US20230295587A1 - Compositions and Methods for Kallikrein (KLKB1) Gene Editing - Google Patents

Compositions and Methods for Kallikrein (KLKB1) Gene Editing Download PDF

Info

Publication number
US20230295587A1
US20230295587A1 US17/882,099 US202217882099A US2023295587A1 US 20230295587 A1 US20230295587 A1 US 20230295587A1 US 202217882099 A US202217882099 A US 202217882099A US 2023295587 A1 US2023295587 A1 US 2023295587A1
Authority
US
United States
Prior art keywords
composition
seq
guide
sequence
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US17/882,099
Other languages
English (en)
Inventor
Shobu Odate
Jessica Lynn Seitzer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intellia Therapeutics Inc
Original Assignee
Intellia Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intellia Therapeutics Inc filed Critical Intellia Therapeutics Inc
Priority to US17/882,099 priority Critical patent/US20230295587A1/en
Priority to US18/362,675 priority patent/US20240018496A1/en
Publication of US20230295587A1 publication Critical patent/US20230295587A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification

Definitions

  • Hereditary angioedema affects one in 50,000 people and contributes to 15,000 to 30,000 emergency room visits per year.
  • HAE is a rare autosomal, dominantly inherited blood disorder characterized by recurrent episodes of severe swelling (angioedema).
  • the most common areas of the body to develop swelling are the limbs, face, GI tract, and airway. Minor trauma or stress may trigger an attack but swelling often occurs without a known trigger.
  • Episodes involving the intestinal tract cause severe abdominal pain, nausea, and vomiting. Swelling in the airway can restrict breathing and lead to life-threatening obstruction of the airway or asphyxiation.
  • Symptoms of HAE typically begin in childhood and worsen during puberty. On average, untreated individuals have an attack every 1 to 2 weeks, and most episodes last for about 3 to 4 days.
  • types I, II, and III There are three types of hereditary angioedema, called types I, II, and III, and the different types have similar signs and symptoms.
  • Hereditary angioedema stems from excess bradykinin in the blood promoting vascular permeability and episodes of swelling.
  • Most patients with HAE have a C1 inhibitor (also called C1 esterase inhibitor or C1-INH) protein deficiency.
  • C1 inhibitor also called C1 esterase inhibitor or C1-INH
  • bradykinin levels can rise, initiate vascular leakage, and cause swelling attacks. Its production is controlled via the kallikrein-kinin (contact) pathway which is endogenously inhibited by C1-INH.
  • Bradykinin peptide is formed when high-molecular weight kininogen (HMWK) is cleaved by plasma kallikrein (pKal), an activated form of the protein prekallikrein.
  • HMWK high-molecular weight kininogen
  • pKal plasma kallikrein
  • Prekallikrein is encoded by KLKB1 and is also called KLKB1 protein.
  • KLKB1 protein is produced in the liver and secreted into plasma where it can be activated by factor XIIa. Once KLKB1 is activated, pKal can increase bradykinin levels. An excess of bradykinin in the blood leads to fluid leakage through the walls of blood vessels into body tissues. Excessive accumulation of fluids in body tissues causes the episodes of swelling seen in individuals with HAE.
  • kallikrein-kinin pathway Several drugs targeting the kallikrein-kinin pathway have been developed, including C1 esterase inhibitors (Berinert®, Cinryze®), recombinant C1-INH replacement therapy (rhC1INH; conestat alfa (Rhucin®, Ruconest®)), and bradykinin receptor antagonist (Icatibant, Firazyr®).
  • C1 esterase inhibitors Boerinert®, Cinryze®
  • rhC1INH recombinant C1-INH replacement therapy
  • conestat alfa Rhucin®, Ruconest®
  • Icatibant bradykinin receptor antagonist
  • Firazyr® bradykinin receptor antagonist
  • the present disclosure provides compositions and methods using the CRISPR/Cas system to knock out the KLKB1 gene, thereby reducing the production of prekallikrein (KLKB1), reducing kallikrein, and reducing bradykinin production in subjects with HAE.
  • the present invention provides compositions and methods using a guide RNA with an RNA-guided DNA binding agent such as the CRISPR/Cas system to substantially reduce or knockout expression of the KLKB1 gene, thereby substantially reducing or eliminating the production of bradykinin.
  • a guide RNA with an RNA-guided DNA binding agent such as the CRISPR/Cas system to substantially reduce or knockout expression of the KLKB1 gene, thereby substantially reducing or eliminating the production of bradykinin.
  • the substantial reduction or elimination of the production of bradykinin through alteration of the KLKB1 gene can be a long-term or permanent treatment.
  • Embodiment A1 is a guide RNA comprising:
  • Embodiment A2 is the guide RNA of embodiment A1, further comprising the nucleotide sequence of SEQ ID NO: 202.
  • Embodiment A3 is the guide RNA of embodiment A1, wherein the guide RNA further comprises a nucleotide sequence selected from SEQ ID NO: 170, 171, 172, and 173 wherein the sequence of SEQ ID NO: 170, 171, 172, or 173 is 3′ of the guide sequence.
  • Embodiment A4 is the guide RNA of any one of embodiments A1-A3, wherein the guide RNA further comprises a 3′ tail.
  • Embodiment A5 is the guide RNA of any one of embodiments A1-A4, wherein the guide RNA comprises at least one modification.
  • Embodiment A6 is the guide RNA of embodiment A5, wherein the modification comprises a 5′ end modification.
  • Embodiment A7 is the guide RNA of embodiment A5 or A6, wherein the modification comprises a 3′ end modification.
  • Embodiment A8 is the guide RNA of any one of embodiments A1-A7, wherein the guide RNA comprises a modification in a hairpin region.
  • Embodiment A9 is the guide RNA of any one of embodiments A1-A8, wherein the modification comprises a 2′-O-methyl (2′-O-Me) modified nucleotide.
  • Embodiment A10 is the guide RNA of any one of embodiments A1-A9, wherein the modification comprises a phosphorothioate (PS) bond between nucleotides.
  • PS phosphorothioate
  • Embodiment A11 is the guide RNA of any one of embodiments A1-A10, wherein the modification comprises a 2′-fluor (2′F) modified nucleotide.
  • Embodiment A12 is the guide RNA of any one of embodiments A1 or A3-A11, further comprising the nucleotide sequence of SEQ ID NO: 171.
  • Embodiment A13 is the guide RNA of embodiment A12, modified according to the pattern of nucleotide sequence of SEQ ID NO: 405.
  • Embodiment A14 is the guide RNA of any one of embodiments A1 or A3-A11, further comprising the nucleotide sequence of SEQ ID NO: 173.
  • Embodiment A15 is the guide RNA of embodiment A14, modified according to the pattern of SEQ ID NO: 248-255 or 450.
  • Embodiment A16 is the guide RNA of any one of embodiments A12-A15, wherein the guide sequence is SEQ ID NO: 15.
  • Embodiment A17 is the guide RNA of any one of embodiments A12-A15, wherein the guide sequence is SEQ ID NO: 8.
  • Embodiment A18 is the guide RNA of any one of embodiments A12-A15, wherein the guide sequence is SEQ ID NO: 41.
  • Embodiment A19 is the guide RNA of any one of embodiments A1 or A4-A11, wherein the guide RNA is modified according to the pattern of SEQ ID NO: 300, wherein the N's are collectively the guide sequence of embodiment A1.
  • Embodiment A20 is the guide RNA of embodiment A16, wherein each N in SEQ ID NO: 300 is any natural or non-natural nucleotide.
  • Embodiment A21 is the guide RNA of embodiment A19, wherein the guide sequence is SEQ ID NO: 15 and the guide RNA is modified according to mG*mG*mA* UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAA GUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUm GmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU, wherein “mA,” “mC,” “mU,” or “mG” denote a nucleotide that has been modified with 2′-O-Me, a * denotes a phosphorothioate bond, and an N is a natural nucleotide.
  • Embodiment A22 is the guide RNA of embodiment A19, wherein the guide sequence is SEQ ID NO: 8 and the guide RNA is modified according to mU*mA*mC*CCGGGAGUUGACUUUGGGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU, wherein “mA,” “mC,” “mU,” or “mG” denote a nucleotide that has been modified with 2′-O-Me, a * denotes a phosphorothioate bond, and N is a natural nucleotide.
  • Embodiment A23 is the guide RNA of embodiment A19, wherein the guide sequence is SEQ ID NO: 41 and the guide RNA is modified according to mU*mA*mU*UAUCAAAUCACAUUACCGUUUUAGAmGmCmUmAmGmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU, wherein “mA,” “mC,” “mU,” or “mG” denote a nucleotide that has been modified with 2′-O-Me, a * denotes a phosphorothioate bond, and N is a natural nucleotide.
  • Embodiment A24 is a composition comprising a guide RNA of any one of embodiments A1-A23.
  • Embodiment A25 is a composition of embodiment A24, further comprising an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent.
  • Embodiment A26 is the composition of embodiment A25, wherein the nucleic acid encoding an RNA-guided DNA binding agent comprises an mRNA comprising an open reading frame (ORF) encoding an RNA guided DNA binding agent.
  • ORF open reading frame
  • Embodiment A27 is the composition of embodiment A25 or A26, wherein the RNA-guided DNA binding agent is Cas9.
  • Embodiment A28 is the composition of embodiment A27, wherein the Cas9 is S. pyogenes Cas9.
  • Embodiment A29 is the composition of any one of embodiments A26-A28, wherein the ORF is a modified ORF.
  • Embodiment A30 is the composition of any one of embodiments A24-A29, further comprising a pharmaceutical excipient.
  • Embodiment A31 is the composition of any one of embodiments A24-A30, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
  • LNP lipid nanoparticle
  • Embodiment A32 is the composition of embodiment A31, wherein the LNP comprises a cationic lipid.
  • Embodiment A33 is the composition of embodiment A32, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.
  • Embodiment A34 is the composition of any one of embodiments A31-A33, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate, DSPC, cholesterol, and PEG2k-DMG.
  • the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)
  • Embodiment A35 is a pharmaceutical composition comprising a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34.
  • Embodiment A36 is a pharmaceutical composition comprising or use of a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34 for inducing a double stranded break or a single stranded break within a KLKB1 gene in a cell or reducing expression of KLKB1 in a cell.
  • Embodiment A37 is the pharmaceutical composition or use of embodiment A36, for reducing expression of the KLKB1 gene in a cell or subject.
  • Embodiment A38 is a pharmaceutical composition comprising or use of a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34 for treating a subject having hereditary angioedema (HAE).
  • HAE hereditary angioedema
  • Embodiment A39 is the pharmaceutical composition or use of embodiment A38, comprising reducing the frequency and/or severity of HAE attacks.
  • Embodiment A40 is a pharmaceutical composition comprising or use of a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34 for treating or preventing angioedema associated with HAE, bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation.
  • Embodiment A41 is a pharmaceutical composition or use of a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34 for reducing total plasma kallikrein activity or reducing prekallikrein and/or kallikrein levels in a subject.
  • Embodiment A42 is the pharmaceutical composition or use of embodiment A41, wherein the total plasma kallikrein activity is reduced by more than 60%.
  • Embodiment A43 is a method or inducing a double stranded break or a single stranded break within a KLKB1 gene in a cell or reducing expression of KLKB1 in a cell comprising contacting a cell with a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34.
  • Embodiment A44 is the method of embodiment A43, wherein the cell is in a subject.
  • Embodiment A45 is a method of treating a subject having hereditary angioedema (HAE) comprising administering a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-34 thereby treating the subject.
  • HAE hereditary angioedema
  • Embodiment A46 is the method of embodiment A45, wherein treating the subject comprises reducing the frequency and/or severity of HAE attacks.
  • Embodiment A47 is a method of treating or preventing angioedema associated with HAE, bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation comprising administering to the subject a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34, thereby treating or preventing angioedema associated with HAE, bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation in the subject.
  • Embodiment A48 is a method of reducing total plasma kallikrein activity in a subject comprising administrating a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34, thereby reducing total plasma kallikrein activity in a subject.
  • Embodiment A49 is the method of embodiment A48, wherein the total plasma kallikrein activity is reduced by more than 60% in the subject.
  • Embodiment A50 is the use of a guide RNA of any one of embodiments A1-A23 or composition of any one of embodiments A24-A34 in the preparation of a medicament for practicing any of the methods of embodiments A43-A49.
  • Embodiment 1 is a method of inducing a double-stranded break (DSB) or a single-stranded break (SSB) within the KLKB1 gene, comprising delivering a composition to a cell, wherein the composition comprises:
  • Embodiment 2 is a method of reducing the expression of the KLKB1 gene comprising delivering a composition to a cell, wherein the composition comprises:
  • Embodiment 3 is a method of treating or preventing hereditary angioedema (HAE) comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 4 is a method of treating or preventing angioedema caused by or associated with HAE comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 5 is a method of treating or preventing any one of bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 6 is a method of reducing the frequency and/or severity of HAE attacks, comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 7 is a method for reducing the frequency and/or severity of angioedema attacks, or achieving remission of angioedema attacks in a subject, comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 8 is a method of reducing total plasma kallikrein activity, comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 9 is the method of embodiment 8, further comprising an activation step to convert prekallikrein to its active form, pKal.
  • Embodiment 10 is the method of embodiment 8, wherein the total plasma kallikrein activity is reduced by more than 60%, more than 85%, or more than 60-80%.
  • Embodiment 11 is a method of reducing total plasma kallikrein levels, comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 12 is a method of reducing prekallikrein and/or kallikrein levels, comprising administering a composition to a subject in need thereof, wherein the composition comprises:
  • Embodiment 13 is the method of any one of the preceding embodiments, wherein there is a dose dependent increase in percent editing.
  • Embodiment 14 is the method of embodiment 13, wherein there is a dose dependent reduction in total plasma kallikrein levels.
  • Embodiment 15 is the method of embodiment 13 or 14, wherein there is a dose dependent reduction in plasma kallikrein activity.
  • Embodiment 16 is the method of any one of the preceding embodiments wherein the effect is durable for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years or more after the administration.
  • Embodiment 17 is the method of any one of the preceding embodiments wherein the effect is durable for at least 6 months.
  • Embodiment 18 is the method of any one of the preceding embodiments wherein the effect is durable for at least 1 year.
  • Embodiment 19 is the method of embodiment 6, wherein the frequency of HAE attacks is reduced.
  • Embodiment 20 is the method of embodiment 19, wherein the frequency is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 60-80%, or at least 40-90%.
  • Embodiment 21 is the method of embodiment 20, wherein the frequency is reduced by at least 60-80%.
  • Embodiment 22 is the method of embodiment 20, wherein the frequency is reduced by at least 40-90%.
  • Embodiment 23 is the method of any one of the preceding embodiments, wherein the effect is durable for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years or more after the administration.
  • Embodiment 24 is the method of any one of the preceding embodiments, wherein the effect is durable for at least 6 months after the administration.
  • Embodiment 25 is the method of any one of the preceding embodiments, wherein the effect is durable for at least 1 year after the administration.
  • Embodiment 26 is the method of any one of the preceding embodiments, wherein the effect is compared to a basal level.
  • Embodiment 27 is the method of any one of the preceding embodiments, wherein the effect is compared to a subject's basal level.
  • Embodiment 28 is the method of any one of the preceding embodiments, wherein an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent is administered.
  • Embodiment 29 is a composition comprising:
  • Embodiment 30 is a composition comprising a short-single guide RNA (short-sgRNA), comprising:
  • Embodiment 31 The composition of embodiment 29, comprising the sequence of SEQ ID NO: 202.
  • Embodiment 32 is the composition of embodiment 29 or embodiment 30, comprising a 5′ end modification.
  • Embodiment 33 is the composition of any one of embodiments 29-32, wherein the short-sgRNA comprises a 3′ end modification.
  • Embodiment 34 is the composition of any one of embodiments 29-33, wherein the short-sgRNA comprises a 5′ end modification and a 3′ end modification.
  • Embodiment 35 is the composition of any one of embodiments 29-34, wherein the short-sgRNA further comprises a 3′ tail.
  • Embodiment 36 is the composition of embodiment 35, wherein the 3′ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
  • Embodiment 37 is the composition of embodiment 35, wherein the 3′ tail comprises about 1-2, 1-3, 1-4, 1-5, 1-7, 1-10, at least 1-2, at least 1-3, at least 1-4, at least 1-5, at least 1-7, or at least 1-10 nucleotides.
  • Embodiment 38 is the composition of any one of embodiments 29-37, wherein the short-sgRNA does not comprise a 3′ tail.
  • Embodiment 39 is the composition of any one of embodiments 29-38, comprising a modification in the hairpin region.
  • Embodiment 40 is the composition of any one of embodiments 29-39, comprising a 3′ end modification, and a modification in the hairpin region.
  • Embodiment 41 is the composition of any one of embodiments 29-40, comprising a 3′ end modification, a modification in the hairpin region, and a 5′ end modification.
  • Embodiment 42 is the composition of any one of embodiments 29-41, comprising a 5′ end modification, and a modification in the hairpin region.
  • Embodiment 43 is the composition of any one of embodiments 29-42, wherein the hairpin region lacks at least 5 consecutive nucleotides.
  • Embodiment 44 is the composition of any one of embodiments 29-43, wherein the at least 5-10 lacking nucleotides:
  • Embodiment 45 is the composition of any one of embodiments 29-44, comprising a conserved portion of an sgRNA comprising a nexus region, wherein the nexus region lacks at least one nucleotide.
  • Embodiment 46 is the composition of embodiment 45, wherein the nucleotides lacking in the nexus region comprise any one or more of:
  • Embodiment 47 is a composition comprising a modified single guide RNA (sgRNA) comprising
  • Embodiment 48 is the composition of embodiment 47, comprising SEQ ID NO: 450.
  • Embodiment 49 is the composition of any one of embodiments 29-48, for use in inducing a double-stranded break (DSB) or a single-stranded break within the KLKB1 gene in a cell or subject.
  • DSB double-stranded break
  • KLKB1 single-stranded break
  • Embodiment 50 is the composition of any one of embodiments 29-48, for use in reducing the expression of the KLKB1 gene in a cell or subject.
  • Embodiment 51 is the composition of any one of embodiments 29-48, for use in treating or preventing HAE in a subject.
  • Embodiment 52 is the composition of any one of embodiments 29-48, for use in reducing serum and/or plasma bradykinin concentration in a subject.
  • Embodiment 53 is the composition of any one of embodiments 29-48, for use in reducing bradykinin-mediated vasodilation concentration in a subject.
  • Embodiment 54 is the composition of any one of embodiments 29-48, for use in treating or preventing bradykinin production and accumulation, bradykinin-mediated vasodilation, swelling, or angioedema, obstruction of the airway, or asphyxiation.
  • Embodiment 55 is the composition of any one of embodiments 29-48, for use in treating or preventing angioedema caused by or associated with HAE.
  • Embodiment 56 is the composition of any one of embodiments 29-48, for use in reducing the frequency of angioedema attacks.
  • Embodiment 57 is the composition of any one of embodiments 29-48, for use in reducing the severity of angioedema attacks.
  • Embodiment 58 is the composition of any one of embodiments 29-48, for use in reducing the frequency and/or severity of attacks.
  • Embodiment 59 is the composition of any one of embodiments 29-48, for use in achieving remission of angioedema attacks.
  • Embodiment 60 is the composition of any one of embodiments 29-48, for use in reducing the frequency and/or severity of HAE attacks.
  • Embodiment 61 is the composition of embodiment 60, for use in reducing the frequency of HAE attacks.
  • Embodiment 62 is the composition of embodiment 61, wherein the frequency is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 60-80%, or at least 40-90%.
  • Embodiment 63 is the method of embodiment 61, wherein the frequency is reduced by at least 60-80%.
  • Embodiment 64 is the method of embodiment 61, wherein the frequency is reduced by at least 40-90%.
  • Embodiment 65 is the composition of embodiment 60, for use in reducing total plasma kallikrein activity.
  • Embodiment 66 is the composition of embodiment 60, for use in reducing total plasma kallikrein levels.
  • Embodiment 67 is the composition of embodiment 60, for use in reducing prekallikrein and/or kallikrein levels.
  • Embodiment 68 is the composition of any one of embodiments 65-67, wherein there is a dose dependent increase in percent editing.
  • Embodiment 69 is the composition of any one of embodiments 65-68, wherein there is a dose dependent reduction in total plasma kallikrein levels.
  • Embodiment 70 is the composition of any one of embodiments 65-69, wherein there is a dose dependent reduction in plasma kallikrein activity.
  • Embodiment 71 is the composition of any one of embodiments 29-70, wherein the effect is durable for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years or more after the administration.
  • Embodiment 72 is the composition of any one of embodiments 29-71, wherein the effect is durable for at least 6 months.
  • Embodiment 73 is the composition of any one of embodiments 29-72, wherein the effect is durable for at least 1 year.
  • Embodiment 74 is the method of any of embodiments 1-28, further comprising:
  • Embodiment 75 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases KLKB1 mRNA production.
  • Embodiment 76 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases prekallikrein protein levels in plasma or serum.
  • Embodiment 77 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases total kallikrein (prekallikrein and pKal) protein levels in plasma or serum.
  • Embodiment 78 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases the proportion of circulating cleaved HMWK (cHMWK) compared to total HMWK in citrated serum or citrated plasma.
  • cHMWK circulating cleaved HMWK
  • Embodiment 79 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's proportion of cHMWK in citrated plasma to below 30% of total HMWK.
  • Embodiment 80 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases the spontaneous pKal activity in serum or plasma.
  • Embodiment 81 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition decreases kallikrein activity.
  • Embodiment 82 is the method, composition, or composition for use of any one the preceding embodiments, wherein the kallikrein activity comprises total kallikrein activity, prekallikrein activity, and/or pKal activity.
  • Embodiment 83 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity by at least about 40% prior to the method or use of the composition.
  • Embodiment 84 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity by at least about 50% prior to the method or use of the composition.
  • Embodiment 85 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity by at least about 60% prior to the method or use of the composition.
  • Embodiment 86 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity to less than about 40% of basal levels.
  • Embodiment 87 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity to about 40-50% of basal levels.
  • Embodiment 88 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces a subject's pKal activity to 20-40% or 20-50% of basal levels.
  • Embodiment 89 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition increases serum and/or plasma bradykinin levels.
  • Embodiment 90 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition results in editing of the KLKB1 gene.
  • Embodiment 91 is the method, composition, or composition for use of embodiment 90, wherein the editing is calculated as a percentage of the population that is edited (percent editing).
  • Embodiment 92 is the method, composition, or composition for use of embodiment 91, wherein the percent editing is between 30 and 99% of the population.
  • Embodiment 93 is the method, composition, or composition for use of embodiment 91, wherein the percent editing is between 30 and 35%, 35 and 40%, 40 and 45%, 45 and 50%, 50 and 55%, 55 and 60%, 60 and 65%, 65 and 70%, 70 and 75%, 75 and 80%, 80 and 85%, 85 and 90%, 90 and 95%, or 95 and 99% of the population.
  • Embodiment 94 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces serum and/or plasma bradykinin concentration.
  • Embodiment 95 is the method, composition, or composition for use of any one the preceding embodiments, wherein the composition reduces serum and/or plasma bradykinin concentration, and wherein a reduction in serum and/or plasma bradykinin results in decreased swelling in organ tissues, including limbs, face, GI tract, or airway.
  • Embodiment 96 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is selected from
  • Embodiment 97 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprises a sgRNA comprising:
  • Embodiment 98 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the target sequence is in exon 1, exon 3, exon 4, exon 5, exon 6, or exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, or exon 15 of the human KLKB1 gene.
  • Embodiment 99 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 1 of the human KLKB1 gene.
  • Embodiment 100 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 3 of the human KLKB1 gene.
  • Embodiment 101 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 4 of the human KLKB1 gene.
  • Embodiment 102 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 5 of the human KLKB1 gene.
  • Embodiment 103 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 6 of the human KLKB1 gene.
  • Embodiment 104 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 8 of the human KLKB1 gene.
  • Embodiment 105 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 9 of the human KLKB1 gene.
  • Embodiment 106 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 10 of the human KLKB1 gene.
  • Embodiment 107 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 11 of the human KLKB1 gene.
  • Embodiment 108 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 12 of the human KLKB1 gene.
  • Embodiment 109 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 13 of the human KLKB1 gene.
  • Embodiment 110 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 14 of the human KLKB1 gene.
  • Embodiment 111 is the method, composition for use, or composition of embodiment 98, wherein the target sequence is in exon 15 of the human KLKB1 gene.
  • Embodiment 112 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is complementary to a target sequence in the positive strand of KLKB1.
  • Embodiment 113 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is complementary to a target sequence in the negative strand of KLKB1.
  • Embodiment 114 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the first guide sequence is complementary to a first target sequence in the positive strand of the KLKB1 gene, and wherein the composition further comprises a second guide sequence that is complementary to a second target sequence in the negative strand of the KLKB1 gene.
  • Embodiment 115 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from any one of SEQ ID Nos 1-149 and further comprises a nucleotide sequence of SEQ ID NO: 170, wherein the nucleotides of SEQ ID NO: 170 follow the guide sequence at its 3′ end.
  • Embodiment 116 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from any one of SEQ ID Nos: 1-149 and further comprises a nucleotide sequence of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, or any one of SEQ ID Nos: 400-450, wherein the nucleotides of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, or any one of conserved portions of sgRNA from Table 4 follow the guide sequence at its 3′ end.
  • the guide RNA comprises a guide sequence selected from any one of SEQ ID Nos: 1-149 and further comprises a nucleotide sequence of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, or any one of SEQ ID Nos: 400-450, wherein the nucleotides of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO
  • Embodiment 117 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA is a single guide RNA (sgRNA).
  • sgRNA single guide RNA
  • Embodiment 118 is the method, composition for use, or composition of embodiment 117, wherein the sgRNA comprises a guide sequence comprising any one of SEQ ID Nos: 8, 15, 41, 51, 69.
  • Embodiment 119 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA is modified according to the pattern of SEQ ID NO: 300, wherein the N's are collectively any one of the guide sequences of Table 1 (SEQ ID Nos: 1-149).
  • Embodiment 120 is the method, composition for use, or composition of embodiment 119, wherein each N in SEQ ID NO: 300 is any natural or non-natural nucleotide, wherein the N's form the guide sequence, and the guide sequence targets Cas9 to the KLKB1 gene.
  • Embodiment 121 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 1-149 and the nucleotides of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, or any of the conserved portions of sgRNA from Table 4, wherein the nucleotides of SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, or any of the conserved portions of sgRNA from Table 4 follow the guide sequence at its 3′ end.
  • Embodiment 122 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the sgRNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID Nos: 1-149.
  • Embodiment 123 is the method, composition for use, or composition of embodiment 122, wherein the sgRNA comprises a sequence selected from SEQ ID Nos: 8, 15, 41, 51, 69.
  • Embodiment 124 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA comprises at least one modification.
  • Embodiment 125 is the method, composition for use, or composition of embodiment 124, wherein the at least one modification includes a 2′-O-methyl (2′-O-Me) modified nucleotide.
  • Embodiment 126 is the method, composition for use, or composition of any one of embodiments 124-125, comprising a phosphorothioate (PS) bond between nucleotides.
  • PS phosphorothioate
  • Embodiment 127 is the method, composition for use, or composition of any one of embodiments 124-126, comprising a 2′-fluoro (2′-F) modified nucleotide.
  • Embodiment 128 is the method, composition for use, or composition of any one of embodiments 124-127, comprising a modification at one or more of the first five nucleotides at the 5′ end of the guide RNA.
  • Embodiment 129 is the method, composition for use, or composition of any one of embodiments 124-128, comprising a modification at one or more of the last five nucleotides at the 3′ end of the guide RNA.
  • Embodiment 130 is the method, composition for use, or composition of any one of embodiments 124-129, comprising a PS bond between the first four nucleotides of the guide RNA.
  • Embodiment 131 is the method, composition for use, or composition of any one of embodiments 124-130, comprising a PS bond between the last four nucleotides of the guide RNA.
  • Embodiment 132 is the method, composition for use, or composition of any one of embodiments 124-131, comprising a 2′-O-Me modified nucleotide at the first three nucleotides at the 5′ end of the guide RNA.
  • Embodiment 133 is the method, composition for use, or composition of any one of embodiments 124-132, comprising a 2′-O-Me modified nucleotide at the last three nucleotides at the 3′ end of the guide RNA.
  • Embodiment 134 is the method, composition for use, or composition of any one of embodiments 124-133, wherein the guide RNA comprises the modified nucleotides of SEQ ID NO: 300.
  • Embodiment 135 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition further comprises a pharmaceutically acceptable excipient.
  • Embodiment 136 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
  • LNP lipid nanoparticle
  • Embodiment 137 is the method, composition for use, or composition of embodiment 136, wherein the LNP comprises a cationic lipid.
  • Embodiment 138 is the method, composition for use, or composition of embodiment 137, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.
  • Embodiment 139 is the method, composition for use, or composition of any one of embodiments 136-138, wherein the LNP comprises a neutral lipid.
  • Embodiment 140 is the method, composition for use, or composition of embodiment 139, wherein the neutral lipid is DSPC.
  • Embodiment 141 is the method, composition for use, or composition of any one of embodiments 136-140, wherein the LNP comprises a helper lipid.
  • Embodiment 142 is the method, composition for use, or composition of embodiment 141, wherein the helper lipid is cholesterol.
  • Embodiment 143 is the method, composition for use, or composition of any one of embodiments 136-142, wherein the LNP comprises a stealth lipid.
  • Embodiment 144 is the method, composition for use, or composition of embodiment 143, wherein the stealth lipid is PEG2k-DMG.
  • Embodiment 145 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition further comprises an RNA-guided DNA binding agent.
  • Embodiment 146 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition further comprises an mRNA that encodes an RNA-guided DNA binding agent.
  • Embodiment 147 is the method, composition for use, or composition of embodiment 145 or 146, wherein the RNA-guided DNA binding agent is Cas9.
  • Embodiment 148 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.
  • Embodiment 149 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprises a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 1.
  • Embodiment 150 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 2.
  • Embodiment 151 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 3.
  • Embodiment 152 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 4.
  • Embodiment 153 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 5.
  • Embodiment 154 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 6.
  • Embodiment 155 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 7.
  • Embodiment 156 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprises a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 8.
  • Embodiment 157 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 9.
  • Embodiment 158 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 10.
  • Embodiment 159 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 11.
  • Embodiment 160 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 12.
  • Embodiment 161 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 13.
  • Embodiment 162 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 14.
  • Embodiment 163 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 15.
  • Embodiment 164 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 16.
  • Embodiment 165 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 17.
  • Embodiment 166 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 18.
  • Embodiment 167 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 19.
  • Embodiment 168 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 20.
  • Embodiment 169 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 21.
  • Embodiment 170 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 22.
  • Embodiment 171 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 23.
  • Embodiment 172 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 24.
  • Embodiment 173 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 25.
  • Embodiment 174 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 26.
  • Embodiment 175 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 27.
  • Embodiment 176 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 28.
  • Embodiment 177 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 29.
  • Embodiment 178 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 30.
  • Embodiment 179 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 31.
  • Embodiment 180 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 32.
  • Embodiment 181 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 33.
  • Embodiment 182 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 34.
  • Embodiment 183 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 35.
  • Embodiment 184 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 36.
  • Embodiment 185 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 37.
  • Embodiment 186 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 38.
  • Embodiment 187 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 39.
  • Embodiment 188 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 40.
  • Embodiment 189 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 41.
  • Embodiment 190 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 42.
  • Embodiment 191 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 43.
  • Embodiment 192 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 44.
  • Embodiment 193 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 45.
  • Embodiment 194 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 46.
  • Embodiment 195 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 47.
  • Embodiment 196 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 48.
  • Embodiment 197 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 49.
  • Embodiment 198 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 50.
  • Embodiment 199 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 51.
  • Embodiment 200 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 52.
  • Embodiment 201 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 53.
  • Embodiment 202 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 54.
  • Embodiment 203 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 55.
  • Embodiment 204 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 56.
  • Embodiment 205 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 57.
  • Embodiment 206 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 58.
  • Embodiment 207 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 59.
  • Embodiment 208 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 60.
  • Embodiment 209 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 61.
  • Embodiment 210 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 62.
  • Embodiment 211 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 63.
  • Embodiment 212 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 64.
  • Embodiment 213 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 65.
  • Embodiment 214 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 66.
  • Embodiment 215 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 67.
  • Embodiment 216 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 68.
  • Embodiment 217 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 69.
  • Embodiment 218 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 70.
  • Embodiment 219 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 71.
  • Embodiment 220 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 72.
  • Embodiment 221 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 73.
  • Embodiment 222 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 74.
  • Embodiment 223 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 75.
  • Embodiment 224 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 76.
  • Embodiment 225 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 77.
  • Embodiment 226 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 78.
  • Embodiment 227 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 79.
  • Embodiment 228 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 80.
  • Embodiment 229 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 81.
  • Embodiment 230 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 82.
  • Embodiment 231 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 83.
  • Embodiment 232 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 84.
  • Embodiment 233 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 85.
  • Embodiment 234 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 86.
  • Embodiment 235 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 87.
  • Embodiment 236 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 88.
  • Embodiment 237 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 89.
  • Embodiment 238 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-1491-149 is SEQ ID NO: 90.
  • Embodiment 239 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-1491-149 is SEQ ID NO: 91.
  • Embodiment 240 is the method, composition for use, or composition of any one of embodiments 1-89, wherein the sequence selected from SEQ ID NOs: 1-1491-149 is SEQ ID NO: 92.
  • Embodiment 241 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 93.
  • Embodiment 242 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 94.
  • Embodiment 243 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 95.
  • Embodiment 244 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 96.
  • Embodiment 245 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 97.
  • Embodiment 246 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 98.
  • Embodiment 247 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 99.
  • Embodiment 248 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 100.
  • Embodiment 249 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 101.
  • Embodiment 250 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 102.
  • Embodiment 251 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 103.
  • Embodiment 252 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 104.
  • Embodiment 253 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 105.
  • Embodiment 254 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 106.
  • Embodiment 255 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 107.
  • Embodiment 256 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 108.
  • Embodiment 257 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 109.
  • Embodiment 258 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 110.
  • Embodiment 259 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 111.
  • Embodiment 260 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 112.
  • Embodiment 261 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 113.
  • Embodiment 262 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 114.
  • Embodiment 263 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 115.
  • Embodiment 264 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 116.
  • Embodiment 265 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 117.
  • Embodiment 266 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 118.
  • Embodiment 267 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 119.
  • Embodiment 268 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 120.
  • Embodiment 269 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 121.
  • Embodiment 270 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 122.
  • Embodiment 271 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 123.
  • Embodiment 272 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 124.
  • Embodiment 273 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 125.
  • Embodiment 274 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 126.
  • Embodiment 275 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 127.
  • Embodiment 276 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 128.
  • Embodiment 277 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 129.
  • Embodiment 278 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 130.
  • Embodiment 279 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 131.
  • Embodiment 280 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 132.
  • Embodiment 281 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 133.
  • Embodiment 282 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 134.
  • Embodiment 283 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 135.
  • Embodiment 284 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 136.
  • Embodiment 285 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 137.
  • Embodiment 286 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 138.
  • Embodiment 287 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 139.
  • Embodiment 288 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 140.
  • Embodiment 289 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 141.
  • Embodiment 290 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 142.
  • Embodiment 291 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 143.
  • Embodiment 292 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 144.
  • Embodiment 293 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 145.
  • Embodiment 294 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 146.
  • Embodiment 295 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 147.
  • Embodiment 296 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 148.
  • Embodiment 297 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1-149 is SEQ ID NO: 149.
  • Embodiment 298 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NO: 310-386.
  • Embodiment 299 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NO: 310-311, 313-326, 329-337, 339-342, 344-346, 348, 350, 352-356, 361, 362, 364, 365, 366, 367, 369-374, 376-380, and 382-386.
  • Embodiment 300 is the method, composition for use, or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NO: 310-386 is SEQ ID NO: 310.
  • Embodiment 301 is the method, composition for use, or composition of any one of the preceding embodiments, comprising an sgRNAs comprising the guide sequence of any one of SEQ ID NOs: 1-149 and any one of the conserved portions of sgRNA of Table 4, optionally having the modification pattern of SEQ ID NO: 450 or any one of the modification patterns of Table 4, optionally wherein the sgRNA comprises a 5′ and 3′ end modification.
  • Embodiment 302 is the method, composition, or composition for use of any one of embodiments 1-301, wherein the composition is administered as a single dose.
  • Embodiment 303 is the method, composition, or composition for use of any one of embodiments 1-301, wherein the composition is administered one time.
  • Embodiment 304 is the method, composition, or composition for use of any one of embodiments 302 or 303, wherein the single dose or one time administration:
  • Embodiment 305 is the method or composition of embodiment 304, wherein the single dose or one time administration achieves any one or more of a)-h) for 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks.
  • Embodiment 306 is the method or composition of embodiment 304, wherein the single dose or one time administration achieves a durable effect.
  • Embodiment 307 is the method, composition, or composition for use of any one of embodiments 1-306, further comprising achieving a durable effect.
  • Embodiment 308 is the method, composition, or composition for use of embodiment 307, wherein the durable effect persists at least 1 month, at least 3 months, at least 6 months, at least one year, or at least 5 years.
  • Embodiment 309 is the method, composition, or composition for use of any one of embodiments 1-308, wherein administration of the composition results in a therapeutically relevant reduction of kallikrein activity, total plasma kallikrein levels, prekallikrein and/or kallikrein levels, or bradykinin in serum and/or plasma.
  • Embodiment 310 is the method, composition, or composition for use of any one of embodiments 1-309, wherein administration of the composition results in serum and/or plasma bradykinin levels within a therapeutic range.
  • Embodiment 311 is the method, composition, or composition for use of any one of the preceding embodiments, wherein administration of the composition results in serum and/or plasma bradykinin levels within 100, 120, or 150% of normal range.
  • Embodiment 312 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for treating a human subject having HAE.
  • Embodiment 313 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for treating and preventing bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation.
  • Embodiment 314 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for treating or preventing angioedema caused by or associated with HAE.
  • Embodiment 315 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for reducing the frequency of angioedema attacks.
  • Embodiment 316 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for reducing the severity of angioedema attacks.
  • Embodiment 317 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for reducing the frequency and/or severity of HAE attacks.
  • Embodiment 318 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for achieving remission of angioedema attacks.
  • Embodiment 319 is use of a composition of any of the preceding composition embodiments for the preparation of a medicament for achieving durable remission, e.g. maintained for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years or more.
  • FIGS. 1 A- 1 D shows percent editing (indel frequency) detected at various sites within the KLKB1 locus using guide RNAs in primary human hepatocytes (PHH) ( FIGS. 1 A- 1 B ) and primary cynomolgus hepatocytes (PCH) ( FIGS. 1 C- 1 D ).
  • FIGS. 2 A- 2 D show percent editing (indel frequency) of KLKB1 sgRNAs in PHH ( FIGS. 2 A- 2 B ) and PCH ( FIGS. 2 C- 2 D ).
  • FIGS. 3 A- 3 E show percent editing (indel frequency) ( FIG. 3 A ), secreted KLKB1 protein levels ( FIG. 3 B ), and correlation plots ( FIGS. 3 C-E ), after transfection of PHH with KLKB1-targeting guide RNAs in three different PHH lots (HU8300, HU8284, and HU8296).
  • FIGS. 4 A- 4 D show percent editing of the KLKB1 guides in primary human hepatocytes (PHH) ( FIGS. 4 A- 4 B ), and percent editing of the KLKB1 guides in primary cynomolgus hepatocytes (PCH) ( FIGS. 4 C- 4 D ).
  • FIGS. 5 A- 5 J show dose response data for percent editing and secreted kallikrein for certain guide sequences in PHH ( FIGS. 5 A- 5 D ) and PCH ( FIGS. 5 E- 5 H ), and correlation plots of percent editing and secreted protein in PHH and PCH ( FIGS. 5 I- 5 J ).
  • FIGS. 6 A- 6 D provide dose response curve data for indel frequency for certain guide sequences in PHH ( FIGS. 6 A- 6 B ) and PCH ( FIGS. 6 C- 6 D ).
  • FIGS. 7 A- 7 E show dose response curve data for indel frequency ( FIGS. 7 A and 7 B ) and KLKB1 secretion ( FIGS. 7 C and 7 D ) for certain guide sequences in PHH ( FIGS. 7 A and 7 C ) and PCH ( FIGS. 7 B and 7 D ) and western blot analysis to measure secreted protein ( FIG. 7 E ).
  • FIG. 8 A shows KLKB1 editing % for various modified sgRNAs in vivo in Hu KLKB1 mice.
  • FIGS. 8 B and 8 C show KLKB1 protein levels measured using the ELISA and electrochemiluminescence-based array respectively in Hu KLKB1 mice (Example 6).
  • FIG. 8 D shows the fold change of KLKB1 mRNA levels for each sequence in Hu KLKB1 mice.
  • FIGS. 9 A- 9 D show levels of KLKB1 editing ( FIG. 9 A ), serum KLKB1 protein (prekallikrein and kallikrein) ( FIG. 9 B ), percent TSS ( FIG. 9 C ) in treated mice, and the correlation of percent liver editing to percent KLKB1 protein ( FIG. 9 D ).
  • FIG. 10 shows dose-dependent levels of KLKB1 gene editing, percent knockdown of KLKB1 mRNA, and plasma kallikrein in Hu KLKB1 mouse model.
  • FIG. 11 A shows levels of KLKB1 gene editing and plasma kallikrein in a dose response assay at after treatment with the indicated doses of sgRNA in Hu KLKB1 mouse model.
  • FIG. 11 B shows levels of absorbance at 600 nm light to detect Evans blue (EB) dye from colon samples in a dose response vascular permeability assay in response to treatment with permeabilizing agents at after treatment with the indicated doses of sgRNA in Hu KLKB1 mouse model.
  • EB Evans blue
  • FIGS. 12 A- 12 B show in vivo dose-dependent reductions in circulating total kallikrein activity ( FIG. 12 A ) and protein levels ( FIG. 12 B ), respectively, after a single dose administration of CRISPR/Cas9 components at 1.5 mg/kg, 3 mg/kg, or 6 mg/kg with G013901 in cynomolgus monkeys.
  • FIGS. 13 A- 13 B show in vivo reductions in circulating total kallikrein activity ( FIG. 13 A ) and protein levels ( FIG. 13 B ), respectively, after a single dose administration of CRISPR/Cas9 components at the indicated dosages with G012267 in cynomologous monkeys.
  • FIG. 14 labels the 10 conserved region YA sites in an exemplary sgRNA sequence (SEQ ID NO: 201) from 1 to 10.
  • the numbers 25, 45, 50, 56, 64, 67, and 83 indicate the position of the pyrimidine of YA sites 1, 5, 6, 7, 8, 9, and 10 in an sgRNA with a guide region indicated as (N)x, e.g., wherein x is optionally 20.
  • FIG. 15 shows an exemplary sgRNA (SEQ ID NO: 401; not all modifications are shown) in a possible secondary structure with labels designating individual nucleotides of the conserved region of the sgRNA, including the lower stem, bulge, upper stem, nexus (the nucleotides of which can be referred to as N1 through N18, respectively, in the 5′ to 3′ direction), hairpin 1, and hairpin 2 regions.
  • a nucleotide between hairpin 1 and hairpin 2 is labeled n.
  • a guide region may be present on an sgRNA and is indicated in this figure as “(N)x” preceding the conserved region of the sgRNA.
  • Polynucleotide and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof.
  • a nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof.
  • Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2′ methoxy or 2′ halide substitutions.
  • Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidine
  • Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (U.S. Pat. No. 5,585,481).
  • a nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2′ methoxy linkages, or polymers containing both conventional bases and one or more base analogs).
  • Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41).
  • LNA locked nucleic acid
  • RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.
  • RNA RNA-guided DNA binding agent
  • gRNA RNA-guided DNA binding agent
  • tracrRNA RNA-guided DNA binding agent
  • the crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA).
  • sgRNA single guide RNA
  • dgRNA dual guide RNA
  • a “guide sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent.
  • a “guide sequence” may also be referred to as a “targeting sequence,” or a “spacer sequence.”
  • a guide sequence can be 20 base pairs in length, e.g., in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs/orthologs.
  • the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-149.
  • the target sequence is in a gene or on a chromosome, for example, and is complementary to the guide sequence.
  • the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the guide sequence comprises a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-149.
  • the guide sequence and the target region may be 100% complementary or identical.
  • the guide sequence and the target region may contain at least one mismatch.
  • the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 17, 18, 19, 20 or more base pairs.
  • the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides.
  • Target sequences for RNA-guided DNA binding agents include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence's reverse compliment), as a nucleic acid substrate for an RNA-guided DNA binding agent is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence”, it is to be understood that the guide sequence may direct a guide RNA to bind to the reverse complement of a target sequence. Thus, in some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence.
  • RNA-guided DNA binding agent means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA.
  • RNA-guided DNA binding agents include Cas cleavases/nickases and inactivated forms thereof (“dCas DNA binding agents”).
  • Cas nuclease also called “Cas protein” as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents.
  • Cas cleavases/nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases.
  • a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity.
  • Class 2 Cas nucleases include Class 2 Cas cleavases/nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase/nickase activity is inactivated.
  • Class 2 Cas cleavases/nickases e.g., H840A, D10A, or N863A variants
  • Class 2 dCas DNA binding agents in which cleavase/nickase activity is inactivated.
  • Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof.
  • Cas9 Cas9
  • Cpf1, C2c1, C2c2, C2c3, HF Cas9 e.g., N497A, R661A, Q695A, Q926A variants
  • HypaCas9 e.g., N692A, M694
  • Cpf1 protein Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain.
  • Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables Si and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell. 60:385-397 (2015).
  • ribonucleoprotein or “RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9).
  • a Cas nuclease e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9).
  • the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.
  • a first sequence is considered to “comprise a sequence with at least X % identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X % or more of the positions of the second sequence in its entirety are matched by the first sequence.
  • the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence.
  • RNA and DNA generally the exchange of uridine for thymidine or vice versa
  • nucleoside analogs such as modified uridines
  • adenosine for all of thymidine, uridine, or modified uridine another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement.
  • sequence 5′-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5′-CAU).
  • exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art.
  • Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.
  • mRNA is used herein to refer to a polynucleotide and comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs).
  • mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2′-methoxy ribose residues.
  • the sugars of an mRNA phosphate-sugar backbone consist essentially of ribose residues, 2′-methoxy ribose residues, or a combination thereof.
  • “indels” refer to insertion/deletion mutations consisting of a number of nucleotides that are either inserted or deleted at the site of double-stranded breaks (DSBs) in a target nucleic acid.
  • knockdown refers to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both). Knockdown of a protein can be measured by detecting total cellular amount of the protein from a sample, such as a tissue, fluid, or cell population of interest. It can also be measured by measuring a surrogate, marker, or activity for the protein. Methods for measuring knockdown of mRNA are known and include sequencing of mRNA isolated from a sample of interest.
  • knockdown may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed by a population of cells (including in vivo populations such as those found in tissues).
  • knockout refers to a loss of expression from a particular gene or of a particular protein in a cell. Knockout can be measured either by detecting total cellular amount of a protein in a cell, a tissue or a population of cells.
  • the methods of the invention “knockout” KLKB1 in one or more samples, e.g., serum, plasma, tissue, or cells (e.g., in a population of cells including in vivo populations such as those found in tissues).
  • a knockout is not the formation of mutant KLKB1 protein, for example, created by indels, but rather the complete loss of expression of KLKB1 protein in a cell.
  • KLKB1 generally refers to prekallikrein, which is the gene product of a KLKB1 gene. Prekallikrein is processed to plasma kallikrein (pKal), and antibodies can detect pKal, prekallikrein, or both.
  • the human wild-type KLKB1 sequence is available at NCBI Gene ID: 3818; Ensembl: ENSG00000164344. “PKK,” “PPK,” “KLK3,” and “PKKD” are gene synonyms.
  • the human KLKB1 transcript is available at Ensembl: ENST00000264690, and the cynomolgus wild-type KLKB1 sequence is available at Ensembl: ENSMFAT00000002355.
  • HAE Human Angioedema
  • SERPING1 which encodes the C1 esterase inhibitor protein (C1-INH).
  • C1-INH blocks the activity of certain proteins that promote inflammation (e.g., in Kinin system).
  • FXII Factor XII
  • pKal processed from KLKB1 protein (prekallikrein)
  • Kallikrein cleaves high-molecular weight kininogen (HMWK) to release bradykinin, a peptide that impacts vascular permeability. Excessive amount of bradykinin in the blood leads to the fluid leakage through the walls of blood vessels into body tissues, causing swelling seen in individuals with HAE.
  • methods for decreasing KLKB1 activity are provided, wherein once reduced, bradykinin production is decreased and swelling attacks are reduced. Protein levels of prekallikrein/kallikrein, HMWK and its cleavage products, and surrogate labeled substrates of HMWK may be measured to assess efficacy of KLKB1 knockout.
  • a “target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target sequence and the guide sequence directs an RNA-guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.
  • a “YA site” refers to a 5′-pyrimidine-adenine-3′ dinucleotide.
  • a “conserved region YA site” is present in the conserved region of an sgRNA.
  • a “guide region YA site” is present in the guide region of an sgRNA.
  • An unmodified YA site in an sgRNA may be susceptible to cleavage by RNase-A like endonucleases, e.g., RNase A.
  • an sgRNA comprises about 10 YA sites in its conserved region.
  • an sgRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA sites in its conserved region. Exemplary conserved region YA sites are indicated in FIG.
  • an sgRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the YA sites indicated in FIG. 14 .
  • an sgRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA sites at the following positions or a subset thereof: LS5-LS6; US3-US4; US9-US10; US12-B3; LS7-LS8; LS12-N1; N6-N7; N14-N15; N17-N18; and H2-2 to H2-3.
  • a YA site comprises a modification, meaning that at least one nucleotide of the YA site is modified.
  • the pyrimidine (also called the pyrimidine position) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine).
  • the adenine (also called the adenine position) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the adenine).
  • the pyrimidine position and the adenine position of the YA site comprise modifications.
  • treatment refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing reoccurrence of one or more symptoms of the disease.
  • treatment of HAE may comprise alleviating symptoms of HAE.
  • KLKB1 activity can mean a greater than about 60% reduction of plasma KLKB1 activity as compared to baseline. See, Banerji et al., N Engl J Med, 2017, 376:717-728; Ferrone et al., Nucleic Acid Therapeutics, 2019, 82-917.
  • KLKB1 activity is often measured as total kallikrein activity, in which prekallikrein is converted to kallikrein in a sample and total kallikrein activity is measured for the sample.
  • a range of KLKB1 activity reduction can mean about 60-80% reduction of plasma KLKB1 activity as compared to baseline.
  • a basal value can be obtained by collecting a pretreatment sample from the subject.
  • the sample is a serum sample.
  • the target KLKB1 activity reduction is about a 60% reduction in total kallikrein (prekallikrein and plasma kallikrein) activity as compared to baseline.
  • achieving KLKB1 activity levels within a therapeutic range can mean reducing total kallikrein by about >60% from baseline.
  • a “normal kallikrein level” or a “normal kallikrein range” is reduced.
  • a therapeutically relevant reduction of kallikrein activity achieves levels of about 0-60%, 0-50%, 0-40%, 0-30%, 0-25%, 0-20%, 0-15%, 0-10% of a basal value for the subject, or 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, or 20-60%, 20-50%, 20-40%, or 20-30%%, of normal kallikrein activity level.
  • KLKB1 activity can be measured by assays known in the field, including assays described herein.
  • target KLKB1 protein reduction means the target level of pKal as compared to baseline.
  • KLKB1 protein levels can be measured by assays known in the field such as ELISA or western blot assays, as described herein.
  • Total KLKB1 protein can be measured with an antibody that detects both prekallikrein and kallikrein and/or after converting prekallikrein to kallikrein in a sample.
  • the sample is a serum sample.
  • the target KLKB1 protein reduction is about a 60% reduction in total kallikrein (prekallikrein and plasma kallikrein) as compared to baseline.
  • a therapeutically relevant reduction of total kallikrein protein achieves levels of about 0-60%, 0-50%, 0-40%, 0-30%, 0-25%, 0-20%, 0-15%, 0-10% of a basal value for the subject, or 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, or 20-60%, 20-50%, 20-40%, or 20-30%%, of normal total kallikrein protein level.
  • Circulating plasma cHMWK levels below about 30% total HMWK were associated with decreases in HAE attacks in patients treated with lanadelumab (See Banerji, et al, 2017). In this same study, healthy controls had plasma levels of cHMWK around 8.3% total HMWK. In another study, Suffriti and colleagues found cHMWK plasma levels of an average of about 34.8% in normal controls, about 41.4% in HAE patients in remission and about 58.1% in HAE patients during an attack (Suffritti, et al. Clin Exp Allergy 2014; 44:1503-14). Therapeutic treatment can target a ratio of circulating plasma cHMWK to total HMWK of less than about 60%. In some embodiments the ratio of cHMWK to HMWK is less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, or more.
  • compositions comprising Guide RNA (gRNAs)
  • compositions useful for inducing a double-stranded break (DSB), single-strand break, and/or site-specific binding that results in nucleic acid modification within the KLKB1 gene e.g., using a guide RNA with an RNA-guided DNA binding agent (e.g., a CRISPR/Cas system).
  • the compositions may be administered to subjects having or suspected of having HAE.
  • compositions may be administered to subjects having increased serum and/or plasma bradykinin concentration as measured, for example, by a decrease in prekallikrein protein levels in the plasma or serum, by a decrease in total kallikrein (prekallikrein and pKal) protein levels in plasma or serum, by a decrease in the proportion of circulating cleaved HMWK (cHMWK), or by a decrease in the proportion of cHMWK in citrated plasma.
  • the compositions may be administered to subjects having increased serum and/or plasma prekallikrein and/or kallikrein concentration.
  • the compositions may be administered to subjects having increased serum and/or plasma total kallikrein concentration.
  • the compositions may be administered to subjects having increased serum and/or plasma kallikrein activity.
  • Guide sequences targeting the KLKB1 gene are shown in Table 1 at SEQ ID NOs: 1-149.
  • Each of the guide sequences shown in Table 1 at SEQ ID NOs: 1-149 may further comprise additional nucleotides to form a crRNA, e.g., with the following exemplary nucleotide sequence following the guide sequence at its 3′ end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 167) in 5′ to 3′ orientation.
  • the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3′ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 171) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172, which is SEQ ID NO: 171 without the four terminal U's) in 5′ to 3′ orientation.
  • the four terminal U's of SEQ ID NO: 171 are not present. In some embodiments, only 1, 2, or 3 of the four terminal U's of SEQ ID NO: 171 are present.
  • the sgRNA comprises any one of the guide sequences of SEQ ID Nos: 1-149 and additional nucleotides to form a crRNA, e.g., with the following exemplary nucleotide sequence following the guide sequence at its 3′ end: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GGCACCGAGUCGGUGCUUUU (SEQ ID NO: 170) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GGCACCGAGUCGGUGC (SEQ ID NO: 173) in 5′ to 3′ orientation.
  • SEQ ID NO: 173 lacks 8 nucleotides with reference to a wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172).
  • KLKB1 short-single guide RNAs comprising a guide sequence as described herein and a “conserved portion of an sgRNA” comprising a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides or 6-10 nucleotides.
  • a hairpin region of the KLKB1 short-single guide RNAs lacks 5-10 nucleotides with reference to the conserved portion of an sgRNA, e.g. nucleotides H1-1 to H2-15 in Table 3B and FIG. 15 .
  • a hairpin 1 region of the KLKB1 short-single guide RNAs lacks 5-10 nucleotides with reference to the conserved portion of an sgRNA, e.g. nucleotides H1-1 to H1-12 in Table 3B and FIG. 15 . See, e.g., WO2019/237069, the contents of which is hereby incorporated by reference in its entirety, for example, at claims 1 - 15 .
  • sgRNA An exemplary “conserved portion of an sgRNA” is shown in Table 3A (see also FIG. 15 ), which shows a “conserved region” of a S. pyogenes Cas9 (“spyCas9” (also referred to as “spCas9”)) sgRNA.
  • spyCas9 S. pyogenes Cas9
  • the first row shows the numbering of the nucleotides
  • the second row shows the sequence (SEQ ID NO: 500); and the third row shows “domains.”
  • Briner A E et al., Molecular Cell 56:333-339 (2014) describes functional domains of sgRNAs, referred to herein as “domains”, including the “spacer” domain responsible for targeting, the “lower stem”, the “bulge”, “upper stem” (which may include a tetraloop), the “ nexus ”, and the “hairpin 1” and “hairpin 2” domains. See, Briner et al. at page 334, FIG. 1 A .
  • Table 3B provides a schematic of the domains of an sgRNA as used herein.
  • the “n” between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. In some embodiments, n equals 1.
  • the KLKB1 sgRNA is from S. pyogenes Cas9 (“spyCas9”) or a spyCas9 equivalent. In some embodiments, the sgRNA is not from S. pyogenes (“non-spyCas9”). In some embodiments, the 5-10 nucleotides or 6-10 nucleotides are consecutive.
  • a KLKB1 short-sgRNA lacks at least nucleotides 54-58 (AAAAA) of the conserved portion of a S. pyogenes Cas9 (“spyCas9”) sgRNA, as shown in Table 3A.
  • a KLKB1 short-sgRNA is a non-spyCas9 sgRNA that lacks at least nucleotides corresponding to nucleotides 54-58 (AAAAA) of the conserved portion of a spyCas9 as determined, for example, by pairwise or structural alignment.
  • the non-spyCas9 sgRNA is Staphylococcus aureus Cas9 (“saCas9”) sgRNA.
  • a KLKB1 short-sgRNA lacks at least nucleotides 54-61 (AAAAAGUG) of the conserved portion of a spyCas9 sgRNA. In some embodiments, a KLKB1 short-sgRNA lacks at least nucleotides 53-60 (GAAAAAGU) of the conserved portion of a spyCas9 sgRNA.
  • a KLKB1 short-sgRNA lacks 4, 5, 6, 7, or 8 nucleotides of nucleotides 53-60 (GAAAAAGU) or nucleotides 54-61 (AAAAAGUG) of the conserved portion of a spyCas9 sgRNA, or the corresponding nucleotides of the conserved portion of a non-spyCas9 sgRNA as determined, for example, by pairwise or structural alignment.
  • Cyno KLKB1 targeted single guide sequences, chromosomal coordinates, and guide sequence homology to human Cyno Percent Cyno SEQ ID
  • cyno guide sequence human guide G013870 310 chr5:185648888-185648908 GCACCUGCUCGACGUACUUU 90 G013871 311 chr5:185652966-185652986 AGGAACGCCUACCACUAUAA 90 G013872 312 chr5:185688465-185688485 UGAUGGAAACGCUCGGAUGC NA G013873 313 chr5:185652964-185652984 AUAGUGGUAGGCGUUCCUCC 90 G013874 314 chr5:185652965-185652985 UAUAGUGGUAGGCGUUCCUC 90 G013875 315 chr5:185652946-185652966 CUCUUAAA
  • the guide RNAs identified above as “G0XXXX” are sgRNAs comprising the identified 20 nucleotide targeting sequence of Table 1 or Table 2, within the guide structure of SEQ ID NO: 300.
  • the sgRNA comprises any one of the guide RNAs of Tables 1 or 2 and the nucleotides of SEQ ID NO: 300, optionally wherein the sgRNA comprises any one of the modification patterns described in Table 4.
  • the sgRNA comprises any one of the guide RNAs of Tables 1 or 2 and any of the conserved portion of sgRNAs of Table 4, optionally with any one of the modification patterns described in Table 4.
  • the invention provides a composition comprising one or more guide RNA (gRNA) comprising guide sequences that direct an RNA-guided DNA binding agent, which can be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in KLKB1.
  • gRNA guide RNA
  • the gRNA may comprise a crRNA comprising a guide sequence shown in Table 1.
  • the gRNA may comprise a crRNA comprising 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a guide sequence shown in Table 1.
  • the gRNA may further comprise a trRNA.
  • the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA).
  • sgRNA single RNA
  • dgRNA separate RNAs
  • the crRNA and trRNA components may be covalently linked, e.g., via a phosphodiester bond or other covalent bond.
  • the guide RNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.”
  • the dgRNA comprises a first RNA molecule comprising a crRNA comprising, e.g., a guide sequence shown in Table 1, and a second RNA molecule comprising a trRNA.
  • the first and second RNA molecules may not be covalently linked, but may form an RNA duplex via the base pairing between portions of the crRNA and the trRNA.
  • the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”.
  • the sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1 covalently linked to a trRNA.
  • the sgRNA may comprise 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the crRNA and the trRNA are covalently linked via a linker.
  • the sgRNA forms a stem-loop structure via the base pairing between portions of the crRNA and the trRNA.
  • the crRNA and the trRNA are covalently linked via one or more bonds that are not a phosphodiester bond.
  • the trRNA may comprise all or a portion of a trRNA sequence derived from a naturally-occurring CRISPR/Cas system.
  • the trRNA comprises a truncated or modified wild type trRNA.
  • the length of the trRNA depends on the CRISPR/Cas system used.
  • the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides.
  • the trRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.
  • a composition comprising one or more guide RNAs comprising a guide sequence of any one of SEQ ID Nos: 1-149 and any conserved portion of an sgRNA shown in Table 4, optionally having a modification pattern of any of an sgRNA shown in Table 4, optionally wherein the sgRNA comprises a 5′ and 3′ end modification (if not already shown in the construct of Table 4) is provided.
  • a composition comprising one or more guide RNAs comprising a guide sequence of any one of SEQ ID Nos: 1-149 is provided, wherein the nucleotides of SEQ ID NO: 170, 171, 172, or 173 follow the guide sequence at its 3′ end.
  • the one or more guide RNAs comprising a guide sequence of any one of SEQ ID Nos: 1-149, wherein the nucleotides of SEQ ID NO: 170, 171, 172, or 173 follow the guide sequence at its 3′ end is modified according to the modification pattern of SEQ ID NO: 300.
  • a composition comprising one or more gRNAs is provided, comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-149.
  • a composition comprising at least one, e.g., at least two gRNA's comprising guide sequences selected from any two or more of the guide sequences of SEQ ID NOs: 1-149.
  • the composition comprises at least two gRNA's that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-149.
  • the guide RNA compositions of the present invention are designed to recognize (e.g., hybridize to) a target sequence in the KLKB1 gene.
  • the KLKB1 target sequence may be recognized and cleaved by a provided Cas cleavase comprising a guide RNA.
  • an RNA-guided DNA binding agent such as a Cas cleavase
  • the selection of the one or more guide RNAs is determined based on target sequences within the KLKB1 gene.
  • the compositions comprising one or more guide sequences comprise a guide sequence that is complementary to the corresponding genomic region shown in Table 1 below, according to coordinates from human reference genome hg38.
  • Guide sequences of further embodiments may be complementary to sequences in the close vicinity of the genomic coordinate listed in any of the Tables provided herein.
  • guide sequences of further embodiments may be complementary to sequences that comprise 15 consecutive nucleotides f10 nucleotides of a genomic coordinate listed in any of the Tables disclosed herein.
  • mutations e.g., frameshift mutations resulting from indels occurring as a result of a nuclease-mediated DSB
  • the location of a DSB is an important factor in the amount or type of protein knockdown that may result.
  • a gRNA complementary or having complementarity to a target sequence within KLKB1 is used to direct the RNA-guided DNA binding agent to a particular location in the KLKB1 gene.
  • gRNAs are designed to have guide sequences that are complementary or have complementarity to target sequences in exon 1, exon 3, exon 4, exon 5, exon 6, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, or exon 15 of KLKB1.
  • the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a target sequence present in the human KLKB1 gene.
  • the target sequence may be complementary to the guide sequence of the guide RNA.
  • the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the target sequence and the guide sequence of the gRNA may be 100% complementary or identical.
  • the target sequence and the guide sequence of the gRNA may contain at least one mismatch.
  • the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20.
  • the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.
  • a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein.
  • an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease is provided, used, or administered.
  • the gRNA is chemically modified.
  • a gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally and/or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues.
  • a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.”
  • Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with “dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (v) replacement or modification of the rib
  • modified gRNAs and/or mRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications.
  • a modified residue can have a modified sugar and a modified nucleobase.
  • every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group.
  • all, or substantially all, of the phosphate groups of an gRNA molecule are replaced with phosphorothioate groups.
  • modified gRNAs comprise at least one modified residue at or near the 5′ end of the RNA.
  • modified gRNAs comprise at least one modified residue at or near the 3′ end of the RNA.
  • the gRNA comprises one, two, three or more modified residues.
  • at least 5% e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%
  • modified nucleosides or nucleotides are modified nucleosides or nucleotides.
  • Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or those found in serum.
  • nucleases can hydrolyze nucleic acid phosphodiester bonds.
  • the gRNAs described herein can contain one or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases.
  • the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo.
  • the term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.
  • the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent.
  • the modified residue e.g., modified residue present in a modified nucleic acid
  • the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
  • modified phosphate groups include, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.
  • the phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral.
  • the stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp).
  • the backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates).
  • a bridging oxygen i.e., the oxygen that links the phosphate to the nucleoside
  • nitrogen bridged phosphoroamidates
  • sulfur bridged phosphorothioates
  • carbon bridged methylenephosphonates
  • the phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications.
  • the charged phosphate group can be replaced by a neutral moiety.
  • moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
  • Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications.
  • the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
  • the modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. a sugar modification.
  • the 2′ hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents.
  • modifications to the 2′ hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2′-alkoxide ion.
  • Examples of 2′ hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH 2 CH 2 O) n CH 2 CH 2 OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20).
  • R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar
  • PEG polyethylene
  • the 2′ hydroxyl group modification can be 2′-O-Me. In some embodiments, the 2′ hydroxyl group modification can be a 2′-fluoro modification, which replaces the 2′ hydroxyl group with a fluoride.
  • the 2′ hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2′ hydroxyl can be connected, e.g., by a C 1-6 alkylene or C 1-6 heteroalkylene bridge, to the 4′ carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH 2 ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH 2 ) n -amino, (wherein amino can be, e.g., NH 2 ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroaryla
  • the 2′ hydroxyl group modification can include “unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2′-C3′ bond.
  • the 2′ hydroxyl group modification can include the methoxyethyl group (MOE), (OCH 2 CH 2 OCH 3 , e.g., a PEG derivative).
  • “Deoxy” 2′ modifications can include hydrogen (i.e. deoxyribose sugars, e.g., at the overhang portions of partially dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH 2 ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH 2 CH 2 NH) n CH2CH 2 - amino (wherein amino can be, e.g., as described herein), —NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycl
  • the sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar.
  • the modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms.
  • the modified nucleic acids can also include one or more sugars that are in the L form, e.g. L-nucleosides.
  • the modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase.
  • a modified base also called a nucleobase.
  • nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids.
  • the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog.
  • the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
  • each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA and/or tracr RNA.
  • one or more residues at one or both ends of the sgRNA may be chemically modified, and/or internal nucleosides may be modified, and/or the entire sgRNA may be chemically modified.
  • Certain embodiments comprise a 5′ end modification.
  • Certain embodiments comprise a 3′ end modification.
  • the guide RNAs disclosed herein comprise one of the modification patterns disclosed in WO2018/107028 and/or WO2019/237069, the contents of which are hereby incorporated by reference in their entirety.
  • the guide RNAs disclosed herein may comprise the short-guide structure described at claims 1 - 15 and/or the modification patterns described at claims 16-462 of WO2019/237069.
  • the guide RNAs disclosed herein comprise one of the structures/modification patterns disclosed in WO 2015/200555, the contents of which are hereby incorporated by reference in their entirety.
  • the guide RNAs disclosed herein comprise one of the structures/modification patterns disclosed in WO2017/136794, the contents of which are hereby incorporated by reference in their entirety.
  • a modification at a YA site can be a modification of the internucleoside linkage, a modification of the base (pyrimidine or adenine), e.g. by chemical modification, substitution, or otherwise, and/or a modification of the sugar (e.g. at the 2′ position, such as 2′-O-alkyl, 2′-F, 2′-moe, 2′-F arabinose, 2′-H (deoxyribose), and the like).
  • a “YA modification” is any modification that alters the structure of the dinucleotide motif to reduce RNA endonuclease activity, e.g., by interfering with recognition or cleavage of a YA site by an RNase and/or by stabilizing an RNA structure (e.g., secondary structure) that decreases accessibility of a cleavage site to an RNase.
  • an RNA structure e.g., secondary structure
  • Peacock et al., Belhke, Ku, and Ghidini provide exemplary modifications suitable as YA modifications. Modifications known to those of skill in the art to reduce endonucleolytic degradation are encompassed. Exemplary 2′ ribose modifications that affect the 2′ hydroxyl group involved in RNase cleavage are 2′-H and 2′-O-alkyl, including 2′-O-Me. Modifications such as bicyclic ribose analogs, UNA, and modified internucleoside linkages of the residues at the YA site can be YA modifications. Exemplary base modifications that can stabilize RNA structures are pseudouridine and 5-methylcytosine. In some embodiments, at least one nucleotide of the YA site is modified.
  • the pyrimidine (also called “pyrimidine position”) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine, a modification of the pyrimidine base, and a modification of the ribose, e.g. at its 2′ position).
  • the adenine (also called “adenine position”) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine, a modification of the pyrimidine base, and a modification of the ribose, e.g. at its 2′ position).
  • the pyrimidine and the adenine of the YA site comprise modifications.
  • the YA modification reduces RNA endonuclease activity.
  • an sgRNA comprises modifications at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more YA sites.
  • the pyrimidine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine).
  • the adenine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the adenine).
  • the pyrimidine and the adenine of the YA site comprise modifications, such as sugar, base, or internucleoside linkage modifications.
  • the YA modifications can be any of the types of modifications set forth herein.
  • the YA modifications comprise one or more of phosphorothioate, 2′-OMe, or 2′-fluoro. In some embodiments, the YA modifications comprise pyrimidine modifications comprising one or more of phosphorothioate, 2′-OMe, or 2′-fluoro. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains one or more YA sites.
  • a bicyclic ribose analog e.g., an LNA, BNA, or ENA
  • the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains a YA site, wherein the YA modification is distal to the YA site.
  • a bicyclic ribose analog e.g., an LNA, BNA, or ENA
  • the sgRNA comprises a guide region YA site modification.
  • the guide region comprises 1, 2, 3, 4, 5, or more YA sites (“guide region YA sites”) that may comprise YA modifications.
  • one or more YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5′ end of the 5′ terminus (where “5-end”, etc., refers to position 5 to the 3′ end of the guide region, i.e., the most 3′ nucleotide in the guide region) comprise YA modifications.
  • two or more YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5′ end of the 5′ terminus comprise YA modifications.
  • three or more YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5′ end of the 5′ terminus comprise YA modifications.
  • four or more YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5′ end of the 5′ terminus comprise YA modifications.
  • YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5′ end of the 5′ terminus comprise YA modifications.
  • a modified guide region YA site comprises a YA modification.
  • a modified guide region YA site is within 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides of the 3′ terminal nucleotide of the guide region.
  • a modified guide region YA site is within 10 nucleotides of the 3′ terminal nucleotide of the guide region and the guide region is 20 nucleotides long, then the modified nucleotide of the modified guide region YA site is located at any of positions 11-20.
  • a YA modification is located within a YA site 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides from the 3′ terminal nucleotide of the guide region.
  • a YA modification is located 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides from the 3′ terminal nucleotide of the guide region.
  • a modified guide region YA site is at or after nucleotide 4, 5, 6, 7, 8, 9, 10, or 11 from the 5′ end of the 5′ terminus.
  • a modified guide region YA site is other than a 5′ end modification.
  • an sgRNA can comprise a 5′ end modification as described herein and further comprise a modified guide region YA site.
  • an sgRNA can comprise an unmodified 5′ end and a modified guide region YA site.
  • an sgRNA can comprise a modified 5′ end and an unmodified guide region YA site.
  • a modified guide region YA site comprises a modification that at least one nucleotide located 5′ of the guide region YA site does not comprise.
  • nucleotides 1-3 comprise phosphorothioates
  • nucleotide 4 comprises only a 2′-OMe modification
  • nucleotide 5 is the pyrimidine of a YA site and comprises a phosphorothioate
  • the modified guide region YA site comprises a modification (phosphorothioate) that at least one nucleotide located 5′ of the guide region YA site (nucleotide 4) does not comprise.
  • nucleotides 1-3 comprise phosphorothioates
  • nucleotide 4 is the pyrimidine of a YA site and comprises a 2′-OMe
  • the modified guide region YA site comprises a modification (2′-OMe) that at least one nucleotide located 5′ of the guide region YA site (any of nucleotides 1-3) does not comprise. This condition is also always satisfied if an unmodified nucleotide is located 5′ of the modified guide region YA site.
  • the modified guide region YA sites comprise modifications as described for YA sites above.
  • the sgRNA comprises a conserved region YA site modification.
  • conserved region YA sites 1-10 are illustrated in FIG. 14 .
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conserved region YA sites comprise modifications.
  • conserved region YA sites 1, 8, or 1 and 8 comprise YA modifications. In some embodiments, conserved region YA sites 1, 2, 3, 4, and 10 comprise YA modifications. In some embodiments, YA sites 2, 3, 4, 8, and 10 comprise YA modifications. In some embodiments, conserved region YA sites 1, 2, 3, and 10 comprise YA modifications. In some embodiments, YA sites 2, 3, 8, and 10 comprise YA modifications. In some embodiments, YA sites 1, 2, 3, 4, 8, and 10 comprise YA modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 additional conserved region YA sites comprise YA modifications.
  • 1, 2, 3, or 4 of conserved region YA sites 2, 3, 4, and 10 comprise YA modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 additional conserved region YA sites comprise YA modifications.
  • the modified conserved region YA sites comprise modifications as described for YA sites above.
  • an sgRNA comprising the guide sequence of any one of SEQ ID NOs: 1-149 and any conserved portion of an sgRNA shown in Table 4, optionally having a modification pattern of any of an sgRNA shown in Table 4, optionally wherein the sgRNA comprises a 5′ and 3′ end modification (if not already shown in the construct of Table 4) is provided.
  • the sgRNA comprises any of the modification patterns shown below in Table 4, where N is any natural or non-natural nucleotide, and wherein the totality of the N's comprise a KLKB1 guide sequence as described herein in Table 1.
  • Table 4 does not depict the guide sequence portion of the sgRNA. The modifications remain as shown in Table 4 despite the substitution of N's for the nucleotides of a guide. That is, although the nucleotides of the guide replace the “N's”, the nucleotides are modified as shown in Table 4.
  • the modified sgRNA comprises the following sequence: mN*mN*mN* NNGUUUUAGAmGmCmUmAmGmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), where “N” may be any natural or non-natural nucleotide, and wherein the totality of N's comprise a KLKB1 guide sequence as described in Table 1.
  • SEQ ID NO: 300 where the N's are replaced with any of the guide sequences disclosed herein in Table 1 (SEQ ID Nos: 1-149).
  • guide RNAs combining any of the guide sequences of Table 1 (SEQ ID Nos: 1-149) combined with a conserved portion of an sgRNA, e.g. a sequence of Table 4.
  • mA mA
  • mC mU
  • mG mG
  • nucleotide sugar rings Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution.
  • 2′-fluoro (2′-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.
  • fA fC
  • fU fU
  • Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases.
  • PS Phosphorothioate
  • the modified oligonucleotides may also be referred to as S-oligos.
  • a “*” may be used to depict a PS modification.
  • the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3′) nucleotide with a PS bond.
  • mA* may be used to denote a nucleotide that has been substituted with 2′-O-Me and that is linked to the next (e.g., 3′) nucleotide with a PS bond.
  • Abasic nucleotides refer to those which lack nitrogenous bases.
  • the figure below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base:
  • Inverted bases refer to those with linkages that are inverted from the normal 5′ to 3′ linkage (i.e., either a 5′ to 5′ linkage or a 3′ to 3′ linkage). For example:
  • An abasic nucleotide can be attached with an inverted linkage.
  • an abasic nucleotide may be attached to the terminal 5′ nucleotide via a 5′ to 5′ linkage, or an abasic nucleotide may be attached to the terminal 3′ nucleotide via a 3′ to 3′ linkage.
  • An inverted abasic nucleotide at either the terminal 5′ or 3′ nucleotide may also be called an inverted abasic end cap.
  • one or more of the first three, four, or five nucleotides at the 5′ terminus, and one or more of the last three, four, or five nucleotides at the 3′ terminus are modified.
  • the modification is a 2′-O-Me, 2′-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art to increase stability and/or performance.
  • the first four nucleotides at the 5′ terminus, and the last four nucleotides at the 3′ terminus are linked with phosphorothioate (PS) bonds.
  • PS phosphorothioate
  • the first three nucleotides at the 5′ terminus, and the last three nucleotides at the 3′ terminus comprise a 2′-O-methyl (2′-O-Me) modified nucleotide. In some embodiments, the first three nucleotides at the 5′ terminus, and the last three nucleotides at the 3′ terminus comprise a 2′-fluoro (2′-F) modified nucleotide. In some embodiments, the first three nucleotides at the 5′ terminus, and the last three nucleotides at the 3′ terminus comprise an inverted abasic nucleotide.
  • the guide RNA comprises a modified sgRNA.
  • the guide RNA comprises any conserved portion of an sgRNA shown in Table 4, optionally having a modification pattern of any of an sgRNA shown in Table 4, optionally wherein the sgRNA comprises a 5′ and 3′ end modification (if not already shown in the construct of Table 4) is provided.
  • the sgRNA comprises the modification pattern of any of an sgRNA shown in Table 4, where N is any natural or non-natural nucleotide, and where the totality of the N's comprise a guide sequence that directs a nuclease to a target sequence in KLKB1, e.g., as shown in Table 1.
  • the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID No: 1-149 and any conserved portion of an sgRNA shown in Table 4, optionally having a modification pattern of any of an sgRNA shown in Table 4, optionally wherein the sgRNA comprises a 5′ and 3′ end modification (if not already shown in the construct of Table 4).
  • the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID No: 1-149 and the nucleotides of SEQ ID No: 170, 171, 172, or 173, wherein the nucleotides of SEQ ID No: 170, 171, 172, or 173 are on the 3′ end of the guide sequence, and wherein the sgRNA may be modified as shown in Table 4 or SEQ ID NO: 300.
  • a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein.
  • an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease is provided, used, or administered.
  • the ORF encoding an RNA-guided DNA nuclease is a “modified RNA-guided DNA binding agent ORF” or simply a “modified ORF,” which is used as shorthand to indicate that the ORF is modified.
  • the modified ORF may comprise a modified uridine at least at one, a plurality of, or all uridine positions.
  • the modified uridine is a uridine modified at the 5 position, e.g., with a halogen, methyl, or ethyl.
  • the modified uridine is a pseudouridine modified at the 1 position, e.g., with a halogen, methyl, or ethyl.
  • the modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof.
  • the modified uridine is 5-methoxyuridine.
  • the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methyl pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.
  • an mRNA disclosed herein comprises a 5′ cap, such as a Cap0, Cap1, or Cap2.
  • a 5′ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below e.g. with respect to ARCA) linked through a 5′-triphosphate to the 5′ position of the first nucleotide of the 5′-to-3′ chain of the mRNA, i.e., the first cap-proximal nucleotide.
  • the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2′-hydroxyl.
  • the riboses of the first and second transcribed nucleotides of the mRNA comprise a 2′-methoxy and a 2′-hydroxyl, respectively.
  • the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2′-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115.
  • Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, comprise Cap1 or Cap2.
  • Cap0 and other cap structures differing from Cap1 and Cap2 may be immunogenic in mammals, such as humans, due to recognition as “non-self” by components of the innate immune system such as IFIT-1 and IFIT-5, which can result in elevated cytokine levels including type I interferon.
  • components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of an mRNA with a cap other than Cap1 or Cap2, potentially inhibiting translation of the mRNA.
  • a cap can be included co-transcriptionally.
  • ARCA anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045
  • ARCA is a cap analog comprising a 7-methylguanine 3′-methoxy-5′-triphosphate linked to the 5′ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation.
  • ARCA results in a Cap0 cap in which the 2′ position of the first cap-proximal nucleotide is hydroxyl.
  • CleanCapTM AG (m7G(5′)ppp(5′)(2′OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCapTM GG (m7G(5′)ppp(5′)(2′OMeG)pG; TriLink Biotechnologies Cat. No. N-7133) can be used to provide a Cap1 structure co-transcriptionally.
  • 3′-O-methylated versions of CleanCapTM AG and CleanCapTM GG are also available from TriLink Biotechnologies as Cat. Nos. N-7413 and N-7433, respectively.
  • the CleanCapTM AG structure is shown below.
  • a cap can be added to an RNA post-transcriptionally.
  • Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No. M2080S) and has RNA triphosphatase and guanylyltransferase activities, provided by its D1 subunit, and guanine methyltransferase, provided by its D12 subunit.
  • it can add a 7-methylguanine to an RNA, so as to give Cap0, in the presence of S-adenosyl methionine and GTP. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
  • the mRNA further comprises a poly-adenylated (poly-A) tail.
  • the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, optionally up to 300 adenines.
  • the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides.
  • compositions comprising one or more gRNAs comprising one or more guide sequences from Table 1 or 2 and an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9.
  • the RNA-guided DNA-binding agent has cleavase activity, which can also be referred to as double-strand endonuclease activity.
  • the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S.
  • Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas10, Csm1, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof.
  • the Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system.
  • Non-limiting exemplary species that the Cas nuclease can be derived from include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis.
  • Campylobacter jejuni Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis rougei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum. Alicyclobacillus acidocaldarius.
  • Bacillus pseudomycoides Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonfex degensii, Caldicommeosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium pulpe, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithi
  • Streptococcus pasteurianus Neisseria cinerea. Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina.
  • the Cas nuclease is the Cas9 nuclease from Streptococcus pyogenes . In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus thermophilus . In some embodiments, the Cas nuclease is the Cas9 nuclease from Neisseria meningitidis . In some embodiments, the Cas nuclease is the Cas9 nuclease is from Staphylococcus aureus . In some embodiments, the Cas nuclease is the Cpf1 nuclease from Francisella novicida .
  • the Cas nuclease is the Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Lachnospiraceae bacterium ND2006.
  • the Cas nuclease is the Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens , or Porphyromonas macacae .
  • the Cas nuclease is a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.
  • the gRNA together with an RNA-guided DNA binding agent is called a ribonucleoprotein complex (RNP).
  • the RNA-guided DNA binding agent is a Cas nuclease.
  • the gRNA together with a Cas nuclease is called a Cas RNP.
  • the RNP comprises Type-I, Type-II, or Type-III components.
  • the Cas nuclease is the Cas9 protein from the Type-II CRISPR/Cas system.
  • the gRNA together with Cas9 is called a Cas9 RNP.
  • Wild type Cas9 has two nuclease domains: RuvC and HNH.
  • the RuvC domain cleaves the non-target DNA strand
  • the HNH domain cleaves the target strand of DNA.
  • the Cas9 protein comprises more than one RuvC domain and/or more than one HNH domain.
  • the Cas9 protein is a wild type Cas9. In each of the composition, use, and method embodiments, the Cas induces a double strand break in target DNA.
  • chimeric Cas nucleases are used, where one domain or region of the protein is replaced by a portion of a different protein.
  • a Cas nuclease domain may be replaced with a domain from a different nuclease such as FokI.
  • a Cas nuclease may be a modified nuclease.
  • the Cas nuclease may be from a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a Type-III CRISPR/Cas system. In some embodiments, the Cas nuclease may have an RNA cleavage activity.
  • the RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a “nick.”
  • the RNA-guided DNA-binding agent comprises a Cas nickase.
  • a nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of the DNA double helix.
  • a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See, e.g., U.S. Pat. No. 8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations.
  • a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.
  • the RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain.
  • the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity.
  • a nickase is used having a RuvC domain with reduced activity.
  • a nickase is used having an inactive RuvC domain.
  • a nickase is used having an HNH domain with reduced activity.
  • a nickase is used having an inactive HNH domain.
  • a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity.
  • a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain.
  • Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3): 759-771.
  • the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain.
  • Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB—AOQ7Q2 (CPF 1_FRATN)).
  • an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively.
  • the guide RNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking).
  • double nicking may improve specificity and reduce off-target effects.
  • a nickase is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick in the target DNA.
  • a nickase is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.
  • the RNA-guided DNA-binding agent lacks cleavase and nickase activity.
  • the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide.
  • a dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase/nickase) activity.
  • the dCas polypeptide is a dCas9 polypeptide.
  • the RNA-guided DNA-binding agent lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 2014/0186958 A1; US 2015/0166980 A1.
  • the RNA-guided DNA-binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).
  • the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell.
  • the heterologous functional domain may be a nuclear localization signal (NLS).
  • the RNA-guided DNA-binding agent may be fused with 1-10 NLS(s).
  • the RNA-guided DNA-binding agent may be fused with 1-5 NLS(s).
  • the RNA-guided DNA-binding agent may be fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence.
  • the RNA-guided DNA-binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA-binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA-binding agent is fused to two SV40 NLS sequences linked at the carboxy terminus.
  • the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with 3 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with no NLS. In some embodiments, the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 600) or PKKKRRV (SEQ ID NO: 601).
  • the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 602).
  • a single PKKKRKV (SEQ ID NO: 600) NLS may be linked at the C-terminus of the RNA-guided DNA-binding agent.
  • One or more linkers are optionally included at the fusion site.
  • the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent may be increased. In some embodiments, the half-life of the RNA-guided DNA-binding agent may be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may be capable of reducing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation.
  • the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases.
  • the heterologous functional domain may comprise a PEST sequence.
  • the RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain.
  • the ubiquitin may be a ubiquitin-like protein (UBL).
  • Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal-precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae ), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
  • SUMO small ubiquitin-like modifier
  • URP ubiquitin cross-reactive protein
  • ISG15 interferon-stimulated gene-15
  • UDM1 ubiquitin-related modifier-1
  • NEDD8 neuronal-precursor-cell
  • the heterologous functional domain may be a marker domain.
  • marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences.
  • the marker domain may be a fluorescent protein.
  • suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalama1, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g.
  • the marker domain may be a purification tag and/or an epitope tag.
  • Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, Si, T7, V5, VSV-G, 6 ⁇ His, 8 ⁇ His, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin.
  • GST glutathione-S-transferase
  • CBP chitin binding protein
  • MBP maltose binding protein
  • TRX thioredoxin
  • poly(NANP) tandem affinity purification
  • TAP tandem affinity pur
  • Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.
  • GST glutathione-S-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-glucuronidase
  • luciferase or fluorescent proteins.
  • the heterologous functional domain may target the RNA-guided DNA-binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA-binding agent to mitochondria.
  • the heterologous functional domain may be an effector domain.
  • the effector domain may modify or affect the target sequence.
  • the effector domain may be chosen from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain.
  • the heterologous functional domain is a nuclease, such as a FokI nuclease.
  • the heterologous functional domain is a transcriptional activator or repressor.
  • a transcriptional activator or repressor See, e.g., Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression,” Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013); Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol.
  • RNA-guided DNA-binding agent essentially becomes a transcription factor that can be directed to bind a desired target sequence using a guide RNA.
  • the efficacy of a gRNA is determined when delivered or expressed together with other components forming an RNP.
  • the gRNA is expressed together with an RNA-guided DNA binding agent, such as a Cas protein, e.g., Cas9.
  • the gRNA is delivered to or expressed in a cell line that already stably expresses an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • the gRNA is delivered to a cell as part of an RNP.
  • the gRNA is delivered to a cell along with a mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • a mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • RNA-guided DNA nuclease and a guide RNA disclosed herein can lead to double-stranded breaks (DSB), single-strand break, and/or site-specific binding that results in nucleic acid modification in the DNA which can produce errors in the form of insertion/deletion (indel) mutations upon repair by cellular machinery.
  • DSB double-stranded breaks
  • Indel insertion/deletion
  • the efficacy of particular gRNAs is determined based on in vitro models.
  • the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9).
  • the in vitro model is HUH7 human hepatocarcinoma cells.
  • the in vitro model is HepG2 cells.
  • the in vitro model is primary human hepatocytes.
  • the in vitro model is primary cynomolgus hepatocytes. With respect to using primary human hepatocytes, commercially available primary human hepatocytes can be used to provide greater consistency between experiments.
  • the number of off-target sites at which a deletion or insertion occurs in an in vitro model is determined, e.g., by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and the guide RNA.
  • such a determination comprises analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide. Exemplary procedures for such determinations are provided in the working examples below.
  • the efficacy of particular gRNAs is determined across multiple in vitro cell models for a gRNA selection process. In some embodiments, a cell line comparison of data with selected gRNAs is performed. In some embodiments, cross screening in multiple cell models is performed. In some embodiments, the efficacy of particular gRNAs is determined in PHH or PCH for a gRNA selection process.
  • the efficacy of particular gRNAs is determined based on in vivo models.
  • the in vivo model is a rodent model.
  • the rodent model is a mouse which expresses a KLKB1 gene.
  • the rodent model is a mouse which expresses a human KLKB1 gene.
  • the in vivo model is a non-human primate, for example cynomolgus monkey.
  • the efficacy of a guide RNA is measured by percent editing of KLKB1. Indel percentage can be calculated from NGS sequencing. In some embodiments, the percent editing of KLKB1 is compared to the percent editing necessary to achieve knockdown of prekallikrein and/or kallikrein protein, e.g., from cell culture media or cell lysates in the case of an in vitro model or plasma containing circulating levels in the case of an in vivo model.
  • the efficacy of a guide RNA is measured by the number and/or frequency of indels at off-target sequences within the genome of the target cell type.
  • efficacious guide RNAs are provided which produce indels at off-target sites at very low frequencies (e.g., ⁇ 5%) in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides for guide RNAs which do not exhibit off-target indel formation in the target cell type (e.g., a hepatocyte such as PHH), or which produce a frequency of off-target indel formation of ⁇ 5% in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides guide RNAs which do not exhibit any off-target indel formation in the target cell type (e.g., hepatocyte).
  • guide RNAs are provided which produce indels at less than 5 off-target sites, e.g., as evaluated by one or more methods described herein.
  • guide RNAs are provided which produce indels at less than or equal to 4, 3, 2, or 1 off-target site(s) e.g., as evaluated by one or more methods described herein.
  • the off-target site(s) does not occur in a protein coding region in the target cell (e.g., hepatocyte) genome.
  • linear amplification is used to detect gene editing events, such as the formation of insertion/deletion (“indel”) mutations, translocations, and homology directed repair (HDR) events in target DNA.
  • gene editing events such as the formation of insertion/deletion (“indel”) mutations, translocations, and homology directed repair (HDR) events in target DNA.
  • Indel insertion/deletion
  • HDR homology directed repair
  • linear amplification with a unique sequence-tagged primer and isolating the tagged amplification products herein after referred to as “UnIT,” or “Unique Identifier Tagmentation” method
  • the efficacy of a guide RNA is determined by measuring levels of KLKB1, pKal, total KLKB1 (prekallikrein+pKal), KLKB1 activity, HMWK, HMWK activity, and/or bradykinin, in a sample such as a body fluid, e.g., serum, plasma, or blood.
  • a body fluid e.g., serum, plasma, or blood.
  • the efficacy of a guide RNA is determined by measuring KLKB1 mRNA levels. A decrease in KLKB1 mRNA levels is indicative of an effective guide RNA.
  • the efficacy of a guide RNA is determined by measuring levels of bradykinin in a sample such as a body fluid, e.g., serum, plasma, or blood.
  • a body fluid e.g., serum, plasma, or blood.
  • the efficacy of a guide RNA is determined by measuring levels of bradykinin and/or its degradation products in a sample. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of bradykinin and/or its degradation products in the serum or plasma. A decrease in the levels of bradykinin and/or its degradation products in the serum or plasma is indicative of an effective guide RNA.
  • bradykinin may also be detected by an enzyme-linked immunosorbent assay (ELISA) assay with cell culture media or serum or plasma.
  • ELISA enzyme-linked immunosorbent assay
  • levels of bradykinin are measured in the same in vitro or in vivo systems or models used to measure editing.
  • levels of bradykinin are measured in cells, e.g., primary human hepatocytes.
  • levels of bradykinin are measured in a fluid such as serum or plasma.
  • circulating levels of bradykinin are measured.
  • the efficacy of a guide RNA is determined by measuring levels of total kallikrein (prekallikrein and plasma kallikrein (pKal)) in a sample. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of total kallikrein in a sample such as a body fluid, e.g., serum, plasma, or blood. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of total kallikrein in the serum or plasma. A decrease in the levels of total kallikrein in the serum or plasma is indicative of an effective guide RNA. In some embodiments, serum and/or plasma total kallikrein is decreased below 40% of basal levels.
  • levels of total kallikrein are measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture media or serum or plasma.
  • ELISA enzyme-linked immunosorbent assay
  • levels of total kallikrein are measured in the same in vitro or in vivo systems or models used to measure editing.
  • levels of total kallikrein are measured in cells, e.g., primary human hepatocytes.
  • levels of total kallikrein are measured in PHH and PCH cells.
  • the efficacy of a guide RNA is determined by measuring levels of prekallikrein and/or kallikrein in a sample such as a body fluid, e.g., serum, plasma, or blood. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of prekallikrein and/or kallikrein in the serum or plasma. A decrease in the levels of prekallikrein and/or kallikrein in the serum or plasma is indicative of an effective guide RNA. In some embodiments, levels of prekallikrein and/or kallikrein are measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture media or serum or plasma.
  • ELISA enzyme-linked immunosorbent assay
  • levels of prekallikrein and/or kallikrein are measured in the in vitro or in vivo systems or models used to measure editing. In some embodiments, levels of prekallikrein and/or kallikrein are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture media. In some embodiments, levels of prekallikrein and/or kallikrein are measured from a plasma sample. In some embodiments, levels of prekallikrein and/or kallikrein are measured from a serum sample. Prekallikrein and/or pKal protein levels are optionally measured by ELISA after an activation step to convert prekallikrein to its active form, pKal.
  • the efficacy of a guide RNA is determined by measuring levels of prekallikrein in a sample. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of prekallikrein in a sample such as a body fluid, e.g., serum, plasma, or blood. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of prekallikrein in the serum or plasma. A decrease in the levels of prekallikrein in the serum or plasma is indicative of an effective guide RNA. In some embodiments, serum and/or plasma prekallikrein is reduced at least 60%, 70%, 80%, 85%, 90%, 95% or more.
  • serum and/or plasma total kallikrein, prekallikrein and/or kallikrein is decreased by about 60-80%, 60-90%, 60-95%, 60-100%, 85-95%, or 85-100%.
  • levels of prekallikrein are measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture media or serum or plasma.
  • ELISA enzyme-linked immunosorbent assay
  • levels of prekallikrein are measured in the in vitro or in vivo systems or models used to measure editing.
  • levels of prekallikrein are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture media.
  • levels of prekallikrein are measured from a plasma sample.
  • levels of prekallikrein are measured from a serum sample.
  • the efficacy of a guide RNA is determined by measuring levels of pKal in a sample. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of pKal in the serum or plasma. A decrease in the level of pKal in the serum or plasma is indicative of an effective guide RNA. In some embodiments, level of pKal is reduced at least 60%, 70%, 80%, 85%, 90%, 95% or more. In some embodiments, serum and/or plasma pKal is decreased by about 60-80%, 60-90%, 60-95%, 60-100%, 85-95%, or 85-100%.
  • levels of pKal are measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture media or serum or plasma.
  • ELISA enzyme-linked immunosorbent assay
  • levels of pKal are measured in the in vitro or in vivo systems or models used to measure editing.
  • levels of pKal are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture media.
  • levels of pKal are measured from a plasma sample.
  • levels of pKal are measured from a serum sample.
  • the efficacy of a guide RNA is determined by measuring levels of circulating cleaved HMWK (cHMWK) and total HMWK in citrated serum or citrated plasma. In some embodiments, the efficacy of a guide RNA is determined by measuring levels of circulating cleaved HMWK (cHMWK) and total HMWK in the serum or plasma. A decrease in the proportion of cleaved HMWK compared to total HMWK is indicative of an effective guide RNA. In some embodiments, the proportion of cleaved HMWK compared to total HMWK can target a ratio of circulating plasma cHMWK to total HMWK of less than about 60%.
  • the ratio of cHMWK to HMWK is less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, or more.
  • levels of prekallikrein are measured using western Blotting assay with cell culture media or serum or plasma.
  • levels of cHMWK and total HMWK are measured in the in vitro or in vivo systems or models used to measure editing.
  • levels of cHMWK and total HMWK are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture media.
  • levels of cHMWK and total HMWK are measured from a plasma sample.
  • levels of cHMWK and total HMWK are measured from a serum sample.
  • the efficacy of a guide RNA is determined by measuring pKal activity in a sample. A decrease in the pKal activity is indicative of an effective guide RNA. In some embodiments, the efficacy of a guide RNA is determined by measuring pKal activity in the serum or plasma.
  • the pKal activity is measured as the capacity of a citrated serum sample or citrated plasma sample to convert HMWK to cHMWK (See Banerji et al, N Engl J Med 2017; 376:717-28). A decrease in the final proportion of cHMWK to total HMWK indicates a decrease in pKal activity.
  • the levels of cHMWK and full length HMWK can be measured by western blotting.
  • pKal activity is measured as the capacity of a citrated serum sample or citrated plasma sample to enzymatically cleave a HWMK-like peptide substrate, in which case a decrease in substrate cleavage indicates a decrease in pKal activity.
  • the pKal activity is reduced by at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or more. In some embodiments, the pKal activity is decreased by about 60-80%, 60-90%, 60-95%, 60-100%, 85-95%, or 85-100%. In some embodiments, pKal activity is reduced to less than about 40% of basal levels. In some embodiments, pKal activity is reduced to about 40-50% of basal levels. In some embodiments, pKal activity is reduced to 20-40 or 20-50% of basal levels. In some embodiments, levels of pKal activity are measured in the in vitro or in vivo systems or models used to measure editing.
  • levels of pKal activity are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture media. In some embodiments, levels of pKal activity are measured from a plasma sample. In some embodiments, levels of pKal are measured from a serum sample.
  • the gRNAs and associated methods and compositions disclosed herein are useful in treating and preventing HAE and preventing symptoms of HAE. In some embodiments, the gRNAs and associated methods and compositions are useful for reducing the frequency of HAE attacks. In some embodiments, the gRNAs and associated methods and compositions are useful for preventing HAE attacks. In some embodiments, the gRNAs disclosed herein are useful in treating and preventing bradykinin production and accumulation, bradykinin-induced swelling, angioedema obstruction of the airway, or asphyxiation. In some embodiments, the gRNAs disclosed herein are useful in treating or preventing angioedema and attacks caused by HAE.
  • the gRNAs disclosed herein are useful for reducing the frequency of angioedema attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for reducing the severity of angioedema attacks. In some embodiments, the gRNAs disclosed herein are useful for reducing the frequency and/or severity of attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for achieving remission of angioedema attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for achieving durable remission, e.g. maintained for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years or more.
  • the gRNAs and associated methods and compositions disclosed herein are useful to decrease KLKB1 mRNA production. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring KLKB1 mRNA levels, wherein a decrease in KLKB1 mRNA levels indicates effectiveness.
  • gRNAs and associated methods and compositions disclosed herein are useful to decrease prekallikrein protein levels in plasma or serum. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring prekallikrein protein levels or total kallikrein protein levels, wherein a decrease in prekallikrein and/or kallikrein protein indicates effectiveness. In some embodiments, effectiveness of treatment/prevention can be assessed by measuring prekallikrein protein in a sample, such as serum or plasma, wherein a decrease in prekallikrein indicates effectiveness. For example, plasma or serum prekallikrein can be measured by ELISA as described in Ferrone J D, Bhattacharjee G, Revenko A S, et al.
  • IONIS-PKK Rx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production. Nucleic Acid Ther. 2019; 29(2):82-91.
  • kallikrein can be measured by ELISA as described herein, and administration of the gRNAs disclosed herein can decrease kallikrein protein levels in plasma or serum.
  • the gRNAs and associated methods and compositions disclosed herein are useful to decrease total kallikrein (prekallikrein and pKal) protein levels in plasma or serum. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring total kallikrein (prekallikrein and pKal) protein levels, wherein a decrease in total kallikrein protein indicates effectiveness. Total kallikrein, prekallikrein, and/or kallikrein may be measured before or after activation to release plasma kallikrein. In some embodiments, effectiveness of treatment/prevention can be assessed by measuring prekallikrein and/or pKal protein in a sample, such as serum or plasma, wherein a decrease in prekallikrein protein indicates effectiveness.
  • effectiveness of treatment/prevention can be assessed by measuring pKal protein in a sample, such as serum or plasma, wherein a decrease in pKal protein indicates effectiveness.
  • levels of prekallikrein and pKal protein can be measured by ELISA, for example by using the Prekallikrein and Kallikrein Human ELISA Kit (Abcam, Eugene, OR).
  • Prekallikrein and/or pKal protein levels are optionally measured by ELISA after an activation step to convert prekallikrein to its active form, pKal.
  • gRNAs and associated methods and compositions disclosed herein are useful to decrease the proportion of circulating cleaved HMWK (cHMWK) compared to total HMWK in citrated serum or citrated plasma. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring total HMWK and cHMWK protein levels, wherein a decrease in the proportion of cleaved HMWK indicates effectiveness. In some embodiments, effectiveness of treatment/prevention can be assessed by measuring total HMWK and cHMWK protein levels in a sample, such as serum or plasma, wherein a decrease in the proportion of cHMWK indicates effectiveness.
  • the proportion of cHMWK compared to total HMWK in citrated serum or citrated plasma samples can be measured by western blotting as described in Suffritti C, Zanichelli A, Maggioni L, Bonanni E, Cugno M, Cicardi M.
  • High-molecular weight kininogen cleavage correlates with disease states in the bradykinin-mediated angioedema due to hereditary C1-inhibitor deficiency.
  • Circulating plasma cHMWK levels below about 30% total HMWK were associated with decreases in HAE attacks in patients treated with lanadelumab (See Banerji, et al, 2017).
  • healthy controls had plasma levels of cHMWK around 8.3% total HMWK.
  • Suffriti and colleagues found cHMWK plasma levels of an average of about 34.8% in normal controls, about 41.4% in HAE patients in remission and about 58.1% in HAE patients during an attack (Suffritti, et al. Clin Exp Allergy 2014; 44:1503-14).
  • the gRNAs and associated methods and compositions disclosed herein are useful for reducing circulating cHMWK levels such that a subject exhibits reduced number of HAE attacks.
  • the gRNAs and associated methods and compositions disclosed herein are useful to reduce a subject's proportion of cHMWK in citrated plasma to below 30%.
  • the gRNAs and associated methods and compositions disclosed herein are useful to reduce a subject's proportion of cHMWK in citrated plasma to below 30%, 20%, and/or 10%.
  • the gRNAs and associated methods and compositions disclosed herein are useful to reduce a subject's proportion of cHMWK in citrated plasma to about those of healthy controls.
  • the gRNAs and associated methods and compositions disclosed herein can be useful to decrease the spontaneous pKal activity in serum or plasma. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring spontaneous pKal activity, wherein a decrease in spontaneous pKal activity indicates effectiveness. In some embodiments, effectiveness of treatment/prevention can be assessed by measuring spontaneous pKal activity in a sample, such as serum or plasma, wherein a decrease in spontaneous pKal activity indicates effectiveness. In certain embodiments, the gRNAs and associated methods and compositions disclosed herein are useful to decrease the basal level of circulating pKal and circulating pKal activity.
  • the gRNAs and associated methods and compositions disclosed herein can be useful to decrease the inducible pKal activity in serum or plasma. Therefore, in one aspect, effectiveness of treatment/prevention can be assessed by measuring inducible pKal activity, wherein a decrease in inducible pKal activity indicates effectiveness. In some embodiments, effectiveness of treatment/prevention can be assessed by measuring inducible pKal activity in a sample, such as serum or plasma, wherein a decrease in inducible pKal activity indicates effectiveness.
  • pKal activity can be induced by exposure of a sample to FXIIa (See Banerji et al, N Engl J Med 2017; 376:717-28.) In some examples, pKal activity can be induced by incubation of a sample with dextran sulfate (See Ferrone, et al. Nucleic Acid Ther. 2019:29(2):82-91.) In some examples pKal activity can be induced by addition of ellagic acid to a sample (Aygören-Pürsün, et al. J Allergy Clin Immunol 2016; 138: 934-936.)
  • pKal activity is measured as the capacity of a citrated serum sample or citrated plasma sample to convert HMWK to cHMWK (See Banerji et al, N Engl J Med 2017; 376:717-28) wherein a decrease in the final proportion of cHMWK to total HMWK indicates a decrease in pKal activity.
  • the proportion of cHMWK and full length HMWK can be measured by Western blotting, for instance as described by Suffritti, et al. Clin Exp Allergy 2014; 44:1503-14.
  • pKal activity is measured as the capacity of a citrated serum sample or citrated plasma sample to enzymatically cleave a HWMK-like peptide substrate, in which case a decrease in substrate cleavage indicates a decrease in pKal activity.
  • the substrate peptide can be the chromogenic substrate H-D-Pro-Phe-Arg-p-nitroanilide peptide (Bachem, Cat. L-2120) and cleavage can be measured as change in A405 (See Defendi et al, PLoS One 2013; 8:e70140).
  • the substrate peptide can be the fluorogenic substrate H-Pro-Phe-Arg-AMC (Sigma, Cat No. P9273) and cleavage can be measured as fluorescence changes as excitation and emission wavelengths at 360 and 480 nm, respectively (See Banerji, et al., N Engl J Med 2017; 376:717-28).
  • administration of the gRNAs and compositions disclosed herein are useful for reducing kallikrein activity, e.g. total kallikrein, prekallikrein, and/or pKal activity) such that a subject exhibits fewer HAE attacks.
  • kallikrein activity e.g. total kallikrein, prekallikrein, and/or pKal activity
  • administration of the gRNAs and compositions disclosed herein reduces a subject's pKal activity to less than about 40% of basal levels. In some embodiments, administration of the gRNAs and compositions disclosed herein reduces a subject's pKal activity to about 40-50% of basal levels. In some embodiments, administration of the gRNAs and compositions disclosed herein reduces a subject's pKal activity to 20-40% or 20-50% of basal levels.
  • any one or more of the gRNAs, compositions, or pharmaceutical formulations described herein is for use in preparing a medicament for treating or preventing a disease or disorder in a subject.
  • treatment and/or prevention is accomplished with a single dose, e.g., one-time treatment, of medicament/composition.
  • the disease or disorder is HAE.
  • the invention comprises a method of treating or preventing a disease or disorder in subject comprising administering any one or more of the gRNAs, compositions, or pharmaceutical formulations described herein.
  • the disease or disorder is HAE.
  • the gRNAs, compositions, or pharmaceutical formulations described herein are administered as a single dose, e.g., at one time.
  • the single dose achieves durable treatment and/or prevention.
  • the method achieves durable treatment and/or prevention.
  • Durable treatment and/or prevention includes treatment and/or prevention that extends at least i) 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks; ii) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, or 36 months; or iii) 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years.
  • a single dose of the gRNAs, compositions, or pharmaceutical formulations described herein is sufficient to treat and/or prevent any of the indications described herein for the duration of the subject's life.
  • the invention comprises a method or use of modifying (e.g., creating a double strand break) a target DNA comprising, administering or delivering any one or more of the gRNAs, compositions, or pharmaceutical formulations described herein.
  • the target DNA is the KLKB1 gene.
  • the target DNA is in an exon of the KLKB1 gene.
  • the target DNA is in exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the KLKB1 gene.
  • the invention comprises a method or use for modulation of a target gene comprising, administering or delivering any one or more of the gRNAs, compositions, or pharmaceutical formulations described herein.
  • the modulation is editing of the KLKB1 target gene.
  • the modulation is a change in expression of the protein encoded by the KLKB1 target gene.
  • the method or use results in gene editing. In some embodiments, the method or use results in a double-stranded break within the target KLKB1 gene. In some embodiments, the method or use results in formation of indel mutations during non-homologous end joining of the DSB. In some embodiments, the method or use results in an insertion or deletion of nucleotides in a target KLKB1 gene. In some embodiments, the insertion or deletion of nucleotides in a target KLKB1 gene leads to a frameshift mutation or premature stop codon that results in a non-functional protein. In some embodiments, the insertion or deletion of nucleotides in a target KLKB1 gene leads to a knockdown or elimination of target gene expression.
  • the method or use results in KLKB1 gene modulation.
  • the KLKB1 gene modulation is a decrease in gene expression.
  • the method or use results in decreased expression of the protein encoded by the target gene in a population of cells or in vivo.
  • a method of inducing a double-stranded break (DSB) within the KLKB1 gene comprising administering a composition comprising a guide RNA comprising any one or more guide sequences of SEQ ID NOs: 1-149.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 1-149 are administered to induce a DSB in the KLKB1 gene.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of modifying the KLKB1 gene comprising administering a composition comprising a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 1-149 are administered to modify the KLKB1 gene.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of treating or preventing hereditary angioedema comprising administering a composition comprising a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 1-149 are administered to treat or prevent HAE.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of decreasing or eliminating bradykinin production and accumulation comprising administering a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of treating or preventing bradykinin-induced swelling comprising administering a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of treating or preventing bradykinin-induced angioedema comprising administering a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • a method of treating or preventing obstruction of the airway and/or asphyxiation comprising administering a guide RNA comprising any one or more of the guide sequences of SEQ ID NOs: 1-149.
  • the guide RNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 1-149 are administered to reduce bradykinin levels in the plasma, serum, or blood.
  • the gRNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 1-149 are administered to decrease bradykinin in the serum or plasma.
  • the gRNAs may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • the gRNAs comprising the guide sequences of Table 1 together with an RNA-guided DNA nuclease such as a Cas nuclease induce DSBs, and non-homologous ending joining (NHEJ) during repair leads to a mutation in the KLKB1 gene.
  • NHEJ leads to a deletion or insertion of a nucleotide(s), which induces a frame shift or nonsense mutation in the KLKB1 gene.
  • administering the guide RNAs of the invention decrease levels (e.g., serum or plasma levels) of total kallikrein, prekallikrein, and/or kallikrein in the subject, and therefore prevents bradykinin overproduction and accumulation.
  • administering the guide RNAs of the invention decrease kallikrein activity levels (e.g., serum or plasma levels) in the subject, and therefore prevents bradykinin overproduction and accumulation.
  • the methods provided herein result in fewer attacks that include fluid leakage through blood cells to tissues. In some embodiments, the methods provided herein reduce the frequency of attacks that increase swelling in organ tissues. In some embodiments, administering the guide RNAs of the invention (e.g., in a composition provided herein) decrease the frequency or severity of angioedema attacks.
  • the subject is mammalian. In some embodiments, the subject is a primate, e.g. human.
  • a guide RNAs comprising any one or more of the guide sequences in Table 1 or Table 2 (e.g., in a composition provided herein) is provided for the preparation of a medicament for treating a human subject having HAE.
  • the guide RNAs, compositions, and formulations are administered intravenously. In some embodiments, the guide RNAs, compositions, and formulations are administered by infusion. In some embodiments, the guide RNAs, compositions, and formulations are administered into the hepatic circulation.
  • a single administration of a composition comprising a guide RNA provided herein is sufficient to knock down expression of the protein. In other embodiments, more than one administration of a composition comprising a guide RNA provided herein may be beneficial to maximize therapeutic effects.
  • treatment slows or halts HAE disease progression.
  • treatment slows or halts progression of angioedema. In some embodiments, treatment results in improvement, stabilization, or slowing of change in symptoms of HAE.
  • Lipid nanoparticles are a well-known means for delivery of nucleotide and protein cargo and may be used for delivery of the guide RNAs, compositions, or pharmaceutical formulations disclosed herein.
  • the LNPs deliver nucleic acid, protein, or nucleic acid together with protein.
  • the invention comprises a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is associated with an LNP.
  • the gRNA/LNP is also associated with a Cas9 or an mRNA encoding Cas9.
  • the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP.
  • the composition further comprises a Cas9 or an mRNA encoding Cas9.
  • the LNPs comprise cationic lipids.
  • the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate) or another ionizable lipid.
  • the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5, 5.0, 5.5, 6.0, or 6.5.
  • N:P RNA phosphate
  • the term cationic and ionizable in the context of LNP lipids is interchangeable, e.g., wherein ionizable lipids are cationic depending on the pH.
  • LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating a disease or disorder.
  • Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or an mRNA encoding Cas9.
  • the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with an LNP or not associated with an LNP.
  • the gRNA/LNP or gRNA is also associated with a Cas9 or an mRNA encoding Cas9.
  • the guide RNA compositions described herein, alone or encoded on one or more vectors, are formulated in or administered via a lipid nanoparticle; see e.g., WO/2017/173054 and WO 2019/067992, the contents of which are hereby incorporated by reference in their entirety.
  • the invention comprises DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein.
  • the vectors further comprise nucleic acids that do not encode guide RNAs.
  • Nucleic acids that do not encode guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding an RNA-guided DNA nuclease, which can be a nuclease such as Cas9.
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and trRNA.
  • the vector comprises one or more nucleotide sequence(s) encoding a sgRNA and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas nuclease, such as Cas9 or Cpf1.
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas protein, such as, Cas9.
  • the Cas9 is from Streptococcus pyogenes (i.e., Spy Cas9).
  • the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may be a sgRNA) comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR/Cas system.
  • the nucleic acid comprising or consisting of the crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence wherein the vector sequence comprises or consists of nucleic acids that are not naturally found together with the crRNA, trRNA, or crRNA and trRNA.
  • IVTT In Vitro Transcription
  • Spy Capped and polyadenylated Streptococcus pyogenes
  • Cas9 mRNA containing N1-methyl pseudo-U was generated by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase.
  • Plasmid DNA containing a T7 promoter and a sequence for transcription (for producing mRNA comprising an mRNA described herein (see SEQ ID NOs: 501-516 in Table 5 below for Cas9 ORFs) was linearized by incubating at 37° C. to complete digestion with XbaI with the following conditions: 200 ng/ ⁇ L plasmid, 2 U/ ⁇ L XbaI (NEB), and 1 ⁇ reaction buffer.
  • the XbaI was inactivated by heating the reaction at 65° C. for 20 min.
  • the linearized plasmid was purified from enzyme and buffer salts using a silica maxi spin column (Epoch Life Sciences) and analyzed by agarose gel to confirm linearization.
  • the IVT reaction to generate Cas9 mRNA was incubated at 37° C. for 4 hours in the following conditions: 50 ng/ ⁇ L linearized plasmid; 2 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink); 10 mM ARCA (Trilink); 5 U/ ⁇ L T7 RNA polymerase (NEB); 1 U/ ⁇ L Murine RNase inhibitor (NEB); 0.004 U/ ⁇ L Inorganic E.
  • ThermoFisher coli pyrophosphatase
  • ThermoFisher was added to a final concentration of 0.01 U/ ⁇ L, and the reaction was incubated for an additional 30 minutes to remove the DNA template.
  • the Cas9 mRNA was purified from enzyme and nucleotides using a MegaClear Transcription Clean-up kit according to the manufacturer's protocol (ThermoFisher). Alternatively, the Cas9 mRNA was purified with a LiCl precipitation method, which in some cases was followed by further purification by tangential flow filtration. The transcript concentration was determined by measuring the light absorbance at 260 nm (Nanodrop), and the transcript was analyzed by capillary electrophoresis by Bioanlayzer (Agilent).
  • Guide RNAs were designed toward human KLKB1 (ENSG00000164344) targeting the protein coding regions within Exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. Guide RNAs were also designed toward cynomolgus KLKB1 (ENSMFAT00000002355) targeting the protein coding regions within Exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. Guide RNAs and corresponding target genomic coordinates are provided above (Table 1).
  • PSH Primary human hepatocytes
  • PCH primary cynomolgus hepatocytes
  • PCH primary cynomolgus hepatocytes
  • Guide RNAs targeting KLKB1 were delivered to cells using a liposomal system with Cas9 protein, for example, or using an LNP formulation comprising Cas9 mRNA and guide RNA as further described below.
  • RNP transfection was used with a liposomal system (Lipofectamine RNAiMAX (ThermoFisher, Cat. 13778150) and CRISPR reagents (guide RNA, Cas9 Protein) to shuttle a ribonucleoprotein (RNP) complex across the cell membrane.
  • Lipofectamine RNAiMAX ThermoFisher, Cat. 13778150
  • CRISPR reagents guide RNA, Cas9 Protein
  • dgRNA dual guide
  • individual crRNA and trRNA was pre-annealed by mixing equivalent amounts of reagent and incubating at 95° C. for 2 min and cooling to room temperature.
  • the gRNA consisting of pre-annealed crRNA and trRNA was added to Spy Cas9 protein in the reaction buffer (OptiMem) to form a RNP complex and the formed RNP complex was incubated at room temperature for 10 minutes.
  • the RNP complex was diluted with OptiMem to prepare a 1 ⁇ m RNP complex stock solution.
  • a Transfection Mix including Lipofectamine RNAiMAX and OptiMem was prepared and incubated for at least 5 minutes.
  • the Transfection Mix was added to the RNP complex and incubated at room temperature for 10 minutes, and the Transfection Agent (Transfection Mix and RNP complex) was added to cells.
  • Cells were transfected with the RNP complex containing Spy Cas9 protein (10 nM), individual guide/tracer RNA (10 nM), and Lipofectamine RNAiMAX (1.0 ⁇ L/well) and OptiMem.
  • RNP Electroporation was used with the cell electroporation system (Lonza 4D NucleofectorTM kit 816B0346) and CRISPR reagents, gRNA and Cas9 protein, to shuttle a ribonucleoprotein (RNP) complex across the cell membrane.
  • crRNA and trRNA were pre-annealed by mixing equivalent amounts of reagent and incubating at 95° C. for 2 min and cooling to room temperature.
  • a 50 uM sgRNA stock solution was prepared by incubating equal amounts of 100 uM sgRNA to water at 95° C. for 2 min followed by cooling on ice for 5 minutes.
  • the sgRNA was added to the Spy Cas9 protein in reaction buffer (20 mM Hepes, 100 mM KCl, 1 mM MgCl2, 10% glycerol, 1 mM DTT pH 7.5) to form an RNP complex and incubated at room temperature for 10 minutes.
  • Cells were electroporated (AmaxaTM 96-well ShuttleTM Cat.
  • AAM-1001S with the RNP complex containing Spy Cas9 protein (2 uM) and gRNA (4 uM) and Lonza P3 buffer (Catalog #: V4SP-3960).
  • Post electroporation, hepatocyte plating media (Will's E, Cat. A12176-01) was added to the cell plate, the media with cells was transferred to collagen coated plates (Corning 354407). After 4-6 hrs, the media was changed to maintenance media (William's E (Gibco, Cat. A12176-01, Lot 2039733) and maintenance supplement (Gibco, Cat. A12176-01, Lot 2039733) for overnight incubation at 37° C. overnight.
  • RNA cargos e.g., Cas9 mRNA and sgRNA
  • the RNA cargos were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg/mL.
  • the LNPs used in Examples 2-10 contained ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a 50:38:9:3 molar ratio, respectively.
  • the LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6, and a ratio of gRNA to mRNA of 1:2 by weight.
  • the LNPs used in Examples 2-10 comprise a Cas9 mRNA and an sgRNA.
  • the LNPs were prepared using a cross-flow technique utilizing impinging jet mixing of the lipid in ethanol with two volumes of RNA solutions and one volume of water.
  • the lipid in ethanol was mixed through a mixing cross with the two volumes of RNA solution.
  • a fourth stream of water was mixed with the outlet stream of the cross through an inline tee (See WO2016010840 FIG. 2 ).
  • the LNPs were held for 1 hour at room temperature, and further diluted with water (approximately 1:1 v/v).
  • Diluted LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100 kD MWCO) and then buffer exchanged using PD-10 desalting columns (GE) into 50 mM Tris, 45 mM NaCl, 5% (w/v) sucrose, pH 7.5 (TSS). The resulting mixture was then filtered using a 0.2 ⁇ m sterile filter. The final LNPs were characterized to determine the encapsulation efficiency, polydispersity index, and average particle size. The final LNP was stored at 4° C. or ⁇ 80° C. until further use.
  • Lipofection of Cas9 mRNA and gRNAs used pre-mixed lipid formulations.
  • the lipofection reagent contained ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a 50:38:9:3 molar ratio, respectively.
  • RNA cargos e.g., Cas9 mRNA and gRNA
  • N:P lipid amine to RNA phosphate
  • Guide RNA was chemically synthesized by commercial vendors or using standard in vitro synthesis techniques with modified nucleotides.
  • a Cas9 ORF of Table 5 was produced by IVT as described in WO2019/067910, see e.g. paragraph [00354], using a 2 hour IVT reaction time and purifying the mRNA by LiCl precipitation followed by tangential flow filtration. Lipofections were performed with 3% cynomolgus serum and a ratio of gRNA to mRNA of 1:1 by weight.
  • Modified sgRNAs targeting human KLKB1 were formulated in LNPs as described in Example 1.
  • Primary human hepatocytes were plated as described in Example 1. Cells were incubated at 37° C., 5% CO2 for 48 hours prior to treatment with LNPs. LNPs were incubated in media containing 3% fetal bovine serum (FBS) at 37° C. for 10 minutes. Post-incubation, media was aspirated from cells and the mixture of media with 3% FBS and LNP were added to the hepatocytes. At 72 to 96 hours post-transfection, a portion of the cells were collected and processed for NGS sequencing as described in Example 1.
  • FBS fetal bovine serum
  • Transfected PHH and PCH were harvested at 48 or 72 hours post-transfection.
  • the gDNA was extracted from each well of a 96-well plate using 50 ⁇ L/well BuccalAmp DNA Extraction solution (Epicentre, Cat. QE09050) or Zymo's Quick RNA/DNA extraction kit (Cat. R2130) according to manufacturer's protocol. All DNA samples were subjected to PCR and subsequent NGS analysis, as described herein.
  • next generation sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing.
  • PCR primers were designed around the target site within the gene of interest (e.g. KLKB1), and the genomic area of interest was amplified. Primer sequence design was done as is standard in the field.
  • PCR was performed according to the manufacturer's protocols (Illumina) to add chemistry for sequencing.
  • the amplicons were sequenced on an Illumina MiSeq instrument.
  • the reads were aligned to the human (e.g., hg38) reference genome after eliminating those having low quality scores.
  • the resulting files containing the reads were mapped to the reference genome (BAM files), where reads that overlapped the target region of interest were selected and the number of wild-type reads versus the number of reads which contain an insertion or deletion (“indel”) was calculated.
  • BAM files reference genome
  • the editing percentage (e.g., the “editing efficiency” or “percent editing”) is defined as the total number of sequence reads with insertions or deletions (“indels”) over the total number of sequence reads, including wild type.
  • a biochemical assay (See, e.g., Cameron et al., Nature Methods. 6, 600-606; 2017) was used to discover potential off-target genomic sites cleaved by Cas9 targeting KLKB1.
  • Purified genomic DNA (gDNA) from cells were digested with in vitro assembled ribonucleoprotein (RNP) of Cas9 and sgRNA, to induce DNA cleavage at the on-target site and potential off-target sites with homology to the sgRNA spacer sequence.
  • RNP ribonucleoprotein
  • the free gDNA fragment ends were ligated with adapters to facilitate edited fragment enrichment and NGS library construction.
  • the NGS libraries were sequenced and through bioinformatic analysis, the reads were analyzed to determine the genomic coordinates of the free DNA ends. Locations in the human genome with an accumulation of reads were then annotated as potential off-target sites.
  • off-target detection assays such as the biochemical assay used above
  • a large number of potential off-target sites are typically recovered, by design, so as to “cast a wide net” for potential sites that can be validated in other contexts, e.g., in a primary cell of interest.
  • the biochemical assay typically overrepresents the number of potential off-target sites as the assay utilizes purified high molecular weight genomic DNA free of the cell environment and is dependent on the dose of Cas9 RNP used. Accordingly, potential off-target sites identified by these assays were validated using targeted sequencing of the identified potential off-target sites.
  • Cas9 and a sgRNA of interest were introduced to PHH or PCH cells.
  • the cells were then lysed and primers flanking the potential off-target site(s) were used to generate an amplicon for NGS analysis.
  • Identification of indels at a certain level can be used to validate potential off-target site, whereas the lack of indels found at the potential off-target site can indicate a false positive in the off-target assay that was utilized.
  • Quantitative PCR was performed to assess KLKB1 transcript levels.
  • the Qiagen RNeasy Mini Kit Qiagen, Cat. 74106 was used. The RNeasy Mini Kit procedure was completed according to the manufacturer's protocol.
  • the Taqman RNA-to-Ct 1-Step Kit (Thermo Fisher Scientific, Cat. 4392938) was used to create the PCR reactions. The reaction set-up was completed according to the manufacturer's protocol. Alternatively, a Cells-to-CT 1-Step TaqMan Kit (Thermo Fisher Scientific, Cat. A25603) was used to produce samples for qPCR. Quantitative PCR probes targeting human or cynomolgus monkey KLKB1 (Thermo Fisher Scientific, Cat. 4351372, transcript UniGene ID Hs01111828_m1; Thermo Fisher Scientific, Cat. 4331182, transcript UniGene ID Hs00168478_ml), internal control PPIB (Thermo Fisher Scientific, Cat.
  • transcript UniGene ID Hs00168719_ml; Thermo Fisher Scientific, Cat. 4331182, transcript UniGene ID Mf02802985 ml), internal control GAPDH (Thermo Fisher Scientific, Cat. 4351372, transcript UniGene ID Hs02786624_g1), and internal control 18S (Thermo Fisher Scientific, Cat. 4319413E) were used in the PCR reactions.
  • the StepOnePlus Real-Time PCR System was used to perform the real-time PCR reaction and transcript quantification according to the manufacturer's protocol.
  • Double delta Ct analysis of KLKB1 mRNA was provided using the Ct values determined from the StepOnePlus Real-Time PCR System. A double delta Ct value was calculated for the Ct values for internal controls within each sample compared to the values for KLKB1. The expression fold change was determined based on the double delta Ct value for each sequence.
  • PHH or PCH were transfected as previously described. Starting at three days post-transfection and plating (96-well plate), media was changed on cells every two days. Seven to ten days post-transfection, media was removed from cells and then replaced with 100 ⁇ L of William's E culture media or Cellartis Power Primary HEP Medium (Takada, Cat. Y20020). Twenty-four to forty-eight hours later, media was harvested and stored at ⁇ 20° C. Total secreted KLKB1 protein levels were determined using a prekallikrein ELISA Kit (Abcam, Cat. ab202405), which detects prekallikrein and kallikrein (also, called total kallikrein). Kit reagents and standards were prepared using the manufacturer's protocols.
  • Serum pre-kallikrein levels were measured in humanized mice using the following procedure. Six to seven days post-dose, animals were euthanized by exsanguination via cardiac puncture under isoflourane anesthesia. Blood was collected into serum separator tubes, and allowed to clot at room temperature for 2 hours before being spun down at 9000 g for 10 min to separate the serum. Samples were stored at ⁇ 20 C until analysis.
  • Pre-kallikrein protein levels were determined using a human pre-kallikrein ELISA Kit (Abcam, Cat. ab202405), which detects prekallikrein and kallikrein (also, called total kallikrein). Briefly, sera were serial diluted with kit sample diluent to a final dilution of 1:500 or 1:1000 fold before adding to the ELISA plate. The assay was carried out according to the manufacturer's protocol. The plate was read on a Clariostar plate reader (BMG Labtech). Pre-kallikrein levels were calculated by Mars software using a four-parameter logistic curve fit of the standard curve. Reduction of total secreted pre-kallikrein protein for cells treated with KLKB1 reagents was determined when compared to wells treated with control reagents or untreated samples.
  • LNPs were incubated in Cellartis Power Primary HEP Medium (Takada, Cat. Y20020) containing 3% FBS or cynomolgus serum at 37° C. for 10 minutes. Post-incubation the LNPs were added to the human hepatocytes. Starting at three days post-transfection, media was changed on cells every two days. Ten to fourteen days post-transfection, for cells plated in a 96-well plate the media was removed and the cells were lysed with 50 ⁇ L/well RIPA buffer (Boston Bio Products, Cat.
  • protease inhibitor mixture consisting of complete protease inhibitor cocktail (Sigma, Cat. 11697498001), 1 mM DTT, and 250 U/ml Benzonase (EMD Millipore, Cat. 71206-3) per 30,000 to 45,000 cells.
  • Cells were kept on ice for 30 minutes at which time NaCl (1 M final concentration) was added.
  • Cell lysates were thoroughly mixed and retained on ice for 30 minutes.
  • the whole cell extracts (“WCE”) were transferred to a PCR plate and centrifuged to pellet debris.
  • a Bradford assay Bio-Rad, Cat. 500-0001 was used to assess protein content of the lysates. The Bradford assay procedure was completed according to the manufacturer's protocol. Extracts were stored at ⁇ 20° C. prior to use.
  • Western blots were performed to assess KLKB1 protein levels. Lysates were mixed with Laemmli buffer (Boston BioProducts, Cat. BP-111R) and denatured at 95° C. for 10 minutes. Western blots were run using the NuPage system on 4-12% Bis-Tris gels (Thermo Fisher Scientific, Cat. NP0323BOX) according to the manufacturer's protocol followed by wet transfer onto 0.45 ⁇ m nitrocellulose membrane (Bio-Rad, Cat. 1620115). After transfer membranes were rinsed thoroughly with water and stained with Ponceau S solution (Boston Bio Products, Cat. ST-180) to confirm complete and even transfer.
  • Laemmli buffer Boston BioProducts, Cat. BP-111R
  • Western blots were run using the NuPage system on 4-12% Bis-Tris gels (Thermo Fisher Scientific, Cat. NP0323BOX) according to the manufacturer's protocol followed by wet transfer onto 0.45 ⁇ m nitrocellulose
  • Blots were blocked using 5% dry milk in TBS for 30 minutes on a lab rocker at room temperature. Blots were rinsed with TBST and probed with rabbit ⁇ -kallikrein monoclonal antibody (Abcam, Cat. ab124938) at 1:1000 in TBST.
  • Abcam rabbit ⁇ -kallikrein monoclonal antibody
  • GAPDH was used as a loading control (Novus, Cat. NB600502) at 1:2500 in TBST and incubated simultaneously with the KLKB1 primary antibody. After incubation, blots were rinsed 3 times for 5 minutes each in TBST. Blots were visualized and analyzed by densitometry using a Licor Odyssey system.
  • Plasma kallikrein levels in in samples were measured by an immunoassay using an electrochemiluminescence detection platform by MesoScale Discovery (MSD).
  • MSD MesoScale Discovery
  • a 96-well MSD standard plate (Cat. No: L15XA) was coated with 25 or 40 ⁇ L of a mouse monoclonal capture antibody for kallikrein (LS-Bio, LS-C38308) at a concentration of 1 ⁇ g/mL in PBS over night at 4° C.
  • the wells were washed and then blocked with 150 ⁇ L of 3% Blocker-A (MSD, Cat. No: R93AA) and incubated for 1 hour at room temperature on a shaker set to 700 rpm.
  • Total plasma kallikrein activity levels in samples were measured using the Fluorometric SensoLyte Rh110 Plasma Kallikrein Activity Assay Kit (Anaspec Cat No: AS-72255).
  • a chloroform pretreatment was performed to inhibit C1-Inhibitor activity by mixing an equal volume of cold chloroform with K2EDTA NHP plasma in a 96-well plate. The plate was then centrifuged for 5 min at 4° C. at 16,000 ⁇ g and 10 uL of the treated plasma was carefully collected from the top layer.
  • the 10 uL of pretreated plasma was mixed with 30 uL of assay buffer, 10 uL of Plasma Prekallikrein Activator and 50 uL of substrate, all of which are provided in the kit and prepared according to kit protocol.
  • the slope of the linear portion of the kinetic fluorometric readout for a given post-treatment plasma sample is compared to the slope of the pre-treatment plasma sample from the same animal to calculate % basal.
  • Plasma kallikrein levels in non-human primates were measured by an immunoassay using an electrochemiluminescence detection platform by MesoScale Discovery (MSD).
  • MSD MesoScale Discovery
  • a 96-well MSD standard plate (Cat. No: L15XA) was coated with 40 ⁇ L of a mouse monoclonal capture antibody for kallikrein (LS-Bio, LS-C38308) at a concentration of 1 pg/mL in PBS over night at 4° C.
  • the wells were washed and then blocked with 150 ⁇ L of 3% Blocker-A (MSD, Cat. No: R93AA) and incubated for 1 hour at room temperature on a shaker set to 700 rpm.
  • NHP samples for the determination of kallikrein concentration along with a NHP kallikrein standard of a known concentration, made in-house, were added to the wells and incubated for 2 hours at room temperature on a shaker set to 700 rpm. Both samples and standards were diluted in 1% Blocker-A with 0.05% Tween20.
  • the Evans Blue vascular permeability assay is an established model of edema and vascular leakage that can be used as a model in the study of HAE (see, e.g., Bhattacharjee et al., 2013).
  • the assay is based on the injection of Evans Blue, an albumin-binding dye, in a test animal, typically a mouse. Under physiologic conditions the endothelium is impermeable to albumin, so the albumin-bound Evans blue remains restricted within blood vessels.
  • extravasation of Evans Blue can be readily observed qualitatively e.g., by the presence of blue color in the ears, feet, and nose of mice after intravenous injection, or quantitatively by measurement of dye incorporated into tissue, e.g., intestine.
  • vascular permeability was induced using a 2.5 mg/kg intraperitoneal injection of the angiotensin converting enzyme (ACE) inhibitor captopril.
  • ACE angiotensin converting enzyme
  • the animals were euthanized 15 minutes after this injection and evaluated for dye extravasation into the colon by optical density (OD) at the absorbance of 600 nm via the Clariostar plate reader (BMG LabTech). Liver and serum were collected to quantify huKLKB1 gene editing and kallikrein protein, respectively.
  • the top performing guide RNAs and corresponding editing data from Set 2 are marked with an asterisk (*) in Table 7A and 7B.
  • PHH and PCH Selected guide sequences targeting KLKB1 were prepared as sgRNAs and further evaluated in PHH and PCH.
  • PHH and PCH Gibco, Lot Hu8298 were prepared and transfected with RNP as described in Example 1.
  • the cells were lysed at 48 and 72 hours, respectively, post-treatment for NGS analysis as described in Example 1.
  • Table 8A and FIGS. 2 A- 2 B show percent editing in PHH and Table 8B and FIGS. 2 C- 2 D in PCH.
  • Three PHH lots (Hu8296, Hu8300, and Hu8284) were individually plated as described in Example 1 and incubated at 37° C., 5% CO2 for 24 hours prior to lipofection.
  • a mixture of 6.88 ⁇ L of 10 ⁇ M sgRNA guide and 4.5 ⁇ L of 500 ng/ ⁇ l Cas9 mRNA was prepared in a total volume of 11.4 ⁇ l water.
  • a lipofection reagent as described in Example 1 was thawed to room temperature.
  • the guide/Cas9 mRNA mix was sequentially added with 4.8 ⁇ L of 50 mM sodium citrate/200 mM NaCl (pH 5), 4.8 ⁇ L of lipofection reagent, and 54 ⁇ L of molecular grade water, to prepare a total volume 75 ⁇ L per sample.
  • the lipofection sample was pre-incubated with media, William's E or Cellartis Power Primary HEP Medium (Takada, Cat. Y20020), containing 3% FBS or cynomolgus serum for 10 min at 37° C. prior to addition to cells.
  • Cells were transfected with 10 ⁇ L of prepared lipofection sample containing 300 ng of Cas9 mRNA and 302 ng guide sgRNA.
  • the cells were lysed 72 hours post-transfection for NGS analysis was conducted as described in Example 1.
  • Table 8C and FIGS. 3 A- 3 B show percent editing and secreted KLKB1 protein levels based on transfection of three PHH lots. Twenty guides were compared in pairs of PHH lots, and determined to be highly correlated (Spearman R>0.8) as shown in FIGS. 3 C- 3 E .
  • PHLs Primary human hepatocytes
  • Percent editing was determined for sgRNAs comprising guide sequences of Table 1 for two primer sets. The average percent editing for each guide in the two data sets is shown in Table 9A and FIGS. 4 A- 4 B .
  • PCHs Primary cynomolgus hepatocytes
  • Cas9 mRNA and sgRNA as described in Example 1 using increasing amounts of prepared lipofection sample to assay a dose responsive effect.
  • the cells were lysed 72 post transfection and NGS analysis was conducted as described in Example 1.
  • Percent editing was determined for sgRNAs comprising guide sequences in Table 1 using two primer sets for amplification and detection of indels. The average percent editing for each guide in the two data sets is shown in Table 9B and FIGS. 4 C- 4 D .
  • Modified sgRNAs targeting human KLKB1 and the cynomolgus matched sgRNA sequences were tested in PHH and PCH in a dose response assay, using 16 guides from the PHH guide screen described in Example 2.2.
  • Lipofection samples including Cas9 mRNA and sgRNAs were prepared as described in Example 2.2.
  • Primary human and cynomolgus hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37° C., 5% CO2 for 48 hours prior to treatment with lipofection samples. Lipofection samples were incubated in Cellartis Power Primary HEP Medium (Takada, Cat. Y20020) containing 3% FBS at 37° C. for 10 minutes.
  • the lipofection samples were added to the human or cynomolgus hepatocytes in a 4-point dose response assay.
  • the PHH were lysed 120 hours post-transfection and the PCH were lysed 168 hrs post-transfection and gDNAs were subjected to quantified PCR for NGS analysis as described in Example 1.
  • the indel frequency of sgRNAs at concentrations 0.4 nM, 3.3 nM, 30 nM, and 90 nM in PHH cells is shown in Table 10 and FIGS. 5 A- 5 B .
  • Secreted KLKB1 protein levels of the sgRNAs determined by ELISA is shown in Table 10 and FIGS. 5 C- 5 D .
  • the indel frequency of sgRNAs at concentrations 0.4 nM, 10 nM, 30 nM, and 90 nM in PCH cells is shown in Table 11 and FIGS. 5 E- 5 F
  • Secreted KLKB1 protein levels of the sgRNAs determined by ELISA is shown in Table 11 and FIGS. 5 G- 5 H .
  • Indel frequency and secreted KLKB1 protein levels were shown to be inversely correlated in both PHH and PCH as shown in FIGS. 5 I- 5 J .
  • Lipid nanoparticle (LNP) formulations of sgRNAs targeting human KLKB1 sgRNA sequences were tested in PHH and PCH in a dose response assay.
  • the LNPs were formulated as described in Example 1.
  • the final LNPs were characterized to determine the encapsulation efficiency, polydispersity index, and average particle size according to the analytical methods provided above.
  • Example 1 Primary human and cynomolgus hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37° C., with 5% CO2 for 24 hours prior to treatment with LNPs. LNPs were incubated in media containing 3% FBS at 37° C. for 10 minutes. Post-incubation the LNPs were added to the human or cynomolgus hepatocytes in a 7 point 3-fold dose response curve. The cells were lysed 72 hours post-transfection and gDNAs were subjected to quantified PCR for NGS analysis as described in Example 1.
  • the indel frequency of sgRNAs at concentrations, 0.04 nM, 0.13 nM, 0.40 nM, 1.19 nM, 3.58 nM, 10.75 nM, and 32.25 nM are shown in Table 12 and corresponding dose response curves in FIGS. 6 A-B for PHH and FIGS. 6 C-D for PCH.
  • Indel Secreted Indel Secreted GUIDE ID (nM) Freq SD KLKB1 SD
  • Freq SD KLKB1 SD G012253
  • 32.25 0.91 0.00 ⁇ 1.38 0.22 0.90 0.01 ⁇ 1.58 0.10 10.75 0.89 0.00 ⁇ 1.30 0.08 0.89 0.01 ⁇ 1.57 0.07 3.58 0.89 0.02 ⁇ 1.23 0.19 0.84 0.00 ⁇ 1.39 0.07 1.19 0.83 0.01 ⁇ 0.48 0.11 0.55 0.03 5.01 0.24 0.40 0.64 0.04 2.49 0.07 0.18 0.02 22.35 0.29 0.13 0.34 0.03 9.34 0.01 0.05 0.01 27.18 0.07 0.04 0.12 0.01 15.04 0.17 0.01 0.00 27.18 0.07 G012259 32.25 0.84 0.01 ⁇ 1.12 0.21 0.95 0.01 ⁇ 1.57 0.07 10.75 0.86 0.
  • Lipid nanoparticle (LNP) formulations of modified sgRNAs were tested in PHH and PCH in a dose response assay.
  • Example 3.2 The LNPs described in Example 3.2 were used in this study.
  • the LNPs were added to the human or cynomolgus hepatocytes in a 7 point, 3-fold dose response curve.
  • the cells were lysed 72 hours post-transfection and gDNAs were subjected to quantified PCR for NGS analysis as described in Example 1.
  • KLKB1 protein analysis the cells were lysed at day 8 post-transfection and whole cell extracts were subject to western blotting analysis as described in Example 1.
  • the indel frequency of sgRNAs at concentrations, 0.04 nM, 0.13 nM, 0.40 nM, 1.19 nM, 3.58 nM, 10.75 nM, and 32.25 nM for PHH and PCH is shown in Table 13 and dose response curve data is illustrated in FIGS. 7 A and 7 B .
  • Secreted KLKB1 protein levels of the sgRNAs determined by ELISA is shown in Table 13 and FIG. 7 C for PHH and FIG. 7 D for PCH.
  • Indel secreted conc. Indel secreted GUIDE ID (nM) Freq SD KLKB1 SD (nM) Freq SD KLKB1 SD G012260 32.25 0.88 0.03 ⁇ 0.07 0.04 32.25 0.97 0.01 ⁇ 1.42 0.04 10.75 0.86 0.03 0.05 0.09 10.75 0.98 0.01 ⁇ 1.32 0.03 3.58 0.82 0.08 0.03 0.04 3.58 0.95 0.00 ⁇ 1.41 0.04 1.19 0.81 0.07 0.06 0.00 1.19 0.68 0.07 ⁇ 0.08 0.03 0.40 0.84 0.00 0.14 0.00 0.40 0.26 0.04 14.46 1.24 0.13 0.79 0.04 0.55 0.01 0.13 0.06 0.01 24.37 0.74 0.04 0.73 0.02 1.80 0.01 0.04 0.01 0.00 25.32 0.79 G012267 32.25 0.88 0.05 0.11 0.02 32.
  • KLKB1 protein analysis PHH were transfected with human KLKB1 guide, G012267, and lysed at day 8 post-transfection and whole cell extracts were subject to western blotting analysis as described in Example 1. Human KLKB1 protein levels across the 7-point dose response curve were compared to untreated control and normalized to GAPDH is shown in FIG. 7 E .
  • Example 1 The biochemical method described in Example 1 was used to determine potential off-target genomic sites cleaved by Cas9 targeting KLKB1. Guides selected based on results from experiments described above were tested for potential off-target genomic cleavage sites. Sixteen KLKB1 targeting guides were evaluated for off-target genomic cleavage against genomic DNA from HEK293 cells at a 16 nM concentration (ATCC, Cat. #CRL-1573).
  • KLKB1 guide G012267 and control guides with known off-target profiles were included in experiments (G000644 targeted to EMX1 for which 281 off-target sites have been detected, G00045 targeted to VEGFA for which 6602 off-target sites have been detected); Frock et al., 2015, Tsai et al., 2015) were evaluated for off-target genomic cleavage against genomic DNA from pooled human PBMC at a 64 nM concentration.
  • the number of potential off-target sites detected in the biochemical assay using genomic DNA from HEK 293 cells are shown in Table 14A.
  • the number of potential off-target sites detected in the biochemical assay using genomic DNA from PBMCs are shown in Table 14B.
  • the percent of off-target sites detected by the assay performed herein as compared to the number of off-target sites noted in the literature for the EMX1 guide and the VEGFA guide are noted.
  • KLKB1 guides were selected based on experiments above for further evaluation.
  • the targeted off-target approach described in Example 1 was used to evaluate the target indel activity for the potential off-targets associated with these guides.
  • the off-target sites tested in the experiment were identified via the biochemical assay experiments described in Example 4 or in silico prediction as described in Example 1.
  • sgRNAs targeting human KLKB1 were evaluated.
  • PHH were cultured and transfected with LNPs comprising Cas9 mRNA and sgRNA of interest (e.g., a sgRNA having potential off-target sites for evaluation) as described in Example 1.
  • LNPs comprising Cas9 mRNA and sgRNA of interest (e.g., a sgRNA having potential off-target sites for evaluation) as described in Example 1.
  • Genomic DNA was isolated from the PHH and subjected to NGS and targeted off-target analysis as described in Example 1.
  • Humanized mice that express human KLKB1 protein (Hu KLKB1 mouse model) were used in this study.
  • the Hu KLKB1 mouse model comprises a humanized KLKB1 locus in which the region from start codon to stop codon of mouse KLKB1 was replaced with the corresponding human genomic sequence.
  • LNPs containing modified sgRNAs (G12260, G12267, G12293, G12303, and G12321) and the Cas9 mRNA were dosed via the lateral tail vein at 0.3 mg/kg based on total RNA cargo in a volume of 10 ml per kilogram body weight.
  • the final LNPs were characterized to determine the encapsulation efficiency, polydispersity index, and average particle size according to the analytical methods described in Example 1.
  • mice were euthanized, and liver tissue was collected for DNA extraction. The tissues were lysed using a Zymo Research Bashing Bead Lysis Rack, and DNA was extracted using the Zymo Research DNA Extraction Kit according to the manufacturer's protocol. The extracted DNA was subject to PCR to be submitted for sequencing.
  • Serum human KLKB1 protein levels, pre- and post-dose, were measured using the ELISA assay as described in Example 1. The results are shown in Table 16B and FIG. 8 B .
  • Serum human KLKB1 protein levels from the samples were measured using the electrochemiluminescence-based array (MSD) as described in Example 1 and compared to baseline levels. The results are shown in Table 17 and FIG. 8 C .
  • KLKB1 mRNA levels for each sequence were measured by quantitative PCR as described in Example 1 and shown in Table 18 and FIG. 8 D . Protein reduction was confirmed by western blot analysis as described in Example 1.
  • mice were euthanized. Liver tissue and blood was processed as described in Example 6 for sequencing and ELISA analysis.
  • Table 19 and FIGS. 9 A- 9 D show levels of KLKB1 editing, serum prekallikrein protein (detected using an ELISA that detects both prekallikrein and kallikrein) (ug/ml), prekallikrein protein as percent of KLKB1 protein level in control TSS in treated mice, and the correlation of percent liver editing to percent prekallikrein protein, respectively.
  • G012323 and G012253 guides were tested; however, editing was not detected due to a failure of the NGS method.
  • mice were euthanized. Liver tissue was processed as described in Example 6 for DNA sequencing. Blood was processed as described in Example 6 and secreted human prekallikrein was measured via an ELISA, which detects prekallikrein and kallikrein (also, called total kallikrein), as described in Example 1.
  • RNA analysis liver tissue was lysed using a Zymo Research Bashing Bead Lysis Rack, and RNA was extracted using the Qiagen RNeasy Mini Kit (Qiagen, Cat. 74106) according to the manufacturer's protocol. RNA was quantified using a Nanodrop 8000 (ThermoFisher Scientific, Cat. ND-8000-GL). RNA samples were stored at ⁇ 20° C. prior to use.
  • the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen, Cat. 11732-088) was used to create the PCR reactions. Quantitative PCR probes targeting Hu KLKB1 and internal control Ms PPIB were used in the reactions. The quantitative PCR assay was performed according to the manufacturer's specifications, scaled to the appropriate reaction volume, as well as using the Hu KLKB1 and Ms PPIB probes specified above. The StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Cat. 4376600) was used to perform the real-time PCR reaction and transcript quantification according to the manufacturer's protocol.
  • Hu KLKB1 mRNA was quantified using a standard curve starting at 20 ng/uL of pooled mRNA from the vehicle control group, with five further 3-fold dilutions ending at 0.06 ng/uL. Ct values were determined from the StepOnePlus Real-Time PCR System. Reduction of total secreted human prekallikrein protein for cells treated with KLKB1 reagents was determined by ELISA as described in Example 1.
  • Table 20 and FIG. 10 show percent editing, serum prekallikrein levels as a percent of TSS vehicle control treated mice, and mRNA transcript levels as a percent of TSS vehicle control treated animals.
  • LNPs containing a modified KLKB1 targeting sgRNA (G12267) and the Cas9 mRNA were dosed via the lateral tail vein at 0.03 mg/kg, 0.1 mg/kg, or 0.3 mg/kg based on total RNA cargo in a volume of 10 ml per kilogram body weight or vehicle control (TSS).
  • TSS vehicle control
  • prekallikrein and kallikrein also, called total kallikrein
  • the vascular leakage assay was performed as described in Example 1. At necropsy, liver tissue was collected and DNA extracted as described in Example 6 to measure KLKB1 editing. For dye quantification in the vascular leakage model, colon tissue was collected and processed as described in Example 1.
  • mice were dosed with modified KLKB1 targeting sgRNA (G12267) and the Cas9 mRNA or a non-targeting sgRNA were dosed via the lateral tail vein at 0.1 mg/kg or 0.3 mg/kg based on total RNA cargo in a volume of 10 ml per kilogram body weight.
  • the durability of the dose response was observed where increased editing, decreased protein levels, and decreased vascular leakage levels were maintained for the length of the study.
  • Each LNP formulation contained a polyadenylated Cas9 mRNA (comprising SEQ ID NO: 516) and gRNA (G013901, a cynomolgus specific KLKB1 guide RNA) with an mRNA:gRNA ratio of 2:1 by weight. Animals were dosed at 1.5, 3, or 6 mg per kg doses based on total RNA cargo. Indel formation (percent editing) was measured by NGS. Total kallikrein activity and serum kallikrein protein level were measured as described in Example 1.
  • Tests of select NHP serum samples found no observed impact on coagulation pathway biomarkers with KLKB1 knockout in NHPs at weeks 10 or 15 (based on measuring prothrombin, APTT, and fibrinogen (all at week 10), and Factor XII (at week 15)) when comparing TSS buffer control groups to treated groups.
  • the NHP study was repeated to evaluate KLKB1 total kallikrein protein expression, and total kallikrein activity levels in cynomolgus monkeys using guide G012267 which includes a guide sequence fully complementary to human KLKB1.
  • the guide sequence of G012267 has one nucleotide difference when compared to the G013901 which has a guide sequence fully complementary to cynomolgus KLKB1.
  • Total kallikrein activity and serum kallikrein protein levels were measured using the methods described in Example 1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Fodder In General (AREA)
  • Medicinal Preparation (AREA)
US17/882,099 2020-02-07 2022-08-05 Compositions and Methods for Kallikrein (KLKB1) Gene Editing Pending US20230295587A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/882,099 US20230295587A1 (en) 2020-02-07 2022-08-05 Compositions and Methods for Kallikrein (KLKB1) Gene Editing
US18/362,675 US20240018496A1 (en) 2020-02-07 2023-07-31 Compositions and Methods for Kallikrein (KLKB1) Gene Editing

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US202062971906P 2020-02-07 2020-02-07
US202062981965P 2020-02-26 2020-02-26
US202063019076P 2020-05-01 2020-05-01
PCT/US2021/016730 WO2021158858A1 (en) 2020-02-07 2021-02-05 Compositions and methods for kallikrein ( klkb1) gene editing
US17/882,099 US20230295587A1 (en) 2020-02-07 2022-08-05 Compositions and Methods for Kallikrein (KLKB1) Gene Editing

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/016730 Continuation WO2021158858A1 (en) 2020-02-07 2021-02-05 Compositions and methods for kallikrein ( klkb1) gene editing

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/362,675 Continuation US20240018496A1 (en) 2020-02-07 2023-07-31 Compositions and Methods for Kallikrein (KLKB1) Gene Editing

Publications (1)

Publication Number Publication Date
US20230295587A1 true US20230295587A1 (en) 2023-09-21

Family

ID=74873798

Family Applications (2)

Application Number Title Priority Date Filing Date
US17/882,099 Pending US20230295587A1 (en) 2020-02-07 2022-08-05 Compositions and Methods for Kallikrein (KLKB1) Gene Editing
US18/362,675 Pending US20240018496A1 (en) 2020-02-07 2023-07-31 Compositions and Methods for Kallikrein (KLKB1) Gene Editing

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/362,675 Pending US20240018496A1 (en) 2020-02-07 2023-07-31 Compositions and Methods for Kallikrein (KLKB1) Gene Editing

Country Status (14)

Country Link
US (2) US20230295587A1 (ja)
EP (1) EP4100528A1 (ja)
JP (1) JP2023512758A (ja)
KR (1) KR20220139352A (ja)
CN (1) CN115362256A (ja)
AU (1) AU2021216451A1 (ja)
BR (1) BR112022015380A2 (ja)
CA (1) CA3169813A1 (ja)
CL (1) CL2022002095A1 (ja)
CO (1) CO2022012196A2 (ja)
IL (1) IL295280A (ja)
MX (1) MX2022009658A (ja)
TW (1) TW202146030A (ja)
WO (1) WO2021158858A1 (ja)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230158059A1 (en) * 2021-10-01 2023-05-25 Adarx Pharmaceuticals, Inc. Prekallikrein-modulating compositions and methods of use thereof
WO2023086953A1 (en) * 2021-11-11 2023-05-19 Beam Therapeutics Inc. Compositions and methods for the treatment of hereditary angioedema (hae)
TW202346586A (zh) * 2022-01-28 2023-12-01 大陸商上海舶望製藥有限公司 用於抑制前激肽釋放酶（pkk）蛋白表達的組合物和方法
TW202405169A (zh) * 2022-07-08 2024-02-01 美商英特利亞醫療公司 活體內編輯ｋｌｋｂ１之方法
WO2024012435A1 (en) * 2022-07-11 2024-01-18 CorrectSequence Therapeutics Co., Ltd Gene editing systems and methods for treating hereditary angioedema

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3320922A1 (en) * 2011-06-10 2018-05-16 Ionis Pharmaceuticals, Inc. Methods for modulating kallikrein (klkb1) expression
EP3715457A3 (en) * 2013-08-28 2020-12-16 Ionis Pharmaceuticals, Inc. Modulation of prekallikrein (pkk) expression
ES2774968T3 (es) * 2013-12-19 2020-07-23 Novartis Ag Lípidos y composiciones lipídicas para la administración de agentes activos
EP3862362A3 (en) * 2014-05-01 2021-10-27 Ionis Pharmaceuticals, Inc. Conjugates of modified antisense oligonucleotides and their use for modulating pkk expression
TW202336231A (zh) * 2015-05-06 2023-09-16 美商阿尼拉製藥公司 第十二因子（哈格曼因子）（Ｆ１２）、激肽釋放素Ｂ、血漿（夫列契因子）１（ＫＬＫＢ１）及激肽原１（ＫＮＧ１）ｉＲＮＡ組成物及其使用方法
WO2019010342A1 (en) * 2017-07-07 2019-01-10 Alnylam Pharmaceuticals, Inc. METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH THE CONTACT ACTIVATION PATHWAY USING FIBER XII-TARGETING RNAI COMPOSITIONS (FACTOR HAGEMAN) (F12)
EP4054651A1 (en) * 2019-11-08 2022-09-14 Regeneron Pharmaceuticals, Inc. Crispr and aav strategies for x-linked juvenile retinoschisis therapy

Also Published As

Publication number Publication date
BR112022015380A2 (pt) 2022-09-27
MX2022009658A (es) 2022-10-27
TW202146030A (zh) 2021-12-16
AU2021216451A1 (en) 2022-09-29
JP2023512758A (ja) 2023-03-29
EP4100528A1 (en) 2022-12-14
CL2022002095A1 (es) 2023-03-10
US20240018496A1 (en) 2024-01-18
IL295280A (en) 2022-10-01
CO2022012196A2 (es) 2022-09-09
CA3169813A1 (en) 2021-08-12
WO2021158858A1 (en) 2021-08-12
CN115362256A (zh) 2022-11-18
KR20220139352A (ko) 2022-10-14

Similar Documents

Publication Publication Date Title
US20230295587A1 (en) Compositions and Methods for Kallikrein (KLKB1) Gene Editing
US20210222173A1 (en) Compositions and Methods for Lactate Dehydrogenase (LDHA) Gene Editing
US20210163943A1 (en) Compositions and Methods for Hydroxyacid Oxidase 1 (HAO1) Gene Editing for Treating Primary Hyperoxaluria Type 1 (PH1)
US20200248180A1 (en) Compositions and Methods for TTR Gene Editing and Treating ATTR Amyloidosis
US20200289628A1 (en) Compositions and methods for expressing factor ix
US20200270617A1 (en) Compositions and methods for transgene expression from an albumin locus
US20240002820A1 (en) Polynucleotides, Compositions, and Methods for Genome Editing Involving Deamination
TW202102529A (zh) 用於多肽表現之多核苷酸、組合物及方法
CA3134544A1 (en) Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof
US20230383253A1 (en) Lymphocyte Activation Gene 3 (LAG3) Compositions and Methods for Immunotherapy
US20230374456A1 (en) T-Cell Immunoglobulin and Mucin Domain 3 (TIM3) Compositions and Methods for Immunotherapy
US20230383252A1 (en) Natural Killer Cell Receptor 2B4 Compositions and Methods for Immunotherapy
WO2023028471A1 (en) Programmed cell death protein 1 (pd1) compositions and methods for cell-based therapy
KR20230084491A (ko) 듀시엔형 근이영양증의 치료를 위한 조성물 및 방법
TW202334396A (zh) 用於免疫療法之ｃｄ３８組成物及方法

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED