ TIL population is dysfunctional in their capacity to produce IL-2. To this end each subpopulation was sorted and stimulated with anti-CD3 and anti-CD28 mAb and analyzed IL-2 production by qRT-PCR and ELISA. Since nearly all CD8⁺ TILs displayed an activated phenotype we used CD8⁺CD44⁺ splenocytes as a positive control. Indeed, the 4-1BB⁺LAG-3⁺ cells showed a 100-fold reduction in Il-2 mRNA and as much as a 40-fold reduction in IL-2 protein levels compared to the 4-1BB⁻LAG-3 population (FIGS. 4A and 4B). As a second approach, Egr2^hiTIL (which are also largely 4-1BB⁺LAG-3⁺) was examined by utilizing the Egr2-GFP reporter mice. Indeed, ex vivo stimulated Egr2-GFP^hiCD8⁺ TILs also exhibited reduced Il-2 transcript compared to Egr2-GFP^locells (FIG. 4C). As a final approach, congenically marked 2C T cells were adoptively transferred intravenously into tumor-bearing hosts and recovered the 2C T cells 7 days later from the tumor and TdLN. 2C T cells isolated from tumors exhibited a reduced capacity to produce Il-2 transcripts, at a level equivalent to 4-1BB⁺LAG-3⁺ TILs, compared to 2C CD44⁺ T cells isolated from the TdLN (FIG. 4D). In chronic infection models, expression of PD-1 has been suggested to identify intrinsically dysfunctional or “exhausted” CD8⁺ T cells. To determine if PD-1 alone might be sufficient to identify cells that lack the capacity to produce IL-2, CD8⁺ TILs that lacked expression of LAG-3 and 4-1BB were isolated and tested for the ability of the PD-1⁺ fraction to produce IL-2. Approximately ˜10% of CD8⁺ TILs were 4-1BB-LAG-3-PD-1⁺ on day 14 and 21 (FIGS. 4E and F). Upon ex vivo stimulation, this population retained the capacity to produce 11-2 mRNA at a level comparable to the 4-1BB⁻LAG-3⁻ cells (FIG. 4G). These results indicate that PD-1 expression alone is not sufficient to identify dysfunctional TIL in the tumor microenvironment.
To further examine functional alterations during tumor progression we tested for protein levels of IL-2, IFN-γ and TNF-α after TCR stimulation. As the loss of the ability of CD8⁺ TILs to produce cytokines is suggested to be a temporal process reported initiated following entry into the tumor microenvironment (Waugh et al., 2016; Schietinger et al., 2016; incorporated by reference in their entireties) or progressively after 30 days in the chronic LCMV model (Wherry et al., 2007; incorporated by reference in its entirety), cytokine production was tested on day 7, 14, 21 and 28. The 4-1BB⁺LAG-3⁺ population lost the capacity to produce IL-2 as early as day 7 while the 4-1BB⁻LAG-3⁺ population lost IL-2 production between day 7 and day 14 (FIG. 5A). The 4-1BB⁻LAG-3⁻ population did not lose the ability to produce IL-2 at any time point tested (FIG. 5A), supporting the notion that this population is not tumor antigen specific and that differentiation into the dysfunctional state is an antigen-dependent process (Schietinger et al., 2016; incorporated by reference in its entirety). The 4-1BB⁺LAG-3⁺ population produced more IFN-γ at all time points after day 7 compared to their negative counterparts, albeit with a slight decrease in IFN-γ production over time. While the increase in IFN-γ was maintained until later time points, TNF-α production was lost by day 28 (FIG. 5A).
Experiments were conducted during development of embodiments herein to evaluate production of cytokines directly in the tumor without in vitro restimulation, which may more closely reflect which T cells were receiving TCR stimulation in situ. Each T cell population was sorted directly ex vivo without any culturing and mRNA levels were measured by qRT-PCR. Elevated Ifn-γ and Gzmb transcripts were observed from the 4-1BB⁺LAG-3⁺ subpopulation, along with a slight decrease in Tnf-α levels, compared to the 4-1BB⁻LAG-3⁻ cells (FIG. 5B). Production of IFN-γ in primary TILs was confirmed by injecting tumors with Brefeldin A prior to analysis by intracellular cytokine staining. Consistent with the mRNA expression, the 4-1BB⁺LAG-3⁺ population produced significantly greater amounts of IFN-γ protein (FIG. 5C). Thus, the 4-1BB⁺LAG-3⁺ TIL are not completely devoid of functionality, as they continue to produce IFN-γ despite defective production of IL-2. This phenotype is consistent with in vitro T cell anergy models (Jenkins et al., 1987; incorporated by reference in its entirety).
To test whether the 4-1BB⁺LAG-3⁺ population still retains cytotoxic capacity, re-directed lysis was performed by co-culturing anti-CD3 bound P815 mastocytoma target cells with the different CD8⁺ TIL subpopulations directly after sorting. 4-1BB⁺LAG-3⁺CD8⁺ TILs isolated from day 14 tumors were able to lyse target cells at a comparable efficacy to in vitro primed OT-I cells. 4-1BB⁺LAG-3⁺ TILs isolated from day 21 tumors were still able to lyse target cells, albeit to a lesser extent compared to primed OT-I cells (FIG. 5D).
CD8⁺ T cells in the tumor can be the source of the chemokine CCL22 that recruits FoxP3⁺ regulatory T cells (Tregs) to the tumor microenvironment (Spranger et al., 2013; incorporated by reference in its entirety). In addition, the chemokine Ccl1 was an Egr2 target in anergic T cells (Zheng et al., 2013; incorporated by reference in its entirety), and it has been suggested that CCL1 also contribute to Treg recruitment in the tumor context in vivo (Hoelzinger et al., 2010; incorporated by reference in its entirety). However, whether all CD8⁺ T cells in the tumor produce these chemokines or if they are only produced by subpopulations of T cells had not been determined. To address this the CD8⁺ TIL phenotypic subpopulations were analyzed for Ccl1 and Ccl22 mRNA expression directly ex vivo by qRT-PCR. Indeed, the 4-1BB⁺LAG-3⁺TIL population produced substantially greater Ccl1 and Ccl22 compared to their negative counterparts or to splenic CD8⁺CD44⁺ T cells (FIG. 4K). As a control, expression of a distinct chemokine Ccl5 was found not to be differentially expressed.
Together, these data show that co-expression of 4-1BB and LAG-3 delineates tumor antigen-specific CD8⁺ TIL that lack the ability to produce IL-2 yet retain the ability to produce IFN-γ, kill target cells in vitro, and secrete chemokines capable of Treg recruitment. Given the fact that IFN-γ is responsible for the upregulation of PD-L1 and IDO in the tumor microenvironment, and that chemokines produced by CD8⁺ TIL contribute to Treg recruitment (Spranger et al., 2013; incorporated by reference in its entirety), these data indicate that the 4-1BB⁺LAG-3⁺ population contributes to the network of immune suppressive mechanisms within the tumor microenvironment that limit the efficacy of anti-tumor immunity.
Gene Expression Profiling Reveals that CD8⁺4-1BB⁺LAG-3⁺ TILs Express an Extensive Array of Additional Co-Stimulatory and Co-Inhibitory Receptors
Having in hand surface markers that define tumor antigen-specific dysfunctional CD8⁺ TILs, experiments conducted during development of embodiments herein to compare the gene expression profile of this population to other published profiles of dysfunctional CD8⁺ T cells to determine genes that regulate or are differentially expressed in cells in this dysfunctional state. To this end, a cross-study comparison was conducted of the transcriptional profiles of the “dysfunctional” 4-1BB⁺LAG-3⁺CD8⁺ TILs, “hypofunctional” CD8⁺ TILs from a study utilizing the murine CT26 tumor model (Waugh et al., 2016; incorporated by reference in its entirety) and LCMV “exhausted” GP33 specific CD8⁺ T cells (Doering et al., 2012; incorporated by reference in its entirety). The results are depicted in Table 2. Only genes with a 2-fold increase over controls from each study independently were considered. Over a 2-fold greater number of genes was found to be shared between the dysfunctional TIL dataset and the previously published hypofunctional CD8⁺ TIL data, than with the exhausted T cell profile (FIG. 6A). In addition, a rank-rank hypergeometric overlap (RRHO) analysis indicated a greater statistically significant overlap (FIG. 10A) and a greater correlation (FIG. 10B) between the current dysfunctional TIL and the published hypofunctional CD8⁺ TIL gene expression profiles compared to the virally-induced exhausted CD8⁺ T cell profile, indicating a more similar molecular program between CD8⁺ T cells isolate from tumors compared to chronic viral infection.

TABLE 2

Differentially regulated genes in CD8⁺ 4-1BB⁺ LAG-3⁺ TILs

		Log2-Fold	Gene		Log2-Fold
Gene	Gene Description	Change	Symbol	Gene Description	Change

GLDC	glycine decarboxylase	11.25109772	CRY2	cryptochrome circadian	−1.546648257
				clock 2
GZMD	Granzyme D	10.66720027	KCMF1	potassium channel	−1.546835341
				modulatory factor 1
SLC17A6	solute carrier family 17	8.946467699	RHOB	ras homolog family member	−1.548813112
	member 6			B
IL1R2	interleukin 1 receptor type	7.595353131	KRT15	keratin 15	−1.549018071
	2
LTF	lactotransferrin	7.530211233	RRAD	RRAD, Ras related	−1.549530357
				glycolysis inhibitor and
				calcium channel regulator
NRGN	neurogranin	7.334049768	C3	complement component 3	−1.549960037
GZME	granzyme E	7.160375687	ITFG3	Description Not Found	−1.550162812
RPL6	ribosomal protein L6	7.142107057	HAAO	3-hydroxyanthranilate 3,4-	−1.550553207
				dioxygenase
NRN1	neuritin 1	7.087993146	RNF138	ring finger protein 138	−1.551449524
LPL	lipoprotein lipase	7.004501392	UNC93B1	unc-93 homolog B1	−1.551767491
				(C. elegans)
CLGN	calmegin	6.933690655	ANKZF1	ankyrin repeat and zinc	−1.552214097
				finger domain containing 1
CD70	CD70 molecule	6.906890596	IFITM3	interferon induced	−1.552644542
				transmembrane protein 3
AREG	amphiregulin	6.712870868	TXNIP	thioredoxin interacting	−1.552785452
				protein
ZRANB3	zinc finger RANBP2-type	6.595443985	LMAN1L	lectin, mannose binding 1	−1.554588852
	containing 3			like
ASNS	asparagine synthetase	6.59496878	ALDH3B1	aldehyde dehydrogenase 3	−1.554711558
	(glutamine-hydrolyzing)			family member B1
FANCD2	Fanconi anemia	6.353146826	GIP	gastric inhibitory	−1.555511104
	complementation group			polypeptide
	D2
GM156	predicted gene	6.293701542	COX7A2L	cytochrome c oxidase	−1.555572553
	156(Gm156)			subunit 7A2 like
ACAA1B	acetyl-Coenzyme A	6.293701542	APPL2	adaptor protein,	−1.555598704
	acyltransferase			phosphotyrosine interacting
	1B(Acaa1b)			with PH domain and
				leucine zipper 2
IGF2BP3	insulin like growth factor	6.186857067	KLHL22	kelch like family member	−1.555929583
	2 mRNA binding protein			22
	3
GZMG	granzyme G	6.093813673	OLFR272	olfactory receptor	−1.557482156
				272(Olfr272)
CIB2	calcium and integrin	6.007868243	LRRC29	leucine rich repeat	−1.559366716
	binding family member 2			containing 29
ATG9B	autophagy related 9B	5.986410935	A630095E13RIK	Description Not Found	−1.560714954
XKR8	XK related 8	5.977279924	OLFR194	olfactory receptor	−1.560714954
				194(Olfr194)
EPDR1	ependymin related 1	5.956521363	OLFR1013	olfactory receptor	−1.560714954
				1013(Olfr1013)
SPP1	secreted phosphoprotein 1	5.797769502	GLRA4	glycine receptor alpha 4	−1.560714954
RGS8	regulator of G-protein	5.753805672	P2RY6	pyrimidinergic receptor	−1.560714954
	signaling 8			P2Y6
MDFIC	MyoD family inhibitor	5.730639956	RASGEF1B	RasGEF domain family	−1.560714954
	domain containing			member 1B
DMWD	dystrophia myotonica,	5.687200695	IL22RA2	interleukin 22 receptor	−1.560714954
	WD repeat containing			subunit alpha 2
KIF11	kinesin family member 11	5.669593751	LIN7C	lin-7 homolog C, crumbs	−1.560714954
				cell polarity complex
				component
LGI2	leucine rich repeat LGI	5.655351829	DMRT1	doublesex and mab-3	−1.560714954
	family member 2			related transcription factor 1
ZFP41	ZFP41 zinc finger protein	5.615445725	TSPAN12	tetraspanin 12	−1.560714954
MLKL	mixed lineage kinase	5.605849867	PAK3	p21 (RAC1) activated	−1.560714954
	domain-like			kinase 3
CENPH	centromere protein H	5.563768278	COL2A1	collagen type II alpha 1	−1.560714954
				chain
SERPINF1	serpin family F member 1	5.5360529	SLC37A1	solute carrier family 37	−1.560714954
				member 1
UNC13B	unc-13 homolog B	5.503030646	PSD3	pleckstrin and Sec7 domain	−1.560714954
	(C. elegans)			containing 3
MLANA	melan-A	5.496654083	RDH5	retinol dehydrogenase 5	−1.560714954
PES1	pescadillo ribosomal	5.484376709	ABCA3	ATP binding cassette	−1.561263453
	biogenesis factor 1			subfamily A member 3
2900026A02RIK	Description Not Found	5.477353527	PLA2G4E	phospholipase A2 group	−1.561650879
				IVE
OSR2	odd-skipped related	5.416164165	DDIT3	DNA damage inducible	−1.563566526
	transciption factor 2			transcript 3
MPP6	membrane palmitoylated	5.408506442	ZFP12	zinc finger protein	−1.564308646
	protein 6			12(Zfp12)
HIST1H3C	histone cluster 1, H3c	5.397460726	PIGYL	phosphatidylinositol glycan	−1.564585219
				anchor biosynthesis, class
				Y-like(Pigyl)
PI4K2B	phosphatidylinositol 4-	5.375039431	CCDC97	coiled-coil domain	−1.565355117
	kinase type 2 beta			containing 97
SH3YL1	SH3 and SYLF domain	5.375039431	OLFR1112	olfactory receptor	−1.56589319
	containing 1			1112(Olfr1112)
RAD51	RAD51 recombinase	5.371558863	ACTN2	actinin alpha 2	−1.566931646
ZBTB32	zinc finger and BTB	5.318316841	POLG	polymerase (DNA) gamma,	−1.567265595
	domain containing 32			catalytic subunit
MSC	musculin	5.285402219	FBXO32	F-box protein 32	−1.567281905
TG	thyroglobulin	5.259272487	MRPL15	mitochondrial ribosomal	−1.570722678
				protein L15
RSPH1	radial spoke head 1	5.236492618	FCHSD2	FCH and double SH3	−1.571821211
	homolog			domains 2
ARL11	ADP ribosylation factor	5.21916852	RECQL	RecQ like helicase	−1.572889668
	like GTPase 11
NUDT11	nudix hydrolase 11	5.215290306	NDUFB11	NADH:ubiquinone	−1.572889668
				oxidoreductase subunit B11
APBB1	amyloid beta precursor	5.197708158	SOX8	SRY-box 8	−1.573341535
	protein binding family B
	member 1
SPINK2	serine peptidase inhibitor,	5.189824559	1700030J22RIK	Description Not Found	−1.57662394
	Kazal type 2
HMGN3	high mobility group	5.168922782	EMB	embigin	−1.577890585
	nucleosomal binding
	domain 3
FAM20B	family with sequence	5.12722055	CELSR1	cadherin EGF LAG seven-	−1.578201987
	similarity 20 member B			pass G-type receptor 1
CDC25C	cell division cycle 25C	5.11997861	COL1A2	collagen type I alpha 2	−1.580682782
				chain
FAM20A	family with sequence	5.108524457	1700080E11RIK	Description Not Found	−1.581046002
	similarity 20 member A
PPP1R16B	protein phosphatase 1	5.09592442	GALNT12	polypeptide N-	−1.581363645
	regulatory subunit 16B			acetylgalactosaminyl-
				transferase 12
SBNO1	strawberry notch homolog	5.050936965	RMND5B	required for meiotic nuclear	−1.583960816
	1 (Drosophila)			division 5 homolog B
ST14	suppression of	5.026800059	LRRC28	leucine rich repeat	−1.583987499
	tumorigenicity 14			containing 28
LRRC49	leucine rich repeat	5.024704311	OLFR622	olfactory receptor	−1.584962501
	containing 49			622(Olfr622)
TIAM1	T-cell lymphoma invasion	5.004501392	OLFR339	olfactory receptor	−1.584962501
	and metastasis 1			339(Olfr339)
APLF	aprataxin and PNKP like	4.951867504	NEIL3	nei like DNA glycosylase 3	−1.584962501
	factor
PGPEP1	pyroglutamyl-peptidase I	4.927185358	SNX24	sorting nexin 24	−1.584962501
ALCAM	activated leukocyte cell	4.909293086	SLC7A11	solute carrier family 7	−1.584962501
	adhesion molecule			member 11
B9D1	B9 domain containing 1	4.906890596	FOXJ1	forkhead box J1	−1.584962501
SCIN	scinderin	4.87282876	TAF3	TATA-box binding protein	−1.584962501
				associated factor 3
EXOC3L	exocyst complex	4.844013973	MATN2	matrilin 2	−1.584962501
	component 3-like(Exoc31)
SLC35D3	solute carrier family 35	4.840463234	ADHFE1	alcohol dehydrogenase, iron	−1.586280668
	member D3			containing 1
ALDOC	aldolase, fructose-	4.832890014	NANOS1	nanos C2HC-type zinc	−1.586914831
	bisphosphate C			finger 1
TMEM205	transmembrane protein	4.830182468	PPP2R5B	protein phosphatase 2	−1.586914831
	205			regulatory subunit B′beta
PLEKHA8	pleckstrin homology	4.820178962	USP22	ubiquitin specific peptidase	−1.588703598
	domain containing A8			22
SPC25	SPC25, NDC80	4.817623258	DAGLB	diacylglycerol lipase beta	−1.588817933
	kinetochore complex
	component
PCYT1B	phosphate	4.749534268	KCTD6	potassium channel	−1.589690033
	cytidylyltransferase 1,			tetramerization domain
	choline, beta			containing 6
SLC6A8	solute carrier family 6	4.749534268	ACTL6B	actin like 6B	−1.591351555
	member 8
TUBB6	tubulin beta 6 class V	4.749241128	FAM129B	family with sequence	−1.5915039
				similarity 129 member B
BSPRY	B-box and SPRY domain	4.711494907	APOE	apolipoprotein E	−1.591683393
	containing
ICA1	islet cell autoantigen 1	4.708739041	GPR18	G protein-coupled receptor	−1.592384168
				18
TNFSF13B	tumor necrosis factor	4.703211467	GSTP2	glutathione S-transferase, pi	−1.592559885
	superfamily member 13b			2(Gstp2)
GSTCD	glutathione S-transferase	4.700439718	GPR114	Description Not Found	−1.593829527
	C-terminal domain
	containing
CCNB1	cyclin B1	4.699051844	CHUK	conserved helix-loop-helix	−1.594823937
				ubiquitous kinase
4930539E08RIK	Description Not Found	4.693211287	TAS1R3	taste 1 receptor member 3	−1.596595048
SRXN1	sulfiredoxin 1	4.66106548	SLC7A7	solute carrier family 7	−1.596935142
				member 7
SERF1	small EDRK-rich factor	4.632268216	SPIB	Spi-B transcription factor	−1.597677703
	1(Serf1)
CCDC77	coiled-coil domain	4.62935662	POLR3A	polymerase (RNA) III	−1.599588488
	containing 77			subunit A
RHBDF1	rhomboid 5 homolog 1	4.626439137	OLFR952	olfactory receptor	−1.599679175
				952(Olfr952)
REEP3	receptor accessory protein	4.599912842	1700021F05RIK	Description Not Found	−1.601623253
	3
ITGA3	integrin subunit alpha 3	4.590961241	CCDC79	Description Not Found	−1.602195565
SCCPDH	saccharopine	4.590961241	FAM134B	family with sequence	−1.602715966
	dehydrogenase (putative)			similarity 134 member B
MYADM	myeloid associated	4.587964989	SEMA3B	semaphorin 3B	−1.602884409
	differentiation marker
FAM132A	family with sequence	4.581953751	FA2H	fatty acid 2-hydroxylase	−1.604494406
	similarity 132 member A
FOXRED2	FAD dependent	4.572889668	ULK1	unc-51 like autophagy	−1.604653903
	oxidoreductase domain			activating kinase 1
	containing 2
CENPK	centromere protein K	4.569855608	MCOLN1	mucolipin 1	−1.606242992
DCXR	dicarbonyl and L-xylulose	4.562242424	BMP5	bone morphogenetic protein	−1.606760033
	reductase			5
TSPAN6	tetraspanin 6	4.54225805	ANKRD50	ankyrin repeat domain 50	−1.607137028
UPP1	uridine phosphorylase 1	4.53838296	OLFR560	olfactory receptor	−1.608809243
				560(Olfr560)
DOK4	docking protein 4	4.520422249	OLFR366	olfactory receptor	−1.608809243
				366(Olfr366)
ELOVL4	ELOVL fatty acid	4.501439145	OLFR273	olfactory receptor	−1.608809243
	elongase 4			273(Olfr273)
KNDC1	kinase non-catalytic C-	4.499790117	FHIT	fragile histidine triad	−1.608809243
	lobe domain containing 1
KRT17	keratin 17	4.491853096	AQP11	aquaporin 11	−1.608809243
CHST2	carbohydrate	4.487315031	TMEM176A	transmembrane protein	−1.608809243
	sulfotransferase 2			176A
TPX2	TPX2, microtubule	4.475733431	ENAH	enabled homolog	−1.608809243
	nucleation factor			(Drosophila)
DUSP14	dual specificity	4.456149035	CLDN6	claudin 6	−1.608809243
	phosphatase 14
BGN	biglycan	4.449561375	SP1	Sp1 transcription factor	−1.608809243
FKBP9	FK506 binding protein 9	4.442943496	SP140	SP140 nuclear body protein	−1.608809243
CAPN5	calpain 5	4.385431037	RASGRP3	RAS guanyl releasing	−1.608809243
				protein 3
SLC1A4	solute carrier family 1	4.375039431	HIF3A	hypoxia inducible factor 3	−1.609422664
	member 4			alpha subunit
IDI2	isopentenyl-diphosphate	4.357552005	FYCO1	FYVE and coiled-coil	−1.611220598
	delta isomerase 2			domain containing 1
AKR1E1	aldo-keto reductase	4.346596388	FBXL12	F-box and leucine rich	−1.6119368
	family 1, member			repeat protein 12
	E1(Akrle1)
GNB4	G protein subunit beta 4	4.336088936	KLRA10	killer cell lectin-like	−1.618484777
				receptor subfamily A,
				member 10(Klra10)
CPNE2	copine 2	4.318640898	ABAT	4-aminobutyrate	−1.62058641
				aminotransferase
FAM132B	family with sequence	4.259272487	AMHR2	anti-Mullerian hormone	−1.62058641
	similarity 132, member			receptor type 2
	B(Fam132b)
SLC6A12	solute carrier family 6	4.259272487	DDX3Y	DEAD-box helicase 3,	−1.620649859
	member 12			Y-linked
CPLX1	complexin 1	4.240314329	LGALS4	galectin 4	−1.621550215
PDCD1	programmed cell death 1	4.221103725	SPG20	spastic paraplegia 20	−1.621653602
				(Troyer syndrome)
UTF1	undifferentiated	4.201633861	CTRL	chymotrypsin like	−1.62729369
	embryonic cell
	transcription factor 1
WDR60	WD repeat domain 60	4.14974712	GREM2	gremlin 2, DAN family	−1.627927342
				BMP antagonist
EGFL7	EGF like domain multiple	4.137503524	ZMAT3	zinc finger matrin-type 3	−1.628362075
	7
ASPM	abnormal spindle	4.133399125	AP4M1	adaptor related protein	−1.628898157
	microtubule assembly			complex 4 mu 1 subunit
TMBIM1	transmembrane BAX	4.104628811	NT5C2	5′-nucleotidase, cytosolic II	−1.63059747
	inhibitor motif containing
	1
KNTC1	kinetochore associated 1	4.093952772	TMIE	transmembrane inner ear	−1.631606148
1700019D03RIK	Description Not Found	4.087462841	OLFR556	olfactory receptor	−1.632268216
				556(Olfr556)
TM4SF5	transmembrane 4 L six	4.087462841	OLFR463	olfactory receptor	−1.632268216
	family member 5			463(Olfr463)
BIRC5	baculoviral IAP repeat	4.027905997	CTS3	cathepsin 3(Cts3)	−1.632268216
	containing 5
SYNGR3	synaptogyrin 3	4.022367813	OAS1B	2′-5′ oligoadenylate	1.632268216
				synthetase 1B(Oas1b)
PLSCR4	phospholipid scramblase	4	KCNF1	potassium voltage-gated	−1.632268216
	4			channel modifier subfamily
				F member 1
KIF15	kinesin family member 15	3.962376898	GCGR	glucagon receptor	−1.632268216
TICAM2	toll like receptor adaptor	3.958842675	NR1I3	nuclear receptor subfamily	−1.632268216
	molecule 2			1 group I member 3
CENPM	centromere protein M	3.957682486	FSTL1	follistatin like 1	−1.632268216
KIF4	kinesin family member	3.956097191	ASAP3	ArfGAP with SH3 domain,	−1.632268216
	4(Kif4)			ankyrin repeat and PH
				domain 3
E2F2	E2F transcription factor 2	3.93191939	IHH	indian hedgehog	−1.632268216
MSN	moesin	3.930737338	SEMA3A	semaphorin 3A	−1.632268216
PTPRA	protein tyrosine	3.928989949	RAMP1	receptor activity modifying	−1.632575446
	phosphatase, receptor			protein 1
	type A
BC026585	cDNA sequence	3.882643049	NFKBID	NFKB inhibitor delta	−1.633158642
	BC026585(BC026585)
IQGAP3	IQ motif containing	3.867896464	KLK15	kallikrein related peptidase	−1.633773522
	GTPase activating protein			15
	3
CD244	CD244 molecule	3.867896464	CYP1B1	cytochrome P450 family 1	−1.634684534
				subfamily B member 1
HIST1H3G	histone cluster 1, H3g	3.837943242	DNAJA1	DnaJ heat shock protein	−1.635111002
				family (Hsp40) member A1
SLC15A3	solute carrier family 15	3.832890014	SDSL	serine dehydratase like	−1.635807742
	member 3
GIPC2	GIPC PDZ domain	3.817623258	CCDC137	coiled-coil domain	−1.636838653
	containing family			containing 137
	member 2
UTP15	UTP15, small subunit	3.812498225	ZSWIM4	zinc finger SWIM-type	−1.638152805
	processome component			containing 4
PDIA6	protein disulfide	3.812498225	BBC3	BCL2 binding component 3	−1.638336813
	isomerase family A
	member 6
JDP2	Jun dimerization protein 2	3.807354922	SOCS3	suppressor of cytokine	−1.638876738
				signaling 3
MESDC1	mesoderm development	3.806723946	2900092C05RIK	Description Not Found	−1.639157339
	candidate 1
GAS2	growth arrest specific 2	3.802193217	CSRNP2	cysteine and serine rich	−1.639383642
				nuclear protein 2
IL4I1	interleukin 4 induced 1	3.802193217	BLOC1S3	biogenesis of lysosomal	−1.639585785
				organelles complex 1
				subunit 3
PHF19	PHD finger protein 19	3.802193217	ELL	elongation factor for RNA	−1.64021945
				polymerase II
CKAP2L	cytoskeleton associated	3.797012978	GTF3C4	general transcription factor	−1.640658029
	protein 2 like			IIIC subunit 4
GSTT1	glutathione S-transferase	3.791814071	MYLPF	myosin light chain,	−1.640660074
	theta 1			phosphorylatable, fast
				skeletal muscle
ADAM3	a disintegrin and	3.781359714	CYP2A12	cytochrome P450, family 2,	−1.641947141
	metallopeptidase domain			subfamily a, polypeptide
	3 (cyritestin)(Adam3)			12(Cyp2a12)
SLAMF7	SLAM family member 7	3.781359714	RNF139	ring finger protein 139	−1.642010395
MCPT8	mast cell protease	3.770829046	C78339	Description Not Found	−1.643573868
	8(Mcpt8)
DGKG	diacylglycerol kinase	3.765534746	EDEM1	ER degradation enhancing	−1.64385619
	gamma			alpha-mannosidase like
				protein 1
NLGN2	neuroligin 2	3.716990894	UBE2E1	ubiquitin conjugating	−1.645859791
				enzyme E2 E1
SERPINE2	serpin family E member 2	3.694880193	PALMD	palmdelphin	−1.646322067
IL10	interleukin 10	3.689299161	AMICA1	adhesion molecule, interacts	−1.647478619
				with CXADR antigen
				1(Amica1)
SLC6A13	solute carrier family 6	3.689299161	KLHL11	kelch like family member	−1.650611828
	member 13			11
STAU2	staufen double-stranded	3.666756592	IFNGR2	interferon gamma receptor	−1.651050175
	RNA binding protein 2			2 (interferon gamma
				transducer 1)
ARHGDIG	Rho GDP dissociation	3.655351829	DECR1	2,4-dienoyl-CoA reductase	−1.651406438
	inhibitor gamma			1, mitochondrial
TK1	thymidine kinase 1	3.637477097	SAMD3	sterile alpha motif domain	−1.653213853
				containing 3
PCYT1A	phosphate	3.617728231	9130409123RIK	Description Not Found	−1.655351829
	cytidylyltransferase 1,
	choline, alpha
LAMB3	laminin subunit beta 3	3.608809243	2010107G12RIK	Description Not Found	−1.655351829
UBE2N	ubiquitin conjugating	3.590961241	ZFP354B	zinc finger protein	−1.655351829
	enzyme E2 N			354B(Zfp354b)
STARD8	StAR related lipid transfer	3.578938713	TAS2R143	taste receptor, type 2,	−1.655351829
	domain containing 8			member 143(Tas2r143)
PRR5	proline rich 5	3.578938713	OLFR65	olfactory receptor	−1.655351829
				65(Olfr65)
BDH2	3-hydroxybutyrate	3.554588852	NRP	neural regeneration	−1.655351829
	dehydrogenase, type 2			protein(Nrp)
FAM124B	family with sequence	3.548436625	DOK3	docking protein 3	−1.655351829
	similarity 124 member B
MGAT3	mannosyl (beta-1,4-)-	3.548436625	HIGD1A	HIG1 hypoxia inducible	−1.655351829
	glycoprotein beta-1,4-N-			domain family member 1A
	acetylglucosaminyl-
	transferase
LAG3	lymphocyte activating 3	3.542346309	CCDC13	coiled-coil domain	−1.655351829
				containing 13
GDPD5	glycerophosphodiester	3.538812733	ANGPTL2	angiopoietin like 2	−1.655351829
	phosphodiesterase domain
	containing 5
RNF168	ring finger protein 168	3.5360529	CNGB3	cyclic nucleotide gated	−1.655351829
				channel beta 3
LYPLA1	lysophospholipase I	3.529820947	HOXD4	homeobox D4	−1.655351829
TUBGCP4	tubulin gamma complex	3.523561956	KIFC3	kinesin family member C3	−1.655351829
	associated protein 4
PYGL	phosphorylase, glycogen,	3.51412226	AMACR	alpha-methylacyl-CoA	−1.655351829
	liver			racemase
CCL3	C-C motif chemokine	3.510281539	2310014L17RIK	Description Not Found	−1.655707015
	ligand 3
BCAT1	branched chain amino	3.508163667	BRAP	BRCA1 associated protein	−1.657090723
	acid transaminase 1
ATP6V0A1	ATPase H+ transporting	3.501439145	SLC39A1	solute carrier family 39	−1.657631089
	V0 subunit a1			member 1
EIF4E	eukaryotic translation	3.498250868	OLFR419	olfactory receptor	−1.65813796
	initiation factor 4E			419(Olfr419)
HIST1H4B	histone cluster 1, H4b	3.491853096	NHP2L1	NHP2 non-histone	−1.658298045
				chromosome protein 2-like
				1 (S. cerevisiae)(Nhp211)
LAD1	ladinin 1	3.49085426	STOML2	stomatin like 2	−1.659357735
ITGAV	integrin subunit alpha V	3.485426827	SAMM50	SAMM50 sorting and	−1.662400762
				assembly machinery
				component
MRPL47	mitochondrial ribosomal	3.485426827	CCDC91	coiled-coil domain	−1.6632299
	protein L47			containing 91
CAMK2N1	calcium/calmodulin	3.484460783	ATF3	activating transcription	−1.663483642
	dependent protein kinase			factor 3
	II inhibitor 1
UEVLD	UEV and lactate/malate	3.465974465	RAI1	retinoic acid induced 1	−1.663885989
	dehyrogenase domains
SFXN4	sideroflexin 4	3.462706751	RRAS2	related RAS viral (r-ras)	−1.665826896
				oncogene homolog 2
2810417H13RIK	Description Not Found	3.461634298	UROS	uroporphyrinogen III	−1.665923156
				synthase
RAD51AP1	RAD51 associated protein	3.459431619	SCOC	short coiled-coil protein	−1.666272349
FUT4	fucosyltransferase 4	3.452858965	DUSP10	dual specificity phosphatase	−1.666485948
				10
CTNNBIP1	catenin beta interacting	3.44625623	CYB5R4	cytochrome b5 reductase 4	−1.666756592
	protein 1
ZBTB8OS	zinc finger and BTB	3.426264755	9930104L06RIK	Description Not Found	−1.667150978
	domain containing 8
	opposite strand
LYSMD4	LysM domain containing	3.42259008	ZFP579	zinc finger protein	−1.669023741
	4			579(Zfp579)
DIAP3	Description Not Found	3.40599236	RGP1	RGP1 homolog, RAB6A	−1.669393721
				GEF complex partner 1
PTGIS	prostaglandin I2	3.399171094	PIAS2	protein inhibitor of	−1.672137196
	(prostacyclin) synthase			activated STAT 2
MOAP1	modulator of apoptosis 1	3.392317423	METTL1	methyltransferase like 1	−1.672425342
SLC27A3	solute carrier family 27	3.392317423	POU5F1	POU class 5 homeobox 1	−1.673854965
	member 3
MRPL39	mitochondrial ribosomal	3.371492175	SERPINB6C	serine (or cysteine)	−1.673932658
	protein L39			peptidase inhibitor, clade B,
				member 6c(Serpinb6c)
WTAP	Wilms tumor 1 associated	3.364572432	STXBP4	syntaxin binding protein 4	−1.675552278
	protein
RAD54L	RAD54-like	3.356589854	RIMS3	regulating synaptic	−1.676120648
	(S. cerevisiae)			membrane exocytosis 3
CETN4	centrin 4(Cetn4)	3.336283388	XYLT2	xylosyltransferase 2	−1.676976793
CEP55	centrosomal protein 55	3.329123596	TAS2R107	taste receptor, type 2,	−1.678071905
				member 107(Tas2r107)
CYP4F39	cytochrome P450, family	3.321928095	SKP1A	S-phase kinase-associated	−1.678071905
	4, subfamily f,			protein 1A(Skp1a)
	polypeptide 39(Cyp4f39)
PTPN5	protein tyrosine	3.314696526	OLFR165	olfactory receptor	−1.678071905
	phosphatase, non-receptor			165(Olfr165)
	type 5
TUBE1	tubulin epsilon 1	3.292781749	OLFR111	olfactory receptor	−1.678071905
				111(Olfr111)
TCAM1	testicular cell adhesion	3.285402219	CYP4A12A	cytochrome P450, family 4,	−1.678071905
	molecule 1(Tcam1)			subfamily a, polypeptide
				12a(Cyp4a12a)
MID1IP1	MID1 interacting protein	3.263034406	TLR6	toll like receptor 6	−1.678071905
	1
ABHD6	abhydrolase domain	3.260682276	KCNS3	potassium voltage-gated	−1.678071905
	containing 6			channel modifier subfamily
				S member 3
ZCCHC4	zinc finger CCHC-type	3.255500733	FARSA	phenylalanyl-tRNA	−1.678071905
	containing 4			synthetase alpha subunit
MGST3	microsomal glutathione	3.25353624	SLC2A4	solute carrier family 2	−1.678071905
	S-transferase 3			member 4
BC022687	cDNA sequence	3.247927513	GDPD4	glycerophosphodiester	−1.678071905
	BC022687(BC022687)			phosphodiesterase domain
				containing 4
ACSF3	acyl-CoA synthetase	3.24325855	RCAN1	regulator of calcineurin 1	−1.678071905
	family member 3
ADAM8	ADAM metallopeptidase	3.240314329	CCDC82	coiled-coil domain	−1.678071905
	domain 8			containing 82
SGCB	sarcoglycan beta	3.237034772	CDYL2	chromodomain protein, Y-	−1.678071905
				like 2
SOCS2	suppressor of cytokine	3.232660757	MBD5	methyl-CpG binding	−1.678071905
	signaling 2			domain protein 5
HIST1H2AG	histone cluster 1, H2ag	3.223000387	ACSL1	acyl-CoA synthetase long-	−1.678071905
				chain family member 1
CRMP1	collapsin response	3.201633861	OTUB2	OTU deubiquitinase,	−1.678071905
	mediator protein 1			ubiquitin aldehyde binding
				2
RPS19BP1	ribosomal protein S19	3.201633861	NPPA	natriuretic peptide A	−1.678071905
	binding protein 1
1700020L24RIK	Description Not Found	3.193771743	LY96	lymphocyte antigen 96	−1.679594789
CCDC109B	coiled-coil domain	3.181276986	OLFR351	olfactory receptor	−1.680730557
	containing			351(Olfr351)
	109B(Ccdc109b)
UBE2C	ubiquitin conjugating	3.177917792	TGFBR1	transforming growth factor	−1.681068055
	enzyme E2 C			beta receptor 1
SLC25A16	solute carrier family 25	3.177917792	KLHL6	kelch like family member 6	−1.683531539
	member 16
ARHGAP19	Rho GTPase activating	3.167705534	ELMO2	engulfment and cell motility	−1.683696454
	protein 19			2
TYMS-PS	thymidylate synthase,	3.166362514	POLR3D	polymerase (RNA) III	−1.683942043
	pseudogene(Tyms-ps)			subunit D
IL3RA	interleukin 3 receptor	3.145793675	RALGPS1	Ral GEF with PH domain	−1.685524532
	subunit alpha			and SH3 binding motif 1
TMEM53	transmembrane protein 53	3.141596278	ATL2	atlastin GTPase 2	−1.685731341
THNSL2	threonine synthase like 2	3.141596278	RAD52	RAD52 homolog, DNA	−1.689523672
				repair protein
2810408M09RIK	Description Not Found	3.129283017	GPC1	glypican 1	−1.689646894
ADAMDEC1	ADAM like decysin 1	3.121015401	ARHGAP15	Rho GTPase activating	−1.690804518
				protein 15
ASB2	ankyrin repeat and SOCS	3.118792343	GPRC5B	G protein-coupled receptor	−1.693999744
	box containing 2			class C group 5 member B
SLC37A4	solute carrier family 37	3.112700133	ZBTB1	zinc finger and BTB	−1.694046727
	member 4			domain containing 1
NICN1	nicolin 1	3.108478268	NARFL	nuclear prelamin A	−1.694880193
				recognition factor like
2310067B10RIK	Description Not Found	3.087462841	SLC26A6	solute carrier family 26	−1.695252347
				member 6
PIGL	phosphatidylinositol	3.077239787	MAPKBP1	mitogen-activated protein	−1.695908738
	glycan anchor			kinase binding protein 1
	biosynthesis class L
1190005I06RIK	Description Not Found	3.070389328	RAB6B	RAB6B, member RAS	−1.697541036
				oncogene family
DHFR	dihydrofolate reductase	3.070389328	ARL2	ADP ribosylation factor like	−1.700349879
				GTPase 2
FABP5	fatty acid binding protein	3.06608919	ZFP646	zinc finger protein	−1.700439718
	5			646(Zfp646)
POMT2	protein O-	3.055794286	SELENBP2	selenium binding protein	−1.700439718
	mannosyltransferase 2			2(Selenbp2)
F2RL2	coagulation factor II	3.053111336	ACOT3	acyl-CoA thioesterase	−1.700439718
	thrombin receptor like 2			3(Acot3)
GRB7	growth factor receptor	3.048852907	REG3G	regenerating family	−1.700439718
	bound protein 7			member 3 gamma
SNX21	sorting nexin family	3.044394119	GAB1	GRB2 associated binding	−1.700439718
	member 21			protein 1
SUFU	SUFU negative regulator	3.044394119	LCN10	lipocalin 10	−1.700439718
	of hedgehog signaling
RFC3	replication factor C	3.029288361	MTHFD2L	methylenetetrahydrofolate	−1.700439718
	subunit 3			dehydrogenase (NADP+
				dependent) 2-like
CLDN12	claudin 12	3.017921908	PTCD3	pentatricopeptide repeat	−1.700439718
				domain 3
C1QTNF6	C1q and tumor necrosis	3.014450679	NTHL1	nth-like DNA glycosylase 1	−1.700439718
	factor related protein 6
PLCXD1	phosphatidylinositol	2.99095486	NUDT3	nudix hydrolase 3	−1.700439718
	specific phospholipase C
	X domain containing 1
SULT4A1	sulfotransferase family	2.99095486	CLEC12A	C-type lectin domain family	−1.700439718
	4A member 1			12 member A
CTTNBP2NL	CTTNBP2 N-terminal	2.981852653	ZBTB3	zinc finger and BTB	−1.700439718
	like			domain containing 3
SNX5	sorting nexin 5	2.977279924	AMT	aminomethyltransferase	−1.700439718
HPS5	HPS5, biogenesis of	2.972692654	ZDHHC14	zinc finger DHHC-type	−1.700439718
	lysosomal organelles			containing 14
	complex 2 subunit 2
WISP1	WNT1 inducible	2.968090752	NKX2-5	NK2 homeobox 5	−1.700491519
	signaling pathway protein
	1
PTPN9	protein tyrosine	2.963474124	FOXA3	forkhead box A3	−1.702815694
	phosphatase, non-receptor
	type 9
USP37	ubiquitin specific	2.95419631	WASF1	WAS protein family	−1.706412734
	peptidase 37			member 1
SH3BGRL	SH3 domain binding	2.935459748	OLFR690	olfactory receptor	−1.707192688
	glutamate rich protein like			690(Olfr690)
NCALD	neurocalcin delta	2.935459748	ENTPD5	ectonucleoside triphosphate	−1.707764551
				diphosphohydrolase 5
CDC42EP4	CDC42 effector protein 4	2.916476644	PCDHGA4	protocadherin gamma	−1.709042655
				subfamily A, 4
IGFBP7	insulin like growth factor	2.910553168	TCF12	transcription factor 12	−1.710308209
	binding protein 7
ABHD4	abhydrolase domain	2.908868748	MTRR	5-methyltetrahydrofolate-	−1.711494907
	containing 4			homocysteine
				methyltransferase reductase
CSF1	colony stimulating factor	2.906890596	CDKN1C	cyclin dependent kinase	−1.711690028
	1			inhibitor 1C
COX7A1	cytochrome c oxidase	2.897240426	PRICKLE1	prickle planar cell polarity	−1.713410822
	subunit 7A1			protein 1
TTYH2	tweety family member 2	2.892391026	ATXN7L1	ataxin 7 like 1	−1.71669984
ACO1	aconitase 1	2.87774425	SLCO3A1	solute carrier organic anion	−1.719235762
				transporter family member
				3A1
BARD1	BRCA1 associated RING	2.867896464	TMEM110	transmembrane protein 110	−1.720046704
	domain 1
GPN1	GPN-loop GTPase 1	2.867896464	KLF2	Kruppel like factor 2	−1.721374729
PTTG1	pituitary tumor-	2.867896464	FGG	fibrinogen gamma chain	−1.722466024
	transforming 1
2810408A11RIK	Description Not Found	2.857980995	ASAH2	N-acylsphingosine	−1.722466024
				amidohydrolase 2
BBX	BBX, HMG-box	2.857980995	LAP3	leucine aminopeptidase 3	−1.722466024
	containing
LTBP3	latent transforming	2.837943242	STAB2	stabilin 2	−1.722466024
	growth factor beta
	binding protein 3
ACTG2	actin, gamma 2, smooth	2.827819025	IL22RA1	interleukin 22 receptor	−1.722466024
	muscle, enteric			subunit alpha 1
ISLR	immunoglobulin	2.827819025	SERINC4	serine incorporator 4	−1.722466024
	superfamily containing
	leucine rich repeat
NARS2	asparaginyl-tRNA	2.823087408	GPR180	G protein-coupled receptor	−1.722466024
	synthetase 2,			180
	mitochondrial (putative)
ICAM4	intercellular adhesion	2.81452379	TIPARP	TCDD inducible	−1.722466024
	molecule 4 (Landsteiner-			poly(ADP-ribose)
	Wiener blood group)			polymerase
ABCB8	ATP binding cassette	2.813358991	USP11	ubiquitin specific peptidase	−1.722466024
	subfamily B member 8			11
IDI1	isopentenyl-diphosphate	2.811782922	TRIP6	thyroid hormone receptor	−1.722466024
	delta isomerase 1			interactor 6
GLS2	glutaminase 2	2.797012978	KCNH2	potassium voltage-gated	−1.722466024
				channel subfamily H
				member 2
HDAC8	histone deacetylase 8	2.797012978	ESR2	estrogen receptor 2	−1.722466024
BRIP1	BRCA1 interacting	2.797012978	FGF13	fibroblast growth factor 13	−1.722639247
	protein C-terminal
	helicase 1
USP6NL	USP6 N-terminal like	2.794415866	KBTBD7	kelch repeat and BTB	−1.724237927
				domain containing 7
TLCD2	TLC domain containing 2	2.791814071	UHRF1BP1	UHRF1 binding protein 1	−1.725835292
GUCY1A3	guanylate cyclase 1	2.787502763	BCAM	basal cell adhesion	−1.726509704
	soluble subunit alpha			molecule (Lutheran blood
				group)
OCA2	OCA2 melanosomal	2.786596362	ELOVL6	ELOVL fatty acid elongase	−1.726565554
	transmembrane protein			6
VAT1	vesicle amine transport 1	2.772502543	PPM1K	protein phosphatase,	−1.726643643
				Mg2+/Mn2+ dependent 1K
HIST1H2AB	histone cluster 1, H2ab	2.767914142	SPATA6	spermatogenesis associated	−1.727673077
				6
PIGC	phosphatidylinositol	2.760220946	NAV1	neuron navigator 1	−1.727920455
	glycan anchor
	biosynthesis class C
PARG	poly(ADP-ribose)	2.756558208	ANK3	ankyrin 3, node of Ranvier	−1.727920455
	glycohydrolase			(ankyrin G)
ESCO2	establishment of sister	2.754887502	KCNAB1	potassium voltage-gated	−1.727920455
	chromatid cohesion N-			channel subfamily A
	acetyltransferase 2			member regulatory beta
				subunit 1
HIPK2	homeodomain interacting	2.754887502	CYP27A1	cytochrome P450 family 27	−1.727920455
	protein kinase 2			subfamily A member 1
IMPA1	inositol monophosphatase	2.752945007	MAP4K4	mitogen-activated protein	−1.729756006
	1			kinase kinase kinase kinase
				4
COQ4	coenzyme Q4	2.744161096	ANKRD7	ankyrin repeat domain 7	−1.730646873
ZBTB7A	zinc finger and BTB	2.744161096	IFRD1	interferon related	−1.732447522
	domain containing 7A			developmental regulator 1
GAMT	guanidinoacetate N-	2.744161096	ALX3	ALX homeobox 3	−1.733354341
	methyltransferase
BIK	BCL2 interacting killer	2.744161096	SNURF	SNRPN upstream reading	−1.733354341
				frame
PMS1	PMS1 homolog 1,	2.733354341	AMZ2	archaelysin family	−1.73350053
	mismatch repair system			metallopeptidase 2
	component
HAVCR2	hepatitis A virus cellular	2.729769667	ROGDI	rogdi homolog	−1.73419198
	receptor 2
FHL2	four and a half LIM	2.727254747	DAGLA	diacylglycerol lipase alpha	−1.734471203
	domains 2
CHAF1A	chromatin assembly	2.725248783	4930432K21RIK	Description Not Found	−1.736243886
	factor 1 subunit A
2810004N23RIK	Description Not Found	2.722466024	KRCC1	lysine rich coiled-coil 1	−1.73665741
TBC1D14	TBC1 domain family	2.722466024	OLFR1331	olfactory receptor	−1.736826447
	member 14			1331(Olfr1331)
EHD2	EH domain containing 2	2.711494907	SLC25A25	solute carrier family 25	−1.73690749
				member 25
APH1A	aph-1 homolog A,	2.705977902	CXCR4	C-X-C motif chemokine	−1.737779353
	gamma-secretase subunit			receptor 4
TMEM2	transmembrane protein 2	2.703211467	EPB4.1L3	Description Not Found	−1.738767837
LCAT	lecithin-cholesterol	2.700439718	CEP164	centrosomal protein 164	−1.738795736
	acyltransferase
FBXO15	F-box protein 15	2.689299161	AGER	advanced glycosylation end	−1.73961488
				product-specific receptor
ADAP1	ArfGAP with dual PH	2.674391397	B3GALT5	beta-1,3-	−1.740215306
	domains 1			galactosyltransferase 5
PPAPDC1B	Description Not Found	2.666756592	OLFR450	olfactory receptor	−1.74228265
				450(Olfr450)
CD48	CD48 molecule	2.666756592	ZFP780B	zinc finger protein	−1.744161096
				780B(Zfp780b)
CAMK4	calcium/calmodulin	2.655351829	OLFR485	olfactory receptor	−1.744161096
	dependent protein kinase			485(Olfr485)
	IV
SAC3D1	SAC3 domain containing	2.64385619	OLFR47	olfactory receptor	−1.744161096
	1			47(Olfr47)
ECHDC2	enoyl-CoA hydratase	2.640725033	CYP4F18	cytochrome P450, family 4,	−1.744161096
	domain containing 2			subfamily f, polypeptide
				18(Cyp4f18)
INCENP	inner centromere protein	2.638460117	PLOD2	procollagen-lysine,2-	−1.744161096
				oxoglutarate 5-dioxygenase
				2
INTS9	integrator complex	2.634920268	OSBPL1A	oxysterol binding protein	−1.744161096
	subunit 9			like 1A
KLRA17	killer cell lectin-like	2.632268216	CHRNA5	cholinergic receptor	−1.744161096
	receptor, subfamily A,			nicotinic alpha 5 subunit
	member 17(Klra17)
MAN2B2	mannosidase alpha class	2.632268216	TSSK4	testis specific serine kinase	−1.744161096
	2B member 2			4
DOLK	dolichol kinase	2.632268216	ALKBH8	alkB homolog 8, tRNA	−1.744161096
				methyltransferase
SAP30BP	SAP30 binding protein	2.632268216	GPX2	glutathione peroxidase 2	−1.744161096
RTN1	reticulon 1	2.627898616	ATG4D	autophagy related 4D	−1.744161096
				cysteine peptidase
ADAM15	ADAM metallopeptidase	2.626439137	SCRN3	secernin 3	−1.744161096
	domain 15
STAG3	stromal antigen 3	2.62058641	NOTCH3	notch 3	−1.744161096
NUDT2	nudix hydrolase 2	2.610775705	OLFR113	olfactory receptor	−1.744357436
				113(Olfr113)
GLT8D2	glycosyltransferase 8	2.609988757	CD28	CD28 molecule	−1.744605653
	domain containing 2
CAPSL	calcyphosine like	2.608809243	SAG	S-antigen; retina and pineal	−1.745224161
				gland (arrestin)
CALR	calreticulin	2.608809243	AGTRAP	angiotensin II receptor	−1.749107415
				associated protein
CRYBG3	crystallin beta-gamma	2.605393551	BLK	BLK proto-oncogene, Src	−1.749534268
	domain containing 3			family tyrosine kinase
DIXDC1	DIX domain containing 1	2.596940379	MGAT5	mannosyl (alpha-1,6-)-	−1.749534268
				glycoprotein beta-1,6-N-
				acetyl-
				glucosaminyltransferase
TACSTD2	tumor-associated calcium	2.593926161	RNF2	ring finger protein 2	−1.750890228
	signal transducer 2
TRP53RK	Description Not Found	2.588066506	COL14A1	collagen type XIV alpha 1	−1.752093722
				chain
PDCD1LG2	programmed cell death 1	2.584962501	PLEKHG3	pleckstrin homology and	−1.752109698
	ligand 2			RhoGEF domain containing
				G3
SEC23IP	SEC23 interacting protein	2.584962501	ARHGEF18	Rho/Rac guanine nucleotide	−1.754100479
				exchange factor 18
ORM1	orosomucoid 1	2.584962501	LEF1	lymphoid enhancer binding	−1.754887502
				factor 1
ZFP322A	zinc finger protein	2.575024164	COMMD9	COMM domain containing	−1.75490709
	322A(Zfp322a)			9
4931406C07RIK	Description Not Found	2.560714954	SLC20A1	solute carrier family 20	−1.758637847
				member 1
ZFP382	zinc finger protein	2.560714954	ACTR5	ARP5 actin-related protein	−1.759244091
	382(Zfp382)			5 homolog
CLIP2	CAP-Gly domain	2.560714954	UBQLN3	ubiquilin 3	−1.765109548
	containing linker protein
	2
TNFAIP8L1	TNF alpha induced	2.560714954	ZFP770	zinc finger protein	−1.765534746
	protein 8 like 1			770(Zfp770)
NRCAM	neuronal cell adhesion	2.560714954	PCDHB18	protocadherin beta	−1.765534746
	molecule			18(Pcdhb18)
HPSE	heparanase	2.560714954	OLFR700	olfactory receptor	−1.765534746
				700(Olfr700)
RTKN	rhotekin	2.558985655	FOXP4	forkhead box P4	−1.765534746
DLGAP5	DLG associated protein 5	2.550125328	CDC34	cell division cycle 34	−1.765534746
ENPP2	ectonucleotide	2.548436625	HIST1H1E	histone cluster 1, H1e	−1.765534746
	pyrophosphatase/
	phosphodiesterase 2
GCNT1	glucosaminyl (N-acetyl)	2.548436625	G6PC2	glucose-6-phosphatase	−1.765534746
	transferase 1, core 2			catalytic subunit 2
SASS6	SAS-6 centriolar	2.548436625	FUT1	fucosyltransferase 1	−1.765534746
	assembly protein			(H blood group)
AMIGO3	adhesion molecule with	2.548436625	ZFP69	ZFP69 zinc finger protein	−1.765534746
	Ig-like domain 3
APH1B	aph-1 homolog B,	2.548436625	WBSCR27	Williams Beuren syndrome	−1.765534746
	gamma-secretase subunit			chromosome region 27
ABCC5	ATP binding cassette	2.547846505	METTL8	methyltransferase like 8	−1.766880868
	subfamily C member 5
YIPF6	Yip1 domain family	2.543805176	TMEM170	transmembrane protein	−1.767462508
	member 6			170(Tmem170)
FFAR1	free fatty acid receptor 1	2.5360529	TRP53INP1	transformation related	−1.767518474
				protein 53 inducible nuclear
				protein 1(Trp53inp1)
TSSK6	testis specific serine	2.5360529	H2-Q5	histocompatibility 2, Q	−1.769676967
	kinase 6			region locus 5(H2-Q5)
ETV6	ETS variant 6	2.535385323	ADCK1	aarF domain containing	−1.770033995
				kinase 1
PTGDS	prostaglandin D2	2.529838423	IMPAD1	inositol monophosphatase	−1.771434505
	synthase			domain containing 1
SH3D19	SH3 domain containing	2.523561956	E4F1	E4F transcription factor 1	−1.772427885
	19
KIF5C	kinesin family member	2.518298014	ZFYVE20	Description Not Found	−1.772942676
	5C
PTGER2	prostaglandin E receptor 2	2.517275693	PNPLA6	patatin like phospholipase	−1.775074114
				domain containing 6
INSR	insulin receptor	2.510961919	TRIB3	tribbles pseudokinase 3	−1.775215233
MAPK6	mitogen-activated protein	2.504620392	GM614	predicted gene 614(Gm614)	−1.776103988
	kinase 6
OXSR1	oxidative stress	2.502211192	D5ERTD579E	DNA segment, Chr 5,	−1.776306798
	responsive 1			ERATO Doi 579,
				expressed(D5Ertd579e)
EZH2	enhancer of zeste 2	2.501439145	SCAND1	SCAN domain containing 1	−1.77785827
	polycomb repressive
	complex 2 subunit
BNIP1	BCL2 interacting protein	2.498250868	ASB13	ankyrin repeat and SOCS	−1.782205107
	1			box containing 13
LPCAT4	lysophosphatidylcholine	2.495285165	ARHGEF4	Rho guanine nucleotide	−1.784072601
	acyltransferase 4			exchange factor 4
PPAP2C	Description Not Found	2.485426827	H1FNT	H1 histone family member	−1.78485543
				N, testis specific
IFNA12	interferon alpha	2.485426827	BLOC1S1	biogenesis of lysosomal	−1.784911393
	12(Ifna12)			organelles complex 1
				subunit 1
DCLK1	doublecortin like kinase 1	2.485426827	ZFYVE27	zinc finger FYVE-type	−1.7851013
				containing 27
MX1	MX dynamin like GTPase	2.485426827	RHOX4B	reproductive homeobox	−1.786596362
	1			4B(Rhox4b)
SMTN	smoothelin	2.485426827	OLFR1134	olfactory receptor	−1.786596362
				1134(Olfr1134)
PLA2G15	phospholipase A2 group	2.48194563	CAR11	carbonic anhydrase	−1.786596362
	XV			11(Car11)
OLFR192	olfactory receptor	2.472487771	LRRIQ4	leucine rich repeats and IQ	−1.786596362
	192(Olfr192)			motif containing 4
ITGB5	integrin subunit beta 5	2.472487771	CASP12	caspase 12	−1.786596362
				(gene/pseudogene)
RAPSN	receptor associated	2.465974465	ODF3L1	outer dense fiber of sperm	−1.786596362
	protein of the synapse			tails 3 like 1
SNX3	sorting nexin 3	2.459431619	CCDC3	coiled-coil domain	−1.786596362
				containing 3
FERMT2	fermitin family member 2	2.459431619	SSPN	sarcospan	−1.786596362
CCR5	C-C motif chemokine	2.444410478	KLK1	kallikrein 1	−1.786596362
	receptor 5
	(gene/pseudogene)
UPK1A	uroplakin 1A	2.439623138	SENP7	SUMO1/sentrin specific	−1.786897131
				peptidase 7
BCL2L2	BCL2 like 2	2.43629512	CAML	calcium modulating	−1.787735284
				ligand(Caml)
2610002M06RIK	Description Not Found	2.432959407	YEATS2	YEATS domain containing	−1.788627083
				2
CENPN	centromere protein N	2.432959407	SERPINF2	serpin family F member 2	−1.791814071
HBEGF	heparin binding EGF like	2.43096254	KCNMB1	potassium calcium-	−1.792597191
	growth factor			activated channel subfamily
				M regulatory beta subunit 1
TYMS	thymidylate synthetase	2.427103287	FCHO2	FCH domain only 2	−1.792666489
MGA	MGA, MAX dimerization	2.426939834	BBS9	Bardet-Biedl syndrome 9	−1.792734984
	protein
RAI14	retinoic acid induced 14	2.426264755	OLFR323	olfactory receptor	−1.794609131
				323(Olfr323)
CFI	complement factor I	2.419538892	CD247	CD247 molecule	−1.796081585
PLK4	polo like kinase 4	2.419538892	HIST2H2AA1	histone cluster 2,	−1.796847743
				H2aa1(Hist2h2aa1)
SLC6A9	solute carrier family 6	2.419538892	PDK1	pyruvate dehydrogenase	−1.800563818
	member 9			kinase 1
TMED2	transmembrane p24	2.419538892	NRARP	NOTCH-regulated ankyrin	−1.803049246
	trafficking protein 2			repeat protein
TMEM120B	transmembrane protein	2.41857423	BTBD11	BTB domain containing 11	−1.804793263
	120B
TRIM36	tripartite motif containing	2.417852515	CSF2RA	colony stimulating factor 2	−1.805089518
	36			receptor alpha subunit
CCDC93	coiled-coil domain	2.416164165	DEXI	Dexi homolog	−1.806998156
	containing 93
SLC25A35	solute carrier family 25	2.409367225	OLFR1276	olfactory receptor	−1.807354922
	member 35			1276(Olfr1276)
BNC1	basonuclin 1	2.40599236	TCSTV3	2-cell-stage, variable group,	−1.807354922
				member 3(Tcstv3)
FOXL2	forkhead box L2	2.40599236	SPRR2D	small proline rich protein	−1.807354922
				2D
TFPI2	tissue factor pathway	2.40599236	SEMA4G	semaphorin 4G	−1.807354922
	inhibitor 2
NET1	neuroepithelial cell	2.40599236	KCNK9	potassium two pore domain	−1.807354922
	transforming 1			channel subfamily K
				member 9
SLCO2A1	solute carrier organic	2.40599236	SNAPC3	small nuclear RNA	−1.807385513
	anion transporter family			activating complex
	member 2A1			polypeptide 3
A730008H23RIK	Description Not Found	2.399275037	AXIN2	axin 2	−1.808429403
CDKN2B	cyclin dependent kinase	2.397264578	PCNXL3	Description Not Found	−1.808995133
	inhibitor 2B
ZFP532	zinc finger protein	2.393138801	KLHL7	kelch like family member 7	−1.809016035
	532(Zfp532)
GTSE1	G2 and S-phase expressed	2.392428431	ZFP281	zinc finger protein	−1.811556991
	1			281(Zfp281)
CCDC14	coiled-coil domain	2.392317423	CHRNB2	cholinergic receptor	−1.812498225
	containing 14			nicotinic beta 2 subunit
ADAT1	adenosine deaminase,	2.392317423	TBC1D15	TBC1 domain family	−1.812909044
	tRNA specific 1			member 15
DGKH	diacylglycerol kinase eta	2.392317423	GALNT9	polypeptide N-	−1.813407449
				acetylgalactosaminyl-
				transferase 9
ZRSR1	zinc finger CCCH-type,	2.392317423	DYNC1I1	dynein cytoplasmic 1	−1.813434179
	RNA binding motif and			intermediate chain 1
	serine/arginine rich 1
NFE2	nuclear factor, erythroid 2	2.391529377	MYH8	myosin heavy chain 8	−1.81403224
CD63	CD63 molecule	2.387853137	CEP57	centrosomal protein 57	−1.815684972
MIB1	mindbomb E3 ubiquitin	2.38645559	LTK	leukocyte receptor tyrosine	−1.817623258
	protein ligase 1			kinase
TSN	translin	2.382349023	COMMD2	COMM domain containing	−1.817623258
				2
2510003E04RIK	Description Not Found	2.378511623	MEF2C	myocyte enhancer factor 2C	−1.817623258
BC043934	cDNA sequence	2.378511623	LONRF2	LON peptidase N-terminal	−1.817941412
	BC043934(BC043934)			domain and ring finger 2
AHCYL1	adenosylhomocysteinase	2.366734247	PDCD6IP	programmed cell death 6	−1.820575529
	like 1			interacting protein
OLFR731	olfactory receptor	2.364572432	DHX16	DEAH-box helicase 16	−1.820661084
	731(Olfr731)
CDKN2A	cyclin dependent kinase	2.364572432	ZFYVE19	zinc finger FYVE-type	−1.825281028
	inhibitor 2A			containing 19
SLC29A4	solute carrier family 29	2.364572432	H2-T10	histocompatibility 2, T	−1.826218639
	member 4			region locus 10(H2-T10)
SLC4A10	solute carrier family 4	2.364572432	ARID1A	AT-rich interaction domain	−1.827043205
	member 10			1A
CYCS	cytochrome c, somatic	2.351872866	NOD1	nucleotide binding	−1.827185706
				oligomerization domain
				containing 1
COL5A1	collagen type V alpha 1	2.350497247	2610318N02RIK	Description Not Found	−1.827819025
UTRN	utrophin	2.350497247	BC048644	cDNA sequence	−1.827819025
				BC048644(BC048644)
AURKA	aurora kinase A	2.349678136	CDC42EP2	CDC42 effector protein 2	−1.827819025
KREMEN2	kringle containing	2.349431709	CCL25	C-C motif chemokine	−1.827819025
	transmembrane protein 2			ligand 25
FGL2	fibrinogen like 2	2.346409407	TBX6	T-box 6	−1.827819025
NCAM1	neural cell adhesion	2.343407822	PLEKHG4	pleckstrin homology and	−1.827819025
	molecule 1			RhoGEF domain containing
				G4
ALG8	ALG8, alpha-1,3-	2.343407822	RAD18	RAD18, E3 ubiquitin	−1.830642494
	glucosyltransferase			protein ligase
OLFR703	olfactory receptor	2.336283388	SLC12A9	solute carrier family 12	−1.830807586
	703(Olfr703)			member 9
SLC39A10	solute carrier family 39	2.336283388	NR1D2	nuclear receptor subfamily	−1.837943242
	member 10			1 group D member 2
HIST1H2AH	histone cluster 1, H2ah	2.322141712	NLK	nemo like kinase	−1.840170811
TSGA8	testis specific gene	2.321928095	TTC37	tetratricopeptide repeat	−1.840462743
	A8(Tsga8)			domain 37
ELOVL2	ELOVL fatty acid	2.321928095	DLG3	discs large MAGUK	−1.841507525
	elongase 2			scaffold protein 3
MLF1	myeloid leukemia factor 1	2.321928095	PCF11	PCF11 cleavage and	−1.843349827
				polyadenylation factor
				subunit
FZD6	frizzled class receptor 6	2.321928095	HIST1H4D	histone cluster 1, H4d	−1.846386944
PLD1	phospholipase D1	2.321928095	PEX26	peroxisomal biogenesis	−1.847440096
				factor 26
IFRD2	interferon-related	2.321928095	CYP2B10	cytochrome P450, family 2,	−1.847996907
	developmental regulator 2			subfamily b, polypeptide
				10(Cyp2b10)
OLA1	Obg-like ATPase 1	2.321928095	GDF3	growth differentiation	−1.847996907
				factor 3
ASPA	aspartoacylase	2.321928095	GPR33	G protein-coupled receptor	−1.847996907
				33 (gene/pseudogene)
TGFB3	transforming growth	2.321928095	TDG	thymine DNA glycosylase	−1.847996907
	factor beta 3
PKIG	protein kinase (cAMP-	2.314696526	HIPK3	homeodomain interacting	−1.847996907
	dependent, catalytic)			protein kinase 3
	inhibitor gamma
TNFRSF4	tumor necrosis factor	2.308832886	PAPOLA	poly(A) polymerase alpha	−1.847996907
	receptor superfamily
	member 4
IQCB1	IQ motif containing B1	2.307984443	MAPK4	mitogen-activated protein	−1.847996907
				kinase 4
SLC16A11	solute carrier family 16	2.307662797	FRAT2	frequently rearranged in	−1.84969115
	member 11			advanced T-cell lymphomas
				2
1190002N15RIK	Description Not Found	2.307428525	HEXIM1	hexamethylene	−1.851035845
				bisacetamide inducible 1
LCE1L	late cornified envelope	2.307428525	TATDN2	TatD DNase domain	−1.851433223
	1L(Lce1l)			containing 2
RGS13	regulator of G-protein	2.307428525	KLRB1C	killer cell lectin-like	−1.854253843
	signaling 13			receptor subfamily B
				member 1C(Klrb1c)
FBXW8	F-box and WD repeat	2.299987517	SLC16A9	solute carrier family 16	−1.855083462
	domain containing 8			member 9
SNCA	synuclein alpha	2.296457407	ACBD4	acyl-CoA binding domain	−1.855739032
				containing 4
OSGIN1	oxidative stress induced	2.294491702	REXO1	RNA exonuclease 1	−1.857980995
	growth inhibitor 1			homolog
BC004004	cDNA sequence	2.292781749	OLFR1442	olfactory receptor	−1.859286959
	BC004004(BC004004)			1442(Olfr1442)
WNT10A	Wnt family member 10A	2.292781749	PHOSPHO1	phosphoethanolamine/	−1.859747926
				phosphocholine
				phosphatase
THG1L	tRNA-histidine	2.292781749	ITPKA	inositol-trisphosphate 3-	−1.859881803
	guanylyltransferase 1 like			kinase A
MLH1	mutL homolog 1	2.292781749	ZFHX2	zinc finger homeobox 2	−1.860513882
RRM2	ribonucleotide reductase	2.289435485	TOR1A	torsin family 1 member A	−1.860949348
	regulatory subunit M2
SHISA4	shisa family member 4	2.277984747	CDKAL1	CDK5 regulatory subunit	−1.862794137
				associated protein 1 like 1
DDAH2	dimethylarginine	2.277984747	SMAD1	SMAD family member 1	−1.863462947
	dimethylaminohydrolase
	2
APBA1	amyloid beta precursor	2.269085766	ZC3H13	zinc finger CCCH-type	−1.863535399
	protein binding family A			containing 13
	member 1
MMAB	methylmalonic aciduria	2.264911693	ZSCAN20	zinc finger and SCAN	−1.863962106
	(cobalamin deficiency)			domain containing 20
	cblB type
DIAP1	Description Not Found	2.263034406	EPB4.1L4A	Description Not Found	−1.867896464
CAR14	carbonic anhydrase	2.263034406	ZFP280C	zinc finger protein	−1.867896464
	14(Car14)			280C(Zfp280c)
C2	complement component 2	2.263034406	GM1322	predicted gene	−1.867896464
				1322(Gm1322)
MAG	myelin associated	2.263034406	OLFR472	olfactory receptor	−1.867896464
	glycoprotein			472(Olfr472)
KCNIP3	potassium voltage-gated	2.263034406	OLFR171	olfactory receptor	−1.867896464
	channel interacting			171(Olfr171)
	protein 3
CFD	complement factor D	2.263034406	OLFR1249	olfactory receptor	−1.867896464
				1249(Olfr1249)
CCNE1	cyclin E1	2.262723645	PRH1	proline rich protein HaeIII	−1.867896464
				subfamily 1
RYR1	ryanodine receptor 1	2.261305322	ARSI	arylsulfatase family	−1.867896464
				member I
PROC	protein C, inactivator of	2.255500733	KRT7	keratin 7	−1.867896464
	coagulation factors Va
	and VIIIa
ZFP27	zinc finger protein	2.247927513	PCGF3	polycomb group ring finger	−1.867896464
	27(Zfp27)			3
TBX1	T-box 1	2.247927513	PCTP	phosphatidylcholine	−1.867896464
				transfer protein
DHRS13	dehydrogenase/reductase	2.247927513	CALD1	caldesmon 1	−1.867896464
	13
HSPG2	heparan sulfate	2.247927513	TREML2	triggering receptor	−1.867896464
	proteoglycan 2			expressed on myeloid cells
				like 2
FRMD8	FERM domain containing	2.24777312	RTN4RL1	reticulon 4 receptor like 1	−1.867896464
	8
MIOX	myo-inositol oxygenase	2.240579987	PARVA	parvin alpha	−1.868479018
LYRM1	LYR motif containing 1	2.232660757	NPCD	neuronal pentraxin chromo	−1.871902039
				domain(Npcd)
STAP1	signal transducing adaptor	2.232660757	RFXANK	regulatory factor X	−1.87206109
	family member 1			associated ankyrin
				containing protein
NAT2	N-acetyltransferase 2	2.232660757	MAP3K14	mitogen-activated protein	−1.872291304
				kinase kinase kinase 14
SRGAP3	SLIT-ROBO Rho GTPase	2.232660757	KLHL9	kelch like family member 9	−1.874528943
	activating protein 3
NXT2	nuclear transport factor 2	2.232660757	SESN1	sestrin 1	−1.875260951
	like export factor 2
RCOR1	REST corepressor 1	2.232660757	ADAMTS7	ADAM metallopeptidase	−1.879404807
				with thrombospondin type 1
				motif 7
SRR	serine racemase	2.230836503	SNAPC1	small nuclear RNA	−1.88488993
				activating complex
				polypeptide 1
IKBKAP	inhibitor of kappa light	2.226177109	ADAR	adenosine deaminase, RNA	−1.885299379
	polypeptide gene			specific
	enhancer in B-cells,
	kinase complex-
	associated protein
AI597479	expressed sequence	2.225819675	LCE1C	late cornified envelope 1C	−1.885626461
	AI597479(AI597479)
POP1	POP1 homolog,	2.224966365	FBXO21	F-box protein 21	−1.886155099
	ribonuclease P/MRP
	subunit
SLC35E4	solute carrier family 35	2.217230716	2610524H06RIK	Description Not Found	−1.887525271
	member E4
XAB2	XPA binding protein 2	2.217230716	1700016K19RIK	Description Not Found	−1.887525271
MREG	melanoregulin	2.2129258	ZFP715	zinc finger protein	−1.887525271
				715(Zfp715)
FKBP11	FK506 binding protein 11	2.210721954	OLFR446	olfactory receptor	−1.887525271
				446(Olfr446)
IGF2BP2	insulin like growth factor	2.207789851	PTK7	protein tyrosine kinase 7	−1.887525271
	2 mRNA binding protein			(inactive)
	2
NUP133	nucleoporin 133	2.207447199	TMEM117	transmembrane protein 117	−1.887525271
OLFR1183	olfactory receptor	2.201633861	ITIH2	inter-alpha-trypsin inhibitor	−1.887525271
	1183(Olfr1183)			heavy chain 2
IL1F6	interleukin 1 family,	2.201633861	TAGLN3	transgelin 3	−1.887525271
	member 6(II1f6)
OTX1	orthodenticle homeobox 1	2.201633861	IFI203	interferon activated gene	−1.887644112
				203(Ifi203)
MSH3	mutS homolog 3	2.201633861	ATP1B1	ATPase Na+/K+	−1.887664186
				transporting subunit beta 1
SCN4B	sodium voltage-gated	2.201633861	BLCAP	bladder cancer associated	−1.888596201
	channel beta subunit 4			protein
CROCC	ciliary rootlet coiled-coil,	2.201633861	IGF1R	insulin like growth factor 1	−1.89024137
	rootletin			receptor
NSUN2	NOP2/Sun RNA	2.194349986	HMG20A	high mobility group 20A	−1.890579593
	methyltransferase family
	member 2
GAS2L1	growth arrest specific 2	2.193771743	WDR24	WD repeat domain 24	−1.891527175
	like 1
3110007F17RIK	Description Not Found	2.190740399	CDX4	caudal type homeobox 4	−1.892655439
DEFB15	defensin beta 15(Defb15)	2.185866545	CLDN18	claudin 18	−1.893449375
C1QTNF2	C1q and tumor necrosis	2.185866545	IL4RA	interleukin 4 receptor,	−1.895369594
	factor related protein 2			alpha(Il4ra)
RAP1GAP	RAP1 GTPase activating	2.185866545	RETNLA	resistin like alpha(Retnla)	−1.895739477
	protein
SNTB1	syntrophin beta 1	2.185866545	AA388235	expressed sequence	−1.895739477
				AA388235(AA388235)
FAH	fumarylacetoacetate	2.182925576	ZC3H6	zinc finger CCCH-type	−1.896127489
	hydrolase			containing 6
AVPI1	arginine vasopressin	2.174393775	D930015E06RIK	RIKEN cDNA	−1.899656973
	induced 1			D930015E06
				gene(D930015E06Rik)
RPA2	replication protein A2	2.172751912	NPFFR2	neuropeptide FF receptor 2	−1.902073579
BRCA2	BRCA2, DNA repair	2.168732488	IRAK1	interleukin 1 receptor	−1.90243374
	associated			associated kinase 1
RBM47	RNA binding motif	2.165911939	CWF19L2	CWF19-like 2, cell cycle	−1.903704505
	protein 47			control (S. pombe)
MSL3L2	male-specific lethal 3-like	2.159061455	STK40	serine/threonine kinase 40	−1.903964448
	2 (Drosophila)(Ms1312)
TNFRSF9	tumor necrosis factor	2.156071704	MARS2	methionyl-tRNA synthetase	−1.904571951
	receptor superfamily			2, mitochondrial
	member 9
TRF	transferrin(Trf)	2.154588207	RAB5A	RAB5A, member RAS	−1.906350687
				oncogene family
ZDHHC15	zinc finger DHHC-type	2.154372546	OLFR1037	olfactory receptor	−1.906890596
	containing 15			1037(Olfr1037)
IGJ	Description Not Found	2.153805336	ARHGAP22	Rho GTPase activating	−1.906890596
				protein 22
FBXO27	F-box protein 27	2.153805336	DENND1B	DENN domain containing	−1.906890596
				1B
ZDHHC24	zinc finger DHHC-type	2.153805336	EAPP	E2F associated	−1.906890596
	containing 24			phosphoprotein
SPCS2	signal peptidase complex	2.153805336	ANKRD13D	ankyrin repeat domain 13D	−1.906890596
	subunit 2
UCN3	urocortin 3	2.153805336	EFCAB2	EF-hand calcium binding	−1.906890596
				domain 2
SLC35A1	solute carrier family 35	2.153805336	HOXC9	homeobox C9	−1.906890596
	member A1
PODXL	podocalyxin like	2.153805336	SENP6	SUMO1/sentrin specific	−1.907956932
				peptidase 6
FAM154B	Description Not Found	2.153792145	SIDT1	SID1 transmembrane	−1.908286674
				family member 1
NRP1	neuropilin 1	2.147470553	2310057J18RIK	Description Not Found	−1.916476644
ERGIC1	endoplasmic reticulum-	2.147104727	SPRYD4	SPRY domain containing 4	−1.916476644
	golgi intermediate
	compartment 1
RNF26	ring finger protein 26	2.146810011	LY6D	lymphocyte antigen 6	−1.916476644
				complex, locus D
LCN3	lipocalin 3(Lcn3)	2.137503524	PPARGC1B	PPARG coactivator 1 beta	−1.917291956
FMO1	flavin containing	2.137503524	SH3TC1	SH3 domain and	−1.917906346
	monooxygenase 1			tetratricopeptide repeats 1
RAB20	RAB20, member RAS	2.137503524	FOXO1	forkhead box O1	−1.920209106
	oncogene family
KATNAL1	katanin catalytic subunit	2.137503524	DHX40	DEAH-box helicase 40	−1.920623917
	A1 like 1
GPR107	G protein-coupled	2.136424717	RECQL5	RecQ like helicase 5	−1.920664575
	receptor 107
MELK	maternal embryonic	2.133399125	RBM15	RNA binding motif protein	−1.922616041
	leucine zipper kinase			15
KCTD9	potassium channel	2.13207329	EGLN2	egl-9 family hypoxia	−1.924079933
	tetramerization domain			inducible factor 2
	containing 9
PBK	PDZ binding kinase	2.130417144	GPR112	Description Not Found	−1.925999419
ENPP5	ectonucleotide	2.124112676	OLFR829	olfactory receptor	−1.925999419
	pyrophosphatase/			829(Olfr829)
	phosphodiesterase 5
	(putative)
ZDHHC16	zinc finger DHHC-type	2.12361008	OLFR684	olfactory receptor	−1.925999419
	containing 16			684(Olfr684)
OLFR1346	olfactory receptor	2.121015401	RETN	resistin	−1.925999419
	1346(Olfr1346)
MILL1	MHC I like leukocyte	2.121015401	ST6GALNAC2	ST6 N-	−1.925999419
	1(Mill1)			acetylgalactosaminide
				alpha-2,6-sialyltransferase 2
RHCG	Rh family C glycoprotein	2.121015401	FES	FES proto-oncogene,	−1.925999419
				tyrosine kinase
CLDN1	claudin 1	2.121015401	KIF13A	kinesin family member 13A	−1.925999419
LHX3	LIM homeobox 3	2.121015401	TRPT1	tRNA phosphotransferase 1	−1.926457816
TUBB2A	tubulin beta 2A class IIa	2.121015401	PLCB2	phospholipase C beta 2	−1.927343833
GSG2	germ cell associated 2,	2.119412265	NADSYN1	NAD synthetase 1	−1.929674394
	haspin
HYAL2	hyaluronoglucosaminidase	2.107345942	4833420G17RIK	Description Not Found	−1.93060469
	2
1700003F12RIK	Description Not Found	2.10433666	P2RY10	purinergic receptor P2Y10	−1.930737338
RUSC2	RUN and SH3 domain	2.10433666	PPAPDC3	Description Not Found	−1.935459748
	containing 2
LRRIQ3	leucine rich repeats and	2.10433666	DIP2B	disco interacting protein 2	−1.935459748
	IQ motif containing 3			homolog B
CHSY1	chondroitin sulfate	2.10433666	RHAG	Rh-associated glycoprotein	−1.935459748
	synthase 1
DUSP23	dual specificity	2.10433666	EMID1	EMI domain containing 1	−1.935459748
	phosphatase 23
RRAGB	Ras related GTP binding	2.10433666	RNF4	ring finger protein 4	−1.938834579
	B
KCNAB3	potassium voltage-gated	2.10433666	UBL5	ubiquitin like 5	−1.938952478
	channel subfamily A
	regulatory beta subunit 3
GRPEL2	GrpE like 2,	2.103129681	PROSC	proline synthetase	−1.94016675
	mitochondrial			cotranscribed homolog
				(bacterial)
TRAF2	TNF receptor associated	2.102029095	FZD5	frizzled class receptor 5	−1.942503137
	factor 2
COQ7	coenzyme Q7,	2.100205246	UBE2D1	ubiquitin conjugating	−1.942775467
	hydroxylase			enzyme E2 D1
TMEM126B	transmembrane protein	2.099187297	KLRA7	killer cell lectin-like	−1.943510757
	126B			receptor, subfamily A,
				member 7(Klra7)
SGPL1	sphingosine-1-phosphate	2.097112667	TMEM63C	transmembrane protein 63C	−1.94425562
	lyase 1
CAPN2	calpain 2	2.096447979	2810006K23RIK	Description Not Found	−1.944858446
CHEK2	checkpoint kinase 2	2.088457439	OLFR672	olfactory receptor	−1.944858446
				672(Olfr672)
GLRP1	glutamine repeat protein	2.087462841	OLFR1347	olfactory receptor	−1.944858446
	1(Glrp1)			1347(Olfr1347)
RTN4R	reticulon 4 receptor	2.087462841	MTTP	microsomal triglyceride	−1.944858446
				transfer protein
TRIM37	tripartite motif containing	2.087462841	MSX1	msh homeobox 1	−1.944858446
	37
NUCB2	nucleobindin 2	2.087462841	BSND	barttin CLCNK type	−1.944858446
				accessory beta subunit
UBE2T	ubiquitin conjugating	2.073616696	MARK1	microtubule affinity	−1.944858446
	enzyme E2 T			regulating kinase 1
CREB3L3	CAMP responsive element	2.070389328	CHRNB1	cholinergic receptor	−1.944858446
	binding protein 3 like 3			nicotinic beta 1 subunit
CHRM4	cholinergic receptor	2.070389328	CRYL1	crystallin lambda 1	−1.946419425
	muscarinic 4
SLC16A13	solute carrier family 16	2.070389328	TEC	tec protein tyrosine kinase	−1.947330641
	member 13
OLFML2B	olfactomedin like 2B	2.070389328	XKR6	XK related 6	−1.95031589
CSNK1G1	casein kinase 1 gamma 1	2.070389328	ARC	activity-regulated	−1.953636949
				cytoskeleton-associated
				protein
S100A14	S100 calcium binding	2.070389328	WFDC10	WAP four-disulfide core	−1.95419631
	protein A14			domain 10(Wfdc10)
SMYD4	SET and MYND domain	2.070389328	OLFR866	olfactory receptor	−1.959768144
	containing 4			866(Olfr866)
CH25H	cholesterol 25-	2.070389328	WIPI2	WD repeat domain,	−1.960171668
	hydroxylase			phosphoinositide interacting
				2
TEX2	testis expressed 2	2.067875748	OLFR948	olfactory receptor	−1.963474124
				948(Olfr948)
SYN1	synapsin I	2.063429187	CRTAM	cytotoxic and regulatory T-	−1.963474124
				cell molecule
CYP3A13	cytochrome P450, family	2.060581758	CCDC116	coiled-coil domain	−1.963474124
	3, subfamily a,			containing 116
	polypeptide 13(Cyp3a13)
CBX8	chromobox 8	2.060297534	ALAS2	5′-aminolevulinate synthase	−1.963474124
				2
TOR2A	torsin family 2 member A	2.056535553	SDC4	syndecan 4	−1.963474124
E230025N22RIK	Riken cDNA	2.053111336	LENG1	leukocyte receptor cluster	−1.963474124
	E230025N22			member 1
	gene(E230025N22Rik)
OLFR963	olfactory receptor	2.053111336	TRIM65	tripartite motif containing	−1.963474124
	963(Olfr963)			65
OLFR694	olfactory receptor	2.053111336	ADRA2B	adrenoceptor alpha 2B	−1.963474124
	694(Olfr694)
AKR1B8	aldo-keto reductase	2.053111336	CPSF4	cleavage and	−1.964016356
	family 1, member			polyadenylation specific
	B8(Akr1b8)			factor 4
UGDH	UDP-glucose 6-	2.053111336	LRCH1	leucine rich repeats and	−1.966068313
	dehydrogenase			calponin homology domain
				containing 1
CLPB	ClpB homolog,	2.053111336	CPXM1	carboxypeptidase X (M14	−1.96782195
	mitochondrial AAA			family), member 1
	ATPase chaperonin
KLHDC9	kelch domain containing	2.053111336	PARP6	poly(ADP-ribose)	−1.968362498
	9			polymerase family member
				6
MCPH1	microcephalin 1	2.051211057	GTF3C2	general transcription factor	−1.975687807
				IIIC subunit 2
IL2RA	interleukin 2 receptor	2.049225103	NEDD4L	neural precursor cell	−1.978518523
	subunit alpha			expressed, developmentally
				down-regulated 4-like, E3
				ubiquitin protein ligase
CAR9	carbonic anhydrase	2.044394119	DICER1	dicer 1, ribonuclease III	−1.97959126
	9(Car9)
USP10	ubiquitin specific	2.044394119	GBA2	glucosylceramidase beta 2	−1.980387638
	peptidase 10
FASTKD2	FAST kinase domains 2	2.044394119	OLFR1269	olfactory receptor	−1.981852653
				1269(Olfr1269)
STRA13	stimulated by retinoic	2.044394119	EAR10	eosinophil-associated,	−1.981852653
	acid 13			ribonuclease A family,
				member 10(Ear10)
HIST1H2AD	histone cluster 1, H2ad	2.044111161	ADAM5	ADAM metallopeptidase	−1.981852653
				domain 5 (pseudogene)
PLA1A	phospholipase A1	2.037157781	MED1	mediator complex subunit 1	−1.981852653
	member A
MCM3	minichromosome	2.036462274	FGFRL1	fibroblast growth factor	−1.981852653
	maintenance complex			receptor-like 1
	component 3
PIF1	PIF1 5′-to-3′ DNA	2.036094966	EXTL1	exostosin like	−1.981852653
	helicase			glycosyltransferase 1
GALR1	galanin receptor 1	2.03562391	ZFHX3	zinc finger homeobox 3	−1.981852653
DLD	dihydrolipoamide	2.03562391	FBXO30	F-box protein 30	−1.981852653
	dehydrogenase
GGCX	gamma-glutamyl	2.03562391	RNF112	ring finger protein 112	−1.984681148
	carboxylase
CEP68	centrosomal protein 68	2.03562391	PARP3	poly(ADP-ribose)	−1.98599548
				polymerase family member
				3
MMP11	matrix metallopeptidase	2.03562391	AIRE	autoimmune regulator	−1.986410935
	11
STMN1	stathmin 1	2.033316653	CYB561D1	cytochrome b561 family	−1.987107951
				member D1
SLCO4A1	solute carrier organic	2.03217627	TRAPPC5	trafficking protein particle	−1.987269174
	anion transporter family			complex 5
	member 4A1
TIAL1	TIA1 cytotoxic granule-	2.02888965	RFTN2	raftlin family member 2	−1.98749308
	associated RNA binding
	protein-like 1
0610009B22RIK	Description Not Found	2.017921908	FRAT1	frequently rearranged in	−1.999894159
				advanced T-cell lymphomas
				1
GM1673	predicted gene	2.017921908	DMC1	DNA meiotic recombinase	−2
	1673(Gm1673)			1
CCL26	C-C motif chemokine	2.017921908	RIPK4	receptor interacting	−2
	ligand 26			serine/threonine kinase 4
ZWILCH	zwilch kinetochore	2.017921908	PVR	poliovirus receptor	−2
	protein
GABRA1	gamma-aminobutyric acid	2.017921908	LPIN2	lipin 2	−2
	type A receptor alpha1
	subunit
ACP2	acid phosphatase 2,	2.017143376	THAP2	THAP domain containing 2	−2
	lysosomal
FAM131A	family with sequence	2.013219985	SHE	Src homology 2 domain	−2
	similarity 131 member A			containing E
PXMP4	peroxisomal membrane	2.012497517	ARHGAP25	Rho GTPase activating	−2.005618551
	protein 4			protein 25
CDC6	cell division cycle 6	2.011166077	CSF1R	colony stimulating factor 1	−2.006350699
				receptor
AXL	AXL receptor tyrosine	2.008131619	ZFP1	ZFP1 zinc finger protein	−2.007904843
	kinase
RBBP7	RB binding protein 7,	2.006746832	SFN	stratifin	−2.008988783
	chromatin remodeling
	factor
PABPC4	poly(A) binding protein	2.005260152	COL17A1	collagen type XVII alpha 1	−2.010386372
	cytoplasmic 4
HIST1H2AK	histone cluster	1, H2ak	2.003307679	XKRX	XK related, X-linked	−2.0105696
MTFMT	mitochondrial methionyl-	2.001754595	BRD8	bromodomain containing 8	−2.01346226
	tRNA formyltransferase
ZFP449	zinc finger protein	2	ZFP213	zinc finger protein	−2.013532276
	449(Zfp449)			213(Zfp213)
D930020B18RIK	RIKEN cDNA		2	ZFY2	zinc finger protein 2, Y-	−2.015657249
	D930020B18			linked(Zfy2)
	gene(D930020B18Rik)
LCE1D	late cornified envelope	2	MAP3K3	mitogen-activated protein	−2.01612652
	1D			kinase kinase kinase 3
UCN	urocortin	2	ZFP445	zinc finger protein	−2.017921908
				445(Zfp445)
SYT4	synaptotagmin	4	2	MTAP7D3	MAP7 domain containing	−2.017921908
				3(Mtap7d3)
GPR132	G protein-coupled	2	TMPRSS11A	transmembrane protease,	−2.017921908
	receptor 132			serine 11A
SDHD	succinate dehydrogenase		2	OLFM2	olfactomedin 2	−2.017921908
	complex subunit D
PANK3	pantothenate kinase	3	2	GRM4	glutamate metabotropic	−2.017921908
				receptor 4
SBSN	suprabasin	1.99095486	ONECUT2	one cut homeobox 2	−2.017921908
WDR59	WD repeat domain 59	1.989976974	HNRNPH3	heterogeneous nuclear	−2.017921908
				ribonucleoprotein H3
MTMR9	myotubularin related	1.987844644	ZMYM5	zinc finger MYM-type	−2.020204421
	protein 9			containing 5
IL15RA	interleukin	15 receptor	1.985628881	RAPGEF6	Rap guanine nucleotide	−2.020953989
	subunit alpha			exchange factor	6
RHBDF2	rhomboid 5 homolog 2	1.984681148	CD34	CD34 molecule	−2.026714044
NHLRC2	NHL repeat containing 2	1.98375117	ACVR2B	activin A receptor type 2B	−2.026714044
NMRAL1	NmrA-like family domain	1.983370163	RILP	Rab interacting lysosomal	−2.026800059
	containing 1			protein
OLFR120	olfactory receptor	1.981852653	EMR1	Description Not Found	−2.031218731
	120(Olfr120)
OLFR1051	olfactory receptor	1.981852653	DNAJA2	DnaJ heat shock protein	−2.031291874
	1051(Olfr1051)			family (Hsp40) member A2
PCDHGA9	protocadherin gamma	1.981852653	SEMA4B	semaphorin 4B	−2.031985281
	subfamily A, 9
FST	follistatin	1.981852653	1700015E13RIK	Description Not Found	−2.03562391
RECQL4	RecQ like helicase 4	1.976611605	RHOX1	reproductive homeobox	−2.03562391
				1(Rhox1)
NFKBIL1	NFKB inhibitor like 1	1.970969489	TCP11	t-complex 11	−2.03562391
TUBD1	tubulin delta 1	1.964367355	FBXW11	F-box and WD repeat	−2.03562391
				domain containing 11
FSD1	fibronectin type III and	1.963474124	ALX1	ALX homeobox 1	−2.03562391
	SPRY domain containing
	1
GDF5	growth differentiation	1.963474124	BST1	bone marrow stromal cell	−2.03562391
	factor 5			antigen 1
TREML4	triggering receptor	1.963474124	GPR83	G protein-coupled receptor	−2.03562391
	expressed on myeloid			83
	cells like 4
SORD	sorbitol dehydrogenase	1.963474124	RECK	reversion inducing cysteine	−2.036112118
				rich protein with kazal
				motifs
HEBP1	heme binding protein 1	1.963474124	ABHD14B	abhydrolase domain	−2.040460993
				containing 14B
KDELR2	KDEL endoplasmic	1.96155465	GPRC6A	G protein-coupled receptor	−2.042122888
	reticulum protein			class C group 6 member A
	retention receptor
2
TRPV4	transient receptor	1.958842675	GRAMD3	GRAM domain containing	−2.042296131
	potential cation channel			3
	subfamily V member 4
ABHD5	abhydrolase domain	1.957389419	IMPACT	impact RWD domain	−2.042436285
	containing 5			protein
YOD1	YOD1 deubiquitinase	1.95419631	TOP1	topoisomerase (DNA) I	−2.044394119
MAGOHB	mago homolog B, exon	1.952932368	NACC2	NACC family member 2	−2.044394119
	junction complex core
	component
TSPAN2	tetraspanin
2	1.95176103	PKNOX1	PBX/knotted 1 homeobox 1	−2.045797958
LDB3	LIM domain binding 3	1.94850842	TMEM79	transmembrane protein 79	−2.046628729
1700067P10RIK	Description Not Found	1.944858446	MYCBP2	MYC binding protein 2, E3	−2.047368853
				ubiquitin protein ligase
9530091C08RIK	Description Not Found	1.944858446	MAS1	MAS1 proto-oncogene, G	−2.048055651
				protein-coupled receptor
RHOJ	ras homolog family	1.944858446	GEMIN6	gem nuclear organelle	−2.053111336
	member J			associated protein 6
SFRP1	secreted frizzled related	1.944858446	TMEM100	transmembrane protein 100	−2.053111336
	protein 1
XPNPEP2	X-prolyl aminopeptidase	1.944858446	FOXI1	forkhead box I1	−2.053111336
	(aminopeptidase P) 2,
	membrane-bound
RNASE4	ribonuclease A family	1.935459748	OPLAH	5-oxoprolinase (ATP-	−2.053111336
	member 4			hydrolysing)
NAPSA	napsin A aspartic	1.931586931	BC094916	Description Not Found	−2.058337935
	peptidase
TIMM22	translocase of inner	1.931202999	GZMM	granzyme M	−2.061193332
	mitochondrial membrane
	22 homolog (yeast)
MTCH2	mitochondrial carrier 2	1.929774464	RCOR2	REST corepressor 2	−2.06280495
ADCK4	aarF domain containing	1.927921426	NR2E1	nuclear receptor subfamily	−2.06366268
	kinase 4			2 group E member 1
PDSS1	prenyl (decaprenyl)	1.926245513	NT5DC1	5′-nucleotidase domain	−2.065994119
	diphosphate synthase,			containing 1
	subunit 1
ZFP94	zinc finger protein	1.925999419	SCN8A	sodium voltage-gated	−2.06750099
	94(Zfp94)			channel alpha subunit 8
FABP9	fatty acid binding protein	1.925999419	CBX7	chromobox 7	−2.06750099
	9
RNF170	ring finger protein 170	1.925999419	FHAD1	forkhead associated	−2.068114527
				phosphopeptide binding
				domain
1
TLR3	toll like receptor 3	1.925999419	KCNQ3	potassium voltage-gated	−2.068885643
				channel subfamily Q
				member
3
LIPH	lipase H	1.925999419	BC025920	zinc finger protein	−2.070389328
				pseudogene(BC025920)
PLEKHA7	pleckstrin homology	1.925999419	FCGR1	Fc receptor, IgG, high	−2.070389328
	domain containing A7			affinity I(Fcgr1)
LXN	latexin	1.9244606	SYN3	synapsin III	−2.070389328
PPCS	phosphopantothenoylcyst	1.92294738	KLHL5	kelch like family member 5	−2.070389328
	eine synthetase
BTRC	beta-transducin repeat	1.92065845	EDA2R	ectodysplasin A2 receptor	−2.070389328
	containing E3 ubiquitin
	protein ligase
APIP	APAF1 interacting	1.920326443	STK38	serine/threonine kinase 38	−2.070389328
	protein
ANK1	ankyrin 1	1.916476644	CDKN2D	cyclin dependent kinase	−2.072205467
				inhibitor 2D
TOMM70A	translocase of outer	1.913107017	IL6ST	interleukin 6 signal	−2.072660321
	mitochondrial membrane			transducer
	70 homolog A
	(yeast)(Tomm70a)
ABCB1B	ATP-binding cassette,	1.908033945	OLFR427	olfactory receptor	−2.074318985
	sub-family B			427(Olfr427)
	(MDR/TAP), member
	1B(Abcb1b)
ACN9	Description Not Found	1.906890596	BAIAP2	BAIl associated protein 2	−2.078951341
DLX1AS	distal-less homeobox 1,	1.906890596	TIMP2	TIMP metallopeptidase	−2.079805224
	antisense(Dlx1as)			inhibitor 2
MRGPRD	MAS related GPR family	1.906890596	CDCP1	CUB domain containing	−2.083991945
	member D			protein	1
WDHD1	WD repeat and HMG-box	1.906890596	RGS14	regulator of G-protein	−2.084198537
	DNA binding protein 1			signaling 14
USP46	ubiquitin specific	1.906890596	VASP	vasodilator-stimulated	−2.086359868
	peptidase 46			phosphoprotein
PKN3	protein kinase N3	1.906890596	ZFP318	zinc finger protein	−2.087462841
				318(Zfp318)
OSCAR	osteoclast associated,	1.906890596	PSG25	pregnancy-specific	−2.087462841
	immunoglobulin-like			glycoprotein 25(Psg25)
	receptor
CDK2	cyclin dependent kinase 2	1.906746727	PDZD8	PDZ domain containing 8	−2.087462841
TRIM62	tripartite motif containing	1.905520967	DET1	de-etiolated homolog 1	−2.087462841
	62			(Arabidopsis)
SQLE	squalene epoxidase	1.903767694	CHST3	carbohydrate	−2.087462841
				sulfotransferase 3
MCM10	minichromosome	1.89598378	EHHADH	enoyl-CoA, hydratase/3-	−2.087462841
	maintenance 10			hydroxyacyl CoA
	replication initiation			dehydrogenase
	factor
CCDC90B	coiled-coil domain	1.894803124	FCGRT	Fc fragment of IgG receptor	−2.090735607
	containing 90B			and transporter
SPATS1	spermatogenesis	1.892848083	CFP	complement factor	−2.09437407
	associated serine rich 1			properdin
GPNMB	glycoprotein nmb	1.891427809	SOCS6	suppressor of cytokine	−2.094638136
				signaling 6
MST1	macrophage stimulating 1	1.88993148	SYT11	synaptotagmin 11	−2.09592442
LTB4R1	leukotriene B4 receptor	1.887644112	MBTPS2	membrane bound	−2.09592442
	1(Ltb4r1)			transcription factor
				peptidase, site 2
DNAJC5B	DnaJ heat shock protein	1.887525271	MEFV	Mediterranean fever	−2.097059135
	family (Hsp40) member
	C5 beta
PCDHGC4	protocadherin gamma	1.887525271	SRPK2	SRSF protein kinase 2	−2.10044313
	subfamily C, 4
HMX2	H6 family homeobox 2	1.887525271	DUSP16	dual specificity phosphatase	−2.102740277
				16
NDUFAB1	NADH:ubiquinone	1.887525271	SLC6A7	solute carrier family 6	−2.103129681
	oxidoreductase subunit			member	7
	AB1
MGP	matrix Gla protein	1.887525271	HBB-B1	hemoglobin, beta adult	−2.10433666
				major chain(Hbb-b1)
ZKSCAN2	zinc finger with KRAB	1.887525271	TNPO3	transportin	3	−2.10433666
	and SCAN domains 2
CCDC51	coiled-coil domain	1.887525271	CSNK2B	casein kinase	2 beta	−2.10433666
	containing 51
CTSK	cathepsin K	1.887525271	BCAS1	breast carcinoma amplified	−2.10433666
				sequence 1
PRDM9	PR domain 9	1.887525271	INO80	INO80 complex subunit	−2.10433666
C8A	complement component	8	1.887525271	MPG	N-methylpurine DNA	−2.10433666
	alpha subunit			glycosylase
NEUROG1	neurogenin 1	1.887082413	FOXP1	forkhead box P1	−2.107557734
NUSAP1	nucleolar and spindle	1.886951242	USP21	ubiquitin specific peptidase	−2.107658353
	associated protein 1			21
LZIC	leucine zipper and	1.877899051	LIMS1	LIM zinc finger domain	−2.112700133
	CTNNBIP1 domain			containing 1
	containing
ZFP609	zinc finger protein	1.87774425	FXYD1	FXYD domain containing	−2.112700133
	609(Zfp609)			ion transport regulator 1
GPR87	G protein-coupled	1.87774425	POU3F1	POU class 3 homeobox 1	−2.113574207
	receptor 87
GMPPB	GDP-mannose	1.871523637	OLFR591	olfactory receptor	−2.114494844
	pyrophosphorylase B			591(Olfr591)
TMEM115	transmembrane protein	1.870364796	GRAMD4	GRAM domain containing	−2.114673101
	115			4
DSN1	DSN1 homolog, MIS12	1.868479018	BCL2	BCL2, apoptosis regulator	−2.115878669
	kinetochore complex
	component
A530099J19RIK	Description Not Found	1.867896464	PELI3	pellino E3 ubiquitin protein	−2.118915146
				ligase family member 3
1700007K09RIK	Description Not Found	1.867896464	PPP1CB	protein phosphatase	1	−2.119236221
				catalytic subunit beta
1810043G02RIK	Description Not Found	1.867896464	TFF2	trefoil factor	2	−2.121015401
UCHL1	ubiquitin C-terminal	1.867896464	GCA	grancalcin	−2.121015401
	hydrolase L1
PTCH2	patched 2	1.867896464	LYL1	LYL1, basic helix-loop-	−2.121015401
				helix family member
APBB3	amyloid beta precursor	1.867896464	ATG4B	autophagy related 4B	−2.121015401
	protein binding family B			cysteine peptidase
	member
3
PTER	phosphotriesterase related	1.867896464	CCDC102A	coiled-coil domain	−2.121015401
				containing 102A
PRKCE	protein kinase C epsilon	1.867896464	ATP2A1	ATPase	−2.121015401
				sarcoplasmic/endoplasmic
				reticulum Ca2+ transporting
				1
PLEKHM3	pleckstrin homology	1.867896464	TERF2	telomeric repeat binding	−2.123585568
	domain containing M3			factor	2
HIST1H4C	histone cluster	1, H4c	1.867896464	LCN5	lipocalin 5(Lcn5)	−2.124432612
PLS3	plastin	3	1.867896464	TM6SF1	transmembrane	6	−2.124533495
				superfamily member 1
DUSP4	dual specificity	1.867686654	SSBP2	single stranded DNA	−2.129283017
	phosphatase 4			binding protein 2
SCLY	selenocysteine lyase	1.862802277	KRTAP6-2	keratin associated protein 6-	−2.137503524
				2
RPRD1A	regulation of nuclear pre-	1.861777838	CRHBP	corticotropin releasing	−2.137503524
	mRNA domain			hormone binding protein
	containing 1A
CCRL2	C-C motif chemokine	1.86175579	TOPBP1	topoisomerase (DNA) II	−2.137503524
	receptor like 2			binding protein 1
CCT7	chaperonin containing	1.861636037	SLC35A3	solute carrier family 35	−2.137503524
	TCP1 subunit 7			member A3
ZFP217	zinc finger protein	1.861097096	CACNB4	calcium voltage-gated	−2.137503524
	217(Zfp217)			channel auxiliary subunit
				beta
4
ACTN4	actinin alpha	4	1.859689938	TASP1	taspase	1	−2.137503524
KCNA3	potassium voltage-gated	1.859135363	HMBOX1	homeobox containing 1	−2.145313833
	channel subfamily A
	member 3
CUL7	cullin 7	1.858597911	ZFP62	ZFP62 zinc finger protein	−2.145677455
LRRC59	leucine rich repeat	1.857543219	PCDHB4	protocadherin beta 4	−2.148666128
	containing 59
PHTF2	putative homeodomain	1.855602651	SLC35F3	solute carrier family 35	−2.15120644
	transcription factor 2			member F3
KDELC1	KDEL motif containing 1	1.852556218	AW549877	expressed sequence	−2.151324826
				AW549877(AW549877)
SEC24D	SEC24 homolog D,	1.8483841	GIMAP9	GTPase, IMAP family	−2.152400921
	COPII coat complex			member 9(Gimap9)
	component
OLFR222	olfactory receptor	1.847996907	ZFP329	zinc finger protein	−2.153805336
	222(Olfr222)			329(Zfp329)
OLFR118	olfactory receptor	1.847996907	KRT74	keratin 74	−2.153805336
	118(Olfr118)
CASKIN2	CASK interacting protein	1.847996907	REG3A	regenerating family	−2.153805336
	2			member 3 alpha
TPK1	thiamin	1.847996907	RAB4A	RAB4A, member RAS	−2.154308231
	pyrophosphokinase 1			oncogene family
NOL3	nucleolar protein 3	1.847996907	CECR5	cat eye syndrome	−2.155682653
				chromosome region,
				candidate 5
UBA6	ubiquitin like modifier	1.847388943	ESM1	endothelial cell specific	−2.157156463
	activating enzyme 6			molecule 1
RAVER1	ribonucleoprotein, PTB	1.846151947	HS6ST1	heparan sulfate 6-O-	−2.164820712
	binding 1			sulfotransferase 1
NAT10	N-acetyltransferase 10	1.843300131	DDB2	damage specific DNA	−2.168338824
				binding protein 2
HIST1H3H	histone cluster	1, H3h	1.842055889	5430435G22RIK	Description Not Found	−2.169925001
SNX8	sorting nexin	8	1.840985134	ALOX12B	arachidonate 12-	−2.169925001
				lipoxygenase, 12R type
POLR3K	polymerase (RNA) III	1.839538616	SLC34A3	solute carrier family 34	−2.169925001
	subunit K			member	3
WDR55	WD repeat domain 55	1.835957408	TNS4	tensin	4	−2.169925001
WDR93	WD repeat domain 93	1.830541464	CANX	calnexin	−2.169925001
PLSCR1	phospholipid scramblase	1.828635636	BET1	Bet1 golgi vesicular	−2.169925001
	1			membrane trafficking
				protein
ARL6	ADP ribosylation factor	1.827819025	BEST2	bestrophin 2	−2.169925001
	like GTPase 6
NOL9	nucleolar protein	9	1.827819025	USP28	ubiquitin specific peptidase	−2.172998154
				28
PNKD	paroxysmal	1.827819025	PDE4B	phosphodiesterase 4B	−2.173614018
	nonkinesigenic dyskinesia
TMEM139	transmembrane protein	1.827819025	CNOT4	CCR4-NOT transcription	−2.177917792
	139			complex subunit 4
ASPH	aspartate beta-	1.827819025	NECAP1	NECAP endocytosis	−2.178043245
	hydroxylase			associated 1
LZTFL1	leucine zipper	1.827819025	JUN	Jun proto-oncogene, AP-1	−2.178565309
	transcription factor like 1			transcription factor subunit
RHEBL1	Ras homolog enriched in	1.827819025	SLC10A7	solute carrier family 10	−2.17990909
	brain like 1			member 7
CHCHD5	coiled-coil-helix-coiled-	1.82552849	IL17A	interleukin 17A	−2.181702586
	coil-helix domain
	containing 5
GPD2	glycerol-3-phosphate	1.824148697	ERICH1	glutamate rich 1	−2.182286216
	dehydrogenase 2
STK39	serine/threonine kinase 39	1.823608879	HN1L	hematological and	−2.185866545
				neurological expressed 1-
				like
MAGED2	MAGE family member	1.820863253	SLFNL1	schlafen like 1	−2.185866545
	D2
TBC1D9B	TBC1 domain family	1.813219568	MYOD1	myogenic differentiation 1	−2.185866545
	member 9B
LSS	lanosterol synthase (2,3-	1.809540228	TRIM35	tripartite motif containing	−2.185866545
	oxidosqualene-lanosterol			35
	cyclase)
OLFR859	olfactory receptor	1.807354922	CHRNE	cholinergic receptor	−2.186397884
	859(Olfr859)			nicotinic epsilon subunit
OLFR1225	olfactory receptor	1.807354922	PHF21A	PHD finger protein 21A	−2.190943197
	1225(Olfr1225)
IFNA11	interferon alpha	1.807354922	HIST1H2AE	histone cluster	1, H2ae	−2.196698179
	11(Ifna11)
ARG1	arginase 1	1.807354922	SATB1	SATB homeobox 1	−2.198659952
ASCL3	achaete-scute family	1.807354922	LCN8	lipocalin	8	−2.201633861
	bHLH transcription factor
	3
AGA	aspartylglucosaminidase	1.807354922	ABCG5	ATP binding cassette	−2.201633861
				subfamily G member 5
MAP3K12	mitogen-activated protein	1.806530545	KRBA1	KRAB-A domain	−2.202959029
	kinase kinase kinase 12			containing 1
COMMD10	COMM domain	1.802771724	CD274	CD274 molecule	−2.206081393
	containing 10
STYX	serine/threonine/tyrosine	1.801251483	DYRK2	dual specificity tyrosine	−2.206730511
	interacting protein			phosphorylation regulated
				kinase 2
EPHA6	EPH receptor A6	1.797583147	ZFP292	zinc finger protein	−2.209453366
				292(Zfp292)
SERPINA3F	serine (or cysteine)	1.794445043	PRX	periaxin	−2.209453366
	peptidase inhibitor, clade
	A, member 3F(Serpina3f)
PUS10	pseudouridylate synthase	1.791814071	SPAG1	sperm associated antigen 1	−2.209453366
	10
RASL12	RAS like family 12	1.791652715	ASGR2	asialoglycoprotein receptor	−2.209784456
				2
MRPL51	mitochondrial ribosomal	1.787631232	PTEN	phosphatase and tensin	−2.215013513
	protein L51			homolog
OLFR1306	olfactory receptor	1.786596362	IL1A	interleukin	1 alpha	−2.217230716
	1306(Olfr1306)
BCL2A1C	B cell	1.786596362	TPCN2	two pore segment channel 2	−2.217230716
	leukemia/lymphoma 2
	related protein
	Alc(Bcl2a1c)
HOXD1	homeobox D1	1.786596362	IKBKB	inhibitor of kappa light	−2.217230716
				polypeptide gene enhancer
				in B-cells, kinase beta
MEMO1	mediator of cell motility 1	1.786596362	ST6GAL1	ST6 beta-galactoside alpha-	−2.218342351
				2,6-sialyltransferase 1
ARCN1	archain	1	1.786596362	TMEM161A	transmembrane protein	−2.232660757
				161A
NUDT10	nudix hydrolase	10	1.786596362	STK32B	serine/threonine kinase 32B	−2.232660757
SLC4A4	solute carrier family 4	1.786596362	CHST14	carbohydrate	−2.232660757
	member 4			sulfotransferase 14
DHRS4	dehydrogenase/reductase	1.786596362	AQP3	aquaporin 3 (Gill blood	−2.232660757
	4			group)
TOM1	target of myb1 membrane	1.786596362	RASSF3	Ras association domain	−2.233505898
	trafficking protein			family member	3
TST	thiosulfate	1.786596362	OTUD7B	OTU deubiquitinase 7B	−2.242923867
	sulfurtransferase
RIPK2	receptor interacting	1.784428584	AP3M2	adaptor related protein	−2.247481244
	serine/threonine kinase 2			complex 3 mu 2 subunit
NAIP2	NLR family, apoptosis	1.780351745	PSMA6	proteasome subunit alpha 6	−2.247927513
	inhibitory protein
	2(Naip2)
OLFR133	olfactory receptor	1.77946628	PRCC	papillary renal cell	−2.247927513
	133(Olfr133)			carcinoma (translocation-
				associated)
NBR1	NBR1, autophagy cargo	1.776995396	ZFP688	zinc finger protein	−2.262218541
	receptor			688(Zfp688)
GLIS1	GLIS family zinc finger 1	1.776512203	DOCK11	dedicator of cytokinesis 11	−2.262218541
SLC35A2	solute carrier family 35	1.776232819	PLA2G4F	phospholipase A2 group	−2.263034406
	member A2			IVF
AU022252	expressed sequence	1.774559318	MYPN	myopalladin	−2.263034406
	AU022252(AU022252)
OLFR64	olfactory receptor	1.773991786	FRS2	fibroblast growth factor	−2.263034406
	64(Olfr64)			receptor substrate 2
PPAPDC2	Description Not Found	1.771983065	STARD6	StAR related lipid transfer	−2.263034406
				domain containing 6
DIS3	DIS3 homolog, exosome	1.771375295	WSCD2	WSC domain containing 2	−2.270653766
	endoribonuclease and 3′-
	5′ exoribonuclease
4931440F15RIK	Description Not Found	1.770829046	TLE1	transducin like enhancer of	−2.272631746
				split 1
ZFP771	zinc finger protein	1.77019569	HDHD3	haloacid dehalogenase like	−2.272966802
	771(Zfp771)			hydrolase domain
				containing 3
HMBS	hydroxymethylbilane	1.769676967	1700029J07RIK	Description Not Found	−2.277984747
	synthase
RCC1	regulator of chromosome	1.768267605	CLEC2D	C-type lectin domain family	−2.277984747
	condensation 1			2 member D
SPAG5	sperm associated antigen	1.767980257	PPM1G	protein phosphatase,	−2.277984747
	5			Mg2+/Mn2+ dependent 1G
TSPAN31	tetraspanin 31	1.767626782	CDKN1B	cyclin dependent kinase	−2.280970508
				inhibitor 1B
PCDHGB8	protocadherin gamma	1.765534746	OASL1	2′-5′ oligoadenylate	−2.28169825
	subfamily B, 8(Pcdhgb8)			synthetase-like 1(Oasl1)
PRL2B1	prolactin family	2,	1.765534746	G0S2	G0/G1 switch 2	−2.282045463
	subfamily b, member
	1(Prl2b1)
OBOX5	oocyte specific homeobox	1.765534746	TMEM17	transmembrane protein 17	−2.285402219
	5(Obox5)
PIK3R3	phosphoinositide-3-kinase	1.765534746	BLVRB	biliverdin reductase B	−2.290619427
	regulatory subunit 3
MAP3K4	mitogen-activated protein	1.765534746	GOSR1	golgi SNAP receptor	−2.290897209
	kinase kinase kinase 4			complex member 1
LRRC30	leucine rich repeat	1.765534746	ZFP26	zinc finger protein	−2.292781749
	containing 30			26(Zfp26)
EN2	engrailed homeobox 2	1.765534746	CXCL2	C-X-C motif chemokine	−2.292781749
				ligand 2
HOOK3	hook microtubule-	1.765534746	SNX7	sorting nexin	7	−2.292781749
	tethering protein 3
MYO9A	myosin IXA	1.765534746	ZDHHC23	zinc finger DHHC-type	−2.292781749
				containing 23
STX7	syntaxin	7	1.765060364	GALNT6	polypeptide N-	−2.292781749
				acetylgalactosaminyl-
				transferase 6
ATM	ATM serine/threonine	1.763504031	AMPD1	adenosine monophosphate	−2.297844157
	kinase			deaminase	1
KCNK6	potassium two pore	1.763385753	GIMAP5	GTPase, IMAP family	−2.303246615
	domain channel			member	5
	subfamily K member 6
PQLC3	PQ loop repeat containing	1.759954577	ATP5F1	ATP synthase, H+	−2.305399163
	3			transporting, mitochondrial
				Fo complex subunit B1
KIFAP3	kinesin associated protein	1.758843168	LHFPL2	lipoma HMGIC fusion	−2.307428525
	3			partner-like 2
E2F4	E2F transcription factor 4	1.757752886	KIF1B	kinesin family member 1B	−2.313231129
ETV5	ETS variant 5	1.757709335	TLE6	transducin like enhancer of	−2.321928095
				split 6
GTF2E2	general transcription	1.75666387	SHF	Src homology 2 domain	−2.330691998
	factor IIE subunit 2			containing F
GPR150	G protein-coupled	1.75547927	NGFR	nerve growth factor	−2.331438521
	receptor 150			receptor
E130308A19RIK	RIKEN cDNA	1.754887502	KLRA4	killer cell lectin-like	−2.334485632
	E130308A19			receptor, subfamily A,
	gene(E130308A19Rik)			member 4(Klra4)
DPYSL4	dihydropyrimidinase like	1.754887502	ITGAE	integrin subunit alpha E	−2.335948972
	4
FNBP1	formin binding protein 1	1.75468902	PQLC2	PQ loop repeat containing 2	−2.336141568
TMOD4	tropomodulin 4	1.754064107	KLRB1A	killer cell lectin-like	−2.336283388
				receptor subfamily B
				member 1A(Klrb1a)
ERLIN1	ER lipid raft associated 1	1.751154691	IRF9	interferon regulatory factor	−2.336308285
				9
ENOPH1	enolase-phosphatase 1	1.748447442	GATA3	GATA binding protein 3	−2.338971433
RAB31	RAB31, member RAS	1.746215332	RSAD2	radical S-adenosyl	−2.33997952
	oncogene family			methionine domain
				containing 2
HOXA6	homeobox A6	1.745184623	RNF215	ring finger protein 215	−2.341976415
TAS2R126	taste receptor, type 2,	1.744161096	IL7R	interleukin	7 receptor	−2.343395577
	member 126(Tas2r126)
AGXT2	alanine--glyoxylate	1.744161096	ACP5	acid phosphatase 5, tartrate	−2.345270806
	aminotransferase 2			resistant
STK32C	serine/threonine kinase	1.744161096	STYXL1	serine/threonine/tyrosine	−2.346956889
	32C			interacting-like 1
P2RY2	purinergic receptor P2Y2	1.744161096	NOXO1	NADPH oxidase organizer	−2.35030956
				1
NWD1	NACHT and WD repeat	1.744161096	IGFALS	insulin like growth factor	−2.358664554
	domain containing 1			binding protein acid labile
				subunit
UQCRQ	ubiquinol-cytochrome c	1.744161096	STIM1	stromal interaction	−2.359335599
	reductase complex III			molecule 1
	subunit VII
PPP1R3A	protein phosphatase	1	1.744161096	TMEM186	transmembrane protein 186	−2.361030771
	regulatory subunit 3A
GOLT1A	golgi transport 1A	1.744161096	OLFR1043	olfactory receptor	−2.364572432
				1043(Olfr1043)
EZH1	enhancer of zeste 1	1.744161096	D8ERTD82E	DNA segment, Chr 8,	−2.364572432
	polycomb repressive			ERATO Doi 82,
	complex 2 subunit			expressed(D8Ertd82e)
MTHFD2	methylenetetrahydrofolate	1.744154314	MYOG	myogenin	−2.364572432
	dehydrogenase (NADP+
	dependent) 2,
	methenyltetrahydrofolate
	cyclohydrolase
PGRMC1	progesterone receptor	1.742545062	NCLN	nicalin	−2.364572432
	membrane component 1
DNAJB12	DnaJ heat shock protein	1.741863621	MTSS1	metastasis suppressor 1	−2.364572432
	family (Hsp40) member
	B12
DNAJC11	DnaJ heat shock protein	1.738767837	TRMU	tRNA 5-	−2.364572432
	family (Hsp40) member			methylaminomethyl-2-
	C11			thiouridylate
				methyltransferase
TOMM6	translocase of outer	1.738448709	EMILIN2	elastin microfibril interfacer	−2.369119767
	mitochondrial membrane			2
	6
RPS6KL1	ribosomal protein S6	1.738393453	MPV17L	MPV17 mitochondrial inner	−2.371558863
	kinase like 1			membrane protein like
CDC73	cell division cycle 73	1.73665741	WWC2	WW and C2 domain	−2.371558863
				containing 2
NDC80	NDC80, kinetochore	1.732078892	TMEM178	transmembrane protein	−2.374005585
	complex component			178(Tmem178)
TACC3	transforming acidic	1.731372884	TPCN1	two pore segment channel 1	−2.375232208
	coiled-coil containing
	protein
3
CPSF3	cleavage and	1.727926568	LRRC45	leucine rich repeat	−2.377207351
	polyadenylation specific			containing 45
	factor 3
ARID3A	AT-rich interaction	1.726471722	1110059G10RIK	Description Not Found	−2.377915929
	domain 3A
LLPH	LLP homolog, long-term	1.726107859	MCOLN2	mucolipin	2	−2.378511623
	synaptic facilitation
PCNA	proliferating cell nuclear	1.725441599	DDX58	DEXD/H-box helicase 58	−2.378511623
	antigen
GJC2	gap junction protein	1.722978517	H2-OA	histocompatibility	2, O	−2.382329516
	gamma 2			region alpha locus(H2-Oa)
OLFR373	olfactory receptor	1.722466024	RARG	retinoic acid receptor	−2.388827772
	373(Olfr373)			gamma
H2-T24	histocompatibility	2, T	1.722466024	SERPINB1A	serine (or cysteine)	−2.392317423
	region locus 24(H2-T24)			peptidase inhibitor, clade B,
				member la(Serpinb1a)
AKAP7	A-kinase anchoring	1.722466024	GHRL	ghrelin/obestatin	−2.392317423
	protein 7			prepropeptide
NDUFB7	NADH:ubiquinone	1.722466024	ZMAT4	zinc finger matrin-type 4	−2.392317423
	oxidoreductase subunit
	B7
PRR11	proline rich 11	1.722466024	BTBD6	BTB domain containing 6	−2.392897478
TJP1	tight junction protein 1	1.722466024	KLRA16	killer cell lectin-like	−2.394534969
				receptor, subfamily A,
				member 16(Klra16)
S100A3	S100 calcium binding	1.722466024	EPS15L1	epidermal growth factor	−2.397012831
	protein A3			receptor pathway substrate
				15 like 1
KRT78	keratin 78	1.718729711	VCPIP1	valosin containing protein	−2.397303585
				interacting protein 1
GMDS	GDP-mannose 4,6-	1.717904741	RRP7A	ribosomal RNA processing	−2.404992223
	dehydratase			7 homolog A
PDGFB	platelet derived growth	1.714400534	IL1B	interleukin	1 beta	−2.40599236
	factor subunit B
SLC36A1	solute carrier family 36	1.714297338	NAT14	N-acetyltransferase 14	−2.40599236
	member 1			(putative)
RSU1	Ras suppressor protein 1	1.712647036	SLC40A1	solute carrier family 40	−2.40599236
				member 1
STX12	syntaxin	12	1.711911478	RAB37	RAB37, member RAS	−2.40599236
				oncogene family
SLC25A34	solute carrier family 25	1.711494907	IL 17RA	interleukin	17 receptor A	−2.40599236
	member 34
AFG3L2	AFG3 like matrix AAA	1.711057	BACE1	beta-secretase 1	−2.40599236
	peptidase subunit 2
RPL24	ribosomal protein L24	1.709193708	CTNS	cystinosin, lysosomal	−2.40599236
				cystine transporter
UBE3C	ubiquitin protein ligase	1.708789682	IFIT3	interferon induced protein	−2.411404504
	E3C			with tetratricopeptide
				repeats
3
CAR12	carbonic anhydrase	1.70867626	ZFYVE21	zinc finger FYVE-type	−2.412378292
	12(Car12)			containing 21
ZFP207	zinc finger protein	1.707603009	1700016D06RIK	Description Not Found	−2.419538892
	207(Zfp207)
XIST	X inactive specific	1.706065607	STK25	serine/threonine kinase 25	−2.419538892
	transcript (non-protein
	coding)
NCAPD2	non-SMC condensin I	1.705012178	PLEKHJ1	pleckstrin homology	−2.419538892
	complex subunit D2			domain containing J1
ZSWIM2	zinc finger SWIM-type	1.704802998	TGIF2	TGFB induced factor	−2.419538892
	containing 2			homeobox 2
CASP1	caspase	1	1.70065942	SLC25A29	solute carrier family 25	−2.419538892
				member 29
OLFR701	olfactory receptor	1.700439718	DAPL1	death associated protein like	−2.419661316
	701(Olfr701)			1
CBLC	Cbl proto-oncogene C	1.700439718	P2RX4	purinergic receptor P2X 4	−2.425748008
HIST1H2AC	histone cluster	1, H2ac	1.700439718	1700001O22RIK	Description Not Found	−2.426264755
EPHA10	EPH receptor A10	1.700439718	C9	complement component 9	−2.429615964
NDUFC2	NADH:ubiquinone	1.700439718	KLF13	Kruppel like factor 13	−2.430628023
	oxidoreductase subunit
	C2
DLG1	discs large MAGUK	1.700439718	GADD45A	growth arrest and DNA	−2.432591239
	scaffold protein 1			damage inducible alpha
SCN10A	sodium voltage-gated	1.700439718	OLFR788	olfactory receptor	−2.432959407
	channel alpha subunit 10			788(Olfr788)
RGL3	ral guanine nucleotide	1.700439718	FADS6	fatty acid desaturase 6	−2.432959407
	dissociation stimulator
	like 3
TMCO3	transmembrane and	1.700439718	CHCHD2	coiled-coil-helix-coiled-	−2.432959407
	coiled-coil domains 3			coil-helix domain
				containing 2
BCL2L14	BCL2 like 14	1.700439718	MPPE1	metallophosphoesterase	1	−2.432959407
THOP1	thimet oligopeptidase	1	1.700290033	CHAC1	ChaC glutathione specific	−2.432959407
				gamma-
				glutamylcyclotransferase 1
MTIF3	mitochondrial	1.698305331	2310011J03RIK	Description Not Found	−2.435017448
	translational initiation
	factor
3
XDH	xanthine dehydrogenase	1.697717724	LRSAM1	leucine rich repeat and	−2.437473925
				sterile alpha motif
				containing 1
ANXA9	annexin A9	1.697184071	SIRPA	signal regulatory protein	−2.443125132
				alpha
OLFR1502	olfactory receptor	1.694046727	CYP24A1	cytochrome P450 family 24	−2.44625623
	1502(Olfr1502)			subfamily A member 1
HCFC2	host cell factor C2	1.693780609	NQO1	NAD(P)H quinone	−2.44625623
				dehydrogenase 1
DIDO1	death inducer-obliterator	1.693596948	HRH4	histamine receptor H4	−2.44625623
	1
PGAM1	phosphoglycerate mutase	1.689846917	NUDCD1	NudC domain containing 1	−2.44625623
	1
RASGEFIC	RasGEF domain family	1.689299161	CCND1	cyclin D1	−2.447924527
	member 1C
SLC25A42	solute carrier family 25	1.686774817	ADAM22	ADAM metallopeptidase	−2.452858965
	member 42			domain 22
CPT2	carnitine	1.686364794	MDK	midkine (neurite growth-	−2.456149035
	palmitoyltransferase 2			promoting factor 2)
MAD2L1	MAD2 mitotic arrest	1.686161103	STX1A	syntaxin 1A	−2.456729828
	deficient-like 1 (yeast)
NQO2	NAD(P)H quinone	1.685558757	HEMK1	HemK methyltransferase	−2.459431619
	dehydrogenase 2			family member 1
HIP1R	huntingtin interacting	1.685473307	B4GALT7	beta-1,4-	−2.459431619
	protein 1 related			galactosyltransferase	7
ALOX12E	arachidonate	1.684373244	ASXL2	additional sex combs like 2,	−2.459431619
	lipoxygenase,			transcriptional regulator
	epidermal(Alox12e)
LMAN1	lectin, mannose binding 1	1.683514205	TLR7	toll like receptor 7	−2.46052038
ASB3	ankyrin repeat and SOCS	1.680142991	TDP1	tyrosyl-DNA	−2.464461869
	box containing 3			phosphodiesterase 1
XKR5	XK related 5	1.679254438	1700025G04RIK	Description Not Found	−2.469303076
ZFP235	zinc finger protein	1.678071905	SLC16A6	solute carrier family 16	−2.471045434
	235(Zfp235)			member 6
OLFR971	olfactory receptor	1.678071905	DOXL2	diamine oxidase-like	−2.472487771
	971(Olfr971)			protein 2(Dox12)
OLFR374	olfactory receptor	1.678071905	PKD1L3	polycystin	1 like 3, transient	−2.472487771
	374(Olfr374)			receptor potential channel
				interacting
NOS1AP	nitric oxide synthase 1	1.678071905	ZC3H11A	zinc finger CCCH-type	−2.472487771
	adaptor protein			containing 11A
GALM	galactose mutarotase	1.678071905	LY6K	lymphocyte antigen	6	−2.472487771
				complex, locus K
MEGF9	multiple EGF like	1.678071905	KLF7	Kruppel like factor 7	−2.474755307
	domains 9
CCDC66	coiled-coil domain	1.678071905	BTLA	B and T lymphocyte	−2.475604026
	containing 66			associated
LRRC40	leucine rich repeat	1.678071905	CDON	cell adhesion associated,	−2.485426827
	containing 40			oncogene regulated
RALA	RALA Ras like proto-	1.678071905	DDC	dopa decarboxylase	−2.485426827
	oncogene A
YIPF4	Yip1 domain family	1.678071905	GTF2A2	general transcription factor	−2.485426827
	member 4			IIA subunit 2
TAL2	T-cell acute lymphocytic	1.678071905	DTX4	deltex E3 ubiquitin ligase 4	−2.485426827
	leukemia 2
LRRC8A	leucine rich repeat	1.678071905	GSTK1	glutathione S-transferase	−2.486195934
	containing 8 family			kappa	1
	member A
APOM	apolipoprotein M	1.678071905	OLFR213	olfactory receptor	−2.489125048
				213(Olfr213)
KCNG3	potassium voltage-gated	1.678071905	PDE5A	phosphodiesterase 5A	−2.490571469
	channel modifier
	subfamily G member 3
CNN1	calponin	1	1.678071905	TOB1	transducer of ERBB2, 1	−2.496763907
STAC2	SH3 and cysteine rich	1.678071905	1700109H08RIK	Description Not Found	−2.498250868
	domain 2
SFRP2	secreted frizzled related	1.678071905	LEFTY1	left-right determination	−2.498250868
	protein 2			factor 1
SERPINB9E	serine (or cysteine)	1.670169131	SNAPC4	small nuclear RNA	−2.500878922
	peptidase inhibitor, clade			activating complex
	B, member 9e(Serpinb9e)			polypeptide 4
TFB1M	transcription factor B1,	1.668946692	RNF41	ring finger protein 41	−2.503551585
	mitochondrial
SLC25A10	solute carrier family 25	1.668856925	KLHL34	kelch like family member	−2.504620392
	member 10			34
BID	BH3 interacting domain	1.667992567	SSH2	slingshot protein	−2.505492762
	death agonist			phosphatase	2
MRPS27	mitochondrial ribosomal	1.667295766	CAMK2B	calcium/calmodulin	−2.507047355
	protein S27			dependent protein kinase II
				beta
NEDD4	neural precursor cell	1.666756592	IRF7	interferon regulatory factor	−2.507590939
	expressed,			7
	developmentally down-
	regulated 4, E3 ubiquitin
	protein ligase
VANGL2	VANGL planar cell	1.666756592	SCML4	sex comb on midleg-like 4	−2.523118672
	polarity protein 2			(Drosophila)
UBE2R2	ubiquitin conjugating	1.666641116	EPB4.1	Description Not Found	−2.523561956
	enzyme E2 R2
KLHL30	kelch like family member	1.666519523	PARP12	poly(ADP-ribose)	−2.523561956
	30			polymerase family member
				12
FBXO36	F-box protein 36	1.665588375	CACNB3	calcium voltage-gated	−2.529877218
				channel auxiliary subunit
				beta
3
DCT	dopachrome tautomerase	1.664016818	NRG4	neuregulin 4	−2.53318567
CCDC120	coiled-coil domain	1.663931727	OLFR1383	olfactory receptor	−2.5360529
	containing 120			1383(Olfr1383)
TMEM38B	transmembrane protein	1.663455268	PTGR1	prostaglandin reductase	1	−2.5360529
	38B
ENDOD1	endonuclease domain	1.663327923	NFAM1	NFAT activating protein	−2.5360529
	containing 1			with ITAM motif 1
PTPRD	protein tyrosine	1.663215776	ARL4C	ADP ribosylation factor like	−2.5360529
	phosphatase, receptor			GTPase 4C
	type D
ARL3	ADP ribosylation factor	1.661690196	LACE1	lactation elevated 1	−2.5360529
	like GTPase 3
CDC37	cell division cycle 37	1.661567827	CDC14B	cell division cycle 14B	−2.545350645
MKKS	McKusick-Kaufman	1.66106548	GUCA1A	guanylate cyclase activator	−2.548436625
	syndrome			1A
CHN2	chimerin	2	1.660998764	KIF21B	kinesin family member 21B	−2.554588852
CRTAP	cartilage associated	1.659431912	ARID3B	AT-rich interaction domain	−2.558087884
	protein			3B
CXCR6	C-X-C motif chemokine	1.657515938	HBA-A1	hemoglobin alpha, adult	−2.560714954
	receptor 6			chain 1(Hba-a1)
BUB1B	BUB1 mitotic checkpoint	1.65691495	CSF2RB2	colony stimulating factor 2	−2.560714954
	serine/threonine kinase B			receptor, beta 2, low-
				affinity (granulocyte-
				macrophage)(Csf2rb2)
B430306N03RIK	RIKEN cDNA	1.655351829	ATP6V1B1	ATPase H+ transporting V1	−2.560714954
	B430306N03			subunit B1
	gene(B430306N03Rik)
OLFR1262	olfactory receptor	1.655351829	PCSK1N	proprotein convertase	−2.560714954
	1262(Olfr1262)			subtilisin/kexin type 1
				inhibitor
SLC38A5	solute carrier family 38	1.655351829	ZFP667	zinc finger protein	−2.566670372
	member 5			667(Zfp667)
VAT1L	vesicle amine transport 1-	1.655351829	SH3BP1	SH3 domain binding	−2.566734604
	like			protein 1
HOXB7	homeobox B7	1.655351829	FFAR2	free fatty acid receptor 2	−2.572889668
GAN	gigaxonin	1.655351829	EEF2K	eukaryotic elongation factor	−2.572889668
				2 kinase
MMP28	matrix metallopeptidase	1.655351829	SLPI	secretory leukocyte	−2.574721828
	28			peptidase inhibitor
METTL10	methyltransferase like 10	1.655351829	CMA1	chymase	1	−2.584962501
SIX4	SIX homeobox 4	1.655351829	ASCL1	achaete-scute family bHLH	−2.584962501
				transcription factor 1
TDRD6	tudor domain containing 6	1.655351829	ACPP	acid phosphatase, prostate	−2.584962501
COMMD5	COMM domain	1.654604999	CLCNKB	chloride voltage-gated	−2.596935142
	containing 5			channel Kb
PRDX4	peroxiredoxin
4	1.651923925	FBXW7	F-box and WD repeat	−2.596935142
				domain containing 7
HS3ST3A1	heparan sulfate-	1.649298274	OLIG3	oligodendrocyte	−2.596935142
	glucosamine 3-			transcription factor 3
	sulfotransferase 3A1
CALCA	calcitonin related	1.649067786	WHRN	whirlin	−2.606789951
	polypeptide alpha
SLC12A2	solute carrier family 12	1.648449243	DNAJC14	DnaJ heat shock protein	−2.608809243
	member 2			family (Hsp40) member
				C14
TJP2	tight junction protein 2	1.644145647	PIGT	phosphatidylinositol glycan	−2.611031218
				anchor biosynthesis class T
LRRC16B	Description Not Found	1.64385619	AP1G2	adaptor related protein	−2.614709844
				complex 1 gamma 2 subunit
AP3S2	adaptor related protein	1.64385619	SAA2	serum amyloid A2	−2.62058641
	complex 3 sigma 2
	subunit
PSMD9	proteasome 26S subunit,	1.64385619	USP30	ubiquitin specific peptidase	−2.62058641
	non-ATPase 9			30
PARD6G	par-6 family cell polarity	1.643379419	RPE65	retinal pigment epithelium	−2.632268216
	regulator gamma			specific protein 65
CIAPIN1	cytokine induced	1.643219709	CML1	Description Not Found	−2.634891632
	apoptosis inhibitor 1
CKAP5	cytoskeleton associated	1.642747156	SLC6A19	solute carrier family 6	−2.640930751
	protein 5			member 19
E430025E21RIK	RIKEN cDNA	1.641902626	FGF15	fibroblast growth factor	−2.64385619
	E430025E21			15(Fgf15)
	gene(E430025E21Rik)
PIAS3	protein inhibitor of	1.641884484	HERC3	HECT and RLD domain	−2.64385619
	activated STAT 3			containing E3 ubiquitin
				protein ligase
3
USP1	ubiquitin specific	1.640233791	ADAMTSL4	ADAMTS like 4	−2.64385619
	peptidase 1
RAB3GAP2	RAB3 GTPase activating	1.639592623	HYAL3	hyaluronoglucosaminidase	−2.64385619
	non-catalytic protein			3
	subunit 2
CSRP2	cysteine and glycine rich	1.639046229	SLC15A2	solute carrier family 15	−2.648217996
	protein 2			member 2
MOV10	Mov10 RISC complex	1.638073837	UFSP1	UFM1-specific peptidase 1	−2.649553823
	RNA helicase			(inactive)
GM1965	predicted gene	1.637881562	6430573F11RIK	Description Not Found	−2.655351829
	1965(Gm1965)
POMGNT1	protein O-linked mannose	1.636237884	DNM3OS	DNM3 opposite	−2.655351829
	N-			strand/antisense RNA
	acetylglucosaminyltransfe
	rase 1 (beta 1,2-)
FIGNL1	fidgetin like 1	1.633950492	F2RL1	F2R like trypsin receptor 1	−2.655351829
TMEM177	transmembrane protein	1.633475547	SNX33	sorting nexin 33	−2.666654581
	177
ALX4	ALX homeobox 4	1.632864872	CXCL9	C-X-C motif chemokine	−2.666756592
				ligand 9
OLFR533	olfactory receptor	1.632268216	TEAD2	TEA domain transcription	−2.666756592
	533(Olfr533)			factor 2
H2-M10.3	histocompatibility 2, M	1.632268216	QSOX1	quiescin sulfhydryl oxidase	−2.666756592
	region locus 10.3(H2-			1
	M10.3)
GPX7	glutathione peroxidase	7	1.632268216	TLR13	toll-like receptor 13(Tlr13)	−2.678071905
STXBP6	syntaxin binding protein 6	1.632268216	SCD3	stearoyl-coenzyme A	−2.678071905
				desaturase 3(Scd3)
RAB33A	RAB33A, member RAS	1.632268216	SDC3	syndecan	3	−2.678071905
	oncogene family
PDCL3	phosducin like 3	1.632268216	GRPR	gastrin releasing peptide	−2.678071905
				receptor
GPR20	G protein-coupled	1.632268216	MAFK	MAF bZIP transcription	−2.678071905
	receptor 20			factor K
GSTA2	glutathione S-transferase	1.632268216	DIRC2	disrupted in renal	−2.678071905
	alpha 2			carcinoma 2
ADCY10	adenylate cyclase	10	1.632268216	ZCCHC12	zinc finger CCHC-type	−2.67833354
	(soluble)			containing 12
PEX12	peroxisomal biogenesis	1.632268216	ADCY6	adenylate cyclase	6	−2.680886921
	factor 12
IQCC	IQ motif containing C	1.632268216	ECM1	extracellular matrix protein	−2.68345512
				1
ENPP1	ectonucleotide	1.632086279	AFP	alpha fetoprotein	−2.689299161
	pyrophosphatase/
	phosphodiesterase 1
ADAL	adenosine deaminase-like	1.630664126	GP5	glycoprotein V platelet	−2.689299161
SCRN2	secernin	2	1.630566247	GAB3	GRB2 associated binding	−2.691405681
				protein 3
CEP78	centrosomal protein 78	1.629851642	USP2	ubiquitin specific peptidase	−2.693334369
				2
SLC25A15	solute carrier family 25	1.629798606	PLXNB1	plexin B1	−2.700439718
	member 15
ADSSL1	adenylosuccinate synthase	1.628272149	PODXL2	podocalyxin like 2	−2.700799925
	like 1
TM6SF2	transmembrane 6	1.627758638	RAD9B	RAD9 checkpoint clamp	−2.70103836
	superfamily member 2			component B
TUBG1	tubulin gamma 1	1.624511879	AKAP10	A-kinase anchoring protein	−2.705977902
				10
FASTK	Fas activated	1.623336662	PIGW	phosphatidylinositol glycan	−2.716990894
	serine/threonine kinase			anchor biosynthesis class W
RBBP5	RB binding protein 5,	1.622163711	COL12A1	collagen type XII alpha 1	−2.722466024
	histone lysine			chain
	methyltransferase
	complex subunit
1700071K01RIK	Description Not Found	1.621465074	GPR137B	G protein-coupled receptor	−2.733354341
				137B
SLC25A33	solute carrier family 25	1.621282718	IMMP2L	inner mitochondrial	−2.733354341
	member 33			membrane peptidase
				subunit
2
MDM4	MDM4, p53 regulator	1.62058641	PIK3CB	phosphatidylinositol-4,5-	−2.737320423
				bisphosphate 3-kinase
				catalytic subunit beta
TOP2A	topoisomerase (DNA) II	1.620374948	TGFBI	transforming growth factor	−2.740276443
	alpha			beta induced
OLFR139	olfactory receptor	1.619731323	ZFP106	zinc finger protein	−2.744161096
	139(Olfr139)			106(Zfp106)
PAPLN	papilin, proteoglycan like	1.618762248	ARNTL	aryl hydrocarbon receptor	−2.744161096
	sulfated glycoprotein			nuclear translocator like
PACSIN2	protein kinase C and	1.617401771	HS3ST3B1	heparan sulfate-	−2.744161096
	casein kinase substrate in			glucosamine 3-
	neurons 2			sulfotransferase 3B1
TRDMT1	tRNA aspartic acid	1.615239219	OASL2	2′-5′ oligoadenylate	−2.744892108
	methyltransferase 1			synthetase-like 2(Oas12)
4932438H23RIK	Description Not Found	1.614681809	PRDX6	peroxiredoxin 6	−2.75084462
SPAG9	sperm associated antigen	1.614567709	RASA2	RAS p21 protein activator 2	−2.751203108
	9
RPA3	replication protein A3	1.61436984	HOXB2	homeobox B2	−2.754887502
GNPTAB	N-acetylglucosamine-1-	1.613298199	TULP3	tubby like protein 3	−2.754887502
	phosphate transferase
	alpha and beta subunits
SNX9	sorting nexin 9	1.609251493	MFRP	membrane frizzled-related	−2.754887502
				protein
OLFR550	olfactory receptor	1.609195813	MEN1	menin 1	−2.757556689
	550(Olfr550)
ZFP160	zinc finger protein	1.608809243	C330021F23RIK	RIKEN cDNA	−2.762199201
	160(Zfp160)			C330021F23
				gene(C330021F23Rik)
TAS2R129	taste receptor, type 2,	1.608809243	CSTAD	CSA-conditional, T cell	−2.765534746
	member 129(Tas2r129)			activation-dependent
				protein(Cstad)
OLFR371	olfactory receptor	1.608809243	ALDH5A1	aldehyde dehydrogenase 5	−2.773022439
	371(Olfr371)			family member A1
OLFR281	olfactory receptor	1.608809243	EPM2AIP1	EPM2A interacting protein	−2.773468928
	281(Olfr281)			1
OLFR195	olfactory receptor	1.608809243	PDE8B	phosphodiesterase 8B	−2.776103988
	195(Olfr195)
OLFR142	olfactory receptor	1.608809243	DMRTA1	DMRT like family A1	−2.776184379
	142(Olfr142)
PRSS3	protease, serine 3	1.608809243	LYPD6B	LY6/PLAUR domain	−2.780048768
				containing 6B
CX3CL1	C-X3-C motif chemokine	1.608809243	CD300E	CD300e molecule	−2.786596362
	ligand 1
TMPRSS6	transmembrane protease,	1.608809243	NPFF	neuropeptide FF-amide	−2.786596362
	serine 6			peptide precursor
ALK	anaplastic lymphoma	1.608809243	FASTKD1	FAST kinase domains 1	−2.793765229
	receptor tyrosine kinase
ITGA9	integrin subunit alpha 9	1.608809243	OLFR802	olfactory receptor	−2.797012978
				802(Olfr802)
TIMM13	translocase of inner	1.608809243	HIVEP1	human immunodeficiency	−2.797012978
	mitochondrial membrane			virus type I enhancer
	13			binding protein 1
MSH5	mutS homolog	5	1.608809243	HIC1	hypermethylated in cancer 1	−2.797012978
XPO4	exportin	4	1.605818241	TRIM33	tripartite motif containing	−2.802009226
				33
MED21	mediator complex subunit	1.603309406	SELL	selectin L	−2.803274253
CHST12	carbohydrate	1.602612589	EPHX1	epoxide hydrolase	1	−2.803758579
	sulfotransferase 12
6030408B16RIK	Description Not Found	1.602195565	BCL9	B-cell CLL/lymphoma 9	−2.807354922
SLU7	SLU7 homolog, splicing	1.601548066	STAT2	signal transducer and	−2.808521822
	factor			activator of transcription 2
CDK5RAP2	CDK5 regulatory subunit	1.601120229	ELMO3	engulfment and cell motility	−2.812498225
	associated protein 2			3
CASP7	caspase	7	1.6002402	HDC	histidine decarboxylase	−2.815167456
KIF22	kinesin family member 22	1.599011705	AI317395	Description Not Found	−2.817623258
E2F1	E2F transcription factor 1	1.598449678	RPL14	ribosomal protein L14	−2.817623258
MXI1	MAX interactor 1,	1.597690116	SNAI1	snail family transcriptional	−2.818256244
	dimerization protein			repressor	1
DONSON	downstream neighbor of	1.596935142	NUPR1	nuclear protein 1,	−2.827819025
	SON			transcriptional regulator
TBX22	T-box 22	1.596935142	IGSF8	immunoglobulin	−2.827819025
				superfamily member 8
INPPL1	inositol polyphosphate	1.596300192	SLC12A7	solute carrier family 12	−2.827819025
	phosphatase like 1			member 7
CSE1L	chromosome segregation	1.59586273	RENBP	renin binding protein	−2.837431463
	1 like
NDFIP2	Nedd4 family interacting	1.594709608	ZFP553	zinc finger protein	−2.837943242
	protein 2			553(Zfp553)
LYPD6	LY6/PLAUR domain	1.592962293	LRFN2	leucine rich repeat and	−2.837943242
	containing 6			fibronectin type III domain
				containing 2
DDX49	DEAD-box helicase 49	1.592190323	HP	haptoglobin	−2.839737506
MGLL	monoglyceride lipase	1.590948822	TOMM40	translocase of outer	−2.847996907
				mitochondrial membrane 40
NR4A3	nuclear receptor	1.59092994	GABARAPL2	GABA type A receptor	−2.847996907
	subfamily 4 group A			associated protein like 2
	member 3
LRRN3	leucine rich repeat	1.590360181	TMEM86A	transmembrane protein 86A	−2.855497819
	neuronal 3
PTPRK	protein tyrosine	1.587927102	LRP1	LDL receptor related	−2.857980995
	phosphatase, receptor			protein	1
	type K
OLFR1212	olfactory receptor	1.584962501	ATXN1	ataxin 1	−2.857980995
	1212(Olfr1212)
KLHL2	kelch like family member	1.584962501	FAS	Fas cell surface death	−2.861524641
	2			receptor
UBE2G2	ubiquitin conjugating	1.584962501	ZDHHC18	zinc finger DHHC-type	−2.882740655
	enzyme E2 G2			containing 18
GRIN2A	glutamate ionotropic	1.584962501	LARGE	Description Not Found	−2.887525271
	receptor NMDA type
	subunit 2A
INHA	inhibin alpha subunit	1.584962501	SP5	Sp5 transcription factor	−2.887525271
RNPC3	RNA binding region	1.584962501	ATG7	autophagy related 7	−2.895440528
	(RNP1, RRM) containing
	3
XKR7	XK related 7	1.584962501	DNAJC27	DnaJ heat shock protein	−2.897240426
				family (Hsp40) member
				C27
STX19	syntaxin 19	1.584962501	PCSK4	proprotein convertase	−2.900866808
				subtilisin/kexin type 4
SLC5A5	solute carrier family 5	1.584962501	RNF141	ring finger protein 141	−2.902073579
	member 5
VPS37C	VPS37C, ESCRT-I	1.584022655	GRAP2	GRB2-related adaptor	−2.904150467
	subunit			protein	2
ERMP1	endoplasmic reticulum	1.582531434	VIPR1	vasoactive intestinal peptide	−2.904484098
	metallopeptidase 1			receptor 1
ZFP790	zinc finger protein	1.581046002	CAR15	carbonic anhydrase	−2.906890596
	790(Zfp790)			15(Car15)
AA467197	expressed sequence	1.579947242	RELL2	RELT like 2	−2.906890596
	AA467197(AA467197)
UBE2Z	ubiquitin conjugating	1.57976541	HECA	hdc homolog, cell cycle	−2.916545968
	enzyme E2 Z			regulator
SOAT2	sterol O-acyltransferase 2	1.577460518	DPM1	dolichyl-phosphate	−2.933100475
				mannosyltransferase
				polypeptide
1, catalytic
				subunit
ZMAT5	zinc finger matrin-type 5	1.576986214	AOC2	amine oxidase, copper	−2.936235748
				containing 2
CDCA3	cell division cycle	1.576323153	HIST2H2BE	histone cluster	2, H2be	−2.936320631
	associated 3
NEUROD2	neuronal differentiation 2	1.576266476	ACAD10	acyl-CoA dehydrogenase	−2.942514505
				family member 10
WDR35	WD repeat domain 35	1.576120636	NT5E	5′-nucleotidase ecto	−2.944039663
TWSG1	twisted gastrulation BMP	1.5758728	SSH1	slingshot protein	−2.944858446
	signaling modulator 1			phosphatase 1
PPT1	palmitoyl-protein	1.575321868	SEMA4F	ssemaphorin 4F	−2.948329995
	thioesterase 1
IRF8	interferon regulatory	1.574489283	NKD2	naked cuticle homolog 2	−2.953960396
	factor 8
PLEKHG5	pleckstrin homology and	1.574066379	TCEB3	transcription elongation	−2.95419631
	RhoGEF domain			factor B subunit 3
	containing G5
CDC20	cell division cycle 20	1.573718243	HDAC4	histone deacetylase	4	−2.95419631
MFI2	antigen p97 (melanoma	1.572889668	PCNX	pecanex homolog	−2.972692654
	associated) identified by			(Drosophila)(Pcnx)
	monoclonal antibodies
	133.2 and 96.5(Mfi2)
HDAC9	histone deacetylase	9	1.571625208	ARL5C	ADP ribosylation factor like	−2.972692654
				GTPase 5C
ASF1B	anti-silencing function 1B	1.570544039	1600014C10RIK	Description Not Found	−2.981852653
	histone chaperone
B3GNT1	Description Not Found	1.569171715	ANKRD23	ankyrin repeat domain 23	−2.981852653
SLC25A14	solute carrier family 25	1.569127395	CLOCK	clock circadian regulator	−2.985543793
	member 14
FYN	FYN proto-oncogene, Src	1.567462919	SFI1	SFI1 centrin binding protein	−2.986410935
	family tyrosine kinase
SERPINB6B	serine (or cysteine)	1.567348435	HEY1	hes related family bHLH	−2.987632559
	peptidase inhibitor, clade			transcription factor with
	B, member 6b(Serpinb6b)			YRPW motif 1
TOP1MT	topoisomerase (DNA) I,	1.567180597	ATP11C	ATPase phospholipid	−2.99095486
	mitochondrial			transporting 11C
CCDC50	coiled-coil domain	1.566273906	NUDCD3	NudC domain containing 3	−3
	containing 50
ZFP414	zinc finger protein	1.565776574	CDC25A	cell division cycle 25A	−3.000238201
	414(Zfp414)
OGFOD2	2-oxoglutarate and iron	1.565512016	OLFR135	olfactory receptor	−3.017921908
	dependent oxygenase			135(Olfr135)
	domain containing 2
CTNNAL1	catenin alpha like 1	1.563586461	RC3H1	ring finger and CCCH-type	−3.019621529
				domains 1
CREB3L2	CAMP responsive element	1.561361122	NSG2	neuron specific gene family	−3.020466888
	binding protein 3 like 2			member 2(Nsg2)
OLFR492	olfactory receptor	1.560714954	ID1	inhibitor of DNA binding 1,	−3.026800059
	492(Olfr492)			HLH protein
OLFR1312	olfactory receptor	1.560714954	CYP2D22	cytochrome P450, family 2,	−3.044282215
	1312(Olfr1312)			subfamily d, polypeptide
				22(Cyp2d22)
UPK2	uroplakin 2	1.560714954	H2AFJ	H2A histone family	−3.044297135
				member J
RESP18	regulated endocrine	1.560714954	TGFBR3	transforming growth factor	−3.053111336
	specific protein 18			beta receptor 3
CRCT1	cysteine rich C-terminal 1	1.560714954	IRS2	insulin receptor substrate 2	−3.061776198
NEUROD4	neuronal differentiation 4	1.560714954	ADCY7	adenylate cyclase	7	−3.06608919
SENP1	SUMO1/sentrin specific	1.560714954	HYI	hydroxypyruvate isomerase	−3.072315809
	peptidase 1			(putative)
MR1	major histocompatibility	1.560714954	TRIP4	thyroid hormone receptor	−3.078951341
	complex, class I-related			interactor	4
BIVM	basic, immunoglobulin-	1.560714954	D730001G18RIK	RIKEN cDNA	−3.087462841
	like variable motif			D730001G18
	containing			gene(D730001G18Rik)
KPNA2	karyopherin subunit alpha	1.560714954	PRR7	proline rich 7 (synaptic)	−3.087462841
	2
BAG2	BCL2 associated	1.560714954	GFPT2	glutamine-fructose-6-	−3.09592442
	athanogene 2			phosphate transaminase 2
SLC12A8	solute carrier family 12	1.560714954	SCMH1	sex comb on midleg	−3.100136671
	member 8			homolog 1 (Drosophila)
SCN7A	sodium voltage-gated	1.560714954	ANKRD12	ankyrin repeat domain 12	−3.107456458
	channel alpha subunit 7
SLC5A7	solute carrier family 5	1.560714954	PTPRV	protein tyrosine	−3.112700133
	member 7			phosphatase, receptor type,
				V(Ptprv)
ENPEP	glutamyl aminopeptidase	1.560714954	TMEM135	transmembrane protein 135	−3.112700133
ANGPTL4	angiopoietin like 4	1.56060777	AKAP3	A-kinase anchoring protein	−3.11460665
				3
OSBPL3	oxysterol binding protein	1.559778376	CBR2	carbonyl reductase 2(Cbr2)	−3.129283017
	like 3
MCFD2	multiple coagulation	1.559617874	CXCL16	C-X-C motif chemokine	−3.129283017
	factor deficiency 2			ligand 16
MAP2K1	mitogen-activated protein	1.558556708	MBTD1	mbt domain containing 1	−3.145677455
	kinase kinase 1
ING2	inhibitor of growth family	1.557223521	UBE2J2	ubiquitin conjugating	−3.161887682
	member 2			enzyme E2 J2
CDCA5	cell division cycle	1.55643411	STK36	serine/threonine kinase 36	−3.161887682
	associated 5
MAP3K7	mitogen-activated protein	1.554463905	SLC14A1	solute carrier family 14	−3.16922072
	kinase kinase kinase 7			member 1 (Kidd blood
				group)
GSTT3	glutathione S-transferase,	1.55048277	CTSE	cathepsin E	−3.177917792
	theta 3(Gstt3)
PFN2	profilin	2	1.549690793	HSD3B7	hydroxy-delta-5-steroid	−3.177917792
				dehydrogenase, 3 beta- and
				steroid delta-isomerase 7
HPS4	HPS4, biogenesis of	1.549115647	3010003L21RIK	Description Not Found	−3.179249632
	lysosomal organelles
	complex
3 subunit 2
CAPN8	calpain	8	1.548436625	BAI1	Description Not Found	−3.186461055
RAB11FIP5	RAB11 family interacting	1.548436625	ZFP451	zinc finger protein	−3.187711618
	protein 5			451(Zfp451)
CD9	CD9 molecule	1.548429184	CCDC28B	coiled-coil domain	−3.192207249
				containing 28B
CCR6	C-C motif chemokine	1.548250633	MCF2L	MCF.2 cell line derived	−3.199672345
	receptor 6			transforming sequence like
ALG2	ALG2, alpha-1,3/1,6-	1.547992668	BCL6	B-cell CLL/lymphoma 6	−3.201024389
	mannosyltransferase
BCDIN3D	BCDIN3 domain	1.546046129	PFKFB4	6-phosphofructo-2-	−3.204935584
	containing RNA			kinase/fructose-2,6-
	methyltransferase			biphosphatase	4
NT5DC3	5′-nucleotidase domain	1.54522349	PROS1	protein S (alpha)	−3.209453366
	containing 3
DNAJC18	DnaJ heat shock protein	1.544626916	CTSH	cathepsin H	−3.21628737
	family (Hsp40) member
	C18
SH3RF1	SH3 domain containing	1.544156019	CRTC3	CREB regulated	−3.217230716
	ring finger 1			transcription coactivator 3
RGS16	regulator of G-protein	1.541382294	TNKS	tankyrase	−3.217230716
	signaling 16
NCAPH	non-SMC condensin I	1.540788228	GRM6	glutamate metabotropic	−3.224966365
	complex subunit H			receptor	6
USP14	ubiquitin specific	1.540333713	SPSB1	splA/ryanodine receptor	−3.255500733
	peptidase 14			domain and SOCS box
				containing 1
RFT1	RFT1 homolog	1.54031759	PARP8	poly(ADP-ribose)	−3.263034406
				polymerase family member
				8
SLC31A1	solute carrier family 31	1.540275536	KCNRG	potassium channel regulator	−3.263034406
	member 1
TCTEX1D2	Tctex1 domain containing	1.538332378	POU6F1	POU class 6 homeobox 1	−3.268517714
	2
TTF2	transcription termination	1.537871953	REV3L	REV3 like, DNA directed	−3.270528942
	factor 2			polymerase zeta catalytic
				subunit
ZFP7	zinc finger protein	1.5360529	TCF7	transcription factor 7 (T-cell	−3.272419178
	7(Zfp7)			specific, HMG-box)
G6PD2	glucose-6-phosphate	1.5360529	NME4	NME/NM23 nucleoside	−3.283551423
	dehydrogenase 2(G6pd2)			diphosphate kinase 4
DEFB14	defensin beta 14(Defb14)	1.5360529	PLAUR	plasminogen activator,	−3.285402219
				urokinase receptor
SLC18A3	solute carrier family 18	1.5360529	CD4	CD4 molecule	−3.285402219
	member A3
AHNAK2	AHNAK nucleoprotein 2	1.5360529	ZMYND11	zinc finger MYND-type	−3.293186363
				containing 11
HOXC12	homeobox C12	1.5360529	ARMCX5	armadillo repeat containing,	−3.298404158
				X-linked 5
CEACAM16	carcinoembryonic antigen	1.5360529	LPHN1	Description Not Found	−3.300123725
	related cell adhesion
	molecule
16
MOSPD3	motile sperm domain	1.5360529	PIK3IP1	phosphoinositide-3-kinase	−3.307428525
	containing 3			interacting protein 1
DCTN1	dynactin subunit	1	1.5360529	ERDR1	erythroid differentiation	−3.317651188
				regulator 1(Erdr1)
MYB	MYB proto-oncogene,	1.5360529	PLD4	phospholipase D family	−3.328444792
	transcription factor			member	4
GLIPR1L2	GLI pathogenesis-related	1.5360529	BMF	Bcl2 modifying factor	−3.336283388
	1 like 2
ALDH1A3	aldehyde dehydrogenase	1.5360529	GALNT11	polypeptide N-	−3.345118795
	1 family member A3			acetylgalactosaminyl-
				transferase 11
SLC2A8	solute carrier family 2	1.5360529	LCN2	lipocalin	2	−3.378511623
	member 8
SRC	SRC proto-oncogene,	1.5360529	PAG1	phosphoprotein membrane	−3.385431037
	non-receptor tyrosine			anchor with
	kinase			glycosphingolipid
				microdomains
1
ZCCHC17	zinc finger CCHC-type	1.535618518	DTX1	deltex E3 ubiquitin ligase 1	−3.425576064
	containing 17
HNRNPUL1	heterogeneous nuclear	1.534420207	RFFL	ring finger and FYVE-like	−3.426684082
	ribonucleoprotein U like 1			domain containing E3
				ubiquitin protein ligase
TRIM68	tripartite motif containing	1.533057052	MAFF	MAF bZIP transcription	−3.429615964
	68			factor F
TPST1	tyrosylprotein	1.53140111	TOR1AIP2	torsin 1A interacting protein	−3.432316325
	sulfotransferase 1			2
OLFR922	olfactory receptor	1.531260941	SNN	stannin	−3.432316325
	922(Olfr922)
FIG4	FIG4 phosphoinositide 5-	1.530442167	CLEC4N	C-type lectin domain family	−3.433567144
	phosphatase			4, member n(Clec4n)
SETMAR	SET domain and mariner	1.530442167	RREB1	ras responsive element	−3.443780274
	transposase fusion gene			binding protein	1
GSTM5	glutathione S-transferase	1.530053218	CCDC84	coiled-coil domain	−3.445188687
	mu 5			containing 84
TUBA3B	tubulin, alpha	1.527986221	ID3	inhibitor of DNA binding 3,	−3.46350285
	3B(Tuba3b)			HLH protein
PDCL	phosducin like	1.527807072	BC065397	cDNA sequence	−3.465974465
				BC065397(BC065397)
SMPDL3B	sphingomyelin	1.527243888	VRK1	vaccinia related kinase 1	−3.46760555
	phosphodiesterase acid
	like 3B
ABHD14A	abhydrolase domain	1.527213882	HOXD13	homeobox D13	−3.491853096
	containing 14A
TIPIN	TIMELESS interacting	1.526972991	MAPK8IP2	mitogen-activated protein	−3.491853096
	protein			kinase	8 interacting protein
				2
DSCC1	DNA replication and	1.525986429	HOXA5	homeobox A5	−3.517275693
	sister chromatid cohesion
	1
PSMD1	proteasome 26S subunit,	1.525574957	HIST1H1A	histone cluster	1, Hla	−3.523561956
	non-ATPase 1
BZRAP1	benzodiazepine receptor	1.524166255	MAML1	mastermind like	−3.523603553
	associated protein			transcriptional coactivator 1
	1(Bzrap1)
ENO3	enolase	3	1.523778831	PTPDC1	protein tyrosine	−3.526694846
				phosphatase domain
				containing 1
E330034G19RIK	RIKEN cDNA	1.523561956	TNFRSF12A	tumor necrosis factor	−3.528725998
	E330034G19			receptor superfamily
	gene(E330034G19Rik)			member 12A
GABRP	gamma-aminobutyric acid	1.523561956	TNIP2	TNFAIP3 interacting	−3.539158811
	type A receptor pi subunit			protein	2
SLC14A2	solute carrier family 14	1.523561956	HIST2H4	histone cluster	2,	−3.540773411
	member 2			H4(Hist2h4)
YWHAE	tyrosine 3-	1.522478712	PIM2	Pim-2 proto-oncogene,	−3.557655155
	monooxygenase/tryptoph			serine/threonine kinase
	an 5-monooxygenase
	activation protein epsilon
EHBP1L1	EH domain binding	1.522282169	DOK7	docking protein	7	−3.567781854
	protein 1 like 1
CHGB	chromogranin B	1.51924262	TNFSF14	tumor necrosis factor	−3.588895735
				superfamily member 14
TXNRD2	thioredoxin reductase	2	1.519008256	TDRKH	tudor and KH domain	−3.590961241
				containing
NCF1	neutrophil cytosolic factor	1.518873761	FIBCD1	fibrinogen C domain	−3.608656121
	1			containing 1
OAF	out at first homolog	1.517431856	RBBP9	RB binding protein 9, serine	−3.608809243
				hydrolase
FAM110A	family with sequence	1.517263583	DERL1	derlin 1	−3.617651119
	similarity 110 member A
ANGEL1	angel homolog 1	1.515832566	LENG9	leukocyte receptor cluster	−3.62058641
	(Drosophila)			member 9
RTN4IP1	reticulon	4 interacting	1.515760776	TRPC2	transient receptor potential	−3.62058641
	protein 1			cation channel subfamily C
				member
2, pseudogene
LAMP2	lysosomal associated	1.515709038	CCDC134	coiled-coil domain	−3.632268216
	membrane protein 2			containing 134
KRT4	keratin	4	1.514299789	OAS2	2′-5′-oligoadenylate	−3.632268216
				synthetase 2
PAFAH1B3	platelet activating factor	1.5142935	2410127L17RIK	Description Not Found	−3.646738698
	acetylhydrolase 1b
	catalytic subunit 3
STT3A	STT3A, catalytic subunit	1.513537695	RSAD1	radical S-adenosyl	−3.649220471
	of the			methionine domain
	oligosaccharyltransferase			containing 1
	complex
PRKAR1B	protein kinase cAMP-	1.51340003	H2-DMB1	histocompatibility	2, class	−3.649615459
	dependent type I			II, locus Mb1(H2-DMb1)
	regulatory subunit beta
HIST1H2BB	histone cluster	1, H2bb	1.512941595	IFT81	intraflagellar transport 81	−3.673839056
ZFP39	zinc finger protein	1.511385424	MID1	midline	1	−3.683696454
	39(Zfp39)
PLK1	polo like kinase 1	1.511151166	DEPDC1B	DEP domain containing 1B	−3.683696454
1700028P14RIK	Description Not Found	1.510961919	SMAD3	SMAD family member 3	−3.716296166
D10BWG1379E	Description Not Found	1.510961919	UBTD1	ubiquitin domain containing	−3.716990894
				1
TREM3	triggering receptor	1.510961919	FBXO44	F-box protein 44	−3.738767837
	expressed on myeloid
	cells 3(Trem3)
GM128	predicted gene	1.510961919	KCNMB4	potassium calcium-	−3.741951111
	128(Gm128)			activated channel subfamily
				M regulatory beta subunit 4
OLFR741	olfactory receptor	1.510961919	FAIM3	Description Not Found	−3.754887502
	741(Olfr741)
OLFR523	olfactory receptor	1.510961919	CCM2	CCM2 scaffolding protein	−3.754887502
	523(Olfr523)
DCPP1	demilune cell and parotid	1.510961919	DAG1	dystroglycan	1	−3.760220946
	protein 1(Dcpp1)
RPRML	reprimo like	1.510961919	FCGR3	Fc receptor, IgG, low	−3.776103988
				affinity III(Fcgr3)
CHRD	chordin	1.510961919	ZNRF1	zinc and ring finger 1, E3	−3.776103988
				ubiquitin protein ligase
C5AR1	complement component	1.510961919	TLR1	toll like receptor 1	−3.786596362
	5a receptor 1
APOA2	apolipoprotein A2	1.510961919	HSD17B11	hydroxysteroid 17-beta	−3.789207575
				dehydrogenase 11
PRG2	proteoglycan	2, pro	1.510961919	ZPBP	zona pellucida binding	−3.887525271
	eosinophil major basic			protein
	protein
VCAM1	vascular cell adhesion	1.510961919	ZSWIM3	zinc finger SWIM-type	−3.892391026
	molecule 1			containing 3
LY6G5B	lymphocyte antigen	6	1.510961919	SOCS1	suppressor of cytokine	−3.892391026
	complex, locus G5B			signaling 1
AIM2	absent in melanoma 2	1.510961919	KLF9	Kruppel like factor 9	−3.902021342
DMBX1	diencephalon/	1.510961919	AHSA2	AHA1, activator of heat	−3.904760449
	mesencephalon			shock 90 kDa protein
	homeobox
1			ATPase homolog 2 (yeast)
HCN2	hyperpolarization	1.510961919	DDHD1	DDHD domain containing 1	−3.914086097
	activated cyclic
	nucleotide gated
	potassium channel
2
MRGPRF	MAS related GPR family	1.510961919	CNKSR3	CNKSR family member 3	−3.930737338
	member F
CYTH4	cytohesin
4	1.510961919	CPEB2	cytoplasmic	−4.017516295
				polyadenylation element
				binding protein
2
ANGPTL3	angiopoietin like 3	1.510961919	TRP53BP2	transformation related	−4.021932279
				protein 53 binding protein
				2(Trp53bp2)
DHX29	DEAH-box helicase 29	1.510667738	FAM178A	family with sequence	−4.03562391
				similarity 178, member
				A(Fam178a)
PMPCB	peptidase, mitochondrial	1.509477625	RCN3	reticulocalbin	3	−4.03562391
	processing beta subunit
HRH3	histamine receptor H3	1.508554002	SPTLC2	serine palmitoyltransferase	−4.040015679
				long chain base subunit 2
ZFP282	zinc finger protein	1.507419453	ZFP810	zinc finger protein	−4.070389328
	282(Zfp282)			810(Zfp810)
TBC1D7	TBC1 domain family	1.504847821	NAGA	alpha-N-	−4.074676686
	member 7			acetylgalactosaminidase
ARSB	arylsulfatase B	1.504845728	KLRA20	killer cell lectin-like	−4.078951341
				receptor subfamily A,
				member 20(Klra20)
RAD17	RAD17 checkpoint clamp	1.504177542	STK11IP	serine/threonine kinase 11	−4.083213368
	loader component			interacting protein
CMTM7	CKLF like MARVEL	1.503297831	KLF4	Kruppel like factor 4	−4.084306687
	transmembrane domain
	containing 7
NFKB2	nuclear factor kappa B	1.500363085	INADL	Description Not Found	−4.086667018
	subunit 2
TOP3A	topoisomerase (DNA) III	−1.50007357	URM1	ubiquitin related modifier 1	−4.0907078
	alpha
RAB33B	RAB33B, member RAS	−1.50054042	PELI1	pellino E3 ubiquitin protein	−4.093813673
	oncogene family			ligase	1
LYSMD1	LysM domain containing	−1.500614885	FBLN1	fibulin	1	−4.098032083
	1
POLG2	polymerase (DNA)	−1.500707646	HR	hair growth associated	−4.135452784
	gamma 2, accessory
	subunit
TGIF1	TGFB induced factor	−1.501196523	ASB6	ankyrin repeat and SOCS	−4.137503524
	homeobox 1			box containing 6
RELL1	RELT like 1	−1.50300255	SLC27A5	solute carrier family 27	−4.141596278
				member 5
CYP26B1	cytochrome P450 family	−1.50439813	PPP1R3F	protein phosphatase	1	−4.14974712
	26 subfamily B member 1			regulatory subunit 3F
PTRH2	peptidyl-tRNA hydrolase	−1.504678598	AB124611	cDNA sequence	−4.173373402
	2			AB124611(AB124611)
ZKSCAN3	zinc finger with KRAB	−1.504916722	CD40	CD40 molecule	−4.181897643
	and SCAN domains 3
SP8	Sp8 transcription factor	−1.505999092	SMAD5	SMAD family member 5	−4.183883459
SAMD14	sterile alpha motif domain	−1.506272343	COL23A1	collagen type XXIII alpha 1	−4.221103725
	containing 14			chain
MX2	MX dynamin like GTPase	−1.507268463	ZFP595	zinc finger protein	−4.228818691
	2			595(Zfp595)
OCRL	OCRL, inositol	−1.507638755	PECAM1	platelet and endothelial cell	−4.232789973
	polyphosphate-5-			adhesion molecule 1
	phosphatase
SYNJ2BP	synaptojanin
2 binding	−1.507669173	TMEM138	transmembrane protein 138	−4.241228289
	protein
CPLX4	complexin
4	−1.508554002	RFX2	regulatory factor X2	−4.244125943
LGALS9	galectin 9	−1.509246723	KCTD12	potassium channel	−4.247846204
				tetramerization domain
				containing 12
TAZ	tafazzin	−1.509269953	TRIM56	tripartite motif containing	−4.262008929
				56
2310002L09RIK	Description Not Found	−1.510961919	EIF4EBP2	eukaryotic translation	−4.263034406
				initiation factor 4E binding
				protein
2
ZFP97	zinc finger protein	−1.510961919	RALGPS2	Ral GEF with PH domain	−4.279842694
	97(Zfp97)			and SH3 binding motif 2
OLFR1494	olfactory receptor	−1.510961919	TGM2	transglutaminase	2	−4.293161941
	1494(Olfr1494)
BC030867	cDNA sequence	−1.510961919	ENC1	ectodermal-neural cortex 1	−4.311067102
	BC030867(BC030867)
CEACAM9	carcinoembryonic	−1.510961919	LRIG1	leucine rich repeats and	−4.375039431
	antigen-related cell			immunoglobulin like
	adhesion molecule			domains	1
	9(Ceacam9)
LRIT1	leucine rich repeat, Ig-like	−1.510961919	PRM1	protamine	1	−4.375039431
	and transmembrane
	domains
1
KLK5	kallikrein related	−1.510961919	DUSP7	dual specificity phosphatase	−4.383538076
	peptidase 5			7
KRT27	keratin 27	−1.510961919	SERTAD3	SERTA domain containing	−4.399171094
				3
CACNG4	calcium voltage-gated	−1.510961919	KCNC1	potassium voltage-gated	−4.409390936
	channel auxiliary subunit			channel subfamily C
	gamma
4			member 1
IL13RA1	interleukin 13 receptor	−1.510961919	UBE2D3	ubiquitin conjugating	−4.462706751
	subunit alpha 1			enzyme E2 D3
TMEM121	transmembrane protein	−1.510961919	SEPP1	selenoprotein P, plasma, 1	−4.463383458
	121
HIST1H2AA	histone cluster 1, H2aa	−1.510961919	ADRB2	adrenoceptor beta 2	−4.463910999
MPZL3	myelin protein zero like 3	−1.510961919	PPP1R13B	protein phosphatase 1	−4.471417658
				regulatory subunit 13B
TGFB2	transforming growth	−1.510961919	ARRDC3	arrestin domain containing	−4.504620392
	factor beta 2			3
IFT74	intraflagellar transport 74	−1.510961919	GNGT2	G protein subunit gamma	−4.531381461
				transducin 2
FCRL1	Fc receptor like 1	−1.510961919	SIAH1A	seven in absentia	−4.539158811
				1A(Siah1a)
ADRB1	adrenoceptor beta	1	−1.510961919	XPC	XPC complex subunit,	−4.563768278
				DNA damage recognition
				and repair factor
MAGI2	membrane associated	−1.510961919	HIPK1	homeodomain interacting	−4.683696454
	guanylate kinase, WW			protein kinase	1
	and PDZ domain
	containing 2
SCG5	secretogranin V	−1.510961919	H2-OB	histocompatibility	2, O	−4.700439718
				region beta locus(H2-Ob)
GCK	glucokinase	−1.510961919	BACH2	BTB domain and CNC	−4.716990894
				homolog 2
ASB10	ankyrin repeat and SOCS	−1.510961919	MAPILC3A	microtubule associated	−4.722466024
	box containing 10			protein 1 light chain 3 alpha
SELE	selectin E	−1.510961919	LRRFIP1	LRR binding FLII	−4.761551232
				interacting protein 1
IGFBP3	insulin like growth factor	−1.510961919	ATP10D	ATPase phospholipid	−4.766581958
	binding protein 3			transporting 10D (putative)
TPT1	tumor protein,	−1.510961919	IGFBP4	insulin like growth factor	−4.790993785
	translationally-controlled			binding protein 4
	1
ROCK1	Rho associated coiled-coil	−1.510961919	TMEM108	transmembrane protein 108	−4.865423978
	containing protein kinase
	1
OGFRL1	opioid growth factor	−1.510961919	PTK2	protein tyrosine kinase 2	−4.875719796
	receptor-like 1
TMEM38A	transmembrane protein	−1.510961919	CLEC11A	C-type lectin domain family	−4.897240426
	38A			11 member A
RLTPR	Description Not Found	−1.51227339	LRP12	LDL receptor related	−4.955029571
				protein 12
ITPKC	inositol-trisphosphate 3-	−1.512389725	GCNT2	glucosaminyl (N-acetyl)	−4.958842675
	kinase C			transferase	2, I-branching
				enzyme (I blood group)
TLE4	transducin like enhancer	−1.51341989	F10	coagulation factor X	−4.965784285
	of split 4
PDE4D	phosphodiesterase 4D	−1.513667908	DBP	D-box binding PAR bZIP	−4.966549451
				transcription factor
A130010J15RIK	Description Not Found	−1.514296211	ABCG1	ATP binding cassette	−5.002252452
				subfamily G member 1
RNF167	ring finger protein 167	−1.514765492	WDR78	WD repeat domain 78	−5.017921908
CCBL1	Description Not Found	−1.515626494	DNAJC6	DnaJ heat shock protein	−5.017921908
				family (Hsp40) member C6
HSD17B1	hydroxysteroid 17-beta	−1.516875069	AFF4	AF4/FMR2 family member	−5.033423002
	dehydrogenase 1			4
OSM	oncostatin M	−1.517234668	TNFRSF26	tumor necrosis factor	−5.040015679
				receptor superfamily,
				member 26(Tnfrsf26)
RHPN1	rhophilin, Rho GTPase	−1.517275693	GFOD2	glucose-fructose	−5.070389328
	binding protein 1			oxidoreductase domain
				containing 2
TAS2R105	taste receptor, type 2,	−1.517431856	TYROBP	TYRO protein tyrosine	−5.114783447
	member 105(Tas2r105)			kinase binding protein
NIPBL	NIPBL, cohesin loading	−1.517569618	TMEM176B	transmembrane protein	−5.118941073
	factor			176B
CXCR3	C-X-C motif chemokine	−1.519325267	ZFP710	zinc finger protein	−5.159871337
	receptor 3			710(Zfp710)
SMURF1	SMAD specific E3	−1.520263252	ENPP4	ectonucleotide	−5.181897643
	ubiquitin protein ligase 1			pyrophosphatase/
				phosphodiesterase 4
				(putative)
RNF208	ring finger protein 208	−1.52126647	MAPK8	mitogen-activated protein	−5.259272487
				kinase 8
ITGA5	integrin subunit alpha 5	−1.523517983	TNFRSF25	tumor necrosis factor	−5.289096702
				receptor superfamily
				member
25
USP18	ubiquitin specific	−1.524814077	LCN4	lipocalin 4(Lcn4)	−5.366322214
	peptidase 18
PIP5K1A	phosphatidylinositol-4-	−1.525074369	CRIM1	cysteine rich	−5.369815424
	phosphate 5-kinase type 1			transmembrane BMP
	alpha			regulator
1
STRBP	spermatid perinuclear	−1.52561213	RTP4	receptor transporter protein	−5.444600814
	RNA binding protein			4
GRAMD2	GRAM domain	−1.52652805	PRNP	prion protein	−5.495055528
	containing 2
ZFP101	zinc finger protein	−1.526555668	ZFP747	zinc finger protein	−5.496654083
	101(Zfp101)			747(Zfp747)
RUNDC1	RUN domain containing 1	−1.526563287	CD7	CD7 molecule	−5.504620392
SLC13A3	solute carrier family 13	−1.528487927	ARHGAP26	Rho GTPase activating	−5.548436625
	member 3			protein 26
CCDC94	coiled-coil domain	−1.528487927	S100A9	S100 calcium binding	−5.557655155
	containing 94			protein A9
MRPS14	mitochondrial ribosomal	−1.528962318	AQP9	aquaporin 9	−5.572889668
	protein S14
NEU4	neuraminidase 4	−1.529820947	CXCR5	C-X-C motif chemokine	−5.573647187
	(sialidase)			receptor 5
PCGF1	polycomb group ring	−1.53059536	CCNO	cyclin O	−5.574404309
	finger 1
PNPLA7	patatin like phospholipase	−1.53207883	LYNX1	Ly6/neurotoxin 1	−5.666756592
	domain containing 7
SPATA19	spermatogenesis	−1.533014103	CLDN10	claudin 10	−5.782015335
	associated 19
AP4B1	adaptor related protein	−1.533821865	AMIGO2	adhesion molecule with Ig-	−5.83541884
	complex 4 beta 1 subunit			like domain 2
BC068281	cDNA sequence	−1.5360529	CD79B	CD79b molecule	−5.94016675
	BC068281(BC068281)
GK2	glycerol kinase	2	−1.5360529	USP53	ubiquitin specific peptidase	−5.980710829
				53
PIGM	phosphatidylinositol	−1.5360529	IKBKE	inhibitor of kappa light	−6.005624549
	glycan anchor			polypeptide gene enhancer
	biosynthesis class M			in B-cells, kinase epsilon
FKBP6	FK506 binding protein 6	−1.5360529	ALOX5AP	arachidonate 5-	−6.008988783
				lipoxygenase activating
				protein
EVI5	ecotropic viral integration	−1.5360529	GGT1	gamma-glutamyltransferase	−6.010108453
	site 5			1
BCL11A	B-cell CLL/lymphoma	−1.5360529	CAMK2D	calcium/calmodulin	−6.047669251
	11A			dependent protein kinase II
				delta
PER1	period circadian clock 1	−1.537278499	RAB3D	RAB3D, member RAS	−6.156841525
				oncogene family
BTBD9	BTB domain containing 9	−1.537451456	MAP3K8	mitogen-activated protein	−6.376776572
				kinase kinase kinase 8
USP38	ubiquitin specific	−1.537763627	NOTCH4	notch	4	−6.495055528
	peptidase 38
LRRC57	leucine rich repeat	−1.538083341	MACROD1	MACRO domain	−6.581200582
	containing 57			containing 1
5830415F09RIK	Description Not Found	−1.53855912	RNF144A	ring finger protein 144A	−6.632268216
EGR2	early growth response 2	−1.540038325	PDE2A	phosphodiesterase 2A	−6.86913112
GMEB2	glucocorticoid	−1.541122795	THA1	threonine aldolase 1(Tha1)	−6.885086225
	modulatory element
	binding protein
2
PIK3R4	phosphoinositide-3-kinase	−1.541975323	APP	amyloid beta precursor	−6.940754047
	regulatory subunit 4			protein
KRR1	KRR1, small subunit	−1.54225805	FAM109A	family with sequence	−6.968666793
	processome component			similarity 109 member A
	homolog
COL9A1	collagen type IX alpha 1	−1.54225805	LRG1	leucine rich alpha-2-	−6.995484519
				glycoprotein 1
POLD4	polymerase (DNA) delta	−1.542654605	IL11RA1	interleukin 11 receptor,	−7.016251155
	4, accessory subunit			alpha chain 1(Il11ra1)
ACSS2	acyl-CoA synthetase	−1.544045378	CNR2	cannabinoid receptor	2	−7.213347282
	short-chain family
	member
2
PDLIM1	PDZ and LIM domain 1	−1.544785186	NUAK2	NUAK family kinase 2	−7.369815424
A430107P09RIK	Description Not Found	−1.544921568	GPR146	G protein-coupled receptor	−7.577806447
				146
SLC38A11	solute carrier family 38	−1.546222547
	member 11

*Log2Fold Change = log2(4 + L+/4 − L−)

To investigate the molecular pathways between these three populations, gene ontology networks were grouped into nodes and the most significant pathways within each node were determined (FIG. 6A). Gene ontology (GO) terms shared between our dysfunctional T cell dataset and the published hypofunctional T cell dataset were greatly enriched in cell cycle genes, consistent with the observation that the dysfunctional population is largely Ki67⁺. GO terms shared between dysfunctional and exhausted gene sets encompassed effector programs such as regulation of cell killing, chemotaxis, interferon-7 production. GO terms shared between hypofunctional and exhausted gene sets consisted of cell cycle pathways, negative regulation of lymphocytes, and interferon-7 production. These data indicate that while some conserved molecular programs likely exist in these dysfunctional differentiation states, many pathways may be differentially regulated between chronic viral infections and in the tumor context. While many inhibitory receptors, including Pdcd1 (PD-1), Havcr2 (TIM-3), Cd244 (2B4), Klre1, and Lag3 were shared between all data sets; the co-stimulatory receptors Tnfrsf4 (OX-40) and Tnfrsf9 (4-1BB) were upregulated in dysfunctional and hypofunctional CD8⁺ TIL data sets. Therefore, to enrich in potential markers and therapeutic targets on tumor specific CD8⁺ TILs, the complete cell surface phenotype of the 4-1BB⁺LAG-3⁺CD8 TIL population was characterized. Comparing the different CD8⁺ TIL subpopulations, several additional upregulated co-stimulatory receptors were found: Tnfrsf18 (GITR), Nkg2d (KLRK1) and Cd27. The transcript for Nrp1 (neuropilin-1), which encodes for a cell surface receptor protein implicated in CD4⁺ Treg function (Sarris et al., 2008; incorporated by reference in its entirety), was also highly expressed. Expression of many of these molecules was confirmed by flow cytometry at day 7, 14 and 21 after tumor inoculation (FIG. 6C). The analysis was extended to include the co-stimulatory molecules ICOS and CD160 and the inhibitory receptor T cell immunoreceptor with Ig and ITIM domains (TIGIT) because ICOS and CD160 were close to the cutoff value and no probe was present for TIGIT in the gene array. In addition, recent reports indicate that targeting these receptors can be therapeutic in murine models of cancer (Johnston et al., 2014; Fan et al., 2014; incorporated by reference in their entireties). PD-1, TIGIT, TIM-3, CD27 and NRP1 were expressed the majority of the 4-1BB⁺LAG-3⁺ TIL population and expression was maintained over time. 2B4, CD160, CTLA4, OX-40, and GITR subdivided a lesser fraction of the 4-1BB⁺LAG-3⁺ population. The expression of several inhibitory receptors, 2B4, TIM3 and CD160 increased over this 3-week time frame while expression of the co-stimulatory receptors, ICOS and OX-40, decreased (FIG. 6C).
To address if the dysfunctional CD8⁺ TILs are terminally-differentiated short term effector cells or memory-like cells, the expression of KLRG-1 and IL-7Rα (Joshi et al., 2007). Most of the CD8⁺ TIL were negative for KLRG-1 expression and there was no difference between the 4-1BB⁺LAG-3⁺ and 4-1BB⁻LAG-3 populations. However, the majority of the 4-1BB⁺LAG-3⁺ TIL did not express the IL-7 receptor (IL-7Ra) compared to their negative counter parts (FIG. 6D). These results indicate that the 4-1BB⁻LAG-3 TIL, which are not apparently specific for antigens expressed in the tumor microenvironment, are more memory-like, yet at the same time the tumor antigen-specific LAG-3⁺4-1BB⁺ subset has not fully acquired a terminal effector phenotype.
Functional Relevance of Genes that are Differentially Regulated in CD8⁺4-1BB⁺LAG-3⁺ TILs
The gene array results in Table 2 provide a list of genes characterizing CD8⁺4-1BB⁺LAG-3⁺ TILs. The list includes therapeutic targets and additional markers of anti-tumor immunity. Experiments conducted during development of embodiments herein to test the functional relevance of these additional targets/markers (FIG. 11 ). Data indicate that the array has identified targets for immunotherapy, using knockout mice (e.g., PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM, Sema7a, etc.). Experiments demonstrate that Nrn1 and CRTAM are negative regulators of the anti-tumor immune response, as knockout mice lacking either of these molecules showed improved immune-mediated tumor control in vivo. In contrast, Sema7a is a positive regulator of anti-tumor immune responses, as knockout mice lacking this molecule show diminished immune-mediated tumor control in vivo (FIG. 11 ). These experiments indicate that agonists of Sema7a signaling and antagonists of Nrn1 and/or CRTAM should be useful therapeutics for the treatment of cancer.

Targeting 4-1BB and LAG-3 Exerts Anti-Tumor Activity In Vivo and Normalizes the Function and Phenotypic Composition of CD8⁺ TILs

Experiments were conducted during development of embodiments herein to assess whether targeting these receptors might have therapeutic utility. To this end, an agonistic anti-4-1BB mAb was administered alone or in combination with a blocking anti-LAG-3 mAb in mice bearing established B16. SIY tumors. While each antibody treatment alone had some therapeutic effect as reflected by slower tumor growth, the combination was particularly potent (FIG. 7A). Analysis of the tumor microenvironment revealed that improved tumor control with the combination therapy was accompanied by an increase in the number of CD8⁺ TILs specific for the SIY antigen (FIG. 7B), consistent with results reported previously with anti-PD-L1⁺ anti-CTLA-4 mAb (Spranger et al., 2014b; Twyman-Saint Victor et al., 2015; incorporated by reference in their entireties).
It was next examined whether the therapeutic effect of anti-4-1BB+anti-LAG-3 mAbs was associated with a loss of phenotypic markers defining dysfunctional T cells in the steady state. Due to concern that re-analyzing the T cells for expression of LAG-3 and 4-1BB might be problematic, as the administered Abs could theoretically modulate the target receptors from the cell surface, the coordinate expression of additional receptors as identified above by gene expression profiling was taken advantage of. Preliminary analyses of the bulk TIL subpopulations revealed decreased expression of NRP1 and 2B4 following anti-LAG-3+anti-4-1BB treatment (data not shown). Co-expression of 2B4 and NRP1 on SIY-reactive CD8⁺ TILs identified by pentamer staining was analyzed. A 2.7-fold-decrease in the co-expression of 2B4 and NRP1 was observed upon anti-4-1BB+ and anti-LAG-3 mAb treatment (FIG. 7C), indicating a loss of the surface phenotype associated with T cell dysfunction. To determine whether this change was accompanied by a shift towards an effector phenotype, expression of KLGR-1 was examined. Indeed, a marked increase in KLGR-1 expression was observed on the SIY-reactive TIL following treatment, and a 3.7-fold increase in the KLRG-1^hiIL-7RA^lopopulation was observed (FIG. 7D).
To eliminate the possibility that treatment with anti-LAG-3+anti-4-1BB mAbs was not altering the phenotype of T cells already within the tumor but rather was supporting recruitment of newly primed functional T cells from secondary lymphoid organs, the S1PR inhibitor FTY720, which prevents T cell egress from lymph nodes (Halin et al., 2005; incorporated by reference in its entirety), was utilized. We The efficacy of anti-PD-L1-based immunotherapies was preserved in the presence of FTY720, arguing for re-functionalization of TIL as the major mechanism of action (Spranger et al., 2014a; incorporated by reference in its entirety). FTY720 administration was started on day 6 after tumor inoculation, 24 hours before the start of anti-LAG-3+anti-4-1BB treatment, and continued every day until TIL analysis on day 14. Peripheral blood analyzed at the same time point revealed marked depletion of circulating T cells (FIG. 9 ). Despite this loss of circulating T cells, the down regulation of 2B4 and NRP1 and the shift towards the KLRG1^hiIL-7RA^lophenotype was nonetheless preserved (FIGS. 7E and F). To examine functional restoration of the TIL, the KLRG-1^loIL-7RA^loand KLRG-1^hiIL-7RA^loCD8⁺ TIL populations were sorted from B16. SIY tumors on day 14 following treatment and analyzed for IL-2 after restimulation in vitro. Indeed, the KLRG-1^loIL-7RA^loand KLRG-1^hiIL-7RA^lopopulations showed an increased capacity to produce IL-2 upon stimulation (FIG. 7G). The relative level of Il-2 mRNA was comparable between the two CD8⁺ TIL populations and control CD8⁺CD44⁺ TdLN T cells. Collectively, these data indicate that anti-4-1BB/anti-LAG-3 combinatorial treatment induces significant changes in the phenotype profile and promotes functional restoration of tumor antigen-specific CD8⁺ T cells already present within the tumor microenvironment.

REFERENCES

The following references, some of which are cited above, are herein incorporated by references in their entireties.

Ahmadzadeh, M., L. A. Johnson, B. Heemskerk, J. R. Wunderlich, M. E. Dudley, D. E. White, and S. A. Rosenberg. 2009. Tumor antigen-specific CD8 T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired. Blood. 114:1537-1544. doi:10.1182/blood-2008-12-195792.
Baitsch, L., A. Legat, L. Barba, S. A. Fuertes Marraco, J.-P. Rivals, P. Baumgaertner, C. Christiansen-Jucht, H. Bouzourene, D. Rimoldi, H. Pircher, N. Rufer, M. Matter, O. Michielin, and D. E. Speiser. 2012. Extended co-expression of inhibitory receptors by human CD8 T-cells depending on differentiation, antigen-specificity and anatomical localization. PLoS ONE. 7:e30852. doi:10.1371/journal.pone.0030852.
Baitsch, L., P. Baumgaertner, E. Devêvre, S. K. Raghav, A. Legat, L. Barba, S. Wieckowski, H. Bouzourene, B. Deplancke, P. Romero, N. Rufer, and D. E. Speiser. 2011. Exhaustion of tumor-specific CD8⁺ T cells in metastases from melanoma patients. J. Clin. Invest. 121:2350-2360. doi:10.1172/JC146102.
Blackburn, S. D., H. Shin, W. N. Haining, T. Zou, C. J. Workman, A. Polley, M. R. Betts, G. J. Freeman, D. A. A. Vignali, and E. J. Wherry. 2009. Coregulation of CD8+ T cell exhaustion by multiple inhibitory receptors during chronic viral infection. Nature Publishing Group. 10:29-37. doi:10.1038/ni.1679.
Brown, I. E., C. Blank, J. Kline, A. K. Kacha, and T. F. Gajewski. 2006. Homeostatic proliferation as an isolated variable reverses CD8+ T cell anergy and promotes tumor rejection. Journal of Immunology (Baltimore, Md.: 1950). 177:4521-4529.
Clouthier, D. L., A. C. Zhou, and T. H. Watts. 2014. Anti-GITR agonist therapy intrinsically enhances CD8 T cell responses to chronic lymphocytic choriomeningitis virus (LCMV), thereby circumventing LCMV-induced downregulation of costimulatory GITR ligand on APC. The Journal of Immunology. 193:5033-5043. doi:10.4049/jimmunol.1401002.
Crawford, A., J. M. Angelosanto, C. Kao, T. A. Doering, P. M. Odorizzi, B. E. Barnett, and E. J. Wherry. 2014. Molecular and Transcriptional Basis of CD4(+) T Cell Dysfunction during Chronic Infection. Immunity. 40:289-302. doi:10.1016/j.immuni.2014.01.005.
Cunningham, C. R., A. Champhekar, M. V. Tullius, B. J. Dillon, A. Zhen, J. R. de la Fuente, J. Herskovitz, H. Elsaesser, L. M. Snell, E. B. Wilson, J. C. de la Torre, S. G. Kitchen, M. A. Horwitz, S. J. Bensinger, S. T. Smale, and D. G. Brooks. 2016. Type I and Type II Interferon Coordinately Regulate Suppressive Dendritic Cell Fate and Function during Viral Persistence. PLoS Pathog. 12:e1005356. doi:10.1371/journal.ppat.1005356.
Currier, J. R., and M. A. Robinson. 2001. Spectratype/Immunoscope Analysis of the Expressed TCR Repertoire. John Wiley & Sons, Inc., Hoboken, NJ, USA. 92544 pp.
Diamond, M. S., M. Kinder, H. Matsushita, M. Mashayekhi, G. P. Dunn, J. M. Archambault, H. Lee, C. D. Arthur, J. M. White, U. Kalinke, K. M. Murphy, and R. D. Schreiber. 2011. Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J. Exp. Med. 208:1989-2003. doi:10.1084/jem.20101158.
Doering, T. A., A. Crawford, J. M. Angelosanto, M. A. Paley, C. G. Ziegler, and E. J. Wherry. 2012. Network analysis reveals centrally connected genes and pathways involved in CD8+ T cell exhaustion versus memory. Immunity. 37:1130-1144. doi:10.1016/j.immuni.2012.08.021.
Evaristo, C., S. Spranger, S. E. Barnes, M. L. Miller, L. L. Molinero, F. L. Locke, T. F. Gajewski, and M.-L. Alegre. 2016. Cutting Edge: Engineering Active IKKβ in T Cells Drives Tumor Rejection. The Journal of Immunology. 196:2933-2938. doi:10.4049/jimmunol.1501144.
Fan, X., S. A. Quezada, M. A. Sepulveda, P. Sharma, and J. P. Allison. 2014. Engagement of the ICOS pathway markedly enhances efficacy of CTLA-4 blockade in cancer immunotherapy. J. Exp. Med. 211:715-725. doi:10.1084/jem.20130590.
Fourcade, J., Z. Sun, O. Pagliano, P. Guillaume, I. F. Luescher, C. Sander, J. M. Kirkwood, D. Olive, V. Kuchroo, and H. M. Zarour. 2012. CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72:887-896. doi:10.1158/0008-5472. CAN-11-2637.
Fridman, W. H., F. Pagès, C. Sautès-Fridman, and J. Galon. 2012. The immune contexture in human tumours: impact on clinical outcome. Nature Publishing Group. 12:298-306. doi:10.1038/nrc3245.
Fuertes, M. B., A. K. Kacha, J. Kline, S.-R. Woo, D. M. Kranz, K. M. Murphy, and T. F. Gajewski. 2011. Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8{alpha}+dendritic cells. J. Exp. Med. 208:2005-2016. doi:10.1084/jem.20101159.
Gajewski, T. F. 2007a. The expanding universe of regulatory T cell subsets in cancer. Immunity. 27:185-187. doi:10.1016/j.immuni.2007.08.001.
Gajewski, T. F. 2007b. Failure at the Effector Phase: Immune Barriers at the Level of the Melanoma Tumor Microenvironment. Clin. Cancer Res. 13:5256-5261. doi:10.1158/1078-0432. CCR-07-0892.
Gajewski, T. F., H. Schreiber, and Y.-X. Fu. 2013. Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol. 14:1014-1022. doi:10.1038/ni.2703.
Gajewski, T. F., Y. Meng, C. Blank, I. E. Brown, A. K. Kacha, J. Kline, and H. Harlin. 2006. Immune resistance orchestrated by the tumor microenvironment. Immunological Reviews. 1-15.
Goldszmid, R. S., A. Dzutsev, and G. Trinchieri. 2014. Host Immune Response to Infection and Cancer: Unexpected Commonalities. Cell Host and Microbe. 15:295-305. doi:10.1016/j.chom.2014.02.003.
Gros, A., P. F. Robbins, X. Yao, Y. F. Li, S. Turcotte, E. Tran, J. R. Wunderlich, A. Mixon, S. Farid, M. E. Dudley, K.-I. Hanada, J. R. Almeida, S. Darko, D. C. Douek, J. C. Yang, and S. A. Rosenberg. 2014. PD-1 identifies the patient-specific CD8⁺ tumor-reactive repertoire infiltrating human tumors. J. Clin. Invest. 124:2246-2259. doi:10.1172/JCI73639.
Halin, C., M. L. Scimone, R. Bonasio, J.-M. Gauguet, T. R. Mempel, E. Quackenbush, R. L. Proia, S. Mandala, and U. H. von Andrian. 2005. The SlP-analog FTY720 differentially modulates T-cell homing via HEV: T-cell-expressed SlPl amplifies integrin activation in peripheral lymph nodes but not in Peyer patches. Blood. 106:1314-1322. doi:10.1182/blood-2004-09-3687.
Harlin, H., T. V. Kuna, A. C. Peterson, Y. Meng, and T. F. Gajewski. 2006. Tumor progression despite massive influx of activated CD8+ T cells in a patient with malignant melanoma ascites. Cancer Immunol Immunother. 55:1185-1197. doi:10.1007/s00262-005-0118-2.
Harlin, H., Y. Meng, A. C. Peterson, Y. Zha, M. Tretiakova, C. Slingluff, M. McKee, and T. F. Gajewski. 2009. Chemokine expression in melanoma metastases associated with CD8+ T-cell recruitment. Cancer Res. 69:3077-3085. doi:10.1158/0008-5472. CAN-08-2281.
Hoelzinger, D. B., S. E. Smith, N. Mirza, A. L. Dominguez, S. Z. Manrique, and J. Lustgarten. 2010. Blockade of CCL1 Inhibits T Regulatory Cell Suppressive Function Enhancing Tumor Immunity without Affecting T Effector Responses. The Journal of Immunology. 184:6833-6842. doi:10.4049/jimmunol.0904084.
Jenkins, M. K., D. M. Pardoll, J. Mizuguchi, T. M. Chused, and R. H. Schwartz. 1987. Molecular events in the induction of a nonresponsive state in interleukin 2-producing helper T-lymphocyte clones. PNAS. 84:5409-5413.
Johnston, R. J., L. Comps-Agrar, J. Hackney, X. Yu, M. Huseni, Y. Yang, S. Park, V. Javinal, H. Chiu, B. Irving, D. L. Eaton, and J. L. Grogan. 2014. The immunoreceptor TIGIT regulates antitumor and antiviral CD8(+) T cell effector function. Cancer Cell. 26:923-937. doi:10.1016/j.ccell.2014.10.018.
Joshi, N. S., W. Cui, A. Chandele, H. K. Lee, D. R. Urso, J. Hagman, L. Gapin, and S. M. Kaech. 2007. Inflammation Directs Memory Precursor and Short-Lived Effector CD8+ T Cell Fates via the Graded Expression of T-bet Transcription Factor. Immunity. 27:281-295. doi:10.1016/j.immuni.2007.07.010.
Kaech, S. M., J. T. Tan, E. J. Wherry, B. T. Konieczny, C. D. Surh, and R. Ahmed. 2003. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat Immunol. 4:1191-1198. doi:10.1038/ni1009.
Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes, and A. Drummond. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 28:1647-1649. doi:10.1093/bioinformatics/bts199.
Kim, J.-O., H. W. Kim, K.-M. Baek, and C.-Y. Kang. 2003. NF-κB and AP-1 regulate activation-dependent CD137 (4-1BB) expression in T cells. FEBS Letters. 541:163-170. doi:10.1016/50014-5793(03)00326-0.
Kline, J., L. Zhang, L. Battaglia, K. S. Cohen, and T. F. Gajewski. 2012. Cellular and molecular requirements for rejection of B16 melanoma in the setting of regulatory T cell depletion and homeostatic proliferation. The Journal of Immunology. 188:2630-2642. doi:10.4049/jimmunol.1100845.
Kuchroo, V. K., A. C. Anderson, and C. Petrovas. 2014. Coinhibitory receptors and CD8 T cell exhaustion in chronic infections. Current Opinion in HIV and AIDS. 9:439-445. doi:10.1097/COH.0000000000000088.
Larkin, J., F. S. Hodi, and J. D. Wolchok. 2015. Combined Nivolumab and Ipilimumab or Monotherapy in Untreated Melanoma. New England Journal of Medicine. 373:1270-1271. doi:10.1056/NEJMc1509660.
Li, S., T. Miao, M. Sebastian, P. Bhullar, E. Ghaffari, M. Liu, A. L. J. Symonds, and P. Wang. 2012. The transcription factors Egr2 and Egr3 are essential for the control of inflammation and antigen-induced proliferation of B and T cells. Immunity. 37:685-696. doi:10.1016/j.immuni.2012.08.001.
Martinez, G. J., R. M. Pereira, T. Äijö, E. Y. Kim, F. Marangoni, M. E. Pipkin, S. Togher, V. Heissmeyer, Y. C. Zhang, S. Crotty, E. D. Lamperti, K. M. Ansel, T. R. Mempel, H. Lähdesmäki, P. G. Hogan, and A. Rao. 2015. The Transcription Factor NFAT Promotes Exhaustion of Activated CD8+ T Cells. Immunity. 42:265-278. doi:10.1016/j.immuni.2015.01.006.
Odorizzi, P. M., K. E. Pauken, M. A. Paley, A. Sharpe, and E. J. Wherry. 2015. Genetic absence of PD-1 promotes accumulation of terminally differentiated exhausted CD8+ T cells. J. Exp. Med. 439:jem.20142237-1137. doi:10.1084/jem.20142237.
Palazón, A., I. Martínez-Forero, A. Teijeira, A. Morales-Kastresana, C. Alfaro, M. F. Sanmamed, J. L. Perez-Gracia, I. Peñuelas, S. Hervás-Stubbs, A. Rouzaut, M. O. de Landázuri, M. Jure-Kunkel, J. Aragonés, and I. Melero. 2012. The HIF-1α hypoxia response in tumor-infiltrating T lymphocytes induces functional CD137 (4-1BB) for immunotherapy. Cancer Discov. 2:608-623. doi:10.1158/2159-8290. CD-11-0314.
Pardoll, D. M. 2012. The blockade of immune checkpoints in cancer immunotherapy. 1-13. doi:10.1038/nrc3239.
Pauken, K. E., and E. J. Wherry. 2015. Overcoming T cell exhaustion in infection and cancer. Trends in Immunology. 36:265-276. doi:10.1016/j.it.2015.02.008.
Pearce, E. L., M. C. Poffenberger, C. H. Chang, and R. G. Jones. 2013. Fueling immunity: insights into metabolism and lymphocyte function. Science.
Plaisier, S. B., R. Taschereau, J. A. Wong, and T. G. Graeber. 2010. Rank-rank hypergeometric overlap: identification of statistically significant overlap between gene-expression signatures. Nucl. Acids Res. 38:e169-el69. doi:10.1093/nar/gkg636.
Rosenblatt, J. D., and J. L. Stein. 2014. RRHO: Test overlap using the Rank-Rank Hypergeometric test.
Safford, M., S. Collins, M. A. Lutz, A. Allen, C.-T. Huang, J. Kowalski, A. Blackford, M. R. Horton, C. Drake, R. H. Schwartz, and J. D. Powell. 2005. Egr-2 and Egr-3 are negative regulators of T cell activation. Nat Immunol. 6:472-480. doi:10.1038/ni1193.
Sarkar, S., V. Kalia, W. N. Haining, B. T. Konieczny, S. Subramaniam, and R. Ahmed. 2008. Functional and genomic profiling of effector CD8 T cell subsets with distinct memory fates. J. Exp. Med. 205:625-640. doi:10.1084/jem.20071641.
Sarris, M., K. G. Andersen, F. Randow, L. Mayr, and A. G. Betz. 2008. Neuropilin-1 Expression on Regulatory T Cells Enhances Their Interactions with Dendritic Cells during Antigen Recognition. Immunity. 28:402-413. doi:10.1016/j.immuni.2008.01.012.
Schietinger, A., and P. D. Greenberg. 2014. Tolerance and exhaustion: defining mechanisms of T cell dysfunction. Trends in Immunology. 35:51-60. doi:10.1016/j.it.2013.10.001.
Schietinger, A., M. Philip, V. E. Krisnawan, E. Y. Chiu, J. J. Delrow, R. S. Basom, P. Lauer, D. G. Brockstedt, S. E. Knoblaugh, G. J. Hammerling, T. D. Schell, N. Garbi, and P. D. Greenberg. 2016. Tumor-Specific T Cell Dysfunction Is a Dynamic Antigen-Driven Differentiation Program Initiated Early during Tumorigenesis. Immunity. doi:10.1016/j.immuni.2016.07.011.
Schwartz, R. H. 2003. T C ELLA NERGY*. Annu. Rev. Immunol. 21:305-334. doi:10.1146/annurev.immunol.21.120601.141110.
Schwartz, R. H., D. L. Mueller, M. K. Jenkins, and H. Quill. 1989. T-cell clonal anergy. Cold Spring Harb. Symp. Quant. Biol. 54 Pt 2:605-610.
Shannon, P., A. Markiel, O. Ozier, N. S. Baliga, J. T. Wang, D. Ramage, N. Amin, B. Schwikowski, and T. Ideker. 2003. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13:2498-2504. doi:10.1101/gr.1239303.
Snell, L. M., and D. G. Brooks. 2015. New insights into type I interferon and the immunopathogenesis of persistent viral infections. Curr. Opin. Immunol. 34:91-98. doi:10.1016/j.coi.2015.03.002.
Spiotto, M. T., P. Yu, D. A. Rowley, M. I. Nishimura, S. C. Meredith, T. F. Gajewski, Y.-X. Fu, and H. Schreiber. 2002. Increasing Tumor Antigen Expression Overcomes “Ignorance” to Solid Tumors via Crosspresentation by Bone Marrow-Derived Stromal Cells. Immunity. 17:737-747. doi:10.1016/S1074-7613(02)00480-6.
Spranger, S., H. K. Koblish, and B. Horton. 2014a. Mechanism of tumor rejection with doublets of CTLA-4, PD-1/PD-L1, or IDO blockade involves restored IL-2 production and proliferation of CD8+ T cells directly . . . Journal for . . . .
Spranger, S., H. K. Koblish, B. Horton, P. A. Scherle, R. Newton, and T. F. Gajewski. 2014b. Mechanism of tumor rejection with doublets of CTLA-4, PD-1/PD-L1, or IDO blockade involves restored IL-2 production and proliferation of CD8(+) T cells directly within the tumor microenvironment. J Immunother Cancer. 2:3. doi:10.1186/2051-1426-2-3.
Spranger, S., R. M. Spaapen, Y. Zha, J. Williams, Y. Meng, T. T. Ha, and T. F. Gajewski. 2013. Up-Regulation of PD-L1, IDO, and Tregs in the Melanoma Tumor Microenvironment Is Driven by CD8+ T Cells. Science Translational Medicine. 5:200ra116-200ra116. doi:10.1126/scitranslmed.3006504.
Sumitomo, S., K. Fujio, T. Okamura, and K. Yamamoto. 2013. Egr2 and Egr3 are the unique regulators for systemic autoimmunity. jak-stat. 2:e23952. doi:10.4161/jkst.23952.
Tumeh, P. C., C. L. Harview, J. H. Yearley, I. P. Shintaku, E. J. M. Taylor, L. Robert, B. Chmielowski, M. Spasic, G. Henry, V. Ciobanu, A. N. West, M. Carmona, C. Kivork, E. Seja, G. Cherry, A. J. Gutierrez, T. R. Grogan, C. Mateus, G. Tomasic, J. A. Glaspy, R. O. Emerson, H. Robins, R. H. Pierce, D. A. Elashoff, C. Robert, and A. Ribas. 2014. PD-1 blockade induces responses by inhibiting adaptive immune resistance. Nature. 515:568-571. doi:10.1038/nature13954.
Twyman-Saint Victor, C., A. J. Rech, A. Maity, R. Rengan, K. E. Pauken, E. Stelekati, J. L. Benci, B. Xu, H. Dada, P. M. Odorizzi, R. S. Herati, K. D. Mansfield, D. Patsch, R. K. Amaravadi, L. M. Schuchter, H. Ishwaran, R. Mick, D. A. Pryma, X. Xu, M. D. Feldman, T. C. Gangadhar, S. M. Hahn, E. J. Wherry, R. H. Vonderheide, and A. J. Minn. 2015. Radiation and dual checkpoint blockade activate non-redundant immune mechanisms in cancer. Nature. 520:373-377. doi:10.1038/nature14292.
Vesely, M. D., M. H. Kershaw, R. D. Schreiber, and M. J. Smyth. 2011. Natural Innate and Adaptive Immunity to Cancer. Annu. Rev. Immunol. 29:235-271. doi:10.1146/annurev-immunol-031210-101324.
Waugh, K. A., S. M. Leach, B. L. Moore, T. C. Bruno, J. D. Buhrman, and J. E. Slansky. 2016. Molecular Profile of Tumor-Specific CD8⁺ T Cell Hypofunction in a Transplantable Murine Cancer Model. The Journal of Immunology. 197:1477-1488. doi:10.4049/jimmunol.1600589.
Wherry, E. J., and M. Kurachi. 2015. Molecular and cellular insights into T cell exhaustion. Nat Rev Immunol. 15:486-499. doi:10.1038/nri3862.
Wherry, E. J., S.-J. Ha, S. M. Kaech, W. N. Haining, S. Sarkar, V. Kalia, S. Subramaniam, J. N. Blattman, D. L. Barber, and R. Ahmed. 2007. Molecular signature of CD8⁺ T cell exhaustion during chronic viral infection. Immunity. 27:670-684. doi:10.1016/j.immuni.2007.09.006.
Wu, X., H. Zhang, Q. Xing, J. Cui, J. Li, Y. Li, Y. Tan, and S. Wang. 2014. PD-1(+) CD8(+) T cells are exhausted in tumours and functional in draining lymph nodes of colorectal cancer patients. Br. J. Cancer. 111:1391-1399. doi:10.1038/bjc.2014.416.
Zajac, A. J., J. N. Blattman, K. Murali-Krishna, D. J. Sourdive, M. Suresh, J. D. Altman, and R. Ahmed. 1998. Viral immune evasion due to persistence of activated T cells without effector function. J. Exp. Med. 188:2205-2213. doi:10.1084/jem.188.12.2205.
Zha, Y., R. Marks, A. W. Ho, A. C. Peterson, S. Janardhan, I. Brown, K. Praveen, S. Stang, J. C. Stone, and T. F. Gajewski. 2006. T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha. Nat Immunol. 7:1166-1173. doi:10.1038/nil394.
Zhang, L., T. F. Gajewski, and J. Kline. 2009. PD-1/PD-L1 interactions inhibit antitumor immune responses in a murine acute myeloid leukemia model. Blood. 114:1545-1552. doi:10.1182/blood-2009-03-206672.
Zheng, Y., Y. Zha, G. Driessens, F. Locke, and T. F. Gajewski. 2012. Transcriptional regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. Journal of Experimental Medicine. 209:2157-2163. doi:10.1084/jem.20120342.
Zheng, Y., Y. Zha, R. M. Spaapen, R. Mathew, K. Barr, A. Bendelac, and T. F. Gajewski. 2013. Egr2-dependent gene expression profiling and ChIP-Seq reveal novel biologic targets in T cell anergy. Mol. Immunol. 55:283-291. doi:10.1016/j.molimm.2013.03.006.

Claims

1. A method of treating a subject with cancer comprising administering an agent that specifically targets dysfunctional tumor antigen-specific CD8⁺ T cells.

2. The method of claim 1, wherein the subject suffers from a solid tumor cancer.

3. The method of claim 2, wherein the tumor allows T cell infiltration, but is resistant to immunotherapies.

4. The method of claim 2, wherein the tumor environment comprises dysfunctional tumor antigen-specific CD8⁺ T cells.

5. The method of claim 1, comprising contacting the dysfunctional tumor antigen-specific CD8⁺ T cells with an anti-4-1BB and/or anti-LAG3 agent.

6. The method of claim 5, wherein the anti-4-1BB and/or anti-LAG3 agent is an antibody, antibody fragment, or antibody mimetic molecule.

7. The method of claim 1, further comprising co-administration of an additional therapeutic agent.

8. The method of claim 7, wherein the additional therapeutic agent is a chemotherapeutic or an immunotherapeutic agent.

9. The method of claim 8, wherein the additional therapeutic agent is an immunotherapeutic agent selected from the list consisting of cell-based therapies, monoclonal antibody (mAb) therapy, cytokine therapy, and adjuvant treatment.

10. The method of claim 9, wherein the immunotherapeutic agent is a mAb therapy selected from the list consisting of anti-CTLA-4 monoclonal antibodies and/or anti-PD-L1 monoclonal antibodies.

11. The method of claim 9, wherein the immunotherapeutic agent is a cell-based therapy selected from the list consisting of dendritic-cell therapy and T-cell therapy.

12. The method of claim 7, wherein the additional therapeutic agent targets one of the receptors listed in Table 2.

13. The method of claim 7, wherein the additional therapeutic agent targets PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM and/or Sema7a.

14. The method of claim 1, comprising contacting the dysfunctional tumor antigen-specific CD8⁺ T cells with a therapeutic agent that targets one of the receptors listed in Table 2.

15. The method of claim 14, wherein the therapeutic agent targets PD-1, TIM-3, OX-40ICOS, TIGIT, CD244, TNFRSF18, Nrn1, Nrp1, KLRG1, GM156, GPNMB, GPR65, TMEM205, and TMEM126A, Nrn1, CRTAM and/or Sema7a.

16. The method of claim 15, wherein the therapeutic agent is an anti-Nrn1 antibody, antibody fragment, or antibody mimetic molecule.

17. The method of claim 15, wherein the therapeutic agent is an anti-Sema7a antibody, antibody fragment, or antibody mimetic molecule.

18. The method of claim 15, wherein the therapeutic agent is an anti-CRTAM antibody, antibody fragment, or antibody mimetic molecule.

19. A composition comprising: (a) one or more of an anti-4-1BB agent, an anti-LAG-3 agent, an anti-Nrn1 agent, an anti-Sema7a agent, and an anti-CRTAM agent; and (b) an immunotherapeutic agent, said composition formulated for therapeutic delivery to a subject.

20. The composition of claim 19, wherein the anti-4-1BB agent, anti-LAG-3 agent, anti-Nrn1 agent, anti-Sema7a agent, and/or anti-CRTAM agent is an antibody, antibody fragment, or antibody mimetic molecule.

21. A method comprising: (a) testing CD8⁺ T cells from a cell population to determine whether they co-express LAG-3 and 4-1BB; and (b) administering an anti-Nrn1 agent, an anti-Sema7a agent, and an anti-CRTAM agent.

22. The method of claim 21, wherein the anti-Nrn1 agent, anti-Sema7a agent, and/or anti-CRTAM agent is an antibody, antibody fragment, or antibody mimetic molecule.

23. The method of claim 21, wherein said testing is performed in vitro.

24. A method of identifying dysfunctional T cells by testing said cells for co-expression of 4-1BB and LAG-3.