US20210038587A1 - Methods and compositions for treating non-erk mapk pathway inhibitor-resistant cancers - Google Patents

Abstract

The present invention provides, inter alia, methods, pharmaceutical compositions, and kits for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. Also provided are methods for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor and methods for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
• This application claims benefit to and is a continuation application of U.S. patent application Ser. No. 15/161,137, filed May 20, 2016. The '137 application is a continuation in part of PCT international application no. PCT/US2014/071749, filed Dec. 19, 2014, which claims benefit of U.S. Patent Application Ser. No. 61/919,551, filed on Dec. 20, 2013 which, applications are incorporated by reference herein in their entireties.
FIELD OF INVENTION
• The present invention provides, inter alia, methods, pharmaceutical compositions, and kits for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING
• This application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing text file “0375608.txt”, file size of 356 KB, created on Dec. 18, 2014. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
BACKGROUND OF THE INVENTION
• Drug inhibitors that target components of the mitogen-activated protein kinases (MAPK) signaling pathway show clinical efficacy in a variety of cancers, particularly those bearing mutations in the BRAF protein kinase. Both RAF and MEK inhibitors are approved for single-agent use in advanced metastatic BRAF mutant melanoma. Either alone or in combination, BRAF and MEK inhibitor activity is unpredictable in other cancers, with promising efficacy in BRAF mutant thyroid and lung cancer, but only marginal activity in BRAF mutant colorectal cancer.
• As with other targeted therapies, patterns of disease response to RAF and MEK inhibitors appear to be influenced by the intrinsic genetic heterogeneity present in the cancers where the drugs are used. For instance, it has been shown that certain genetic alterations, including PTEN and other changes that activate the PI3K cell growth signaling pathway, may predict a poor initial response, and/or relatively rapid progression, in BRAF mutant melanoma treated with the RAF inhibitor vemurafenib. Likewise, direct mutations in MEK gene loci appear to emerge in tumors that have progressed following either BRAF, MEK, or combined drug treatment. Several additional examples, from RAS and RAF gene amplification and splicing mutations, suggest that acquired drug resistance is produced when oncogenic pleiotropy encounters the selective pressure of targeted drug treatment.
• In view of the foregoing, there is a need for novel targeted agents that would ideally inhibit diverse nodes of oncogenic pathways, and also be effective in combinations by inducing a burden of selective pressures that exceeds the adaptive capacity of diverse cancer genomes. The present application is directed to meeting these and other needs.
SUMMARY OF THE INVENTION
• One embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• Another embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject. The method comprises:
• • (a) identifying a subject with cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and
  • (b) administering to the subject with said refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
• A further embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject, which cancer is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• Another embodiment of the present invention is a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor. The method comprises:
• • (a) obtaining a biological sample from the subject; and
  • (b) screening the sample to determine whether the subject has one or more of the following markers:
    • (i) a switch between RAF isoforms,
    • (ii) upregulation of receptor tyrosine kinase (RTK) or NRAS signaling,
    • (iii) reactivation of mitogen activated protein kinase (MAPK) signaling,
    • (iv) the presence of a MEK activating mutation,
    • (v) amplification of mutant BRAF,
    • (vi) STAT3 upregulation,
    • (vii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity,
      wherein the presence of one or more of the markers confirms that the subject's cancer is refractory or resistant to BRAF and/or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
• A further embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• Another embodiment of the present invention is a kit for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The kit comprises any of the pharmaceutical compositions according to the present invention packaged together with instructions for its use.
• Another embodiment of the present invention is a method for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor. The method comprises contacting the cancer cell with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient for phosphorylation of RSK in the cancer cell to be inhibited.
• Another embodiment of the present invention is a method of treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.
• Another embodiment of the present invention is a composition for treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle.
BRIEF DESCRIPTION OF THE DRAWINGS
• The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
• FIG. 1A-FIG. 1C show the progress of a dose escalation study in a human malignant melanoma cell line (A375 cells) for month 1. Various treatments (trametinib (a type 2 MEK inhibitor), dabrafenib (a BRAF inhibitor), and BVD-523 (an ERK1/2 inhibitor)) are as labeled.
• FIG. 2A-FIG. 2H show the results of a proliferation assay that tracks changes in sensitivity to the escalated agent(s) at month 1. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, “dabrafenib” refers to the cells that have been treated with the highest dose of dabrafenib from month 1 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs. FIG. 2A, FIG. 2C and FIG. 2G are normalized to control, whereas FIG. 2D, FIG. 2F and FIG. 2H show the raw data.
• FIG. 3A-FIG. 3D show the progress of a dose escalation study in A375 cells for month 2. Various treatments (trametinib, dabrafenib, and BVD-523) are as labeled.
• FIG. 4A-FIG. 4H show the results of a proliferation assay that tracks changes in sensitivity to the escalated agent(s) at month 2. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, “dabrafenib” refers to the cells that have been treated with the highest dose of dabrafenib from month 2 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs. FIG. 4A, FIG. 4C and FIG. 4G are normalized to control, whereas FIG. 4D, FIG. 4F and FIG. 4H show the raw data.
• FIG. 5A-FIG. 5H show only the parental and BVD-523 cell line data from FIG. 4A-FIG. 4H. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled. FIG. 5A, FIG. 5C and FIG. 5G are normalized to control, whereas FIG. 5D, FIG. 5F and FIG. 5H show the raw data.
• FIG. 6A-FIG. 6D show the progress of the dose escalation study in a human malignant cell line (A375 cells) for month 3. Various treatments (trametinib, dabrafenib, and BVD-523) are as labeled.
• FIG. 7 is a histogram showing the results of a proliferation assay as applied to cells grown in the DMSO control wells from the dose escalation assay.
• FIG. 8A-FIG. 8D are a set of line graphs showing proliferation assays for month 3 of the study. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, “dabrafenib” refers to the cells that have been treated with the highest dose of dabrafenib from month 3 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs.
• FIG. 9A-FIG. 9D show only the parental, dabrafenib, and BVD-523 cell line data from FIG. 8A-FIG. 8D.
• FIG. 10A is a dose matrix showing % inhibition of the trametinib/dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. FIG. 10B is a dose matrix showing excess over Bliss for the trametinib/dabrafenib combination. FIG. 10C and FIG. 10D show % viability relative to DMSO only treated controls for dabrafenib and trametinib single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 10E shows % viability relative to DMSO only treated controls for dabrafenib and trametinib combination treatments in A375 cells using the Alamar Blue cell viability assay.
• FIG. 11A is a dose matrix showing % inhibition of the trametinib/dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 11B is a dose matrix showing excess over Bliss for the trametinib/dabrafenib combination. FIG. 11C and FIG. 11D show % viability relative to DMSO only treated controls for dabrafenib and trametinib single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 11E shows % viability relative to DMSO only treated controls for dabrafenib and trametinib combination treatments in A375 cells using the CellTiter-Glo cell viability assay.
• FIG. 12A is a dose matrix showing % inhibition of the BVD-523/dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. FIG. 12B is a dose matrix showing excess over Bliss for the BVD-523/dabrafenib combination. FIG. 12C and FIG. 12D show % viability relative to DMSO only treated controls for dabrafenib and BVD-523 single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 12E shows % viability relative to DMSO only treated controls for dabrafenib and BVD-523 combination treatments in A375 cells using the Alamar Blue cell viability assay.
• FIG. 13A is a dose matrix showing % inhibition of the BVD-523/dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 13B is a dose matrix showing excess over Bliss for the BVD-523/dabrafenib combination. FIG. 13C and FIG. 13D show % viability relative to DMSO only treated controls for dabrafenib and BVD-523 single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 13E shows % viability relative to DMSO only treated controls for dabrafenib and BVD-523 combination treatments in A375 cells using the CellTiter-Glo cell viability assay.
• FIG. 14A is a dose matrix showing % inhibition of the trametinib/BVD-523 combination in A375 cells using the Alamar Blue cell viability assay. FIG. 14B is a dose matrix showing excess over Bliss for the trametinib/BVD-523 combination. FIG. 14C and FIG. 14D show % viability relative to DMSO only treated controls for BVD-523 and trametinib single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 14E shows % viability relative to DMSO only treated controls for BVD-523 and trametinib combination treatments in A375 cells using the Alamar Blue cell viability assay.
• FIG. 15A is a dose matrix showing % inhibition of the trametinib/BVD-523 combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 15B is a dose matrix showing excess over Bliss for the trametinib/BVD-523 combination. FIG. 15C and FIG. 15D show % viability relative to DMSO only treated controls for BVD-523 and trametinib single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 15E shows % viability relative to DMSO only treated controls for BVD-523 and trametinib combination treatments in A375 cells using the CellTiter-Glo cell viability assay.
• FIG. 16A-FIG. 16D are a set of images showing Western blot analysis of MAPK signaling in A375 cells after a 4 hour treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and Trametinib (Tram). 40 μg of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIG. 16A and FIG. 16B show results from duplicate samples. Similarly, FIG. 16C and FIG. 16D also show results from duplicate samples. In FIG. 16A and FIG. 16B, pRSK1 had a relatively weak signal in A375 cells compared to other markers. A different pRSK1-S380 antibody from Cell Signaling (cat. #11989) was tested but did not give a detectable signal (data not shown). In FIG. 16C and FIG. 16D, pCRAF-338 gave a minimal signal.
• FIG. 17A-FIG. 17D are a set of images showing Western blot analysis of MAPK signaling in a human colorectal carcinoma cell line (HCT116 cells) after a 4 hour treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and Trametinib (Tram). 40 μg of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIG. 17A and FIG. 17B show results from duplicate samples. Similarly, FIG. 17C and FIG. 17D also show results from duplicate samples. In FIG. 17A and FIG. 17B, pRSK1 levels appear to be very low in HCT116 cells, and in FIG. 17C and FIG. 17D, pCRAF-338 signal was also very weak.
• FIG. 18A-FIG. 18D are a set of images showing Western blot analysis of cell cycle and apoptosis signaling in A375 melanoma cells after a 24 hour treatment with various concentrations (in nM) of BVD-523 (“BVD523”), trametinib (“tram”) and/or dabrafenib (“Dab”) as labelled. 50 μg of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIG. 18A and FIG. 18B show results from duplicate samples. Similarly, FIG. 18C and FIG. 18D also show results from duplicate samples. In FIG. 18A and FIG. 18B, no band of a size corresponding to cleaved PARP (89 kDa) was apparent.
• FIG. 19 shows that BVD-523 can treat acquired resistance to targeted drugs in-vivo. A patient-derived line, ST052C, was isolated from a BRAFV600E melanoma patient that progressed following 10 months of therapy with MAPK-pathway directed therapies. Treated ex vivo, ST052C exhibited acquired cross-resistance to dabrafenib at 50 mg/kg BID. Meanwhile, BVD-523 was effective in ST052C as a single-agent at 100 mg/kg BID.
• FIG. 20 is a flowchart showing the dose escalation protocol used herein.
• FIG. 21 shows a schematic of the mitogen-activated protein kinases (MAPK) pathway.
• FIG. 22A-FIG. 22E show the results of single agent proliferation assays. Proliferation results are shown for treatment with BVD-523 (FIG. 22A), SCH772984 (FIG. 22B), Dabrafenib (FIG. 22C), Trametinib (FIG. 22D), and Paclitaxel (FIG. 22E).
• FIG. 23A-FIG. 23O show the results of the combination of BVD-523 and Dabrafenib. FIG. 23A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 23B-FIG. 23C show the results of single agent proliferation assays for the combination in FIG. 23A. FIG. 23D shows Loewe excess for the combination in FIG. 23A and FIG. 23E shows Bliss excess for the combination in FIG. 23A. FIG. 23F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 1 cells. FIG. 23G-FIG. 23H show the results of single agent proliferation assays for the combination in FIG. 23F. FIG. 23I shows Loewe excess for the combination in FIG. 23F and FIG. 23J shows Bliss excess for the combination in FIG. 23F. FIG. 23K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 2 cells. FIG. 23L-FIG. 23M show the results of single agent proliferation assays for the combination in FIG. 23K. FIG. 23N shows Loewe excess for the combination in FIG. 23K and FIG. 23O shows Bliss excess for the combination in FIG. 23K.
• FIG. 24A-FIG. 24O show the results of the combination of SCH772984 and Dabrafenib. FIG. 24A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 24B-FIG. 24C show the results of single agent proliferation assays for the combination in FIG. 24A. FIG. 24D shows Loewe excess for the combination in FIG. 24A and FIG. 24E shows Bliss excess for the combination in FIG. 24A. FIG. 24F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 1 cells. FIG. 24G-FIG. 24H show the results of single agent proliferation assays for the combination in FIG. 24F. FIG. 24I shows Loewe excess for the combination in FIG. 24F and FIG. 24J shows Bliss excess for the combination in FIG. 24F. FIG. 24K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 2 cells. FIG. 24L-FIG. 24M show the results of single agent proliferation assays for the combination in FIG. 24K. FIG. 24N shows Loewe excess for the combination in FIG. 24K and FIG. 24O shows Bliss excess for the combination in FIG. 24K.
• FIG. 25A-FIG. 25O show the results of the combination of Trametinib and Dabrafenib. FIG. 25A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 25B-FIG. 25C show the results of single agent proliferation assays for the combination in FIG. 25A. FIG. 25D shows Loewe excess for the combination in FIG. 25A and FIG. 25E shows Bliss excess for the combination in FIG. 25A. FIG. 25F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 1 cells. FIG. 25G-FIG. 25H show the results of single agent proliferation assays for the combination in FIG. 25F. FIG. 25I shows Loewe excess for the combination in FIG. 25F and FIG. 25J shows Bliss excess for the combination in FIG. 25F. FIG. 25K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+)-clone 2 cells. FIG. 25L-FIG. 25M show the results of single agent proliferation assays for the combination in FIG. 25K. FIG. 25N shows Loewe excess for the combination in FIG. 25K and FIG. 25O shows Bliss excess for the combination in FIG. 25K.
• FIG. 26A shows Lowe Volumes for the combinations tested. FIG. 26B shows Bliss Volumes for the combinations tested. FIG. 26C shows Synergy Scores for the combinations tested.
• FIG. 27A-FIG. 27I show the changes in MAPK and Effector Pathway Signaling in MEK acquired resistance. Isogenic RKO parental and MEK1 (Q56P/+) cells were treated with compound for 4 or 24 h and then immuno-blotted with the indicated antibodies. Dabrafenib was the BRAF inhibitor and trametinib was the MEK inhibitor. FIG. 27A shows increased signaling in RKO MEK1 (Q56P/+) cells. FIG. 27B-FIG. 27C show the results of a 4 hour treatment in Experiment 1 (See, Example 7) in RKO Parental (27B) and RKO MEK1 (Q56P/+) (27C) cells. FIG. 27D-FIG. 27E show the results of a 4 hour treatment in Experiment 2 (See, Example 7) in RKO Parental (27D) and RKO MEK1 (Q56P/+) (27E) cells. FIG. 27F-FIG. 27G show the results of a 4 hour treatment in Experiment 2 (See, Example 7) in RKO Parental (27F) and RKO MEK1 (Q56P/+) (27G) cells. FIG. 27H-FIG. 27I show a summary of results in RKO Parental (27H) and RKO MEK1 (Q56P/+) (27I) cells.
• FIG. 28A-FIG. 28E show the results of the combination of BVD-523 and SCH772984. FIG. 28A shows a dose matrix showing inhibition (%) for the combination in A375 cells. FIG. 28B-FIG. 28C show the results of single agent proliferation assays for the combination in FIG. 28A. FIG. 28D shows Loewe excess for the combination in FIG. 28A and FIG. 28E shows Bliss excess for the combination in FIG. 28A.
• FIG. 29A-FIG. 29F show discovery and characterization of the novel ERK1/2 inhibitor BVD-523 (ulixertinib). FIG. 29A shows that BVD-523 demonstrates inhibition in a reversible ATP-competitive manner. This is demonstrated by a linear increase in IC₅₀ values for inhibition of ERK2 with increasing ATP concentration as shown in FIG. 29B. FIG. 29C shows a representative plot of the dose-response curve and FIG. 29D shows a plot of IC₅₀ over time. FIG. 29E shows BVD-523 binding to ERK2 and phospho-ERK2 (pERK2), compared with negative control protein p38. FIG. 29F shows BVD-523 binding to ERK2 compared with the ERK inhibitors SCH772984 and pyrazolylpyrrole.
• FIG. 30A-FIG. 30D show that BVD 523 inhibits cellular proliferation and enhances caspase 3 and caspase 7 activity in vitro. FIG. 30A shows that BVD-523 demonstrates preferential activity in cells with MAPK pathway mutations, as defined by the presence of mutations in RAS family members and RAF. In addition, as shown in FIG. 30B, BVD-523 blocks sensitive cell lines in the G1 phase of the cell cycle. FIG. 30C shows that BVD-523 induced a concentration- and time-dependent increase in caspase activity in the A375, WM266, and LS411N cancer cell lines after 72 hours of exposure. FIG. 30D shows that the MAPK pathway and effector proteins are modulated by acute (4-hour) and prolonged (24-hour) BVD-523 treatment in BRAF^V600E-mutant A375 cells.
• FIG. 31A-FIG. 31C show in vivo BVD-523 anti-tumor activity. BVD-523 monotherapy inhibits tumor growth in (FIG. 31A) A375 and (FIG. 31B) Colo205 cell line xenograft models (^aP<0.0001, compared with vehicle control; CPT-11 dosed on Day 14 and Day 18 only). Abbreviations: BID, twice daily; CMC, carboxymethylcellulose; QD, every day; Q4D, every 4 days. FIG. 31C shows that in Colo205 xenografts, increased ERK1/2 phosphorylation correlates with BVD-523 concentration.
• FIG. 32A shows signaling effects of ERK1/2 inhibitors. Using RPPA, effects on proteins are measured in cell lines (A375, AN3Ca, Colo205, HCT116, HT29 and MIAPaca2) following treatment with ERK1/2 inhibitors BVD-523 (BVD), Vx11e (Vx), GDC-0994 (GDC), or SCH722984 (SCH). FIG. 32B shows that the ERK inhibitors BVD-523, GDC-0994, and Vx11e have differential effects on phospho-ERK (ERK 1/2 T202 Y204) compared with SCH722984; phospho-RSK (p90 RSK 380) and Cyclin D1 are inhibited by the ERK inhibitors tested. Abbreviations: BRAFi, BRAF inhibitors; MEKi, MEK inhibitors. FIG. 32C shows a western blot assay of cellular and nuclear fractions from a RKO cell line following treatment with BVD-523, trametinib, SCH722984, or dabrafenib. Histone H3 (nuclear localized protein) and HSP90 (cytoplasmically localized protein) were included as positive controls to confirm that the nuclear and cytoplasmic fractions were properly enriched; nuclear fractions have high H3 and cytoplasmic fractions have higher HSP90.
• FIG. 33 shows that the ERK inhibitors BVD-523, Vx11, GDC-0994, and SCH772984 (SCH) demonstrate cell line-dependent changes in phospho-ATK levels. Abbreviation: DMSO, dimethyl sulfoxide.
• FIG. 34A-FIG. 34D show that BVD-523 demonstrates activity in models of resistance to BRAF/MEK inhibition. The appearance of resistance to BVD-523, dabrafenib, or trametinib in BRAF^600E A375 cells following exposure to increasing concentrations of drug is indicated. A strict set of “criteria” was applied to determine when the dose could be increased in order to ensure that the kinetics of the acquisition of resistance between treatments was comparable. See, Example 1. Time is shown against multipliers of IC₅₀; each point on the plotted line represents a change of medium or cell split. FIG. 34A shows that adapting cells to growth in the presence of BVD-523 was more challenging than with either dabrafenib or trametinib. FIG. 34B shows that BVD-523 sensitivity is retained in A375 cells cultured to acquire resistance to combined BRAF (dabrafenib)+MEK (trametinib) inhibition. In FIG. 34C, cells were treated with compound for 96 h and viability was assessed using CellTiter-Glo®. BVD-523 activity is retained in BRAF^V600E RKO cells cross-resistant to BRAF (dabrafenib) and MEK (trametinib) inhibitors due to endogenous heterozygous knock-in of MEK1^Q56P. FIG. 34D shows that BVD-523 inhibition of pRSK in BRAF^V600E-mutant cell line RKO is maintained in the presence of MEK1^Q56P, which confers resistance to MEK and BRAF inhibition. Knock-in of KRAS mutant alleles into SW48 cell lines significantly diminishes sensitivity to the MEK inhibitors trametinib and selumetinib, while comparatively sensitivity to BVD-523 is retained.
• FIG. 35A shows BVD-523 in vivo activity in xenografts derived from a vemurafenib-relapsed patient. Mean tumor volume (±SEM) is shown for BVD-523 100 mg/kg BID alone, dabrafenib 50 mg/kg BID alone, and BVD-523 100 mg/kg BID plus dabrafenib 50 mg/kg BID. Abbreviations: BID, twice daily; SEM, standard error of mean.
• FIG. 36A-FIG. 36D show the benefit of combined BVD-523 and BRAF inhibition. FIG. 36A-FIG. 36B show that the combination of BVD-523 plus dabrafenib exhibited superior antitumor activity compared with treatment with either agent alone in a A375 BRAF^V600E-mutant melanoma cell line xenograft model with a tumor start volume of 75-144 mm³. FIG. 36C-FIG. 36D show similar data from the same model with an enlarged tumor volume (700-800 mm³) at the start of dosing. Plots of mean tumor growth (left panels) and Kaplan-Meier survival (right panels) are presented for each study. Abbreviations: BID, twice daily; QD, once daily.
• FIG. 37A shows that, in SW48 colorectal cells engineered with KRAS alleles, response to paclitaxel was unaltered compared to control. FIG. 37B shows combination interactions between BVD-523 and vemurafenib, which were assessed using an 8×10 matrix of concentrations using the Loewe Additivity and Bliss Independence Models, and analyzed with Horizon's Chalice, Bioinformatics Software. Chalice enables potential synergistic interactions to be identified by displaying the calculated excess inhibition over that predicted as being additive across the dose matrix as a heat map, and by reporting a quantitative “Synergy Score” based on the Loewe model. The results suggest that interactions between BVD-523 and vemurafenib are at least additive, and in some cases synergistic in melanoma cell lines carrying a BRAF^V600E mutation. FIG. 37C shows that BVD-523 in combination with dabrafenib markedly delays the onset of acquired resistance in A375 BRAF^V600E melanoma cells. The temporal acquisition of resistance in response to escalating concentrations of dabrafenib alone or in combination with BVD-523 or trametinib was assessed. Strict criteria were applied as to when the dose could be increased to ensure that the kinetics of adaptation was comparable between treatments. See, Example 1.
• FIG. 38 shows that BVD-523 inhibits ex vivo PMA-stimulated RSK1/2 phosphorylation in human whole blood. Averages of BVD-523 concentration data set are indicated by (-). n=20 for each concentration of BVD-523. Abbreviations: PBMC, peripheral blood mononuclear cells; RSK, ribosomal S6 kinase.
• FIG. 39A shows steady-state BVD-523 pharmacokinetics (Cycle 1, Day 15). The dashed red line indicates an EC ₅₀ 200 ng/mL HWB. Abbreviations: AUC, area under the curve; BID, twice daily; C_max, maximum concentration; EC₅₀, 50% maximum effective concentration; HWB, human whole blood; SD, standard deviation. FIG. 39B shows pharmacodynamic inhibition of ERK phosphorylation by BVD-523 in human whole blood. Abbreviations: BID, twice daily; pRSK, phospho-RSK; RSK, ribosomal S6 kinase.
• FIG. 40A shows the best radiographic response in patients treated with BVD-523. Included are all patients with disease measured by RECIST v1.1 who received ≥1 dose of study treatment and had >1 on-treatment tumor assessment (25/27; 2 did not receive both scans of target lesions). Response was measured as the change from baseline in the sum of the longest diameter of each target lesion. Dose shown is that which the patient was receiving at the time of response. The dashed line indicates the threshold for a partial response according to RECIST v1.1. Abbreviations: CRC, colorectal cancer; NET, neuroendocrine tumors; NSCLC, non-small cell lung cancer; NSGCT, nonseminomatous germ cell tumors; PNET, pancreatic NET; PTC, papillary thyroid cancer; RECIST v1.1, Response Evaluation Criteria in Solid Tumors version 1.1; SLD, sum of the largest diameter. FIG. 40B shows a computerized tomography scan of a confirmed partial response in a 61-year-old patient with a BRAF-mutant melanoma treated with BVD-523.
• FIG. 41 shows tumor response and tumor progression. Shown is a swimmer plot of tumor response, tumor progression, and duration of treatment in response-evaluable patients treated with BVD-523. Origin of the vertical axis corresponds to randomization date or reference start date. Analysis cut-off date: Dec. 1, 2015. Abbreviation: BID, twice daily.
DETAILED DESCRIPTION OF THE INVENTION
• One embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present invention may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population may fail to respond or respond inadequately to treatment.
• As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.
• As used herein, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.
• In the present invention, BVD-523 corresponds to a compound according to formula (I):
• 
• and pharmaceutically acceptable salts thereof. BVD-523 may be synthesized according to the methods disclosed, e.g., in U.S. Pat. No. 7,354,939. Enantiomers and racemic mixtures of both enantiomers of BVD-523 are also contemplated within the scope of the present invention. BVD-523 is an ERK1/2 inhibitor with a mechanism of action that is believed to be, e.g., unique and distinct from certain other ERK1/2 inhibitors, such as SCH772984 and the pyrimidinal structure used by Hatzivassiliou et al. (2012). For example, other ERK1/2 inhibitors, such as SCH772984, inhibit autophosphorylation of ERK (Morris et al., 2013), whereas BVD-523 allows for the autophosphorylation of ERK while still inhibiting ERK. (See, e.g., FIG. 18).
• As used herein, the words “resistant” and “refractory” are used interchangeably. Being “resistant” to non-ERK MAPK pathway inhibitor therapy treatments means that non-ERK MAPK inhibitors have reduced efficacy in treating cancer.
• As used herein, a “non-ERK MAPK inhibitor” means any substance that reduces the activity, expression or phosphorylation of proteins or other members of the MAPK pathway that results in a reduction of cell growth or an increase in cell death, with the exception of ERK1/2 inhibitors. As used herein, an “ERK1/2 inhibitor” means those substances that (i) directly interact with ERK1 and/or ERK2, e.g., by binding to ERK1/2 and (ii) decrease the expression or the activity of ERK1 and/or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1/2, such as MEK inhibitors and RAF inhibitors, are not ERK1/2 inhibitors according to the present invention (but they are non-ERK MAPK inhibitors). Non-limiting examples of ERK1/2 inhibitors according to the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523 (BioMed Valley Discoveries, Inc.), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.
• An overview of the mammalian MAPK cascades is shown in FIG. 21. The MAPK pathway is reviewed in e.g., Akinleye et al., 2013. Briefly, with respect to the ERK1/2 module in FIG. 21 (light purple box), the MAPK 1/2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTK). The activated receptors recruit and phosphorylate adaptor proteins Grb2 and SOS, which then interact with membrane-bound GTPase Ras and cause its activation. In its activated GTP-bound form, Ras recruits and activates RAF kinases (A-RAF, B-RAF, and C-RAF/RAF-1). The activated RAF kinases activate MAPK 1/2 (MKK1/2), which in turn catalyzes the phosphorylation of threonine and tyrosine residues in the activation sequence Thr-Glu-Tyr of ERK1/2. With respect to the JNK/p38 module (yellow box in FIG. 21), upstream kinases, MAP3Ks, such as MEKK1/4, ASK1/2, and MLK1/2/3, activate MAP2K3/6 (MKK3/6), MAP2K4 (MKK4), and MAP2K7 (MKK7). These MAP2K's then activate JNK protein kinases, including JNK1, JNK2, and JNK3, as well as p38 α/β/γ/δ. To execute their functions, JNKs activate several transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1 and STAT3. With respect to the ERK5 module (blue box in FIG. 21), the kinases upstream of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.
• Non-limiting examples of non-ERK MAPK pathway inhibitors according to the present invention include RAS inhibitors, RAF inhibitors (such as, e.g., inhibitors of A-RAF, B-RAF, C-RAF (RAF-1)), MEK inhibitors, and combinations thereof. Preferably, the non-ERK MAPK pathway inhibitors are BRAF inhibitors, MEK inhibitors, and combinations thereof.
• As used herein, a “RAS inhibitor” means those substances that (i) directly interact with RAS, e.g., by binding to RAS and (ii) decrease the expression or the activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (such as, e.g., tipifarnib and lonafarnib), farnesyl group-containing small molecules (such as, e.g., salirasib and TLN-4601), DCAI, as disclosed by Maurer (Maurer et al., 2012), Kobe0065 and and Kobe2602, as disclosed by Shima (Shima et al., 2013), HBS 3 (Patgiri et al., 2011), and AIK-4 (Allinky).
• As used herein, a “RAF inhibitor” means those substances that (i) directly interact with RAF, e.g., by binding to RAF and (ii) decrease the expression or the activity of RAF, such as, e.g., A-RAF, B-RAF, and C-RAF (RAF-1). Non-limiting exemplary RAF inhibitors, including BRAF inhibitors, include:
• 

  

  

  

  

  
• AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQuie), ARQ-761 (ArQuie), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
• As used herein, a “MEK inhibitor” means those substances that (i) directly interact with MEK, e.g., by binding to MEK and (ii) decrease the expression or the activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), RO092210 (Roche), RO4987655 (Hoffmann-La Roche), RO5126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
• In one aspect of this embodiment, substantially all phosphorylation of ribosomal s6 kinase (RSK) is inhibited after administration of BVD-523 or a pharmaceutically acceptable salt thereof. As used herein in the context of RSK phosphorylation, “substantially all” means a reduction of greater than 50% reduction, preferably greater than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% reduction.
• In another aspect of this embodiment, the cancer has MAPK activity. As used herein, having “MAPK activity” means that proteins downstream of ERK are still active, even if proteins upstream of ERK may not be active. Such a cancer may be a solid tumor cancer or a hematologic cancer.
• In the present invention, cancers include both solid and hemotologic cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumor, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, large intestine cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver tumor/cancer, lung tumor/cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasm, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell cancer, transitional cell cancer of the renal pelvis and ureter, salivary gland cancer, Sezary syndrome, skin cancers (such as cutaneous t-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.
• Examples of hematologic cancers include, but are not limited to, leukemias, such as adult/childhood acute lymphoblastic leukemia, adult/childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia, lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult/childhood Hodgkin lymphoma, mycosis fungoides, adult/childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sezary syndrome, cutaneous T-cell lymphoma, and Waldenstrom macroglobulinemia, as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma/plasma cell neoplasm, myelodysplastic syndromes, and myelodysplastic/myeloproliferative neoplasms.
• Preferably, the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers. More preferably, the cancer is melanoma.
• In another aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent effective for treating or ameliorating the effects of the cancer. The additional therapeutic agent may be selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
• As used herein, an “antibody” encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single chain antibodies, chimeric antibodies (e.g., humanized murine antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Fragments of antibodies include those that bind antigen, (e.g., Fab′, F(ab′)₂, Fab, Fv, and rIgG). See also, e.g., Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term “antibody” further includes both polyclonal and monoclonal antibodies.
• Examples of therapeutic antibodies that may be used in the present invention include rituximab (Rituxan), Cetuximab (Erbitux), bevacizumab (Avastin), and Ibritumomab (Zevalin).
• Cytotoxic agents according to the present invention include DNA damaging agents, antimetabolites, anti-microtubule agents, antibiotic agents, etc. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inhibitors of DNA replication include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists such as methotrexate and premetrexed, purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Anti-microtubule agents include without limitation vinca alkaloids, paclitaxel (Taxol®), docetaxel (Taxotere®), and ixabepilone (Ixempra®). Antibiotic agents include without limitation actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
• Cytotoxic agents according to the present invention also include an inhibitor of the PI3K/Akt pathway. Non-limiting examples of an inhibitor of the PI3K/Akt pathway include A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
• In the present invention, the term “toxin” means an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or portions thereof.
• In the present invention, the term “radionuclide” means a radioactive substance administered to the patient, e.g., intravenously or orally, after which it penetrates via the patient's normal metabolism into the target organ or tissue, where it delivers local radiation for a short time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.
• In the present invention, the term “immunomodulator” means a substance that alters the immune response by augmenting or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with the antigen that initiated their production. Immunomodulators may be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunomodulators are naturally present in the body, and certain of these are available in pharmacologic preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).
• In the present invention, the term “photoactive therapeutic agent” means compounds and compositions that become active upon exposure to light. Certain examples of photoactive therapeutic agents are disclosed, e.g., in U.S. Patent Application Serial No. 2011/0152230 A1, “Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy.”
• In the present invention, the term “radiosensitizing agent” means a compound that makes tumor cells more sensitive to radiation therapy. Examples of radiosensitizing agents include misonidazole, metronidazole, tirapazamine, and trans sodium crocetinate.
• In the present invention, the term “hormone” means a substance released by cells in one part of a body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.
• Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in the present invention.
• As used herein, an “anti-angiogenesis” agent means a substance that reduces or inhibits the growth of new blood vessels, such as, e.g., an inhibitor of vascular endothelial growth factor (VEGF) and an inhibitor of endothelial cell migration. Anti-angiogenesis agents include without limitation 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
• Another embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject. The method comprises:
• • (a) identifying a subject with cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and
  • (b) administering to the subject with said refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
• Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above. In accordance with the present invention, the cancer may have MAPK activity.
• In one aspect of this embodiment, identifying a subject with cancer that is refractory or resistant to BRAF and/or MEK inhibitor therapy comprises:
• • (a) obtaining a biological sample from the subject; and
  • (b) screening the sample to determine whether the subject has become resistant to an inhibitor therapy selected from the group consisting of BRAF inhibitor therapy, MEK inhibitor therapy, and combinations thereof.
• In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art.
• Preferably, screening for a cancer that is refractory or resistant to BRAF inhibitor therapy may comprise, e.g., identifying (i) a switch between RAF isoforms, (ii) upregulation of RTK or NRAS signaling, (iii) reactivation of mitogen activated protein kinase (MAPK) signaling, (iv) the presence of a MEK activating mutation, and combinations thereof.
• A switch between RAF isoforms may occur in subjects having acquired resistance to BRAF inhibitor therapy. To detect such a switch, BRAF inhibitor-resistant tumor cells may be retrieved from a patient and analyzed via Western blotting for ERK and phospho-ERK levels in the presence of a BRAF inhibitor. Comparison with BRAF inhibitor-sensitive cells treated with a BRAF inhibitor may reveal higher levels of phospho-ERK in BRAF inhibitor-resistant tumor cells, implying that a switch has taken place in which another RAF isoform phosphorylates ERK in place of BRAF. Confirmation of which RAF isoform has taken over may involve sh/siRNA-mediated knockdown of ARAF and CRAF individually in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor, followed by subsequent Western blotting for ERK and phospho-ERK levels. If, for example, ARAF knockdown in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor still results in high levels of phospho-ERK, it would indicate that CRAF has taken over phosphorylating ERK. Likewise, if CRAF was knocked down in BRAF inhibitor-resistant cells exposed to BRAF inhibitor and ERK was still highly phosphorylated, it would mean that ARAF has taken over ERK phosphorylation. RAF isoform switching may also involve simultaneous knockdown of ARAF and CRAF in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor, effectively blocking all RAF-mediated phosphorylation. A resulting decrease in ERK phosphorylation would indicate that the BRAF inhibitor-resistant cells have the capacity to switch between RAF isoforms in order to phosphorylate ERK (Villanueva, et al., 2010).
• Upregulation of RTK or NRAS signaling may also be a cause of BRAF inhibitor resistance. Detection may, e.g., first involve using Western blotting protocols with phospho-specific antibodies to analyze the activation of the downstream RAF effectors MEK1/2 and ERK1/2. If BRAF inhibitor-resistant cells show high activation levels of these proteins in the presence of a BRAF inhibitor, RTK or NRAS upregulation may be the cause. Gene expression profiling (or other related methods) of BRAF inhibitor-resistant cells in the presence of a BRAF inhibitor may reveal higher expression levels of KIT, MET, EGFR, and PDGFRβ RTKs as compared to BRAF inhibitor-sensitive cells. Real-time quantitative polymerase chain reaction experiments, or other similar procedures, focusing on any of these genes may confirm higher expression levels while phospho-RTK arrays (R&D Systems, Minneapolis, Minn.) may show elevated activation-associated tyrosine phosphorylation. Alternatively, NRAS activation may be detected by various gene sequencing protocols. Activating mutations in NRAS, particularly Q61K, may indicate that B-RAF signaling has been bypassed. In melanoma cells, activated NRAS uses C-RAF to signal to MEK-ERK. Thus, activated NRAS may enable a similar bypass pathway in BRAF inhibitor-resistant cells exposed to BRAF inhibitor. Further confirmation of these mechanisms in a given BRAF inhibitor-resistant sample may be accomplished, for example, using sh/siRNA-mediated knockdown of upregulated RTKs or activated NRAS in the presence of BRAF inhibitor. Any significant levels of growth inhibition may indicate that upregulation of RTK or NRAS signaling is the cause of BRAF inhibition in that particular sample (Nazarian, et al., 2010).
• Detecting reactivation of MAPK signaling in BRAF inhibitor-resistant cells may indicate another bypass mechanism for BRAF inhibitor resistance. COT and C-RAF have been shown to be upregulated in a BRAF V600E background exposed to BRAF inhibitor. Quantitative real-time RT-PCR, e.g., may reveal increased COT expression in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor. Furthermore, sh/siRNA-mediated knockdown of COT in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor may reduce the viability of BRAF inhibitor-resistant cells, indicating that these particular cells may be sensitive to COT inhibition and/or combination BRAF inhibitor/MEK inhibitor treatments (Johannessen, et al., 2010).
• Reactivation of MAPK signaling may also be accomplished in a BRAF inhibitor-resistant background by activating mutations in MEK1. Targeted, massively parallel sequencing of genomic DNA from a BRAF inhibitor-resistant tumor may reveal activating mutations in MEK1, such as C121S, G128D, N122D, and Y130, among others. Other, undocumented mutations in MEK1 may be analyzed by, for example, expressing the particular mutation in a BRAF inhibitor-sensitive cell line such as A375. Determining levels of growth inhibition in these cells upon exposure to BRAF inhibitor may indicate if the MEK1 mutation is causing resistance to BRAF inhibitory therapy. To confirm such a finding, Western blotting for elevated levels of phospho-ERK1/2 in cells ectopically expressing the MEK1 mutation may indicate that the MEK1 mutation is allowing the BRAF inhibitor-resistant tumor to bypass BRAF and promote phosphorylation of ERK through MEK1 (Wagle, et al., 2011).
• In accordance with the present invention, screening for a cancer that is refractory or resistant to MEK inhibitor therapy may comprise, e.g., identifying (i) amplification of mutant BRAF, (ii) STAT3 upregulation, (iii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity, and combinations thereof.
• Amplification of mutant BRAF may cause MEK inhibitor resistance. MEK inhibitor resistance is typically associated with high levels of phosphorylated ERK and MEK in the presence of a MEK inhibitor, which may be assessed via, for example, Western blotting. Amplification of mutant BRAF in MEK inhibitor-resistant cell lines may be detected by, for example, fluorescence in situ hybridization (FISH) or quantitative PCR from genomic DNA of the resistant cell lines. Confirmation that BRAF amplification is a primary cause of MEK inhibitor resistance may entail using BRAF-targeted sh/siRNAs in resistant cells. If a significant decrease in MEK or ERK phosphorylation is observed, BRAF amplification may be a suitable target for further therapeutic approaches. (Corcoran, et al., 2010).
• Identifying STAT3 upregulation may indicate that a particular tumor sample is resistant to MEK inhibitor therapy. Genome-wide expression profiling may reveal the STAT3 pathway to be upregulated in a tumor. Other techniques, such as Western blotting for phospho-STAT3 and real-time qPCR for the STAT pathway-associated genes JAK and IL6ST may reveal upregulated STAT3. Further confirmation that STAT3 upregulation causes MEK inhibitor resistance in a particular sample may comprise the use of sh/siRNAs against STAT3 in the sample followed by appropriate Western blotting for MEK and ERK activation as well as phospho-STAT3 and total STAT3. Growth inhibition studies may show that STAT3 knockdown sensitizes previously MEK inhibitor-resistant cells to MEK inhibition. A similar effect may be seen if the sample were exposed to a STAT3 inhibitor such as JSI-124. Additional confirmation that STAT3 upregulation is the cause of MEK inhibitor resistance in a particular tumor could arise from Western blotting for BIM expression, including BIM-EL, BIM-L, and BIM-SL. BIM expression leads to MEK inhibitor-induced apoptosis, thus STAT3 upregulation may lower BIM levels. STAT3 is known to regulate the expression of miR 17-92, which suppresses BIM expression. Upregulated STAT3 may lead to higher levels of miR 17-92, which will lower BIM levels and promote resistance to MEK inhibition. Thus, real-time qPCR of miR 17-92 levels may also assist in assessing whether STAT3 upregulation is causing MEK inhibition resistance in a particular sample. (Dai, et al., 2011).
• Mutations in the allosteric pocket of MEK that can directly block binding of inhibitors to MEK or lead to constitutive MEK activity may be detected by methods disclosed below. Such mutations have been identified previously by Emery and colleagues (Emery, et al., 2009) as well as Wang and colleagues (Wang et al., 2011). Other mutations may affect MEK1 codons located within or abutting the N-terminal negative regulatory helix, such as P124L and Q56P. (Id.).
• Methods for identifying mutations in nucleic acids, such as the above identified MEK genes, are known in the art. Nucleic acids may be obtained from biological samples. In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art.
• Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and combinations thereof.
• Various sequencing methods are known in the art. These include, but are not limited to, Sanger sequencing (also referred to as dideoxy sequencing) and various sequencing-by-synthesis (SBS) methods as disclosed in, e.g., Metzker 2005, sequencing by hybridization, by ligation (for example, WO 2005021786), by degradation (for example, U.S. Pat. Nos. 5,622,824 and 6,140,053) and nanopore sequencing (which is commercially available from Oxford Nanopore Technologies, UK). In deep sequencing techniques, a given nucleotide in the sequence is read more than once during the sequencing process. Deep sequencing techniques are disclosed in e.g., U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.
• PCR-based methods for detecting mutations are known in the art and employ PCR amplification, where each target sequence in the sample has a corresponding pair of unique, sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows for rapid detection of mutations after the genomic sequences are amplified by PCR. The mutation is discriminated by digestion with specific restriction endonucleases and is identified by electrophoresis. See, e.g., Ota et al., 2007. Mutations may also be detected using real time PCR. See, e.g., International Application publication No. WO2012046981.
• Hybrid capture methods are known in the art and are disclosed in e.g., U.S. Patent Publication No. 20130203632 and U.S. Pat. Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of the target genomic regions to user-designed oligonucleotides. The hybridization can be to oligonucleotides immobilized on high or low density microarrays (on-array capture), or solution-phase hybridization to oligonucleotides modified with a ligand (e.g. biotin) which can subsequently be immobilized to a solid surface, such as a bead (in-solution capture).
• Molecular Inversion Probe (MIP) techniques are known in the art and are disclosed in e.g., Absalan et al., 2008. This method uses MIP molecules, which are special “padlock” probes (Nilsson et al, 1994) for genotyping. A MIP molecule is a linear oligonucleotide that contains specific regions, universal sequences, restriction sites and a Tag (index) sequence (16-22 bp). A MIP hybridizes directly around the genetic marker/SNP of interest. The MIP method may also use a number of “padlock” probe sets that hybridize to genomic DNA in parallel (Hardenbol et al., 2003). In case of a perfect match, genomic homology regions are ligated by undergoing an inversion in configuration (as suggested by the name of the technique) and creating a circular molecule. After the first restriction, all molecules are amplified with universal primers. Amplicons are restricted again to ensure short fragments for hybridization on a microarray. Generated short fragments are labeled and, through a Tag sequence, hybridized to a cTag (complementary strand for index) on an array. After the formation of Tag-cTag duplex, a signal is detected.
• The following Tables 1, 2, and 3 show the SEQ ID Nos. of representative nucleic acid and amino acid sequences of wild type BRAF, N-RAS, and MEK1 from various animals in the sequence listing. These sequences may be used in methods for identifying subjects with mutant BRAF, N-RAS, and MEK1 genotypes.

• TABLE 1
  BRAF sequences

  	polypeptide or
  SEQ	nucleic acid		Other
  ID NO.	sequence	Organism	information
  1	nucleic acid	human
  2	polypeptide	human
  3	nucleic acid	rat (Rattus
  		norvegicus)
  4	polypeptide	rat (Rattus
  		norvegicus)
  5	nucleic acid	mouse, Mus
  		musculus
  6	polypeptide	mouse, Mus
  		musculus
  7	nucleic acid	rabbit,
  		Oryctolagus
  		cuniculus
  8	polypeptide	rabbit,
  		Oryctolagus
  		cuniculus
  9	nucleic acid	guinea pig, Cavia
  		porcellus
  10	polypeptide	guinea pig, Cavia
  		porcellus
  11	nucleic acid	dog, Canis lupus	variant × 1
  		familiaris
  12	polypeptide	dog, Canis lupus	variant × 1
  		familiaris
  13	nucleic acid	dog, Canis lupus	variant × 2
  		familiaris
  14	polypeptide	dog, Canis lupus	variant × 2
  		familiaris
  15	nucleic acid	cat, Felis catus
  16	polypeptide	cat, Felis catus
  17	nucleic acid	cow, Bos taurus	variant × 1
  18	polypeptide	cow, Bos taurus	variant × 1
  19	nucleic acid	cow, Bos taurus	variant × 2
  20	polypeptide	cow, Bos taurus	variant × 2
  21	nucleic acid	cow, Bos taurus	variant × 3
  22	polypeptide	cow, Bos taurus	variant × 3
  23	nucleic acid	cow, Bos taurus	variant × 4
  24	polypeptide	cow, Bos taurus	variant × 4
  25	nucleic acid	cow, Bos taurus	variant × 5
  26	polypeptide	cow, Bos taurus	variant × 5
  27	nucleic acid	cow, Bos taurus	variant × 6
  28	polypeptide	cow, Bos taurus	variant × 6
  29	nucleic acid	cow, Bos taurus	variant × 7
  30	polypeptide	cow, Bos taurus	variant × 7
  31	nucleic acid	cow, Bos taurus	variant × 8
  32	polypeptide	cow, Bos taurus	variant × 8
  33	nucleic acid	cow, Bos taurus	variant × 9
  34	polypeptide	cow, Bos taurus	variant × 9
  35	nucleic acid	cow, Bos taurus	variant × 10
  36	polypeptide	cow, Bos taurus	variant × 10
  37	nucleic acid	cow, Bos taurus	variant × 11
  38	polypeptide	cow, Bos taurus	variant × 11
  39	nucleic acid	cow, Bos taurus	variant 2
  40	polypeptide	cow, Bos taurus	variant 2
  41	nucleic acid	horse, Equus
  		caballus
  42	polypeptide	horse, Equus
  		caballus
  43	nucleic acid	chicken, Gallus
  		gallus
  44	polypeptide	chicken, Gallus
  		gallus

• TABLE 2
  N-RAS sequences

  	polypeptide or
  SEQ	nucleic acid		Other
  ID NO.	sequence	Organism	information
  45	nucleic acid	human
  46	polypeptide	human
  47	nucleic acid	rat (Rattus norvegicus)
  48	polypeptide	rat (Rattus norvegicus)
  49	nucleic acid	mouse, Mus musculus
  50	polypeptide	mouse, Mus musculus
  51	nucleic acid	guinea pig, Cavia porcellus
  52	polypeptide	guinea pig, Cavia porcellus
  53	nucleic acid	guinea pig, Cavia porcellus	variant × 1
  54	polypeptide	guinea pig, Cavia porcellus	variant × 1
  55	nucleic acid	dog, Canis lupus familiaris
  56	polypeptide	dog, Canis lupus familiaris
  57	nucleic acid	cat, Felis catus
  58	polypeptide	cat, Felis catus
  59	nucleic acid	cow, Bos taurus
  60	polypeptide	cow, Bos taurus
  61	nucleic acid	chicken, Gallus gallus
  62	polypeptide	chicken, Gallus gallus

• TABLE 3
  MEK1 sequences

  		polypeptide or
  	SEQ	nucleic acid
  	ID NO.	sequence	Organism
  	63	nucleic acid	human
  	64	polypeptide	human
  	65	nucleic acid	rat (Rattus norvegicus)
  	66	polypeptide	rat (Rattus norvegicus)
  	67	nucleic acid	mouse, Mus musculus
  	68	polypeptide	mouse, Mus musculus
  	69	nucleic acid	rabbit, Oryctolagus cuniculus
  	70	polypeptide	rabbit, Oryctolagus cuniculus
  	71	nucleic acid	guinea pig, Cavia porcellus
  	72	polypeptide	guinea pig, Cavia porcellus
  	73	nucleic acid	dog, Canis lupus familiaris
  	74	polypeptide	dog, Canis lupus familiaris
  	75	nucleic acid	cat, Felis catus
  	76	polypeptide	cat, Felis catus
  	77	nucleic acid	cow, Bos taurus
  	78	polypeptide	cow, Bos taurus
  	79	nucleic acid	horse, Equus caballus
  	80	polypeptide	horse, Equus caballus
  	81	nucleic acid	chicken, Gallus gallus
  	82	polypeptide	chicken, Gallus gallus

• In another aspect of this embodiment, the method further comprises administering at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.
• A further embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject, which cancer is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above.
• In a further aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.
• Another embodiment of the present invention is a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor. The method comprises:
• • (a) obtaining a biological sample from the subject; and
  • (b) screening the sample to determine whether the subject has one or more of the following markers:
    • (i) a switch between RAF isoforms,
    • (ii) upregulation of RTK or NRAS signaling,
    • (iii) reactivation of mitogen activated protein kinase (MAPK) signaling,
    • (iv) the presence of a MEK activating mutation,
    • (v) amplification of mutant BRAF,
    • (vi) STAT3 upregulation,
    • (vii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity,
      wherein the presence of one or more of the markers confirms that the subject's cancer is refractory or resistant to BRAF and/or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
• Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to identify a subject having cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above.
• In one aspect of this embodiment, the method further comprises administering BVD-523 or a pharmaceutically acceptable salt thereof to a subject having one or more of the markers. Preferably, the method additionally comprises administering to the subject having one or more of the markers at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.
• An additional embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
• Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapy are as disclosed herein. In this embodiment, the pharmaceutical composition may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above.
• In one aspect of this embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.
• Another embodiment of the present invention is a kit for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. This kit comprises any pharmaceutical composition according to the present invention packaged together with instructions for its use.
• The kits may also include suitable storage containers, e.g., ampules, vials, tubes, etc., for each pharmaceutical composition and other reagents, e.g., buffers, balanced salt solutions, etc., for use in administering the pharmaceutical compositions to subjects. The pharmaceutical compositions and other reagents may be present in the kits in any convenient form, such as, e.g., in a solution or in a powder form. The kits may further include a packaging container, optionally having one or more partitions for housing the pharmaceutical composition and other optional reagents.
• Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapy are as disclosed herein. In this embodiment, the kit may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified herein. Methods of identifying such mutations are as set forth above.
• In one aspect of this embodiment, the kit further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.
• Another embodiment of the present invention is a method for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor. The method comprises contacting the cancer cell with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient for phosphorylation of RSK in the cancer cell to be inhibited. In this embodiment, “contacting” means bringing BVD-523 or a pharmaceutically acceptable salt thereof and optionally one or more additional therapeutic agents into close proximity to the cancer cells. This may be accomplished using conventional techniques of drug delivery to mammals, or in the in vitro situation by, e.g., providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a culture media in which the cancer cells are located. In the ex vivo situation, contacting may be carried out by, e.g., providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a cancerous tissue.
• Suitable and preferred types of non-ERK MAPK pathway inhibitors are as disclosed herein. In this embodiment, effecting cancer cell death may be accomplished in cancer cells having various mutational backgrounds, resistance profiles, and MAPK activity as disclosed above. Methods of identifying such mutations are also as set forth above.
• The methods of this embodiment, which may be carried out in vitro, ex vivo, or in vivo, may be used to effect cancer cell death, by e.g., killing cancer cells, in cells of the types of cancer disclosed herein.
• In one aspect of this embodiment, greater than 50% of RSK phosphorylation is inhibited. In another aspect of this embodiment, greater than 75% of RSK phosphorylation is inhibited. In an additional aspect of this embodiment, greater than 90% of RSK phosphorylation is inhibited. In a further aspect of this embodiment, greater than 95% of RSK phosphorylation is inhibited. In another aspect of this embodiment, greater than 99% of RSK phosphorylation is inhibited. In an additional aspect of this embodiment, 100% of RSK phosphorylation is inhibited.
• In a further aspect of this embodiment, the cancer cell is a mammalian cancer cell. Preferably, the mammalian cancer cell is obtained from a mammal selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammalian cancer cell is a human cancer cell.
• In a further aspect of this embodiment, the contacting step comprises administering BVD-523 or a pharmaceutically acceptable salt to a subject from whom the cancer cell was obtained.
• In the present invention, an “effective amount” or a “therapeutically effective amount” of a compound or composition disclosed herein is an amount of such compound or composition that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g., human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of a compound or composition according to the invention will be that amount of the composition, which is the lowest dose effective to produce the desired effect. The effective dose of a compound or composition of the present invention may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
• A suitable, non-limiting example of a dosage of a BVD-523 and other anti-cancer agents disclosed herein is from about 1 mg/kg to about 2400 mg/kg per day, such as from about 1 mg/kg to about 1200 mg/kg per day, 75 mg/kg per day to about 300 mg/kg per day, including from about 1 mg/kg to about 100 mg/kg per day. Other representative dosages of such agents include about 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 75 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 250 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 1000 mg/kg, 1100 mg/kg, 1200 mg/kg, 1300 mg/kg, 1400 mg/kg, 1500 mg/kg, 1600 mg/kg, 1700 mg/kg, 1800 mg/kg, 1900 mg/kg, 2000 mg/kg, 2100 mg/kg, 2200 mg/kg, and 2300 mg/kg per day. The effective dose of BVD-523 and other anti-cancer agents disclosed herein, may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
• The BVD-523, other inhibitors, and various other anti-cancer agents disclosed herein, or a pharmaceutical composition of the present invention may be administered in any desired and effective manner: for oral ingestion, or as an ointment or drop for local administration to the eyes, or for parenteral or other administration in any appropriate manner such as intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Further, BVD-523, other inhibitors, and various other anti-cancer agents disclosed herein, or a pharmaceutical composition of the present invention may be administered in conjunction with other treatments. BVD-523, other inhibitors, and various other anti-cancer agents disclosed herein, or a pharmaceutical composition of the present invention may be encapsulated or otherwise protected against gastric or other secretions, if desired.
• The pharmaceutical compositions of the invention comprise one or more active ingredients in admixture with one or more pharmaceutically-acceptable diluents or carriers and, optionally, one or more other compounds, drugs, ingredients and/or materials. Regardless of the route of administration selected, the agents/compounds of the present invention are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art. See, e.g., Remington, The Science and Practice of Pharmacy (21^st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.).
• Pharmaceutically acceptable diluents or carriers are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21^st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)) and include sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and tryglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and groundnut), cocoa butter, waxes (e.g., suppository waxes), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable diluent or carrier used in a pharmaceutical composition of the invention must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a chosen dosage form and method of administration can be determined using ordinary skill in the art.
• The pharmaceutical compositions of the invention may, optionally, contain additional ingredients and/or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, sucrose and acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicates, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) control-release or absorption-delaying agents, such as hydroxypropylmethyl cellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents which render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening, flavoring, coloring, perfuming and preservative agents. Each such ingredient or material must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a chosen dosage form and method of administration may be determined using ordinary skill in the art.
• The pharmaceutical compositions of the present invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, powders, granules, a solution or a suspension in an aqueous or non-aqueous liquid, an oil-in-water or water-in-oil liquid emulsion, an elixir or syrup, a pastille, a bolus, an electuary or a paste. These formulations may be prepared by methods known in the art, e.g., by means of conventional pan-coating, mixing, granulation or lyophilization processes.
• Solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like) may be prepared, e.g., by mixing the active ingredient(s) with one or more pharmaceutically-acceptable diluents or carriers and, optionally, one or more fillers, extenders, binders, humectants, disintegrating agents, solution retarding agents, absorption accelerators, wetting agents, absorbents, lubricants, and/or coloring agents. Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using a suitable excipient. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using a suitable binder, lubricant, inert diluent, preservative, disintegrant, surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine. The tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein. They may be sterilized by, for example, filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of a composition such that they release the active ingredient only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. The active ingredient can also be in microencapsulated form.
• Liquid dosage forms for oral administration include pharmaceutically-acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. The liquid dosage forms may contain suitable inert diluents commonly used in the art. Besides inert diluents, the oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents. Suspensions may contain suspending agents.
• The pharmaceutical compositions of the present invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more active ingredient(s) with one or more suitable nonirritating diluents or carriers which are solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. The pharmaceutical compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such pharmaceutically-acceptable diluents or carriers as are known in the art to be appropriate.
• Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent(s)/compound(s) may be mixed under sterile conditions with a suitable pharmaceutically-acceptable diluent or carrier. The ointments, pastes, creams and gels may contain excipients. Powders and sprays may contain excipients and propellants.
• The pharmaceutical compositions of the present invention suitable for parenteral administrations may comprise one or more agent(s)/compound(s) in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain suitable antioxidants, buffers, solutes which render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption.
• In some cases, in order to prolong the effect of a drug (e.g., pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility.
• The rate of absorption of the active agent/drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered agent/drug may be accomplished by dissolving or suspending the active agent/drug in an oil vehicle. Injectable depot forms may be made by forming microencapsule matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue. The injectable materials can be sterilized for example, by filtration through a bacterial-retaining filter.
• The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid diluent or carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.
• The present invention provides treatment of cancer which is refractory or resistant to non-ERK MAPK pathway inhibitor therapy and discloses combinations shown to enhance the effects of ERK inhibitors. Herein, applicants have also shown that the combination of different ERK inhibitors is likewise synergistic. Therefore, it is contemplated that the effects of the combinations described herein can be further improved by the use of one or more additional ERK inhibitors. Accordingly, some embodiments of the present invention include one or more additional ERK inhibitors.
• The present invention also provides a method of treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.
• In some embodiments of the invention, the mutation is a BRAF^V600E mutation.
• The present invention also provides a composition for treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle.
• The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.
EXAMPLES Example 1 Materials and Methods
• Cancer cell lines were maintained in cell culture under standard media and serum conditions. For dose escalation studies, A375 cells were split, grown to about 40-60% confluence, and then treated with the initial dose of the specified drug. Table 4 shows a summary of drug treatments that were escalated.

• TABLE 4
  Summary of Treatments Being Escalated

  	Treatment	Inhibitor
  	1	Trametinib (MEKi)
  	2	Dabrafenib (BRAFi)
  	3	BVD-523 (ERKi)
  	4	Dabrafenib (BRAFi) + Trametinib (MEKi)
  	5	Dabrafenib (BRAFi) + BVD-523 (ERKi)
  	6	Trametinib (MEKi) + BVD-523 (ERKi)

• Single agent dose escalations were performed based on Little et al., 2011 and are outlined in FIG. 20. Cells were then allowed to grow until 70-90% confluence and split. Split ratios were kept as “normal” as possible and reasonably consistent between treatments (e.g. a minimum of 50% of the normal split ratio of the parentals). Medium was refreshed every 3-4 days. When cells again reached about 40-60% confluence, the dose was escalated. In the event that the 40-60% window was missed, the cells were split again and dosed once they reached 40-60% confluence. Again, medium was refreshed every 3-4 days. The process was repeated as required (FIG. 20).
• For single agent treatments, starting concentrations and dose increases were conducted by starting with the approximate IC₅₀, escalating in small increments or, gently, for the initial 4-5 doses, doubling the dose, increasing by the same increment for the next 4 doses, then moving to 1.5-fold increases in concentration for subsequent doses.
• For combination treatments, starting concentrations and dose increases were conducted by starting with half of the approximate IC₅₀ of each compound (combination assay suggests this will result in about 40-70% inhibition range), escalating as per single agents (i.e. doing an initial doubling and then increasing by the same increment for the next 4 doses, then moving to 1.5-fold increases in concentration). Table 5 shows the projected dose increases using these schemes.

• TABLE 5
  Projected Dose Increases-Month 1

  Dab/Tram

  Dab/523

  Tram/523

  	Tram	Dab	BVD-523	Dab	Tram	Dab	523	Tram	523
  Dose	(nM)	(nM)	(μM)	(nM)	(nM)	(nM)	(μM)	(nM)	(μM)

  1	1	5	0.16	2.5	0.5	2.5	0.08	0.5	0.08
  2	2	10	0.32	5	1	5	0.16	1	0.16
  3	3	15	0.48	7.5	1.5	7.5	0.24	1.5	0.24
  4	4	20	0.64	10	2	10	0.32	2	0.32
  5	5	25	0.80	12.5	2.5	12.5	0.40	2.5	0.40
  6	8	38	1.2	19	4	19	0.6	4	0.6
  7	11	56	1.8	28	6	28	0.9	6	0.9
  8	17	84	2.7	42	8	42	1.4	8	1.4
  9	25	127	4.1	63	13	63	2.0	13	2.0
  10	38	190	6.1	95	19	95	3.0	19	3.0
  11	57	285	9.1	142	28	142	4.6	28	4.6
  12	85	427	13.7	214	43	214	6.8	43	6.8
  13	128	641	20.5	320	64	320	10.3	64	10.3
  14	192	961	30.8	481	96	481	15.4	96	15.4
  15	288	1442	46.1	721	144	721	23.1	144	23.1
  16	432	2162	69.2	1081	216	1081	34.6	216	34.6
  17	649	3244	103.8	1622	324	1622	51.9	324	51.9
  18	973	4865	155.7	2433	487	2433	77.8	487	77.8
  19	1460	7298	233.5	3649	730	3649	116.8	730	116.8
  20	2189	10947	350.3	5474	1095	5474	175.2	1095	175.2

• Clonal resistant cell populations were derived from resistant cell pools by limiting dilution.
• Proliferation assays were used to track changes in sensitivity to the escalated agent(s) at appropriate time intervals (e.g. each month, although the timing is dependent on adequate cell numbers being available). For proliferation assays, cells were seeded in 96-well plates at 3000 cells per well in drug-free DMEM medium containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Compounds were prepared from DMSO stocks to give a final concentration range as shown in FIG. 2A-FIG. 2H. The final DMSO concentration was constant at 0.1%. Test compounds were incubated with the cells for 96 hours at 37° C. and 5% CO₂ in a humidified atmosphere. Alamar Blue 10% (v/v) was then added and incubated for 4 hours and fluorescent product was detected using a BMG FLUOstar plate reader. The average media only background value was deducted and the data analyzed using a 4-parameter logistic equation in GraphPad Prism. Paclitaxel was used as a positive control.
• Proliferation assays for month 1 were initiated at day 28 using cells growing in the concentrations of each agent indicated in Table 6.

• TABLE 6
  Initial Concentrations of Drugs Used
  in Proliferation Assays-Month 1

  	Line	Dab	Tram	BVD-523
  	Parental	—	—	—
  	Tram	—	2 nM	—

  Dab

  15

  nM

  —

  —

  BVD-523

  —

  —

  0.48 μM

  	Tram + Dab	5	nM	1 nM	—
  	Dab + BVD-523	7.5	nM	—	0.24 μM

  	Tram + BVD-523	—	1 nM	0.16 μM

• Proliferation assays for month 2 were initiated at day 56 using cells growing in the concentrations of each agent indicated in Table 7.

• TABLE 7
  Initial Concentrations of Drugs Used
  in Proliferation Assays-Month 2

  	Line	Dab	Tram	BVD-523
  	Parental	—	—	—
  	Tram	—	8 nM	—
  	Dab	127 nM	—	—
  	BVD-523	—	—	0.8 μM
  	Tram + Dab	10 nM	2 nM	—
  	Dab + BVD-523	12.5 nM	—	0.4 μM
  	Tram + BVD-523	—	2 nM	0.32 μM

• At the end of the 3 month escalation period, cultures were maintained at the top concentration for 2 weeks prior to the final round of proliferation assays and potential single cell cloning. As the proliferation assays/single cell cloning required actively proliferating cells, for treatments where cells were proliferating very slowly at the top concentration or that were only recently escalated, a backup culture was also maintained at a lower concentration (Table 8). For the BVD-523 treatment, where cells appeared to have almost completely stopped growing and looked particularly fragile at the top concentration (1.8 μM), cultures were maintained at a lower concentration for the 2 week period.

• TABLE 8
  Details of Treatments Being Cultured
  at a Fixed Concentration for 2 Weeks

  	Treatment	Inhibitor	Culture	1	Backup Culture

  1

  Tram

  160

  nM

  80

  nM

  2

  Dab

  3.2

  μM

  —

  	3	BVD-523	1.2	μM	0.8	μM
  	4	Dab +	D: 160	nM	D:	80	nM
  		Tram	T: 30	nM	T: 16	nM
  	5	Dab +	D: 42	nM	D: 28	nM
  		BVD-523	523: 1.4	μM	523: 0.9	μM
  	6	Tram +	T: 4	nM	T: 2.5	nM
  		BVD-523	523: 0.6	μM	523: 0.4	μM

• Proliferation assays for month 3 used cells growing in the concentrations of each agent indicated in Table 9.

• TABLE 9
  Initial Concentrations of Drugs Used
  in Proliferation Assays-Month 3

  	Line	Dab	Tram	BVD-523
  	Parental	—	—	—

  Tram

  —

  160

  nM

  —

  Dab

  3.2

  μM

  —

  —

  BVD-523

  —

  —

  1.2 μM

  Tram + Dab

  80

  nM

  16

  nM

  —

  Dab + BVD-523

  28

  nM

  —

  0.9 μM

  	Tram + BVD-523	—	2.5	nM	0.4 μM

• For combination studies, A375 cells (ATCC) were seeded into triplicate 96-well plates at a cell density of 3000 cells/well in DMEM plus 10% FBS and allowed to adhere overnight prior to addition of test compound or vehicle control. Combinations were tested using a 10×8 dose matrix with a final DMSO concentration of 0.2%. A 96 hour assay incubation period followed, with subsequent addition of Alamar Blue 10% (v/v) and 4 hours incubation prior to reading on a fluorescent plate reader. After reading Alamar Blue, the medium/Alamar Blue mix was flicked off and 100 μl of CellTiter-Glo/PBS (1:1) added and the plates processed as per the manufacturers instructions (Promega). Media only background values were subtracted before the data was analysed. The Bliss additivity model was then applied.
• In brief, predicted fractional inhibition values for combined inhibition were calculated using the equation C_bliss=A+B−(A×B) where A and B are the fractional inhibitions obtained by drug A alone or drug B alone at specific concentrations. C_bliss is the fractional inhibition that would be expected if the combination of the two drugs were exactly additive. C_bliss values are subtracted from the experimentally observed fractional inhibition values to give an ‘excess over Bliss’ value. Excess over Bliss values greater than 0 indicate synergy, whereas values less than 0 indicate antagonism. Excess over Bliss values are plotted as heat maps ±SD.
• The single and combination data are also presented as dose-response curves generated in GraphPad Prism (plotted using % viability relative to DMSO only treated controls).
• For focused combination studies, the Alamar Blue viability assays were performed as described above for combination studies. Additionally, Caspase-Glo 3/7 assays were performed. In brief, HCT116 cells were seeded in triplicate in white 96-well plates at a cell density of 5000 cells/well in McCoy's 5A plus 10% FBS. A375 cells were seeded at a density of 5000 cells/well in DMEM plus 10% FBS. Cells were allowed to adhere overnight prior to addition of test compound or vehicle control. The final concentration of DMSO was 0.2%, and 800 nM staurosporine was included as a positive control. 24 and 48 hour assay incubation periods were used. Then, Caspase-Glo® 3/7 50% (v/v) was added, plates were mixed for 5 minutes on an orbital shaker and incubated for 1 hour at room temperature prior to reading on a luminescent plate reader. Media only background values were subtracted before the data was analysed.
• For Differential Scanning Fluorimetry, SYPRO orange (5,000× solution, Invitrogen) was diluted (1:1,000) in buffer solution (10 mM HEPES, 150 mM NaCl, pH 7.5). HisX6 tagged proteins included inactive ERK2, active ERK2 (ppERK2), or p38α at a final concentration of 1 μM. The protein/dye solution and compounds in 100% DMSO were added to wells (2% v/v final DMSO concentration) to achieve the desired final concentrations, mixed, and placed into an RT-PCR instrument. Next, a melting curve was run from 25-95° C. at a rate of 1° C. per minute and the melting temperature (Tm) was determined for each protein in the absence or presence of compounds. The change in Tm (ΔTm) in the presence of various drug concentrations is presented.
• For Ki determination of ERK1, activated ERK1 (10 nM) was incubated with various concentrations of the compounds in 2.5% (v/v) DMSO for 10 minutes at 30° C. in 0.1 M HEPES buffer (pH 7.5), 10 mM MgCl₂, 2.5 mM phosphoenolpyruvate, 200 μM nicotinamide adenine dinucleotide (NADH), 150 μg/mL pyruvate kinase, 50 μg/mL lactate dehydrogenase, and 200 μM Erktide peptide. The reaction was initiated by the addition of 65 μM of ATP. Decreased absorbance rate (340 nm) was monitored and the IC₅₀ was determined as a function of inhibitor concentration.
• For Ki determination of ERK2, the inhibitory activity of BVD-523 against ERK2 was determined using a radiometric assay, with final concentration of the components being 100 mM HEPES (pH 7.5), 10 mM MgCl₂, 1 mM dithiothreitol (DTT), 0.12 nM ERK2, 10 μM myelin basic protein (MBP), and 50 μM ³³P-γ-ATP. All reaction components, with the exception of ATP and MBP, were premixed and aliquoted (33 μL) into a 96-well plate. A stock solution of compound in DMSO was used to make up to 500-fold dilutions; a 1.5-μL aliquot of DMSO or inhibitor in DMSO was added to each well. The reaction was initiated by adding the substrates ³³P-γ-ATP and MBP (33 μL). After 20 minutes the reaction was quenched with 20% (w/v) tricholoracetic acid (TCA) (55 μL) containing 4 mM ATP, transferred to the GF/B filter plates, and washed 3 times with 5% (w/v) TCA). Following the addition of Ultimate Gold™ scintillant (50 μL), the samples were counted in a Packard TopCount. From the activity versus concentration titration curve, the Ki value was determined by fitting the data to an equation for competitive tight binding inhibition kinetics using Prism software, version 3.0.
• For IC₅₀ determination of ERK2, activity was assayed by a standard coupled-enzyme assay. The final concentrations were as follows: 0.1 M HEPES (pH 7.5), 10 mM MgCl₂, 1 mM DTT, 2.5 mM phosphoenolpyruvate, 200 μM NADH, 50 μg/mL pyruvate kinase, 10 μg/mL lactate dehydrogenase, 65 μM ATP, and 800 μM peptide (ATGPLSPGPFGRR). All of the reaction components except ATP were premixed with ERK and aliquoted into assay-plate wells. BVD-523 in DMSO was introduced into each well, keeping the concentration of DMSO per well constant. BVD-523 concentrations spanned a 500-fold range for each titration. The assay-plate was incubated at 30° C. for 10 minutes in the plate reader compartment of the spectrophotometer (molecular devices) before initiating the reaction by adding ATP. The absorbance change at 340 nm was monitored as a function of time; the initial slope corresponds to the rate of the reaction. The rate versus concentration of the BVD-523 titration curve was fitted either to an equation for competitive tight-binding inhibition kinetics to determine a value for Ki or to a 3-parameter fit to determine the IC₅₀ using Prism software, version 3.0.
• For apoptosis assays, cells were plated at 2×10⁴ cells per well in a 96-well plate and allowed to attach overnight or grow to 50% confluency. Cells were treated with a serial dilution of BVD-523 in media (final volume 200 μL, concentration ranges 4-0.25 μM) and incubated for 48 hours in a 37° C. CO₂ incubator. Cells were washed with 100 μL of PBS, and 60 μL of radioimmunoprecipitation assay buffer was added (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1.0% [w/v] NP-40, 0.5% [w/v] sodium deoxycholate, 1% [w/v] SDS), then incubated for 10 minutes at 4° C. to lyse the cells. A 30-μL lysate aliquot was added to 100 μL of caspase assay buffer (120 mM HEPES, 12 mM EDTA, 20 mM dithiothreitol, 12.5 μg/mL AC-DEVD-AMC caspase substrate) and incubated at RT from 4 hours to overnight. The plate was read in a fluorimeter (excitation wavelength 360 nm, emission wavelength 460 mm). The remaining 30 μL of lysate was analyzed for total protein content using the BioRad Protein Assay Kit (sample-to-working reagent ratio of 1:8). Final normalized caspase activity was derived as fluorescence units per μg protein and converted to a fold increase in caspase activity when compared with DMSO controls.
• For measurement of antitumor activity in A375 xenografts, xenografts were initiated with A375 cells maintained by serial subcutaneous transplantation in female athymic nude mice. Each test mouse received an A375 tumor fragment (1 mm³) implanted subcutaneously in the right flank. Once tumors reached target size (80-120 mm³), animals were randomized into treatment and control groups, and drug treatment was initiated.
• To evaluate BVD-523 monotherapy, BVD-523 in 1% (w/v) carboxymethylcellulose (CMC) was administered orally, per os (p.o.), BID at doses of 5, 25, 50, 100, or 150 mg/kg. Oral temozolomide was administered as a positive reference compound at 75 or 175 mg/kg once daily (QD) for a total of five treatments (QD×5).
• The efficacy of BVD-523 in combination with dabrafenib was evaluated in mice randomized into 9 groups of 15 and 1 group of 10 (Group 10). Dabrafenib was administered p.o. at 50 or 100 mg/kg QD and BVD-523 was administered p.o. at 50 or 100 mg/kg BID, alone and in combination, until study end; vehicle-treated and temozolomide-treated (150 mg/kg QD×5) control groups were also included. Combination dosing was stopped on Day 20 to monitor for tumor regrowth. Animals were monitored individually and euthanized when each tumor reached an endpoint volume of 2000 mm³, or the final day (Day 45), whichever came first, and median time to endpoint (TTE) calculated. The combination was also evaluated in an upstaged A375 model where larger tumors in the range 228-1008 mm³ were evaluated. Here, mice were randomized into 1 group (Group 1) of 14 and 4 groups (Groups 2-5) of 20. Dosing was initiated on Day 1 with dabrafenib plus BVD-523 (25 mg/kg dabrafenib+50 mg/kg BVD-523 or 50 mg/kg dabrafenib+100 mg/kg BVD-523), with each agent given p.o. BID until study end. The study included 50-mg/kg dabrafenib and 100-mg/kg BVD-523 monotherapy groups as well as a vehicle-treated control group. Tumors were measured twice weekly. Combination dosing was stopped on Day 42 to monitor for tumor regrowth through study end (Day 60). Treatment outcome was determined from % TGD, defined as the percent increase in median TTE for treated versus control mice, with differences between groups analyzed via log rank survival analysis. For TGI analysis, % TGI values were calculated and reported for each treatment (T) group versus the control (C) using the initial (i) and final (f) tumor measurements based on the following formula: % TGI=1−Tf−Ti/Cf−C. Mice were also monitored for CR and PR responses. Animals with a CR at the end of the study were additionally classified as TFS.
• For measurement of BVD-523 activity in Colo205 xenografts, human Colo205 cells were cultured in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/mL streptomycin (Invitrogen), and 2 mM L-glutamine. Cells were cultured for fewer than four passages prior to implantation. Female athymic nude mice (19-23 g) were injected subcutaneously with 2×10⁶ Colo205 cells into the right dorsal axillary region on Day 0.
• Mice with an approximate tumor volume of 200 mm³ were randomized into 6 experimental groups. Vehicle control, 1% CMC (w/v), was prepared weekly. BVD-523 was suspended in 1% (w/v) CMC at the desired concentration and homogenized on ice at 6,500 rpm for 50 minutes. BVD-523 suspensions were prepared weekly and administered p.o. BID at total daily doses of 50, 100, 150, and 200 mg/kg (n=12/group) on an 8- or 16-hour dosing schedule for 13 days. The vehicle control (n=12) was administered using the same dosing regimen. CPT-11 was administered as a positive reference compound (n=12). Each 1 mL of CPT-11 injection contained 20 mg irinotecan, 45 mg sorbitol, and 0.9 mg lactic acid. CPT-11 was administered at 100 mg/kg/day intraperitoneally every 4 days for 2 consecutive doses.
• For measurement of ERK1/2 Isotope-Tagged Internal Standard (ITIS) Mass Spectrometry in Colo205 Xenografts, frozen tumors were lysed in 10 volumes of ice cold lysis buffer (10 mM TRIS-HCl, pH 8.0, 10 mM MgCl₂, 1% (v/v) Triton X-100, Complete™ Protease Inhibitor Cocktail [Roche, cat. No. 1836170], Phosphatase Inhibitor Cocktail I [Sigma, cat. No. P-2850], Phosphatase Inhibitor Cocktail II [Sigma cat. No. 5726], and benzonase [Novagen cat. No. 70664]). Lysates were clarified by centrifugation (100,000×g for 60 minutes at 4° C.) and the supernatants adjusted to 2 mg/mL with lysis buffer. ERK1 was immunoprecipitated using agarose-coupled and pan-anti-ERK1 (Santa Cruz Biotechnology cat. No. sc-93ac) antibodies. Immunoprecipitated proteins were resolved by SDS-PAGE and stained with SYPRO Ruby (Invitrogen), and the ERK bands excised via razor. Gel slices were washed in 300 μL of 20 mM NH₄HCO₃, diced into small pieces, and placed in Page Eraser Tip (The Nest Group cat no. SEM0007). Gel fragments were reduced and alkylated prior to trypsin digestion. Tryptic fragments were isolated in 75 μL of 50% (v/v) Acetonitrile, 0.2% (v/v) trifluoroacetic acid and the resulting sample concentrated to 0-10 μL in a SpeedVac.
• For ITIS analysis, digested samples were spiked with heavy-atom labeled peptide standards and fractional phosphorylation was quantified by coupled liquid chromatography-tandem mass spectrometry (MS). Nanocapillary chromatography was performed using a Rheos 2000 binary pump from Flux Instruments delivering nanoscale flow after 1:750 splitting, an LC Packings Inertsil nano-precolumn (C18, 5 mm, 100 Å, 30 mm ID×1 mm), and a New Objective PicoFrit AQUASIL resolving column (C18, 5 mm, 75/15 mm ID×10 cm), which also served as an electrospray ionization (ESI) emitter. An Applied Biosystem API 3000 mass spectrometer coupled with a nano-ESI source was used for MS analysis. An in-house-made gas nozzle connected to a nebulizing gas source was used to help steady nano-flow spray. Data were acquired in a multiple reaction monitoring (MRM) mode: nebulizing gas at 3; curtain gas at 7; collision gas at 5; ion spray voltage at 2150 volts, exit potential at 10 volts; Q1/Q3 resolution Low/Unit; and dwell time of 65 msec for all MRM channels. All raw MS data were processed using a combination of the Analyst software suite from Applied Biosystem and custom tools.
• For assessment of drug sensitivity in cell-line models of acquired resistance, drug sensitivity of dose-escalated A375 cells and isogenic RKO cells was assessed in 96-hour proliferation assays. RKO isogenic cells (McCoy's 5A containing 10% [v/v] FBS) or dose-escalated A375 cells (DMEM containing 10% FBS were seeded into 96-well plates and allowed to adhere overnight prior to addition of compound or vehicle control. Note that the dose-escalated A375 cells were seeded in the absence of inhibitor. Compounds were prepared from 0.1% (v/v) DMSO stocks to give a final concentration as indicated. Test compounds were incubated with the cells for 96 hours at 37° C. in a 5% CO₂ humidified atmosphere. For the RKO cells, CellTiter-Glo® reagent (Promega) was added according to manufacturer's instructions and luminescence detected using a BMG FLUOstar plate reader. For the A375 assays Alamar blue (ThermoFisher) 10% (v/v) was added and incubated for 4 h, and fluorescent product was then detected using a BMG FLUOstar. The average media only background value was deducted and the data analyzed using a 4-parameter logistic equation in GraphPad Prism.
• IC₅₀ Determination of ERK1 was measured in a final reaction volume of 25 μL. ERK1 (human) (5-10 mU) was incubated with 25 mM Tris (pH 7.5), 0.02 mM ethyleneglycoltetracetic acid, 250 μM peptide, 10 mM Mg acetate, and γ-³³P-ATP (specific activity approximately 500 cpm/pmol, concentration as required). Adding Mg ATP initiated the reaction. After incubation for 40 minutes at room temperature (RT), the reaction was stopped by adding 5 μL of a 3% (w/v) phosphoric acid solution. Then, 10 μL of the reaction was spotted onto a P30 filtermat, and washed 3 times for 5 minutes in 75 mM of phosphoric acid then once in methanol before drying and scintillation counting.
• RKO MEK1 Q56P Isogenic cells were produced by Horizon Discovery (Cambridge, UK; #HD 106-019) using a recombinant AAV-mediated gene targeting strategy. Briefly, rAAV virus was generated following transfection of the appropriate targeting vector and helper vectors in HEK293T cells, purified using an AAV purification kit (Virapur, San Diego, USA) and titrated using qPCR. Parental homozygous RKO cells (homozygous wild type for MEK1) were then infected with rAAV virus and clones that had integrated the selection cassette were identified by G418 selection and expanded. Correctly targeted clones that were heterozygous for knock-in of the MEK1 Q56P point mutation into a single allele were identified by PCR and sequencing.
• Isogenic SW48 cell lines heterozygous for knock-in of mutant KRAS (De Roock et al 2010, JAMA, 304, 1812-1820) were obtained from Horizon Discovery (Catalogue numbers; HD 103-002, HD 103-006 HD 103-007, HD 103-009, HD 103-010, HD 103-011, HD 103-013). For proliferation assay, cells were seeded into 96-well plates in McCoy's 5A medium supplemented with 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Test compounds were incubated with the cells for 96 hours at 37° C. in a 5% CO₂ atmosphere. Viability was then assessed using Alamar blue.
• The proprietary KinaseProfiler assay was conducted at Upstate Discovery and employed radiometric detection similar to that employed by Davies et al, was used to profile the selectivity of BVD-523 against a panel of 70 kinases.
• A drug sensitivity analysis was carried out as part of The Genomics of Drug Sensitivity in Cancer Project using high-throughput screening, as previously described (Yang et al. 2013).
• For Western blot analysis, A375 cells were seeded onto 10 cm dishes in Dulbecco's Modified Eagle's Medium plus 10% (v/v) FBS. Cells were allowed to adhere overnight prior to the addition of test compound or vehicle. For experiments with RKO cells, these cells were seeded in 6-well plates or 10 cm dishes with McCoy's 5A+10% (v/v) FBS. Cells were then treated at the desired concentration and duration. Cells were harvested by trypsinization, pelleted, and snap frozen. Lysates were prepared with RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Roche), clarified by centrifugation at 11,000 rpm for 10 minutes, and quantitated by bicinchoninic acid assay. Samples were resolved by SDS-PAGE, blotted onto polyvinylidene difluoride membranes, and probed using antibodies (i.e., pRB [Ser780], cat. no. 9307; CCND1, cat. no. ab6152; BCL-xL, cat. no. 2762; PARP, cat. no. 9542; DUSP6, cat. no. 3058S) directed to the indicated targets.
• For Reverse Phase Protein Analysis (RPPA), A375, MIAPaCa-2, HCT116, Colo205, HT-29, and AN3Ca cells (ATCC) were plated at 80% confluence, allowed to recover overnight (MIAPaCa-2 cells were plated at 30% confluence and allowed to recover for 3 days), then treated with 10 μM of each compound (i.e., BVD-523, SCH722984, GDC-0994, or Vx-11e) for 6 hours at 37° C. Control wells were treated with DMSO at 0.1% (v/v) for 6 hours prior to cell lysate generation. Samples were then analyzed using reverse-phase protein microarray technology (Theranostics Health).
• For analysis of pERK IHC in Colo205 xenografts, xenograft tumors were processed overnight in 70% through 100% graded ethanols, cleared in two changes of xylene, infiltrated with paraffin, and embedded into paraffin blocks. Then, 5-μm sections were cut and placed onto positively charged glass slides and baked for at least 30 minutes, but not longer than 1 hour, at 60° C. A single section from each animal and dose group was probed with anti-phospho p42/p44 MAPK antibody (pERK [1:100], CST; Cat no. 9101; Lot no. 16), counterstained with hematoxylin, and then analyzed microscopically using a Zeiss Axioplan 2 microscope. An isotype control (rabbit, Zymed laboratories, catalog no. 08-6199, lot no. 40186458) was run as a negative control.
• For FACS analysis, cells were scraped and pelleted at 1,500 rpm for 5 minutes, then re-suspended in 1 mL of buffer and frozen at −70° C. The frozen cells were thawed and centrifuged again, followed by 10 minutes of re-suspension in 0.25 mL of Buffer A (trypsin in spermine tetrahydrochloride detergent buffer) to disaggregate cell clumps and digest cell membranes and cytoskeletons. Buffer B (trypsin inhibitor and Ribonuclease I in buffer, 0.2 mL) was added for 10 minutes in the dark. The resulting DNA-stained nuclei were filtered and analyzed by FACS. The histograms were analyzed to establish the proportion of cells in the G1, S, and G2/M phases of the cell cycle based on the presence of n and 2n DNA (or higher) content.
• For measurement of in vitro combination activity, five thousand G-361 cells were seeded into triplicate 96-well plates containing McCoy's 5A with 10% (v/v) FBS and allowed to adhere overnight. The vemurafenib/BVD-523 combination was tested using a 10×8 dose matrix. Compounds were incubated with the cells for 72 hours at 37° C. in a 5% CO₂ humidified atmosphere. CellTiter-Glo reagent was added according to manufacturer's instructions and luminescence detected using a MBG FLUOstar plate reader. The interactions across the dose matrix were determined by the Loewe Additivity and Bliss independence models using Horizon's Chalice Combination Analysis Software.
• For generating compound resistance in vitro by dose escalation, A375 parental cells (ATCC CRL-1619) were grown to ˜40-60% confluence in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% heat-inactivated FBS and penicillin/streptomycin, then treated with initial doses of BVD-523, trametinib, or dabrafenib either alone or in combination at or slightly below each compound's IC₅₀; for combination studies, initial dosing was half of each compound's IC₅₀. Cells were allowed to grow until ˜70-90% confluence and split; medium was refreshed every 3-4 days. When cells again reached ˜40-60% confluence, the dose was escalated by the same increment (equivalent to the starting concentration) then moved to 1.5-fold increases in concentration followed by a further move to 2-fold increases if the cells continued to adapt rapidly (e.g., the first six doses of the dabrafenib escalation were: 5, 10, 15, 20, 25, and 37.5 nM). This process was repeated as required.
• Cell viability assays for FIG. 30A were performed by a Resazurin (Alamar Blue) metabolic assay after 5 days in drug in full serum under high glucose conditions. Cells were seeded in 384-well microplates at ˜15%-50% confluence in medium with 10% FBS and penicillin/streptavidin plus high glucose (18-25 mM). The optimal cell number for each cell line was determined to optimize growth during drugging. For adherent cell lines, after overnight incubation cells were treated with 9 concentrations of each compound (2-fold dilutions series) using liquid handling robotics, and returned to the incubator for assay at a 96-h time point. For suspension cell lines, cells were treated with compound immediately after plating and returned to the incubator for a 96-h time point. Cells were then stained with 55 μg/ml Resazurin (Sigma) prepared in glutathione-free media for 4 hours. Quantitation of fluorescent signal intensity was performed using a fluorescent plate reader at excitation and emission wavelengths of 535/595 nm for Resazurin. All screening plates were subjected to stringent quality control measures. Effects on cell viability were measured and a curve-fitting algorithm was applied to the raw dataset to derive a multi-parameter description of drug response, including the half maximal inhibitory concentration (IC₅₀). IC₅₀ is expressed in natural log of the IC₅₀ in μM (LN_IC₅₀; EXP returns IC₅₀ in μM). Extrapolation of the IC₅₀ was allowed for where it yielded very high values. If desired the data was restricted to the tested concentration range by capping IC₅₀ values at the maximum tested concentration (and the minimum tested concentration for low values).
• For efficacy testing of BVD-523 in a patient-derived xenograft (AT052C) representing melanoma from a BRAF^V600E patient that had become clinically refractory to vemurafenib. Tumor fragments were harvested from host animals and implanted into immune-deficient mice. The study was initiated at a mean tumor volume of approximately 170 mm³, at which point the animals were randomized into four groups including a control (1% [v/v] CMC p.o., BID×31) and three treatment groups (BVD-523 [100 mg/kg], dabrafenib [50 mg/kg], or BVD-523/dabrafenib [100/50 mg/kg], n=10/group); All treatment drugs were administered p.o. on a BID×31 schedule.
• For IC₅₀ determination for the inhibition of PMA-stimulated RSK1 phosphorylation by BVD-523 in human whole blood samples, IC₅₀ values for the inhibition of PMA stimulated RSK1 phosphorylation by BVD-523 were determined for 10 healthy donors (aged 22-61 years) using an 8-point concentration curve ranging from 10 μM to 5 nM of BVD-523. Controls consisted of 3 unstimulated samples and 3 PMA-stimulated samples for each donor. Both phosphor-RSK (pRSK) and total RSK levels were determined and data were calculated using pRSK/RSK levels for each sample.
• Thirty milliliters of blood was drawn from each donor into sodium heparin vacutainers. One mL of whole blood was added to each of twenty-two 2-mL microtubes per donor. The microtubes tubes were labeled with the donor number (1 through 10) and the subsequent treatment designation: “A” for PMA stimulation only (maximum), “B” for BVD-523-containing samples that received PMA stimulation; and “C” for the unstimulated samples (minimum). Dimethyl sulfoxide (DMSO) was added to all tubes in groups A and C to a final concentration of 0.1%. Samples were then rocked gently at room temperature.
• BVD-523 (10 mM in 100% DMSO) was serially diluted with 3-fold dilutions into 100% DMSO. These serially diluted BVD-523 samples in 100% DMSO were then diluted 10-fold in Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum and penicillin/streptomycin/glutamine, and 10 μL of each of these working solutions was added per mL of blood for each designated BVD-523 concentration. Each concentration of BVD-523 was run in duplicate, two 1-mL blood samples each, yielding 16 total samples for the full 8-point concentration curve. Samples were then rocked gently at room temperature for a minimum of 2 hours but not longer than 3 hours.
• Human whole blood samples in groups A and B for all donors were stimulated with PMA at a final concentration of 100 nM for 20 minutes at room temperature. Samples in group C were not treated with PMA but were rocked and handled as all other samples.
• Upon completion of PMA treatment for each sample, peripheral blood mononuclear cells were isolated from the human whole blood. One mL of blood from each sample was gently layered onto 0.75 mL of room-temperature Histopaque 1077 in a 2-mL microcentrifuge tube. The samples were centrifuged for 2 minutes at 16,000×g in an Eppendorf microcentrifuge. The interface and upper layers were removed and added to tubes containing 1 mL of cold Dulbecco's phosphate-buffered saline (DPBS). These samples were then centrifuged for 30 seconds at 16,000×g to pellet the cells. The buffer supernatant was removed by aspiration and the pellets were re-suspended in 1 mL of cold DPBS. The pellets from each sample were then re-pelleted as above. The buffer was removed by aspiration and the pellets were lysed as indicated below.
• Complete lysis buffer consisted of Meso Scale Discovery Tris lysis buffer, 1× Halt Protease inhibitor cocktail, 1× Phosphatase inhibitor cocktail 2, 1× Phosphatase inhibitor cocktail 3, 2 mM phenylmethanesulfonyl fluoride, and 0.1% sodium dodecyl sulfate. Lysis buffer was kept on ice and made fresh for each sample group. Final cell pellets were lysed by the addition of 120 μL of complete lysis buffer. Samples were vortexed until the cell pellet disappeared and then flash frozen on dry ice. Samples were stored at −20° C. prior to measurement of pRSK and total RSK by ELISA.
• For the pRSK ELISA (PathScan), thawed lysates were combined 1:1 with sample diluent (provided in ELISA kit): 120 μL of lysate added to 120 μL of sample diluent in a round bottom 96-well plate. This combination was then transferred to the pRSK microwells at 100 μL per well. For the total RSK ELISA (PathScan), 20 μL of the lysate already diluted 1:1 in sample diluent was further diluted in 200 μL of sample diluent in a round bottom 96-well plate. This combination was then transferred to the total RSK microwells at 100 μL per well. The plates were sealed with a plate seal and incubated 16 to 18 hours at 4° C., a time that was shown to yield the best detection of the target protein. Both ELISAs were developed according to the kit instructions.
• Patients aged ≥18 years were eligible for participation if they had noncurable, histologically confirmed metastatic or advanced stage malignant tumors; an ECOG performance status of 0 or 1; adequate renal, hepatic, bone marrow, and cardiac function; and a life expectancy ≥3 months. Patients may have received up to 2 prior lines of chemotherapy for their metastatic disease. Exclusion criteria were known uncontrolled brain metastases; gastrointestinal conditions which could impair absorption of study medication; history or current evidence/risk of retinal vein occlusion or central serous retinopathy; and concurrent therapy with drugs known to be strong inhibitors of CYP1A2, CYP2D6, and CYP3A4 or strong inducers of CYP3A4. All participants provided informed consent prior to initiation of any study procedures.
• Patients that received at least one dose of BVD-523 were included in the analysis using SAS (version 9.3) software. The data cutoff was Dec. 1, 2016. This study is registered with ClinicalTrials.gov, number NCT01781429.
• The present invention presents data from an open-label, multicenter phase I study to assess the safety, pharmacokinetics, and pharmacodynamics of escalating doses of BVD-523 in patients with advanced malignancies. The dosing regimen combined both accelerated titration and standard cohort 3+3 dose escalation schema, which were used jointly to identify the MTD and RP2D of BVD-523 in patients with advanced solid tumors. One to 6 patients per treatment cohort were assigned to receive sequentially higher oral doses of BVD-523 on a BID schedule (12-hour intervals) in 21-day cycles, starting at a dose of 10 mg BID. BVD-523 was administered BID continuously in 21-day cycles at the following doses: 10 mg (n=1); 20 mg (n=1); 40 mg (n=1); 75 mg (n=1); 150 mg (n=1); 300 mg (n=4); 600 mg (n=7); 750 mg (n=4); and 900 mg (n=7).
• Patients received BID oral doses until disease progression, unacceptable toxicity, or a clinical observation satisfying another withdrawal criterion. Dose escalations occurred in up to 100% increments in single-patient cohorts until 1 patient experienced a ≥Grade 2 toxicity (excluding alopecia or diarrhea). Cohorts were then expanded to at least 3 patients each and subsequent dose-escalation increments were reduced from up to 100% to a maximum of 50%. When at least 1 patient in a 3-patient cohort experienced a DLT, up to 3 additional patients were treated at this dose level. When more than 1 DLT occurred in ≤6 patients, this dose level was defined as the nontolerated dose and dose escalation was stopped. Intrapatient dose escalation was allowed, provided the patients receiving the highest current dose had been observed for at least 3 weeks and dose-limiting side effects were reported in fewer than 2 of 6 patients assigned to a given dose. Patients experiencing DLTs or unacceptable toxicity had their treatment interrupted until the toxicity returned to ≤Grade 1. Resumption of BVD-523 treatment was then initiated at the next lower dose level tested or at a 20% to 30% dose decrease, aligning with capsule dosage.
• The primary objective of the phase I study was to define the safety and tolerability of BVD-523 by determining the dose-limiting toxicities, the MTD, and the RP2D. The secondary objectives included the determination of the pharmacokinetic profile of BVD-523 in patients with advanced malignancies and the investigation of any preliminary clinical effects on tumor response, as assessed by physical or radiologic exam using RECIST v1.1. The exploratory objectives included evaluation of pharmacodynamic marker (biomarker) measures and investigation of preliminary clinical effects on tumor response assessed by ¹⁸F-FDG-PET as indicated.
• For determination of MTD, DLT, and RP2D, MTD was defined as the highest dose cohort at which ≤33% of patients experienced BVD-523-related DLTs in the first 21 days of treatment DLT was defined as a BVD-related toxicity in the first 21 days of treatment that resulted in ≥Grade 4 hematologic toxicity for >1 day; Grade 3 hematologic toxicity with complications (e.g., thrombocytopenia with bleeding); ≥Grade 3 nonhematologic toxicity, except untreated nausea, vomiting, constipation, pain, and rash (these become DLTs if the AE persisted despite adequate treatment); or a treatment interruption exceeding 3 days in Cycle 1 (or the inability to being in Cycle 2 for >7 days) due to BVD-523-related toxicity.
• The RP2D could be as high as the MTD and was determined in discussion with the clinical investigators, the medical monitor, and the sponsor. Observations related to pharmacokinetics, pharmacodynamics, and any cumulative toxicity observed after multiple cycles were included in the rationale supporting the RP2D.
• With regard to safety assessments, AEs were defined as any untoward medical occurrence in a patient who was administered a medicinal product that does not necessarily have a causal relationship with BVD-523, and was coded using the MedDRA coding dictionary. An SAE was any untoward medical occurrence that occurred at any dose that resulted in death, was life-threatening, required inpatient hospitalization or prolongation of existing hospitalization, or resulted in persistent or significant disability/incapacity or a congenital anomaly/birth defect. The severity of AEs were graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Grading Scale, version 4.
• Safety evaluations were conducted at baseline, on Days 8, 15, 22, 29, 36, and 43, and, in patients who continued treatment, every 3 weeks or if clinically indicated thereafter. Each evaluation included a physical examination and clinical laboratory studies. Electrocardiograms were repeated if clinically significant and at the discretion of the investigator. The investigators made judgments regarding whether or not AEs were related to study drug and followed up until resolution or stabilization, or the AE was judged to be no longer clinically significant.
• For pharmacokinetic analysis, the pharmacokinetic population consisted of patients who received at least one dose of BVD-523 and had evaluable pharmacokinetic data for plasma and/or urine. Blood samples were collected prior to dosing, and then at 0.5 (±5 min), 1 (±5 min), 2 (±10 min), 4 (±10 min), 6 (±10 min), 8 (±10 min), and 12 (±2 hr) hours on Day 1 (Visit 2; baseline/initiation of treatment) and Day 15 (Visit 4; at steady state) after the morning dose. On Day 22, prior to dose administration, a final blood sample was collected for pharmacokinetic analyses. Urine samples were collected predose and at the 1- to 6-hour and 6- to 12-±2-hour intervals postdose on Days 1 and 15. Plasma and urine samples were analyzed for BVD-523 and metabolites using validated LC/MS/MS methods. Standard pharmacokinetic parameters were obtained using Phoenix WinNonlin (Pharsight) with a noncompartmental method. Relationship between dose and exposure was calculated using standard least-squares regression analysis.
• For pharmacodynamic confirmation of target inhibition by BVD-523, targeted ERK inhibition by BVD-523 was determined by examining pRSK as a target biomarker in human whole blood samples obtained from patients with advanced solid tumors (N=27) who had received different doses of BVD-523 (10-900 mg BID) during the phase I study. The activity of BVD-523 from 4 timepoints (baseline predose, baseline 4 hours postdose, Day 15 predose, and Day 15 4 hours postdose) was expressed as a percent activity (pRSK) of PMA-stimulated blood incubated with BVD-523.
• For measurement of antitumor response, tumor measurements based on physical examination occurred at baseline and on the first day of each treatment cycle. CT and other assessments were made every 2 to 3 cycles. Findings were assessed in accordance with RECIST v1.1: CR was defined as disappearance of all target lesions; PR was defined as a ≥30% decrease in the sum of the longest diameters of target lesions, taking baseline measurements as reference; stable disease was defined as being of neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for progressive disease, taking as reference the baseline measurement. Metabolic response was assessed by visualizing tumor uptake of ¹⁸F-glucose via ¹⁸F-FDG-PET scanning prior to receiving the first dose of BVD-523 and at Day 15 (Visit 4).
Example 2 Dose Escalation and Proliferation Assays—Month 1 Dose Escalation Progress—Month 1
• A375 cells were dose escalated using BVD-523, dabrafenib, and trametinib either as single agents or in combination. Doses were increased in small increments during the first month. Other than a marked reduction in growth rate, cells generally tolerated the escalations well and the doses were planned to be more aggressively escalated using larger increments in month 2. FIG. 1A-FIG. 1C show month 1 progress for the dose escalation studies.
Proliferation Assay Results—Month 1
• Proliferation assays were performed to assess the response of the escalated cells lines vs. parental cell line, to BVD-523, dabrafenib, and trametinib treatments.
• FIG. 2A-FIG. 2H show normalized and raw proliferation assay results from month 1 of the studies. Note that differences in max signals in DMSO controls between different treatments (FIG. 2D, FIG. 2F, and FIG. 2H) suggest differential growth rates between treatments. These differences may influence the responses of lines to inhibitors in the proliferation assays.
• Table 10 shows IC₅₀ data for month 1 of the studies.

• TABLE 10
  IC50 Data-Month 1

  Cell Line, Relative IC50 (nM)

  				BVD-	Dab/	Dab/	Tram/
  Compound	Par*	Tram	Dab		523	Tram	523	523

  Dabrafenib	6	29	about	8	58	68	11
  			161
  Trametinib	0.5	2.2	2.5	0.7	3.9	3.1	2.5
  BVD-523	189	335	350	268	300	412	263
  Paclitaxel	2.2	3.0	3.3	3.4	3.5	3.4	3.4
  *Par = Parental cell line

• There were early hints that cells grown in the presence of escalating doses of dabrafenib or trametinib, either as single agents or in combinations, were exhibiting decreased responses to these two agents in proliferation assays.
• In the early stages of month 2, the growth rate of cells in the dabrafenib only treatment notably increased relative to the early stages of month 1. This enabled an increased rate of progression and suggested that resistance was becoming apparent.
Example 3 Dose Escalation and Proliferation Assays—Month 2 Dose Escalation Progress—Month 2
• The second month of studies saw most treatments move into a phase where doses were increased in greater increments (1.5-fold) compared to the initial gentle escalation phase. The single agent escalation of dabrafenib and trametinib was quickest, with cells growing in concentrations equivalent to 100× parental cell IC₅₀ (FIG. 3A and FIG. 3B). The single agent escalation of BVD-523 progressed more slowly compared to dabrafenib and trametinib (FIG. 3C). See FIG. 3D for a comparison of the single agent escalations. BVD-523 escalated cells had a more “fragile” appearance and there was a greater number of floating cells compared to the dabrafenib and trametinib escalated populations.
• The combined agent escalations progressed more slowly than the single agent treatments. The BVD-523/trametinib combination was particularly effective in preventing cells from progressing.
Proliferation Assay Results—Month 2
• Proliferation assays on single agent escalated dabrafenib and trametinib cell populations revealed modest shifts in the dose response curves, suggesting that an additional period of escalation would be beneficial to further enrich for resistant cells. Interestingly, in the proliferations assay, there was evidence to suggest that cells exposed to BVD-523 grew less well upon inhibitor withdrawal, perhaps indicating a level of addiction.
• FIG. 4A-FIG. 4H show normalized and raw proliferation assay results from month 2 of the studies. Note that differences in max signals in DMSO controls between different treatments (FIG. 4D, FIG. 4F, and FIG. 4H) suggest differential growth rates between treatments. These differences may influence the responses of lines to inhibitors in the proliferation assays.
• FIG. 5A-FIG. 5H show normalized and raw proliferation assay results from month 2 of the studies with a focus on parental and BVD-523 line data only.
• Table 11 shows IC₅₀ data for month 2 of the studies. Relative IC₅₀s were determined from 4-parameter curve fits in Prism.

• TABLE 11
  IC50 Data-Month 2

  Cell Line, Relative IC50 (nM)

  				BVD-	Dab/	Dab/	Tram/
  Compound	Par*	Tra	Dab		523	Tram	523	523

  Dabrafenib	4.1	6.2	11.5	697	256	218	68
  Trametinib	0.4	0.7	1.1	24.3	12.6	6.2	4.6
  BVD-523	187	252	284	1706	561	678	435
  Paclitaxel	3.7	8.9	1.9	6.5	4.7	4.2	8.9
  *Par = Parental cell line

Example 4 Dose Escalation and Proliferation Assays—Month 3 Dose Escalation Progress—Month 3
• FIG. 6A-FIG. 6C show single and combination agent escalation for month 3 of the studies. FIG. 6D shows a comparison of single agent escalations.
Proliferation Assay Results—Month 3
• FIG. 7 shows an assessment of growth during the proliferation assay in DMSO control wells. FIG. 8A-FIG. 8D show results from month 3 of the studies. FIG. 9A-FIG. 9D show results from month 3 of the studies with a focus on single treatment cell lines.
• Table 12 shows IC₅₀ data for month 3 of the studies. Relative IC₅₀s were determined from 4-parameter curve fits in Prism. IC₅₀ values were not determined for the cell line escalated with trametinib due to a lack of growth during the assay (ND: not done).

• TABLE 12
  IC50 Data-Month 3

  Cell Line, Relative IC50 (nM)

  				BVD-	Dab/	Dab/	Tram/
  Compound	Par*	Tram	Dab		523	Tram	523	523

  Dabrafenib	2.1	ND	2.5	18.4	17.9	337	73
  Trametinib	0.2	ND	0.4	1.7	2.7	90	11.2
  BVD-523	129	ND	198	433	323	1151	296
  Paclitaxel	1.9	ND	1.9	6.5	4.7	4.2	8.9
  *Par = Parental cell line

• FIG. 19 shows single and combination agent escalation for month 3 of the studies. Cell line variants were obtained that could grow in the presence of dabrafenib or trametinib at concentrations greater than 100 times the IC₅₀ of these agents in parental A375 cell. In comparison, cell lines resistant to BVD-523 could only be maintained in less than 10× of parental IC₅₀ concentration. Sensitivity testing suggested dabrafenib and trametinib-resistant cell lines remained relatively sensitive to BVD-523; the increased IC₅₀ “shift” for BVD-523 in resistant cell lines was more modest than those corresponding IC₅₀ increases following dabrafenib or trametinib treatment. Likewise, compared to dabrafenib or trametinib treatment, more complete inhibition of cell growth was observed when resistant cell lines were treated with BVD-523 at concentrations 10-fold above its IC₅₀ in the parental A375 line. In total, patterns of resistance and cross-sensitivity suggest BVD-523 may remain effective in settings of acquired resistance.
Example 5 Combination Study Results
• As expected, A375 cells, which carry a BRAF (V600E) mutation, were sensitive to dabrafenib. Single agent IC₅₀ values calculated using Alamar Blue (FIG. 10A-FIG. 10E, FIG. 12A-FIG. 12E, and FIG. 14A-FIG. 14E) were generally slightly lower for Dabrafenib and BVD-523 compared to those derived using CellTiter-Glo (FIG. 11A-FIG. 11E, FIG. 13A-FIG. 13E, and FIG. 15A-FIG. 15E). Published IC₅₀ values for Dabrafenib and Trametinib in a 72 hour CellTiter-Glo assay were 28±16 nM and 5±3 nM respectively (Greger et al., 2012; King et al., 2013)—the single agent results reported here are consistent with these values. There was some evidence for a window of synergy in all treatments. Variation between triplicates was low, however, there was some evidence of edge effects that likely explains the apparent enhanced growth observed in some treatments versus the no drug control (e.g. particularly apparent in the Trametinib/BVD-523 combination). This makes the interpretation of the Bliss analysis more challenging as in some treatments it may have resulted in the artefactual enhancement in the level of synergy.
• The combination assays were repeated for A375 cells. Single agent BVD-523, Trametinib and Dabrafenib potencies were consistent with those reported in the previous studies disclosed herein.
• In sum, taken together the data show that MEK and BRAF resistant cells could be overcome by treatment with the ERK inhibitor, BVD-523.
Example 6 BVD-523 Altered Markers of MAPK Kinase Activity and Effector Function
• For Western blot studies, HCT116 cells (5×10⁶) were seeded into 10 cm dishes in McCoy's 5A plus 10% FBS. A375 cells (2.5×10⁶) were seeded into 10 cm dishes in DMEM plus 10% FBS. Cells were allowed to adhere overnight prior to addition of the indicated amount of test compound (BVD-523) or vehicle control. Cells were treated for either 4 or 24 hours before isolation of whole-cell protein lysates, as specified below. Cells were harvested by trypsinisation, pelleted and snap frozen. Lysates were prepared with RIPA (Radio-Immunoprecipitation Assay) buffer, clarified by centrifugation and quantitated by bicinchoninic acid assay (BCA) assay. 20-50 μg of protein was resolved by SDS-PAGE electrophoresis, blotted onto PVDF membrane and probed using the antibodies detailed in Table 13 (for the 4-hour treatment) and Table 14 (for the 24-hour treatment) below.

• TABLE 13
  Antibody Details

  					Incu-
  					bation/
  					Block
  	Size		Cat		Con-	Sec-
  Antigen	(kDa)	Supplier	No	Dilution	ditions	ondary

  pRSK1/2	90	Cell	9335	1:1000	o/n 4° C.	anti-
  pS380		Signaling			5%	rabbit
  					BSA
  pRSK1/2	90	Cell	11989	1:2000	o/n 4° C.	anti-
  pS380		Signaling			5%	rabbit
  					BSA
  pRSK-	90	Millipore	04-419	1:40000	o/n 4° C.	anti-
  T359/					5%	rabbit
  S363					BSA
  Total	90	Cell	9333	1:1000	o/n 4° C.	anti-
  RSK		Signaling			5%	rabbit
  					BSA
  pErk 1/2	42/44	Cell	9106S	1:500	o/n 4° C.	anti-
  		Signaling			5%	mouse
  					milk
  Total	42/44	Cell	9102	1:2000	o/n 4° C.	anti-
  ERK		Signaling			5%	rabbit
  					milk
  pMEK1/2	45	Cell	9154	1:1000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					BSA
  Total	45	Cell	9126	1:1000	o/n 4° C.	anti-
  MEK		Signaling			5%	rabbit
  					BSA
  pS6-	32	Cell	2211S	1:3000	o/n 4° C.	anti-
  pS235		Signaling			5%	rabbit
  					milk
  Total S6	32	Cell	2217	1:2000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					milk
  DUSP6	48	Cell	3058S	1:1000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					BSA
  Total	73	BD Bio-	610152	1:2000	o/n 4° C.	anti-
  CRAF		sciences			5%	mouse
  					milk
  pCRAF-	73	Cell	9427	1:1000	o/n 4° C.	anti-
  Ser338		Signaling			5%	rabbit
  					BSA
  pRB	105	Cell	9307	1:2000	o/n 4° C.	anti-
  (Ser780)		Signaling			5%	rabbit
  					BSA
  β-Actin	42	Sigma	A5441	1:500,000	o/n 4° C.	anti-
  					5%	mouse
  					milk

• TABLE 14
  Antibody details

  					Incu-
  					bation/
  					Block
  	Size				Con-	Sec-
  Antigen	(kDa)	Supplier	Cat No	Dilution	ditions	ondary

  pRB	105	Cell	9307	1:2000	o/n 4° C.	anti-
  (Ser780)		Signaling			5%	rabbit
  					BSA
  CCND1	34	Abcam	ab6152	1:500	o/n 4° C.	anti-
  					5%	mouse
  					milk
  Bim-EL	23	Millipore	AB17003	1:1000	o/n 4° C.	anti-
  					5%	rabbit
  					BSA
  Bim-EL	23	Cell	2933	1:1000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					BSA
  BCL-xL	30	Cell	2762	1:2000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					BSA
  PARP	116/	Cell	9542	1:1000	o/n 4° C.	anti-
  	89	Signaling			5%	rabbit
  					milk
  Cleaved	17,	Cell	9664X	1:1000	o/n 4° C.	anti-
  Caspase	19	Signaling			5%	rabbit
  3					milk
  DUSP6	48	Cell	3058S	1:1000	o/n 4° C.	anti-
  		Signaling			5%	rabbit
  					BSA
  pRSK1/2	90	Cell	9335	1:1000	o/n 4° C.	anti-
  pS380		Signaling			5%	rabbit
  					BSA
  pRSK1/2	90	Cell	11989	1:2000	o/n 4° C.	anti-
  pS380		Signaling			5%	rabbit
  					BSA
  pRSK-	90	Millipore	04-419	1:40000	o/n 4° C.	anti-
  T359/					5%	rabbit
  S363					BSA
  Total	90	Cell	9333	1:1000	o/n 4° C.	anti-
  RSK		Signaling			5%	rabbit
  					BSA
  pErk 1/2	42/44	Cell	9106S	1:500	o/n 4° C.	anti-
  		Signaling			5%	mouse
  					milk
  Total	42/44	Cell	9102	1:2000	o/n 4° C.	anti-
  ERK		Signaling			5%	rabbit
  					milk
  B-Actin	42	Sigma	A5441	1:	o/n 4° C.	anti-
  				500,000	5%	mouse
  					milk

• FIG. 16A-FIG. 16D, FIG. 17A-FIG. 17D, and FIG. 18A-FIG. 18D show Western blot analyses of cells treated with BVD-523 at various concentrations for the following: 1) MAPK signaling components in A375 cells after 4 hours; 2) cell cycle and apoptosis signaling in A375 24 hours treatment with various amounts of BVD-523; and 3) MAPK signaling in HCT-116 cells treated for 4 hours. The results show that acute and prolonged treatment with BVD-523 in RAF and RAS mutant cancer cells in-vitro affects both substrate phosphorylation and effector targets of ERK kinases. The concentrations of BVD-523 required to induce these changes is typically in the low micromolar range.
• Changes in several specific activity markers are noteworthy. First, the abundance of slowly migrating isoforms of ERK kinase increase following BVD-523 treatment; modest changes can be observed acutely, and increase following prolonged treatment. While this could indicate an increase in enzymatically active, phosphorylated forms of ERK, it remains noteworthy that multiple proteins subject to both direct and indirect regulation by ERK remain “off” following BVD-523 treatment. First, RSK1/2 proteins exhibit reduced phosphorylation at residues that are strictly dependent on ERK for protein modification (T359/S363). Second, BVD-523 treatment induces complex changes in the MAPK feedback phosphatase, DUSP6: slowly migrating protein isoforms are reduced following acute treatment, while total protein levels are greatly reduced following prolonged BVD-523 treatment. Both of these findings are consistent with reduced activity of ERK kinases, which control DUSP6 function through both post-translational and transcriptional mechanisms. Overall, despite increases in cellular forms of ERK that are typically thought to be active, it appears likely that cellular ERK enzyme activity is fully inhibited following either acute or prolonged treatment with BVD-523.
• Consistent with these observations, effector genes that require MAPK pathway signaling are altered following treatment with BVD-523. The G1/S cell-cycle apparatus is regulated at both post-translational and transcriptional levels by MAPK signaling, and cyclin-D1 protein levels are greatly reduced following prolonged BVD-523 treatment. Similarly, gene expression and protein abundance of apoptosis effectors often require intact MAPK signaling, and total levels of Bim-EL increase following prolonged BVD-523 treatment. As noted above, however, PARP protein cleavage and increased apoptosis were not noted in the A375 cell background; this suggests that additional factors may influence whether changes in BVD-523/ERK-dependent effector signaling are translated into definitive events such as cell death and cell cycle arrest.
• Consistent with the cellular activity of BVD-523, marker analysis suggests that ERK inhibition alters a variety of molecular signaling events in cancer cells, making them susceptible to both decreased cell proliferation and survival.
• In sum, FIG. 16A-FIG. 16D, FIG. 17A-FIG. 17D, and FIG. 18A-FIG. 18D show that BVD-523 inhibits the MAPK signaling pathway and may be more favorable compared to RAF or MEK inhibition in this setting.
• Finally, properties of BVD-523 may make this a preferred agent for use as an ERK inhibitor, compared to other agents with a similar activity. It is known that kinase inhibitor drugs display unique and specific interactions with their enzyme targets, and that drug efficacy is strongly influenced by both the mode of direct inhibition, as well as susceptibility to adaptive changes that occur following treatment. For example, inhibitors of ABL, KIT, EGFR and ALK kinases are effective only when their cognate target is found in active or inactive configurations. Likewise, certain of these inhibitors are uniquely sensitive to either secondary genetic mutation, or post-translational adaptive changes, of the protein target. Finally, RAF inhibitors show differential potency to RAF kinases present in certain protein complexes and/or subcellular localizations. In summary, as ERK kinases are similarly known to exist in diverse, variable, and complex biochemical states, it appears likely that BVD-523 may interact with and inhibit these targets in a fashion that is distinct and highly preferable to other agents.
Example 7 Effects of BVD-523 and Benchmark ERK BRAF and MEK Inhibitors on Viability and MAPK Signalling Single Agent Proliferation Assay
• Cells were seeded in 96-well plates at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Compounds were prepared from DMSO stocks to give the desired final concentrations. The final DMSO concentration was constant at 0.1%. Test compounds were incubated with the cells for 96 h at 37° C., 5% CO₂ in a humidified atmosphere. CellTiter-Glo® reagent (Promega, Madison, Wis.) was added according to manufacturer's instructions and luminescence detected using the BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany). The average media only background value was deducted and the data analysed using a 4-parameter logistic equation in GraphPad Prism (GraphPad Software, La Jolla, Calif.).
Combination Proliferation Assay
• Cells were seeded into triplicate 96-well plates at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of test compound or vehicle control. Combinations were tested using a 10×8 dose matrix. The final DMSO concentration was constant at 0.2%.
• Test compounds were incubated with the cells for 96 h at 37° C., 5% CO₂ in a humidified atmosphere. Cells were stained with Hoechst stain and fluorescence detected as described above. The average media only background value was deducted and the data analysed.
• Combination interactions across the dose matrix were determined by the Loewe Additivity and Bliss independence models using Chalice™ Combination Analysis Software (Horizon Discovery Group, Cambridge, Mass.) as outlined in the user manual (available at chalice.horizondiscovery.com/chalice-portal/documentation/analyzer/home.jsp). Synergy is determined by comparing the experimentally observed level of inhibition at each combination point with the value expected for additivity, which is derived from the single-agent responses along the edges of the matrix. Potential synergistic interactions were identified by displaying the calculated excess inhibition over that predicted as being additive across the dose matrix as a heat map, and by reporting a quantitative ‘Synergy Score’ based on the Loewe model. The single agent data derived from the combination assay plates were presented as dose-response curves generated in Chalice™.

• TABLE 15
  Cell Line Seeding Density

  Seeding density (cells/well)

  		96-well	6-Well	10 cm dish
  	Cell Line	Proliferation	Western	Westerns
  	RKO Parental	1000	1 × 106	2.9 × 106
  	RKO MEK1	1250	Not tested	Not tested
  	(Q56P/+) Clone 1
  	RKO MEK1	1000	7.5 × 105	2 × 106
  	(Q56P/+) Clone 2

Western Blotting
• Cells were seeded into 6-well plates (Experiment 1) or 10 cm dishes (Experiment 2) at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Test compounds were added and incubated with the cells for 4 or 24 h at 37° C., 5% CO₂ in a humidified atmosphere. Cells were harvested by trypsinisation, pelleted by centrifugation and snap frozen on dry ice.
• Lysates were prepared using RIPA buffer (50 mM Tris-hydrochloride, pH 8.0; 150 mM sodium chloride; 1.0% Igepal CA-630 (NP-40); 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulphate; 1× complete EDTA-free protease inhibitor cocktail (Roche, Nutley, N.J.; cat 05 892 791 001); 1×phosSTOP phosphatase inhibitor cocktail (Roche Nutley, N.J.; cat. 04 906 837 001)) and clarified by centrifugation at 11,000 rpm for 10 min in a bench-top centrifuge.
• Total protein in the lysates was quantitated by BCA assay according to the manufacturer's instructions (Pierce™ BCA Protein Assay Kit; Thermo Scientific, Waltham, Mass.; cat. 23225), boiled in sample buffer (NuPAGE LDS Sample Buffer; (Invitrogen, Carlsbad, Calif.; cat. NP0007)) and stored at −80° C.
• Equal amounts of protein (40 μg) were resolved on NuPAGE 4-12% Bis-Tris gels (Invitrogen, Carlsbad, Calif.; cat. WG1402BOX) and blotted onto PVDF membranes using iBlot gel transfer stacks (Invitrogen, Carlsbad, Calif.; cat. IB4010-01) on an iBlot gel transfer device (Invitrogen Carlsbad, Calif.) according to the manufacturer's instructions.
• Blots were probed using the antibodies and block conditions detailed in Table 16. Western blots were developed using Pierce™ ECL2 Western blotting substrate (Thermo Scientific, Waltham, Mass.; cat. 80196) and imaged using a FluorChem M Western blot imager (ProteinSimple, San Jose, Calif.).

• TABLE 16
  Antibodies and Western Blotting Conditions

  	Size				Incubation/block
  Antigen	(kDa)	Supplier	Cat No	Dilution	Conditions	Secondary

  pRSK-T359/S363	90	Millipore	04-419	1:20000	o/n 4° C. 5% BSA	anti-rabbit
  Total RSK	90	Cell Signaling	9333	1:1000	o/n 4° C. 5% BSA	anti-rabbit
  pErk 1/2	42/44	Cell Signaling	9106S	1:500	o/n 4° C. 5% milk	anti-mouse
  Total ERK	42/44	Cell Signaling	9102	1:2000	o/n 4° C. 5% milk	anti-rabbit
  PMEK 1/2	45	Cell Signaling	9154	1:1000	o/n 4° C. 5% BSA	anti-rabbit
  Total MEK	45	Cell Signaling	9126	1:1000	o/n 4° C. 5% BSA	anti-rabbit
  DUSP6	48	Cell Signaling	3058S	1:1000	o/n 4° C. 5% BSA	anti-rabbit
  pRB (Ser780)	105	Cell Signaling	9307	1:2000	o/n 4° C. 5% BSA	anti-rabbit
  CCND1	34	Abcam	ab6152	1:500	o/n 4° C. 5% milk	anti-mouse
  B-Actin	42	Sigma	A5441	1:100,000	o/n 4° C. 5% milk	anti-mouse
  Anti-rabbit	—	Cell Signaling	7074S	1:2000	1 h room temp;	—
  HRP-conjugated					Block matched to
  secondary					primary Antibody
  Anti-mouse	—	Cell Signaling	7076	1:5000	1 h room temp;	—
  HRP-conjugated					Block matched to
  secondary					primary Antibody

• The MEK1 (Q56P) mutation exemplifies a class of clinically relevant MEK1/2 activating mutations known to up-regulate the MAPK pathway and drive acquired resistance to BRAF or MEK inhibitors.
• This study used a pair of RKO BRAF(V600E) cell lines that are isogenic for the presence or absence of a MEK1 (Q56P) activating mutation, to assess the effect that activating MEK mutations have in response to the novel ERK inhibitor BVD-523 versus other benchmark MAPK inhibitors.
• Effects of on cell viability were assessed by quantitating cellular ATP levels using CellTiter-Glo® after 96 h. Single agent assays demonstrated that the double mutant BRAF(V600E)::MEK1(Q56P) cells displayed a markedly reduced sensitivity to inhibition with benchmark clinical BRAF (exemplified by Dabrafenib) or MEK (exemplified by Trametinib) inhibitors relative to the parental BRAF(V600E) cells, which demonstrates the suitability of this isogenic model for recapitulating the acquired resistance known to be associated with this class of mutation in the clinic (Table 17).

• TABLE 17
  Single Agent IC50 Values

  	RKO	RKO MEK1	RKO MEK1
  Compound	Parental	Q56P/+ CI.1	Q56P/+ CI.2

  BVD-523	0.20	0.17	0.18
  SCH772984	0.04	0.14	0.12
  Dabrafenib	n.d.	n.d.	n.d.
  Trametinib	0.006	0.093	0.080
  Paclitaxel	0.002	0.002	0.002
  n.d.—not determined, only a partial dose response achieved

• In contrast, response to BVD-523 was identical in both the parental and double mutant cells, indicating that BVD-523 is not susceptible to this mechanism of acquired resistance.
• These results were identical in two independently derived double mutant BRAF(V600E)::MEK1(Q56P) cell line clones confirming that these differences in response versus the parental cells were specifically related to the presence of the MEK1 mutation rather than an unrelated clonal artifact (FIG. 22A-FIG. 22E). Similar results were also observed with a second mechanistically distinct benchmark ERK inhibitor (SCH772984), which supports the notion that these observations are specifically related to inhibition of ERK and not due to an off-target effect.
• The effect of combining BVD-523 with a BRAF inhibitor (exemplified by Dabrafenib) was also assessed in these cell lines across a matrix of concentrations using the Loewe Addivity or Bliss Independence models with Horizon's Chalice™ combination analysis software (FIG. 23-FIG. 23O and FIG. 24A-FIG. 24O). The presence of potentially synergistic interactions was then assessed by displaying the calculated excess inhibition over that predicted as being additive across the dose matrix as a heat map, and by calculating a ‘Volume Score’ that shows whether the overall response to a combination is synergistic (positive values), antagonistic (negative values) or additive (˜0).
• The results suggest that the BVD-523::Dabrafenib combination was mainly additive in the parental and mutant cell line. In contrast, the combination of a MEK inhibitor (trametinib) plus Dabrafenib, while being mostly additive in the parental cell line, showed strong synergy in the double mutant BRAF(V600E)::MEK1(Q56P) cell line (FIG. 25A-FIG. 25O). Loewe Volumes, Bliss Volumes and Synergy scores for the combinations tested are shown in Tables 18-20, respectively and are shown graphed in FIG. 26A-FIG. 26C.

• TABLE 18
  Loewe Volumes

  	RKO	RKO MEK1	RKO MEK1
  	Parental	(Q56P)-Clone 1	(Q56P)-Clone 2

  BVD-523 × Dabrafenib	3.54	2.88	2.35
  Dabrafenib × SCH772984	5.2	6.79	6.14
  Dabrafenib × Trametinib	5.68	12.6	11.6

• TABLE 19
  Bliss Volumes

  	RKO	RKO MEK1	RKO MEK1
  	Parental	(Q56P)-Clone 1	(Q56P)-Clone 2

  BVD-523 × Dabrafenib	−0.894	0.527	1.42
  Dabrafenib × SCH772984	0.209	4.3	5.07
  Dabrafenib × Trametinib	0.353	10.8	9.87

• TABLE 20
  Synergy Scores

  	RKO	RKO MEK1	RKO MEK1
  	Parental	(Q56P)-Clone 1	(Q56P)-Clone 2

  BVD-523 × Dabrafenib	3.18	2.31	1.77
  Dabrafenib × SCH772984	4.56	5.57	4.36
  Dabrafenib × Trametinib	5.58	11	9.83

• Effects on MAPK pathway signally was assessed by Western blotting. The levels of basal ERK phosphorylation (DMSO samples) was markedly up-regulated in the MEK1(Q56P)-expressing line relative to parental further confirming that this isogenic model faithfully recapitulates the expected phenotype for the expression of MEK activating acquired resistance mutations.
• In the parental BRAF(V600E) RKO cells, a reduced level of RSK1/2 phosphorylation is observed following acute treatment with RAF, MEK and ERK kinase inhibitors at pharmacologically active concentrations. In contrast, isogenic, double mutant BRAFV600E::MEK1Q56P cells do not exhibit reduced RSK phosphorylation following BRAF or MEK inhibitor treatment, while BVD-523 remains effective at similar concentrations (FIG. 27A-FIG. 27I). The dotted lines indicate that the trametinib-treated samples (plus matched DMSO control) and blots are derived from a separate experiment to the BRAFi and BVD-523 treated samples.
• Changes in effector gene signaling consistent with cell growth inhibition patterns are observed following prolonged inhibitor treatment. In parental RKO lines, a reduced level of phosphorylated pRB is observed following prolonged MEK and ERK inhibitor treatment. At the level of pRB modulation, MEK1 mutant lines appear insensitive to low concentration MEK inhibitor treatment, while higher concentrations remain effective. Critically, BVD-523 potency against pRB activity does not appear to be strongly affected by MEK mutation. Surprisingly, RAF inhibitor treatment does not affect pRB status, despite potent inhibition of upstream signaling, in both parental and MEK mutant backgrounds.
• In summary, these results show that BVD-523 is not susceptible to acquired resistance driven by MEK activating mutations such as MEK1 (Q56P). In addition they suggest that in combination the interactions between BVD-523 and BRAFi (exemplified by Dabrafenib) are additive irrespective of the presence of a MEK activating mutation.
Example 8 Combination Interactions Between ERK Inhibitors
• RAF mutant melanoma cell line A375 cells were cultured in DMEM with 10% FBS and seeded into triplicate 96-well plates at an initial density of 2000 cells per well. Combination interactions between ERK inhibitors BVD-523 and SCH772984 were analized after 72 hours as described above in Example 4. Viability was determined using CellTiter-Glo® reagent (Promega, Madison, Wis.) according to manufacturer's instructions and luminescence was detected using the BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany).
• Visualization of the Loewe and Bliss ‘excess inhibition’ heat maps suggested that the combination of BVD-523 and SCH772984 was mainly additive with windows of potential synergy in mid-range doses (FIG. 28A-FIG. 28E).
• In summary, these results suggest that interactions between BVD-523 and SCH772984 are at least additive, and in some cases synergistic.
Example 9 Targeting the MAPK Signaling Pathway in Cancer: Promising Activity with the Novel Selective ERK1/2 Inhibitor BVD-523 (Ulixertinib)
• Treatment strategies for cancer have evolved from classic cytotoxic-based approaches to agents that counteract the effects of genetic lesions that drive aberrant signaling essential to tumor proliferation and survival. For example, the ERK module of the mitogen-activated protein kinase (MAPK) signaling cascade (RAS-RAF-MEK-ERK) (Cargnello and Rouxx 2011) can be engaged by several receptor tyrosine kinases (e.g., EGFR and ErbB-2) in addition to constitutively activated mutations of pathway components such as RAS and BRAF (Gollob et al. 2006). Through aberrant activation of ERK signaling, genetic alterations in RAS or BRAF result in rapid tumor growth, increased cell survival, and resistance to apoptosis (Poulikakos et al. 2011, Corcoran et al. 2010, Nazarian et al. 2010, Shi et al. 2014, Wagle et al. 2011). Activating mutations of RAS family members KRAS and NRAS are found in 30% of all human cancers, with particularly high incidence in pancreatic (Kanda et al. 2012) and colorectal cancer (Arrington et al. 2014). Constitutively activating mutations in the BRAF gene that normally encodes for valine at amino acid 600 have been observed in melanoma, thyroid carcinoma, colorectal cancer, and non-small cell lung cancer (Hall et al. 2014). Cancers bearing genetic mutations that result in changes of the downstream components ERK and MEK have also been reported (Ojesina et al. 2014, Arcila et al. 2015). Alterations that activate the MAPK pathway are also common in the setting of resistance to targeted therapies (Groenendijk et al. 2014). Thus, targeting the MAPK pathway terminal master kinases (ERK1/2) is a promising strategy for tumors harboring such pathway activating alterations (e.g., BRAF, NRAS, and KRAS).
• Three MAPK pathway-targeting drugs have been approved by the US Food and Drug Administration (FDA) for single-agent treatment of nonresectable or metastatic cutaneous melanoma with BRAF^V600 mutations: the BRAF inhibitors vemurafenib and dabrafenib and the MEK inhibitor trametinib. Furthermore, the combination of dabrafenib and trametinib is also approved in this indication (Queirolo et al. 2015 and Massey et al. 2015). An additional MEK inhibitor, cobimetinib, is approved in this indication as part of a combination regimen with BRAF inhibitors. Clinical experience with these drugs validates the MAPK pathway as a therapeutic target. In phase III trials of patients with BRAF^V600-mutant melanoma, the single agents vemurafenib and dabrafenib demonstrated superior response rates (approximately 50% vs. 5-19%) and median progression-free survival (PFS, 5.1-5.3 months vs. 1.6-2.7 months) over cytotoxic chemotherapy (dacarbazine) (Chapman et al. 2011 and Hauschild et al. 2012). Furthermore, clinical use of concomitant BRAF- plus MEK-targeted therapies has demonstrated that simultaneous targeting of different nodes in the MAPK pathway can enhance the magnitude and duration of response. First-line use of BRAF plus MEK-targeted agents (dabrafenib/trametinib or cobimetinib/vemurafenib) further improved median overall survival compared with single-agent BRAF inhibition (Robert et al. 2015, Long et al. 2015, Larkin et al. 2014). Thus, combined BRAF-/MEK-targeted therapy is a valuable treatment option for patients with metastatic melanoma with BRAF^V600 mutations.
• Despite improvements in clinical outcomes seen with BRAF-/MEK-inhibitor combination therapies, durable benefit is limited by the eventual development of acquired resistance and subsequent disease progression, with median PFS ranging from approximately 9 to 11 months. (Robert et al. 2015, Long et al. 2015, Larkin et al. 2014, and Flaherty et al. 2012). Genetic mechanisms of acquired resistance to single-agent BRAF inhibition have been intensely studied, and identification of resistance mechanisms include splice variants of BRAF (Poulikakos et al. 2011), BRAF^V600E amplification (Corcoran et al. 2010), MEK mutations (Wagle et al. 2014), NRAS mutations, and RTK activation (Nazarian et al. 2010 and Shi et al. 2014). Resistance mechanisms in the setting of BRAF-/MEK-inhibitor combination therapy are beginning to emerge and mirror that of BRAF single-agent resistance (Wagle et al. 2014 and Long et al. 2014). These genetic events all share in common the ability to reactivate ERK signaling. Indeed, reactivated MAPK pathway signaling as measured by ERK transcriptional targets is common in tumor biopsies from BRAF inhibitor-resistant patients (Rizos et al. 2014). Furthermore, ERK1/2 reactivation has been observed in the absence of a genetic mechanism of resistance (Carlino et al. 2015). Therefore, the quest to achieve durable clinical benefit has led researchers to focus on evaluating additional agents that target the downstream MAPK components ERK1/2. Inhibiting ERK may provide important clinical benefit to patients with acquired resistance to BRAF/MEK inhibition. ERK family kinases have shown promise as therapeutic targets in preclinical cancer models, including those cancers resistant to BRAF or MEK inhibitors (Morris et al. 2013 and Hatzivassiliou et al. 2012). However, the potential use of such ERK1/2 inhibitors expands beyond acquired-resistance in melanoma.
• Targeting ERK1/2 is a rational strategy in any tumor type harboring known drivers of MAPK, not only BRAF/MEK therapy-relapsed patients. As ERK1 and ERK2 reside downstream in the pathway, they represent a particularly attractive treatment strategy within the MAPK cascade that may avoid upstream resistance mechanisms. Here, preclinical characterization of BVD-523 (ulixertinib) in models of MAPK pathway-dependent cancers is reported, including drug-naïve and BRAF/MEK therapy acquired-resistant models. Results of a phase I dose-finding study of BVD-523 are included as a companion publication in this journal. See, Examples 17-24.
• In the present invention, BVD-523 was shown to be a potent, highly selective, reversible, small molecule ATP-competitive inhibitor of ERK1/2 with in vitro and in vivo anticancer activity.
• BVD-523 (ulixertinib) was identified and characterized as a novel, reversible, ATP-competitive ERK1/2 inhibitor with high potency and ERK1/2 selectivity. BVD-523 caused reduced proliferation and enhanced caspase activity, most notably in cells harboring MAPK (RAS-RAF-MEK) pathway mutations. In in vivo BRAF^V600E xenograft studies, BVD-523 showed dose-dependent growth inhibition and tumor regressions. Interestingly, BVD-523 inhibited phosphorylation of target substrates despite increased phosphorylation of ERK1/2. BVD-523 also demonstrated antitumor activity in models of acquired resistance to single-agent and combination BRAF/MEK targeted therapy. Synergistic antiproliferative effects in a BRAF^V600E-mutant melanoma cell line xenograph model were also demonstrated when BVD-523 was used in combination with BRAF inhibition. These studies suggest that BVD-523 holds promise as a treatment for ERK-dependent cancers, including those whose tumors have acquired resistance to other treatments targeting upstream nodes of the MAPK pathway.
Example 10 Discovery and Initial Characterization of a Novel ERK1/2 Inhibitor, BVD-523 (Ulixertinib)
• Following extensive optimization of leads originally identified using a high-throughput, small-molecule screen (Aronov et al. 2009), a novel adenosine triphosphate (ATP)-competitive ERK1/2 inhibitor, BVD-523 (ulixertinib) was identified (FIG. 29 A). BVD-523 is a potent ERK inhibitor with a Ki of 0.04±0.02 nM against ERK2. It was shown to be a reversible, competitive inhibitor of ATP, as the IC₅₀ values for ERK2 inhibition increased linearly with increasing ATP concentration (FIG. 29B and FIG. 29C). The IC₅₀ remained nearly constant for incubation times ≥10 minutes, suggesting rapid equilibrium and binding of BVD-523 with ERK2 (FIG. 29D). BVD-523 is also a tight-binding inhibitor of recombinant ERK1 (Rudolph et al. 2015), exhibiting a K_i of <0.3 nM.
• Binding of BVD-523 to ERK2 was demonstrated using calorimetric studies and compared to data generated using the ERK inhibitors SCH772984 and pyrazolylpyrrole (Arovov et al. 2007). All compounds bound and stabilized inactive ERK2 with increasing concentration, as indicated by positive ΔTm values (FIG. 29E). The 10- to 15-degree change in ΔTm observed with BVD-523 and SCH-772984 is consistent with compounds that have low-nanomolar binding affinities (Fedorov et al. 2012). BVD-523 demonstrated a strong binding affinity to both phosphorylated active ERK2 (pERK2) and inactive ERK2 (FIG. 29F). A stronger affinity to pERK2 compared with inactive ERK2 was observed. BVD-523 did not interact with the negative control protein p38a MAP kinase (FIG. 29F).
• BVD-523 demonstrated excellent ERK1/2 kinase selectivity based on biochemical counter-screens against 75 kinases in addition to ERK1 and ERK2. The ATP concentrations were approximately equal to the K_m in all assays. Kinases inhibited to greater than 50% by 2 μM BVD-523 were retested to generate K_i values (or apparent Ki; Table 21). Twelve of the 14 kinases had a K_i of <1 μM. The selectivity of BVD-523 for ERK2 was >7000-fold for all kinases tested except ERK1, which was inhibited with a Ki of <0.3 nM (10-fold). Therefore, BVD-523 is a highly potent and selective inhibitor of ERK1/2.

• TABLE 21
  BVD-523 displays selectivity
  for ERK1 and ERK2 kinases.

  	Kinase	Ki (μM)

  	CDK1/cyclinB	0.07a
  	CDK2/cyclinA	0.36
  	CDK5/p35	0.09a
  	CDK6/cycinD3	0.09a
  	ERK1	0.0003
  	ERK2	0.00004
  	GSK3b	0.32
  	JNK2α	0.65a
  	JNK3	1.3
  	P38γ	0.45a
  	P38δ	0.24a
  	ROCKI	11.1
  	ROCKII	0.27a
  	RSK3	0.45
  	aApparent.
  	<50% inhibition at 2 μM: ABL, AKT3, AMPK, AUR1, AUR2, AXL, BLK, CAMKII, CAMKIV, CHK1, CHK2, CK1, CK2, CSK, EGFR, EPHB4, FES, FGFR3, FLT3, FYN, IGF1R, IKKα, IKKβ, IKKi, IRAK4, IRTK, ITK, JAK3, JNK1α 1, KDR, LCK, LYN, cMET, MKK4, MKK6, MKK7β, MLK2, MSK1, MST2, NAK, NEK2, p38α, p38β, p70S6K, PAK2, PDGFRα, PDK1, PKA, PKCα, PKCβ II, PKCγ, PKCi, PKCθ, PRAK, PRK2, cRAF, SGK, SRC, SYK, TAK1, TIE2, ZAP70

Example 11 BVD-523 Preferentially Inhibits Cellular Proliferation and Enhances Caspase-3/7 Activity In Vitro in Cancer Cell Lines with MAPK Pathway-Activating Mutations
• BVD-523 cellular activity was assessed in a panel of approximately 1,000 cancer cell lines of various lineages and genetic backgrounds (FIG. 30A and Table 22). Cell lines were classified as MAPK wild type (wt) or mutant depending on the absence or presence of mutations in RAS family members and BRAF. Although some MAPK-wt cell lines were sensitive to BVD-523, generally BVD-523 inhibited proliferation preferentially in cells with MAPK pathway alterations.
• Next, the growth and survival impact of BVD-523 treatment on sensitive cells was characterized. Fluorescence activated cell sorting (FACS) analysis was performed on BRAF^V600E-mutant melanoma cell line UACC-62 following treatment with BVD-523 at 500 nM or 2000 nM for 24 hours. Treated cells were arrested in the G1 phase of the cell cycle in a concentration-dependent manner (FIG. 30B).
• In addition, caspase-3/7 activity was analyzed as a measure of apoptosis in multiple human cancer cell lines. A concentration- and cell-line-dependent increase in caspase 3/7 was observed following treatment with BVD-523 for 72 hours (FIG. 30C). BVD-523 treatment resulted in pronounced caspase-3/7 induction in a subset of MAPK-activated cell lines harboring a BRAF^V600 mutation (A375, WM266, and LS411N). This is consistent with earlier observations for preferential inhibition of proliferation by BVD-523 in MAPK pathway-mutant cancer cell lines (FIG. 30A).
• To further characterize the mechanism of action and effects on signaling elicited by BVD-523, the levels of various effector and MAPK-related proteins were assessed in BVD-523-treated BRAF^V600E-mutant A375 melanoma cells (FIG. 30D). Phospho-ERK1/2 levels increased in a concentration-dependent manner after 4 and 24 hours of BVD-523 treatment. Despite prominent concentration-dependent increases in pERK1/2 observed with 2 μM BVD-523 treatment, phosphorylation of the ERK1/2 target RSK1/2 was reduced at both 4 and 24 hours, which is consistent with sustained inhibition. Total protein levels of DUSP6, a distal marker of ERK1/2 activity, were also attenuated at 4 and 24 hours. Following 24 hours of treatment with BVD-523, the apoptotic marker BIM-EL increased in a dose-dependent manner, while cyclin D-1 and pRB was attenuated at 2 μM. All effects are consistent with on-target ERK1/2 inhibition.

• TABLE 22
  		Cell			Fitted
  Barcode	Organ	ID	Cell Line	Compound No	MGH_IC500
  026_8049_00277140	Biliary Tract	8049	ETK-1	456	3.525905
  026_664_00277150	Biliary Tract	664	HuCCT1	456	3.600435
  026_653_00278500	Biliary Tract	653	EGI-1	456	4.229085
  026_8204_00278540	Biliary Tract	8204	TGBC24TKB	456	5.609877
  026_8188_00293390	Biliary Tract	8188	TGBC1TKB	456	6.179372
  026_330_00278580	Bone	330	H-EMC-SS	456	0.038629
  026_8047_00283120	Bone	8047	ES7	456	1.846677
  026_8053_00287650	Bone	8053	EW-13	456	2.197657
  026_8227_00288230	Bone	8227	CADO-ES1	456	2.29467
  026_8050_00279380	Bone	8050	EW-1	456	2.409222
  026_306_00278530	Bone	306	SK-ES-1	456	2.4607
  026_305_00277180	Bone	305	U-2 OS	456	2.847932
  026_337_00283440	Bone	337	Hu09	456	2.916396
  26_8227_00304340	Bone	8227	CADO-ES1	456	2.975471
  026_8043_00283110	Bone	8043	ES1	456	2.981717
  026_8142_00282550	Bone	8142	NOS-1	456	3.203574
  026_8055_00290580	Bone	8055	EW-18	456	3.311765
  026_8058_00293350	Bone	8058	EW-3	456	3.365484
  026_339_00277160	Bone	339	NY	456	3.400937
  026_8165_00287690	Bone	8165	SK-PN-DW	456	3.476926
  026_326_00282540	Bone	326	MHH-ES-1	456	3.524605
  026_8048_00279370	Bone	8048	ES8	456	3.530755
  026_331_00278590	Bone	331	HOS	456	3.602447
  026_8045_00282660	Bone	8045	ESS	456	3.665641
  026_8059_00283090	Bone	8059	EW-7	456	3.827217
  026_8201_00282520	Bone	8201	ES3	456	3.982944
  026_8056_00314310	Bone	8056	EW-22	456	4.196343
  026_329_00282700	Bone	329	G-292 Clone A141B1	456	4.264519
  026_324_00278550	Bone	324	CAL-72	456	4.286956
  026_304_00283460	Bone	304	Saos-2	456	4.597501
  026_325_00283060	Bone	325	CAL-78	456	4.650689
  026_1138_00278560	Bone	1138	CS1	456	4.765346
  026_8162_00282560	Bone	8162	SJSA-1	456	4.867747
  026_336_00283430	Bone	336	HuO-3N1	456	4.900372
  026_328_00278600	Bone	328	TC-71	456	5.117725
  026_8054_00282530	Bone	8054	EW-16	456	5.180986
  026_335_00308220	Bone	335	MG-63	456	5.257203
  026_1241_00283070	Bone	1241	CHSA8926	456	5.394244
  026_8044_00279340	Bone	8044	ES4	456	6.158016
  026_8057_00283080	Bone	8057	EW-24	456	6.273162
  026_8051_00285230	Bone	8051	EW-11	456	6.340509
  026_8046_00279351	Bone	8046	ES6	456	6.745328
  026_8146_00285140	Brain	8146	ONS-76	456	1.017095
  026_8009_00285111	Brain	8009	AM-38	456	2.859683
  026_8091_00285281	Brain	8091	KS-1	456	2.979142
  026_388_00285240	Brain	388	MOG-G-CCM	456	3.029922
  026_352_00283150	Brain	352	LN-229	456	3.053877
  026_8214_00290680	Brain	8214	YH-13	456	3.068585
  026_8214_00288290	Brain	8214	YH-13	456	3.531592
  026_358_00293700	Brain	358	D283 Med	456	3.551231
  026_8061_00290830	Brain	8061	GB-1	456	3.686496
  026_374_00283180	Brain	374	U-251 MG	456	3.933399
  026_343_00283160	Brain	343	PFSK-1	456	3.963833
  026_393_00283190	Brain	393	YKG-1	456	3.987729
  026_8028_00287630	Brain	8028	D-263MG	456	4.157483
  026_379_00283140	Brain	379	GAMG	456	4.214093
  026_8019_00293320	Brain	8019	CAS-1	456	4.309856
  026_8001_00285100	Brain	8001	8-MG-BA	456	4.345495
  026_351_00283450	Brain	351	LN-18	456	4.481815
  026_357_00283410	Brain	357	H4	456	4.481909
  026_8085_00293731	Brain	8085	KINGS-1	456	4.48888
  026_350_00284910	Brain	350	M059J	456	4.537622
  026_8015_00308070	Brain	8015	Becker	456	4.548091
  026_8160_00287680	Brain	8160	SF539	456	4.738405
  026_8159_00287670	Brain	8159	SF268	456	4.804304
  026_359_00283100	Brain	359	Daoy	456	4.81575
  026_8217_00290890	Brain	8217	SK-MG-1	456	4.83361
  026_342_00285160	Brain	342	SW 1783	456	4.84471
  026_8029_00288240	Brain	8029	D-336MG	456	4.925588
  026_8030_00295500	Brain	8030	D-392MG	456	4.966575
  026_8089_00287440	Brain	8089	KNS-81-FD	456	5.077406
  026_8138_00285290	Brain	8139	NMC-G1	456	5.086457
  026_8139_00285130	Brain	8139	no-10	456	5.147267
  026_8083_00293720	Brain	8083	KALS-1	456	5.203248
  026_378_00284880	Brain	378	DK-MG	456	5.2953
  026_383_00284900	Brain	383	LN-405	456	5.313289
  026_8032_00293340	Brain	8032	D-542MG	456	5.342096
  026_344_00282720	Brain	344	LNZTA3WT4	456	5.43481
  026_8167_00290910	Brain	8167	SNB75	456	5.474524
  026_8087_00285270	Brain	8087	KNS-42	456	5.484622
  026_354_00287481	Brain	354	U-87 MG	456	5.588679
  026_8140_00285300	Brain	8140	no-11	456	5.608459
  026_8221_00284860	Brain	8221	D-423MG	456	5.731372
  026_348_00283400	Brain	348	DBTRG-05MG	456	5.749405
  026_341_00285310	Brain	341	SW 1088	456	5.805148
  026_356_00283420	Brain	356	Hs 683	456	5.858982
  026_8031_00287640	Brain	8031	D-502MG	456	5.99897
  026_8224_00284870	Brain	8224	D-566MG	456	6.026403
  026_389_00284920	Brain	389	MOG-G-UVW	456	6.074777
  026_341_00283470	Brain	341	SW 1088	456	6.105387
  026_375_00284850	Brain	375	42-MG-BA	456	6.106423
  026_1122_00283170	Brain	1122	SF-295	456	6.112956
  026_8158_00290650	Brain	8158	SF126	456	6.158755
  026_340_00285250	Brain	340	CCF-STTG1	456	6.170298
  026_380_00284890	Brain	380	GMS-10	456	6.23472
  026_354_00290361	Brain	354	U-87 MG	456	6.315816
  026_8063_00290841	Brain	8063	GI-1	456	6.443002
  026_8027_00293330	Brain	8027	D-247MG	456	6.453915
  026_346_00283390	Brain	346	A172	456	6.640511
  026_8089_00291170	Brain	8089	KNS-81-FD	456	7.067458
  026_355_00285180	Brain	355	U-118 MG	456	7.408088
  026_347_00282740	Brain	347	T98G	456	7.802123
  026_417_00271110	Breast	417	DU4475	456	−3.0044
  26_465_00271670	Breast	465	MRK-nu-1	456	1.744742
  026_438_00273540	Breast	438	HCC1599	456	1.968855
  026_435_00271290	Breast	435	HCC1187	456	2.132259
  026_403_00271400	Breast	403	MCF7	456	2.857648
  026_401_00273450	Breast	401	MDA-MB-468	456	3.05753
  26_451_00271640	Breast	451	CAL-85-1	456	3.06898
  026_404_00273430	Breast	404	MDA-MB-231	456	3.086092
  026_418_00271550	Breast	418	Hs 578T	456	3.125956
  026_402_00272120	Breast	402	CAMA-1	456	3.166443
  026_426_00274200	Breast	426	HCC1569	456	3.228782
  026_431_00271130	Breast	431	HCC1806	456	3.337319
  026_414_00271900	Breast	414	AU565	456	3.409308
  026_452_00272130	Breast	452	COLO-824	456	3.645131
  026_416_00271360	Breast	416	BT-549	456	3.723874
  026_8144_00274240	Breast	8144	OCUB-M	456	3.727884
  026_432_00271960	Breast	432	HCC70	456	3.73179
  026_457_00273420	Breast	457	EVSA-T	456	3.968951
  026_466_00274370	Breast	466	YMB-1-E	456	3.997753
  026_441_00285120	Breast	441	HCC2157	456	3.997874
  026_443_00271990	Breast	443	MDA-MB-330	456	4.004084
  026_436_00271300	Breast	436	HCC1395	456	4.036641
  026_412_00277190	Breast	412	UACC-893	456	4.234383
  026_450_00271390	Breast	450	CAL-51	456	4.319545
  026_449_00271380	Breast	449	CAL-148	456	4.389344
  026_434_00271920	Breast	434	HCC1143	456	4.464516
  026_433_00276270	Breast	433	HCC202	456	4.571252
  026_422_00274230	Breast	422	MDA-MB-175-VII	456	4.594595
  026_461_00272170	Breast	461	MFM-223	456	4.656681
  026_427_00271330	Breast	427	MDA-MB-453	456	4.669025
  026_448_00271370	Breast	448	CAL-120	456	4.779687
  026_411_00271420	Breast	411	UACC-812	456	5.072094
  026_442_00273480	Breast	442	HCC2218	456	5.225292
  026_398_00272150	Breast	398	HCC1428	456	5.256241
  026_464_00308490	Breast	464	T47D	456	5.26439
  026_400_00273440	Breast	400	MDA-MB-436	456	5.286367
  026_437_00280161	Breast	437	HCC1500	456	5.288806
  026_440_00271950	Breast	440	HCC1954	456	5.303093
  026_413_00271930	Breast	413	HCC1419	456	5.337084
  026_410_00272180	Breast	410	ZR-75-30	456	5.373081
  026_439_00271940	Breast	439	HCC1937	456	5.44243
  026_408_00271350	Breast	408	BT-20	456	5.735872
  026_399_00272160	Breast	399	MDA-MB-415	456	5.879088
  026_458_00274220	Breast	458	HDQ-P1	456	6.259493
  026_397_00274350	Breast	397	HCC38	456	6.744219
  026_405_00274360	Breast	405	MDA-MB-361	456	6.792889
  026_425_00280231	Breast	425	MDA-MB-157	456	7.000504
  026_454_00272140	Breast	454	EFM-192A	456	7.097342
  026_420_00271541	Breast	420	BT-474	456	7.458914
  026_453_00273410	Breast	453	EFM-19	456	8.207256
  026_415_00316440	Breast	415	BT-483	456	8.21654
  026_8176_00316650	Cervix	8176	TC-YIK	456	0.842618
  026_479_00264920	Cervix	479	HT-3	456	1.420025
  026_478_00271910	Cervix	478	C-33 A	456	2.72591
  026_478_00269410	Cervix	478	C-33 A	456	2.976483
  026_493_00268830	Cervix	493	ME-180	456	3.07379
  026_476_00269050	Cervix	476	C-4 I	456	3.232632
  026_8145_00271140	Cervix	8145	OMC-1	456	3.295968
  026_484_00263710	Cervix	484	Ca Ski	456	3.639931
  026_469_00264610	Cervix	469	HeLa	456	3.981495
  026_493_00262480	Cervix	493	ME-180	456	4.007923
  026_474_00269100	Cervix	474	SiHa	456	4.596545
  026_482_00262520	Cervix	482	SISO	456	5.313141
  026_482_00274250	Cervix	482	SISO	456	5.375837
  026_482_00269740	Cervix	482	SISO	456	5.709731
  026_468_00264600	Cervix	468	DoTc2 4510	456	5.749229
  026_473_00264650	Cervix	473	SW756	456	5.953892
  026_491_00264830	Cervix	491	SKG-IIIa	456	6.261878
  026_476_00264900	Cervix	476	C-4 I	456	6.792994
  026_474_00264930	Cervix	474	SiHa	456	7.505839
  026_472_00264630	Cervix	472	MS751	456	7.679336
  026_8180_00276230	Esophagus	8180	TE-15	456	0.823778
  026_502_00276550	Esophagus	502	KYSE-450	456	1.219587
  026_497_00274050	Esophagus	497	KYSE-150	456	1.304746
  026_8252_00276570	Esophagus	8252	OACp4C	456	1.678468
  026_496_00276530	Esophagus	496	KYSE-140	456	2.209734
  026_8233_00278570	Esophagus	8233	ESO26_	456	2.595405
  026_8184_00282680	Esophagus	8184	TE-6	456	2.946928
  026_8277_00276670	Esophagus	8277	TE-4	456	3.072573
  026_506_00277170	Esophagus	506	OE19	456	3.143883
  026_8179_00276220	Esophagus	8179	TE-12	456	3.163617
  026_8185_00276250	Esophagus	8185	TE-8	456	3.50176
  026_8184_00293680	Esophagus	8184	TE-6	456	3.545508
  026_8178_00280260	Esophagus	8178	TE-10	456	3.804003
  026_499_00276630	Esophagus	499	KYSE-270	456	4.027681
  026_509_00276620	Esophagus	509	KYSE-220	456	4.075564
  026_8235_00276520	Esophagus	8235	FLO-1	456	4.100409
  026_8251_00276640	Esophagus	8251	OACM5-1	456	4.181038
  026_8186_00282690	Esophagus	8186	TE-9	456	4.291684
  026_495_00274190	Esophagus	495	COLO-680N	456	4.332573
  026_510_00273560	Esophagus	510	KYSE-50	456	4.431288
  026_8186_00292740	Esophagus	8186	TE-9	456	4.438695
  026_503_00274070	Esophagus	503	KYSE-510	456	4.484808
  026_504_00276560	Esophagus	504	KYSE-520	456	4.773857
  026_8208_00276600	Esophagus	8208	HCE-4	456	4.88732
  026_512_00274080	Esophagus	512	T.T	456	4.943912
  026_8268_00276650	Esophagus	8268	SK-GT-4	456	5.079273
  026_505_00274210	Esophagus	505	KYSE-70	456	5.137973
  026_508_00278520	Esophagus	508	OE33	456	5.424479
  026_498_00276540	Esophagus	498	KYSE-180	456	5.533652
  026_8202_00276660	Esophagus	8202	TE-11	456	5.740526
  026_8039_00276580	Esophagus	8039	EC-GI-10	456	5.844841
  026_501_00274060	Esophagus	501	KYSE-410	456	6.135532
  026_8246_00276610	Esophagus	8246	KYAE-1	456	6.1525
  026_507_00278510	Esophagus	507	OE21	456	6.23551
  026_8183_00276240	Esophagus	8183	TE-5	456	6.777236
  026_8177_00282670	Esophagus	8177	TE-1	456	7.848711
  026_545_00260020	Head & Neck	545	DOK	456	−0.22061
  026_1217_00255750	Head & Neck	1217	H3118	456	0.314816
  026_526_00308740	Head & Neck	526	PCI-4B	456	1.887412
  026_530_00260620	Head & Neck	530	PCI-30	456	1.98819
  026_552_00252890	Head & Neck	552	SAT	456	2.534279
  026_550_00258980	Head & Neck	550	SCC-4	456	2.544916
  026_1224_00256200	Head & Neck	1224	SCC-9	456	2.68588
  026_1223_00259190	Head & Neck	1223	SCC-25	456	2.934793
  026_548_00261030	Head & Neck	548	RPMI 2650	456	3.095229
  026_517_00308680	Head & Neck	517	JHU-011	456	3.112112
  026_8011_00257080	Head & Neck	8011	BB30-HNC	456	3.217966
  026_553_00259140	Head & Neck	553	OSC-20	456	3.378306
  026_556_00257220	Head & Neck	556	SKN-3	456	3.392608
  026_536_00256080	Head & Neck	536	BHY	456	3.443799
  026_561_00257110	Head & Neck	561	Ca9-22	456	3.710495
  026_532_00308750	Head & Neck	532	PCI-6A	456	3.742916
  026_8012_00266550	Head & Neck	8012	BB49-HNC	456	3.77782
  026_8100_00256170	Head & Neck	8100	LB771-HNC	456	3.926882
  026_1222_00253030	Head & Neck	1222	SCC-15	456	4.189701
  026_533_00260900	Head & Neck	533	PCI-15A	456	4.236361
  26_547_00314070	Head & Neck	547	KOSC-2 cl3-43	456	4.563275
  026_544_00256140	Head & Neck	544	Detroit 562	456	4.601961
  026_543_00256100	Head & Neck	543	BICR 78	456	4.851894
  026_537_00256120	Head & Neck	537	CAL-33	456	5.580216
  026_549_00256220	Head & Neck	549	HO-1-N-1	456	5.63511
  026_557_00259180	Head & Neck	557	SAS	456	6.035072
  026_534_00256110	Head & Neck	534	CAL 27	456	6.045151
  026_542_00269190	Head & Neck	542	BICR 31	456	6.045414
  026_530_00262500	Head & Neck	530	PCI-30	456	6.119674
  026_540_00258490	Head & Neck	540	BICR 10	456	6.128463
  026_541_00256090	Head & Neck	541	BICR 22	456	6.156446
  026_8003_00263440	Head & Neck	8003	A253	456	6.291179
  026_535_00256160	Head & Neck	535	FaDu	456	6.303565
  026_554_00257210	Head & Neck	554	OSC-19	456	6.322489
  026_559_00256250	Head & Neck	559	HSC-3	456	6.797258
  026_8071_00256760	Head & Neck	8071	HCE-T	456	6.917353
  026_521_00257180	Head & Neck	521	JHU-022	456	7.049785
  026_555_00256270	Head & Neck	555	KON	456	7.114386
  026_538_00258510	Head & Neck	538	HN	456	7.118392
  026_546_00259150	Head & Neck	546	PE/CA-PJ15	456	7.26219
  026_560_00256260	Head & Neck	560	HSC-4	456	7.41962
  026_551_00259130	Head & Neck	551	HO-1-u-1	456	7.903602
  026_558_00256240	Head & Neck	558	HSC-2	456	8.185707
  026_531_00258970	Head & Neck	531	PCI-38	456	8.493869
  026_570_00293670	Intestine	570	SK-CO-1	456	−0.30187
  026_8153_00295901	Intestine	8153	RKO	456	0.044041
  18	Intestine	586	COLO 205	456	0.350012
  026_582_00295550	Intestine	582	LoVo	456	0.399717
  026_8108_00298530	Intestine	8108	LS-513	456	0.423432
  026_8274_00258540	Intestine	8274	SNU-61	456	0.467862
  026_8136_00260060	Intestine	8136	NCI-H747	456	0.578701
  026_574_00298390	Intestine	574	CL-11	456	0.894127
  026_589_00295371	Intestine	589	HCT 116	456	0.931657
  026_608_00293620	Intestine	608	CCK-81	456	1.046144
  026_610_00293660	Intestine	610	RCM-1	456	1.475794
  026_569_00295390	Intestine	569	HT-29	456	1.526342
  026_8271_00314300	Intestine	8271	SNU-175	456	1.739925
  026_8108_00296610	Intestine	8108	LS-513	456	1.815428
  026_592_00295380	Intestine	592	HT115	456	1.869689
  026_606_00293630	Intestine	606	HCC-56	456	1.929923
  026_8107_00296450	Intestine	8107	LS-411N	456	2.297731
  026_595_00295420	Intestine	595	LS180	456	2.32965
  026_8169_00295910	Intestine	8169	SNU-C2B	456	2.617884
  026_564_00292860	Intestine	564	NCI-H630	456	2.627492
  026_603_00292731	Intestine	603	SW837	456	2.797981
  026_588_00295360	Intestine	588	GP5d	456	2.925873
  026_598_00302650	Intestine	598	SW 1417	456	3.077195
  026_8276_00296000	Intestine	8276	SNU-C5	456	3.153347
  026_593_00295530	Intestine	593	HT55	456	3.164186
  026_8106_00264670	Intestine	8106	LS-123	456	3.191118
  026_599_00296340	Intestine	599	SW 1463	456	3.237942
  026_8086_00296431	Intestine	8086	KM12	456	3.240654
  026_587_00302320	Intestine	587	COLO 741	456	3.269221
  026_8273_00295970	Intestine	8273	SNU-407	456	3.390403
  026_8270_00304630	Intestine	8270	SNU-1040	456	3.643993
  026_8168_00295990	Intestine	8168	SNU-C1	456	3.717495
  026_8275_00256210	Intestine	8275	SNU-81	456	3.903109
  026_583_00295921	Intestine	583	SW-948	456	3.908038
  026_8274_00295980	Intestine	8274	SNU-61	456	4.14154
  026_8105_00296440	Intestine	8105	LS-1034	456	4.222062
  026_580_00295930	Intestine	580	COLO-678	456	4.449849
  026_580_00266560	Intestine	580	COLO-678	456	4.550688
  026_581_00295830	Intestine	581	HCT-15	456	4.608693
  026_573_00296370	Intestine	573	SW620	456	4.816766
  026_8021_00296390	Intestine	8021	COLO-320-HSR	456	4.87923
  026_8106_00298521	Intestine	8106	LS-123	456	4.895207
  026_600_00296361	Intestine	600	SW 48	456	4.951306
  026_8070_00296411	Intestine	8070	HCC2998	456	4.984157
  026_8135_00295950	Intestine	8135	NCI-H716	456	4.988916
  026_8136_00295961	Intestine	8136	NCI-H747	456	5.220086
  026_574_00263900	Intestine	574	CL-11	456	5.294016
  026_8026_00300671	Intestine	8026_	CW-2	456	5.403672
  026_607_00293610	Intestine	607	CaR-1	456	5.551737
  026_8074_00296420	Intestine	8074	HUTU-80	456	5.701754
  026_563_00316540	Intestine	563	C2BBe1	456	5.783056
  026_596_00296280	Intestine	596	MDST8	456	6.402689
  026_597_00300651	Intestine	597	SW 1116	456	6.447765
  026_601_00296480	Intestine	601	T84	456	7.233631
  026_622_02288160	Kidney	622	G-401	456	1.158385
  026_626_00298790	Kidney	626	BFTC-909	456	1.589633
  026_623_00288201	Kidney	623	SK-NEP-1	456	1.837955
  026_8264_00290630	Kidney	8264	RCC-JF	456	2.377362
  026_619_00290290	Kidney	619	769-P	456	2.463867
  026_627_00291130	Kidney	627	CAL-54	456	2.931844
  026_617_00290310	Kidney	617	ACHN	456	2.983353
  026_8263_00290620	Kidney	8263	RCC-FG2	456	3.111338
  026_8190_00290280	Kidney	8190	TK10	456	3.318654
  026_638_00288220	Kidney	638	VMRC-RCZ	456	3.36569
  026_8261_00308760	Kidney	8261	RCC-AB	456	3.394556
  026_628_00288210	Kidney	628	SW 13	456	3.41636
  026_8262_00290610	Kidney	8262	RCC-ER	456	3.745967
  026_8265_00302360	Kidney	8265	RCC-JW	456	3.749626
  026_8261_00311200	Kidney	8261	RCC-AB	456	3.919417
  026_618_00290300	Kidney	618	786-O	456	3.967789
  026_625_00290670	Kidney	625	UO-31	456	3.998088
  026_8096_00290860	Kidney	8096	LB2241-RCC	456	3.99857
  026_614_00291210	Kidney	614	SW 156	456	4.137243
  026_8249_00295560	Kidney	8249	NCC021	456	4.201277
  026_633_00290250	Kidney	633	KMRC-20	456	4.24311
  026_8068_00290231	Kidney	8068	HA7-RCC	456	4.403879
  026_8095_00290260	Kidney	8095	LB1047-RCC	456	4.460236
  026_626_00258890	Kidney	626	BFTC-909	456	4.464205
  026_8147_00290270	Kidney	8147	OS-RC-2	456	4.480976
  026_8013_00290220	Kidney	8013	BB65-RCC	456	4.50555
  026_8006_00293300	Kidney	8006	A704	456	4.630889
  026_637_00290240	Kidney	637	KMRC-1	456	4.786417
  026_624_00290320	Kidney	624	Caki-1	456	4.808296
  026_8266_00290640	Kidney	8266	RCC-MF	456	4.811179
  026_620_00288170	Kidney	620	G-402	456	4.865533
  026_8152_00293381	Kidney	8152	RCC10RGB	456	5.110675
  026_640_00291220	Kidney	640	VMRC-RCW	456	5.287926
  026_8102_00293360	Kidney	8102	LB996-RCC	456	5.484542
  026_1119_00290901	Kidney	1119	SN-12C	456	5.586587
  026_626_00290810	Kidney	626	BFTC-909	456	5.753321
  026_8005_00266530	Kidney	8005	A498	456	5.843211
  026_8157_00296471	Kidney	8157	RXF393	456	6.166218
  026_8102_00253000	Kidney	8102	LB996-RCC	456	6.306723
  026_8006_00263880	Kidney	8006	A704	456	6.969306
  026_8152_00256190	Kidney	8152	RCC10RGB	456	7.15535
  026_8005_00296380	Kidney	8005	A498	456	8.190783
  026_233_00277420	Leukemia	233	SIG-M5	456	−5.883853
  026_217_00277380	Leukemia	217	OCI-AML2	456	−1.42786
  026_179_00314500	Leukemia	179	KMOE-2	456	−0.249088
  026_214_00285590	Leukemia	214	NB-4	456	−0.011745
  026_168_00280410	Leukemia	168	JURL-MK1	456	0.181843
  026_194_00280680	Leukemia	194	ML-2	456	0.294246
  026_186_00280670	Leukemia	186	LAMA-84	456	0.295979
  026_234_00314650	Leukemia	234	SKM-1	456	0.349518
  026_221_00280300	Leukemia	221	OCT-M1	456	0.656393
  026_260_00280430	Leukemia	260	KO52	456	0.674413
  026_45_00274530	Leukemia	45	HL-60	456	0.756274
  026_218_00279140	Leukemia	218	OCI-AML3	456	0.868641
  026_219_00280290	Leukemia	219	OCI-AML5	456	0.879404
  026_199_00314510	Leukemia	199	MOLT-13	456	0.892109
  026_226_00280310	Leukemia	226	PL-21	456	0.938066
  026_8141_00274380	Leukemia	8141	NOMO-1	456	1.040856
  026_8069_00279180	Leukemia	8069	HAL-01	456	1.147185
  026_68_00273640	Leukemia	68	MV-4-11	456	1.155322
  026_175_00282940	Leukemia	175	KARPAS-620	456	1.190853
  026_89_00278880	Leukemia	89	MEG-01	456	1.211836
  026_8017_00279150	Leukemia	8017	BV-173	456	1.464827
  026_225_00277400	Leukemia	225	PF-382	456	1.646942
  026_285_00282960	Leukemia	285	KY821A3	456	1.656661
  026_8008_00280620	Leukemia	8008	ALL-PO	456	1.659142
  026_177_00276860	Leukemia	177	KE-37	456	1.711407
  026_126_00280270	Leukemia	126	GDM-1	456	1.723253
  026_261_00274440	Leukemia	261	MY-M12	456	1.811821
  026_201_00277390	Leukemia	201	MOLT-16	456	1.821177
  026_148_00277330	Leukemia	148	CMK	456	1.894859
  026_28_00280320	Leukemia	28	SUP-B15	456	1.921651
  026_190_00287920	Leukemia	190	ME-1	456	1.924633
  026_8150_00273700	Leukemia	8150	QIMR-WIL	456	1.928333
  026_8156_00273710	Leukemia	8156	RPMI-8866	456	1.939976
  026_161_00277350	Leukemia	161	HC-1	456	1.948766
  026_195_00279120	Leukemia	195	MOLM-13	456	1.961596
  026_209_00279130	Leukemia	209	NALM-6	456	2.000316
  026_127_00278810	Leukemia	127	CESS	456	2.000616
  026_8196_00278790	Leukemia	8196	697	456	2.032634
  026_223_00276841	Leukemia	223	P12-ICHIKAWA	456	2.094412
  026_157_00279291	Leukemia	157	DND-41	456	2.109279
  026_174_00276850	Leukemia	174	KARPAS-45	456	2.156973
  026_223_00274461	Leukemia	223	P12-ICHIKAWA	456	2.170641
  026_231_00277410	Leukemia	231	RPMI-8402	456	2.171412
  026_176_00278840	Leukemia	176	KCL-22	456	2.178418
  026_198_00279320	Leukemia	198	MOLP-8	456	2.182175
  026_35_00274541	Leukemia	35	MOLT-4	456	2.185513
  26_256_00273800	Leukemia	256	U266B1	456	2.191112
  026_41_00278850	Leukemia	41	KG-1	456	2.260524
  026_38_00278900	Leukemia	38	THP-1	456	2.296961
  026_153_00277340	Leukemia	153	CTV-1	456	2.301756
  26_284_00273770	Leukemia	284	KY821	456	2.31293
  026_256_00304780	Leukemia	256	U266B1	456	2.374209
  026_8033_00279160	Leukemia	8033	DEL	456	2.390133
  026_227_00314640	Leukemia	227	RCH-ACV	456	2.405281
  026_33_00274521	Leukemia	33	CCRF-CEM	456	2.408403
  026_141_00276820	Leukemia	141	K-562	456	2.457405
  026_8137_00273680	Leukemia	8137	NKM-1	456	2.543263
  026_36_00274550	Leukemia	36	Reh	456	2.569808
  026_8042_00285400	Leukemia	8042	EoL-1-cell	456	2.64235
  026_281_00273690	Leukemia	281	P30/OHK	456	2.804566
  026_59_00278820	Leukemia	59	J.RT3-T3.5	456	2.830428
  026_164_00277360	Leukemia	164	HEL	456	2.835925
  026_183_00277370	Leukemia	183	L-363	456	2.864138
  026_90_00282840	Leukemia	90	KU812	456	2.874545
  026_27_00278890	Leukemia	27	RS4; 11	456	2.914096
  026_167_00314490	Leukemia	167	JURKAT	456	2.954834
  026_181_00278860	Leukemia	181	KOPN-8	456	2.957727
  026_8155_00309110	Leukemia	277	RPMI 8226	456	2.959542
  026_8041_00280640	Leukemia	8041	EM-2	456	3.022652
  026_142_00279280	Leukemia	142	ALL-SIL	456	3.085854
  026_277_00280420	Leukemia	277	RPMI 8226	456	3.102844
  026_180_00279310	Leukemia	180	KMS-12-BM	456	3.125028
  026_8066_00279170	Leukemia	8066	GR-ST	456	3.192114
  26_283_00273780	Leukemia	283	LC4-1	456	3.243599
  026_114_00273650	Leukemia	114	SUP-T1	456	3.397019
  026_138_00287901	Leukemia	138	Loucy	456	3.501279
  026_8014_00282911	Leukemia	8014	BE-13	456	3.615529
  26_274_00273860	Leukemia	274	BALL-1	456	3.704228
  026_222_00280480	Leukemia	222	OPM-2	456	3.757754
  026_8164_00283540	Leukemia	8164	SK-MM-2	456	3.790344
  026_166_00278830	Leukemia	166	JJN-3	456	3.901981
  026_230_00282970	Leukemia	230	ROS-50	456	4.130585
  026_159_00314480	Leukemia	159	EJM	456	4.251735
  026_278_00304730	Leukemia	278	KMS-12-PE	456	4.269602
  026_8219_00282850	Leukemia	8219	Mo-T	456	4.313664
  026_279_00274450	Leukemia	279	P31/FUJ	456	4.386897
  026_171_00285190	Leukemia	171	KARPAS-231	456	4.404825
  026_244_00273660	Leukemia	244	TALL-1	456	4.411016
  026_158_00291340	Leukemia	158	EHEB	456	4.509743
  026_134_00278800	Leukemia	134	ARH-77	456	4.545002
  026_246_00273670	Leukemia	246	U-698-M	456	4.580953
  026_8113_00280440	Leukemia	8113	MHH-CALL-2	456	4.648418
  026_159_00311690	Leukemia	159	EJM	456	4.699945
  026_159_00282920	Leukemia	159	EJM	456	4.832393
  026_8115_00280450	Leukemia	8115	MN-60	456	4.861437
  026_204_00280460	Leukemia	204	MONO-MAC-6	456	4.946039
  026_8117_00280470	Leukemia	8117	MUTZ-1	456	5.304526
  026_188_00282930	Leukemia	188	LP-1	456	5.373997
  026_8081_00285580	Leukemia	8081	JVM-3	456	5.581328
  026_159_00309070	Leukemia	159	EJM	456	5.810283
  026_8080_00280660	Leukemia	8080	JVM-2	456	5.982881
  026_278_00306920	Leukemia	278	KMS-12-PE	456	6.629507
  026_8010_00280630	Leukemia	8010	ATN-1	456	7.14863
  26_262_00273790	Leukemia	262	MLMA	456	7.68552
  026_278_00282950	Leukemia	278	KMS-12-PE	456	7.74945
  026_649_00264910	Liver	649	Hep 3B2.1-7	456	−0.30042
  026_658_00262810	Liver	658	JHH-1	456	−0.185127
  026_649_00266180	Liver	649	Hep 3B2.1-7	456	−0.037335
  026_667_00273550	Liver	667	HuH-7	456	1.289162
  026_659_00255780	Liver	659	JHH-2	456	1.758427
  026_643_00266460	Liver	643	SNU-398	456	2.578054
  026_667_00269210	Liver	667	HuH-7	456	2.760591
  026_647_00269110	Liver	647	SNU-387	456	2.930627
  026_661_00252500	Liver	661	JHH-7	456	3.286573
  026_643_00263980	Liver	643	SNU-398	456	3.293137
  026_642_00308440	Liver	642	C3A	456	3.554832
  026_648_00258350	Liver	648	SNU-423	456	3.576003
  026_656_00252510	Liver	656	JHH-4	456	3.61979
  026_660_00252490	Liver	660	JHH-6	456	3.831185
  026_644_00252750	Liver	644	SNU-449	456	4.40481
  026_644_00306170	Liver	644	SNU-449	456	6.450644
  26_646_00314060	Liver	646	SNU-475	456	6.501654
  026_654_00255800	Liver	654	SK-HEP-1	456	6.515068
  026_668_00252690	Liver	668	HLE	456	7.25378
  026_662_00252460	Liver	662	huH-1	456	7.722693
  026_645_00306160	Liver	645	SNU-182	456	7.852049
  026_642_00252670	Liver	642	C3A	456	7.864415
  026_830_00304760	Lung	830	NCI-H2135	456	−0.374655
  026_698_00300170	Lung	698	NCI-H524	456	2.279246
  026_672_00314460	Lung	672	NCI-H510A	456	2.367223
  026_761_00300410	Lung	761	COR-L279	456	3.131703
  026_726_00304770	Lung	726	NCI-H2171	456	3.185965
  026_740_00302760	Lung	740	NCI-H82	456	3.210581
  026_787_00302910	Lung	787	SBC-3	456	3.410219
  026_695_00300150	Lung	695	NCI-H211	456	3.515811
  026_721_00302860	Lung	721	NCI-H2029	456	3.591515
  026_776_00303250	Lung	776	MS-1-L	456	3.614256
  026_8197_00304741	Lung	8197	LU-139	456	3.667637
  026_702_00302900	Lung	702	NCI-H847	456	3.686524
  026_8203_00309050	Lung	8203	IST-SL1	456	3.697133
  026_724_00300140	Lung	724	NCI-H2081	456	3.857634
  026_765_00300050	Lung	765	DMS 273	456	3.890251
  026_829_00305160	Lung	829	NCI-H2110	456	3.972695
  026_742_00303230	Lung	742	DMS 53	456	3.990104
  026_710_00316710	Lung	710	NCI-H1341	456	4.024081
  026_738_00302800	Lung	738	NCI-H446	456	4.043153
  026_751_00308570	Lung	751	NCI-H209	456	4.061511
  026_716_00298900	Lung	716	NCI-H1876	456	4.083964
  026_725_00303280	Lung	725	NCI-H2141	456	4.09696
  026_688_00302810	Lung	688	SW 1271	456	4.124557
  026_720_00302380	Lung	720	NCI-H1994	456	4.130367
  026_811_00311720	Lung	811	NCI-H1435	456	4.138326
  026_704_00300250	Lung	704	NCI-H1048	456	4.178908
  026_746_00302780	Lung	746	SHP-77	456	4.20487
  026_829_00311740	Lung	829	NCI-H2110	456	4.22315
  026_736_00300181	Lung	736	NCI-H69	456	4.26966
  026_724_00303270	Lung	724	NCI-H2081	456	4.274134
  026_714_00300260	Lung	714	NCI-H1694	456	4.276996
  026_715_00298890	Lung	715	NCI-H1836	456	4.291554
  026_757_00302870	Lung	757	CPC-N	456	4.345126
  026_8229_00304990	Lung	8229	COR-L303	456	4.468573
  026_691_00308560	Lung	691	NCI-H526	456	4.602758
  026_8099_00316740	Lung	8099	LB647-SCLC	456	4.613258
  026_725_00302750	Lung	725	NCI-H2141	456	4.618451
  026_705_00314520	Lung	705	NCI-H1092	456	4.678169
  026_684_00303260	Lung	684	NCI-H1688	456	4.865947
  026_725_00300160	Lung	725	NCI-H2141	456	4.894458
  026_8281_00300930	Lung	8281	COR-L311	456	5.024667
  026_757_00300940	Lung	757	CPC-N	456	5.046784
  026_701_00309060	Lung	701	NCI-H841	456	5.157768
  026_814_00304750	Lung	814	NCI-H1568	456	5.159278
  026_741_00305010	Lung	741	NCI-H345	456	5.184481
  026_705_00311700	Lung	705	NCI-H1092	456	5.191642
  026_786_00300950	Lung	786	SBC-5	456	5.281883
  026_723_00316720	Lung	723	NCI-H2066	456	5.313778
  026_705_00309080	Lung	705	NCI-H1092	456	5.329516
  026_709_00305000	Lung	709	NCI-H1304	456	5.330039
  026_739_00314630	Lung	739	NCI-H146	456	5.38813
  026_8110_00314450	Lung	8110	LU-165	456	5.539798
  026_811_00305140	Lung	811	NCI-H1435	456	5.586661
  026_711_00311710	Lung	711	NCI-H1417	456	5.606717
  026_712_00309090	Lung	712	NCI-H1436	456	5.636542
  026_711_00305130	Lung	711	NCI-H1417	456	5.804325
  026_728_00311760	Lung	728	NCI-H2196	456	5.845371
  026_831_00311750	Lung	831	NCI-H2172	456	5.851811
  026_1216_00300060	Lung	1216	H292	456	5.909493
  026_8109_00314440	Lung	8109	LU-134-A	456	5.930549
  026_831_00305170	Lung	831	NCI-H2172	456	6.053261
  026_728_00305180	Lung	728	NCI-H2196	456	6.171009
  026_689_00300910	Lung	689	NCI-H187	456	6.191556
  026_785_00302770	Lung	785	SBC-1	456	6.234067
  026_8280_00306910	Lung	8280	COR-L321	456	6.254083
  026_706_00318720	Lung	706	NCI-H1105	456	6.355
  026_712_00305150	Lung	712	NCI-H1436	456	6.498513
  026_8079_00306720	Lung	8079	IST-SL2	456	6.56418
  026_743_00303220	Lung	743	DMS 114	456	6.614771
  026_8022_00306711	Lung	8022	COLO-668	456	6.912523
  026_8109_00308510	Lung	8109	LU-134-A	456	6.98132
  026_758_00303240	Lung	758	HCC-33	456	7.022636
  026_771_00306940	Lung	771	Lu-135	456	7.040802
  026_694_00302790	Lung	694	NCI-H196	456	7.041262
  026_764_00308550	Lung	764	COR-L95	456	7.251052
  026_763_00300900	Lung	763	COR-L88	456	7.365052
  026_8134_00306730	Lung	8134	NCI-H64	456	7.782872
  026_712_00311730	Lung	712	NCI-H1436	456	7.804947
  026_8018_00304801	Lung:NSCLC	8018	Calu-6	456	−0.899538
  026_1246_00304570	Lung:NSCLC	1246	NCI-H1770	456	−0.072444
  026_847_00304580	Lung:NSCLC	847	NCI-H2087	456	1.048994
  026_680_00298830	Lung:NSCLC	680	NCI-H727	456	1.334143
  026_748_00304590	Lung:NSCLC	748	NCI-H226	456	1.690128
  026_851_00298380	Lung:NSCLC	851	CAL-12T	456	1.708943
  026_861_00300230	Lung:NSCLC	861	LCLC-97TM1	456	2.249036
  026_1245_00304550	Lung:NSCLC	1245	NCI-H1648	456	2.511131
  026_1180_00308140	Lung:NSCLC	1180	NCI-H3122	456	2.550953
  026_802_00298451	Lung:NSCLC	802	NCI-H358	456	2.662533
  026_815_00311140	Lung:NSCLC	815	NCI-H1623	456	2.802368
  026_1180_00302350	Lung:NSCLC	1180	NCI-H3122	456	2.945291
  026_8040_00304501	Lung:NSCLC	8040	EKVX	456	3.134434
  026_865_00308451	Lung:NSCLC	865	COR-L23	456	3.225036
  026_1243_00304541	Lung:NSCLC	1243	NCI-H1395	456	3.23207
  026_884_00308160	Lung:NSCLC	884	RERF-LC-MS	456	3.239905
  026_796_00295871	Lung:NSCLC	796	NCI-H2009	456	3.244878
  026_799_00295880	Lung:NSCLC	799	NCI-H661	456	3.295179
  026_822_00311150	Lung:NSCLC	822	NCI-H1869	456	3.570833
  026_756_00302670	Lung:NSCLC	756	BEN	456	3.65632
  026_876_00299781	Lung:NSCLC	876	LU65	456	3.69068
  026_805_00304531	Lung:NSCLC	805	NCI-H1155	456	3.716538
  026_834_00304610	Lung:NSCLC	834	NCI-H2347	456	3.72347
  026_822_00304840	Lung:NSCLC	822	NCI-H1869	456	3.749478
  026_835_00302390	Lung:NSCLC	835	NCI-H2405	456	3.789193
  026_678_00304981	Lung:NSCLC	678	UMC-11	456	3.815948
  026_807_00314280	Lung:NSCLC	807	NCI-H650	456	3.884087
  026_871_00299771	Lung:NSCLC	871	LK-2	456	3.898613
  026_1249_00308150	Lung:NSCLC	1249	NCI-H720	456	3.907633
  026_8231_00304510	Lung:NSCLC	8231	EMC-BAC-1	456	3.943946
  026_820_00304560	Lung:NSCLC	820	NCI-H1755	456	3.964037
  026_815_00304830	Lung:NSCLC	815	NCI-H1623	456	3.981628
  026_839_00302410	Lung:NSCLC	839	SW 900	456	3.982367
  026_804_00308480	Lung:NSCLC	804	NCI-H810	456	4.03318
  026_678_00309011	Lung:NSCLC	678	UMC-11	456	4.0744
  026_842_00298540	Lung:NSCLC	842	NCI-H520	456	4.082969
  026_824_00314260	Lung:NSCLC	824	NCI-H1944	456	4.107799
  026_888_00298370	Lung:NSCLC	888	ABC-1	456	4.123019
  026_823_00298430	Lung:NSCLC	823	NCI-H1915	456	4.260241
  026_8232_00304520	Lung:NSCLC	8232	EMC-BAC-2	456	4.327709
  026_755_00300611	Lung:NSCLC	755	NCI-H1975	456	4.450033
  026_868_00295440	Lung:NSCLC	868	PC-14	456	4.458594
  026_872_00299750	Lung:NSCLC	872	HARA	456	4.480998
  026_800_00298441	Lung:NSCLC	800	NCI-H23	456	4.511394
  026_836_00304620	Lung:NSCLC	836	NCI-H2444	456	4.530511
  026_865_00296401	Lung:NSCLC	865	COR-L23	456	4.577187
  026_858_00300591	Lung:NSCLC	858	HCC-78	456	4.583505
  026_854_00300681	Lung:NSCLC	854	EPLC-272H	456	4.590654
  026_837_00311160	Lung:NSCLC	837	NCI-H2122	456	4.595192
  026_8111_00308110	Lung:NSCLC	8111	LXF-289	456	4.689278
  026_1136_00308471	Lung:NSCLC	1136	NCI-H1993	456	4.705234
  026_827_00308860	Lung:NSCLC	827	NCI-H2085	456	4.711775
  026_859_00311090	Lung:NSCLC	859	HCC-827	456	4.735253
  026_886_00296261	Lung:NSCLC	886	EBC-1	456	4.744821
  026_8132_00308130	Lung:NSCLC	8132	NCI-H2126	456	4.781635
  026_793_00299711	Lung:NSCLC	793	NCI-H1781	456	4.904802
  026_1247_00314271	Lung:NSCLC	1247	NCI-H2291	456	4.945975
  026_860_00298400	Lung:NSCLC	860	LCLC-103H	456	4.97209
  026_806_00300270	Lung:NSCLC	806	NCI-H647	456	5.044917
  026_877_00300630	Lung:NSCLC	877	PC-3 [JPC-3]	456	5.056812
  026_753_00298460	Lung:NSCLC	753	NCI-H460	456	5.061076
  026_844_00295461	Lung:NSCLC	844	SW 1573	456	5.077017
  026_8088_00314320	Lung:NSCLC	8088	KNS-62	456	5.130485
  026_848_00314320	Lung:NSCLC	848	SK-LU-1	456	5.2771
  026_864_00300641	Lung:NSCLC	864	COR-L 105	456	5.319498
  026_677_00304961	Lung:NSCLC	677	A549	456	5.414187
  026_8207_00298361	Lung:NSCLC	8207	LC-1F	456	5.423228
  026_833_00304810	Lung:NSCLC	833	NCI-H2342	456	5.548934
  026_870_00299801	Lung:NSCLC	870	RERF-LC-KJ	456	5.685511
  026_845_00311341	Lung:NSCLC	845	NCI-H1838	456	5.711103
  026_8103_00306210	Lung:NSCLC	8103	LC-2-ad	456	5.718708
  026_794_00300601	Lung:NSCLC	794	NCI-H1792	456	5.721238
  026_890_00300220	Lung:NSCLC	890	H3255	456	5.722728
  026_862_00304820	Lung:NSCLC	862	LOU-NH91	456	5.738178
  026_812_00298410	Lung:NSCLC	812	NCI-H1437	456	5.791603
  026_862_00316560	Lung:NSCLC	862	LOU-NH91	456	5.867157
  026_857_00296270	Lung:NSCLC	857	HCC-44	456	5.930045
  026_679_00296240	Lung:NSCLC	679	ChaGo-K-1	456	5.965866
  026_791_00298421	Lung:NSCLC	791	NCI-H1650	456	5.971987
  026_864_00311551	Lung:NSCLC	864	COR-L 105	456	5.975297
  026_846_00300620	Lung:NSCLC	846	NCI-H2030	456	6.014339
  026_841_00296291	Lung:NSCLC	841	NCI-H2170	456	6.01763
  026_813_00308231	Lung:NSCLC	813	NCI-H1563	456	6.06364
  026_816_00295860	Lung:NSCLC	816	NCI-H1651	456	6.160326
  026_818_00308241	Lung:NSCLC	818	NCI-H1703	456	6.172519
  026_808_00296300	Lung:NSCLC	808	NCI-H838	456	6.172929
  026_855_00302330	Lung:NSCLC	855	HCC-15	456	6.195295
  026_803_00298470	Lung:NSCLC	803	NCI-H522	456	6.200929
  026_832_00303110	Lung:NSCLC	832	NCI-H2228	456	6.240586
  026_874_00308171	Lung:NSCLC	874	RERF-LC-Sq1	456	6.282697
  026_879_00308101	Lung:NSCLC	879	LU99A	456	6.327465
  026_856_00299760	Lung:NSCLC	856	HCC-366	456	6.328052
  026_798_00304790	Lung:NSCLC	798	Calu-3	456	6.338698
  026_825_00308250	Lung:NSCLC	825	NCI-H2023	456	6.435057
  026_8072_00306200	Lung:NSCLC	8072	HOP-62	456	6.481774
  026_843_00296331	Lung:NSCLC	843	SK-MES-1	456	6.499026
  026_1251_00318710	Lung:NSCLC	1251	NCI-H835	456	6.684349
  026_816_00302370	Lung:NSCLC	816	NCI-H1651	456	6.769433
  026_801_00295941	Lung:NSCLC	801	NCI-H1299	456	6.808075
  026_850_00311050	Lung:NSCLC	850	201T	456	6.874432
  026_818_00309001	Lung:NSCLC	818	NCI-H1703	456	7.192409
  026_1247_00304851	Lung:NSCLC	1247	NCI-H2291	456	7.252153
  026_819_00306250	Lung:NSCLC	819	NCI-H1734	456	7.342705
  026_821_00306261	Lung:NSCLC	821	NCI-H1299	456	7.345651
  026_798_00308080	Lung:NSCLC	798	Calu-3	456	7.389624
  026_678_00306181	Lung:NSCLC	678	UMC-11	456	7.458364
  026_797_00308730	Lung:NSCLC	797	NCI-H593	456	7.556662
  026_790_00306231	Lung:NSCLC	790	NCI-H1573	456	7.606756
  026_752_00306191	Lung:NSCLC	752	A-427	456	7.608444
  026_845_00306271	Lung:NSCLC	845	NCI-H1838	456	7.666847
  026_8133_00306280	Lung:NSCLC	8133	NCI-H322M	456	7.713112
  026_8130_00306220	Lung:NSCLC	8130	NCI-H1355	456	7.765888
  026_683_00306241	Lung:NSCLC	683	NCI-H1581	456	7.774034
  026_792_00306140	Lung:NSCLC	792	NCI-H1666	456	7.825548
  026_840_00306151	Lung:NSCLC	840	NCI-H441	456	7.946249
  026_8075_00306131	Lung:NSCLC	8075	IA-LM	456	7.984543
  026_61_00285570	Lymphoma	61	JSC-1	456	0.316646
  026_8222_00291350	Lymphoma	8222	H9	456	0.402947
  026_140_00291320	Lymphoma	140	A3/KAW	456	0.717935
  026_237_00291380	Lymphoma	237	SU-DHL-16	456	0.982467
  026_220_00288720	Lymphoma	220	OCI-LY-19	456	1.28484
  026_257_00285640	Lymphoma	257	WIL2 NS	456	1.523653
  026_239_00288750	Lymphoma	239	SU-DHL-5	456	1.616577
  026_124_00287850	Lymphoma	124	BC-1	456	1.816766
  026_104_00287960	Lymphoma	104	TUR	456	2.217781
  026_8199_00291330	Lymphoma	8199	CTB-1	456	2.341488
  026_69_00283480	Lymphoma	69	CA46	456	2.43077
  026_112_00285620	Lymphoma	112	SR	456	2.466522
  026_241_00288760	Lymphoma	241	SU-DHL-8	456	2.509783
  026_255_00285610	Lymphoma	255	Sci-1	456	2.705483
  026_62_00293930	Lymphoma	62	IM-9	456	2.809638
  026_93_00287880	Lymphoma	93	HH	456	2.828886
  026_216_00290710	Lymphoma	216	NU-DUL-1	456	2.880782
  026_123_00287860	Lymphoma	123	BC-3	456	2.893681
  026_113_00288520	Lymphoma	113	DB	456	2.901204
  026_8035_00303290	Lymphoma	8035	DOHH-2	456	2.927461
  026_240_00300290	Lymphoma	240	SU-DHL-6	456	2.933827
  026_248_00285630	Lymphoma	248	VAL	456	2.964017
  026_162_00290790	Lymphoma	162	HDLM-2	456	2.980685
  026_105_00287940	Lymphoma	105	RPMI 6666	456	3.064381
  026_240_00302920	Lymphoma	240	SU-DHL-6	456	3.114948
  026_163_00287730	Lymphoma	163	HD-MY-Z	456	3.123344
  026_139_00283530	Lymphoma	139	MC116	456	3.12577
  026_133_00293941	Lymphoma	133	NK-92MI	456	3.297366
  026_282_00287750	Lymphoma	282	P32/ISH	456	3.328203
  026_80_00287950	Lymphoma	80	ST489	456	3.520498
  026_73_00283500	Lymphoma	73	EB-3	456	3.528971
  026_60_00287891	Lymphoma	60	JM1	456	3.618767
  026_185_00288820	Lymphoma	185	L-540	456	3.666174
  026_70_00283490	Lymphoma	70	Daudi	456	3.687192
  026_228_00291370	Lymphoma	228	RC-K8	456	3.710403
  026_74_00285600	Lymphoma	74	Raji	456	3.736373
  026_173_00288920	Lymphoma	173	KARPAS-422	456	3.812903
  026_125_00287910	Lymphoma	125	MC/CAR	456	3.860302
  026_280_00285420	Lymphoma	280	SCC-3	456	3.903427
  026_242_00288770	Lymphoma	242	SUP-HD1	456	4.023177
  026_160_00285410	Lymphoma	160	GRANTA-519	456	4.112789
  026_144_00287710	Lymphoma	144	BL-41	456	4.441898
  026_184_00290800	Lymphoma	184	L-428	456	4.489131
  026_128_00290690	Lymphoma	128	Farage	456	4.585156
  026_250_00285660	Lymphoma	250	WSU-NHL	456	4.693667
  026_182_00290700	Lymphoma	182	L-1236	456	4.714251
  026_95_00283510	Lymphoma	95	HT	456	4.721481
  026_264_00288840	Lymphoma	264	TK	456	4.750226
  026_266_00287760	Lymphoma	266	SLVL	456	4.90866
  026_75_00282830	Lymphoma	75	Jiyoye	456	4.937844
  026_111_00291360	Lymphoma	111	Hs 445	456	5.022248
  026_8151_00288540	Lymphoma	8151	Ramos-2G6-4C10	456	5.147746
  026_156_00287720	Lymphoma	156	DG-75	456	5.222394
  026_243_00296620	Lymphoma	243	SUP-M2	456	5.25553
  026_86_00287870	Lymphoma	86	EB2	456	5.287284
  026_162_00288790	Lymphoma	162	HDLM-2	456	5.425219
  026_172_00287740	Lymphoma	172	KARPAS-299	456	5.433867
  026_235_00285430	Lymphoma	235	SU-DHL-1	456	6.401484
  026_143_00288690	Lymphoma	143	AMO-1	456	6.692908
  026_193_00288830	Lymphoma	193	MHH-PREB-1	456	6.799634
  026_236_00288730	Lymphoma	236	SU-DHL-10	456	6.99662
  026_81_00288530	Lymphoma	81	GA-10	456	7.031749
  026_251_00287840	Lymphoma	251	YT	456	7.411746
  026_178_00288810	Lymphoma	178	KM-H2	456	7.739504
  026_249_00285650	Lymphoma	249	WSU-DLCL2	456	8.212885
  026_238_00288740	Lymphoma	238	SU-DHL-4	456	8.647656
  026_131_00287930	Lymphoma	131	RL	456	8.679308
  026_915_00269070	Miscellaneous	915	Hs 633T	456	1.797943
  026_911_00269060	Miscellaneous	911	GCT	456	2.424125
  026_8172_00269460	Miscellaneous	8172	SW872	456	3.196748
  026_913_00271970	Miscellaneous	913	JAR	456	3.876744
  026_8194_00271980	Miscellaneous	8194	JEG-3	456	3.901223
  026_8171_00269120	Miscellaneous	8171	SW684	456	3.978538
  026_8112_00269450	Miscellaneous	8112	MFH-ino	456	4.013788
  026_916_00271320	Miscellaneous	916	HT 1080	456	4.254215
  026_8004_00271280	Miscellaneous	8004	A388	456	4.494172
  026_8112_00271340	Miscellaneous	8112	MFH-ino	456	4.624376
  026_8004_00269400	Miscellaneous	8004	A388	456	4.778414
  026_8192_00269470	Miscellaneous	8192	VA-ES-BJ	456	4.956405
  026_8194_00269440	Miscellaneous	8194	JEG-3	456	5.058221
  026_913_00269430	Miscellaneous	913	JAR	456	5.170211
  026_916_00269420	Miscellaneous	916	HT 1080	456	5.302771
  026_8175_00269140	Miscellaneous	8175	SW982	456	5.586364
  026_1225_00269660	Muscle	1225	RD	456	2.694207
  26_135_00271680	Muscle	135	SJCRH30	456	2.740947
  026_924_00269640	Muscle	924	A673	456	2.779569
  26_562_00271660	Muscle	562	KYM-1	456	2.818237
  026_135_00271410	Muscle	135	SJCRH30	456	3.059385
  026_923_00269680	Muscle	923	RH-41	456	3.133389
  026_562_00270060	Muscle	562	KYM-1	456	3.396905
  026_920_00269670	Muscle	920	RH-1	456	3.433085
  026_135_00270070	Muscle	135	SJCRH30	456	3.759361
  026_919_00269630	Muscle	919	A-204	456	5.25605
  026_921_00285151	Muscle	921	RH-18	456	5.863422
  026_8182_00293791	Muscle	8182	TE-441-T	456	6.133177
  026_369_00258500	Nervous System	369	CHP-212	456	−4.151196
  026_390_00262920	Nervous System	390	NB69	456	−1.3827
  026_629_00316570	Nervous System	629	NB(TU)1-10	456	−0.654294
  026_366_00257090	Nervous System	366	BE(2)-M17	456	−0.258429
  026_384_00314240	Nervous System	384	MHH-NB-11	456	1.316182
  026_385_00314290	Nervous System	385	SIMA	456	1.359572
  026_630_00264810	Nervous System	630	NH-12	456	1.516245
  026_8124_00308720	Nervous System	8124	NB14	456	1.784337
  026_639_00271120	Nervous System	639	GOTO	456	1.784838
  026_8094_00314230	Nervous System	8094	LAN-6	456	1.824343
  026_8076_00260401	Nervous System	8076	IMR-5	456	1.864038
  026_8127_00258950	Nervous System	8127	NB5	456	2.106125
  026_8124_00311130	Nervous System	8124	NB14	456	2.216808
  026_8126_00264800	Nervous System	8126	NB17	456	2.289546
  026_641_00308180	Nervous System	641	TGW	456	2.326645
  026_8121_00256290	Nervous System	8121	NB10	456	2.356578
  026_8220_00308810	Nervous System	8220	KP-N-YN	456	2.470465
  026_8090_00263920	Nervous System	8090	KP-N-YS	456	2.547617
  026_363_00252730	Nervous System	363	SK-N-FI	456	2.667265
  026_382_00311110	Nervous System	382	KELLY	456	3.39659
  026_8064_00259120	Nervous System	8064	GI-ME-N	456	3.426922
  026_8195_00318640	Nervous System	8195	CHP-134	456	3.519288
  026_382_00308690	Nervous System	382	KELLY	456	3.678148
  026_8129_00314250	Nervous System	8129	NB7	456	3.824042
  026_8126_00280241	Nervous System	8126	NB17	456	3.845261
  026_8007_00252850	Nervous System	8007	ACN	456	3.989797
  026_8122_00273460	Nervous System	8122	NB12	456	4.358809
  026_8226_00252530	Nervous System	8226	NBsusSR	456	4.365592
  026_8064_00256670	Nervous System	8064	GI-ME-N	456	4.809816
  026_8128_00257200	Nervous System	8128	NB6	456	4.886145
  026_8123_00256300	Nervous System	8123	NB13	456	5.775254
  026_396_00261020	Nervous System	396	NB-1	456	5.873385
  026_370_00252740	Nervous System	370	SK-N-SH	456	6.176056
  026_364_00252720	Nervous System	364	SK-N-DZ	456	6.251974
  026_370_00258530	Nervous System	370	SK-N-SH	456	6.266144
  026_362_00252710	Nervous System	362	SK-N-AS	456	6.874316
  026_368_00252700	Nervous System	368	MC-IXC	456	6.982443
  026_8122_00262490	Nervous System	8122	NB12	456	7.149853
  026_934_00287430	Ovary	934	A2780	456	0.227264
  026_1126_00293760	Ovary	1126	OV-90	456	0.856076
  026_1129_00290660	Ovary	1129	TOV-112D	456	2.270257
  026_1220_00291150	Ovary	1220	ES-2	456	2.397868
  026_949_00290350	Ovary	949	TYK-nu	456	2.489488
  026_925_00290850	Ovary	925	IGROV-1	456	2.753994
  026_8244_00314220	Ovary	8244	JHOS-4	456	2.779507
  026_8279_00293400	Ovary	8279	UWB1.289	456	2.893774
  026_940_00290340	Ovary	940	RMG-I	456	3.11591
  26_8238_00304370	Ovary	8238	IOSE-364-	456	3.149354
  026_8237_00295840	Ovary	8237	Hey	456	3.317969
  026_8260_00292720	Ovary	8260	PEO1	456	3.508406
  026_8230_00303100	Ovary	8230	DOV13	456	3.68994
  026_8230_00292650	Ovary	8230	DOV13	456	3.809459
  026_8092_00295850	Ovary	8092	KURAMOCHI	456	3.819916
  026_8240_00291160	Ovary	8240	IOSE-523-	456	3.834885
  026_932_00291140	Ovary	932	EEO-27	456	3.943589
  026_8084_00292670	Ovary	8084	KGN	456	4.00968
  026_1125_00290571	Ovary	1125	Caov-3	456	4.050855
  026_8256_00292920	Ovary	8256	OV-7	456	4.064163
  026_8241_00292900	Ovary	8241	IOSE-75-16SV40	456	4.094216
  026_938_00287450	Ovary	938	OAW42	456	4.158942
  026_1235_00298501	Ovary	1235	Caov-4	456	4.19878
  026_1221_00293780	Ovary	1221	SW 626	456	4.261643
  026_933_00295510	Ovary	933	FU-OV-1	456	4.35795
  026_8259_00292710	Ovary	8259	OVK-18	456	4.419332
  026_8242_00295400	Ovary	8242	JHOS-2	456	4.46038
  026_1128_00292620	Ovary	1128	PA-1	456	4.524728
  026_938_00290330	Ovary	938	OAW42	456	4.600882
  026_8148_00292700	Ovary	8148	OVCAR-4	456	4.649732
  026_8243_00295410	Ovary	8243	JHOS-3	456	4.699022
  026_1130_00308501	Ovary	1130	TOV-21G	456	4.743414
  026_931_00252940	Ovary	931	EEO-21	456	4.786052
  026_931_00290820	Ovary	931	EEO-21	456	4.852802
  026_932_00288450	Ovary	932	EEO-27	456	4.890908
  026_8258_00291180	Ovary	8258	OVCA433	456	4.901177
  026_928_00290870	Ovary	928	OVCAR-5	456	4.903025
  026_8257_00293650	Ovary	8257	OVCA420	456	4.98883
  026_8257_00292690	Ovary	8257	OVCA420	456	5.050268
  026_8239_00292890	Ovary	8239	IOSE-397	456	5.092878
  026_941_00288490	Ovary	941	RKN	456	5.095259
  026_929_00290880	Ovary	929	OVCAR-8	456	5.147098
  026_8215_00287660	Ovary	8215	OC-314	456	5.38803
  026_939_00287460	Ovary	939	SK-OV-3	456	5.430154
  026_945_00288480	Ovary	945	OVMIU	456	5.797932
  026_948_00291230	Ovary	948	OVTOKO	456	5.89738
  026_8255_00293640	Ovary	8255	OV-56	456	5.989644
  026_937_00288460	Ovary	937	OAW28	456	6.027686
  026_1127_00296460	Ovary	1127	NIH:OVCAR-3	456	6.109694
  026_947_00263500	Ovary	947	OVKATE	456	6.266319
  026_938_00292910	Ovary	938	OAW42	456	6.299032
  026_945_00256180	Ovary	945	OVMIU	456	6.360298
  026_946_00291190	Ovary	946	OVISE	456	6.600815
  026_8254_00295890	Ovary	8254	OV-17R	456	6.877329
  026_973_00295540	Pancreas	973	HUP-T4	456	0.866739
  026_983_00295450	Pancreas	983	SUIT-2	456	1.197889
  026_982_00292940	Pancreas	982	QGP-1	456	1.430625
  026_8118_00295430	Pancreas	8118	MZ1-PC	456	1.48113
  026_8149_00293771	Pancreas	8149	PSN1	456	1.829333
  026_953_00295470	Pancreas	953	AsPC-1	456	1.847893
  026_1256_00260300	Pancreas	1256	950-MP5	456	1.902786
  026_976_00298480	Pancreas	976	Panc 04.03	456	2.685969
  026_954_00292870	Pancreas	954	BxPC-3	456	2.90077
  026_967_00292570	Pancreas	967	Capan-1	456	3.140577
  026_975_00295591	Pancreas	975	YAPC	456	3.507979
  026_1135_00292930	Pancreas	1135	PL18	456	3.513426
  026_977_00308210	Pancreas	977	KP-1N	456	3.657778
  026_969_00295580	Pancreas	969	PA-TU-8988T	456	3.657963
  026_1491_00273490	Pancreas	1491	SNU-324	456	3.732679
  026_961_00295570	Pancreas	961	Panc 02.03	456	4.088522
  026_974_00292601	Pancreas	974	HUP-T3	456	4.280085
  026_963_00293710	Pancreas	963	Hs 766T	456	4.34359
  026_959_00292630	Pancreas	959	Panc 03.27	456	4.482408
  026_981_00293750	Pancreas	981	KP-4	456	4.755774
  026_968_00292580	Pancreas	968	CFPAC-1	456	4.814885
  026_1134_00300280	Pancreas	1134	PL4	456	4.852316
  026_979_00293740	Pancreas	979	KP-3	456	4.900084
  026_956_00292591	Pancreas	956	HPAF-II	456	5.005523
  026_953_00257150	Pancreas	953	AsPC-1	456	5.141432
  26_968_00304350	Pancreas	968	CFPAC-1	456	5.151366
  026_957_00296350	Pancreas	957	SW 1990	456	5.575766
  026_960_00296311	Pancreas	960	Panc 08.13	456	5.65459
  026_951_00256230	Pancreas	951	HPAC	456	5.736336
  026_964_00295480	Pancreas	964	Capan-2	456	5.74256
  026_1134_00298560	Pancreas	1134	PL4	456	5.771259
  026_970_00293370	Pancreas	970	PA-TU-8902	456	5.772043
  026_952_00292610	Pancreas	952	MIA PaCa-2	456	5.946631
  026_972_00296250	Pancreas	972	DAN-G	456	5.955955
  026_951_00295520	Pancreas	951	HPAC	456	5.962773
  026_975_00252910	Pancreas	975	YAPC	456	5.989883
  026_963_00252950	Pancreas	963	Hs 766T	456	6.264463
  026_958_00296320	Pancreas	958	Panc 10.05	456	6.318194
  026_955_00292640	Pancreas	955	SU.86.86	456	6.593699
  026_759_00300240	Pleura	759	MSTO-211H	456	3.066599
  026_1213_00303050	Pleura	1213	H2818	456	3.157415
  026_8116_00303080	Pleura	8116	MPP-89	456	3.723631
  026_1206_00302600	Pleura	1206	H2722	456	3.764667
  026_1210_00302610	Pleura	1210	H2803	456	4.117283
  026_1215_00311260	Pleura	1215	H290	456	4.122283
  026_1206_00308200	Pleura	1206	H2722	456	4.184817
  026_1212_00300580	Pleura	1212	H2810	456	4.445211
  026_682_00304600	Pleura	682	NCI-H2452	456	4.452468
  026_1200_00300690	Pleura	1200	H2373	456	4.612295
  026_1214_00308460	Pleura	1214	H2869	456	4.934927
  026_1214_00308790	Pleura	1214	H2869	456	4.961713
  026_1202_00303040	Pleura	1202	H2591	456	5.067997
  026_1209_00300210	Pleura	1209	H28	456	5.341766
  026_8078_00303060	Pleura	8078	IST-MES1	456	5.358253
  026_1199_00300560	Pleura	1199	H2369	456	5.439636
  026_8078_00304970	Pleura	8078	IST-MES1	456	5.505825
  026_1207_00298510	Pleura	1207	H2731	456	5.56988
  026_1198_00302580	Pleura	1198	H2052	456	5.579483
  026_1201_00302590	Pleura	1201	H2461	456	5.654117
  026_1213_00300720	Pleura	1213	H2818	456	5.828097
  026_1211_00300570	Pleura	1211	H2804	456	5.890027
  026_1218_00300730	Pleura	1218	H513	456	5.953268
  026_1208_00300710	Pleura	1208	H2795	456	6.063798
  026_1203_00300850	Pleura	1203	H2595	456	6.184806
  026_8245_00282710	pleural effusion	8245	KMS-11	456	0.702427
  026_996_00298490	Prostate	996	22RV1	456	2.346887
  026_985_00303070	Prostate	985	LNCaP clone FGC	456	4.018762
  026_987_00298550	Prostate	987	PC-3	456	4.097696
  026_1001_00300200	Prostate	1001	DU 145	456	5.044916
  026_988_00308270	Prostate	988	PWR-1E	456	5.228199
  026_997_00300660	Prostate	997	BPH-1	456	5.448713
  026_1000_00300740	Prostate	1000	VCaP	456	5.968581
  026_1009_00264700	Skin	1009	WM35	456	−2.372512
  026_8212_00264590	Skin	8212	CP50-MEL-B	456	−1.651586
  026_1039_00265170	Skin	1039	SK-MEL-30	456	−1.476493
  026_1023_00269690	Skin	1023	SK-MEL-2	456	−1.357658
  026_1034_00264680	Skin	1034	MEL-HO	456	−0.964561
  026_8073_00263480	Skin	8073	HT-144	456	−0.641233
  026_8114_00259970	Skin	8114	MMAC-SF	456	−0.613008
  026_8209_00266540	Skin	8209	A4-Fuk	456	−0.557176
  026_1046_00263470	Skin	1046	HMVII	456	−0.454742
  026_8120_00262840	Skin	8120	MZ7-mel	456	−0.254795
  026_8191_00260580	Skin	8191	UACC-257	456	−0.10266
  026_1176_00266430	Skin	1176	451Lu	456	−0.00066
  026_1149_00263460	Skin	1149	G-MEL	456	0.018696
  026_1147_00263750	Skin	1147	SK-MEL-28	456	0.142676
  026_1037_00260080	Skin	1037	SK-MEL-1	456	0.168848
  026_1190_00266570	Skin	1190	Hs 939.T	456	0.185332
  026_1024_00265150	Skin	1024	M-14	456	0.192152
  026_1025_00269710	Skin	1025	COLO-679	456	0.228168
  026_8161_00263740	Skin	8161	SH-4	456	0.433257
  026_8097_00262820	Skin	8097	LB2518-MEL	456	0.437866
  026_8120_00260550	Skin	8120	MZ7-mel	456	0.447706
  026_1033_00262470	Skin	1033	IPC-298	456	0.460127
  026_1031_00264030	Skin	1031	IGR-37	456	0.57267
  026_1006_00260110	Skin	1006	WM-115	456	0.616077
  026_8023_00265291	Skin	8023	COLO-829	456	0.740747
  026_1036_00264690	Skin	1036	RVH-421	456	0.784255
  026_1011_00269770	Skin	1011	WM278	456	0.944573
  026_1003_00269650	Skin	1003	G-361	456	0.948854
  026_8002_00263700	Skin	8002	A101D	456	0.960267
  026_8104_00260540	Skin	8104	LOXIMVI	456	1.072404
  026_1005_00268780	Skin	1005	A-375	456	1.191442
  026_1004_00260870	Skin	1004	C32	456	1.195832
  026_1030_00264020	Skin	1030	IGR-1	456	1.307792
  026_1035_00265160	Skin	1035	MEL-JUSO	456	1.414781
  026_8119_00259980	Skin	8119	MZ2-MEL.	456	1.446447
  026_8097_00260530	Skin	8097	LB2518-MEL	456	1.447504
  026_8225_00264640	Skin	8225	SK-MEL-5	456	1.574212
  026_8104_00262830	Skin	8104	LOXIMVI	456	1.676415
  026_1042_00274340	Skin	1042	COLO 792	456	1.75025
  026_1026_00269720	Skin	1026	COLO-783	456	1.791757
  026_1010_00262530	Skin	1010	WM1552C	456	2.109919
  026_1041_00263450	Skin	1041	A431	456	2.481335
  026_8098_00269090	Skin	8098	LB373-MEL-D	456	2.623655
  026_1022_00262940	Skin	1022	RPMI-7951	456	2.647594
  026_1181_00269080	Skin	1181	Hs 944.T	456	2.824283
  026_1008_00262540	Skin	1008	WM793B	456	2.933974
  026_1027_00265280	Skin	1027	COLO-800	456	3.132083
  026_8034_00265300	Skin	8034	DJM-1	456	3.234358
  026_1181_00264620	Skin	1181	Hs 944.T	456	3.491747
  026_8225_00263510	Skin	8225	SK-MEL-5	456	3.505326
  026_1145_00263720	Skin	1145	CHL-1	456	3.811805
  026_8060_00265311	Skin	8060	GAK	456	4.2621
  026_1047_00265320	Skin	1047	MEWO	456	4.342961
  026_1022_00260910	Skin	1022	RPMI-7951	456	4.58823
  026_1038_00260090	Skin	1038	SK-MEL-3	456	4.834702
  026_1002_00260861	Skin	1002	A2058	456	5.928358
  026_8025_00306491	Skin	8025	CP66-MEL	456	6.278644
  026_1120_00264061	Skin	1120	UACC-62	456	6.317961
  026_1049_00269761	Skin	1049	VMRC-MELG	456	6.363031
  026_8077_00311281	Skin	8077	IST-MEL1	456	6.486215
  026_1002_00262871	Skin	1002	A2058	456	6.768535
  026_1191_00266580	Skin	1191	Hs 940.T	456	7.017835
  026_8211_00306531	Skin	8211	SK-MEL-24	456	7.240348
  026_1004_00262880	Skin	1004	C32	456	7.407136
  026_8077_00263490	Skin	8077	IST-MEL1	456	8.189893
  026_1076_00260350	Stomach	1076	OCUM-1	456	−1.975727
  026_1050_00262790	Stomach	1050	AGS	456	0.402284
  026_1070_00258920	Stomach	1070	HSC-39	456	1.218484
  026_8193_00311240	Stomach	8193	ECC10	456	1.328742
  026_1052_00255810	Stomach	1052	SNU-1	456	1.425654
  026_1056_00316590	Stomach	1056	KATO III	456	1.949149
  026_1060_00256830	Stomach	1060	MKN45	456	2.285447
  026_1072_00258880	Stomach	1072	23132/87	456	2.907608
  026_1060_00262910	Stomach	1060	MKN45	456	2.913103
  026_1078_00263960	Stomach	1078	IM-95	456	3.209661
  026_1054_00308870	Stomach	1054	SNU-16	456	3.34225
  026_1064_00258960	Stomach	1064	NUGC-3	456	3.516892
  026_1075_00308260	Stomach	1075	NUGC-4	456	3.652276
  026_1065_00273570	Stomach	1065	MKN7	456	3.792655
  026_1067_00311560	Stomach	1067	PERF-GC-1B	456	4.166168
  026_1067_00314080	Stomach	1067	PERF-GC-1B	456	4.402339
  026_1068_00258930	Stomach	1068	MKN28	456	4.480011
  026_1057_00271310	Stomach	1057	Hs 746T	456	4.481195
  026_1060_00260890	Stomach	1060	MKN45	456	4.604315
  026_1051_00269200	Stomach	1051	FU97	456	4.755599
  026_8187_00316461	Stomach	8187	TGBC11TKB	456	4.931222
  026_1058_00263730	Stomach	1058	NCI-N87	456	5.400356
  026_1064_00264040	Stomach	1064	NUGC-3	456	6.53754
  026_1077_00264820	Stomach	1077	SCH	456	6.77844
  026_1051_00265140	Stomach	1051	FU97	456	6.812551
  026_8067_00258320	Stomach	8067	GT3TKB	456	7.007727
  026_1053_00258360	Stomach	1053	SNU-5	456	7.265878
  026_1073_00258910	Stomach	1073	HGC-27	456	7.474785
  026_8062_00266170	Stomach	8062	GCIY	456	7.70033
  026_1059_00256820	Stomach	1059	MKN1	456	7.84127
  026_8216_00258330	Stomach	8216	RF-48	456	8.041101
  026_8143_00302630	Testes	8143	NTERA-S-cl-D1	456	4.238289
  026_1081_00299690	Testes	1081	NCC-IT-A3	456	4.69755
  026_1082_00300430	Testes	1082	NEC8	456	5.794775
  026_1087_00311210	Thyroid	1087	BHT-101	456	0.094631
  026_1098_00252970	Thyroid	1098	IHH-4	456	0.734299
  026_1093_00253040	Thyroid	1093	TT2609-C02	456	1.438563
  026_1100_00252990	Thyroid	1100	KMH-2	456	1.898194
  026_1085_00252920	Thyroid	1085	8505C	456	2.3348
  026_1088_00252930	Thyroid	1088	CAL-62	456	2.495611
  026_1089_00261010	Thyroid	1089	HTC-C3	456	2.538171
  026_1090_00311330	Thyroid	1090	ML-1	456	2.64388
  026_1090_00253010	Thyroid	1090	ML-1	456	3.121258
  026_1090_00308850	Thyroid	1090	ML-1	456	3.18393
  026_1086_00255730	Thyroid	1086	B-CPAP	456	3.682081
  026_8020_00314210	Thyroid	8020	CGTH-W-1	456	4.407018
  026_1084_00266520	Thyroid	1084	8305C	456	4.442179
  026_8213_00259200	Thyroid	8213	TT	456	4.648028
  026_8082_00252980	Thyroid	8082	K5	456	6.244906
  026_1099_00306470	Thyroid	1099	ASH-3	456	6.262224
  026_1094_00259110	Thyroid	1094	FTC-133	456	6.573461
  026_1092_00259170	Thyroid	1092	S-117	456	6.767861
  026_1097_00259160	Thyroid	1097	RO82-W-1	456	7.698514
  26_8036_00304360	UrinaryTrack	8036	DSH1	456	1.200178
  026_24_00298840	UrinaryTrack	24	RT4	456	2.281802
  026_18_00299720	UrinaryTrack	18	RT-112	456	2.448355
  026_24_00252540	UrinaryTrack	24	RT4	456	2.668527
  026_8036_00257170	UrinaryTrack	8036	DSH1	456	2.728478
  026_9_00298850	UrinaryTrack	9	SW 780	456	2.896276
  026_15_00316530	UrinaryTrack	15	BFTC-905	456	3.218144
  026_8_00298880	UrinaryTrack	8	UM-UC-3	456	3.221517
  026_6_00303090	UrinaryTrack	6	5637	456	3.348554
  026_6_00256650	UrinaryTrack	6	5637	456	3.837233
  026_8101_00256280	UrinaryTrack	8101	LB831-BLC	456	3.939929
  026_11_00298870	UrinaryTrack	11	T24	456	4.120815
  026_19_00298860	UrinaryTrack	19	SW-1710	456	4.713264
  026_7_00302400	UrinaryTrack	7	SCaBER	456	4.780909
  026_8101_00302620	UrinaryTrack	8101	LB831-BLC	456	4.856105
  026_22_00298810	UrinaryTrack	22	HT 1376	456	4.888331
  026_20_00299740	UrinaryTrack	20	VM-CUB1	456	4.987745
  026_14_00298780	UrinaryTrack	14	647-V	456	5.049696
  026_12_00299730	UrinaryTrack	12	TCCSUP	456	5.306108
  026_13_00298770	UrinaryTrack	13	639-V	456	5.658711
  026_16_00298800	UrinaryTrack	16	CAL-29	456	5.956916
  026_3_00308800	UrinaryTrack	3	HT-1197	456	6.060787
  026_17_00300420	UrinaryTrack	17	KU-19-19	456	6.388593
  026_10_00298820	UrinaryTrack	10	J82	456	6.755266
  026_8154_00262510	Uterus	8154	RL95-2	456	0.033885
  026_1116_00268860	Uterus	1116	SNG-M	456	2.236003
  026_8154_00280250	Uterus	8154	RL95-2	456	2.655708
  026_8166_00269750	Uterus	8166	SK-UT-1	456	2.769805
  026_1115_00268850	Uterus	1115	SKN	456	3.232484
  026_1112_00268820	Uterus	1112	Ishikawa (Heraldio)	456	3.572844
  			02 ER-
  026_1107_00311310	Uterus	1107	MFE-296	456	3.590101
  026_1108_00308840	Uterus	1108	MFE-319	456	3.953038
  026_1109_00269701	Uterus	1109	COLO 684	456	4.059524
  026_1102_00268790	Uterus	1102	AN3CA	456	4.238238
  026_1108_00314330	Uterus	1108	MFE-319	456	4.375739
  026_1113_00268840	Uterus	1113	MES-SA	456	4.83984
  026_1117_00268810	Uterus	1117	HEC-1	456	5.215029
  026_1113_00318661	Uterus	1113	MES-SA	456	5.307659
  026_8206_00264270	Uterus	8206	KLE	456	5.888467
  026_1105_00308190	Uterus	1105	ESS-1	456	6.082924
  026_1104_00306500	Uterus	1104	EN	456	7.302741
  026_1106_00306510	Uterus	1106	MFE-280	456	7.686964
  026_8163_00302640	Vulva	8163	SK-LMS-1	456	2.432701
  026_8173_00302660	Vulva	8173	SW954	456	2.875791
  26_8174_00304380	Vulva	8174	SW962	456	4.641057
  026_481_00302570	Vulva	481	CAL-39	456	5.164144
  026_8174_00306540	Vulva	8174	SW962	456	6.896884

  Viability ratio

  	20	10	5	2.5	1.25	0.625	0.3125	0.15625	0.078125
  Barcode	uM	uM	uM	uM	uM	uM	uM	uM	uM
  026_8049_00277140	0.587	0.805	0.874	0.9304	0.8796	0.954	1.0285	1.094	0.9918
  026_664_00277150	0.663	0.734	0.847	0.9661	0.9652	1.029	0.9656	1.0172	0.9981
  026_653_00278500	0.693	0.686	0.74	0.7843	0.8546	0.889	0.967	0.9286	0.9525
  026_8204_00278540	0.768	0.875	0.826	0.8122	0.8629	0.862	0.8909	0.9353	0.9353
  026_8188_00293390	0.915	0.929	0.913	0.9808	0.9201	1.144	1.0128	0.9048	0.9496
  026_330_00278580	0.36	0.392	0.383	0.4615	0.437	0.566	0.7772	0.9442	0.9662
  026_8047_00283120	0.515	0.521	0.539	0.5362	0.7569	0.769	0.8353	0.9371	0.9503
  026_8053_00287650	0.333	0.545	0.665	0.8165	0.9099	0.962	0.9571	0.9945	1.0406
  026_8227_00288230	0.359	0.554	0.585	1.0389	0.9034	0.952	1.1264	1.2671	1.0023
  026_8050_00279380	0.487	0.555	0.593	0.6879	0.6908	0.788	0.8057	0.892	0.9331
  026_306_00278530	0.527	0.556	0.577	0.682	0.673	0.855	0.8706	0.8641	0.8867
  026_305_00277180	0.145	0.599	0.657	0.7441	0.8231	0.793	0.8449	0.9969	0.8925
  026_337_00283440	0.448	0.696	0.939	0.8026	0.8478	0.903	0.9796	0.8682	1.0954
  026_8227_00304340	0.542	0.666	0.884	0.8971	0.9918	0.974	1.0247	1.0031	1.0728
  026_8043_00283110	0.543	0.663	0.705	0.7865	0.811	0.835	0.7995	0.9278	0.8292
  026_8142_00282550	0.547	0.775	0.825	0.892	0.7556	0.894	0.8477	1.1038	0.9881
  026_8055_00290580	0.638	0.688	0.718	1.1012	0.9293	0.993	1.0646	1.1078	1.0895
  026_8058_00293350	0.715	0.595	0.72	0.7195	0.8774	0.8	0.8628	0.9101	1.2148
  026_339_00277160	0.59	0.789	0.875	0.9222	0.9594	0.975	0.933	1.1433	0.9637
  026_8165_00287690	0.621	0.812	0.933	0.9706	0.9188	0.991	1.0026	1.0012	1.0432
  026_326_00282540	0.618	0.719	0.824	0.8235	0.8745	0.966	1.1187	1.0416	0.913
  026_8048_00279370	0.572	0.698	0.765	0.8053	0.8255	0.912	0.931	0.9069	0.9095
  026_331_00278590	0.53	0.798	0.749	0.7609	0.8727	0.839	0.8786	0.8236	0.972
  026_8045_00282660	0.704	0.653	0.874	0.8827	0.7407	0.913	0.8294	1.0585	1.162
  026_8059_00283090	0.662	0.72	0.76	0.831	0.8857	0.95	0.9309	0.9266	0.9963
  026_8201_00282520	0.707	0.721	0.778	0.8414	0.8385	0.989	0.9588	1.0248	1.0261
  026_8056_00314310	0.701	0.827	0.819	0.8824	0.9413	0.894	0.9848	1.0221	1.1139
  026_329_00282700	0.705	0.918	0.893	0.949	1.0435	1.016	0.9814	0.9215	1.1209
  026_324_00278550	0.731	0.942	0.942	0.9262	0.9863	0.966	0.9797	0.9547	1.0113
  026_304_00283460	0.742	0.784	0.9	0.8765	0.9306	0.926	0.9516	0.95	1.0352
  026_325_00283060	0.727	0.913	0.918	0.9149	0.8999	0.897	0.9065	1.0242	1.0181
  026_1138_00278560	0.744	0.848	0.864	0.8601	0.8818	1.016	1.0005	0.9749	0.977
  026_8162_00282560	0.802	0.803	0.805	0.7765	0.762	0.974	1.0651	1.0412	1.0623
  026_336_00283430	0.724	0.86	0.806	0.8427	0.8308	0.87	0.8972	0.9772	1.0073
  026_328_00278600	0.844	0.939	0.97	1.0221	0.9857	1.072	1.023	1.0842	1.0071
  026_8054_00282530	0.835	0.775	0.925	0.8021	0.8155	0.934	0.9339	1.058	1.1414
  026_335_00308220	0.884	0.841	0.852	0.8745	1.0185	1.081	1.1007	1.0325	1.0709
  026_1241_00283070	0.883	0.851	0.947	0.9788	0.9327	1.019	1.0879	1.0294	1.119
  026_8044_00279340	0.822	0.876	0.92	0.8612	0.8592	0.873	0.8969	0.9914	0.9632
  026_8057_00283080	0.927	0.899	0.97	0.9817	0.9704	1.012	0.9822	0.9596	0.9793
  026_8051_00285230	0.924	1.008	0.846	0.9309	1.047	0.868	0.9762	1.0834	1.048
  026_8046_00279351	0.882	1.065	1.046	1.0203	1.0617	0.85	0.8881	1.0547	0.9578
  026_8146_00285140	0.362	0.369	0.387	0.52	0.6146	0.733	0.8773	0.9176	1.1016
  026_8009_00285111	0.545	0.617	0.664	0.5881	0.5592	0.692	0.826	0.9522	1.078
  026_8091_00285281	0.617	0.59	0.62	0.7057	0.7844	0.875	0.9025	1.0584	1.1343
  026_388_00285240	0.505	0.754	0.852	0.977	0.9597	0.989	1.1211	1.0361	1.0747
  026_352_00283150	0.552	0.647	0.662	0.7206	0.8119	0.932	0.9285	1.0381	1.0748
  026_8214_00290680	0.558	0.628	0.773	1.0443	0.9614	1.113	1.1139	1.093	1.2619
  026_8214_00288290	0.627	0.651	0.866	0.8387	0.8073	0.922	1.077	1.0619	1.1182
  026_358_00293700	0.64	0.743	0.916	0.9078	0.9464	0.928	0.871	0.9767	1.4204
  026_8061_00290830	0.613	0.692	0.809	0.8255	0.8977	0.877	0.9922	0.9416	0.8923
  026_374_00283180	0.654	0.733	0.861	0.8164	0.8981	0.891	0.9222	0.9976	1.1342
  026_343_00283160	0.626	0.904	1.007	1.0229	0.934	1.078	1.0411	1.0084	1.052
  026_393_00283190	0.646	0.714	0.77	0.8178	0.8374	0.848	0.953	0.8805	1.0209
  026_8028_00287630	0.662	0.709	0.734	0.7813	0.8341	0.839	0.9023	0.9333	1.0435
  026_379_00283140	0.681	0.701	0.829	0.8043	0.8412	0.83	0.9322	0.8908	1.046
  026_8019_00293320	0.732	0.772	0.825	0.9222	0.9783	1.227	0.8865	0.8407	1.1628
  026_8001_00285100	0.688	0.845	0.88	0.8958	0.9285	0.912	0.9148	0.9398	1.07
  026_351_00283450	0.685	0.822	0.862	0.8746	0.8966	0.902	0.9022	0.9311	0.9325
  026_357_00283410	0.721	0.808	0.876	0.858	0.8822	0.94	1.0232	0.9287	1.0614
  026_8085_00293731	0.797	0.781	0.82	0.9645	0.9641	1.015	0.9981	1.0442	0.974
  026_350_00284910	0.723	0.834	0.869	0.8888	0.9473	0.909	0.9144	1.0191	1.0818
  026_8015_00308070	0.696	0.814	0.876	0.8121	0.825	0.889	0.917	0.9113	1.0138
  026_8160_00287680	0.726	0.919	0.827	0.8875	0.9392	0.934	0.952	1.0525	0.9285
  026_8159_00287670	0.786	0.825	0.923	0.9225	0.9772	0.99	0.978	0.9754	0.9699
  026_359_00283100	0.683	0.74	0.796	0.8102	0.876	0.896	0.9135	0.9254	0.9257
  026_8217_00290890	0.725	0.784	0.83	0.844	0.8849	0.901	0.9119	0.9353	0.9859
  026_342_00285160	0.796	0.905	0.896	0.9349	1.0662	0.935	1.0347	1.0148	1.08
  026_8029_00288240	0.792	0.892	0.997	0.8872	0.9556	0.944	1.105	1.0724	1.1057
  026_8030_00295500	0.791	0.866	0.824	0.9331	0.8638	1.022	0.9531	0.9688	1.0531
  026_8089_00287440	0.804	0.89	0.869	0.8138	0.8421	1.049	1.0747	0.9317	1.1222
  026_8138_00285290	0.771	0.817	0.763	0.762	0.8138	0.887	0.968	1.0104	1.049
  026_8139_00285130	0.824	0.888	0.928	0.9069	0.9436	1.031	0.943	1.05	1.0543
  026_8083_00293720	0.817	0.765	0.902	0.9843	0.9376	0.915	0.9382	1.0116	0.9496
  026_378_00284880	0.789	0.757	0.713	0.7179	0.7297	0.849	0.8425	0.9101	1.0114
  026_383_00284900	0.839	0.886	0.901	0.937	0.8868	1.041	0.949	0.0816	1.0986
  026_8032_00293340	0.822	0.856	0.927	0.9108	0.8977	0.934	0.9191	0.9743	0.9895
  026_344_00282720	0.777	1.136	0.931	0.9386	0.9371	1.018	1.0441	1.0001	0.9944
  026_8167_00290910	0.76	0.772	0.83	0.8023	0.8147	1.01	0.8804	1.0523	0.9382
  026_8087_00285270	0.862	0.858	0.846	0.8777	0.9301	0.972	0.9923	1.0701	1.0135
  026_354_00287481	0.851	0.949	0.942	0.9605	0.9939	1.004	1.0222	0.9964	1.0855
  026_8140_00285300	0.844	0.885	0.896	0.959	0.9411	0.893	0.9627	1.0352	0.9432
  026_8221_00284860	0.807	0.783	0.798	0.8469	0.8833	0.945	0.9877	0.9131	0.9215
  026_348_00283400	0.792	0.75	0.763	0.7919	0.7917	0.856	0.9393	0.9013	0.9922
  026_341_00285310	0.869	0.907	0.895	0.8893	0.9105	0.919	0.966	0.8961	1.0957
  026_356_00283420	0.841	0.993	0.888	0.8789	0.8908	1.04	0.8743	0.906	1.058
  026_8031_00287640	0.825	0.819	0.771	0.7649	0.8658	0.834	0.9457	0.9922	0.9572
  026_8224_00284870	0.839	0.84	0.858	0.8841	0.9252	0.941	0.968	0.9815	0.9816
  026_389_00284920	0.861	0.876	0.879	0.9129	0.9004	0.902	1.0597	0.9108	1.0304
  026_341_00283470	0.913	0.89	0.897	0.897	0.9463	0.931	0.9486	0.9506	1.1024
  026_375_00284850	0.896	0.892	0.932	0.944	0.9633	0.976	0.9735	0.9871	1.0285
  026_1122_00283170	0.879	0.909	0.909	0.9301	0.9215	0.946	0.9199	0.9433	1.0329
  026_8158_00290650	0.86	0.97	1	1.0676	1.0025	1.187	0.9851	0.9627	1.1324
  026_340_00285250	0.851	0.911	0.916	0.9011	0.9748	0.919	0.9109	0.9323	0.9837
  026_380_00284890	0.842	0.885	0.853	0.8466	0.8914	0.914	0.8882	1.0019	1.0545
  026_354_00290361	0.93	0.874	0.977	0.9346	0.9336	1.084	0.9295	1.062	1.073
  026_8063_00290841	0.809	0.877	0.913	0.9018	0.9184	0.86	0.9241	0.9072	0.9709
  026_8027_00293330	0.928	0.905	0.908	0.8398	0.8592	0.911	0.9463	0.9529	0.9044
  026_346_00283390	0.941	0.953	0.995	1.0208	0.9242	1.026	1.0141	1.0236	1.0356
  026_8089_00291170	0.854	0.823	0.854	0.8437	0.8524	0.889	0.8917	0.9075	0.9111
  026_355_00285180	0.965	1.005	0.945	0.9352	0.9307	0.932	0.9407	0.945	0.9851
  026_347_00282740	0.986	1.098	0.951	1.0602	0.9957	1.038	1.0462	0.9753	0.982
  026_417_00271110	0.119	0.118	0.124	0.1202	0.1235	0.121	0.164	0.4789	0.6922
  26_465_00271670	0.115	0.398	0.572	0.6893	0.7807	0.868	0.921	0.9463	1.1175
  026_438_00273540	0.352	0.459	0.617	0.7517	0.8021	0.899	0.9102	0.9757	1.0216
  026_435_00271290	0.375	0.482	0.801	0.7466	0.7917	0.794	0.9164	0.9352	0.9707
  026_403_00271400	0.493	0.634	0.765	0.8761	0.9706	0.973	1.0249	1.0247	1.0456
  026_401_00273450	0.415	0.718	0.931	0.9526	0.909	0.954	0.9512	1.0282	0.9601
  26_451_00271640	0.489	0.695	0.808	0.7646	0.8147	0.885	0.8459	1.0885	0.9906
  026_404_00273430	0.483	0.731	0.783	0.824	0.8358	0.874	0.9446	0.9609	1.0599
  026_418_00271550	0.071	0.614	0.832	0.7916	0.8611	0.836	0.9569	0.9556	1.0186
  026_402_00272120	0.55	0.636	0.773	0.8152	0.9017	0.886	0.906	0.9417	0.9695
  026_426_00274200	0.571	0.713	0.945	0.9056	0.9414	0.938	0.9814	1.028	1.0046
  026_431_00271130	0.566	0.672	0.68	0.6852	0.6987	0.765	0.8378	1.0081	1.1468
  026_414_00271900	0.533	0.816	0.949	0.9831	0.9841	0.924	0.9729	0.9876	1.1475
  026_452_00272130	0.358	0.743	0.843	0.9519	0.9643	0.904	0.9021	1.0288	0.9665
  026_416_00271360	0.659	0.818	0.911	0.9492	0.9446	0.965	0.9707	0.9785	1.0314
  026_8144_00274240	0.44	0.801	0.89	0.9127	1.0139	1.046	0.9729	0.96	1.0167
  026_432_00271960	0.605	0.733	0.855	0.8647	0.8214	0.887	0.9582	0.9394	1.1987
  026_457_00273420	0.686	0.879	0.927	0.9385	0.9505	0.975	0.9713	0.9606	1.0214
  026_466_00274370	0.654	0.836	0.87	0.9113	0.9082	0.908	0.9623	1.0457	0.9738
  026_441_00285120	0.474	1.044	0.849	0.8244	0.6122	0.948	1.0739	0.6695	1.0405
  026_443_00271990	0.601	0.92	0.94	0.9085	0.9663	0.971	0.9817	0.9257	1.0607
  026_436_00271300	0.703	0.897	0.946	0.9395	1.0136	1.033	1.0207	1.0407	1.1296
  026_412_00277190	0.421	0.859	0.854	0.8448	0.9188	0.999	0.9512	1.0422	0.9971
  026_450_00271390	0.678	0.725	0.783	0.8043	0.8395	0.899	0.9313	0.9642	1.0975
  026_449_00271380	0.747	0.676	1.08	0.9571	0.7093	0.888	0.981	0.8213	1.2196
  026_434_00271920	0.726	0.808	0.808	0.822	0.8993	0.923	0.919	0.949	1.1427
  026_433_00276270	0.686	0.9	0.944	0.8549	0.8115	0.943	0.972	0.9241	0.9618
  026_422_00274230	0.7	0.73	0.74	0.7666	0.8545	0.848	0.9155	0.9541	0.9487
  026_461_00272170	0.787	0.875	0.908	0.9465	0.988	1.047	1.0015	1.1431	1.0159
  026_427_00271330	0.795	0.819	0.921	0.9998	0.9757	0.998	1.0349	1.0264	1.1651
  026_448_00271370	0.744	0.746	0.796	0.8032	0.8728	0.85	0.9852	1.0071	1.0287
  026_411_00271420	0.82	0.894	0.873	0.9564	0.9958	0.944	0.9931	1.0326	0.9659
  026_442_00273480	0.614	0.923	0.963	1.0597	1.042	1.043	1.0714	1.0498	1.0318
  026_398_00272150	0.85	0.899	1.013	0.8915	0.9851	0.983	0.9959	0.9937	1.0331
  026_464_00308490	0.825	0.853	0.869	0.8588	0.823	0.978	0.9397	0.9562	0.968
  026_400_00273440	0.725	0.844	0.848	0.8326	0.8721	0.851	0.8881	0.9805	0.933
  026_437_00280161	0.796	0.982	0.913	0.8847	0.9397	1.088	0.8523	0.9109	0.9883
  026_440_00271950	0.807	0.813	0.885	0.8155	0.8463	0.861	1.0199	1.0209	0.9481
  026_413_00271930	0.839	0.926	0.932	0.9634	0.9633	0.941	0.9595	0.9516	1.1518
  026_410_00272180	0.83	0.857	0.88	0.8529	0.9183	0.913	0.911	1.03	0.9685
  026_439_00271940	0.841	0.952	0.975	1.0253	0.9632	0.953	1.0302	1.0262	1.0774
  026_408_00271350	0.871	0.955	0.93	0.9913	0.9764	0.972	1.0674	0.9818	1.1818
  026_399_00272160	0.884	0.875	0.885	0.8851	0.9175	0.914	0.9179	0.9049	0.9735
  026_458_00274220	0.84	1.072	1.136	1.0763	1.0797	1.042	1.0437	1.0231	1.0073
  026_397_00274350	0.874	1.053	1.023	1.0222	0.9856	0.93	0.9274	0.9402	0.9941
  026_405_00274360	0.935	0.959	0.987	0.9819	0.9119	0.921	0.9597	0.998	0.9922
  026_425_00280231	0.906	1.069	1.05	0.9597	0.9229	0.966	0.9422	0.9712	0.9545
  026_454_00272140	0.942	1.032	1.041	1.0545	0.9812	0.979	1.0186	1.0191	0.9742
  026_420_00271541	0.191	1.089	1.053	1.0824	1.0008	0.955	0.9764	0.9678	1.0149
  026_453_00273410	1.096	1.286	1.208	1.1112	1.0544	1.042	1.0064	1.0474	1.0572
  026_415_00316440	1.148	1.275	1.181	1.1462	1.089	1.147	1.0671	1.0911	1.1123
  026_8176_00316650	0.29	0.416	0.488	0.5211	0.5993	0.669	0.7672	0.7877	1.0572
  026_479_00264920	0.257	0.608	0.574	0.5844	0.5901	0.637	0.8649	0.8189	0.8617
  026_478_00271910	0.472	0.615	0.658	0.6776	0.6753	0.734	0.7964	0.8383	0.9143
  026_478_00269410	0.445	0.701	0.714	0.731	0.8172	0.771	0.9038	0.852	0.9634
  026_493_00268830	0.509	0.667	0.695	0.7355	0.6828	0.732	0.7953	0.9097	1.0456
  026_476_00269050	0.508	0.792	0.857	0.8645	0.8671	0.933	1.0078	1.0484	1.1636
  026_8145_00271140	0.531	0.786	0.84	0.8546	0.9307	0.911	1.0261	1.0441	1.0392
  026_484_00263710	0.327	0.715	0.879	0.8811	0.8284	0.817	0.9599	1.0361	1.165
  026_469_00264610	0.311	0.783	0.933	0.9784	0.9807	0.982	0.9321	0.9429	0.9946
  026_493_00262480	0.639	0.799	0.885	0.9474	0.9337	0.873	0.9457	0.8694	0.8949
  026_474_00269100	0.742	0.846	0.832	0.8807	0.9276	0.898	1.0004	0.9967	1.1646
  026_482_00262520	0.851	0.946	0.96	0.9752	0.9888	0.276	0.975	0.947	0.9669
  026_482_00274250	0.842	0.881	0.887	0.9541	0.9605	0.96	0.9679	1.044	1.0481
  026_482_00269740	0.838	0.89	0.925	0.9202	0.9445	0.931	0.9609	0.9695	0.9938
  026_468_00264600	0.363	0.92	0.961	0.9796	0.9907	0.984	1.01	0.9525	0.9858
  026_473_00264650	0.162	0.868	0.813	0.7938	0.8104	0.779	0.9163	0.8951	0.9568
  026_491_00264830	0.721	1.002	1.008	1.007	1.0125	0.97	1.0049	0.9721	0.9931
  026_476_00264900	0.225	0.991	0.994	0.9083	0.8797	0.89	0.982	0.9123	0.9144
  026_474_00264930	0.532	0.824	0.865	0.9092	0.9029	0.879	0.8904	0.8746	0.8785
  026_472_00264630	1.023	0.945	0.949	0.9806	0.9744	0.979	0.9915	0.9775	0.9824
  026_8180_00276230	0.313	0.365	0.448	0.4963	0.618	0.64	0.8902	0.6859	1.0361
  026_502_00276550	0.422	0.41	0.448	0.5484	0.5334	0.703	0.7332	0.8892	0.853
  026_497_00274050	0.328	0.402	0.467	0.567	0.6585	0.801	0.8957	0.9976	0.9719
  026_8252_00276570	0.101	0.3	0.567	0.6503	0.7826	0.861	0.8531	0.9243	0.9446
  026_496_00276530	0.522	0.516	0.476	0.5824	0.6741	0.815	0.8515	0.806	0.8896
  026_8233_00278570	0.493	0.568	0.679	0.7293	0.7791	0.852	0.8801	1.0449	0.8251
  026_8184_00282680	1.152	0.677	0.704	0.6755	0.7901	0.89	1.1989	1.0724	0.9825
  026_8277_00276670	0.518	0.605	0.768	0.8018	0.8549	0.883	0.9093	0.8952	0.9579
  026_506_00277170	0.544	0.752	0.743	0.8799	1.0437	0.937	1.0332	1.0004	1.0701
  026_8179_00276220	0.183	0.742	0.633	0.6476	0.7356	0.839	0.7964	0.8189	0.8318
  026_8185_00276250	0.201	0.606	0.658	0.7374	0.6587	0.744	0.775	0.681	0.9258
  026_8184_00293680	0.552	0.767	0.935	0.8745	0.8626	0.742	1.0239	0.863	0.9232
  026_8178_00280260	0.664	0.735	0.78	0.9124	0.8781	1.01	1.0331	0.9777	1.0127
  026_499_00276630	0.678	0.727	0.767	0.7928	0.8774	0.984	0.9911	1.0386	1.0007
  026_509_00276620	0.637	0.656	0.682	0.7368	0.7969	0.844	0.873	0.9181	0.9229
  026_8235_00276520	0.604	0.732	0.778	0.7882	0.8071	0.864	0.8729	0.8842	0.9483
  026_8251_00276640	0.673	0.784	0.878	0.8883	0.9366	0.926	0.9214	0.9309	0.9714
  026_8186_00282690	0.689	0.795	0.742	0.8146	0.856	0.846	1.0123	0.8588	1.0654
  026_495_00274190	0.742	0.818	0.865	0.9122	0.97	0.96	1.1262	0.9684	1.0444
  026_510_00273560	0.658	0.743	0.781	0.8044	0.8395	0.815	0.8665	0.9009	1.0802
  026_8186_00292740	0.739	0.769	0.893	0.8667	0.8573	0.944	1.0623	1.0025	1.1458
  026_503_00274070	0.731	0.796	0.816	0.8942	0.9487	0.912	0.9785	1.0104	1.0221
  026_504_00276560	0.716	0.731	0.748	0.7768	0.8124	0.867	0.9459	0.995	0.9576
  026_8208_00276600	0.748	0.785	0.808	0.8645	0.9033	0.954	0.9197	0.9231	0.9878
  026_512_00274080	0.781	0.839	0.89	0.9002	0.9769	0.929	0.9845	0.9744	1.0152
  026_8268_00276650	0.835	0.788	0.758	0.735	0.7503	0.833	0.9063	0.9163	0.972
  026_505_00274210	0.794	0.857	0.892	0.8943	0.9411	0.957	0.9493	0.9907	1.0431
  026_508_00278520	0.701	0.81	0.783	0.7873	0.7763	0.833	0.8596	0.903	0.9287
  026_498_00276540	0.84	0.853	0.898	0.9109	0.9353	0.924	0.9336	0.9199	0.942
  026_8202_00276660	0.822	0.845	0.848	0.8684	0.8821	0.913	0.9297	0.9627	1.0605
  026_8039_00276580	0.878	0.905	0.892	0.951	0.9277	0.926	0.9555	1.04	1.0068
  026_501_00274060	0.762	0.836	0.846	0.8398	0.8691	0.887	0.9278	0.9729	0.9854
  026_8246_00276610	0.887	0.93	0.92	0.9326	0.9185	0.978	0.97	0.9663	0.9315
  026_507_00278510	0.922	0.838	0.875	0.7771	0.8079	0.985	0.9753	0.9667	0.9919
  026_8183_00276240	0.111	1.028	0.936	1.0341	1.0898	0.876	0.8843	0.9699	0.8561
  026_8177_00282670	1.022	1.1	0.912	1.0973	1.0839	1.065	1.0874	1.0775	1.0749
  026_545_00260020	0.308	0.451	0.33	0.4014	0.4436	0.534	0.6634	0.7589	0.8693
  026_1217_00255750	0.254	0.413	0.453	0.4692	0.5199	0.565	0.691	0.6788	0.7738
  026_526_00308740	0.418	0.409	0.489	0.7595	0.7429	0.873	0.9067	0.918	1.0403
  026_530_00260620	0.142	0.356	0.628	0.7119	0.7851	0.825	0.9139	0.8747	0.8098
  026_552_00252890	0.382	0.613	0.727	0.8554	0.7778	0.977	0.8474	0.7957	0.9605
  026_550_00258980	0.464	0.564	0.904	0.7519	0.7827	0.709	0.7715	0.8596	0.9574
  026_1224_00256200	0.466	0.633	0.641	0.6635	0.6231	0.758	0.8287	0.8854	0.9263
  026_1223_00259190	0.193	0.664	0.718	0.8957	0.937	0.932	1.0111	0.988	1.0055
  026_548_00261030	0.489	0.696	0.761	0.8664	0.8685	0.911	0.9177	0.9218	0.9624
  026_517_00308680	0.536	0.616	0.696	0.7845	0.8433	0.813	0.9157	0.9495	1.0827
  026_8011_00257080	0.541	0.677	0.734	0.7445	0.7909	0.917	0.9622	0.9832	1.0203
  026_553_00259140	0.587	0.751	0.792	0.8761	0.9722	0.983	1.0097	0.974	0.999
  026_556_00257220	0.207	0.626	0.805	0.7174	0.6353	0.718	0.757	0.8593	0.8383
  026_536_00256080	0.593	0.821	0.877	0.8931	0.9405	1.049	1.0289	0.9991	1.0281
  026_561_00257110	0.634	0.867	0.849	0.916	0.9493	0.99	1.0155	1.0225	1.0222
  026_532_00308750	0.628	0.684	0.811	0.8452	0.8862	0.945	0.9298	0.9056	0.9974
  026_8012_00266550	0.46	0.775	0.9	0.8967	0.924	0.968	0.9717	1.0116	0.9946
  026_8100_00256170	0.701	0.899	0.929	0.9987	0.9867	0.989	1.0145	0.9621	0.9588
  026_1222_00253030	0.411	0.772	0.855	0.8291	0.7747	1.02	0.8664	0.932	0.9717
  026_533_00260900	1.325	1.15	0.832	0.8691	0.8188	0.863	0.9549	1.0427	1.0471
  26_547_00314070	0.708	0.872	0.897	0.9	0.8378	0.941	1.0131	0.9825	0.9292
  026_544_00256140	0.746	0.964	0.951	0.9801	0.9656	0.961	0.9765	0.9793	0.9061
  026_543_00256100	0.728	0.818	0.868	0.8349	0.9283	0.925	0.9696	0.966	0.9649
  026_537_00256120	0.834	0.892	0.921	0.9097	0.9511	0.935	0.9977	1.0062	0.9837
  026_549_00256220	0.866	0.873	0.883	0.8726	0.8907	0.97	0.987	0.9898	1.0714
  026_557_00259180	0.913	0.97	0.967	0.9738	0.9866	1.043	1.0896	1.0407	1.0277
  026_534_00256110	0.85	0.904	0.912	0.9312	0.925	0.939	0.9758	0.9901	0.9927
  026_542_00269190	0.903	0.908	0.952	0.9408	0.977	0.97	0.9966	1.0002	1.0269
  026_530_00262500	0.884	0.955	1.145	0.9682	1.009	0.988	0.9261	1.0121	0.9861
  026_540_00258490	0.839	1.048	1.049	1.0556	1.0464	1.041	1.0301	0.974	0.9953
  026_541_00256090	0.828	1.076	1.058	0.9602	1.0898	1.064	1.0874	0.9689	1.0462
  026_8003_00263440	0.877	0.857	0.859	0.8594	0.9753	0.982	0.9985	0.9367	0.969
  026_535_00256160	0.841	1.063	1.091	1.0795	1.0793	1.034	1.0404	1.0191	1.0095
  026_554_00257210	0.938	0.942	0.914	0.9247	0.9682	1.004	1.0285	1.0504	1.0506
  026_559_00256250	0.909	1.024	1.057	1.0632	1.0572	1.029	1.0059	0.9701	0.9782
  026_8071_00256760	0.576	1.146	1.274	1.3514	1.1688	1.173	1.0336	1.1999	0.8849
  026_521_00257180	0.896	0.846	0.901	0.8757	0.9278	0.886	0.9103	0.9436	0.9699
  026_555_00256270	0.946	0.982	0.977	0.9826	0.9957	0.96	0.9991	0.961	0.9207
  026_538_00258510	0.947	1.007	0.984	1.0014	1.0052	0.998	1.0105	0.9648	0.9952
  026_546_00259150	0.96	0.963	0.931	0.9179	0.9698	0.969	0.9884	1.006	0.9974
  026_560_00256260	1.005	0.994	1.003	0.9486	1.2114	0.897	0.9756	0.9433	0.9255
  026_551_00259130	0.999	1.037	1.039	1.0722	1.0616	1.067	1.0655	1.0038	0.9405
  026_558_00256240	1.148	1.077	0.985	1.1269	1.0034	1.093	0.9608	0.9252	0.9888
  026_531_00258970	1.046	1.067	1.063	1.0751	1.0712	0.965	1.0236	1.0421	0.9848
  026_570_00293670	0.268	0.258	0.267	0.2555	0.3743	0.418	0.7306	0.9824	0.9276
  026_8153_00295901	0.222	0.197	0.246	0.3161	0.4612	0.693	0.7818	0.9061	1.1131
  18	0.083	0.182	0.268	0.3978	0.5206	0.706	0.8518	0.9472	0.9745
  026_582_00295550	0.325	0.396	0.385	0.4168	0.4097	0.533	0.75	0.8239	0.9276
  026_8108_00298530	0.094	0.146	0.195	0.2527	0.5673	0.876	1.1755	1.0179	1.1926
  026_8274_00258540	0.432	0.599	0.539	0.5369	0.5735	0.603	0.7283	0.7462	0.9243
  026_8136_00260060	0.356	0.465	0.488	0.5338	0.5471	0.613	0.7238	0.8107	0.9473
  026_574_00298390	0.381	0.401	0.395	0.4593	0.6002	0.69	0.749	0.8474	0.9789
  026_589_00295371	0.336	0.381	0.435	0.4732	0.5791	0.862	1.1049	1.0627	1.1072
  026_608_00293620	0.242	0.394	0.399	0.4912	0.6325	0.738	0.9653	0.9069	0.9123
  026_610_00293660	0.45	0.416	0.414	0.6252	0.6775	0.804	0.981	1.0277	1.0565
  026_569_00295390	0.48	0.464	0.5	0.5547	0.5893	0.74	0.9536	0.9048	0.9241
  026_8271_00314300	0.382	0.522	0.535	0.5651	0.6481	0.701	0.7957	0.9458	0.9851
  026_8108_00296610	0.37	0.448	0.511	0.6156	0.8074	0.933	0.9905	0.9579	0.9991
  026_592_00295380	0.377	0.436	0.5	0.6258	0.8213	1.101	1.0858	1.0169	1.1148
  026_606_00293630	0.646	0.514	0.536	0.5915	0.7207	0.867	0.8829	0.9131	0.9417
  026_8107_00296450	0.497	0.55	0.585	0.5585	0.6884	0.755	0.8626	0.8921	0.9253
  026_595_00295420	0.453	0.515	0.551	0.6999	0.8666	0.91	1.0102	0.9178	1.1155
  026_8169_00295910	0.503	0.566	0.598	0.7373	0.671	0.774	0.9066	0.8796	0.9886
  026_564_00292860	0.496	0.556	0.55	0.7713	1.0007	0.964	0.9563	0.8783	0.9169
  026_603_00292731	0.525	0.597	0.586	0.7811	0.7763	1.002	1.023	1.0218	1.0696
  026_588_00295360	0.521	0.65	0.67	0.679	0.8325	0.964	1.0479	1.1013	1.0678
  026_598_00302650	0.616	0.696	0.742	0.6531	1.034	1.029	1.0798	0.8321	1.2207
  026_8276_00296000	0.603	0.592	0.612	0.6327	0.7283	0.812	0.8824	0.9411	0.9768
  026_593_00295530	0.589	0.646	0.61	0.7857	0.7974	1.03	1.1134	1.0941	1.1175
  026_8106_00264670	0.547	0.687	0.783	0.7554	0.8823	0.879	0.9202	0.965	0.9375
  026_599_00296340	0.572	0.642	0.631	0.6255	0.6275	0.757	0.9237	0.9401	0.9681
  026_8086_00296431	0.564	0.657	0.65	0.6739	0.8062	0.903	0.8847	0.9825	0.9793
  026_587_00302320	0.615	0.622	0.694	0.6624	0.7236	0.816	1.1047	1.0995	1.0783
  026_8273_00295970	0.577	0.622	0.663	0.7325	0.7399	0.745	0.8059	0.8644	1.0342
  026_8270_00304630	0.604	0.78	0.799	0.8256	0.8028	0.92	0.9246	0.9919	1.2066
  026_8168_00295990	0.645	0.673	0.685	0.6875	0.8368	0.739	0.8513	1.1115	1.0883
  026_8275_00256210	0.338	0.659	0.68	0.6942	0.7065	0.761	0.7749	0.8653	0.9224
  026_583_00295921	0.735	0.672	0.851	0.9918	1.0392	0.979	0.9178	0.9736	0.9758
  026_8274_00295980	0.663	0.72	0.672	0.6639	0.7521	0.794	0.8775	0.8761	0.9371
  026_8105_00296440	0.732	0.754	0.781	0.8085	0.8857	1.006	1.1032	1.0973	1.0698
  026_580_00295930	0.891	0.793	0.767	0.8394	0.8741	0.917	1.0326	0.9344	1.0884
  026_580_00266560	0.724	0.686	0.785	0.8147	0.8701	0.885	0.9546	0.9558	0.9803
  026_581_00295830	0.811	0.75	0.973	0.9405	1.0972	0.98	1.098	1.0722	1.1405
  026_573_00296370	0.775	0.787	0.797	0.8519	0.8683	0.915	0.9626	1.0901	1.097
  026_8021_00296390	0.817	0.861	0.828	1.0219	0.8974	1.103	1.0927	0.9967	1.1145
  026_8106_00298521	0.706	0.749	0.852	0.7598	0.7605	0.923	0.8934	0.9319	1.0175
  026_600_00296361	0.706	0.776	0.775	0.7937	0.8445	0.857	0.9382	0.915	0.9609
  026_8070_00296411	0.701	0.788	0.743	0.7463	0.8151	0.891	0.9115	0.9572	0.9432
  026_8135_00295950	0.813	0.864	0.948	0.9832	0.9658	0.94	0.9372	0.9633	1.1237
  026_8136_00295961	0.699	0.693	0.763	0.7315	0.7863	0.815	0.8715	0.8842	1.1461
  026_574_00263900	0.826	0.812	0.761	0.7543	0.8087	0.891	0.9784	0.9577	0.9649
  026_8026_00300671	0.827	0.955	0.974	0.9551	0.9288	0.954	0.9824	0.9866	1.0636
  026_607_00293610	0.834	0.873	0.912	0.8795	0.9318	0.939	0.9636	0.9483	0.9415
  026_8074_00296420	0.841	0.852	0.876	0.9027	0.8952	1.007	1.0026	0.966	0.9322
  026_563_00316540	0.853	0.949	0.926	0.9333	0.9253	0.879	0.9164	1.0369	1.0733
  026_596_00296280	0.885	0.885	0.874	0.8768	0.9374	0.931	0.9758	0.9779	1.0734
  026_597_00300651	0.647	1.058	0.925	1.031	0.9839	0.997	1.0631	1.0277	0.905
  026_601_00296480	0.973	0.939	0.93	0.9736	0.9545	0.891	0.964	0.9372	1.0259
  026_622_02288160	0.353	0.358	0.433	0.5045	0.6202	0.865	0.8778	1.0261	1.0061
  026_626_00298790	0.292	0.387	0.526	0.5522	0.8154	0.895	0.9347	1.005	1.054
  026_623_00288201	0.412	0.444	0.507	0.7421	0.8141	0.813	0.9099	0.9209	0.981
  026_8264_00290630	0.452	0.535	0.585	0.6574	0.9675	0.851	0.9828	1.0591	1.0712
  026_619_00290290	0.439	0.58	0.576	0.7655	0.8898	0.994	1.0776	1.0508	1.1513
  026_627_00291130	0.586	0.588	0.649	0.6813	0.7826	0.858	0.9811	0.9726	1.0003
  026_617_00290310	0.545	0.592	0.627	0.7345	0.7447	0.733	0.7712	0.919	1.1152
  026_8263_00290620	0.517	0.689	0.691	0.7857	0.7896	0.884	0.8746	0.9754	1.0284
  026_8190_00290280	0.638	0.654	0.671	0.7606	0.892	0.932	1.0085	1.0009	0.9983
  026_638_00288220	0.14	0.709	0.838	0.9211	0.92	0.981	0.9922	0.9588	0.989
  026_8261_00308760	0.566	0.724	0.758	0.85	0.8258	0.948	0.9492	0.9471	0.9351
  026_628_00288210	0.454	0.733	0.735	0.7572	0.8068	0.826	0.8584	0.9361	1.0195
  026_8262_00290610	0.583	0.783	0.794	0.8415	0.9082	0.87	0.8861	0.9471	0.9855
  026_8265_00302360	0.686	0.758	0.874	0.9595	1.0107	1.003	1.0135	1.0068	1.0345
  026_8261_00311200	0.288	0.72	0.73	0.765	0.8515	0.878	0.9287	0.8965	0.9174
  026_618_00290300	0.657	0.719	0.822	0.8016	0.8829	0.898	1.0239	0.917	1.0472
  026_625_00290670	0.662	0.756	0.767	0.9002	0.8304	0.876	0.9012	1.0588	1.1507
  026_8096_00290860	0.643	0.686	0.74	0.8137	0.8533	0.902	0.9235	0.9107	0.9322
  026_614_00291210	0.651	0.665	0.71	0.7683	0.8365	0.896	0.903	0.9074	0.9013
  026_8249_00295560	0.701	0.897	0.903	0.9199	0.9735	0.942	0.9933	1.0276	1.0113
  026_633_00290250	0.713	0.872	0.83	0.9644	0.8737	1.135	1.027	1.0923	1.0373
  026_8068_00290231	0.761	0.764	0.7	0.8322	0.7944	0.89	1.0474	1.1224	1.0563
  026_8095_00290260	0.772	0.824	0.914	1.0356	1.0154	1.004	1.0739	1.1192	1.1745
  026_626_00258890	0.741	0.932	1.057	1.0395	1.0888	1.03	1.0217	1.0625	1.0049
  026_8147_00290270	0.767	0.794	0.799	0.8302	0.9419	1.023	1.0718	1.0847	1.1694
  026_8013_00290220	0.714	0.769	0.765	0.8909	0.8509	0.865	0.9509	1.0096	0.903
  026_8006_00293300	0.755	0.917	0.918	0.9328	0.9788	1.112	0.981	0.9813	1.0413
  026_637_00290240	0.748	0.889	0.97	0.9322	0.836	1.012	1.0239	0.9503	1.088
  026_624_00290320	0.821	0.803	0.908	0.9738	0.9722	1.083	1.1676	1.1464	1.1228
  026_8266_00290640	0.754	0.903	0.819	0.8455	0.8764	0.999	0.9885	0.935	1.1762
  026_620_00288170	0.694	0.721	0.686	0.7919	0.7766	0.804	0.8404	0.885	0.9093
  026_8152_00293381	0.821	0.719	0.783	0.9032	0.8829	0.858	0.8991	0.9287	1.0343
  026_640_00291220	0.73	0.737	0.793	0.8088	0.8744	0.905	0.9003	0.9127	0.9163
  026_8102_00293360	0.855	0.901	0.954	0.9116	0.9754	0.98	0.958	0.9786	0.9921
  026_1119_00290901	0.818	0.749	0.747	0.783	0.8058	0.856	0.9038	0.9508	0.9573
  026_626_00290810	0.799	0.854	0.903	0.9293	0.9289	0.92	0.9333	0.9322	0.9535
  026_8005_00266530	0.594	0.917	1.009	1.0079	0.9307	0.996	1.0002	1.0033	0.9941
  026_8157_00296471	0.853	0.878	0.91	0.8924	0.9071	0.932	0.9081	0.9505	0.9889
  026_8102_00253000	0.959	0.873	0.878	0.9741	0.9596	1.025	0.9525	0.9849	0.9931
  026_8006_00263880	1.351	0.929	1.157	0.9881	1.0206	0.957	1.0009	0.9583	0.9931
  026_8152_00256190	1.178	0.835	1.176	0.846	0.8683	1.123	1.1733	1.1056	1.0876
  026_8005_00296380	1.022	1.025	1.024	1.0158	1.03	1.032	1.0128	1.0239	1.0104
  026_233_00277420	0.228	0.243	0.233	0.2401	0.2362	0.247	0.2641	0.2732	0.4405
  026_217_00277380	0.09	0.102	0.106	0.1256	0.1044	0.132	0.3277	0.8333	0.8618
  026_179_00314500	0.13	0.135	0.138	0.1591	0.3658	0.608	0.865	0.8967	1.0615
  026_214_00285590	0.18	0.323	0.315	0.3611	0.4215	0.592	0.8144	0.8865	0.9464
  026_168_00280410	0.145	0.179	0.186	0.2526	0.4638	0.727	0.9379	0.904	0.9907
  026_194_00280680	0.418	0.395	0.379	0.4439	0.4739	0.633	0.7874	0.8519	1.0223
  026_186_00280670	0.152	0.15	0.191	0.3623	0.6147	0.774	0.777	0.8716	0.8816
  026_234_00314650	0.37	0.347	0.369	0.4439	0.4995	0.57	0.729	0.9566	1.2103
  026_221_00280300	0.183	0.235	0.344	0.5052	0.5942	0.759	0.8267	0.8418	1.1212
  026_260_00280430	0.348	0.376	0.357	0.3446	0.4195	0.753	0.7217	0.7637	1.0996
  026_45_00274530	0.344	0.389	0.403	0.4669	0.6154	0.78	0.9211	0.9579	1.0107
  026_218_00279140	0.368	0.38	0.401	0.4571	0.5459	0.76	0.8359	0.9311	0.9403
  026_219_00280290	0.245	0.404	0.427	0.4943	0.686	0.712	0.8112	0.9498	0.9021
  026_199_00314510	0.227	0.339	0.454	0.5097	0.5774	0.766	0.8101	0.9633	1.1416
  026_226_00280310	0.406	0.425	0.463	0.4834	0.537	0.657	0.7338	0.7978	0.8482
  026_8141_00274380	0.375	0.445	0.435	0.4798	0.5465	0.636	0.9597	0.9214	0.9288
  026_8069_00279180	0.349	0.345	0.454	0.634	0.6764	1.103	0.7322	0.8261	1.0097
  026_68_00273640	0.061	0.367	0.445	0.5488	0.6586	0.777	0.8697	0.9167	1.045
  026_175_00282940	0.562	0.517	0.444	0.6051	0.7411	0.916	0.9551	1.1003	1.0193
  026_89_00278880	0.223	0.376	0.433	0.6062	0.6931	0.86	0.9075	0.9993	1.0376
  026_8017_00279150	0.147	0.454	0.57	0.8503	0.5534	0.638	0.7679	0.8629	1.0089
  026_225_00277400	0.317	0.403	0.525	0.6985	0.7396	0.932	0.9611	0.9018	1.0833
  026_285_00282960	0.422	0.426	0.445	0.6672	0.7837	0.935	1.0015	1.0293	1.0583
  026_8008_00280620	0.143	0.469	0.549	0.6225	0.6911	0.725	0.845	0.8482	1.019
  026_177_00276860	0.195	0.451	0.523	0.6745	0.9068	0.897	0.9087	0.9169	1.0477
  026_126_00280270	0.297	0.444	0.595	0.682	0.7944	0.786	0.9053	0.9081	0.8666
  026_261_00274440	0.395	0.471	0.59	0.6443	0.7461	0.832	0.8778	1.0023	1.0569
  026_201_00277390	0.276	0.43	0.578	0.7394	0.7801	0.857	0.9379	1.0322	0.9678
  026_148_00277330	0.275	0.484	0.637	0.6101	0.744	0.771	0.9002	0.8949	0.8668
  026_28_00280320	0.261	0.506	0.579	0.7214	0.7165	0.82	0.908	0.9679	0.9913
  026_190_00287920	0.611	0.596	0.587	0.5806	0.5987	0.684	0.7906	0.8581	0.9106
  026_8150_00273700	0.441	0.546	0.595	0.6574	0.7011	0.771	0.852	0.962	0.9148
  026_8156_00273710	0.339	0.474	0.598	0.694	0.7428	0.867	0.9518	0.9936	0.9682
  026_161_00277350	0.447	0.517	0.568	0.6165	0.6342	0.768	0.7642	0.9074	1.0155
  026_195_00279120	0.394	0.455	0.518	0.6868	0.817	0.872	0.9157	0.983	1.0345
  026_209_00279130	0.14	0.471	0.592	0.6915	0.7587	0.808	0.8658	0.9205	0.9768
  026_127_00278810	0.342	0.505	0.625	0.6869	0.7679	0.843	0.9355	0.9565	0.9827
  026_8196_00278790	0.337	0.476	0.617	0.7249	0.8167	0.885	1.0481	1.0695	1.0723
  026_223_00276841	0.266	0.472	0.62	1.0139	0.9551	0.864	0.9219	1.0283	0.907
  026_157_00279291	0.354	0.498	0.624	0.7174	0.8189	0.89	0.9495	0.9928	1.0144
  026_174_00276850	0.368	0.541	0.63	0.778	0.8566	0.998	1.0142	0.9561	0.9985
  026_223_00274461	0.274	0.465	0.567	0.909	0.9914	1.041	1.0272	0.9908	1.0038
  026_231_00277410	0.292	0.525	0.673	0.8379	0.894	0.956	1.0525	1.0069	1.0163
  026_176_00278840	0.342	0.551	0.66	0.7185	0.7521	0.822	0.8942	1.034	0.9817
  026_198_00279320	0.422	0.613	0.604	0.6789	0.7123	0.753	0.8469	0.8678	0.9555
  026_35_00274541	0.368	0.518	0.657	0.7557	0.8266	0.893	0.9057	1.0649	1.0505
  26_256_00273800	0.423	0.53	0.596	0.6351	0.7316	0.782	0.8701	0.9616	0.9089
  026_41_00278850	0.445	0.507	0.569	0.7321	0.8443	0.89	0.9006	0.9237	0.9648
  026_38_00278900	0.389	0.568	0.692	0.7667	0.7899	0.895	0.9332	0.9649	0.9902
  026_153_00277340	0.308	0.563	0.682	0.7882	0.8949	0.972	1.0362	1.0213	1.0568
  26_284_00273770	0.459	0.524	0.599	0.642	0.7677	0.831	0.9119	0.9596	0.9938
  026_256_00304780	0.453	0.543	0.608	0.6629	0.7604	0.806	0.9117	0.9547	0.9487
  026_8033_00279160	0.433	0.595	0.647	0.7617	0.7648	0.851	0.9096	0.9116	0.9641
  026_227_00314640	0.39	0.571	0.742	0.8517	0.9043	0.946	0.9917	1.0175	1.1197
  026_33_00274521	0.354	0.606	0.685	0.7594	0.8191	0.904	0.9597	0.9629	1.0269
  026_141_00276820	0.51	0.504	0.624	0.8081	0.8379	1.163	0.9404	1.0057	1.0193
  026_8137_00273680	0.464	0.601	0.622	0.6486	0.7425	0.801	0.8993	0.9038	0.9449
  026_36_00274550	0.418	0.628	0.742	0.8367	0.88	0.896	0.9262	0.8979	0.9849
  026_8042_00285400	0.232	0.569	0.651	0.7409	0.7743	0.894	0.8333	0.905	0.9094
  026_281_00273690	0.473	0.654	0.769	0.9121	0.8865	1.022	1.0746	1.0233	1.0407
  026_59_00278820	0.457	0.659	0.795	0.8429	0.9259	1.002	1.0587	0.9873	1.1396
  026_164_00277360	0.426	0.745	0.939	0.9081	1.0194	0.987	1.0611	1.0159	0.9841
  026_183_00277370	0.468	0.685	0.82	0.9025	0.9548	1.046	1.0249	0.9812	1.02
  026_90_00282840	0.446	0.74	0.806	0.917	0.9589	0.978	0.9646	1.0111	1.0409
  026_27_00278890	0.47	0.684	0.809	0.8895	0.9144	0.975	0.9547	0.9619	1.0194
  026_167_00314490	0.503	0.713	0.842	0.9399	0.9544	0.985	0.9987	1.034	1.0702
  026_181_00278860	0.484	0.669	0.731	0.7843	0.8662	0.92	0.9473	0.9339	0.9555
  026_8155_00309110	0.648	0.63	0.689	0.8376	0.888	0.99	0.9938	1.0182	1.0157
  026_8041_00280640	0.557	0.687	0.614	0.634	0.706	0.679	0.8613	0.8617	1.9538
  026_142_00279280	0.187	0.624	0.769	0.7092	0.7975	0.937	0.9525	0.9717	0.8276
  026_277_00280420	0.659	0.636	0.566	0.6117	0.6594	0.722	0.8693	0.9508	0.9057
  026_180_00279310	0.512	0.704	0.788	0.8503	0.8703	0.949	0.905	0.9806	0.9931
  026_8066_00279170	0.532	0.681	0.762	0.8318	0.8448	0.865	1.0258	0.9609	0.9989
  026_283_00273780	0.592	0.732	0.916	0.9522	1.0268	1.078	0.9517	1.0295	1.0135
  026_114_00273650	0.637	0.807	0.908	1.0154	0.984	1.031	0.99	0.9877	1.0134
  026_138_00287901	0.289	0.749	0.772	0.942	0.9225	0.948	0.9678	0.9653	1.0654
  026_8014_00282911	0.68	0.757	0.965	1.1246	1.0528	1.075	1.0884	1.0694	1.1037
  026_274_00273860	0.65	0.709	0.777	0.8768	0.9725	0.983	0.9819	0.9839	0.9978
  026_222_00280480	0.681	0.619	0.771	0.9443	0.8789	1.073	0.9014	0.9191	0.9051
  026_8164_00283540	0.669	0.788	0.861	0.8903	0.938	0.941	1.0087	0.9277	0.9972
  026_166_00278830	0.636	0.791	0.85	0.8566	0.8711	0.916	0.9455	0.9892	1.057
  026_230_00282970	0.741	0.775	0.805	0.9413	0.9813	1.11	1.1334	1.0559	0.999
  026_159_00314480	0.714	0.845	0.899	0.9099	1.0285	0.923	1.0677	1.0768	1.0543
  026_278_00304730	0.765	0.814	0.84	1.0641	0.988	1.023	1.0045	1.0284	1.0665
  026_8219_00282850	0.73	0.825	0.804	0.9425	0.9233	1.033	0.8454	1.1551	1.0561
  026_279_00274450	0.705	0.805	0.799	0.819	0.8632	1.043	1.0364	0.9822	1.0363
  026_171_00285190	0.703	0.9	0.906	0.9339	0.9295	0.904	0.9725	0.9496	0.9164
  026_244_00273660	0.698	0.758	0.785	0.8345	0.8593	0.861	1.0445	1.0026	1.0194
  026_158_00291340	0.665	0.745	0.765	0.7841	0.8282	0.839	0.92	0.9348	1.0344
  026_134_00278800	0.781	0.856	0.96	0.848	1.0568	1.029	1.0104	1.0156	1.0086
  026_246_00273670	0.754	0.891	0.936	0.9419	0.9607	0.937	1.032	0.9352	1.0229
  026_8113_00280440	0.771	0.883	0.929	0.9704	0.9337	0.987	1.0345	1.0223	1.0471
  026_159_00311690	0.746	0.894	0.921	0.9275	0.9393	0.941	0.9575	0.9338	0.9675
  026_159_00282920	0.746	0.976	1.016	0.9859	1.0015	1.002	1.1587	1.1041	1.0548
  026_8115_00280450	0.826	0.804	0.822	1.0586	0.9555	0.947	1.0471	1.128	1.0314
  026_204_00280460	0.736	0.802	0.771	0.8409	0.8712	0.833	0.8634	1.0677	0.855
  026_8117_00280470	0.823	0.984	1.063	1.051	1.0142	1.007	0.9986	0.9654	0.9525
  026_188_00282930	0.831	0.887	0.972	0.8808	0.9105	0.886	0.9533	0.9576	1.138
  026_8081_00285580	0.884	0.904	0.907	0.9131	1.01	1.097	1.0593	0.9629	1.0333
  026_159_00309070	0.882	0.986	0.998	1.0992	1.0048	1.045	1.0126	1.024	1.0649
  026_8080_00280660	0.867	0.876	0.901	0.8865	0.9235	0.909	0.9782	0.8964	0.9789
  026_278_00306920	0.971	0.92	0.95	0.9554	0.9046	0.905	0.9657	1.0243	0.9236
  026_8010_00280630	1.03	0.958	0.835	0.8896	0.8651	0.907	0.9392	0.8582	0.9763
  26_262_00273790	0.485	1.033	1.077	1.0216	1.0341	0.962	1.0378	0.9821	1.0245
  026_278_00282950	0.958	1.101	1.04	1.1177	1.0046	1.029	1.0272	1.0311	1.0037
  026_649_00264910	0.134	0.098	0.087	0.1121	0.2203	0.601	0.8432	0.8926	0.9089
  026_658_00262810	0.054	0.329	0.515	0.3993	0.5194	0.524	0.6608	0.6499	0.6863
  026_649_00266180	0.073	0.105	0.093	0.0908	0.1037	0.202	0.8123	0.9207	1.007
  026_667_00273550	0.279	0.565	0.539	0.5535	0.7134	0.77	0.8626	0.9675	0.9662
  026_659_00255780	0.283	0.473	0.657	0.7149	0.551	0.819	0.8858	0.8891	1.0202
  026_643_00266460	0.415	0.687	0.643	0.6854	0.6879	0.717	0.7896	0.8076	0.9193
  026_667_00269210	0.501	0.59	0.665	0.6852	0.6886	0.781	0.95	1.0287	1.0142
  026_647_00269110	0.494	0.772	0.829	0.9402	0.9686	1.046	1.0372	1.0223	1.2144
  026_661_00252500	0.539	0.889	0.794	0.8777	1.0776	0.953	0.9918	1.037	0.9476
  026_643_00263980	0.487	0.768	0.854	0.8235	0.8763	0.883	0.9616	1.068	1.0718
  026_642_00308440	0.587	0.68	0.706	0.7687	0.817	0.878	0.9697	0.9574	0.9245
  026_648_00258350	0.139	0.699	0.902	0.9157	0.9485	0.909	0.9218	0.9469	1.0028
  026_656_00252510	0.701	0.653	0.631	0.8187	0.7968	0.977	0.9161	0.9897	0.9288
  026_660_00252490	0.696	0.88	1.034	0.9294	0.9465	1.04	0.9417	1.0528	0.952
  026_644_00252750	0.664	0.733	0.764	0.7954	0.8597	0.896	0.9485	0.9457	0.9162
  026_644_00306170	0.96	0.961	0.745	1.0716	1.0197	1.08	0.991	0.9007	0.9369
  26_646_00314060	0.181	0.97	0.971	0.9863	1.0061	1.007	1.0271	1.0202	0.057
  026_654_00255800	0.927	0.956	0.961	0.9827	0.9589	0.98	0.9783	0.9726	0.9998
  026_668_00252690	0.434	1.006	1.087	0.9897	1.1103	0.964	1.006	1.106	0.9541
  026_662_00252460	0.466	1.165	1.072	1.0401	1.0408	1.136	1.015	1.123	0.9778
  026_645_00306160	1.105	1.061	1.063	1.0055	1.0268	1.053	1.0365	1.0318	1.0842
  026_642_00252670	0.386	1.1	1.007	1.108	0.9463	1.051	0.9803	1.029	0.9218
  026_830_00304760	0.298	0.262	0.246	0.3049	0.3692	0.528	0.7269	0.8905	0.977
  026_698_00300170	0.443	0.506	0.63	0.8741	0.9302	1.005	1.0131	1.0304	1.0567
  026_672_00314460	0.323	0.585	0.763	0.783	0.8906	0.969	0.9972	1.1809	1.0131
  026_761_00300410	0.559	0.745	0.868	0.9821	1.0079	1.06	1.0144	1.0182	1.0709
  026_726_00304770	0.524	0.729	0.842	0.8655	0.9088	0.871	1.0252	0.9207	1.129
  026_740_00302760	0.542	0.755	0.865	0.9592	1.0522	0.888	0.9137	1.004	1.0151
  026_787_00302910	0.582	0.655	0.694	0.802	0.8502	0.902	0.9485	0.9451	0.9885
  026_695_00300150	0.644	0.645	0.719	0.8327	0.8177	0.933	0.9519	0.9812	1.0305
  026_721_00302860	0.606	0.8	0.891	0.9011	0.8579	0.931	0.9429	1.0032	1.0011
  026_776_00303250	0.642	0.767	0.855	0.8458	1.1115	0.929	1.0414	1.0285	1.162
  026_8197_00304741	0.66	0.84	0.901	1.0158	0.9097	0.912	1.0844	1.1048	1.0641
  026_702_00302900	0.818	0.707	0.668	0.6815	0.7184	0.743	0.7999	0.9145	0.9524
  026_8203_00309050	0.635	0.801	0.87	0.931	0.9112	1	1.0127	0.9507	1.0704
  026_724_00300140	0.623	0.866	0.895	0.9027	0.9349	0.948	0.969	0.9681	1.0072
  026_765_00300050	0.702	0.844	0.904	0.9648	1.028	0.968	1.0795	1.0165	1.0825
  026_829_00305160	0.67	0.694	0.776	0.8765	0.8765	0.946	1.0573	0.91	0.9398
  026_742_00303230	0.711	0.802	0.867	0.9734	1.0075	1.037	1.0307	1.0204	1.0405
  026_710_00316710	0.591	0.852	0.7	0.7407	0.8259	0.789	0.8069	0.8386	0.865
  026_738_00302800	0.692	0.871	0.917	1.0421	0.9341	0.915	1.0657	0.9649	1.0382
  026_751_00308570	0.657	0.848	0.89	0.9403	0.8939	0.91	0.9316	0.9524	0.9513
  026_716_00298900	0.744	0.866	0.936	0.9448	0.9881	0.979	0.9782	0.9994	1.0261
  026_725_00303280	0.711	0.842	0.928	0.9702	0.9155	0.924	1.0044	1.0101	0.9559
  026_688_00302810	0.602	0.761	0.79	0.8093	0.807	0.823	0.896	0.8782	0.9341
  026_720_00302380	0.696	0.694	0.73	0.8114	0.9245	0.935	0.9484	0.9393	0.9738
  026_811_00311720	0.635	0.803	0.855	0.8503	0.8571	0.89	0.8912	0.955	0.9956
  026_704_00300250	0.166	0.762	0.867	0.8914	0.9318	0.923	0.9201	1.0122	0.9635
  026_746_00302780	0.79	0.843	0.955	1.029	0.9896	1.021	1.0111	0.9931	1.0025
  026_829_00311740	0.739	0.83	0.914	0.9675	0.9597	0.983	0.9791	1.032	0.9995
  026_736_00300181	0.798	0.87	0.945	1.0535	1.0472	1.143	1.0521	1.0846	1.1743
  026_724_00303270	0.708	0.95	1.023	0.9666	1.0134	0.99	1.0037	1.0388	1.0531
  026_714_00300260	0.701	0.831	0.843	0.8708	0.9426	0.93	0.9095	1.1071	1.0848
  026_715_00298890	0.73	0.833	0.997	0.9315	0.9434	0.955	0.9291	0.9423	1
  026_757_00302870	0.718	0.819	0.887	0.8883	0.9167	0.938	0.9641	1.0154	1.0153
  026_8229_00304990	0.685	0.828	0.788	0.868	0.6881	0.855	0.9579	0.8466	0.9772
  026_691_00308560	0.748	0.932	0.944	0.9861	0.9744	0.954	1.0035	1.0955	1.0007
  026_8099_00316740	0.755	0.954	0.998	0.9372	0.957	1.041	1.0171	1.0259	0.9506
  026_725_00302750	0.747	0.869	0.906	0.9009	0.9283	0.901	1.003	0.9238	1.1424
  026_705_00314520	0.77	0.861	0.911	1.02	0.9158	1.082	0.9997	0.9139	0.961
  026_684_00303260	0.832	0.831	0.988	1.0672	0.9906	1.099	1.0391	1.0378	1.0698
  026_725_00300160	0.785	0.908	0.936	0.9468	0.9309	0.94	0.9635	1.0477	0.9963
  026_8281_00300930	0.792	0.892	0.947	0.9155	0.8604	0.871	1.0268	1.0989	1.045
  026_757_00300940	0.796	0.904	0.984	1.0041	1.0137	0.919	0.905	0.9063	1.0167
  026_701_00309060	0.826	0.808	0.939	0.891	0.8811	0.919	0.9514	1.0474	1.0933
  026_814_00304750	0.784	0.726	0.739	0.745	0.7127	0.774	0.9411	0.9	0.9817
  026_741_00305010	0.801	0.818	0.835	0.9503	0.9116	0.894	0.8849	0.9853	1.083
  026_705_00311700	0.849	0.892	0.945	1.0426	0.9184	0.981	1.0366	1.0158	1.0581
  026_786_00300950	0.841	1.002	0.991	1.0148	0.9974	0.998	1.0298	1.0075	1.0015
  026_723_00316720	0.793	0.815	0.866	0.86	0.9117	0.892	0.9084	0.923	0.9757
  026_705_00309080	0.829	0.941	0.999	0.9672	0.8963	0.935	0.9991	0.9888	1.0506
  026_709_00305000	0.838	0.882	0.906	0.8939	0.9384	0.978	1.0127	1.0322	1.0575
  026_739_00314630	0.858	0.893	0.978	1.0115	1.0583	0.937	0.9685	1.0018	1.0831
  026_8110_00314450	0.87	0.909	0.986	0.9964	0.9809	1.094	0.9305	0.9513	1.1416
  026_811_00305140	0.886	0.953	0.978	0.9914	1.0102	0.994	0.9871	0.9783	0.9731
  026_711_00311710	0.875	0.91	0.911	0.9612	1.0374	0.917	1.267	1.0195	0.9447
  026_712_00309090	0.85	0.918	0.976	0.9527	0.9331	0.932	0.9583	0.9477	1.0343
  026_711_00305130	0.849	1.022	0.916	0.9247	0.9771	0.939	0.9326	1.0168	1.0143
  026_728_00311760	0.89	0.908	0.918	0.9801	0.875	1.033	0.9519	0.931	1.0431
  026_831_00311750	0.879	0.986	1.002	0.9709	0.9562	0.984	0.9781	1.0144	0.974
  026_1216_00300060	0.869	0.823	0.808	0.8192	0.8429	0.864	0.9245	0.9789	1.0777
  026_8109_00314440	0.868	0.95	0.972	0.9375	0.9332	0.959	0.9516	1.1207	1.1025
  026_831_00305170	0.837	0.856	0.908	0.8908	0.9397	0.905	0.9677	0.9512	0.9839
  026_728_00305180	0.9	0.903	0.976	0.9979	0.9199	0.928	0.9453	0.9369	0.941
  026_689_00300910	0.887	1.009	0.976	0.9779	0.9535	1.047	1.021	1.0846	0.959
  026_785_00302770	0.875	1.037	1.061	0.9376	1.0385	0.937	0.9403	1.0039	1.1602
  026_8280_00306910	0.965	0.937	1.019	0.8492	0.948	1.048	1.0366	1.0761	0.9586
  026_706_00318720	0.897	0.965	1.099	0.9821	0.9646	1.037	0.9974	0.9667	0.9589
  026_712_00305150	0.959	0.818	0.938	1.1033	0.9924	0.922	1.0128	1.0035	0.9263
  026_8079_00306720	0.947	0.972	0.935	0.9658	0.9445	0.966	0.9554	1.0191	1.0006
  026_743_00303220	0.862	0.853	0.785	0.7831	0.861	0.851	0.8815	0.9129	1.0374
  026_8022_00306711	0.97	0.968	0.956	1	0.9608	0.917	1.0093	0.9217	0.9308
  026_8109_00308510	0.924	1.012	1.105	0.9946	0.9684	1.081	0.9878	0.9397	0.9606
  026_758_00303240	0.931	1.056	1.002	1.0822	1.0508	1.011	1.0081	1.1612	1.1932
  026_771_00306940	0.988	0.969	0.972	1.0271	0.9989	1.006	0.993	1.0649	1.0235
  026_694_00302790	0.976	0.954	0.975	0.9548	0.9357	0.922	0.9564	0.9433	1.019
  026_764_00308550	0.978	1.021	0.944	1.002	1.0708	0.947	0.9637	0.9383	0.903
  026_763_00300900	0.96	1.168	0.891	1.1434	1.1503	0.976	1.0066	1.0636	1.052
  026_8134_00306730	1.026	1.003	0.976	1.0025	0.951	1.047	0.9338	0.8997	1.0076
  026_712_00311730	1.019	1.049	0.947	0.9403	0.9104	0.931	0.9349	0.9472	0.9659
  026_8018_00304801	0.106	0.165	0.183	0.2075	0.2699	0.394	0.8182	0.9121	1.0531
  026_1246_00304570	0.109	0.175	0.267	0.3543	0.4184	0.552	0.6475	1.0183	0.9838
  026_847_00304580	0.368	0.402	0.458	0.4756	0.5065	0.683	0.7888	0.9774	0.9846
  026_680_00298830	0.329	0.434	0.475	0.4492	0.5064	0.604	0.8522	0.9134	0.98
  026_748_00304590	0.342	0.457	0.514	0.5901	0.7687	0.757	0.7854	1.0039	0.932
  026_851_00298380	0.452	0.449	0.49	0.5839	0.7337	0.842	0.9205	0.938	0.9948
  026_861_00300230	0.424	0.573	0.622	0.7209	0.7517	0.873	1.0412	0.9724	0.974
  026_1245_00304550	0.507	0.571	0.662	0.5623	0.7611	0.961	1.0696	1.0483	1.4204
  026_1180_00308140	0.534	0.517	0.616	0.6044	0.7162	0.883	0.9512	0.9659	0.9657
  026_802_00298451	0.509	0.53	0.626	0.7229	0.8072	0.806	0.8743	0.9218	0.9534
  026_815_00311140	0.523	0.592	0.685	0.6168	0.6264	0.746	0.872	0.8493	1.0805
  026_1180_00302350	0.724	0.649	0.605	0.75	0.7455	0.913	0.9083	1.0538	1.1763
  026_8040_00304501	0.532	0.642	0.782	0.752	0.7074	0.804	0.9087	1.0521	1.0032
  026_865_00308451	0.58	0.657	0.735	0.83	0.9489	0.935	1.0144	1.0355	1.0002
  026_1243_00304541	0.553	0.739	0.944	0.948	0.9289	0.926	0.9919	1.0441	1.1113
  026_884_00308160	0.585	0.663	0.662	0.6574	0.7423	0.886	0.9636	0.9621	0.9957
  026_796_00295871	0.582	0.62	0.631	0.635	0.7036	0.747	0.8586	0.9443	0.9943
  026_799_00295880	0.667	0.587	0.685	0.6862	0.8151	0.782	1.0055	0.9053	0.9863
  026_822_00311150	0.153	0.716	0.736	0.7399	0.8095	0.819	1.026	0.9674	1.0055
  026_756_00302670	0.639	0.833	0.942	0.9322	0.9128	0.965	0.9486	1.0116	1.0192
  026_876_00299781	0.635	0.695	0.704	0.7208	0.8211	0.878	0.9851	1.0211	1.0551
  026_805_00304531	0.61	0.788	0.787	0.8467	0.9573	0.91	0.953	1.0683	1.0508
  026_834_00304610	0.653	0.736	0.756	0.8026	0.8524	0.984	0.9516	1.2251	1.0554
  026_822_00304840	0.594	0.736	0.791	0.7802	0.8592	0.824	0.8872	0.9703	1.0592
  026_835_00302390	0.693	0.659	0.651	0.6574	0.7337	0.768	0.8849	0.9046	1.0375
  026_678_00304981	0.655	0.751	0.848	0.8851	0.9411	1.013	0.9806	1.0842	1.1132
  026_807_00314280	0.604	0.778	0.772	0.8577	0.8346	0.815	1.0068	0.831	0.9772
  026_871_00299771	0.684	0.806	0.903	0.9071	0.958	1.018	0.9981	1.0604	1.0786
  026_1249_00308150	0.632	0.829	0.932	1.0847	1.526	0.799	0.8751	1.2042	1.1215
  026_8231_00304510	0.675	0.713	0.751	0.8781	0.831	0.931	0.976	1.0569	1.0459
  026_820_00304560	0.658	0.769	0.785	0.8744	0.8799	0.931	0.9563	1.1261	1.0206
  026_815_00304830	0.646	0.709	0.712	0.7108	0.8124	0.879	0.7844	1.0245	1.0786
  026_839_00302410	0.65	0.725	0.782	0.8242	0.8576	0.897	0.9535	1.0086	0.9978
  026_804_00308480	0.731	0.763	0.91	0.9442	0.9087	1.003	0.9482	0.9716	1.0139
  026_678_00309011	0.514	0.846	0.86	0.931	0.9037	0.925	0.9312	0.9354	1.0786
  026_842_00298540	0.729	0.811	0.916	1.0516	1.0142	1.002	1.0457	1.0025	0.9761
  026_824_00314260	0.695	0.731	0.691	0.7704	0.893	0.886	0.905	0.9791	1.0866
  026_888_00298370	0.64	0.676	0.717	0.7343	0.8328	0.84	0.8774	0.9195	0.9448
  026_823_00298430	0.691	0.707	0.702	0.7393	0.7957	0.834	0.9053	0.9612	0.9902
  026_8232_00304520	0.712	0.795	0.825	0.8558	0.8815	0.959	0.9014	1.1842	1.0135
  026_755_00300611	0.666	0.968	0.963	0.9052	0.9346	0.928	0.9969	0.9681	0.973
  026_868_00295440	0.726	0.893	0.842	0.8971	0.9361	1.057	0.9146	1.1281	0.933
  026_872_00299750	0.731	0.742	0.798	0.8152	0.8972	0.941	0.9735	1.0074	1.0301
  026_800_00298441	0.702	0.698	0.786	0.7938	0.8549	0.889	0.9216	0.9447	1.013
  026_836_00304620	0.684	0.798	0.819	0.8507	0.863	0.86	0.9116	1.0106	1.0518
  026_865_00296401	0.791	0.78	0.815	0.8605	0.9148	0.924	1.1179	1.1287	1.1293
  026_858_00300591	0.703	0.983	0.936	1.06	0.9813	0.96	1.0028	0.9854	1.0584
  026_854_00300681	0.736	0.914	0.943	1.0019	1.0017	0.864	0.8937	0.9686	1.0373
  026_837_00311160	0.771	0.917	0.969	0.9878	0.9667	1.017	1.0165	1.0062	1.0324
  026_8111_00308110	0.711	0.796	0.884	0.8648	0.868	0.89	0.9108	0.8979	0.9642
  026_1136_00308471	0.725	0.768	0.682	0.7469	0.7866	0.883	0.9296	0.914	0.9652
  026_827_00308860	0.79	0.823	0.87	0.9311	0.924	1.007	0.967	1.0124	1.1093
  026_859_00311090	0.737	0.86	0.852	0.7863	0.8298	0.853	1.0366	1.1949	0.9783
  026_886_00296261	0.761	0.848	0.884	0.9053	0.9307	0.969	0.9903	0.9432	1.0947
  026_8132_00308130	0.749	0.796	0.839	0.8331	0.8916	0.939	0.9049	0.9661	0.9286
  026_793_00299711	0.775	0.801	0.686	0.7429	0.7804	0.897	0.9136	0.9608	1.0112
  026_1247_00314271	0.773	0.893	0.836	0.831	0.851	1.029	1.0615	0.9828	1.0493
  026_860_00298400	0.751	0.819	0.803	0.8985	0.8725	0.898	0.9606	0.9519	1.061
  026_806_00300270	0.792	0.845	0.882	0.8698	0.8856	0.881	1.0769	0.9333	1.0648
  026_877_00300630	0.847	0.832	0.968	0.9943	1.0985	1.01	1.0152	1.0063	1.1608
  026_753_00298460	0.839	0.888	0.945	0.9015	1.041	1.039	1.021	0.9905	1.0126
  026_844_00295461	0.798	0.834	0.833	0.8824	0.8946	0.971	1.0223	0.9943	1.0074
  026_8088_00314320	0.86	0.847	0.879	0.9874	0.9738	1.047	1.0602	1.0303	0.9876
  026_848_00314320	0.811	0.91	0.946	0.9174	0.9429	0.922	0.9544	1.0372	1.0115
  026_864_00300641	0.718	0.78	0.762	0.8018	0.7683	0.837	0.9721	0.8644	0.9527
  026_677_00304961	0.763	0.799	0.843	0.8595	0.9001	0.919	0.9405	0.9783	0.996
  026_8207_00298361	0.825	0.794	0.845	0.8457	0.8483	0.976	0.8421	0.8626	0.9602
  026_833_00304810	0.856	0.888	0.917	0.9241	0.9293	1.015	0.9449	1.0616	0.9624
  026_870_00299801	0.892	0.96	0.999	0.9623	1.0469	1.054	1.0305	1.0128	1.0476
  026_845_00311341	0.847	0.867	0.909	0.9088	0.9208	0.932	0.9775	0.9857	0.9755
  026_8103_00306210	0.836	0.96	1.004	0.9427	1.0257	1.064	1.0682	0.9834	1.007
  026_794_00300601	0.339	0.904	0.992	0.9248	0.9615	1.005	0.9405	0.9595	1.0225
  026_890_00300220	0.903	0.862	0.844	0.9926	1.005	0.998	1.1503	1.1306	1.1501
  026_862_00304820	0.886	0.864	0.837	0.9386	0.9258	0.887	0.948	1.0561	1.1752
  026_812_00298410	0.894	0.946	0.993	0.9231	0.9704	1.003	1.0591	1.0305	1.0361
  026_862_00316560	0.871	0.905	0.923	0.9415	0.9143	0.955	0.9491	0.9721	0.9923
  026_857_00296270	0.904	0.868	0.893	0.9249	0.9348	0.956	1.0259	0.9727	1.0027
  026_679_00296240	0.878	0.915	0.949	0.8968	0.942	0.953	0.9732	0.9711	1.0338
  026_791_00298421	0.888	0.896	0.979	0.9429	0.9543	0.921	0.9516	0.9551	0.9966
  026_864_00311551	0.765	0.838	0.843	0.8384	0.8225	0.848	0.8917	0.8749	0.9811
  026_846_00300620	0.886	0.979	0.985	0.9316	1.0428	0.925	0.9778	1.056	0.9904
  026_841_00296291	0.897	0.938	0.928	0.9356	0.9557	0.955	1.0968	1.0708	1.0963
  026_813_00308231	0.856	0.979	0.977	0.9369	0.9242	0.912	0.8859	0.9059	0.8856
  026_816_00295860	0.864	1.039	1.026	1.008	1.0776	0.871	1.0553	1.0199	0.9978
  026_818_00308241	0.946	0.829	0.858	0.9042	0.9197	0.887	0.9097	0.9729	0.9634
  026_808_00296300	0.922	0.941	0.955	1.022	0.964	1.043	1.0358	1.0134	1.0658
  026_855_00302330	0.868	0.911	0.901	0.8895	0.9071	0.95	0.9608	1.0091	1.0383
  026_803_00298470	0.878	0.933	0.953	0.8695	0.9015	0.833	0.8882	0.8789	1.1066
  026_832_00303110	0.908	0.872	0.907	0.9005	0.9724	0.974	0.9776	0.9706	0.968
  026_874_00308171	1.064	0.854	0.829	0.8009	0.8914	0.943	0.8612	0.9931	0.9393
  026_879_00308101	0.881	0.987	0.995	1.0199	0.9725	0.948	0.9588	0.9756	0.9692
  026_856_00299760	0.936	0.943	0.959	1.0286	0.9991	1.002	1.0072	1.0077	1.0015
  026_798_00304790	0.926	0.986	0.869	0.9635	1.0683	1.166	1.1053	1.1123	1.1003
  026_825_00308250	0.938	0.885	0.929	0.961	0.9166	0.959	0.9502	0.9835	0.9846
  026_8072_00306200	0.973	0.958	0.931	0.9405	0.9799	0.901	1.0374	0.9717	1.1512
  026_843_00296331	0.91	0.99	0.934	0.9509	0.9694	1.003	0.9804	0.9674	1.0295
  026_1251_00318710	0.964	1.054	0.854	0.9853	0.77	0.963	0.8714	0.9637	1.1416
  026_816_00302370	0.903	1.072	1.021	1.002	1.0583	0.94	1.0664	1.0462	1.0774
  026_801_00295941	1.036	0.898	0.912	0.9194	0.9832	0.955	1.0252	0.9946	1.085
  026_850_00311050	0.942	0.957	0.988	0.989	0.9596	0.985	0.9759	0.9839	0.9726
  026_818_00309001	0.889	0.857	0.855	0.8355	0.8207	0.856	0.8191	0.9124	0.9468
  026_1247_00304851	1.162	1.047	0.877	1.034	0.8759	0.694	1.2149	1.0391	1.1021
  026_819_00306250	1.046	1.007	1.012	1.018	0.9902	0.945	0.9742	0.9718	1.0221
  026_821_00306261	1.015	1.1	1.058	1.0171	1.0121	1.065	1.0342	1.0776	1.0468
  026_798_00308080	1.032	1	0.914	0.9927	1.0342	1.004	1.0095	0.9327	0.938
  026_678_00306181	1.03	1.058	1.054	1.0958	1.0021	1.03	1.0784	1.0779	1.0688
  026_797_00308730	1.124	1.076	0.92	0.9992	0.9285	0.936	0.911	1.276	0.8862
  026_790_00306231	1.049	1	1.054	1.0146	1.0291	0.99	1.0304	1.0221	1.0512
  026_752_00306191	1.109	0.988	1.054	1.0224	0.9429	1.084	1.0956	1.0273	1.0528
  026_845_00306271	1.074	1.08	1.064	1.0779	1.0805	1.046	1.0674	0.9941	1.02
  026_8133_00306280	1.158	1.06	1.135	1.1499	1.1305	1.103	1.1464	1.1475	1.0913
  026_8130_00306220	1.12	1.188	1.002	0.9001	0.8103	1.095	0.9608	0.9714	0.9997
  026_683_00306241	1.163	1.024	0.949	1.0959	1.0605	1.114	1.0118	0.9537	0.9212
  026_792_00306140	1.136	1.069	1.132	1.0901	1.0688	1.097	1.0684	1.0463	1.1115
  026_840_00306151	1.088	1.059	1.052	1.0622	1.0476	1.049	1.0439	1.045	1.0714
  026_8075_00306131	1.046	1.042	1.043	1.0424	1.0323	1.048	1.0441	1.0279	1.0694
  026_61_00285570	0.313	0.329	0.341	0.3908	0.5654	0.63	0.724	0.8346	0.8527
  026_8222_00291350	0.102	0.284	0.272	0.3996	0.5762	0.732	0.8412	0.8346	0.8529
  026_140_00291320	0.185	0.296	0.408	0.4762	0.5561	0.736	0.8297	0.8761	0.8425
  026_237_00291380	0.155	0.278	0.405	0.5737	0.6759	0.816	0.9129	0.9363	0.9318
  026_220_00288720	0.324	0.393	0.455	0.5338	0.6443	0.826	0.9343	0.9969	1.073
  026_257_00285640	0.32	0.456	0.509	0.6199	0.6926	0.771	0.8518	0.9524	0.934
  026_239_00288750	0.174	0.577	0.461	0.7856	0.7368	0.845	0.9512	0.9535	1.2005
  026_124_00287850	0.239	0.53	0.6	0.6778	0.8612	0.946	0.9754	0.9846	1.0038
  026_104_00287960	0.396	0.51	0.597	0.7468	0.9062	0.94	0.9822	0.9761	1.0165
  026_8199_00291330	0.445	0.509	0.654	0.6993	0.7792	0.767	0.8214	0.8543	0.9676
  026_69_00283480	0.358	0.6	0.775	0.78	0.8817	0.896	0.9912	0.9446	0.9358
  026_112_00285620	0.224	0.573	0.653	0.7668	0.8482	0.866	0.9087	0.9409	0.9255
  026_241_00288760	0.398	0.583	0.743	0.8249	0.935	0.956	1.0439	0.9903	1.0527
  026_255_00285610	0.445	0.61	0.788	0.9473	0.9153	1.003	0.9035	0.8642	0.8757
  026_62_00293930	0.572	0.562	0.594	0.6839	0.7773	1.18	0.876	1.0089	1.0329
  026_93_00287880	0.523	0.575	0.731	0.804	0.9283	0.948	0.9965	0.999	1.0069
  026_216_00290710	0.459	0.664	0.767	0.8093	0.7784	0.884	0.9338	0.9363	0.9519
  026_123_00287860	0.495	0.678	0.776	0.9051	1.0108	1.003	1.0056	0.9841	0.9941
  026_113_00288520	0.479	0.705	0.868	0.9097	0.9559	0.984	1.0104	0.992	1.0316
  026_8035_00303290	0.508	0.78	0.831	0.8009	0.9998	0.997	1.0295	0.9393	1.0203
  026_240_00300290	0.208	0.663	0.733	0.7473	0.7814	0.839	0.8554	0.9327	1.029
  026_248_00285630	0.528	0.639	0.739	0.9112	0.9265	0.96	1.0023	0.9827	0.9859
  026_162_00290790	0.56	0.811	0.678	0.7341	0.7627	0.782	0.7915	0.9638	0.7387
  026_105_00287940	0.516	0.701	0.691	0.7257	0.8234	0.904	0.9883	1.0013	1.033
  026_240_00302920	0.326	0.629	0.741	0.7802	0.8119	0.831	0.9347	0.921	0.9838
  026_163_00287730	0.582	0.606	0.654	0.6825	0.785	0.896	0.9395	0.98	1.0207
  026_139_00283530	0.085	0.686	0.917	0.9565	0.9611	0.99	0.9875	0.9789	0.9559
  026_133_00293941	0.637	0.637	0.757	0.8911	0.8633	1.136	1.0548	0.89	0.9001
  026_282_00287750	0.416	0.744	0.875	0.8947	0.8754	0.907	0.9959	0.9144	0.9277
  026_80_00287950	0.263	0.688	0.699	0.7969	0.8071	0.904	0.8902	0.9142	1.017
  026_73_00283500	0.566	0.739	0.806	0.8214	0.8547	1.09	0.8321	0.8619	0.8548
  026_60_00287891	0.577	0.678	0.734	0.7932	0.8209	0.833	0.8444	0.8567	0.902
  026_185_00288820	0.626	0.88	0.936	1.0302	1.0245	1.037	1.0524	1.0175	1.0525
  026_70_00283490	0.603	0.789	0.925	0.8867	0.9929	0.987	0.8586	0.9555	0.8243
  026_228_00291370	0.605	0.678	0.732	0.7776	0.8387	0.943	0.9437	0.9368	0.9149
  026_74_00285600	0.639	0.768	0.89	0.8258	0.9671	0.97	0.9444	0.9665	1.046
  026_173_00288920	0.638	0.787	0.876	0.8937	0.8652	0.959	0.9976	0.9896	1.005
  026_125_00287910	0.687	0.792	0.873	0.8871	1.009	1.011	0.9976	0.987	1.0162
  026_280_00285420	0.648	0.86	0.895	0.9301	0.9335	0.934	1.0707	0.9	0.9445
  026_242_00288770	0.671	0.815	0.875	0.8573	0.8914	0.965	1.0137	0.9754	1.1043
  026_160_00285410	0.631	0.706	0.761	0.7798	0.7991	0.771	0.9167	0.9366	0.9971
  026_144_00287710	0.536	1.076	0.941	0.9045	0.8922	0.893	0.9542	0.9696	1.0289
  026_184_00290800	0.614	0.705	0.723	0.7315	0.7351	0.721	1.0011	0.7501	0.8687
  026_128_00290690	0.766	0.834	0.861	0.8151	0.9324	0.908	1.3723	1.1697	1.2229
  026_250_00285660	0.719	0.765	0.866	0.8242	0.9178	0.947	0.9725	0.9585	0.9714
  026_182_00290700	0.76	0.859	0.875	0.8522	0.9702	0.962	1.0483	0.9432	1.3018
  026_95_00283510	0.719	0.842	0.88	0.8266	0.8534	0.902	1.0348	0.9564	0.966
  026_264_00288840	0.794	0.966	0.936	0.9709	1.0212	1.024	1.0348	1.0318	1.0681
  026_266_00287760	0.731	0.786	0.794	0.8012	0.8742	0.873	0.9435	0.9199	0.977
  026_75_00282830	0.801	0.99	0.974	1.0523	1.196	1.107	1.0641	1.1044	1.0749
  026_111_00291360	0.704	0.734	0.703	0.794	0.7451	0.779	0.8243	0.8675	0.946
  026_8151_00288540	0.242	0.868	0.954	0.9827	1.022	0.974	0.9967	0.9674	1.0529
  026_156_00287720	0.834	1.001	1.03	1.0349	0.9848	0.996	1.012	0.9965	0.9857
  026_243_00296620	0.648	0.88	0.96	0.9351	0.9518	0.968	0.9742	0.9627	0.9659
  026_86_00287870	0.86	1.017	1.01	1.0356	1.0217	1.05	1.0267	1.0118	1.0227
  026_162_00288790	0.877	0.903	0.797	0.9228	1.0293	1.043	1.0157	1.0517	1.0837
  026_172_00287740	0.832	0.891	0.95	0.9494	0.955	0.954	0.9499	0.9633	0.9487
  026_235_00285430	0.885	0.997	0.987	0.9424	0.9387	0.884	0.8642	0.9464	0.9439
  026_143_00288690	0.924	1.025	1.129	1.034	1.1112	1.034	1.0278	1.0136	1.0255
  026_193_00288830	0.622	0.958	1.012	1.0149	1.0368	1.025	1.0064	0.9803	0.989
  026_236_00288730	0.175	0.993	1.05	1.0763	1.0476	1.029	1.0509	1.0397	1.0494
  026_81_00288530	0.608	1.003	1.009	1.1031	1.0252	1.021	1.0113	1.0077	1.0848
  026_251_00287840	0.64	0.986	1.008	1.0201	1.0204	1.022	1.0267	0.9848	1.0079
  026_178_00288810	1.008	1.009	0.976	1.0197	1.0404	1.036	1.0412	1.0156	1.0276
  026_249_00285650	1.047	1.226	1.172	1.1142	1.0869	1.071	0.9837	1.0247	1.0207
  026_238_00288740	1.061	1.077	1.045	1.0257	1.0384	1.029	1.0236	1.018	1.0204
  026_131_00287930	1.124	1.094	1.048	1.024	1.0293	1.012	1.0293	0.9824	1.0061
  026_915_00269070	0.344	0.532	0.607	0.6061	0.6357	0.736	0.8936	1.0346	1.1375
  026_911_00269060	0.433	0.617	0.642	0.6508	0.655	0.804	0.7763	0.9066	0.9967
  026_8172_00269460	0.511	0.716	0.719	0.7459	0.8264	0.884	0.9107	0.9313	1.0224
  026_913_00271970	0.685	0.695	0.794	0.851	0.9936	1.011	0.9013	1.0881	1.0491
  026_8194_00271980	0.623	0.808	0.876	0.9097	0.9037	0.874	0.9014	0.943	1.1354
  026_8171_00269120	0.693	0.91	0.98	1.1114	1.0275	1.032	0.9881	0.9218	1.0725
  026_8112_00269450	0.691	0.674	0.795	0.8068	0.8378	0.91	0.9824	1.0389	1.0625
  026_916_00271320	0.695	0.804	0.766	0.7943	0.8276	0.873	1.1135	1.1006	1.1093
  026_8004_00271280	0.743	0.793	0.841	0.8441	0.8899	0.888	1.1408	0.925	1.1327
  026_8112_00271340	0.721	0.732	0.741	0.7501	0.7753	0.799	1.017	0.9044	1.0866
  026_8004_00269400	0.747	0.764	0.776	0.8164	0.8628	0.861	0.9217	0.8924	1.0697
  026_8192_00269470	0.78	0.867	0.874	0.984	0.9192	0.889	0.9737	1.0227	1.0186
  026_8194_00269440	0.786	0.87	1.048	0.908	0.8876	0.984	0.8804	1.0294	1.0609
  026_913_00269430	0.816	0.841	0.849	0.8709	0.8661	0.88	1.0502	1.0585	1.0591
  026_916_00269420	0.831	0.891	0.904	0.9053	0.9327	0.978	0.9465	1.1023	1.1108
  026_8175_00269140	0.832	0.968	0.988	1.1946	1.0638	1.017	1.0728	1.1006	1.2781
  026_1225_00269660	0.612	0.595	0.602	0.575	0.6051	0.678	0.8404	0.9183	0.947
  26_135_00271680	0.247	0.61	0.713	0.8654	0.8633	0.854	0.9433	0.9991	1.105
  026_924_00269640	0.563	0.554	0.607	0.6884	0.7085	0.808	0.8122	0.8796	0.9437
  26_562_00271660	0.433	0.665	0.727	0.7663	0.7943	0.835	0.9132	0.9948	0.9596
  026_135_00271410	0.345	0.672	0.79	0.8395	0.8741	0.957	0.9768	1.032	1.1796
  026_923_00269680	0.309	0.65	0.731	0.7895	0.6971	0.795	0.7303	0.9458	0.9325
  026_562_00270060	0.586	0.748	0.78	0.8707	0.8698	0.955	1.0372	1.0323	1.0217
  026_920_00269670	0.581	0.772	0.846	0.9032	0.9238	0.951	0.9496	0.9615	0.9852
  026_135_00270070	0.326	0.727	0.825	0.8737	0.9084	0.931	0.9701	0.9946	0.9435
  026_919_00269630	0.778	0.798	0.868	0.8744	0.861	0.89	0.9735	0.9392	0.9765
  026_921_00285151	0.84	0.987	0.961	0.9653	0.9811	0.903	0.8875	0.9228	0.9815
  026_8182_00293791	0.848	1.001	1.103	1.0954	1.1007	0.855	0.8882	1.0698	0.8069
  026_369_00258500	0.165	0.184	0.183	0.1873	0.1985	0.219	0.2948	0.3285	0.4946
  026_390_00262920	0.056	0.074	0.068	0.0948	0.096	0.163	0.4343	0.6938	0.8833
  026_629_00316570	0.322	0.361	0.388	0.398	0.4347	0.594	0.7533	0.6321	0.6782
  026_366_00257090	0.204	0.352	0.333	0.3872	0.4128	0.547	0.6415	0.7687	0.9298
  026_384_00314240	0.368	0.42	0.48	0.6318	0.5903	0.783	0.7802	0.9243	0.5317
  026_385_00314290	0.402	0.496	0.488	0.5135	0.6006	0.629	0.8787	0.8808	1.0864
  026_630_00264810	0.143	0.443	0.537	0.5763	0.6816	0.684	0.7263	0.9504	0.791
  026_8124_00308720	0.802	0.401	0.6	0.6379	0.6871	0.943	0.8827	0.8247	0.9343
  026_639_00271120	0.174	0.52	0.54	0.6353	0.6485	0.726	0.9341	0.8908	1.1295
  026_8094_00314230	0.55	0.565	0.476	0.5734	0.6862	0.656	0.7893	0.9264	0.7016
  026_8076_00260401	0.346	0.489	0.575	1.2246	0.8619	0.823	1.0781	0.7607	0.8894
  026_8127_00258950	0.202	0.628	0.611	0.6823	0.725	0.845	0.9541	0.9703	1.0012
  026_8124_00311130	0.544	0.563	0.516	0.5711	0.5857	0.776	0.9014	0.9091	1.0395
  026_8126_00264800	0.347	0.54	0.684	0.7567	0.8851	0.929	0.8729	0.9752	0.9196
  026_641_00308180	0.456	0.502	0.593	0.7234	0.8006	0.88	0.9296	0.9651	0.9821
  026_8121_00256290	0.646	0.568	0.562	0.5835	0.6642	0.613	0.5487	0.6035	1.0005
  026_8220_00308810	0.366	0.619	0.752	0.7815	0.7642	0.87	0.8457	0.8335	0.8942
  026_8090_00263920	0.267	0.583	0.69	0.9135	0.905	0.924	0.9505	0.9232	1.012
  026_363_00252730	0.519	0.583	0.574	0.6332	0.5059	0.571	0.7766	0.6898	0.9188
  026_382_00311110	0.518	0.757	0.767	0.7123	0.7538	0.883	0.8718	0.8733	0.9755
  026_8064_00259120	0.582	0.763	0.78	0.8295	0.8371	0.955	1.0539	1.0652	1.104
  026_8195_00318640	0.6	0.8	0.86	0.909	0.9931	0.919	0.9533	0.941	1.0273
  026_382_00308690	0.59	0.706	0.666	0.7413	0.8277	0.814	0.8335	0.8742	0.9843
  026_8129_00314250	0.644	0.861	0.945	0.972	0.9655	0.998	1.0941	1.0771	1.0471
  026_8126_00280241	0.611	0.771	0.746	1.0569	0.8567	0.864	0.9408	0.9041	0.972
  026_8007_00252850	0.411	0.72	0.821	0.7359	0.7717	0.797	0.8528	1.0702	0.9564
  026_8122_00273460	0.15	0.809	0.911	0.9912	0.9113	1.021	0.9055	0.8723	1.0083
  026_8226_00252530	1.14	0.81	0.878	0.6567	0.6737	0.94	0.7615	0.8399	1.1136
  026_8064_00256670	0.398	0.871	0.839	0.9402	0.8757	0.96	0.9284	0.9838	1.0451
  026_8128_00257200	0.836	0.93	0.956	1.0121	0.9926	1.008	0.9893	0.9944	0.9472
  026_8123_00256300	0.837	1.028	1.034	0.9756	1.0272	0.974	0.9893	0.9781	0.9486
  026_396_00261020	0.813	1.039	0.892	0.8527	0.9085	0.934	0.9583	0.9709	1.0441
  026_370_00252740	0.926	0.811	0.891	1.0803	2.0427	1.01	0.892	0.9269	0.9864
  026_364_00252720	0.895	1.012	0.958	1.0963	0.9642	0.976	1.0005	0.9787	0.9774
  026_370_00258530	0.36	0.933	1.052	1.0961	1.0754	0.948	0.9798	1.0134	0.9668
  026_362_00252710	0.911	1.075	0.916	1.0354	0.9179	0.939	1.178	0.9451	0.9362
  026_368_00252700	0.084	0.616	1.087	1.1559	1.0678	1.11	1.0784	0.9917	0.9902
  026_8122_00262490	0.063	0.973	1.019	1.3067	1.0528	0.999	1.4063	0.9955	0.9632
  026_934_00287430	0.302	0.3	0.342	0.3503	0.3758	0.467	0.7239	0.7489	0.9268
  026_1126_00293760	0.323	0.361	0.384	0.4703	0.5785	0.701	0.8275	0.885	0.873
  026_1129_00290660	0.47	0.481	0.592	0.7498	0.7692	0.925	0.9217	0.9942	1.1258
  026_1220_00291150	0.584	0.504	0.584	0.5655	0.9851	0.957	1.1602	1.1706	1.0966
  026_949_00290350	0.511	0.577	0.587	0.5768	0.6153	0.686	0.7718	1.0687	1.0378
  026_925_00290850	0.494	0.608	0.578	0.7594	0.7462	0.857	0.9169	0.8966	0.8943
  026_8244_00314220	0.63	0.601	0.597	0.6381	0.7711	0.88	0.955	0.9128	0.9028
  026_8279_00293400	0.764	0.625	0.723	0.7182	0.783	1.079	0.9597	1.044	1.0467
  026_940_00290340	0.587	0.604	0.66	0.6995	0.6871	0.846	0.8531	0.9424	1.0257
  026_8238_00304370	0.505	0.763	0.761	0.7451	0.8102	0.848	1.0558	1.0226	1.0295
  026_8237_00295840	0.551	0.783	0.688	0.776	0.8484	0.917	1.1038	1.0681	1.1892
  026_8260_00292720	0.648	0.61	0.642	0.7269	0.6891	0.74	1.0027	0.9408	0.9148
  026_8230_00303100	0.636	0.73	0.886	0.851	0.9406	0.961	0.9388	0.9681	1.0998
  026_8230_00292650	0.641	0.685	0.768	0.9488	0.8764	0.863	0.9076	0.9226	1.0565
  026_8092_00295850	0.757	0.729	0.642	0.6589	0.7541	0.914	0.9211	1.0035	1.0531
  026_8240_00291160	0.676	0.747	0.827	0.9249	0.9868	1	0.9181	0.9742	1.0197
  026_932_00291140	0.65	0.668	0.65	0.7216	0.7753	0.887	0.9104	0.9136	0.9152
  026_8084_00292670	0.776	0.686	0.68	0.804	0.816	0.93	0.911	0.9826	0.9092
  026_1125_00290571	0.676	0.787	0.855	0.951	0.9041	1.029	0.9092	0.8992	1.0107
  026_8256_00292920	0.666	0.844	0.821	0.9099	0.9293	0.961	1.0098	0.9638	0.9379
  026_8241_00292900	0.698	0.804	0.834	0.8672	0.894	1.02	1.0443	1.0711	1.107
  026_938_00287450	0.689	0.707	0.728	0.8613	0.7453	0.912	0.7815	1.0258	1.0515
  026_1235_00298501	0.673	0.815	0.851	0.7794	0.8482	0.895	1.0046	1.0048	0.9449
  026_1221_00293780	0.636	0.704	0.69	0.6894	0.7014	0.755	0.8172	0.8859	1.0281
  026_933_00295510	0.921	0.786	0.66	0.785	0.7855	0.932	1.0797	1.0643	1.0563
  026_8259_00292710	0.714	0.849	0.926	0.7816	0.8328	1.11	1.0158	0.9241	1.1619
  026_8242_00295400	0.744	0.845	0.843	0.8069	0.9687	1.09	0.9491	1.0683	1.0333
  026_1128_00292620	0.741	0.875	0.809	0.8925	0.9409	1.005	1.0033	1.0111	1.0682
  026_938_00290330	0.772	0.772	0.843	0.9103	0.8456	1.001	1.0305	1.0314	1.0721
  026_8148_00292700	0.715	0.824	0.723	0.6704	0.8391	0.855	0.9034	1.0922	1.0169
  026_8243_00295410	0.801	0.758	0.691	0.7427	0.8184	0.86	1.0104	0.9653	1.0478
  026_1130_00308501	0.744	0.838	0.882	0.8952	0.9369	0.922	0.9212	0.9456	0.9683
  026_931_00252940	0.749	0.962	0.957	1.0202	1.0143	0.983	0.9976	0.9688	0.9523
  026_931_00290820	0.791	0.924	0.954	0.9827	1.0247	0.961	0.9353	0.9274	0.9237
  026_932_00288450	0.759	0.729	0.783	0.7813	0.828	0.851	0.9362	1.0032	1.0515
  026_8258_00291180	0.703	0.713	0.753	0.7366	0.79	0.864	0.9468	0.9244	0.9669
  026_928_00290870	0.791	0.718	0.699	0.6913	0.7147	0.8	0.831	0.8925	0.9149
  026_8257_00293650	0.716	0.738	0.79	0.8055	0.8238	0.819	0.8677	0.8812	1.0222
  026_8257_00292690	0.789	0.822	0.798	0.9932	0.8382	0.876	0.928	0.9213	1.1024
  026_8239_00292890	0.842	0.8	0.866	0.8796	0.8926	0.921	1.2015	0.9976	1.2125
  026_941_00288490	0.777	0.883	0.798	0.796	0.8682	1.049	1.195	1.0697	1.0119
  026_929_00290880	0.763	0.805	0.822	0.8457	0.8675	0.888	0.9211	0.9687	1.0047
  026_8215_00287660	0.869	0.99	0.986	1.0451	1.0092	1.01	1.0495	0.9963	1.0021
  026_939_00287460	0.806	0.848	0.834	0.8094	0.8719	0.891	0.9424	0.903	1.1026
  026_945_00288480	0.75	0.737	0.748	0.7949	0.7921	0.844	0.8857	0.9368	0.9866
  026_948_00291230	0.829	0.912	0.942	0.9105	0.938	0.909	0.9025	0.9329	0.9575
  026_8255_00293640	0.874	0.894	0.904	0.9159	0.9189	0.911	0.9267	0.9453	0.9277
  026_937_00288460	0.859	0.878	0.802	0.8512	0.7724	0.814	1.0447	0.8649	1.0363
  026_1127_00296460	0.886	0.95	0.992	0.9785	0.8788	0.986	0.9619	1.0732	0.8745
  026_947_00263500	0.819	0.823	0.875	0.8874	0.9093	0.906	0.9175	0.9563	0.9507
  026_938_00292910	0.918	0.963	0.958	0.9614	0.9778	1.041	1.0213	0.9899	1.0087
  026_945_00256180	0.891	0.987	1.001	0.9225	0.8452	0.776	0.8273	0.9233	1.0102
  026_946_00291190	0.805	0.739	0.737	0.7358	0.7593	0.759	0.8539	0.8664	0.8624
  026_8254_00295890	0.913	1.041	0.974	1.0282	1.0077	1.015	1.0376	0.9484	1.0604
  026_973_00295540	0.321	0.315	0.362	0.4721	0.5603	0.814	1.0984	0.8938	1.1407
  026_983_00295450	0.397	0.339	0.382	0.581	0.6565	0.942	0.9937	1.019	1.1926
  026_982_00292940	0.538	0.437	0.492	0.5682	0.6307	0.8	0.8372	0.9601	1.0476
  026_8118_00295430	0.363	0.489	0.495	0.5335	0.6471	0.671	0.9118	1.008	0.9838
  026_8149_00293771	0.531	0.553	0.5	0.5231	0.6104	0.71	0.8375	0.909	0.9509
  026_953_00295470	0.476	0.515	0.508	0.4987	0.5741	0.746	0.8281	1.0377	1.0843
  026_1256_00260300	0.332	0.473	0.515	0.7193	0.8035	0.916	0.9125	1.0441	0.9009
  026_976_00298480	0.592	0.594	0.57	0.562	0.6645	0.706	0.8319	0.9296	1.0176
  026_954_00292870	0.574	0.607	0.558	0.6572	0.7404	0.813	1.0541	1.0916	0.9092
  026_967_00292570	0.522	0.69	0.758	0.8527	0.6713	0.874	0.9506	0.894	0.958
  026_975_00295591	0.613	0.705	0.797	0.9196	0.8833	0.921	1.0616	1.0323	1.0675
  026_1135_00292930	0.636	0.623	0.694	0.6978	0.7917	0.832	0.9096	0.9334	0.9721
  026_977_00308210	0.607	0.764	0.684	0.7525	0.7655	0.908	0.9944	0.9837	0.9553
  026_969_00295580	0.664	0.653	0.725	0.7145	0.7879	0.992	1.0299	1.0048	1.0863
  026_1491_00273490	0.387	0.683	0.791	0.7879	0.8486	0.832	0.9455	0.9813	0.9695
  026_961_00295570	0.702	0.699	0.633	0.701	0.7003	0.795	0.8748	0.9019	1.1113
  026_974_00292601	0.684	0.754	0.793	0.909	0.7596	0.88	0.9895	0.9696	1.0099
  026_963_00293710	0.709	0.746	0.833	0.7623	0.8169	1.052	0.9605	0.9551	1.0544
  026_959_00292630	0.701	0.682	0.805	0.8272	0.7565	0.838	0.9087	0.9434	1.0258
  026_981_00293750	0.733	0.9	0.784	0.9218	0.8875	1.007	0.9325	1.0003	0.8788
  026_968_00292580	0.772	0.822	0.87	0.9195	0.9082	0.935	0.8889	1.0106	1.1286
  026_1134_00300280	0.738	0.739	0.727	0.7443	0.7816	0.797	0.9521	0.9663	1.0376
  026_979_00293740	0.956	0.777	0.839	0.8825	0.8836	0.909	0.9593	0.9092	0.9686
  026_956_00292591	0.734	0.786	0.762	0.6523	0.7269	0.755	0.9185	0.979	1.0195
  026_953_00257150	0.761	0.708	0.731	0.7295	0.7369	0.79	0.8534	0.8911	0.9577
  26_968_00304350	0.817	0.828	0.864	0.8724	0.8715	1.008	1.007	0.9779	1.001
  026_957_00296350	0.849	0.911	0.906	0.8954	0.9494	0.957	0.977	0.9769	1.1173
  026_960_00296311	0.875	0.894	0.924	0.9669	0.9243	0.96	1.1005	1.065	1.0309
  026_951_00256230	0.862	1.024	0.931	0.8532	0.9386	1.035	1.0328	1.0507	1.0612
  026_964_00295480	0.877	0.928	0.759	0.8346	0.9905	0.925	1.0364	1.027	0.9499
  026_1134_00298560	0.844	0.812	0.91	0.8479	0.7738	0.977	0.9068	1.059	0.9774
  026_970_00293370	0.841	0.97	0.919	0.8896	0.9177	0.966	0.9181	1.322	0.9871
  026_952_00292610	0.923	0.885	0.718	0.8919	0.8505	1.058	1.0586	0.8995	1.1403
  026_972_00296250	0.897	0.924	0.945	0.9646	0.9703	0.978	1.0074	1.032	1.0585
  026_951_00295520	0.923	0.889	0.787	0.9719	0.9562	1.118	0.986	0.9708	1.1145
  026_975_00252910	1.015	0.914	0.897	0.8713	0.8903	1.037	0.9777	1.1409	0.981
  026_963_00252950	0.496	0.974	0.953	1.0445	0.9118	1.028	0.9324	1.0245	1.0186
  026_958_00296320	0.851	0.835	0.851	0.824	0.8929	0.879	0.9003	1.0065	1.0291
  026_955_00292640	1.017	0.82	0.986	0.9378	1.1258	1.072	1.0873	1.0381	0.9789
  026_759_00300240	0.666	0.637	0.664	0.6954	0.8026	0.901	1.0485	1.0165	1.0436
  026_1213_00303050	0.577	0.674	0.728	0.8558	0.9032	0.962	0.9285	1.0744	1.1008
  026_8116_00303080	0.416	0.808	0.823	0.9733	0.9887	0.968	1.0012	0.9912	1.0294
  026_1206_00302600	0.604	0.768	0.801	0.8049	0.8692	0.937	0.9073	0.9842	0.9698
  026_1210_00302610	0.686	0.723	0.669	0.7081	0.719	0.892	0.9533	1.0129	0.9547
  026_1215_00311260	0.629	0.753	0.69	0.7652	0.7781	0.737	0.8199	0.9853	0.9812
  026_1206_00308200	0.699	0.769	0.85	0.8838	0.889	0.906	1.0135	0.9948	1.0129
  026_1212_00300580	0.69	0.929	0.942	0.9243	0.9927	0.884	0.9289	0.9051	0.9626
  026_682_00304600	0.722	0.847	0.891	0.906	0.9407	0.899	0.9567	1.0786	1.1287
  026_1200_00300690	0.695	0.911	0.887	0.9257	0.9258	0.849	0.9218	0.9772	0.9399
  026_1214_00308460	0.775	0.881	0.878	0.926	0.9241	0.914	0.9475	0.9536	1.0138
  026_1214_00308790	0.802	0.879	0.908	0.9132	0.9528	0.991	0.9959	1.0132	1.0202
  026_1202_00303040	0.82	0.918	0.945	1.0327	0.9338	0.983	0.9541	1.0755	1.1707
  026_1209_00300210	0.817	0.821	0.827	0.8331	0.8999	0.927	0.9491	1.0072	0.9857
  026_8078_00303060	0.782	0.897	0.859	0.8822	0.8445	0.907	0.9752	0.926	1.0513
  026_1199_00300560	0.82	0.91	0.99	0.8596	0.9181	0.984	0.9172	0.9896	1.1394
  026_8078_00304970	0.847	0.88	0.853	0.8587	0.8938	0.89	0.9416	0.9423	1.0968
  026_1207_00298510	0.819	1.018	1.003	0.8986	0.9778	0.921	0.9543	0.9856	0.9695
  026_1198_00302580	0.859	0.966	0.995	0.9551	0.9651	1.01	1.0265	1.0233	1.0095
  026_1201_00302590	0.856	0.868	0.914	0.904	0.8852	0.908	0.9343	1.0239	1.1079
  026_1213_00300720	0.843	0.946	0.86	0.9682	0.9236	0.942	0.9493	0.9688	0.9576
  026_1211_00300570	0.881	0.886	0.907	0.8753	0.9153	0.955	0.969	0.9857	1.0448
  026_1218_00300730	0.9	0.905	0.905	1.0722	1.0284	0.976	0.9507	1.0341	1.2023
  026_1208_00300710	0.3	0.943	0.961	0.8752	0.9823	0.905	0.9466	0.9643	0.975
  026_1203_00300850	0.92	0.909	0.899	1.0357	1.0632	0.905	0.974	1.018	0.9037
  026_8245_00282710	0.356	0.381	0.404	0.4804	0.491	0.652	0.7128	1.0645	1.1048
  026_996_00298490	0.542	0.521	0.592	0.6234	0.6635	0.707	0.7764	0.8517	0.9168
  026_985_00303070	0.727	0.863	0.923	1.1164	1.0922	0.984	1.0179	1.1749	1.0533
  026_987_00298550	0.698	0.761	0.871	0.9338	0.9109	0.914	0.9938	1.2109	0.991
  026_1001_00300200	0.768	0.832	0.867	0.8699	0.8879	0.906	0.9933	0.9168	1.1136
  026_988_00308270	0.804	0.854	0.877	0.8566	0.8621	0.923	0.9727	0.9516	0.9806
  026_997_00300660	0.479	0.868	1.201	1.1209	1.1016	0.674	0.9562	1.1603	0.8983
  026_1000_00300740	0.692	1.071	1.005	1.0988	0.9203	0.91	0.9225	0.9154	1.1301
  026_1009_00264700	0.112	0.201	0.203	0.2168	0.2138	0.242	0.3676	0.463	0.7025
  026_8212_00264590	0.151	0.398	0.392	0.3817	0.3556	0.35	0.4631	0.5633	0.8209
  026_1039_00265170	0.263	0.352	0.317	0.3236	0.3515	0.424	0.5534	0.8565	0.8549
  026_1023_00269690	0.147	0.207	0.235	0.2621	0.2935	0.343	0.5053	0.6866	0.8936
  026_1034_00264680	0.144	0.372	0.375	0.3139	0.3537	0.327	0.4189	0.6188	0.8613
  026_8073_00263480	0.154	0.241	0.236	0.3036	0.3695	0.397	0.6432	0.7444	0.9033
  026_8114_00259970	0.211	0.399	0.492	0.3813	0.4238	0.662	0.5683	0.6942	1.0563
  026_8209_00266540	0.179	0.476	0.467	0.4234	0.4176	0.498	0.6644	0.7338	0.7609
  026_1046_00263470	0.389	0.419	0.403	0.3903	0.4097	0.503	0.6117	0.8285	1.0625
  026_8120_00262840	0.073	0.323	0.41	0.4001	0.4106	0.468	0.6687	0.6311	0.8761
  026_8191_00260580	0.456	0.468	0.426	0.404	0.4006	0.534	0.6654	0.7954	0.894
  026_1176_00266430	0.26	0.428	0.38	0.386	0.4254	0.499	0.6795	0.8423	0.9729
  026_1149_00263460	0.065	0.23	0.181	0.1928	0.2465	0.404	0.7707	0.8991	0.9576
  026_1147_00263750	0.187	0.48	0.376	0.4566	0.4611	0.565	0.6083	0.8116	0.9418
  026_1037_00260080	0.176	0.417	0.368	0.3716	0.3919	0.613	0.6978	0.9091	0.966
  026_1190_00266570	0.283	0.631	0.615	0.5802	0.5603	0.559	0.5576	0.7187	0.8082
  026_1024_00265150	0.418	0.433	0.383	0.391	0.4651	0.618	0.742	0.7678	0.9177
  026_1025_00269710	0.267	0.288	0.296	0.3664	0.4611	0.681	0.8141	0.9334	1.1196
  026_8161_00263740	0.203	0.383	0.33	0.3147	0.3323	0.488	0.7539	0.8959	0.983
  026_8097_00262820	0.076	0.501	0.37	0.3843	0.4237	0.706	0.7414	0.8914	0.9396
  026_8120_00260550	0.299	0.428	0.435	0.4782	0.4839	0.498	0.6521	0.7326	0.8788
  026_1033_00262470	0.363	0.36	0.404	0.4297	0.5245	0.562	0.7868	0.9191	0.8529
  026_1031_00264030	0.159	0.498	0.512	0.4794	0.5367	0.602	0.8381	0.9754	1.0032
  026_1006_00260110	0.079	0.437	0.583	0.4912	0.4928	0.627	0.6176	0.6485	0.9586
  026_8023_00265291	0.164	0.659	0.533	0.5534	0.5976	0.709	0.8699	0.9148	0.9877
  026_1036_00264690	0.099	0.511	0.489	0.5329	0.5785	0.531	0.5954	0.5867	0.7408
  026_1011_00269770	0.289	0.463	0.457	0.4545	0.4605	0.568	0.7513	0.8836	0.9597
  026_1003_00269650	0.099	0.326	0.434	0.5233	0.6155	0.705	0.83	0.8998	1.0756
  026_8002_00263700	0.088	0.468	0.524	0.5105	0.5276	0.55	0.5835	0.7643	0.8791
  026_8104_00260540	0.278	0.403	0.39	0.4769	0.6158	0.839	0.877	0.864	0.9209
  026_1005_00268780	0.45	0.499	0.485	0.4604	0.5149	0.506	0.6624	0.892	0.928
  026_1004_00260870	0.288	0.331	0.256	0.265	0.3055	0.504	0.8497	0.9278	0.9753
  026_1030_00264020	0.075	0.388	0.556	0.5173	0.6922	0.688	0.8911	0.7819	0.8658
  026_1035_00265160	0.305	0.481	0.494	0.5153	0.7013	0.739	0.9127	0.9597	1.0093
  026_8119_00259980	0.402	0.467	0.438	0.4246	0.4152	0.679	0.7345	0.8985	0.9484
  026_8097_00260530	0.439	0.438	0.44	0.3578	0.3688	0.635	0.8111	0.8622	0.8731
  026_8225_00264640	0.07	0.432	0.581	0.5597	0.6534	0.603	0.7648	0.9285	1.0194
  026_8104_00262830	0.172	0.565	0.594	0.5546	0.7085	0.865	1.2098	1.0454	1.1061
  026_1042_00274340	0.329	0.514	0.573	0.6166	0.6518	0.787	0.8993	0.9066	0.9485
  026_1026_00269720	0.479	0.599	0.603	0.6144	0.5728	0.634	0.6979	0.8575	0.9077
  026_1010_00262530	0.364	0.794	0.685	0.6806	0.6737	0.881	0.8586	0.9992	0.9359
  026_1041_00263450	0.436	0.563	0.633	0.821	0.8517	0.858	1.0792	0.8962	0.9346
  026_8098_00269090	0.496	0.615	0.627	0.6225	0.6708	0.815	0.8109	0.9711	1.0201
  026_1022_00262940	0.249	0.552	0.678	0.6664	0.7181	0.824	0.8966	0.8605	0.908
  026_1181_00269080	0.206	0.612	0.779	0.8499	0.8608	0.892	0.9924	1.1546	1.1214
  026_1008_00262540	0.371	0.744	0.693	0.6962	0.7393	0.731	0.8508	0.9586	0.8942
  026_1027_00265280	0.537	0.717	0.804	0.8959	0.9417	0.926	0.9678	0.954	1.0136
  026_8034_00265300	0.554	0.778	0.806	0.9452	0.9331	1.005	0.9966	1.0061	1.0084
  026_1181_00264620	0.094	0.698	0.822	0.9152	0.8448	0.9	0.9921	0.9743	0.9841
  026_8225_00263510	0.234	0.653	0.694	0.7331	0.7681	0.79	0.9216	0.9437	0.9528
  026_1145_00263720	0.609	0.895	0.833	0.8778	0.9025	0.855	0.9286	0.9316	1.0458
  026_8060_00265311	0.37	0.758	0.827	0.7891	0.8733	0.894	0.9899	0.9692	0.9911
  026_1047_00265320	0.779	0.931	0.98	0.9757	0.9449	0.991	1.0008	0.9996	1
  026_1022_00260910	0.257	0.748	0.801	0.8703	0.8751	0.884	0.9495	0.9173	0.9542
  026_1038_00260090	0.151	0.731	0.777	0.7955	0.7955	0.827	0.8793	0.913	0.9361
  026_1002_00260861	0.795	0.897	0.85	0.894	0.8474	0.885	1.0053	0.8902	0.984
  026_8025_00306491	0.914	0.888	1.059	0.9053	1.0334	0.961	0.8798	1.0258	0.9475
  026_1120_00264061	0.417	0.99	0.941	0.9531	0.9635	1.005	1.0535	1.0033	0.9903
  026_1049_00269761	0.904	0.991	0.949	0.974	0.9849	1.004	1.032	1.0282	1.0264
  026_8077_00311281	0.817	0.849	0.783	0.8212	0.8361	0.894	0.8282	0.9342	0.9134
  026_1002_00262871	0.494	1.023	0.918	0.9957	0.9334	0.899	0.9223	0.931	0.9502
  026_1191_00266580	0.562	0.98	1.123	1.1931	0.9727	1.159	1.1334	1.0446	1.0643
  026_8211_00306531	0.995	1.062	1.047	0.9379	1.0364	1.075	1.0521	1.0504	1.0137
  026_1004_00262880	1.327	0.196	1.169	0.1356	1.1547	0.213	1.1935	0.7281	1.1468
  026_8077_00263490	1.25	1.21	1.184	1.1565	0.9453	0.931	1.1642	1.0861	1.0387
  026_1076_00260350	0.138	0.299	0.203	0.1441	0.1472	0.137	0.1598	0.2644	0.5747
  026_1050_00262790	0.198	0.304	0.337	0.4411	0.6201	0.452	0.6355	0.7729	1.0239
  026_1070_00258920	0.163	0.38	0.469	0.5806	0.7048	0.892	1.16	0.922	1.1787
  026_8193_00311240	0.306	0.42	0.445	0.5445	0.7218	0.758	0.8813	0.9883	0.9993
  026_1052_00255810	0.369	0.469	0.497	0.5342	0.5814	0.77	0.7984	0.8285	0.947
  026_1056_00316590	0.309	0.531	0.622	0.6777	0.7504	0.912	0.9052	1.0407	1.0158
  026_1060_00256830	0.504	0.586	0.532	0.5224	0.5043	0.577	0.7757	0.8156	0.9028
  026_1072_00258880	0.473	0.717	0.911	0.8748	1.0846	1.055	1.07	0.981	1.001
  026_1060_00262910	0.498	0.498	0.474	0.9422	0.5296	0.623	1.0575	0.9958	0.8867
  026_1078_00263960	0.348	0.625	0.723	1.042	0.7453	0.866	0.8746	0.9835	0.9734
  026_1054_00308870	0.574	0.78	0.883	0.9578	0.9599	0.973	0.9861	1.0293	1.027
  026_1064_00258960	0.253	0.754	0.947	0.9636	0.9596	1.019	1.0426	1.0278	1.0027
  026_1075_00308260	0.617	0.827	0.703	0.9984	1.0102	1.068	1.1379	0.9929	1.1512
  026_1065_00273570	0.621	0.777	0.872	0.891	0.9122	0.904	0.9197	0.9359	0.9547
  026_1067_00311560	0.732	0.677	0.761	0.8438	0.781	0.877	0.8716	0.958	1.0772
  026_1067_00314080	0.708	0.833	0.831	0.8383	0.8843	0.854	0.9212	0.9276	1.1227
  026_1068_00258930	0.554	0.885	0.897	0.9579	0.9774	1.009	1.0156	1.0042	1.0326
  026_1057_00271310	0.745	0.743	0.677	0.6977	0.6882	0.86	0.875	0.9503	1.0984
  026_1060_00260890	0.753	0.738	0.731	0.6895	0.6891	0.836	1.0727	1.008	0.9928
  026_1051_00269200	0.738	0.851	0.914	0.8985	0.8947	0.955	0.9241	0.9866	1.0457
  026_8187_00316461	0.775	0.953	0.925	0.9227	0.9488	0.988	0.9649	0.9982	0.9763
  026_1058_00263730	0.754	0.824	0.808	0.8382	0.8486	0.868	0.9105	0.9132	0.9828
  026_1064_00264040	0.915	1.021	1.007	1.0316	0.9966	1.014	1.0431	0.9819	1.0068
  026_1077_00264820	0.466	1.271	1.195	1.2103	1.1255	0.977	0.9179	1.1315	1.1153
  026_1051_00265140	0.149	0.752	0.783	0.8562	0.833	0.758	0.8748	0.8287	0.8438
  026_8067_00258320	0.623	0.977	1.004	1.0575	1.0443	1.026	1.0598	1.0143	1.0267
  026_1053_00258360	1	0.967	0.868	0.95	0.958	1.018	1.0763	1.0284	1.0105
  026_1073_00258910	0.055	1.003	1.012	1.0288	1.0225	1.013	1.0331	0.9845	0.9972
  026_8062_00266170	1.076	1.218	0.962	1.0422	0.9155	1.202	0.9466	0.9302	1.1001
  026_1059_00256820	1.023	1.223	1.097	1.1806	1.0334	0.924	1.0209	0.9691	0.9885
  026_8216_00258330	0.627	1.056	1.075	1.0873	1.0084	1.031	1.0144	1.008	0.9914
  026_8143_00302630	0.709	0.74	0.781	0.8439	0.8942	0.971	0.9553	0.9264	1.0878
  026_1081_00299690	0.834	0.925	0.99	1.0022	1.0753	0.959	1.0664	0.9907	0.9674
  026_1082_00300430	0.518	0.919	1.026	1.1263	1.0267	0.882	1.2293	0.8206	0.9481
  026_1087_00311210	0.409	0.442	0.405	0.4025	0.4677	0.606	0.749	0.9156	0.9734
  026_1098_00252970	0.193	0.418	0.365	0.5027	0.4309	0.608	0.6796	0.9903	0.9333
  026_1093_00253040	0.33	0.462	0.489	0.4674	0.6027	0.719	0.8623	0.9552	1.0031
  026_1100_00252990	0.142	0.5	0.577	0.6566	0.6074	0.682	0.7694	0.8888	0.9822
  026_1085_00252920	0.536	0.498	0.605	0.5369	0.584	0.788	0.7985	1.0523	0.937
  026_1088_00252930	0.451	0.785	0.606	0.8114	0.6653	0.836	1.0285	1.0053	0.944
  026_1089_00261010	0.577	0.55	0.623	0.7757	0.5886	0.616	0.7161	0.7476	0.9625
  026_1090_00311330	0.368	0.64	0.793	0.8005	0.8127	0.931	0.9783	0.9389	1.0355
  026_1090_00253010	0.165	0.778	0.787	0.6376	0.6432	0.975	1.0524	0.7737	1.0765
  026_1090_00308850	0.308	0.673	0.724	0.8112	0.8338	0.925	0.9016	0.8988	1.0407
  026_1086_00255730	0.171	0.695	0.763	0.7585	0.7239	0.856	0.9452	0.9473	1.0079
  026_8020_00314210	0.694	0.874	0.871	0.8186	0.9478	0.965	0.9497	1.0206	1.0176
  026_1084_00266520	0.592	0.739	0.746	0.7517	0.73	0.793	0.8273	0.8894	0.8901
  026_8213_00259200	0.769	0.966	0.965	0.9831	0.9968	0.984	0.9765	0.9632	0.942
  026_8082_00252980	0.27	0.935	0.007	0.9319	0.951	0.93	0.997	0.9506	0.9691
  026_1099_00306470	0.912	0.905	0.964	0.9293	0.932	0.965	0.9777	0.9947	1.0629
  026_1094_00259110	0.084	0.958	0.978	1.0951	1.0879	1.057	1.063	1.0254	0.8654
  026_1092_00259170	0.271	0.973	0.988	1.0669	1.039	1.047	1.018	1.0563	1.0542
  026_1097_00259160	0.685	1.079	1.053	1.0554	1.0411	1.049	1.0682	10.349	1.0563
  26_8036_00304360	0.377	0.348	0.397	0.5545	0.7402	0.871	0.9778	0.9884	1.0288
  026_24_00298840	0.504	0.543	0.577	0.6272	0.7473	0.889	1.0564	1.0628	1.0768
  026_18_00299720	0.479	0.581	0.587	0.6728	0.7768	0.797	0.8705	1.106	1.03
  026_24_00252540	0.216	0.59	0.634	0.6994	0.7144	0.855	0.9368	0.9696	1.0194
  026_8036_00257170	0.679	0.605	0.639	0.6941	0.7355	0.829	0.9411	1.0033	1.0113
  026_9_00298850	0.523	0.587	0.676	0.7538	0.7859	0.866	0.9594	0.9717	1.0348
  026_15_00316530	0.607	0.59	0.688	0.6971	0.8338	0.848	0.8978	1.0448	1.0799
  026_8_00298880	0.557	0.72	0.789	0.8471	0.8599	0.995	1.0484	1.045	1.0264
  026_6_00303090	0.553	0.725	0.744	0.7649	0.9313	0.918	0.9221	0.9563	1.0354
  026_6_00256650	0.726	0.703	0.715	0.7187	0.7189	0.755	0.9193	0.965	1.0004
  026_8101_00256280	0.504	0.835	0.952	1.0143	1.0014	1.01	0.9848	0.9739	0.9713
  026_11_00298870	0.697	0.744	0.763	0.8533	0.8788	0.941	0.9969	1.0222	1.1105
  026_19_00298860	0.758	0.847	0.828	0.8254	0.8943	0.979	0.9968	1.0264	1.0955
  026_7_00302400	0.779	0.775	0.708	0.7824	0.8163	0.882	1.0463	0.9494	1.0621
  026_8101_00302620	0.76	0.882	0.929	0.9235	0.9393	0.926	0.9386	0.9281	1.0507
  026_22_00298810	0.823	0.879	1.047	0.8692	1.0283	0.988	1.0731	1.1432	1.097
  026_20_00299740	0.751	0.753	0.758	0.8989	0.8726	0.877	0.9581	0.9471	0.9762
  026_14_00298780	0.854	0.851	0.873	0.8859	0.9584	1.097	1.1389	1.2074	1.0083
  026_12_00299730	0.821	0.876	0.897	0.9178	0.9315	0.962	0.9176	1.0469	1.0217
  026_13_00298770	0.867	0.933	0.849	0.9317	0.8466	1.046	1.0223	1.1266	1.2765
  026_16_00298800	0.811	0.834	0.909	0.8884	0.9073	0.924	0.956	0.9709	0.9841
  026_3_00308800	0.877	0.935	0.984	0.8762	0.9541	0.87	1.0393	1.0266	1.0429
  026_17_00300420	0.216	0.953	0.975	0.9996	0.9834	0.744	0.9959	0.9777	1.0473
  026_10_00298820	0.951	0.965	0.925	0.9536	1.0393	1.06	1.0882	1.0657	1.037
  026_8154_00262510	0.116	0.241	0.307	0.315	0.5516	0.413	0.6863	0.814	0.8778
  026_1116_00268860	0.377	0.605	0.635	0.4653	0.7155	0.805	0.9708	1.0702	1.1724
  026_8154_00280250	0.475	0.611	0.69	0.5902	0.6865	0.677	0.826	0.8426	0.9723
  026_8166_00269750	0.399	0.642	0.861	0.9305	0.8691	0.946	0.8217	0.867	0.9308
  026_1115_00268850	0.402	0.724	0.819	0.8345	0.9291	0.941	1.0001	0.9878	0.9814
  026_1112_00268820	0.62	0.659	0.62	0.6814	0.702	0.72	0.9036	0.8807	1.0744
  026_1107_00311310	0.601	0.697	0.647	0.7074	0.7773	0.802	0.8186	0.9166	1.0105
  026_1108_00308840	0.7	0.723	0.698	0.8033	0.8993	0.819	0.9773	1.1189	1.0369
  026_1109_00269701	0.645	0.818	0.925	0.873	0.8541	0.934	0.9505	0.9782	1.0023
  026_1102_00268790	0.395	0.808	0.815	0.8203	0.9291	0.817	0.9786	0.9815	0.9877
  026_1108_00314330	0.745	0.784	0.794	0.8526	0.9259	0.907	1.0498	1.0643	1.1339
  026_1113_00268840	0.832	0.962	1.003	0.9833	0.9906	0.984	0.9981	1.0121	0.9684
  026_1117_00268810	0.824	0.904	0.885	0.8856	0.9834	0.972	0.9217	1.0697	1.0963
  026_1113_00318661	0.807	0.995	0.947	0.9632	1.0122	1.033	1.0384	1.0103	0.9636
  026_8206_00264270	0.885	1	1.029	1.0338	1.0454	1.029	0.9964	1.0291	0.9684
  026_1105_00308190	0.887	0.915	0.911	0.9349	0.8927	0.94	0.9007	0.9407	0.9198
  026_1104_00306500	1.047	0.983	0.999	0.9204	1.0053	1.011	1.0162	1.0749	1.0308
  026_1106_00306510	1.124	0.983	1	0.9683	1.0601	1.156	1.0799	1.0206	0.9018
  026_8163_00302640	0.479	0.526	0.621	0.7198	0.8786	0.991	1.0278	1.0369	1.1613
  026_8173_00302660	0.539	0.622	0.644	0.6956	0.8294	0.866	1.072	1.0089	1.087
  26_8174_00304380	0.756	0.704	0.824	0.7868	0.8056	0.875	0.851	0.96	1.0607
  026_481_00302570	0.803	0.856	0.841	0.8864	0.9389	0.924	0.983	0.9909	1.1127
  026_8174_00306540	0.97	0.963	1.002	0.9267	1.0771	0.973	1.0027	1.0435	1.0588

Example 12 BVD-523 Demonstrates In Vivo Antitumor Activity in BRAF^V600E-Mutant Cancer Cell Line Xenograft Models
• Based on our in vitro findings that BVD-523 reduced proliferation and induced apoptosis in a concentration-dependent manner, BVD-523 was administered by oral gavage to demonstrate its in vivo anti-tumor activity in models with MAPK/ERK-pathway dependency. Xenograft models of melanoma (cell line A375), and colorectal cancer (cell line Colo205), were utilized, both of which harbor a BRAF^V600E mutation.
• In A375 cell line xenografts, BVD-523 efficacy was compared with the control cytotoxic alkylating agent temozolomide following 14 days of treatment. BVD-523 demonstrated significant dose-dependent antitumor activity starting at 50 mg/kg twice daily (BID) (FIG. 31A). Doses of 50 and 100 mg/kg BID significantly attenuated tumor growth, with tumor growth inhibition (TGI) of 71% (P=0.004) and 99% (P<0.001), respectively. Seven partial regressions (PRs) were noted in the 100 mg/kg BID group; no regression responses were noted in any other group. The efficacy observed compared favorably with that of temozolomide, which when administered at 75 and 175 mg/kg resulted in modest dose-dependent TGI of 34% (P>0.05) and 78% (P=0.005), respectively.
• Additionally, BVD-523 demonstrated antitumor efficacy in a Colo205 human colorectal cancer cell line xenograft model (FIG. 31B). BVD-523 again showed significant dose-dependent tumor regressions at doses of 50, 75, and 100 mg/kg BID, yielding mean tumor regressions T/T_i (T=End of treatment, T_i=Treatment initiation) of −48.2%, −77.2%, and −92.3%, respectively (all P<0.0001). Regression was not observed at the lowest dose of BVD-523 (25 mg/kg BID); however, significant tumor growth inhibition, with a T/C (T=Treatment, C=Control) of 25.2% (P<0.0001), was observed. Although not well tolerated, the positive control chemotherapeutic agent irinotecan (CPT-11) showed significant antitumor activity, inhibiting Colo205 tumor growth with a T/C of 6.4% (P<0.0001). However, even at its maximum tolerated dose in mice, CPT-11 was not as effective as BVD-523 at doses of 50, 75, or 100 mg/kg BID.
• To establish the relationship between pharmacokinetics and pharmacodynamics, BVD-523 plasma concentrations were compared with pERK1/2 levels measured in the tumor by immunohistochemistry and isotope-tagged internal standard mass spectrometry over a 24-hour period following a single 100 mg/kg oral dose of BVD-523 (FIG. 31C). Phosphorylation of ERK1/2 was low in untreated tumors (0 hours). Following treatment with BVD-523, ERK1/2 phosphorylation steadily increased from 1 hour post-dose to maximal levels at 8 hours post-dose, then returned to pre-dose levels by 24 hours. This increase in pERK1/2 correlated with BVD-523 drug plasma concentrations. The in vivo observation of increased pERK1/2 with BVD-523 treatment is consistent with earlier in vitro findings (FIG. 30D).
Example 13 BVD-523 Results in ERK1/2 Substrate Inhibition Despite Increased ERK1/2 Phosphorylation
• To examine the effects of BVD-523 on signaling relative to other known ERK1/2 inhibitors (SCH772984, GDC-0994, and Vx-11e) (Morris et al. 2013 and Liu et al. 2015), a large-scale reverse phase protein array (RPPA) of approximately 40 proteins was employed in a variety of cell lines with sensitivity to ERK inhibition. Cell lines with common alterations in BRAF and RAS were assayed: BRAF^V600E mutant lines A375, Colo205, and HT29; KRAS^G12C-mutant cell line MIAPACa-2; KRAS^G13D-mutant cell line HCT116; and AN3Ca with atypical HRAS^F82L mutation. Changes in protein levels are shown as a percentage change from dimethyl sulfoxide (DMSO)-treated parental control (FIG. 32A and Table 23). All ERK inhibitors elicited qualitatively similar protein effects, with the exception of phosphorylation of ERK1/2 (pERK1/2 [ERK1/2-T202, -Y204]); SCH7722984 inhibited pERK1/2 in all cell lines, while BVD-523, GDC-0994, and Vx-11e markedly increased pERK1/2. Phospho-p90 RSK (pRSK1) and cyclin D1, which are proximal and distal targets of pERK1/2, respectively, were similarly inhibited by all inhibitors tested regardless of the degree of ERK1/2 phosphorylation (FIG. 32B). These independent findings for BVD-523 are consistent with studies showing that phosphorylation of ERK1/2 substrates RSK1/2 remained inhibited despite dramatically elevated pERK1/2 by Western blots in A375 cells (FIG. 32D), in addition to protein-binding studies demonstrating BVD-523 binding and stabilization of pERK1/2 and inactive ERK1/2 (FIG. 29E and FIG. 29F). Therefore, measuring increased pERK1/2 levels could be considered as a clinical pharmacodynamic biomarker for BVD-523, while quantifying inhibition of ERK1/2 targets such as pRSK1 and DUSP6 as well could serve a similar purpose.
• Additional protein changes are of note in this RPPA dataset (FIG. 32A). Decreased pS6-ribosomal protein appears to be another pharmacodynamic marker of ERK1/2 inhibition, as evidenced in all cell lines with all compounds (FIG. 32B). Furthermore, prominent induction of pAKT appears to be a cell line-dependent observation, where each ERK1/2 inhibitor induced pAKT in cell lines A375 and AN3CA cells (FIG. 33). Interestingly, the degree of inhibition of survival marker pBAD appears to differ between compounds, with only modest inhibition of pBAD by GDC-0994 compared with the other ERK1/2 inhibitors tested (FIG. 32A).
• Next, how BVD-523 affects cellular localization of ERK1/2 and downstream target pRSK in a BRAF^V600E-mutant RKO colorectal cell line (FIG. 32C) was investigated. In resting cells, ERK1/2 localizes to the cytoplasm, and once stimulated pERK1/2 migrates to target organelles, particularly the nucleus where transcriptional targets are activated (Wainstein et al. 2016). In DMSO-treated control cells, pERK1/2 is evident in both nuclear and cytoplasmic fractions, which is likely reflective of MAPK pathway activity due to the presence of BRAF^V600E in this cell line. Treatment with BVD-523 resulted in elevated pERK1/2 in the nucleus and cytoplasm as well as a modest increase in nuclear total ERK1/2 compared with DMSO-treated cells, suggesting that compound-induced stabilization of pERK1/2 stimulates some nuclear translocation. Despite increased pERK1/2 in both compartments, pRSK levels are lower in the cytoplasmic and nuclear compartments compared with DMSO control. Comparator MAPK signaling inhibitors (i.e., trametinib, SCH7722984, dabrafenib) inhibited phosphorylation of ERK1/2 and RSK, as reflected by lower levels in the nuclear and cytoplasmic compartments. These data again suggest that BVD-523-associated increases in pERK1/2 are evident in both the cytoplasm and nucleus; however, this does not translate to activation of target substrates. This is consistent with data presented in FIG. 30D and FIG. 32A.

• TABLE 23
  		% change from DMSO (matched cell line)

  							Avg
  Cell Line	Treatment	Avg(S6 Ribo Prot S235 236)	Avg(S6 Ribo Prot S240 244)	Avg (Cyclin D1)	Avg (p90 RSK S380)	Avg (bad S112)	(4ebp1 T70)
  A375	BVD	−95.3	−91.98	−81.45	−71	−72.37	−31.82
  A375	Vx	(Empty)	(Empty)	−85.46	−65.25	−69.29	23.33
  A375	GDC	−87.61	−80.3	−81.65	−60.74	−55.32	−29.47
  A375	SCH	−94.71	−91.78	−84.05	−72.44	−71.44	−31.75
  AN3Ca	BVD	−43.41	−22.2	−0.69	−28.11	−54.1	32.17
  AN3Ca	Vx	−18.54	−12.55	−9.59	−28.41	−45.63	16.67
  AN3Ca	GDC	−30.74	−23.47	0.34	−29.44	2.53	11.28
  AN3Ca	SCH	−61.99	−35.88	−11.33	−40.26	−39.14	61.57
  COLO205	BVD	−96.15	−97.33	−23.65	−50.84	−31.51	−36.35
  COLO205	Vx	−93.04	−94.89	−39.79	−58.6	−30.28	−43.71
  COLO205	GDC	−91.19	−91.59	−28.02	−57.5	−6.12	−36.69
  COLO205	SCH	−94.67	−95.09	−36.7	−62.31	−29.4	−27.51
  HCT116	BVD	−96.31	−96.26	−69.62	−31.81	−34.27	4.03
  HCT116	Vx	−90.03	−86.06	−72.72	−33.05	−23.88	10.35
  HCT116	GDC	−94.82	−95.1	−63.59	−22.25	−12.36	20.5
  HCT116	SCH	−93.86	−91.07	−73.21	−33.7	−31.29	5.6
  HT29	BVD	−44.68	−25.67	−37.21	−60.5	−20.66	−41.47
  HT29	Vx	−32.8	−24.35	−35.2	−43.41	−35.62	−2.89
  HT29	GDC	−41.45	−21.74	−35.69	−30.59	−12.98	1.95
  HT29	SCH	−44.9	−25.73	−36.66	−53.88	−33.9	−40.58
  MIAPaca2	BVD	−79.46	−88.03	−37.9	−35	−30.29	−9.42
  MIAPaca2	Vx	−63.36	−74.82	−33.96	−39.91	−20.85	−15.72
  MIAPaca2	GDC	−67.9	−75.59	−31.92	−39.09	−10.08	−34.01
  MIAPaca2	SCH	−77.57	−86.61	−39.88	−38.58	−33.07	19.27
  		Avg(p70	Avg(p70				Avg
  		S6 Kinase	S6 Kinase	Avg	Avg	Avg	(Caspase
  Cell Line	Treatment	T389 T412)	S371 S394)	(ERK 1 2)	(Akt)	(Raptor)	3 CL D175)
  A375	BVD	−23.79	−8.58	−22.91	−14.03	−7.77	−8.06
  A375	Vx	−25.54	−17.32	−5.39	−30.34	−12.7	−9.27
  A375	GDC	−31.9	−17.34	31.55	−20.7	−14.32	−16.74
  A375	SCH	−42.73	−28.72	−21.65	−23.26	−11.66	−9.87
  AN3Ca	BVD	−14.78	32.26	−9.05	−22.43	−13.82	−10.8
  AN3Ca	Vx	0.56	44.04	−11.27	−24.62	−2.47	−12.7
  AN3Ca	GDC	26.01	29.09	−2.87	−26.04	−8.05	1.55
  AN3Ca	SCH	−16.63	24.56	−9.27	−16.35	−11.09	1.25
  COLO205	BVD	−36.4	−18.11	−18.83	−3.85	−7.14	−3.18
  COLO205	Vx	−28	−13.64	−12.32	−12.51	−0.05	−2.67
  COLO205	GDC	−32.2	−13.02	−3.33	−11.83	−5.48	23.06
  COLO205	SCH	−30.4	−14.59	−31.87	−10.31	−2.2	14.08
  HCT116	BVD	−28.11	−16.9	−29.42	4.41	−7.06	−10.11
  HCT116	Vx	−20.99	−9.89	−24.01	−18.15	−4.32	−5.19
  HCT116	GDC	−24.73	−11.47	−1.9	−6.13	−6.2	−8.36
  HCT116	SCH	−24.63	−12.3	−10.22	−9.86	−9.66	−4.63
  HT29	BVD	−24.58	−35.94	−44.3	−13.41	−8.53	−7.03
  HT29	Vx	−12.31	−22.86	0.24	−17.84	−6.53	−2.86
  HT29	GDC	−20.86	−25.73	4.66	−10.01	−6.85	−3.44
  HT29	SCH	−9.55	−20.52	−37	−16.93	−12.18	−7.9
  MIAPaca2	BVD	−39.23	−28.27	−40.33	23.63	21.15	22.35
  MIAPaca2	Vx	−30.66	−30.35	−14.85	−0.15	5.4	6.17
  MIAPaca2	GDC	−40.99	−14.4	−6.88	4.33	22.43	10.47
  MIAPaca2	SCH	−50.97	−40.47	−23.09	13.47	17.66	21.05

  		Avg (mTOR	Avg (Bad	Avg	Avg	Avg (p70	Avg
  Cell Line	Treatment	S2448)	S155)	(c Fos)	(Rictor)	S6 Kinase)	(Raptor S792)	Avg (Bcl 2 T56)
  A375	BVD	−27.87	−21.9	4.39	−20.11	−7.6	−10.33	−8.54
  A375	Vx	−21.66	−6.3	−13.65	−8.16	−6.42	−0.86	−7.53
  A375	GDC	−23.61	−13.31	−12.46	−23.29	−18.11	−15.93	−4.1
  A375	SCH	−26.17	−13.86	−12.51	−22.13	−17.66	−6.89	−19.55
  AN3Ca	BVD	−10.79	0.66	−5.15	−4.52	−10.27	−8.47	−12.85
  AN3Ca	Vx	−2.37	4.59	−5.52	0.02	−2.33	0.37	−11.73
  AN3Ca	GDC	−2.96	17.31	−0.63	−9.21	−3.67	4.85	1.23
  AN3Ca	SCH	−4.84	12.92	−9.18	−10.89	−7.71	−4.03	−10.73
  COLO205	BVD	−23.51	−18.18	−12.25	−5.21	0.14	0.41	−11.84
  COLO205	Vx	−8.52	−9.72	−19.34	1.65	−3.42	0.2	−12.02
  COLO205	GDC	−7.36	−9.11	−21.33	−5.04	5.83	−9.04	−4.6
  COLO205	SCH	−9.44	−10.96	−15.17	−19.07	−2.85	−4.17	−6.73
  HCT116	BVD	−12.78	−30.72	−14.08	−13.05	−12.86	−22.04	−8.36
  HCT116	Vx	−10.12	−15.59	−13.89	1.78	−4.45	−11.21	−25
  HCT116	GDC	−19.33	−19.71	−10.36	−10.98	−9.9	−15.77	−11.96
  HCT116	SCH	−16.05	−22.96	−15.27	−18.5	−14.12	−18.18	−15.89
  HT29	BVD	−20.68	−25.9	−13.48	−18.76	−10.64	−10.48	−8.18
  HT29	Vx	−13.94	−11.26	−8.23	−2.6	−1.72	−2.13	−25.01
  HT29	GDC	−11.44	−6.7	−12.92	−10.62	−2.83	−1.75	1.61
  HT29	SCH	−22.65	−7.98	−9.26	−13.03	−2.36	−6.38	−17.9
  MIAPaca2	BVD	−11.73	−5.65	−18.44	−11.11	−3.59	5.95	−1.78
  MIAPaca2	Vx	−5.38	7.38	−4.43	−13.24	−9.27	−3.74	−9.86
  MIAPaca2	GDC	11.84	8.18	−16.12	−11.25	−3.25	2.18	−2.12
  MIAPaca2	SCH	−11.48	−1.71	−8.99	−15.15	−7.51	4.43	−1.98
  		Avg	Avg	Avg	Avg	Avg(Tuberin	Avg	Avg
  Cell Line	Treatment	(Bcl2 S70)	(Bcl 2)	(Bax)	(mTOR S2481)	TSC2 Y1571)	(Chk1 S345)	(CREB S133)
  A375	BVD	−7.91	−12.55	−6.98	−3.36	−6.32	−7.43	−12.65
  A375	Vx	−4.02	−9.93	−5.05	−2.9	−3.55	0.56	−15.8
  A375	GDC	6.3	−3.13	3.97	−19.37	−16.74	−18.35	−1.18
  A375	SCH	−12.91	−18.53	−17.32	−15.82	−13.7	−10.59	−1.55
  AN3Ca	BVD	−14.81	−16.83	−10.47	2.75	2.86	−13.34	1.03
  AN3Ca	Vx	−14.39	−18.77	−7.89	7.22	3.8	−9.54	0.16
  AN3Ca	GDC	−0.65	7.8	23.83	25.42	25.18	15.46	5.03
  AN3Ca	SCH	−12.42	−5.14	0.15	11.24	13.44	14.56	3.64
  COLO205	BVD	−10.2	−0.13	0.28	−1.33	−3.48	−4.63	−2.67
  COLO205	Vx	−20.82	−14.09	−9.16	−9.43	−9.45	13.12	−10.64
  COLO205	GDC	−9	17.95	8.2	0.96	0.66	6.08	−11.85
  COLO205	SCH	−18.52	−14.56	−6.44	−6.68	−1.38	1	−14.56
  HCT116	BVD	−8.23	−3.59	−0.8	−34.09	−29.89	−39.65	−30.64
  HCT116	Vx	−17.79	−17.3	−20.46	−17.82	−16.51	−16.49	−9.17
  HCT116	GDC	−12.53	−4.56	−20.11	−18.34	−9.4	−18.77	−8.56
  HCT116	SCH	−18.34	−10.58	−13.86	−22.53	−16.17	−18.51	−24.18
  HT29	BVD	2.83	10.68	8.39	−8.64	0.66	−13.48	−3.46
  HT29	Vx	−12.55	−16.73	−18.47	0.52	2.85	6.44	14.16
  HT29	GDC	10.59	18.16	1.1	3.23	11.86	6.88	9.54
  HT29	SCH	−11.45	−10.01	−20.59	13.93	13.25	19.05	9.87
  MIAPaca2	BVD	0.89	5.86	23.44	−0.24	1.7	1.2	−19.26
  MIAPaca2	Vx	−7.83	−2.3	4.33	−3.12	−0.01	2.09	−13.28
  MIAPaca2	GDC	−6.78	−7.8	3.48	3.65	5.71	32.96	−21.37
  MIAPaca2	SCH	−4.23	4.96	15.67	2.43	8.86	13.39	−6.63

  		Avg (Caspase	Avg	Avg	Avg	Avg	Avg	Avg
  Cell Line	Treatment	7 Cl D198)	(Stat3)	(Bak)	(MAK1 S360)	(mTOR)	(c Myc)	(Stat1)	Avg (Mcl1)
  A375	BVD	3.18	6.02	−3.26	3.35	0.2	2.56	1.32	10.67
  A375	Vx	−7.62	1.71	0.65	−7.63	−3.31	−0.97	0.23	1.6
  A375	GDC	−5.53	14.24	2.76	−5.21	−6.2	−9.11	−5.67	−9.09
  A375	SCH	−6	−1.42	−2.37	0.97	−5.18	1.86	−6.01	2.11
  AN3Ca	BVD	−12.35	−4.97	3.38	0.49	5.58	−0.58	−5.65	−4.9
  AN3Ca	Vx	−8.09	−7.67	−1.6	6.83	−6.27	−5.47	−0.83	−4.24
  AN3Ca	GDC	−15.56	−13.05	7.33	6.84	−2.85	3.99	9.15	−4.16
  AN3Ca	SCH	−24.17	−6.01	9.73	−5.02	−5.33	0.88	5.52	−7.15
  COLO205	BVD	6.76	−2.58	3.79	14.69	12.77	−1.11	0.53	−2.7
  COLO205	Vx	0.03	−7.96	−2.79	6.22	3.62	−7.42	−6.1	−10.64
  COLO205	GDC	1.37	−0.86	6.58	0.82	3.39	−6.22	7.26	2.5
  COLO205	SCH	12.36	−6.1	4.59	7.54	−5.62	−0.64	−4.31	−0.14
  HCT116	BVD	−21.09	−5.52	−13.16	−13.45	−11.96	−11.15	−13.76	−8.72
  HCT116	Vx	−11.41	−7.76	−3.07	−13.73	−0.59	−18.56	−14.06	−7.79
  HCT116	GDC	−13.99	−0.25	−1.74	−12.93	−4.85	−12.03	−6.32	−4.77
  HCT116	SCH	−16.35	−7.67	−4.66	−15.32	−12.56	−12.86	−10.74	−6.55
  HT29	BVD	−6.93	−6.46	−1.42	1.49	5.02	17.85	4.74	−2.83
  HT29	Vx	8.28	−4.28	2.69	5.64	16.94	10.71	4.29	1.36
  HT29	GDC	−0.88	−3.69	3.56	−0.04	10.45	7.56	2.58	3.71
  HT29	SCH	7.02	−2.15	2.78	1.25	9.31	13.55	5.79	14.05
  MIAPaca2	BVD	−6.44	−1.23	−15.15	−10.72	−3.27	−8.77	8.62	−7.27
  MIAPaca2	Vx	−0.32	0.61	−1.93	−0.87	−1.58	−5.94	−1.64	−6.58
  MIAPaca2	GDC	−4.92	−9.44	−8.11	−5.25	−9.8	−7.84	7.4	−1.79
  MIAPaca2	SCH	8.35	−9.19	−10.88	2.74	1.64	2.11	7.17	−1.88

  		Avg	Avg	Avg	Avg
  Cell Line	Treatment	(Bad S136)	(Chk1)	(Bim)	(Akt S473)	Avg (ERK 1 2 T202 Y204)
  A375	BVD	12.31	16.94	14.57	73.07	43.34
  A375	Vx	5.06	−0.86	12.32	93.85	128.93
  A375	GDC	−6.21	−7.72	9.8	53.66	142.37
  A375	SCH	5.32	2.83	17.52	58.13	−90.63
  AN3Ca	BVD	−1.02	−8.45	−12.57	52.11	733.27
  AN3Ca	Vx	−3.81	−0.46	−1.46	56.17	718.94
  AN3Ca	GDC	0.71	9.43	−11.63	82.37	645.51
  AN3Ca	SCH	5.26	1.35	−14.09	66.17	19.75
  COLO205	BVD	5.05	−2.86	41.73	−5.78	14.39
  COLO205	Vx	−1.01	−9.16	34.1	−10.96	98.48
  COLO205	GDC	4	5.06	20.59	4.45	20.01
  COLO205	SCH	1.88	7.49	29.22	−1.74	−91.43
  HCT116	BVD	−11.49	−11.26	12.44	−6.14	849.12
  HCT116	Vx	−5.39	−8.63	4.82	−16.94	873.33
  HCT116	GDC	−1.24	2.28	6.2	4.69	526.64
  HCT116	SCH	−10.55	−5.58	1.95	−8.76	−75.21
  HT29	BVD	10.73	7.4	2.81	−3.06	54.82
  HT29	Vx	5.53	4.68	3.12	−20.5	435.68
  HT29	GDC	2	5.68	7.74	−10.5	268.99
  HT29	SCH	9.67	14.64	0.69	−22.14	−74.84
  MIAPaca2	BVD	−4.12	−3.51	−12.51	9.9	209.14
  MIAPaca2	Vx	0.36	−1.8	2.1	0.48	729.27
  MIAPaca2	GDC	2.25	6.56	5.07	2.24	199.59
  MIAPaca2	SCH	8.62	12.07	2.08	2.84	−76.71

Example 14 BVD-523 Exhibited Activity in In Vitro Models of BRAF and MEK Inhibitor Resistance
• Emergence of resistance to BRAF and MEK inhibitors limits their clinical efficacy. Here, the experiments sought to model and compare the development of resistance to BRAF (dabrafenib), MEK (trametinib), and ERK1/2 (BVD-523) inhibition in vitro. Over several months, BRAF^V600E-mutant A375 cells were cultured in progressively increasing concentrations of each inhibitor. Drug-resistant A375 cell lines were readily obtained following growth in high concentrations of trametinib or dabrafenib, while developing cell lines with resistance to BVD-523 proved challenging (FIG. 34A). Overall, these in vitro data suggest that at concentrations yielding similar target inhibition, resistance to BVD-523 is delayed compared with dabrafenib or trametinib, and may translate to durable responses in the clinic.
• Reactivation and dependence on ERK1/2 signaling is a common feature of acquired resistance to BRAF/MEK inhibition (Morris et al. 2013 and Hatzivassiliou et al. 2012); therefore, the activity of BVD-523 in in vitro models of acquired resistance was evaluated. First, a dabrafenib and trametinib combination-resistant A375 population was obtained using the increased concentration method described. The IC₅₀ and IC₅₀-fold change from parental A375 for dabrafenib, trametinib, and BVD-523 in the BRAF/MEK combination-resistant population is shown in Table 24. BVD-523 IC₅₀ was modestly shifted (2.5-fold), while dabrafenib and trametinib were more significantly shifted (8.5-fold and 13.5-fold, respectively) (Table 24). The cytotoxic agent paclitaxel was tested as a control with only a modest shift in potency observed. These data support the investigation of BVD-523 in the setting of BRAF/MEK therapy resistance, although the mechanism of resistance in this cell population remains to be characterized.

• TABLE 24
  BVD-523 activity in models of BRAF/MEK inhibition

  	Cell Line	Dabrafenib	Trametinib	BVD-523	Paclitaxel

  	Parental	2.1	0.2	129	1.9
  	(IC50nM)
  	BRAFi- +	17.9	2.7	323	3.5
  	MEKi-
  	resistant
  	(IC50nM)
  	Fold	+8.5	+13.5	+2.5	+1.8
  	Change

• To further investigate the tractability of ERK1/2 inhibition in a model with a known mechanism of BRAF inhibitor resistance, AAV-mediated gene targeting was used to generate a pair of RKO BRAF^V600E-mutant cell lines isogenic for the presence or absence of an engineered heterozygous knock-in of MEK1^Q56P-activating mutation (Trunzer et al. 2013 and Emery et al. 2009). MEK1/2 mutations, including MEK1^Q56P, have been implicated in both single-agent BRAF and combination BRAF/MEK therapy-acquired resistance in patients (Wagle et al. 2011, Wagle et al. 2014, Emery et al. 2009 and Johnson et al. 2015). Single-agent assays demonstrated that relative to the parental BRAF^V600E::MEK1^wt cells, the double-mutant BRAF^V600E::MEK1^Q56P cells displayed a markedly reduced sensitivity to the BRAF inhibitors vemurafenib and dabrafenib and the MEK inhibitor trametinib (FIG. 34B). In contrast, response to BVD-523 was essentially identical in both the parental and MEK^Q56P-mutant cells, indicating that BVD-523 is not susceptible to this mechanism of acquired resistance. These results were confirmed in 2 independently derived double-mutant BRAF^V600E::MEK1^Q56P cell line clones, thus validating that results were specifically related to the presence of the MEK1^Q56P mutation rather than an unrelated clonal artifact (data not shown). Similar results were also observed with a second mechanistically distinct ERK1/2 inhibitor (SCH772984), supporting the expectation that these observations are specifically related to mechanistic inhibition of ERK1/2 and not due to an off-target compound effect.
• To further characterize the mechanistic effects of BVD-523 on MAPK pathway signaling in BRAF^V600E::MEK1^Q56P cell lines, protein levels were assessed by Western blot (FIG. 34C). In the parental BRAF^V600E RKO cells, a reduced level of pRSK1/2 was observed following 4-hour treatment with BRAF (vemurafenib), MEK (trametinib), or ERK1/2 (BVD-523) inhibitors at pharmacologically active concentrations. In contrast, isogenic double-mutant BRAF^V600E::MEK1^Q56P cells did not exhibit reduced RSK phosphorylation following BRAF or MEK inhibitor treatment, while BVD-523 remained effective in inhibiting pRSK1/2 to a level comparable to parental RKO. Similarly, pRB is reduced, indicating G0/G1 arrest, by 24 hours of BVD-523 treatment in both parental RKO and BRAF^V600E::MEK1^Q56P.
• Acquired KRAS mutations are also known drivers of resistance to MAPK pathway inhibitors. To understand the susceptibility of BVD-523 to this mechanism of resistance, an isogenic panel of clinically relevant KRAS mutations in colorectal cell line SW48 was used. Sensitivity to BVD-523 was compared with MEK inhibitors selumetinib and trametinib (FIG. 34D). Sensitivity to paclitaxel was unaltered (FIG. 37A). While several mutant KRAS alleles conferred robust to intermediate levels of resistance to MEK inhibition, sensitivity to BVD-523 was unaltered by the majority of alleles, and where a shift in sensitivity was observed, it was not to the extent observed with trametinib or selumetinib. Overall, these data suggest that BVD-523 is more efficacious in this context than MEK inhibitors.
Example 15 BVD-523 Demonstrates In Vivo Activity in a BRAF Inhibitor-Resistant Patient-Derived Melanoma Xenograft Model
• To confirm and extend the antitumor effects of BVD-523 observed in in vitro models of BRAF-/MEK-acquired resistance, a BRAF-resistant xenograft model derived from a patient with resistance to vemurafenib was utilized. BVD-523 was dosed by oral gavage at 100 mg/kg BID for 28 days, both alone and in combination with dabrafenib at 50 mg/kg BID (FIG. 35). As expected, minimal antitumor activity was demonstrated for single-agent dabrafenib (22% TGI). BVD-523 activity was significant compared with vehicle control (P≤0.05), with a TGI of 78%. In this model, combining BVD-523 with dabrafenib resulted in a TGI of 76% (P≤0.05); therefore, further benefit was not gained for the combination compared with single-agent BVD-523 in this model of BRAF-acquired resistance.
Example 16 Combination Therapy with BVD-523 and a BRAF Inhibitor Provides Promising Antitumor Activity
• Patients with BRAF-mutant cancer may acquire resistance to combined BRAF/MEK therapy (Wagle et al. 2014), warranting consideration of other combination approaches within the MAPK pathway. The anti-proliferative effects of combining BVD-523 with the BRAF inhibitor vemurafenib was assessed in the BRAF^V600E-mutant melanoma cell line G-361. As anticipated, single agents BVD-523 and vemurafenib were both active, and modest synergy was observed when combined (FIG. 37B). This indicates that BVD-523 combined with BRAF inhibitors are at least additive and potentially synergistic in melanoma cell lines carrying a BRAF^V600E mutation. Furthermore, generating acquired resistance in vitro following continuous culturing of BRAF^V600E mutant cell line (A375) in BRAF inhibitor plus BVD-523 was challenging. In contrast generating resistance to dabrafenib alone occurred relatively rapidly (FIG. 37C). Even resistance to combined dabrafenib and trametinib emerged before dabrafenib plus trametinib.
• The benefit of combined BRAF and ERK inhibition may not be fully realized in in vitro combination studies where concentrations are not limited by tolerability. To understand the benefit of the combination, efficacy was assessed in vivo utilizing xenografts of the BRAF^V600E-mutant human melanoma cell line A375. Due to the noteworthy response to combination treatment, dosing in the combination groups was stopped on Day 20 to monitor for tumor regrowth, and was reinitiated on Day 42 (FIG. 36A). Tumors were measured twice weekly until the study was terminated on Day 45. The median time to endpoint (TTE) for controls was 9.2 days, and the maximum possible tumor growth delay (TGD) of 35.8 days was defined as 100%. Temozolomide treatment resulted in a TGD of 1.3 days (4%) and no regressions. The 50- and 100-mg/kg dabrafenib monotherapies produced TGDs of 6.9 days (19%) and 19.3 days (54%), respectively, a significant survival benefit (P<0.001), and 1 PR in the 100-mg/kg group. The 100-mg/kg BVD-523 monotherapy resulted in a TGD of 9.3 days (26%), a significant survival benefit (P<0.001), and 2 durable complete responses. The combinations of dabrafenib with BVD-523 each produced the maximum possible 100% TGD with noteworthy regression responses, and statistically superior overall survival compared with their corresponding monotherapies (P<0.001). The lowest dose combination produced a noteworthy 7/15 tumor-free survivors (TFS), and the 3 higher-dosage combinations produced a total of 43/44 TFS, consistent with curative or near-curative activity (FIG. 36B). In summary, the combination of dabrafenib with BVD-523 produced a greater number of TFS and superior efficacy to either single agent.
• Based on the activity of BVD-523 plus dabrafenib in A375 xenograft models with a starting tumor volume of approximately 75-144 mm³, a follow-up experiment was conducted to determine the efficacy of combination therapy in “upstaged” A375 xenografts (average tumor start volume, 700-800 mm³) (FIG. 36C). The median TTE for controls was 6.2 days, establishing a maximum possible TGD of 53.8 days, which was defined as 100% TGD for the 60-day study. BVD-523 100-mg/kg monotherapy produced a negligible TGD (0.7 day, 1%) and no significant survival difference from controls (P>0.05). The distribution of TTEs and 2 PRs suggested there may have been a subset of responders to treatment with BVD-523 alone. Dabrafenib 50-mg/kg monotherapy was efficacious, yielding a TGD of 46.2 days (86%) and a significant survival benefit compared with controls (P<0.001). This group had 5 PRs and 5 CRs, including 3 TFS, among the 11 evaluable mice (FIG. 36D). Both combinations of dabrafenib with BVD-523 produced the maximum 100% TGD and a significant survival benefit compared with controls (P<0.001). Each combination produced 100% regression responses among evaluable mice, though there were distinctions in regression activity. The 25-mg/kg dabrafenib and 50-mg/kg BVD-523 combination had 2 PRs and 8 CRs, with 6/10 TFS, whereas the 50-mg/kg dabrafenib and 100-mg/kg BVD-523 combination had 11/11 TFS on Day 60 (FIG. 36D). Overall, these data support the rationale for frontline combination of BVD-523 with BRAF-targeted therapy in BRAF^V600-mutant melanoma, and this is likely to extend to other tumor types harboring this alteration.
Discussion
• BVD-523 is a potent, highly selective, reversible, small molecule ATP-competitive inhibitor of ERK1/2 with activity in in vivo and in vitro cancer models. In vitro, BVD-523 demonstrated potent inhibition against several human tumor cell lines, particularly those harboring activating mutations in the MAPK signaling pathway, consistent with its mechanism of action. BVD-523 elicited changes in downstream target and effector proteins, including inhibition of direct substrate of ERK1/2, pRSK, and total DUSP6 protein levels. These findings are in line with those of previous studies of other ERK1/2 inhibitors, which demonstrated effective suppression of pRSK with ERK1/2 inhibition (Morris et al. 2013 and Hatzivassiliou et al. 2012). Interestingly, BVD-523 treatment resulted in a marked increase in ERK1/2 phosphorylation in vitro and in vivo. Similar to our findings, an increase in pERK1/2 has been reported with the ERK1/2 inhibitor Vx11e; conversely, pERK1/2 inhibition occurs with SCH772984 (Morris et al. 2013). Although differences in pERK1/2 levels were observed among the various ERK1/2 inhibitors tested, downstream effectors (i.e., pRSK1 and total DUSP6) were similarly inhibited. These findings suggest quantifying ERK1/2 target substrates, such as pRSK1, may serve as reliable pharmacodynamic biomarkers for BVD-523-mediated inhibition of ERK1/2 activity.
• While BRAF (dabrafenib, vemurafenib) and MEK (trametinib, cobimetinib) inhibitors validate the MAPK pathway as a therapeutic target, particularly in patients with BRAF^V600 mutations, the antitumor response is limited by the emergence of acquired resistance and subsequent disease progression. Resistance has been attributed to the upregulation and activation of compensatory signaling molecules (Nazarian et al. 2010, Villanueva et al. 2010, Johannessen et al. 2010 and Wang et al. 2011), amplification of the target genes (Corcoran et al. 2010), and activating mutations of pathway components (e.g., RAS, MEK) (Wagle et al. 2011, Emery et al. 2009 and Wang et al. 2011). Reactivation of the ERK1/2 pathway is one common consequence of acquired resistance mechanism. When introduced into the BRAF^V600E-mutant melanoma cell line A375, MEK^Q56P conferred resistance to MEK and BRAF inhibition (Wagle et al. 2011). By contrast, BVD-523 retained its potent inhibitory activity in the engineered MEK^Q56P cell line, indicating that ERK1/2 inhibition is effective in the setting of upstream activating alterations which can arise in response to BRAF/MEK treatment. As further evidence of a role for BVD-523 in the context of acquired resistance, efficacy of BVD-523 was evident in a xenograft model derived from a tumor sample from a patient whose disease progressed on vemurafenib; the BRAF inhibitor dabrafenib was not effective in this model. These data support a role for targeting ERK1/2 in the setting of BRAF/MEK resistance, and complement previously published findings (Morris et al. 2013 and Hatzivassiliou et al. 2012). To further characterize resistance to inhibitors of the MAPK pathway, the emergence of resistance to BVD-523 itself was investigated. It was found that single-agent treatment of cancer cells with BVD-523 was durable and more challenging to develop resistance compared with other agents targeting upstream MAPK signaling components (i.e., dabrafenib, trametinib). This may suggest that acquiring resistance to ERK1/2-targeting agents is harder to achieve than acquiring resistance to BRAF or MEK therapy, potentially due to the fact that BVD-523 preferentially targets the more conserved active confirmation of the ATP binding site. However, in vitro studies with other ERK1/2 inhibitors have identified specific mutants in ERK1/2 that drive resistance (Jha et al. 2016 and Goetz et al. 2014); these specific mutations have yet to be identified in clinical samples from ERK1/2 inhibitor-relapsed patients.
• The potential clinical benefit of ERK1/2 inhibition with BVD-523 extends beyond the setting of BRAF/MEK therapy-resistant patients. As ERK1/2 is a downstream master node within this MAPK pathway, its inhibition is attractive in numerous cancer settings where tumor growth depends on MAPK signaling. Approximately 30% of all cancers harbor RAS mutations; therefore, targeting downstream ERK1/2 with BVD-523 is a rational treatment approach for these cancers. Furthermore, results from a study by Hayes et al. indicate that prolonged ERK1/2 inhibition in KRAS-mutant pancreatic cancer is associated with senescent-like growth suppression (Hayes et al. 2016). However, a combination approach may be required for maximal and durable attenuation of MAPK signaling in the setting of RAS mutations. For example, MEK inhibition in KRAS-mutant colorectal cancer cell results in an adaptive response of ErbB family activation, which dampens the response to MEK inhibition (Sun et al. 2014). Similar context-specific adaptive responses may occur following ERK1/2 inhibition with BVD-523. The optimal treatment combinations for various genetic profiles and cancer histologies are the subject of ongoing research. In addition to BRAF^V600 and RAS mutations, other alterations which drive MAPK are emerging. For example, novel RAF fusions and atypical non-V600 BRAF mutations which promote RAF dimerization activate the MAPK pathway (Yao et al. 2015). BRAF inhibitors such as vemurafenib and dabrafenib which inhibit BRAF^V600-mutant monomer proteins have been shown to be inactive in atypical RAF alterations which drive MAPK signaling in a dimerization-dependent manner (Yao et al. 2015). However, treatment with BVD-523 to target downstream ERK1/2 in these tumors may be a novel approach to addressing this unmet medical need.
• In the setting of BRAF^V600-mutant melanoma tumors, combined BRAF and MEK inhibition exemplifies how agents targeting different nodes of the same pathway can improve treatment response and duration. Our combination studies in BRAF^V600E-mutant xenografts of human melanoma cell line A375 provides support for combination therapy with BVD-523 and BRAF inhibitors. The combination demonstrated superior benefit relative to single-agent treatments, including results consistent with curative responses. The clinical efficacy and tolerability of combined BRAF/BVD-523 therapy remains to be determined. It would not be unreasonable to expect that a BRAF/ERK1/2 combination will at least be comparable in efficacy to a targeted BRAF/MEK combination. Furthermore, the in vitro observation that acquired resistance to BVD-523 is more challenging to achieve compared with other MAPK pathway inhibitors suggests that the BRAF/BVD-523 inhibitor combination has the potential to provide a more durable response.
• Significant progress has also been made using immunotherapy for melanoma. The US FDA has approved various immune checkpoint inhibitors for the treatment of advanced melanoma, including the cytotoxic T-lymphocyte antigen-4 targeted agent ipilimumab and the programmed death-1 inhibitors pembrolizumab and nivolumab. Combining BVD-523 with such immunotherapies is an attractive therapeutic option; further investigation is warranted to explore dosing schedules and to assess whether synergistic response can be achieved.
• Based on the preclinical data, BVD-523 may hold promise for treatment of patients with malignancies dependent on MAPK signaling, including those whose tumors have acquired resistance to other treatments. The clinical development of BVD-523 is described below. See, Examples 17-24
Example 17 Phase I Dose-Escalation Study of the First-In-Class Novel Oral ERK1/2 Kinase Inhibitor BVD-523 (Ulixertinib) in Patients with Advanced Solid Tumors
• The present invention describes the first-in-human dose escalation study of an ERK1/2 inhibitor for the treatment of patients with advanced solid tumors. BVD-523 has an acceptable safety profile with favorable pharmacokinetics and early evidence of clinical activity.
• Mitogen-activated protein kinase (MAPK) signaling via the RAS-RAF-MEK-ERK cascade plays a critical role in oncogenesis; thus attracting significant interest as a therapeutic target. This ubiquitous pathway is composed of RAS upstream of a cascade of the protein kinases RAF, MEK1/2, and ERK1/2. RAS is activated by GTP binding, which in turn results in activation of each protein kinase sequentially. Although they appear to be the only physiologic substrates for MEK1/2, ERK1/2 have many targets in the cytoplasm and nucleus, including the transcription factors Elk1, c-Fos, p53, Ets1/2, and c-Jun (Shaul et al. 2007). ERK1/2 activation and kinase activity influences cellular proliferation, differentiation, and survival through a variety of mechanisms (Rasola et al. 2010), including activation of the ribosomal S6 kinase (RSK) family members (Romeo et al. 2012).
• Constitutive, aberrant activation of the RAS-RAF-MEK1/2-ERK1/2 signaling pathway has been identified and implicated in the development or maintenance of many cancers (Schubbert et al. 2007 and Gollob et al. 2006). Mutations in RAS family genes, such as KRAS, NRAS, and HRAS are the most common, with activating RAS mutations occurring in 30% of human cancers (Schubbert et al. 2007). KRAS mutations are prevalent in pancreatic (>90%) (Kanda et al. 2012), biliary tract (3%-50%) (Hezel et al. 2014), colorectal (30%-50%) (Arrington et al. 2012), lung (27%) (Pennycuick et al. 2012), ovarian (15%-39%) (Dobrzycka et al. 2009), and endometrioid endometrial (18%) (O'Hara and Bell 2012) cancers; NRAS mutations are prevalent in melanoma (20%) (Khattak et al. 2013) and myeloid leukemia (8%-13%) (Yohe 2015); and HRAS mutations are prevalent in bladder (12%) cancer (Fernández-Medarde and Santos 2011). Mutations in RAF family genes, most notably BRAF, are frequent, particularly in melanoma. BRAF mutations have been identified in 66% of malignant melanomas and in ˜7% of a wide range of other cancers (Davies et al. 2002), while MEK mutations are rarer, occurring at an overall frequency of 8% in melanomas (Nikolaev et al. 2012). In contrast, ERK mutations resulting in tumorigenesis have been reported only rarely to date (Deschenes-Simard et al. 2014).
• The US Food and Drug Administration (FDA) has approved two selective BRAF inhibitors, vemurafenib and dabrafenib, as monotherapies for patients with BRAF^V600-mutant metastatic melanoma (Taflinar [package insert] and Zelboraf [package insert]). Though response rates for these targeted therapies can be as high as 50% in in patients with BRAF^V600 mutations, duration of response is often measured in months, not years (Hauschild et al. 2012 and McArthur et al. 2014). The MEK1/2 inhibitor trametinib is also approved as a monotherapy in this setting (Mekinist [package insert]), but is more commonly used in combination with the BRAF inhibitor dabrafenib. First-line use of trametinib administered in combination with dabrafenib offers an even greater improvement in overall survival compared with vemurafenib monotherapy without increased overall toxicity (Robert et al. 2015), highlighting the potential utility of simultaneously targeting multiple proteins of this MAPK signaling pathway. This therapeutic combination was also associated with a lower incidence of MEK inhibitor-associated rash and BRAF inhibitor-induced hyperproliferative skin lesions compared with each single agent alone (Flaherty et al. 2012). Recently, a phase III trial also demonstrated significant improvements in overall survival (25.1 vs. 18.7 months, hazard ratio [HR] 0.71, P=0.0107), progression-free survival (PFS) (11.0 vs. 8.8 months, HR 0.67, P=0.0004), and overall response (69% vs. 53%; P=0.0014) with dabrafenib plus trametinib versus dabrafenib alone in patients with BRAF^V600E/K mutation-positive melanoma (Long et al. 2015). Similarly, significant improvements in PFS (9.9 vs. 6.2 months, HR 0.51, P<0.001) and the rate of complete response (CR) or partial response (PR) (68% vs. 45%; P<0.001) have been demonstrated with the combination of cobimetinib plus vemurafenib compared with vemurafenib alone (Larkin et al. 2014). To this end, FDA approval was recently granted for the combination of vemurafenib and cobemetinib for BRAF^V600E/K-mutated melanoma. Based on these and related findings, the combination of a BRAF inhibitor plus a MEK inhibitor has become a standard targeted treatment option for patients with metastatic melanoma containing BRAF^V600E/K mutations.
• Though BRAF/MEK-targeted combination therapy has been demonstrated to provide significant additional benefit beyond single-agent options, most patients eventually develop resistance and disease progression after ˜12 months (Robert et al. 2015, Flaherty et al. 2012 and Long et al. 2015). Several mechanisms of acquired resistance following either single-agent or combination therapies have been identified, including the generation of BRAF splicing variants, BRAF amplification, development of NRAS or MEK mutations, and upregulation of bypass pathways (Poulikakos et al. 2011, Corcoran et al. 2010, Nazarian et al. 2010, Shi et al. 2014, Johannessen et al. 2010, Wagle et al. 2011, Wagle et al. 2014 and Ahronian et al. 2015). Central to many of these mechanisms of resistance is the reactivation of ERK signaling, which enables the rapid recovery of MAPK pathway signaling and escape of tumor cells from single-agent BRAF or combination BRAF/MEK inhibitor therapies (Paraiso et al. 2010). ERK inhibition may provide the opportunity to avoid or overcome resistance from upstream mechanisms, as it is the most distal master kinase of this MAPK signaling pathway. This is supported by preclinical evidence that inhibition of ERK by small molecule inhibitors acted to both inhibit the emergence of resistance and overcome acquired resistance to BRAF and MEK inhibitors (Morris et al. 2013 and Hatzivassiliou et al. 2012).
• BVD-523 is a highly potent, selective, reversible, ATP-competitive ERK1/2 inhibitor which has been shown to reduce tumor growth and induce tumor regression in BRAF and RAS mutant xenograft models. Furthermore, single-agent BVD-523 inhibited human xenograft models that were cross-resistant to both BRAF and MEK inhibitors. See, Examples 9-16. Therefore, an open-label, first-in-human study (Clinicaltrials.gov identifier, NCT01781429) of oral BVD-523 to identify both the maximum tolerated dose and the recommended dose for further study was undertaken. The present study also aimed to assess pharmacokinetic and pharmacodynamic properties as well as preliminary efficacy in patients with advanced cancers.
Example 18 Patient Characteristics
• A total of 27 patients were enrolled and received at least one dose of study drug from Apr. 4, 2013 to Dec. 1, 2015. Baseline demographics and disease characteristics are shown in Table 25. The median patient age was 61 years (range, 33-86 years). Fifty-two percent (14/27) of patients were male and 63% (17/27) had an Eastern Cooperative Oncology Group (ECOG) performance status of 1. Melanoma was the most common cancer (30%; BRAF mutation present in 7/8 of these patients). The remaining patients had colorectal (19%; 5/27), papillary thyroid (15%; 4/27), or non-small cell lung cancer (NSCLC) (7%; 2/27), and 8 (30%) were classified as having other cancers (2 pancreatic, 1 appendiceal, 1 nonseminomatous germ cell, 1 ovarian and 3 with unknown primary). The majority of patients had received 2 or more prior lines of systemic therapy, with 41% (11/27) receiving 2 to 3 and 48% (13/27) receiving >3 prior lines of systemic therapy.

• TABLE 25
  Baseline demographics and clinical characteristics of patients

  Parameter	N = 27
  Median age, years (range)	61 (33-86)
  Sex, n (%)
  Female	13 (48)
  Male	14 (52)
  Ethnicity, n (%)
  Not Hispanic/Latino	27 (100)
  ECOG performance status
  0	10 (37)
  1	17 (63)
  Cancer type, n (%)
  Melanomaa	8 (30)
  Colorectal	5 (19)
  Papillary thyroid	4 (15)
  Non-small cell lung	2 (7)
  Otherb	8 (30)
  Molecular abnormalities, n (%)c
  BRAF mutant	13 (48)
  KRAS mutant	6 (22)
  NRAS mutant	2 (7)
  Otherd	7 (26)
  Unknown	4 (15)
  Number of prior systemic anticancer
  regimens, n (%)
  0	1 (4)
  1	2 (7)
  2-3	11 (41)
  >3	13 (48)
  Prior BRAF/MEK-targeted therapye, n (%)	11 (41)
  BRAF	5 (19)
  MEK	6 (22)
  BRAF/MEK	2 (7)
  aSeven were BRAF mutant and 1 was unknown.
  bTwo pancreatic, 1 appendiceal, 1 non-seminomatous germ cell, 1 ovarian, 3 unknown primary.
  cPatients may have more than 1 molecular abnormality.
  dOther molecular abnormalities included ERCC1, RRM1, thymidylate synthetase, GNAS, MEK1, TP53, CREBBP, ROS1, PTEN, AKT3, and PIK3CA.
  eSome patients were treated with more than one BRAF inhibitor.
  Abbreviation: ECOG, Eastern Cooperative Oncology Group.

Example 19 Ex Vivo Effects of BVD-523 on RSK1/2 Phosphorylation
• An ex vivo biomarker assay that could be used to support clinical studies was developed to demonstrate the inhibitory effects of BVD-523 on ERK activity. The assay extends preclinical cellular data where inhibitors of MAPK signaling, such as BVD-523, dabrafenib, trametinib, and vemurafenib, have been shown to inhibit RSK phosphorylation as a function of inhibitor concentration in BRAF mutant cancer cell lines. See, Examples 9-16. Specifically, ERK inhibitor-dependent inhibition of phorbol 12-myristate 13-acetate (PMA)-stimulated phosphorylation of the ERK substrate RSK1 in whole blood was used as a target marker. When BVD-523 was added directly to whole blood from healthy volunteers, PMA-stimulated RSK phosphorylation decreased with increasing concentrations of BVD-523 (FIG. 38). The mean IC₅₀ for the cumulative data was 461±20 nM for BVD-523, with a maximum inhibition of 75.8±2.7% at 10 μM BVD-523. Maximum inhibition was defined as the RSK phosphorylation measured in the presence of 10 μM BVD-523. Patient-derived whole blood samples, collected just prior to dosing or at defined timepoints following dosing with BVD-523, were similarly treated and RSK phosphorylation levels quantitated.
Example 20 Dose Escalation, Dose-Limiting Toxicities (DLTs), Maximum Tolerated Dose (MTD), and Recommended Phase II Dose (RP2D)
• As per protocol, 5 single-patient cohorts (from 10 to 150 mg twice-daily [BID]) proceeded without evidence of a DLT. The 300-mg BID cohort was expanded to more fully characterize BVD-523 exposures. One of 6 patients given 600 mg BID experienced a DLT of Grade 3 rash. The 900-mg BID dose exceeded the MTD, with one patient experiencing Grade 3 pruritus and elevated aspartate aminotransferase (AST) and another patient experiencing Grade 3 diarrhea, vomiting, dehydration, and elevated creatinine (Table 26). The subsequent intermediate dose of 750 mg BID also exceeded the MTD, with DLTs of Grade 3 rash and Grade 2 diarrhea in 1 patient and Grade 2 hypotension, elevated creatinine, and anemia in another patient. Therefore, the MTD and RP2D were determined to be 600 mg BID.

• TABLE 26
  Dose-limiting toxicities in Cycle 1 (21 days)

  Dose,
  mg	DLT
  (BID)	Frequency	DLT Description
  10	0/1	N/A
  20	0/1	N/A
  40	0/1	N/A
  75	0/1	N/A
  150	0/1	N/A
  300	0/4	N/A
  600	1/8	Rash (Grade 3)
  750a	2/4	Rash (Grade 3), diarrhea (Grade 2)
  		Hypotension (Grade 2), elevated creatinine (Grade 2),
  		anemia (Grade 2), delay to cycle 2 dosing
  900	2/7	Pruritus (Grade 3), elevated AST (Grade 3)
  		Diarrhea (Grade 3), vomiting (Grade 3), dehydration
  		(Grade 3), elevated creatinine (Grade 3)
  aIntermediate dose.
  Abbreviations:
  AST, aspartate transaminase,
  BID, twice daily;
  DLT, dose-limiting toxicity;
  N/A, not applicable.

Example 21 Adverse Events (AEs)
• Investigator-assessed treatment-related AEs of any grade were noted in 26 of 27 patients (96%). The most common treatment-related AEs (>30%) were rash (predominately acneiform) (70%), fatigue (59%), diarrhea (52%), and nausea (52%) (Table 27). No patients experienced a Grade 4 or 5 treatment-related AE or discontinued treatment due to a treatment-related AE. Most events were Grade 1 to 2, with treatment-related Grade 3 events noted in 13 of 27 patients (48%). The only Grade 3 treatment-related events present in ≥10% of patients were diarrhea (15%) and increased liver function tests (11%), all of which occurred above the 600-mg BID dose.

• TABLE 27
  Adverse events possibly/definitely related to
  BVD-523 in ≥ 10% of patients

  N = 27

  	Any grade, n	Grade		1 or 2,	Grade 3a, n
  Event	(%)	n (%)	(%)
  Rash	20 (74)	18 (67)	2b (7)
  Fatigue	17 (63)	16 (59)	1  (4)
  Diarrhea	16 (59)	12 (44)	4  (15)
  Nausea	14 (52)	14 (52)	0
  Vomiting	8 (30)	7 (26)	1  (4)
  Anorexia	6 (22)	6 (22)	0
  Pruritus	6 (22)	6 (22)	0
  Anemia	5 (19)	3 (11)	2  (7)
  Increased creatinine	5 (19)	4 (15)	1  (4)
  Dehydration	5 (19)	3 (11)	2  (7)
  Peripheral edema	4 (15)	4 (15)	0
  Increased LFTs (ALT	4 (14)	1 (4)	3  (11)
  and AST)
  Blurry/dimmed visionc	3 (11)	3 (11)	0
  Constipation	3 (11)	3 (11)	0
  Fever	3 (11)	3 (11)	0
  aNo patients experienced Grade 4 or 5 AEs that were possibly or definitely related to BVD-523 treatment.
  bAcneiform and maculo-papular rash.
  cOne Grade 1 event of related central serous retinopathy.
  Analysis cut-off date: Dec. 1, 2015.
  Abbreviations:
  AEs, adverse events;
  ALT, alanine transaminase;
  AST, aspartate transaminase;
  LFTs, liver function tests.

• Fourteen patients experienced a total of 28 serious AEs (SAEs). Nine of these were considered to be related or possibly related to BVD-523 by the investigator, which included dehydration, diarrhea, or elevated creatinine (2 patients each), vomiting, nausea, and fever (1 patient each). All other SAEs were considered to be unrelated to treatment with BVD-523. Dose reductions resulting from AEs occurred in 3 patients during the study: 1 patient reduced from 600 mg BID to 300 mg BID and 2 patients reduced from 900 mg BID to 600 mg BID.
Example 22 Pharmacokinetics
• Single-dose and steady-state pharmacokinetics of BVD-523 are summarized in FIG. 39A and Table 28. Generally, orally administered BVD-523 was slowly absorbed in patients with advanced malignancies. After reaching the maximum concentration (C_max), plasma BVD-523 levels remained sustained for approximately 2 to 4 hours. Subsequently, plasma drug concentrations slowly declined. Since plasma drug concentrations were measured only up to 12 hours after the morning dose, it was not possible to calculate an effective or terminal phase elimination rate. BVD-523 pharmacokinetics were linear and dose proportional in terms of both C_max and area under the curve (AUC) when administered up to 600 mg BID. A further increase in exposure was not observed as the dose increased from 600 to 900 mg BID. The C_max reached the level of the EC₅₀ based on the ex vivo whole blood assay (≈200 ng/mL) for all doses above 20 mg BID. Additionally, steady-state exposures remained at or above the target EC₅₀ for dose levels of ≥150 mg BID throughout the dosing period. Minimal plasma accumulation of BVD-523 and its metabolites were observed on Day 15 at the lower (<75 mg BID) dose levels, whereas accumulation ranged from approximately 1.3- to 4.0-fold for the higher dose levels. Predose concentrations on Day 22 were generally similar to those on Day 15, indicating that steady state had already been attained by Day 15 (data not shown). The degree of interpatient variability in plasma exposure to BVD-523 and its metabolites was considered moderate and not problematic.

• TABLE 28
  Steady-state BVD-523 pharmacokinetics (Cycle 1, Day 15)

  Cmax, ng/mL ± SD

  AUC0-12, ng · hr/mL ± SD

  Dose, mga	n=	Day 1	Day 15	Day 1	Day 15

  10	1	48.2	45.7	220	234
  20	1	14.9	15.8	91.7	98.7
  40	1	100	191	614	999
  150	1	133	326	817	2770
  300	4b	765 ± 234	586 ± 257	4110 ± 1140	4460 ± 2460
  600c	7d	1110 ± 589	2750 ± 170	2750 ± 1740	24400 ± 16200
  750	4b	1450 ± 539	2290 ± 1790f	10700 ± 1120g	23300 ± 19800f
  900	7e	1430 ± 1010	1720 ± 328	10800 ± 6320h	15900 ± 1300g
  aDose level administered twice daily;
  bn = 3 on Day 15;
  cNumber of subjects for Day 15 at the 600 mg dose level includes two subjects who started Day 1 dosing at 900 mg and were later reduced to 600 mg;
  dn = 8 on Day 15;
  en = 4 on Day 15;
  fOne subject started on Day 1 dosing at 750 mg and was later redcued to 450 mg. Day 15 parameters for this subject reflect at least 10 consecutive doses at 450 mg/dose. Individual Day 15 parameters were 1300 ng/mL for Cmax and 10700 ng/hr/mL for AUC0-12;
  gn = 3;
  hn = 5.

• The urinary excretion after first dose and at steady state of BVD-523 was negligible (<0.2% of the dose) at all dose levels within 12 hours postdose, and not dose-related within this very low percentage range. Renal clearance appeared to be dose-independent. Individual renal clearance values ranged from 0.128 to 0.0895 L/hr (where n=1 per dose level) and mean values ranged from 0.0149 to 0.0300 L/hr (where n≥3).
Example 23 Pharmacodynamic Confirmation of Target Inhibition by BVD-523
• To confirm on-target and pathway inhibition by BVD-523, RSK-1 phosphorylation was examined as a target biomarker in human whole blood samples from patients with solid tumors who received BVD-523. Steady state whole blood samples collected just prior to Day 15 dosing from BVD-523-treated patients displayed concentration-dependent inhibition of PMA stimulated ERK activity (FIG. 39B), ranging from 0% ERK inhibition with BVD-523 dosing at 10 mg BID to 93±8% ERK inhibition with dosing at 900 mg BID. The plasma concentrations of BVD-523 that yielded 50% inhibition of ERK phosphorylation were similar whether BVD-523 was spiked directly into healthy volunteer plasma or was present following oral dosing of patients.
Example 24 Antitumor Effects
• Tumor response to BVD-523 was assessed in 25 evaluable patients using Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST v1.1); 2 patients did not receive both scans of target lesions and were thus not evaluated using RECIST v1.1. No patients achieved a complete response, but 3 patients (all patients with melanoma with BRAF^V600 mutations) achieved a partial response (129 days [BRAF/MEK-inhibitor naïve], 294 days ongoing at [refractory to prior BRAF/MEK inhibitors], 313 days ongoing by the data cutoff date [intolerant to other BRAF/MEK inhibitors]) (FIG. 40A). Interestingly, all 3 partial responders had BRAF-mutant melanoma. One partial responder, who was receiving BVD-523 at a dose of 450 mg BID, had an approximate 70% reduction in the sum of target lesions from baseline, while the other partial responders showed reductions of 47.0% and 33.6%. Stable disease was demonstrated in 18 patients, with 6 having stable disease for more than 6 months, and 6 additional patients having stable disease for more than 3 months. In this study, 4 patients displayed progressive disease at first evaluation.
• FIG. 40B shows computed tomography (CT) scans of 1 of the 3 partial responders (RECIST v1.1) who had progressed on prior vemurafenib and subsequent dabrafenib/trametinib treatment; a durable partial response was observed following dosing of BVD-523 600 mg BID for >300 days. BVD-523 was associated with a metabolic response using fluorodeoxyglucose-positive emission tomography (¹⁸F-FDG-PET) in 5 of 16 evaluable patients.
• FIG. 41 depicts the time to response and the duration of response in the study population. The two patients who demonstrated responses to BVD-523 remained on study and continued with BVD-523 treatment as of the study cutoff date (>500 days); additionally, one patient with bronchoalveolar NSCLC (not enough tissue for molecular profiling) had been on treatment for >700 days with stable disease. Twenty-four of 27 patients (90%) discontinued treatment due to progressive disease (22/27, 82%) or other reasons (2/27, 7%). The mean duration of BVD-523 treatment before discontinuation was 4.7 months.
Discussion
• The present invention presents results from a first-in-human study evaluating the safety, pharmacokinetics, pharmacodynamics, and preliminary efficacy of BVD-523 in 27 patients with advanced solid tumors. In this dose-escalation study, oral treatment with BVD-523 resulted in both radiographic responses by RECIST v1.1 (3 partial responses) and prolonged disease stabilization in some patients, the majority of whom had been treated with 2 prior systemic therapies. Evidence of BVD-523-dependent inhibition of metabolic response in tumors was established in a subset of patients by imaging tumor uptake of ¹⁸F-glucose. Drug exposures increased linearly with increasing doses up to 600 mg BID, with exposures at 600 mg BID providing near complete 24/7 inhibition of ERK-dependent substrate (RSK-1) phosphorylation in an ex vivo whole blood assay. Furthermore, tolerability to BVD-523 was manageable when administered up to its MTD and RP2D, determined to be 600 mg BID.
• BVD-523 was generally well tolerated, with manageable and reversible toxicity. The most common AEs were rash (usually acneiform), fatigue, and gastrointestinal side effects, including nausea, vomiting, and diarrhea. The safety profile of BVD-523 is consistent with its selective inhibition of the MAPK pathway; the AE profile shows considerable overlap with MEK inhibitor experience. However, toxicities associated with any targeted therapy may include dependence on both the specific mechanism and the degree of target inhibition as well as any off-target effects (Zelboraf [package insert] and Hauschild et al. 2012). Ongoing and future investigations will extend both the efficacy and safety profile demonstrated in this dose-escalation study, and will guide how the unique profile of the ERK inhibitor BVD-523 might be used as a single agent or in combination with other agents.
• Durable responses by RAF and MEK inhibitors are often limited by intrinsic and eventual acquired resistance, with a common feature often involving reactivation of the ERK pathway (Poulikakos et al. 2011, Corcoran et al. 2010, Nazarian et al. 2010, Shi et al. 2014, Johannessen et al. 2010, Wagle et al. 2011, Wagle et al. 2014, Ahronian et al. 2015 and Paraiso et al. 2010). Thus, ERK inhibition with BVD-523 alone or in combination with other MAPK signaling pathway inhibitors may have the potential to delay the development of resistance to existing therapies and to benefit a broader patient population. That ERK inhibitors, including BVD-523, retain their potency in BRAF- and MEK-resistant cell lines provide preclinical evidence for the use of ERK inhibitors in patients with acquired resistance to standard of care (BRAF/MEK combination therapy) See, e.g., Examples 9-16. Importantly, in this study, a patient whose cancer had progressed after experiencing stable disease when treated initially with a BRAF inhibitor (vemurafenib) and subsequently with a combination of BRAF and MEK inhibitors (dabrafenib/trametinib) had a partial response when receiving single-agent BVD-523. This patient has remained on-study for a total of 708 days, as of the cutoff date of the study reported herein. Based in part on the antitumor effects observed in this patient, the FDA has designated as a Fast Track development program the investigation of BVD-523 for the treatment of patients with unresectable or metastatic BRAF^V600 mutation-positive melanoma that is refractory to or has progressed following treatment with a BRAF and/or MEK inhibitor(s). Precise definition of exactly how BVD-523 might best support patient care (eg, as a single agent or in various combinations) requires additional clinical studies.
• In summary, the present examples present data from an initial data from the dose escalation portion of a phase I study evaluating BVD-523, a novel first-in-class ERK inhibitor, as a treatment for patients with advanced cancers. Continuous, twice-daily oral treatment with BVD-523 resulted in antitumor effects in several patients, including patients either naïve to or having progressed on available MAPK pathway-targeted therapies. BVD-523 was generally well tolerated in this advanced cancer patient population and toxicities were manageable; the MTD and RP2D were 600 mg BID. BVD-523 exposures increased linearly up to the RP2D and robust pharmacodynamics effects were evident at this dose level. An expansion of this phase I clinical study is currently underway to confirm and extend the observations made in the dose-escalation phase. Specifically, patients are being enrolled into molecularly classified expansion cohorts (e.g., NRAS, BRAF, MEK or ERK alterations) across various tumor histologies. Furthermore, expansion cohorts are evaluating the use of BVD-523 in patients with cancer who are either naïve to available MAPK pathway therapies or those whose disease has progressed on such treatments.
DOCUMENTS
• ABSALAN, Farnaz, Mostafa Ronaghi (2008). Molecular Inversion Probe Assay. Methods in Molecular Biology 396. Humana Press. pp. 315-330.
• AHRONIAN L G, Sennott E M, Van Allen E M, Wagle N, Kwak E L, Faris J E, et al. Clinical acquired resistance to RAF inhibitor combinations in BRAF-mutant colorectal cancer through MAPK pathway alterations. Cancer Discov 2015; 5:358-67.
• ARCILA M E, Drilon A, Sylvester B E, Lovly C M, Borsu L, Reva B, et al. MAP2K1 (MEK1) mutations define a distinct subset of lung adenocarcinoma associated with smoking. Clin Cancer Res 2015; 21:1935-43.
• ARONOV A M, Baker C, Bemis G W, Cao J, Chen G, Ford P J, et al. Flipped out: structure-guided design of selective pyrazolylpyrrole ERK inhibitors. J Med Chem 2007; 50:1280-7.
• ARONOV A M, Tang Q, Martinez-Botella G, Bemis G W, Cao J, Chen G, et al. Structure-guided design of potent and selective pyrimidylpyrrole inhibitors of extracellular signal-regulated kinase (ERK) using conformational control. J Med Chem 2009; 52:6362-8.
• ARRINGTON A K, Heinrich E L, Lee W, Duldulao M, Patel S, Sanchez J, et al. Prognostic and predictive roles of KRAS mutation in colorectal cancer. Int J Mol Sci 2012; 13:12153-68.
• CARGNELLO M, Roux P P. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev 2011; 75:50-83.
• CARLINO M S, Fung C, Shahheydari H, Todd J R, Boyd S C, Irvine M, et al. Preexisting MEK1P124 mutations diminish response to BRAF inhibitors in metastatic melanoma patients. Clin Cancer Res 2015; 21:98-105.
• CHAPMAN P B, Hauschild A, Robert C, Haanen J B, Ascierto P, Larkin J, et al. Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med 2011; 364:2507-16.
• CORCORAN, R. B., et al. BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Sci Signal (2010); 3(149): ra84.
• DAI, B., et al. STAT3 mediates resistance to MEK inhibitor through microRNA miR-17. Cancer Res (2011); 71:3658-3668.
• DAVIES H, Bignell G R, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002; 417:949-54.
• DESCHENES-SIMARD X, Kottakis F, Meloche S, Ferbeyre G. ERKs in cancer: friends or foes? Cancer Res 2014; 74:412-9.
• DOBRZYCKA B, Terlikowski S J, Kowalczuk O, Niklinska W, Chyczewski L, Kulikowski M. Mutations in the KRAS gene in ovarian tumors. Folia Histochem Cytobiol 2009; 47:221-4.
• EMERY, C. M., et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. PNAS (2009); 106(48):20411-6.
• FEDOROV O, Niesen F H, Knapp S. Kinase inhibitor selectivity profiling using differential scanning fluorimetry. Methods Mol Biol 2012; 795:109-18.
• FERNÁNDEZ-MEDARDE A, Santos E. Ras in cancer and developmental diseases. Genes Cancer 2011; 2:344-58.
• FLAHERTY K T, Infante J R, Daud A, Gonzalez R, Kefford R F, Sosman J, et al. Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. N Engl J Med 2012; 367:1694-703.
• GOETZ E M, Ghandi M, Treacy D J, Wagle N, Garraway L A. ERK mutations confer resistance to mitogen-activated protein kinase pathway inhibitors. Cancer Res 2014; 74:7079-89.
• GOLLOB J A, Wilhelm S, Carter C, Kelley S L. Role of Raf kinase in cancer: therapeutic potential of targeting the Raf/MEK/ERK signal transduction pathway. Semin Oncol 2006; 33:392-406.
• GREGER, James G., et al. “Combinations of BRAF, MEK, and PI3K/mTOR inhibitors overcome acquired resistance to the BRAF inhibitor GSK2118436 dabrafenib, mediated by NRAS or MEK mutations.” Molecular cancer therapeutics 11.4 (2012): 909-920.
• GROENENDIJK F H, Bernards R. Drug resistance to targeted therapies: deja vu all over again. Mol Oncol 2014; 8:1067-83.
• HALL R D, Kudchadkar R R. BRAF mutations: signaling, epidemiology, and clinical experience in multiple malignancies. Cancer Control 2014; 21:221-30.
• HARDENBOL, P., et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat. Biotechnol. 2003, no. 21, p. 673-678.
• HATZIVASSILIOU, Georgia, et al. “RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth.” Nature 464.7287 (2010): 431-435.
• HATZIVASSILIOU G, Liu B, O'Brien C, Spoerke J M, Hoeflich K P, Haverty P M, et al. ERK inhibition overcomes acquired resistance to MEK inhibitors. Mol Cancer Ther 2012; 11:1143-54.
• HAUSCHILD A, Grob J-J, Demidov L V, Jouary T, Gutzmer R, Millward M, et al. Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial. Lancet 2012; 380:358-65.
• HAYES T K, Neel N F, Hu C, Gautam P, Chenard M, Long B, et al. Long-Term ERK Inhibition in KRAS-Mutant Pancreatic Cancer Is Associated with MYC Degradation and Senescence-like Growth Suppression. Cancer Cell 2016; 29:75-89.
• HEZEL A F, Noel M S, Allen J N, Abrams T A, Yurgelun M, Faris J E, et al. Phase II study of gemcitabine, oxaliplatin in combination with panitumumab in KRAS wild-type unresectable or metastatic biliary tract and gallbladder cancer. Br J Cancer 2014; 111:430-6.
• JHA S, Morris E J, Hruza A, Mansueto M S, Schroeder G, Arbanas J, et al. Dissecting therapeutic resistance to ERK inhibition. Mol Cancer Ther 2016; 15:548-59.
• JOHANNESSEN, C. M., et al. COT/MAP3K8 drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature (2010); 468(7326):968-972.
• JOHNSON D B, Menzies A M, Zimmer L, Eroglu Z, Ye F, Zhao S, et al. Acquired BRAF inhibitor resistance: A multicenter meta-analysis of the spectrum and frequencies, clinical behaviour, and phenotypic associations of resistance mechanisms. Eur J Cancer 2015; 51:2792-9.
• KANDA M, Matthaei H, Wu J, Hong S M, Yu J, Borges M, et al. Presence of somatic Mutations in most early-stage pancreatic intraepithelial neoplasia. Gastroenterology 2012; 142:730-733.
• KHATTAK M, Fisher R, Turajlic S, Larkin J. Targeted therapy and immunotherapy in advanced melanoma: an evolving paradigm. Ther Adv Med Oncol 2013; 5:105-18.
• KING, Alastair J., et al. “Dabrafenib; preclinical characterization, increased efficacy when combined with trametinib, while BRAF/MEK tool combination reduced skin lesions.” PloS one 8.7 (2013): e67583.
• LARKIN J, Ascierto P A, Dréno B, Atkinson V, Liszkay G, Maio M, et al. Combined vemurafenib and cobimetinib in BRAF-mutated melanoma. N Engl J Med 2014; 371:1867-76.
• LITTLE, A. S., et al., Amplification of the Driving Oncogene, KRAS or BRAF, Underpins Acquired Resistance to MEK1/2 Inhibitors in Colorectal Cancer Cells. Sci. Signal. 4, ra17 (2011).
• LIU, Dingxie, et al. “BRAF V600E maintains proliferation, transformation, and tumorigenicity of BRAF-mutant papillary thyroid cancer cells.” Journal of Clinical Endocrinology & Metabolism 92.6 (2007): 2264-2271.
• LIU B, Fu L, Zhang C, Zhang L, Zhang Y, Ouyang L, et al. Computational design, chemical synthesis, and biological evaluation of a novel ERK inhibitor (BL-EI001) with apoptosis-inducing mechanisms in breast cancer. Oncotarget 2015; 6:6762-75.
• LONG G V, Fung C, Menzies A M, Pupo G M, Carlino M S, Hyman J, et al. Increased MAPK reactivation in early resistance to dabrafenib/trametinib combination therapy of BRAF-mutant metastatic melanoma. Nat Commun 2014; 5:5694.
• LONG G V, Stroyakovskiy D, Gogas H, Levchenko E, de Braud F, Larkin J, et al. Dabrafenib and trametinib versus dabrafenib and placebo for Val600 BRAF-mutant melanoma: a multicentre, double-blind, phase 3 randomised controlled trial. Lancet 2015; 386:444-51.
• MANANDHAR S P, Hildebrandt E R, Schmidt W K. Small-molecule inhibitors of the Rce1p CaaX protease. J Biomol Screen. 2007; 12(7):983-993.
• MASSEY P R, Prasad V, Figg W D, Fojo T. Multiplying therapies and reducing toxicity in metastatic melanoma. Cancer Biol Ther 2015; 16:1014-8.
• MAURER, T, Garrenton, L S, Oh, A, Pitts, K, Anderson, D J, Skelton, N J, Fauber, B P, Pan, B, Malek, S, Stokoe, D, Ludlam, MJC, Bowman, K K, Wu, J, Giannetti, A M, Starovasnik, M A, Mellman, I, Jackson, P K, Rudolph, J, Wang, W, Fang, G. Small-molecule ligands bind to a distinct pocket in Ras and inhibit SOS-mediated nucleotide exchange activity. PNAS. 2012; 109(14):5299-304.
• MCARTHUR G A, Chapman P B, Robert C, Larkin J, Haanen J B, Dummer R, et al. Safety and efficacy of vemurafenib in BRAF^V600E and BRAF^V600K mutation-positive melanoma (BRIM-3): extended follow-up of a phase 3, randomised, open-label study. Lancet Oncol 2014; 15:323-32.
• MEKINIST [package insert]. Research Triangle Park, N.C.: GlaxoSmithKline; 2014.
• METZKER, Emerging technologies in DNA sequencing Genome Res. 2005. 15: 1767-1776.
• MITTAL, Rohit et al. “The acetyltransferase activity of the bacterial toxin YopJ of Yersinia is activated by eukaryotic host cell inositol hexakisphosphate.” Journal of Biological Chemistry 285.26 (2010): 19927-19934.
• MORRIS E J, Jha S, Restaino C R, Dayananth P, Zhu H, Cooper A, et al. Discovery of a novel ERK inhibitor with activity in models of acquired resistance to BRAF and MEK inhibitors. Cancer Discov 2013; 3:742-50.
• NAZARIAN, R., et al. Melanomas acquire resistance to B-RAF (V600E) inhibition by RTK or N-RAS upregulation. Nature. 2010; 468(7326):973-977.
• NIKOLAEV S I, Rimoldi D, Iseli C, Valsesia A, Robyr D, Gehrig C, et al. Exome sequencing identifies recurrent somatic MAP2K1 and MAP2K2 mutations in melanoma. Nat Genet 2012; 44:133-9.
• NILSSON, M., et al. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science. 1994, no. 265, p. 2085-2088.
• O'HARA A J, Bell D W. The genomics and genetics of endometrial cancer. Adv Genomics Genet 2012; 2012:33-47.
• OJESINA A I, Lichtenstein L, Freeman S S, Pedamallu C S, Imaz-Rosshandler I, Pugh T J, et al. Landscape of genomic alterations in cervical carcinomas. Nature 2014; 506:371-5.
• OTA et al., Single nucleotide polymorphism detection by polymerase chain reaction-restriction fragment length polymorphism. Nat Protoc. 2007; 2(11):2857-64.
• PARAISO K H T, Fedorenko I V, Cantini L P, Munko A C, Hall M, Sondak V K, et al. Recovery of phospho-ERK activity allows melanoma cells to escape from BRAF inhibitor therapy. Br J Cancer 2010; 102:1724-30.
• PATGIRI A, Yadav, K K, Arora, P S, Bar-Sagi, D. An orthosteric inhibitor of the Ras-Sos interaction. Nat Chem Biol. 2011; 7:585-587.
• PENNYCUICK A, Simpson T, Crawley D, Lal R, Santis G, Cane P, et al. Routine EGFR and KRAS mutation analysis using COLD-PCR in non-small cell lung cancer. Int J Clin Pract 2012; 66:748-52.
• PORTER S B, Hildebrandt E R, Breevoort S R, Mokry D Z, Dore T M, Schmidt W K. Inhibition of the CaaX proteases Rce1p and Ste24p by peptidyl (acyloxy)methyl ketones. Biochim Biophys Acta. 2007; 1773(6):853-862.
• POULIKAKOS P I, Persaud Y, Janakiraman M, Kong X, Ng C, Moriceau G, et al. RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E). Nature 2011; 480:387-90.
• QUEIROLO P, Picasso V, Spagnolo F. Combined BRAF and MEK inhibition for the treatment of BRAF-mutated metastatic melanoma. Cancer Treat Rev 2015; 41:519-26.
• RASOLA A, Sciacovelli M, Chiara F, Pantic B, Brusilow W S, Bernardi P. Activation of mitochondrial ERK protects cancer cells from death through inhibition of the permeability transition. Proc Natl Acad Sci USA 2010; 107:726-31.
• RIZOS H, Menzies A M, Pupo G M, Carlino M S, Fung C, Hyman J, et al. BRAF inhibitor resistance mechanisms in metastatic melanoma: spectrum and clinical impact. Clin Cancer Res 2014; 20:1965-77.
• ROBERT C, Karaszewska B, Schachter J, Rutkowski P, Mackiewicz A, Stroiakovski D, et al. Improved overall survival in melanoma with combined dabrafenib and trametinib. N Engl J Med 2015; 372:30-9.
• ROMEO Y, Zhang X, Roux P P. Regulation and function of the RSK family of protein kinases. Biochem J 2012; 441:553-69.
• RUDOLPH J, Xiao Y, Pardi A, Ahn N G. Slow inhibition and conformation selective properties of extracellular signal-regulated kinase 1 and 2 inhibitors. Biochemistry 2015; 54:22-31.
• SHAUL Y D, Seger R. The MEK/ERK cascade: from signaling specificity to diverse functions. Biochim Biophys Acta 2007; 1773:1213-26.
• SHI H, Hugo W, Kong X, Hong A, Koya R C, Moriceau G, et al. Acquired resistance and clonal evolution in melanoma during BRAF inhibitor therapy. Cancer Discov 2014; 4:80-93.
• SHIMA, F, Yoshikawa, Y, Ye, M, Araki, M, Matsumoto, S, Liao, J, Hu, L, Sugimoto, T, Ijiri, Y, Takeda, A, Nishiyama, Y, Sato, C, Muraoka, S, Tamura, A, Osoda, T, Tsuda, K-I, Miyakawa, T, Fukunishi, H, Shimada, J, Kumasaka, Yamamoto, M, Kataoka, T. In silico discovery of small-molecule Ras inhibitors that display antitumor activity by blocking the Ras-effector interaction. PNAS. 2013; 110(20):8182-7.
• SCHUBBERT S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 2007; 7:295-308.
• SUN C, Hobor S, Bertotti A, Zecchin D, Huang S, Galimi F, et al. Intrinsic resistance to MEK inhibition in KRAS mutant lung and colon cancer through transcriptional induction of ERBB3. Cell Rep 2014; 7:86-93.
• TAFLINAR [package insert]. Research Triangle Park, N.C.: GlaxoSmithKline; 2015.
• TRUNZER K, Pavlick A C, Schuchter L, Gonzalez R, McArthur G A, Hutson T E, et al. Pharmacodynamic effects and mechanisms of resistance to vemurafenib in patients with metastatic melanoma. J Clin Oncol 2013; 31:1767-74.
• VILLANUEVA, J., et al. Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer Cell. 2010; 18:683-695.
• WAGLE, N., et al. Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. Journal of Clinical Oncology 2011; 29(22):3085-3096.
• WAGLE N, Van Allen E M, Treacy D J, Frederick D T, Cooper Z A, Taylor-Weiner A, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer Discov 2014; 4:61-8.
• Wainstein E, Seger R. The dynamic subcellular localization of ERK: mechanisms of translocation and role in various organelles. Curr Opin Cell Biol 2016; 39:15-20.
• WANG, H., et al. Identification of the MEK1(F129L) activating mutation as a potential mechanism of acquired resistance to MEK inhibition in human cancers carrying the B-RAF V600E mutation. Cancer Res (2011); 71(16):5535-45.
• YANG W, Soares J, Greninger P, Edelman E J, Lightfoot H, Forbes S, et al. Genomics of Drug Sensitivity in Cancer (GDSC): a resource for therapeutic biomarker discovery in cancer cells. Nucleic Acids Res 2013; 41:D955-D961.
• YAO Z, Torres N M, Tao A, Gao Y, Luo L, Li Q, et al. BRAF Mutants Evade ERK-Dependent Feedback by Different Mechanisms that Determine Their Sensitivity to Pharmacologic Inhibition. Cancer Cell 2015; 28:370-83.
• YOHE S. Molecular genetic markers in acute myeloid leukemia. J Clin Med 2015; 4:460-78.
• ZELBORAF [package insert]. South San Francisco, Calif.: Genentech USA, Inc.; 2015.
• All documents cited in this application are hereby incorporated by reference as if recited in full herein.
• Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the invention.

Claims (83)

1. A method for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy, the method comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

2. The method according to claim 1, wherein the non-ERK MAPK pathway inhibitor therapy is selected from the group consisting of a RAS inhibitor, a RAF inhibitor, a MEK inhibitor, and combinations thereof.

3. The method according to claim 1, wherein the non-ERK MAPK pathway inhibitor therapy is selected from the group consisting of a BRAF inhibitor, a MEK inhibitor, and combinations thereof.

4. The method according to claim 1, wherein substantially all phosphorylation of RSK is inhibited after administration of BVD-523 or a pharmaceutically acceptable salt thereof.

5. The method according to claim 1, wherein the subject is a mammal.

6. The method according to claim 5, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

7. The method according to claim 5, wherein the mammal is a human.

8. The method according to claim 1, wherein the cancer has MAPK activity.

9. The method according to claim 8, wherein the cancer is a solid tumor cancer or a hematologic cancer.

10. The method according to claim 8, wherein the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers.

11. The method according to claim 8, wherein the cancer is melanoma.

12. The method according to claim 1 further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.

13. The method according to claim 12, wherein the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.

14. The method according to claim 13, wherein the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (542,2-Difluoro-benzo[1,3]dioxol-5-ylmethyleneythiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

15-28. (canceled)

29. A method for treating or ameliorating the effects of cancer in a subject, which cancer is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both, the method comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

30. The method according to claim 29, wherein the subject is a mammal.

31. The method according to claim 30, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

32. The method according to claim 30, wherein the mammal is a human.

33. The method according to claim 29, wherein the cancer has MAPK activity.

34. The method according to claim 33, wherein the cancer is a solid tumor cancer or a hematologic cancer.

35. The method according to claim 33, wherein the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers.

36. The method according to claim 33, wherein the cancer is melanoma.

37. The method according to claim 29, wherein the cancer is determined to be refractory or resistant to BRAF inhibitor therapy based on one or more of the following: (i) a switch between RAF isoforms, (ii) upregulation of RTK or NRAS signaling, (iii) reactivation of mitogen activated protein kinase (MAPK) signaling, (iv) the presence of a MEK activating mutation.

38. The method according to claim 29, wherein the cancer is determined to be refractory or resistant to MEK inhibitor therapy based on one or more of the following: (i) amplification of mutant BRAF, (ii) STAT3 upregulation, (iii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity.

39. The method according to claim 29 further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.

40. The method according to claim 39, wherein the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.

41. The method according to claim 40, wherein the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (542,2-Difluoro-benzo[1,3]dioxol-5-ylmethyleneythiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

42. A method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor, the method comprising:

(a) obtaining a biological sample from the subject; and

(b) screening the sample to determine whether the subject has one or more of the following markers:

(i) a switch between RAF isoforms,

(ii) upregulation of receptor tyrosine kinase (RTK) or NRAS signaling,

(iii) reactivation of mitogen activated protein kinase (MAPK) signaling,

(iv) the presence of a MEK activating mutation,

(v) amplification of mutant BRAF,

(vi) STAT3 upregulation,

(vii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity,

wherein the presence of one or more of the markers confirms that the subject's cancer is refractory or resistant to BRAF and/or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.

43. The method according to claim 42, wherein the subject is a mammal.

44. The method according to claim 43, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

45. The method according to claim 43, wherein the mammal is a human.

46. The method according to claim 42, wherein the cancer has MAPK activity.

47. The method according to claim 46, wherein the cancer is a solid tumor cancer or a hematologic cancer.

48. The method according to claim 46, wherein the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers.

49. The method according to claim 46, wherein the cancer is melanoma.

50. The method according to claim 42 further comprising administering BVD-523 or a pharmaceutically acceptable salt thereof to a subject having one or more of the markers.

51. The method according to claim 50 further comprising administering to the subject having one or more of the markers at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.

52. The method according to claim 51, wherein the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.

53. The method according to claim 52, wherein the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (542,2-Difluoro-benzo[1,3]dioxol-5-ylmethyleneythiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

54. A pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

55. The pharmaceutical composition according to claim 54, wherein the non-ERK MAPK pathway inhibitor therapy is selected from the group consisting of a RAS inhibitor, a RAF inhibitor, a MEK inhibitor, and combinations thereof.

56. The pharmaceutical composition according to claim 54, wherein the non-ERK MAPK pathway inhibitor therapy is selected from the group consisting of a BRAF inhibitor, a MEK inhibitor, and combinations thereof.

57. The pharmaceutical composition according to claim 54, wherein the subject is a mammal.

58. The pharmaceutical composition according to claim 57, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

59. The pharmaceutical composition according to claim 57, wherein the mammal is a human.

60. The pharmaceutical composition according to claim 54, wherein the cancer has MAPK activity.

61. The pharmaceutical composition according to claim 60, wherein the cancer is a solid tumor cancer or a hematologic cancer.

62. The pharmaceutical composition according to claim 60, wherein the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers.

63. The pharmaceutical composition according to claim 60, wherein the cancer is melanoma.

64. The pharmaceutical composition according to claim 54 further comprising at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.

65. The pharmaceutical composition according to claim 64, wherein the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.

66. The pharmaceutical composition according to claim 65, wherein the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

67. A kit for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy, the kit comprising a pharmaceutical composition according to any one of claims 54, 55, or 56 packaged together with instructions for its use.

68. A method for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor, the method comprising contacting the cancer cell with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient for phosphorylation of RSK in the cancer cell to be inhibited.

69. The method according to claim 68, wherein greater than 50% of RSK phosphorylation is inhibited.

70. The method according to claim 68, wherein greater than 75% of RSK phosphorylation is inhibited.

71. The method according to claim 68, wherein greater than 90% of RSK phosphorylation is inhibited.

72. The method according to claim 68, wherein greater than 95% of RSK phosphorylation is inhibited.

73. The method according to claim 68, wherein greater than 99% of RSK phosphorylation is inhibited.

74. The method according to claim 68, wherein 100% of RSK phosphorylation is inhibited.

75. The method according to claim 68, which is carried out in vitro, ex vivo, or in vivo.

76. The method according to claim 68, wherein the contacting step comprises administering BVD-523 or a pharmaceutically acceptable salt to a subject from whom the cancer cell was obtained.

77. The method according to claim 68, wherein the non-ERK MAPK pathway inhibitor is selected from the group consisting of a RAS inhibitor, a RAF inhibitor, a MEK inhibitor, and combinations thereof.

78. The method according to claim 68, wherein the non-ERK MAPK pathway inhibitor is selected from the group consisting of BRAF inhibitors, MEK inhibitors, and combinations thereof.

79. The method according to claim 68, wherein the cancer is from a mammal.

80. The method according to claim 79, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

81. The method according to claim 79, wherein the mammal is a human.

82. The method according to claim 68, wherein the cancer has MAPK activity.

83. The method according to claim 82, wherein the cancer is a solid tumor cancer or a hematologic cancer.

84. The method according to claim 82, wherein the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers.

85. The method according to claim 82, wherein the cancer is melanoma.

86. A method of treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.

87. The method according to claim 86, wherein the mutation is a BRAF^V600E mutation.

88. The method according to claim 86, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

89. The method according to claim 86, wherein the mammal is a human.

90. The method according to claim 86, wherein the melanoma has MAPK activity.

91. A composition for treating a subject having an unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle.

92. The composition according to claim 91, wherein the subject is a mammal.

93. The composition according to claim 91, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

94. The composition according to claim 91, wherein the mammal is a human.

95. The composition according to claim 91, wherein the melanoma has MAPK activity.

96. The composition of claim 91 wherein the mutation is a BRAF^V600E mutation.

Images