US20210017599A1 - Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them - Google Patents

Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them Download PDF

Info

Publication number
US20210017599A1
US20210017599A1 US16/857,005 US202016857005A US2021017599A1 US 20210017599 A1 US20210017599 A1 US 20210017599A1 US 202016857005 A US202016857005 A US 202016857005A US 2021017599 A1 US2021017599 A1 US 2021017599A1
Authority
US
United States
Prior art keywords
clonality
cancer
cdr3
immunotherapy
specific
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/857,005
Inventor
Haruo Sugiyama
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
International Institute of Cancer Immunology Inc
Original Assignee
International Institute of Cancer Immunology Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International Institute of Cancer Immunology Inc filed Critical International Institute of Cancer Immunology Inc
Priority to US16/857,005 priority Critical patent/US20210017599A1/en
Publication of US20210017599A1 publication Critical patent/US20210017599A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0635—B lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G01N33/56977—HLA or MHC typing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a polynucleotide contained in the gene for a cancer antigen-specific T-cell receptor, and the peptide encoded by the polynucleotide, and to cancer tests, e.g., diagnosis, prognosis, or treatment monitoring using the same, cancer therapy, and the like.
  • Cancer treatments include extirpation of cancer by surgical operation, radiotherapy, treatment with anti-cancer medication, and immunotherapy.
  • immunotherapy in particular has drawn attention in recent years because it is a treatment more selective and specific against cancer with least side effects.
  • attempts have been extensively made to treat cancer and leukemia by targeting WT1 protein, which is abundantly present in many types of cancer cells and leukemia cells.
  • TCR T-cell receptor
  • CTL cytotoxic T-cells
  • Non-Patent Document 1 Valmori D. et al., J. Immunol. 168: 4231-4240, 2002
  • Non-Patent Document 2 Dietrich P . et al., Cancer Res. 61: 2047-2054, 2001
  • Non-Patent Document 3 Coulie P . et al., Proc. Natl. Acad. Sci. U.S.A. 98: 10290-10295, 2001
  • Non-Patent Document 4 Godelaine D. et al. J. Immunol. 171: 4893-4897, 2003
  • Non-Patent Document 5 Mandruzzato S. et al., J. Immunol. 169: 4017-4024, 2002
  • An object of the present invention was to reveal the amino acid sequences of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) for WT1 protein, and the nucleotide sequences of the genes encoding them, in particular, the amino acid and nucleotide sequences of the CDR3 region of them, as well as to use those pieces of information in cancer tests (diagnosis, prognosis, treatment monitoring, or the like) and in cancer therapy.
  • TCRs T-cell receptors
  • CTLs cytotoxic T-cells
  • the present inventor has conducted extensive research and determined, for the first time, the nucleotide and amino acid sequences of CD3 of the V ⁇ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients, and have thereby completed the present invention.
  • TCRs V ⁇ chain of T-cell receptors
  • CTLs cytotoxic T-cells
  • the present invention provides the following:
  • the present invention also provides cancer therapy using lymphocytes from HLA-A*2402-positive patients, wherein a T-cell receptor gene containing a CDR3 polynucleotide is introduced into the lymphocytes.
  • the present invention provides an antibody raised against a CDR3 polypeptide and use thereof.
  • TCRs V ⁇ chain of T-cell receptors
  • CTLs cytotoxic T-cells
  • FIGS. 1A-1 through 1 ZZZ- 3 comprise a table that shows the nucleotide and amino acid sequences of CDR3 of the V ⁇ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients, which sequences have been identified in the present invention.
  • TCRs T-cell receptors
  • CTLs cytotoxic T-cells
  • FIGS. 1A-1 through 1 ZZZ- 3 the nucleotide sequences shown under “V-REGION...NI...D-REGION...(P)N2...J-REGION” correspond to SEQ ID NOs: 1-1696 as identified in the Sequence Listing, and the amino acid sequences shown under “CDR3 amino acid” correspond to SEQ ID NOs: 1697-3392 as identified in the Sequence Listing.
  • FIGS. 2A-1 through 2 VVVV- 3 comprise a table that shows the clonality of each clone of the WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients identified in the present invention.
  • CTLs cytotoxic T-cells
  • “clone #” indicates the clone numbers, the numbers to the left of the dot indicate the family numbers of V ⁇ chains, and the numbers to the right of the dot indicate the reference numbers;
  • HV is healthy volunteers, AML is patients with acute myelocytic leukemia, and MDS is patients with dysmyelopoietic syndrome.
  • the numbers added to these abbreviations are healthy volunteer numbers and patient numbers.
  • HV is healthy volunteers
  • AML is patients with acute myelocytic leukemia
  • MDS is patients with dysmyelopoietic syndrome.
  • the numbers added to these abbreviations are healthy volunteer numbers and patient numbers.
  • Res indicates patients who responded to treatment; and nonRes indicates patients who did not respond to treatment.
  • pre indicates pre-treatment, and 4 w, 8 w, 12 w, and 42 w indicate 4 weeks, 8 weeks, 12 weeks, and 42 weeks, respectively, after the treatment.
  • Phase 1 denotes the first phase of clinical trials.
  • PB(pre) indicates peripheral blood before treatment
  • BM(pre) indicates bone marrow before treatment.
  • the present inventor stained the peripheral lymphocytes from cancer patients with WT1 tetramer that comprises WT1 peptide/HLA-A*2402 complexes, and separated WT1 tetramer-positive cells one by one using a FACS; cDNAs were generated from each separated cell, and the nucleotide sequences encoding CDR3 contained in the V ⁇ chain of T-cell receptors (hereinafter may be referred to as “TCR”) of WT1-specific cytotoxic T-cells (CTLs, hereinafter may be referred to as “WT1-sepcific CTL”) were determined by applying PCR method ( FIGS. 1A-1 to 1 ZZZ- 3 ). From these results, the amino acid sequences of the CDR3 were also determined ( FIGS. 1A-1 to 1 ZZZ- 3 ; SEQ ID Nos.: 1697-3392). These sequences have been determined for the first time in the present invention.
  • the present invention provides a polynucleotide having the nucleotide sequence encoding CDR3 of the V ⁇ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) obtained from healthy individuals and HLA-A*2402-positive patients, wherein the polynucleotide is DNA having any of the CDR3 nucleotide sequences shown in SEQ ID Nos.: 1-1696, RNA complementary to the DNA, or a polynucleotide having a complementary sequence thereof.
  • TCRs V ⁇ chain of T-cell receptors
  • CTLs cytotoxic T-cells
  • CDR3 polynucleotides include, in addition to the DNAs comprising the nucleotide sequences shown in SEQ ID Nos.: 1-1696, DNAs comprising these sequences.
  • the CDR3 polynucleotides include, in addition to the RNAs complementary to the DNAs comprising the nucleotide sequences shown in SEQ ID Nos.: 1-1696, RNAs comprising these sequences.
  • the CDR3 polynucleotides include polynucleotides having the sequences of the DNAs or RNAs, and polynucleotides complementary to the RNAs.
  • the “CDR polynucleotides” include those having degenerate sequences encoding “CDR3 peptides.”
  • the present invention provides peptides having the amino acid sequences of CDR3 of the V ⁇ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs), which CDR3 amino acid sequences being shown in any of SEQ ID Nos.: 1697-3392.
  • these peptides are collectively referred to as “CDR3 peptides.”
  • the CDR3 peptides include, in addition to a peptide comprising any of the CDR3 amino acid sequences shown in SEQ ID Nos.: 1697-3392, peptides comprising these CDR3 amino acid sequences (such as, for example, V ⁇ chain peptides or a portion thereof).
  • CDR3 peptides consisting or comprising the amino acid sequence shown in SEQ ID Nos.: 1697-3392 in which one or a few, preferably one to three, one or two, or one amino acid is substituted, added, or deleted is included in the “CDR3 peptides.”
  • these peptides are required to have equivalent functions to the original peptide.
  • These CDR3 peptides are encoded by the above-mentioned CDR3 polynucleotides.
  • the CDR3 regions are the most diverse portions and are the most responsible parts for the specificity of antigen recognition.
  • the sequences of the CDR3 polynucleotides and CDR3 peptides of the present invention are considered peculiar to WT1-specific CTL in HLA-A*2402-positive patients. Therefore, provided that the polynucleotide encoding the CDR3 region of the gene for the TCR V ⁇ chain of a certain T-cell or the peptide corresponding to the CDR3 region have the sequence of the polynucleotide or peptide of the present invention, the T-cell is considered as specific for WT1.
  • the CDR3 polynucleotides and CDR3 peptides of the present invention may find use as markers for a wide variety of cancers, use in applications such as diagnosis of cancer, diagnosis of the susceptibility of patients to WT1 peptide immunotherapy, and tests for the responsiveness in the patients to WT1 peptide immunotherapy.
  • the CDR3 polynucleotides and CDR3 peptides of the present invention may be present in the lymphocytes of patients with any type of cancer as long as the cancer is generated from cells containing WT1.
  • WT1 is known as a cancer antigen in a variety of cancers and hematological malignancies.
  • the CDR3 polynucleotides and CDR3 peptides of the present invention may be applied to almost all the types of cancers including, but not limited to, for example, hematologic malignancies, such as acute myelocytic leukemia, acute lymphocytic leukemia, malignant lymphoma, multiple myeloma, chronic myelocytic leukemia, myelodysplastic syndrome, and recurrence after the transplantation of hematopoietic stem cells of the same type; solid cancers, such as tongue cancer, gingival cancer, mouth floor cancer, pharyngeal cancer, larynx cancer, salivary gland cancer, and thyroid cancer; thoracic cancers, such as breast cancer, lung cancer, and thymic cancer; gastrointestinal cancers, such as colon cancer, small intestine cancer, gastric cancer, pancreatic cancer, liver cancer, bile duct cancer, gastrointestinal endocrine tumor, and
  • CDR3 polynucleotides or CDR3 peptides When producing CDR3 polynucleotides or CDR3 peptides, conventional genetic engineering techniques and/or chemical synthetic procedures may be used. For example, CDR3 polynucleotides may be isolated from cells or chemically synthesized. CDR3 polynucleotides may also be amplified using a known method, such as PCR. Also, for example, a CDR3 polynucleotide (optionally amplified to an appropriate level using a known method) may be integrated into a suitable vector and introduced into suitable cells, or may be introduced into suitable cells by biolistic bombardment or electroporation.
  • the cells into which the CDR3 polynucleotide is introduced are cultured for expression, thereby obtaining the CDR3 polynucleotide or peptide.
  • Available vectors and cells, conditions for gene transfer, culture conditions, and methods for isolating genes and peptides are known to those skilled in the art and appropriately selected for use.
  • Chemical synthesis may be used to produce CDR3 polynucleotides or CDR3 peptides. Methods for such chemical synthesis are known, and the methods for chemical synthesis of genes include solid-phase DNA synthesis using amidite, and the 1-4 phosphonate method; the methods for chemical synthesis of peptides include the Fmoc method.
  • the present invention provides a method for diagnosing cancer in an HLA-A*2402-positive patient, the method including assessing the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides in a sample obtained from the patient before therapy, wherein if a multiplicity of clonality are present, the patient is determined to have a possibility of cancer.
  • clonality refers to the frequency of detection of cells having an identical nucleotide or amino acid sequence. To examine clonality, it is general to use a cell sorter that allows identification of individual cells.
  • the “patients” include both humans suspected to have cancer and those suffering from cancer.
  • the present inventor has found that it is possible to determine whether a patient develops cancer or not by examining the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides in the patient. As can be seen from FIGS.
  • the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides is 1 for almost all the clones, and 2 or 3 for rare clones; however, by contrast, all the cancer patients before therapy (AMLs (acute myelocytic leukemia) 1-4 and MDS (myelodysplastic syndrome) 1-5) have a multiplicity of clonality of the WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides without exception.
  • AMLs acute myelocytic leukemia
  • MDS myelodysplastic syndrome
  • the number of the clonality is larger and the types of such cells are more abundant than those of the healthy individuals.
  • the increases in clonality and in types of cells having a multiplicity of clonality in patients before therapy indicate a possibility that defense and attack against cancer cells has already been launched in the patients.
  • the possibility of cancer in a patient may be determined if a multiplicity of clonality is found in the WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides when examining a sample from a subject. Further, it is possible to determine that the larger the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides, or the more abundant the types of WT1-specific CTLs having a multiplicity of clonality, the higher the possibility of developing cancer is in the subject before therapy.
  • the determination method it is possible to determine that the higher the possibility of developing cancer in the patient before therapy is when the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides and having the clonality of 3 or more is larger, or the types of WT1-specific CTL having the clonality of 3 or more are more abundant.
  • the present invention provides a method for testing for the sensitivity of an HLA-A*2402-positive patient to WT1 peptide immunotherapy, the method including assessing the clonality and the number of types of WT1-specific CTL clones having any of the polynucleotides of claim 1 or any of the peptides of claim 2 in a sample obtained from the patient before therapy, wherein the patient is determined to have the sensitivity to WT1 peptide immunotherapy when the types of WT1-specific CTL clones with a multiplicity of clonality are more abundant in the patient than in non-responsive subjects.
  • WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides act against cancer cells in the patients.
  • the clones that already have a multiplicity of clonality before the therapy tend to further increase the clonality or maintain their clonality by WT1 peptide immunotherapy.
  • WT1 immunotherapy is more likely to be successful when there are clones of as many types as possible, which gives increased number and types of effective WT1-specific CTL clones as a whole. More strictly speaking, the sensitivity of a patient to WT1 peptide immunotherapy may be determined as being high when the types of WT1-specific CTL clones with a multiplicity of clonality are more abundant in the patient than in non-responsive subjects.
  • the present invention provides a method for monitoring WT1 peptide immunotherapy in an HLA-A*2402-positive patient, the method including assessing the clonality of WT1-specific CTL clones having any of the polynucleotides of claim 1 or any of the peptides of claim 2 in a sample obtained from the patient before and after the therapy, wherein the patient is determined to have responded to WT1 peptide immunotherapy when the clonality of any of the WT1-specific CTL clones increases after the therapy compared to before the therapy.
  • WT1-specific CTLs are observed in which the clonality increased (including the cases where the clonality increased from 0 to 1 or more) in the AML patients during the period of WT1 peptide immunotherapy.
  • the exemplary clones exhibiting such behavior include Clones #02.28, #05.034, #05.135, #05.219, #09.65, #12.04, #13.13, #27.016, and #28.83 from AML (Pt1), and Clones #02.27, #05.035, #05.141, #05.219, #06.009, #12.04, #12.20, #15.44, #20.068, and #27.032 from AML (Pt2).
  • the presence of clones that increases their clonality due to WT1 peptide immunotherapy indicates the responsiveness to the WT1 peptide immunotherapy.
  • increases in the clonality suggests that the WT1 peptide immunotherapy showed its effect for a certain period of time.
  • These increases in clonality may be transient or sustained. If the clonality of certain clones may increase only temporarily and then decrease, the clonality of other WT1-specific CTLs would increase to complement the effect. Considering the effect on cancer cells, a larger increase in the clonality is more desired.
  • the patient may be determined to have higher responsiveness to the WT1 peptide immunotherapy.
  • the number and properties of cancer cells may be examined using an appropriate method depending on the type and site of the cancer.
  • the time period between the before and after the therapy may be of any length. For example, it may be a few days, one week, two, three, or four weeks, or two or three months or more.
  • the means and methods for assessing clonality and determining the types of clones are known in the art, and those skilled in the art may conveniently carry out these operations.
  • a known sorting apparatus such as the FACSAria system
  • a method for gene amplification such as PCR (using, for example, a primer set selected from the sequences listed in Table 1), may be used.
  • WT1 peptide immunotherapy is also known. For example, it may be performed on HLA-A*2402-positive patients by administering HLA-A*2402-restricted WT1 peptide in the native form (having the amino acid sequence: CMTWNQMNL) or in the modified form (having the amino acid sequence: CYTWNQMNL) via, for example, a transdermal route.
  • a single dose is in the order of ⁇ g/kg body weight to mg/kg body weight, and it may be administered at an interval of one week to a few weeks.
  • the present invention provides a chip comprising the CDR3 polynucleotides or the polynucleotides complementary thereto; a chip comprising the CDR3 peptides; or a chip comprising antibodies against the CDR3 peptides.
  • the chips may be in the form of microchips, microarrays, and the like.
  • the production of the chips may be conducted according to conventional methods; for example, antibodies raised against the CDR3 polynucleotides or CDR3 peptides may be immobilized on a glass substrate.
  • the species of the CDR3 polynucleotides or the polynucleotides complementary thereto, the CDR3 peptides, or the antibodies against the CDR3 peptides that is immobilized on the chip may be one to all; preferably, all the species are immobilized for exhaustive analysis.
  • all the polynucleotides comprising the nucleotide sequences complementary to the nucleotide sequences shown in SEQ ID Nos.: 1-1696 may be immobilized on the chip; alternatively, for example, antibodies that specifically recognize and bind to all the peptides comprising the amino acid sequences shown in SEQ ID Nos.: 1697-3392 may be immobilized on the chip.
  • the CDR3 polynucleotides or the polynucleotides complementary thereto, the CDR3 peptides, or the antibodies against the CDR3 peptides may be placed at any position on the chip.
  • the chips may be used for, for example, diagnosis of cancer as described above.
  • the samples may be affected tissues, body fluids such as blood and lymphatic fluid, or mucosal membranes.
  • the samples are peripheral blood.
  • CDR3 polynucleotides are to be analyzed, the nucleic acids are extracted from the cells according to conventional methods, and a chip onto which all the species of polynucleotides comprising the nucleotide sequences complementary to the nucleotide sequences shown in SEQ ID Nos.: 1-1696 are immobilized may be used to examine the species and quantity of the hybridized DNA present in the sample.
  • a chip onto which antibodies that specifically recognize and bind to all the species of peptides comprising the amino acid sequences shown in SEQ ID Nos.: 1697-3392 are immobilized may be used to examine the species and quantity of the specifically bound peptides present in the sample.
  • the present invention provides an antibody that specifically recognizes and binds to a CDR3 peptide.
  • a CDR3 peptide Preferably, such an antibody specifically recognizes and binds to any of the amino acid sequences shown in SEQ ID Nos.: 1697-3392. Methods for preparing such an antibody are known to those skilled in the art.
  • DNAs in the sample or DNA sequences placed on the chip are labeled so that the presence or absence, or the amount of hybridization is indicated.
  • the presence or absence, or the species of CDR3 peptides in a sample may be identified by arraying antibodies for each of the CDR3 peptides of SEQ ID Nos.: 1697-3392 on a chip and testing for their specific binding to the CDR3 peptides present in the sample.
  • the peptides in the sample or the antibodies on the chip are labeled so that the presence or absence of the specific binding can be determined.
  • Labels capable of indicating the presence or absence and the amount of hybridization or specific binding include, for example, fluorescent labels, radioactive labels, enzyme labels, and chromophore labels.
  • fluorescent labels for example, fluorescent labels, radioactive labels, enzyme labels, and chromophore labels.
  • enzyme labels for example, enzyme labels, and chromophore labels.
  • chromophore labels One skilled in the art may conveniently select suitable labels.
  • the chips described above may be used to analyze a plurality of samples at the same time.
  • the CDR3 polynucleotides and CDR peptides of the present invention may be analyzed and identified using a known method, such as Southern blotting, Northern blotting, colony hybridization, and ELISA, as well as using the chips described above.
  • the CDR3 DNAs of the present invention have been identified using the primers shown in Examples, particularly, the primer sets shown in Table 1. Therefore, the present invention provides primers for amplifying CDR polynucleotides, which primers having the sequences selected from the sequences shown in SEQ ID Nos.: 3394-3421.
  • a primer set comprising the primers shown in SEQ ID Nos.: 3396-3420 may be used for amplification of a CDR3 polynucleotide.
  • the present invention also provides a kit for diagnosing cancer including means for detecting a WT1-specific CTL having a CDR3 polynucleotide or CDR3 peptide; a kit for testing for the sensitivity of a patient to WT1 peptide immunotherapy; or a kit for monitoring WT1 peptide immunotherapy.
  • the present invention further provides a device for cancer diagnosis including means for detecting a WT1-specific CTL having a CDR3 polynucleotide or CDR3 peptide; a device for testing for the sensitivity of a cancer patient to WT1 peptide immunotherapy; or a device for monitoring WT1 peptide immunotherapy.
  • a part for amplifying genes, such as a primer set, as described above, a chip as described above, or means for analyzing the information obtained from the chip may be used in the kit as a component or in the device.
  • the present invention relates to a lymphocyte from an HLA-A*2402-positive cancer patient, which lymphocyte incorporating a T-cell receptor gene containing a sequence of a CDR3 polynucleotide.
  • a lymphocyte is a peripheral blood lymphocyte into which the gene for the V ⁇ chain of TCR of WT1-specific CTLs comprising a CDR3 polynucleotide of the present invention, and a gene for the V ⁇ chain of TCR of WT1-specific CTLs.
  • a single species of the gene for the V ⁇ chain of TCR of WT1-specific CTLs may be used to obtain a plurality of types of peripheral blood lymphocytes, which are in turn introduced into patients.
  • a gene to be introduced may be integrated into a suitable vector and then introduced into suitable cells, or may be introduced into suitable cells by biolistic bombardment or electroporation. Other conditions for gene transfer and for cell culture may be appropriately selected by those skilled in the art.
  • the lymphocytes into which a gene has been introduced as described above may be cultured ex vivo to obtain a large amount of WT1-specific CTLs. Then, the CTLs obtained may be introduced into a cancer patient to kill tumor cells expressing WT1, thereby performing cancer therapy. Patients preferred for introduction of the CTLs obtained are the patients from whom the peripheral blood lymphocytes were obtained.
  • the cancer therapy described above may be combined with other cancer therapies including anti-cancer agents and radiotherapy.
  • the cancer therapy described above has a wide range of applications. They are exemplified above, but are not limited thereto.
  • the present invention provides an antibody against a CDR3 peptide and a method of use thereof.
  • Methods for preparing such an antibody are known in the art.
  • Such an antibody may be used to detect or identify a lymphocyte having the amino acid sequence of the CDR3 peptide of the present invention or an amino acid sequence containing the above sequence in its V ⁇ chain in the subject sample.
  • antibodies against peptides comprising the amino acid sequences of any of SEQ ID Nos.: 1697-3392 may be used to detect or identify cancer-specific lymphocytes.
  • These antibodies may also be used to carry out the methods of the present invention, for example, the method for diagnosing cancer.
  • Such an antibody may also be contacted with lymphocytes having the amino acid sequence of CDR3 of the present invention to activate them.
  • the lymphocytes thus activated may be used to treat cancer.
  • lymphocytes obtained from a cancer patient are activated and, if necessary, proliferated, and the cancer therapy is conducted by returning the lymphocytes to the patient.
  • Such an antibody may also be used to enrich the WT1-specific T-cells of interest.
  • such an antibody may be used to enrich the WT1-specific T-cells in a cancer patient, thereby assisting the cancer therapy.
  • the present invention provides a method for identifying the position and size of a solid cancer, the method including: administering the peripheral blood lymphocytes of the present invention described above after being labeled with a detectable label, and then examining the location and quantity of the label.
  • the label may be a known label, such as radioactive label, e.g. Tecnecium-99, and fluorescent label. Methods for labeling cells are also known. Detection of labels and quantification of signals are also known in the art; they can be performed using a radiation counter, by fluorescence assay, or by obtaining a tissue sample by biopsy.
  • Peripheral blood samples were obtained from five healthy volunteers (HV1 to HV5) and four HLA-A*2402-positive AML patients (AML1 to AML4). Bone marrow samples and peripheral blood samples were obtained from five HLA-A*2402-positive MDS patients (MDS1 to MDS5). More specifically, peripheral blood was obtained before treatment and at weeks 4, 8, 12, and 42 of treatment from ALM1. Peripheral blood was obtained before treatment and at weeks 4, 8, 12, and 42 of treatment from ALM2. Peripheral blood was obtained before treatment and at weeks 4 and 8 of treatment from ALMS. Peripheral blood was obtained before treatment and at week of treatment from ALM4. From MDS1, bone marrow and peripheral blood were obtained before treatment; and peripheral blood was obtained at weeks 4, 8, and 12 of treatment.
  • Peripheral blood and bone marrow before treatment were collected from MDS1 to MDS5.
  • the peripheral blood samples obtained were subjected to Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) density gradient centrifugation and peripheral blood mononuclear cells (PBMCs) were separated and stored frozen at ⁇ 170° C. until use.
  • the treatment on the patients was conducted using WT1 peptide immunotherapy.
  • the amino acid sequence of the WT1 peptide used in the treatment is Cys-Tyr-Thr-Trp-Asn-Gln-Met-Asn-Leu (SEQ ID No.: 3393). This peptide was administered by intradermal injection at an interval of two weeks.
  • single HLA-A*2402-WT1 235-243 tetramer + CD3 + CD8 + cells were obtained from the fraction of CD4 ⁇ CD14 ⁇ CD16 ⁇ CD19 ⁇ CD56 ⁇ cells and were defined as WT1-Tet + cells.
  • the cDNA reaction mixture contained the following components in lysis buffer (1 ⁇ cDNA buffer containing 0.5% Triton X-100): reverse transcriptase (SuperScript III, Invitrogen, Carlsbad, Calif.), 0.5 mM dNTPs (Invitrogen), 20 units (U) of Rnase inhibitor(Invitrogen), 100 ⁇ g/ml gelatin (Roche, Indianapolis, Ind.), 100 pg/ml tRNA (Roche), and a 200 nM primer (5′-CACCAGTGTGGCCTTTTG-3′ (SEQ ID No.: 3394)) specific for the TCR- ⁇ chain constant region. After the sorting, the samples were incubated for 90 minutes at 50° C. for cDNA synthesis, and then incubated for 5 minutes at 95° C. for terminating the reaction.
  • lysis buffer 1 ⁇ cDNA buffer containing 0.5% Triton X-100
  • reverse transcriptase SuperScript III, Invitrogen, Carlsbad, Calif
  • the reaction mixture contained 1> PCR buffer, 2 mM MgCl 2 , 0.25 mM dNTPs, 1.25 U DNA polymerase (Platinum Tag DNA Polymerase, Invitrogen), a 5 nM mixture of 24 different V ⁇ -family-specific forward primers (shown in Table 1), and 5 nM 3′-C ⁇ reverse primer (5′-GCTTCTGATGGCTCAAACACAGC-3′ (SEQ ID No.: 3395)).
  • the procedure of PCR was as follows: a pre-PCR heating step at 95° C. for 2 minutes, followed by 40 cycles of a denaturing step at 95° C. for 45 seconds, an annealing step at 57° C. for 45 seconds, and an extension step at 72° C. for 50 seconds.
  • PCR products were subjected to screening PCR.
  • One ⁇ l of each PCR product was placed in separate 8 tubes and 24 ⁇ l of a reaction mixture was added to each of the tubes.
  • the reaction mixture contained 1 ⁇ PCR buffer, 2 mM MgCl 2 . 0.2 mM dNTPs, 1.0 U of Platinum Tag DNA polymerase, one set of forward primers selected from the 8 screening sets S1 to S8, shown in Table 1, and 5′-C ⁇ reverse primer (5′-GGAACACGTTTTTCAGGTCCT-3′ (SEQ ID No.: 3421)) (150 nM each).
  • the procedure of PCR was as follows: a pre-PCR heating step at 95° C. for 2 minutes, followed by 35 cycles of a denaturing step at 94° C. for 45 seconds, an annealing step at 57° C. for 45 seconds, and an extension step at 72° C. for 40 seconds.
  • each screening PCR product was subjected to 2% agarose gel electrophoresis, followed by further PCR. This PCR was performed 35 cycles using 150 nM each of the VP-specific forward primers contained in the screening sets that were confirmed as positive. The positive reaction was verified by 2% agarose gel electrophoresis. A cell-free system was used as negative contrast, and three wells were prepared for the negative contrast in the same manner as above. The experiment was performed according to the same procedure.
  • TCR- ⁇ gene Amplified fragments of the TCR- ⁇ gene were purified using the PCR Purification Kit (Qiagen, Valencia, Calif.). Corresponding TCR VR-specific forward primers were used for sequencing.
  • the ABI PRIAM BigDye Terminator v 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, Calif., USA) was used for sequencing, and the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for analysis.
  • the sequence data on CDR3 were analyzed by comparing the sequences with those available from the website of the IMGT human TCR gene database (imgt.cines.fr).
  • FIGS. 1A-1 to 1 ZZZ- 3 The sequences of the gene for the V ⁇ chain, the J region sequences, D region sequences, N region sequences, CDR3 nucleotide sequences, and CDR3 amino acid sequences of WT1-specific CTLs derived from healthy individuals and cancer patients (AML1 to AML4 and MDS1 to MDSS) are shown in FIGS. 1A-1 to 1 ZZZ- 3 .
  • the clonality of each WT1-specific CTL is shown in FIGS. 2A-1 to 2 VVVV- 3 .
  • the CDR3 nucleotide sequences are shown in SEQ ID Nos.: 1-1696 (since clones #24.29 and #28.92 have the identical CDR3 nucleotide sequence, only clone #24.29 is shown in the Sequence Listing), and the CDR3 amino acid sequences are shown in SEQ ID Nos.: 1697-3392 (since clones #2.53 and #28.58 have the identical CDR3 amino acid sequence, and so do clones #24.29 and #28.92, only clones #2.53 and #24.19 are shown in the Sequence Listing).
  • AML1 and AML2 responded to the treatment, but AML3 and AML4 did not.
  • the response of the MDS patients to the treatment has not been determined.
  • the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides is 1 for almost all the clones, and 2 or 3 for rare clones; however, all the cancer patients before therapy (AMLs and MDSs) have a multiplicity of clonality of the WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides without exception. The number of the clonality was larger and the types of such cells were more abundant in the cancer patients than in the healthy individuals.
  • the AML patients who responded to WT1 peptide immunotherapy had a larger number of types of clones with a multiplicity of clonality than the healthy subjects and non-responsive patients before the therapy.
  • AML1 (responder) 10 types (clonality of 58 in total);
  • AML2 (responder) 12 types (clonality of 93 in total);
  • AML3 (non-responder) 9 types (clonality of 27 in total);
  • Healthy individuals HV1-5 had clones with a multiplicity of clonality in a range of 0 to 2 types.
  • the clones that already have a multiplicity of clonality before the therapy tend to further increase the clonality or maintain their clonality by WT1 peptide immunotherapy. It is also considered that WT1 peptide immunotherapy is more likely to be successful when there are clones of as many types as possible, which gives increased number and types of effective WT1-specific CTL clones as a whole.
  • WT1-specific CTLs were observed in which the clonality increased either temporarily or continuously (including the cases where the clonality increased from 0 to 1 or more) in the AML patients during the period of WT1 peptide immunotherapy.
  • the exemplary clones exhibiting such behavior include clones #02.28, #05.034, #05.135, #05.219, #09.65, #12.04, #13.13, #27.016, and #28.83 from AML (patient 1—a responder), and clones #02.27, #05.035, #05.141, #05.219, #06.009, #12.04, #12.20, #15.44, #20.068, and #27.032 from AML (patient 1—a non-responder).
  • patient 1 a responder
  • patient 1 a non-responder
  • the present invention may provide pharmaceutical compositions useful for anti-cancer therapy, cancer test kits or reagents, reagents for cancer research, and the like. Therefore, the present invention may find use in the fields of pharmaceuticals for cancer therapy, of cancer test kits or reagents, and of cancer research.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)

Abstract

Disclosed are: a nucleotide sequence and an amino acid sequence for CDR3 region of T-cell receptor (TCR) gene of WT1-specific cytotoxic T-cell (CTL) for WT1 protein; a method for the detection or treatment of cancer using the nucleotide sequence or the amino acid sequence; and a chip, a primer set, a kit, an apparatus and the like for use in the detection of cancer, each of which comprises the nucleotide sequence or the amino acid sequence.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • This is a divisional application of U.S. patent application Ser. No. 14/184,979, filed Feb. 20, 2014, which is a divisional application of U.S. application Ser. No. 12/529,701, which issued on Oct. 9, 2018, as U.S. Pat. No. 10,093,977, whose 35 U.S.C. § 371(c) date is Mar. 26, 2010 and which is a national stage of International Application No. PCT/JP2008/053469, filed Feb. 28, 2008, all of which claim priority to Japanese Patent Application No. 2007-054215, filed Mar. 5, 2007, and the entire disclosures of all of which are incorporated herein by reference.
    • SEQUENCE LISTING
  • The instant application contains a Sequence Listing which has been submitted electronically in ASCII format in U.S. patent application Ser. No. 14/184,979 and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Feb. 14, 2017, is named 05273 0120-02000 SL.tzt and is 582,545 bytes in size.
    • TECHNICAL FIELD
  • The present invention relates to a polynucleotide contained in the gene for a cancer antigen-specific T-cell receptor, and the peptide encoded by the polynucleotide, and to cancer tests, e.g., diagnosis, prognosis, or treatment monitoring using the same, cancer therapy, and the like.
    • BACKGROUND ART
  • Cancer treatments include extirpation of cancer by surgical operation, radiotherapy, treatment with anti-cancer medication, and immunotherapy. Among these treatments, immunotherapy in particular has drawn attention in recent years because it is a treatment more selective and specific against cancer with least side effects. Inter alia, attempts have been extensively made to treat cancer and leukemia by targeting WT1 protein, which is abundantly present in many types of cancer cells and leukemia cells. In order to study the mechanism of the WT1-targeted anti-cancer therapy and to further increase the effect of the therapy, it is necessary to identify the nucleotide sequences of the T-cell receptor (TCR) genes of WT1-specific cytotoxic T-cells (CTL) and the amino acid sequences of the receptor peptides encoded by the nucleotide sequences. However, up to the present date, little is known about the sequences of those receptor genes and the receptor peptides, let alone that no effective use of them has been described, although a number of researches have been conducted (see, e.g., non-patent documents 1-5).
  • Non-Patent Document 1: Valmori D. et al., J. Immunol. 168: 4231-4240, 2002
  • Non-Patent Document 2: Dietrich P . et al., Cancer Res. 61: 2047-2054, 2001
  • Non-Patent Document 3: Coulie P . et al., Proc. Natl. Acad. Sci. U.S.A. 98: 10290-10295, 2001
  • Non-Patent Document 4: Godelaine D. et al. J. Immunol. 171: 4893-4897, 2003
  • Non-Patent Document 5: Mandruzzato S. et al., J. Immunol. 169: 4017-4024, 2002
    • SUMMARY OF THE INVENTION
  • An object of the present invention was to reveal the amino acid sequences of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) for WT1 protein, and the nucleotide sequences of the genes encoding them, in particular, the amino acid and nucleotide sequences of the CDR3 region of them, as well as to use those pieces of information in cancer tests (diagnosis, prognosis, treatment monitoring, or the like) and in cancer therapy.
    • DISCLOSURE OF INVENTION Problems to be Solved by the Invention
  • To accomplish the above object, the present inventor has conducted extensive research and determined, for the first time, the nucleotide and amino acid sequences of CD3 of the Vβ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients, and have thereby completed the present invention.
  • Thus, the present invention provides the following:
    • (1) A polynucleotide having a nucleotide sequence encoding CDR3 of a Vβ chain of a T-cell receptor (TCR) of a WT1-specific cytotoxic T-cell (CTL), said polynucleotide having DNA having any of the CDR3 nucleotide sequences shown in SEQ ID Nos.: 1-1696, RNA complementary to the DNA, or a polynucleotide having a complementary sequence thereof;
    • (2) The polynucleotide according to (1), wherein said polynucleotide consists of a DNA comprising any of the CDR3 nucleotide sequences shown in SEQ ID Nos.: 1-1696, or an RNA complementary thereto, or complementary sequences thereof;
    • (3) A peptide having an amino acid sequence of CDR3 of a Vβ chain of a T-cell receptor (TCR) of a WT1-specific cytotoxic T-cell (CTL), said peptide having any of the amino acid sequences of CDR3 shown in SEQ ID Nos.: 1697-3392;
    • (4) The peptide according to (3) consisting of any of the amino acid sequences of CDR3 shown in SEQ ID Nos.: 1697-3392;
    • (5) Use of the polynucleotide of (1) or (2), or the peptide of (3) or (4) as a cancer marker;
    • (6) A method for diagnosing cancer in an HLA-A*2402-positive patient, which comprises assessing the clonality of a WT1-specific CTL having any of the polynucleotides of (1) or (2), or any of the peptides of (3) or (4) in a sample obtained from the patient before therapy, wherein when a WT1-specific CTL having a multiplicity of clonality is present, the patient is determined to have a possibility of having cancer;
    • (7) The method according to (6), wherein a higher possibility of developing cancer in the patient before therapy is determined when the clonality of a WT1-specific CTL having any of the CDR3 polynucleotides or any of the CDR3 peptides and having the clonality of 3 or more is higher, or when the types of a WT1-specific CTL having the clonality of 3 or more are more abundant;
    • (8) A method for testing for sensitivity of an HLA-A*2402-positive patient to WT1 peptide immunotherapy, which comprises assessing the clonality and the number of types of WT1-specific CTLs having any of the polynucleotides of (1) or (2) or any of the peptides of (3) or (4) in a sample obtained from the patient before therapy, wherein the patient is determined to have sensitivity to WT1 peptide immunotherapy when the types of WT1-specific CTLs with a multiplicity of clonality are more abundant in the patient than in a subject non-responsive to the therapy;
    • (9) The method according to (8), wherein a patient is determined to have higher sensitivity to WT1 peptide immunotherapy when the types of WT1-specific CTL clones with a multiplicity of clonality are more abundant, or the clonality is larger in the patient before the therapy;
    • (10) A method for monitoring WT1 peptide immunotherapy in an HLA-A*2402-positive patient, which comprises assessing the clonality of WT1-specific CTL clones having any of the polynucleotides of (1) or (2) or any of the peptides of (3) or (4) in a sample obtained from the patient before and after the therapy, wherein the patient is determined to have responded to WT1 peptide immunotherapy when the clonality of any of the WT1-specific CTL clones increases after the therapy compared to before the therapy;
    • (11) The method according to (10), wherein a patient is determined to have higher responsiveness to WT1 peptide immunotherapy when the larger becomes the increase rate in the clonality, or the more abundant become the types of clones with increased clonality after the WT1 peptide immunotherapy;
    • (12) An antibody against the peptide of (3) or (4);
    • (13) A chip comprising the polynucleotide of (1) or (2), the peptide of (3) or (4), or the antibody of (12);
    • (14) A primer for amplifying a CDR3 polynucleotide, which has a sequence selected from the sequences shown in SEQ ID Nos.: 3394-3421;
    • (15) A kit for diagnosing cancer, a kit for testing for sensitivity of a patient to WT1 peptide immunotherapy, or a kit for monitoring WT1 peptide immunotherapy, comprising means for detecting a WT1-specific CTL having the polynucleotide of (1) or (2) or the peptide of (3) or (4);
    • (16) A device for cancer diagnosis, a device for testing for sensitivity of a patient to WT1 peptide immunotherapy, or a device for monitoring WT1 peptide immunotherapy, comprising means for detecting a WT1-specific CTL having the polynucleotide of (1) or (2) or the peptide of (3) or (4);
    • (17) The kit according to (15), comprising the chip of (13) or the primer of (14);
    • (18) The device according to (16), wherein the chip of (13) or the primer of (14) is used in the device;
    • (19) A lymphocyte of an HLA-A*2402-positive cancer patient, into which a T-cell receptor gene comprising a sequence of the polynucleotide of (1) or (2) is introduced.
  • The present invention also provides cancer therapy using lymphocytes from HLA-A*2402-positive patients, wherein a T-cell receptor gene containing a CDR3 polynucleotide is introduced into the lymphocytes.
  • Further, the present invention provides an antibody raised against a CDR3 polypeptide and use thereof.
    • Effect of the Invention
  • By virtue of the present invention, the nucleotide sequences contained in the gene for the Vβ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs), and the amino acid sequences of peptides encoded by them, in particular, the nucleotide and amino acid sequences of CDR3 have been revealed, and extensive cancer tests (diagnosis, prognosis, treatment monitoring, or the like), cancer therapy, and the like are enabled using these polynucleotides and peptides.
    • BRIEF DESCRIPTION OF DRAWINGS
  • FIGS. 1A-1 through 1ZZZ-3 comprise a table that shows the nucleotide and amino acid sequences of CDR3 of the Vβ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients, which sequences have been identified in the present invention. In the figures, “clone #” indicates the clone numbers, the numbers to the left of the dot indicate the family numbers of Vβ chains, and the numbers to the right of the dot indicate the reference numbers. V name, J name, and D name indicate the details of the V region, J region, and D region, respectively. The letters “V-REGION...N1...D-REGION...(P)N2...J-REGION” on the nucleotide sequence indicate the origins of each portion of the nucleotide sequence.
  • In FIGS. 1A-1 through 1ZZZ-3, the nucleotide sequences shown under “V-REGION...NI...D-REGION...(P)N2...J-REGION” correspond to SEQ ID NOs: 1-1696 as identified in the Sequence Listing, and the amino acid sequences shown under “CDR3 amino acid” correspond to SEQ ID NOs: 1697-3392 as identified in the Sequence Listing.
  • FIGS. 2A-1 through 2VVVV-3 comprise a table that shows the clonality of each clone of the WT1-specific cytotoxic T-cells (CTLs) from healthy individuals and HLA-A*2402-positive patients identified in the present invention. In the figure, “clone #” indicates the clone numbers, the numbers to the left of the dot indicate the family numbers of Vβ chains, and the numbers to the right of the dot indicate the reference numbers; HV is healthy volunteers, AML is patients with acute myelocytic leukemia, and MDS is patients with dysmyelopoietic syndrome. The numbers added to these abbreviations are healthy volunteer numbers and patient numbers. HV is healthy volunteers, AML is patients with acute myelocytic leukemia, and MDS is patients with dysmyelopoietic syndrome. The numbers added to these abbreviations are healthy volunteer numbers and patient numbers. Res indicates patients who responded to treatment; and nonRes indicates patients who did not respond to treatment. Further, pre indicates pre-treatment, and 4 w, 8 w, 12 w, and 42 w indicate 4 weeks, 8 weeks, 12 weeks, and 42 weeks, respectively, after the treatment. Phase 1 denotes the first phase of clinical trials. PB(pre) indicates peripheral blood before treatment; and BM(pre) indicates bone marrow before treatment.
    •  BEST MODE FOR CARRYING OUT THE INVENTION
  • The present inventor stained the peripheral lymphocytes from cancer patients with WT1 tetramer that comprises WT1 peptide/HLA-A*2402 complexes, and separated WT1 tetramer-positive cells one by one using a FACS; cDNAs were generated from each separated cell, and the nucleotide sequences encoding CDR3 contained in the Vβ chain of T-cell receptors (hereinafter may be referred to as “TCR”) of WT1-specific cytotoxic T-cells (CTLs, hereinafter may be referred to as “WT1-sepcific CTL”) were determined by applying PCR method (FIGS. 1A-1 to 1ZZZ-3). From these results, the amino acid sequences of the CDR3 were also determined (FIGS. 1A-1 to 1ZZZ-3; SEQ ID Nos.: 1697-3392). These sequences have been determined for the first time in the present invention.
  • Thus, in a first aspect, the present invention provides a polynucleotide having the nucleotide sequence encoding CDR3 of the Vβ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs) obtained from healthy individuals and HLA-A*2402-positive patients, wherein the polynucleotide is DNA having any of the CDR3 nucleotide sequences shown in SEQ ID Nos.: 1-1696, RNA complementary to the DNA, or a polynucleotide having a complementary sequence thereof. As used herein, these DNA and RNA molecules and the complementary polynucleotides thereof are collectively referred to as “CDR3 polynucleotides.” For example, the CDR3 polynucleotides include, in addition to the DNAs comprising the nucleotide sequences shown in SEQ ID Nos.: 1-1696, DNAs comprising these sequences. Also, for example, the CDR3 polynucleotides include, in addition to the RNAs complementary to the DNAs comprising the nucleotide sequences shown in SEQ ID Nos.: 1-1696, RNAs comprising these sequences. Further, for example, the CDR3 polynucleotides include polynucleotides having the sequences of the DNAs or RNAs, and polynucleotides complementary to the RNAs. The “CDR polynucleotides” include those having degenerate sequences encoding “CDR3 peptides.”
  • In another aspect, the present invention provides peptides having the amino acid sequences of CDR3 of the Vβ chain of T-cell receptors (TCRs) of WT1-specific cytotoxic T-cells (CTLs), which CDR3 amino acid sequences being shown in any of SEQ ID Nos.: 1697-3392. As used herein, these peptides are collectively referred to as “CDR3 peptides.” For example, the CDR3 peptides include, in addition to a peptide comprising any of the CDR3 amino acid sequences shown in SEQ ID Nos.: 1697-3392, peptides comprising these CDR3 amino acid sequences (such as, for example, Vβ chain peptides or a portion thereof). In addition, a peptide consisting or comprising the amino acid sequence shown in SEQ ID Nos.: 1697-3392 in which one or a few, preferably one to three, one or two, or one amino acid is substituted, added, or deleted is included in the “CDR3 peptides.” However, these peptides are required to have equivalent functions to the original peptide. These CDR3 peptides are encoded by the above-mentioned CDR3 polynucleotides.
  • The CDR3 regions are the most diverse portions and are the most responsible parts for the specificity of antigen recognition. Thus, the sequences of the CDR3 polynucleotides and CDR3 peptides of the present invention are considered peculiar to WT1-specific CTL in HLA-A*2402-positive patients. Therefore, provided that the polynucleotide encoding the CDR3 region of the gene for the TCR Vβ chain of a certain T-cell or the peptide corresponding to the CDR3 region have the sequence of the polynucleotide or peptide of the present invention, the T-cell is considered as specific for WT1. Accordingly, the CDR3 polynucleotides and CDR3 peptides of the present invention may find use as markers for a wide variety of cancers, use in applications such as diagnosis of cancer, diagnosis of the susceptibility of patients to WT1 peptide immunotherapy, and tests for the responsiveness in the patients to WT1 peptide immunotherapy.
  • The CDR3 polynucleotides and CDR3 peptides of the present invention may be present in the lymphocytes of patients with any type of cancer as long as the cancer is generated from cells containing WT1. WT1 is known as a cancer antigen in a variety of cancers and hematological malignancies. Thus, the CDR3 polynucleotides and CDR3 peptides of the present invention, as well as the methods of the present invention described below, may be applied to almost all the types of cancers including, but not limited to, for example, hematologic malignancies, such as acute myelocytic leukemia, acute lymphocytic leukemia, malignant lymphoma, multiple myeloma, chronic myelocytic leukemia, myelodysplastic syndrome, and recurrence after the transplantation of hematopoietic stem cells of the same type; solid cancers, such as tongue cancer, gingival cancer, mouth floor cancer, pharyngeal cancer, larynx cancer, salivary gland cancer, and thyroid cancer; thoracic cancers, such as breast cancer, lung cancer, and thymic cancer; gastrointestinal cancers, such as colon cancer, small intestine cancer, gastric cancer, pancreatic cancer, liver cancer, bile duct cancer, gastrointestinal endocrine tumor, and gastrointestinal carcinoid; cancers of urinary and genital tract, such as renal cancer, urothelial cancer, germinoma, Wilms' tumor, prostate cancer, uterine body cancer, cervical cancer, uterine sarcoma, and ovarian malignancy; musculoskeletal malignancies, such as primary malignancy of bone (e.g., osteosarcoma and Ewing's sarcoma) and soft tissue sarcoma; and other cancers, such as skin cancer, neuroblastoma, malignant glioma (glioblastoma), primary malignant lymphoma of the central nervous system, medulloblastoma, and PNET.
  • When producing CDR3 polynucleotides or CDR3 peptides, conventional genetic engineering techniques and/or chemical synthetic procedures may be used. For example, CDR3 polynucleotides may be isolated from cells or chemically synthesized. CDR3 polynucleotides may also be amplified using a known method, such as PCR. Also, for example, a CDR3 polynucleotide (optionally amplified to an appropriate level using a known method) may be integrated into a suitable vector and introduced into suitable cells, or may be introduced into suitable cells by biolistic bombardment or electroporation. Then the cells into which the CDR3 polynucleotide is introduced are cultured for expression, thereby obtaining the CDR3 polynucleotide or peptide. Available vectors and cells, conditions for gene transfer, culture conditions, and methods for isolating genes and peptides are known to those skilled in the art and appropriately selected for use. Chemical synthesis may be used to produce CDR3 polynucleotides or CDR3 peptides. Methods for such chemical synthesis are known, and the methods for chemical synthesis of genes include solid-phase DNA synthesis using amidite, and the 1-4 phosphonate method; the methods for chemical synthesis of peptides include the Fmoc method.
  • Thus, in a further aspect, the present invention provides a method for diagnosing cancer in an HLA-A*2402-positive patient, the method including assessing the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides in a sample obtained from the patient before therapy, wherein if a multiplicity of clonality are present, the patient is determined to have a possibility of cancer. As used herein, the term “clonality” refers to the frequency of detection of cells having an identical nucleotide or amino acid sequence. To examine clonality, it is general to use a cell sorter that allows identification of individual cells. The “patients” include both humans suspected to have cancer and those suffering from cancer.
  • The present inventor has found that it is possible to determine whether a patient develops cancer or not by examining the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides in the patient. As can be seen from FIGS. 2A-1 to 2VVVV-3, in the healthy individuals (HV1 to HV4), the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides is 1 for almost all the clones, and 2 or 3 for rare clones; however, by contrast, all the cancer patients before therapy (AMLs (acute myelocytic leukemia) 1-4 and MDS (myelodysplastic syndrome) 1-5) have a multiplicity of clonality of the WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides without exception. The number of the clonality is larger and the types of such cells are more abundant than those of the healthy individuals. The increases in clonality and in types of cells having a multiplicity of clonality in patients before therapy indicate a possibility that defense and attack against cancer cells has already been launched in the patients.
  • In view of these results, the possibility of cancer in a patient may be determined if a multiplicity of clonality is found in the WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides when examining a sample from a subject. Further, it is possible to determine that the larger the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides, or the more abundant the types of WT1-specific CTLs having a multiplicity of clonality, the higher the possibility of developing cancer is in the subject before therapy. Also, in the determination method, it is possible to determine that the higher the possibility of developing cancer in the patient before therapy is when the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides and having the clonality of 3 or more is larger, or the types of WT1-specific CTL having the clonality of 3 or more are more abundant.
  • In a further aspect, the present invention provides a method for testing for the sensitivity of an HLA-A*2402-positive patient to WT1 peptide immunotherapy, the method including assessing the clonality and the number of types of WT1-specific CTL clones having any of the polynucleotides of claim 1 or any of the peptides of claim 2 in a sample obtained from the patient before therapy, wherein the patient is determined to have the sensitivity to WT1 peptide immunotherapy when the types of WT1-specific CTL clones with a multiplicity of clonality are more abundant in the patient than in non-responsive subjects.
  • WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides act against cancer cells in the patients. In this process, the clones that already have a multiplicity of clonality before the therapy tend to further increase the clonality or maintain their clonality by WT1 peptide immunotherapy. It is also considered that WT1 immunotherapy is more likely to be successful when there are clones of as many types as possible, which gives increased number and types of effective WT1-specific CTL clones as a whole. More strictly speaking, the sensitivity of a patient to WT1 peptide immunotherapy may be determined as being high when the types of WT1-specific CTL clones with a multiplicity of clonality are more abundant in the patient than in non-responsive subjects.
  • As can be seen from FIGS. 2A-1 to 2VVVV-3, the AML patients who responded to WT1 peptide immunotherapy had a larger number of the types of clones with a multiplicity of clonality than the healthy subjects and non-responsive patients before the therapy. AML1 (responder): 10 types (clonality of 58 in total); AML2 (responder): 12 types (clonality of 93 in total); AML3 (non-responder): 9 types (clonality of 27 in total); and AML4 (non-responder): 3 types (clonality of 10 in total). Healthy individuals HV1-5 had clones with a multiplicity of clonality in a range of 0 to 2 types.
  • In a further aspect, the present invention provides a method for monitoring WT1 peptide immunotherapy in an HLA-A*2402-positive patient, the method including assessing the clonality of WT1-specific CTL clones having any of the polynucleotides of claim 1 or any of the peptides of claim 2 in a sample obtained from the patient before and after the therapy, wherein the patient is determined to have responded to WT1 peptide immunotherapy when the clonality of any of the WT1-specific CTL clones increases after the therapy compared to before the therapy.
  • As can be seen from FIGS. 2A-1 to 2VVVV-3, WT1-specific CTLs are observed in which the clonality increased (including the cases where the clonality increased from 0 to 1 or more) in the AML patients during the period of WT1 peptide immunotherapy. The exemplary clones exhibiting such behavior include Clones #02.28, #05.034, #05.135, #05.219, #09.65, #12.04, #13.13, #27.016, and #28.83 from AML (Pt1), and Clones #02.27, #05.035, #05.141, #05.219, #06.009, #12.04, #12.20, #15.44, #20.068, and #27.032 from AML (Pt2). The presence of clones that increases their clonality due to WT1 peptide immunotherapy indicates the responsiveness to the WT1 peptide immunotherapy. In other words, increases in the clonality suggests that the WT1 peptide immunotherapy showed its effect for a certain period of time. These increases in clonality may be transient or sustained. If the clonality of certain clones may increase only temporarily and then decrease, the clonality of other WT1-specific CTLs would increase to complement the effect. Considering the effect on cancer cells, a larger increase in the clonality is more desired. Therefore, the larger becomes the increase in the clonality or the more abundant become the types of clones with increased clonality after the WT1 peptide immunotherapy, the patient may be determined to have higher responsiveness to the WT1 peptide immunotherapy. The number and properties of cancer cells may be examined using an appropriate method depending on the type and site of the cancer.
  • In the method for monitoring therapy, although the clonality is compared before and after WT1 peptide immunotherapy, the time period between the before and after the therapy may be of any length. For example, it may be a few days, one week, two, three, or four weeks, or two or three months or more.
  • In the methods of the present invention described above, the means and methods for assessing clonality and determining the types of clones (i.e., determining the amino acid sequences of CDR3 peptides or the nucleotide sequences encoding the same) are known in the art, and those skilled in the art may conveniently carry out these operations. For example, as shown in Examples in the specification, a known sorting apparatus, such as the FACSAria system, and a method for gene amplification, such as PCR (using, for example, a primer set selected from the sequences listed in Table 1), may be used. In order to analyze the CDR3 polynucleotides or CDR peptides of the present invention in a stricter or more definite manner, one has only to confirm whether the nucleotide sequences of CDR3, IMGT, and the J and D regions in the Vβ chain gene are shown in FIGS. 1A-1 to 1ZZZ-3. Such confirmation is well within the ordinary skill of the art.
  • WT1 peptide immunotherapy is also known. For example, it may be performed on HLA-A*2402-positive patients by administering HLA-A*2402-restricted WT1 peptide in the native form (having the amino acid sequence: CMTWNQMNL) or in the modified form (having the amino acid sequence: CYTWNQMNL) via, for example, a transdermal route. In general, a single dose is in the order of μg/kg body weight to mg/kg body weight, and it may be administered at an interval of one week to a few weeks.
  • In a further aspect, the present invention provides a chip comprising the CDR3 polynucleotides or the polynucleotides complementary thereto; a chip comprising the CDR3 peptides; or a chip comprising antibodies against the CDR3 peptides. The chips may be in the form of microchips, microarrays, and the like. The production of the chips may be conducted according to conventional methods; for example, antibodies raised against the CDR3 polynucleotides or CDR3 peptides may be immobilized on a glass substrate. The species of the CDR3 polynucleotides or the polynucleotides complementary thereto, the CDR3 peptides, or the antibodies against the CDR3 peptides that is immobilized on the chip may be one to all; preferably, all the species are immobilized for exhaustive analysis. For example, all the polynucleotides comprising the nucleotide sequences complementary to the nucleotide sequences shown in SEQ ID Nos.: 1-1696 may be immobilized on the chip; alternatively, for example, antibodies that specifically recognize and bind to all the peptides comprising the amino acid sequences shown in SEQ ID Nos.: 1697-3392 may be immobilized on the chip. The CDR3 polynucleotides or the polynucleotides complementary thereto, the CDR3 peptides, or the antibodies against the CDR3 peptides may be placed at any position on the chip.
  • The chips may be used for, for example, diagnosis of cancer as described above. The samples may be affected tissues, body fluids such as blood and lymphatic fluid, or mucosal membranes. Preferably, the samples are peripheral blood. For example, when CDR3 polynucleotides are to be analyzed, the nucleic acids are extracted from the cells according to conventional methods, and a chip onto which all the species of polynucleotides comprising the nucleotide sequences complementary to the nucleotide sequences shown in SEQ ID Nos.: 1-1696 are immobilized may be used to examine the species and quantity of the hybridized DNA present in the sample. Also, for example, when CDR3 peptides are to be analyzed, a chip onto which antibodies that specifically recognize and bind to all the species of peptides comprising the amino acid sequences shown in SEQ ID Nos.: 1697-3392 are immobilized may be used to examine the species and quantity of the specifically bound peptides present in the sample.
  • In this regard, the present invention provides an antibody that specifically recognizes and binds to a CDR3 peptide. Preferably, such an antibody specifically recognizes and binds to any of the amino acid sequences shown in SEQ ID Nos.: 1697-3392. Methods for preparing such an antibody are known to those skilled in the art.
  • Typically, DNAs in the sample or DNA sequences placed on the chip are labeled so that the presence or absence, or the amount of hybridization is indicated. For example, the presence or absence, or the species of CDR3 peptides in a sample may be identified by arraying antibodies for each of the CDR3 peptides of SEQ ID Nos.: 1697-3392 on a chip and testing for their specific binding to the CDR3 peptides present in the sample. Typically, the peptides in the sample or the antibodies on the chip are labeled so that the presence or absence of the specific binding can be determined. Labels capable of indicating the presence or absence and the amount of hybridization or specific binding are known and include, for example, fluorescent labels, radioactive labels, enzyme labels, and chromophore labels. One skilled in the art may conveniently select suitable labels. The chips described above may be used to analyze a plurality of samples at the same time.
  • The CDR3 polynucleotides and CDR peptides of the present invention may be analyzed and identified using a known method, such as Southern blotting, Northern blotting, colony hybridization, and ELISA, as well as using the chips described above.
  • As described above, the CDR3 DNAs of the present invention have been identified using the primers shown in Examples, particularly, the primer sets shown in Table 1. Therefore, the present invention provides primers for amplifying CDR polynucleotides, which primers having the sequences selected from the sequences shown in SEQ ID Nos.: 3394-3421. For example, a primer set comprising the primers shown in SEQ ID Nos.: 3396-3420 may be used for amplification of a CDR3 polynucleotide.
  • The present invention also provides a kit for diagnosing cancer including means for detecting a WT1-specific CTL having a CDR3 polynucleotide or CDR3 peptide; a kit for testing for the sensitivity of a patient to WT1 peptide immunotherapy; or a kit for monitoring WT1 peptide immunotherapy. The present invention further provides a device for cancer diagnosis including means for detecting a WT1-specific CTL having a CDR3 polynucleotide or CDR3 peptide; a device for testing for the sensitivity of a cancer patient to WT1 peptide immunotherapy; or a device for monitoring WT1 peptide immunotherapy. A part for amplifying genes, such as a primer set, as described above, a chip as described above, or means for analyzing the information obtained from the chip may be used in the kit as a component or in the device.
  • In still another aspect, the present invention relates to a lymphocyte from an HLA-A*2402-positive cancer patient, which lymphocyte incorporating a T-cell receptor gene containing a sequence of a CDR3 polynucleotide. Preferably, such a lymphocyte is a peripheral blood lymphocyte into which the gene for the Vβ chain of TCR of WT1-specific CTLs comprising a CDR3 polynucleotide of the present invention, and a gene for the Vα chain of TCR of WT1-specific CTLs. In preparation of such a peripheral blood lymphocyte, a single species of the gene for the Vβ chain of TCR of WT1-specific CTLs may be used to obtain a plurality of types of peripheral blood lymphocytes, which are in turn introduced into patients. However, in view of improving the therapeutic effect, it is preferred to use a plurality of species of the gene for the Vβ chain of TCR of WT1-specific CTLs to obtain a plurality of types of peripheral blood lymphocytes, which are in turn introduced into patients. Alternatively, it is also preferred to select the nucleotide sequences of a suitable gene to be introduced depending on individual circumstances, because the therapeutically effective nucleotide sequences in the gene may differ depending on patients and cancer types.
  • Methods for preparing a gene to be introduced and for introducing the gene into peripheral blood lymphocytes are known in the art. For example, a gene to be introduced may be integrated into a suitable vector and then introduced into suitable cells, or may be introduced into suitable cells by biolistic bombardment or electroporation. Other conditions for gene transfer and for cell culture may be appropriately selected by those skilled in the art.
  • The lymphocytes into which a gene has been introduced as described above may be cultured ex vivo to obtain a large amount of WT1-specific CTLs. Then, the CTLs obtained may be introduced into a cancer patient to kill tumor cells expressing WT1, thereby performing cancer therapy. Patients preferred for introduction of the CTLs obtained are the patients from whom the peripheral blood lymphocytes were obtained.
  • The cancer therapy described above may be combined with other cancer therapies including anti-cancer agents and radiotherapy. The cancer therapy described above has a wide range of applications. They are exemplified above, but are not limited thereto.
  • In still another aspect, the present invention provides an antibody against a CDR3 peptide and a method of use thereof. Methods for preparing such an antibody are known in the art. Such an antibody may be used to detect or identify a lymphocyte having the amino acid sequence of the CDR3 peptide of the present invention or an amino acid sequence containing the above sequence in its Vβ chain in the subject sample. For example, antibodies against peptides comprising the amino acid sequences of any of SEQ ID Nos.: 1697-3392 may be used to detect or identify cancer-specific lymphocytes. These antibodies may also be used to carry out the methods of the present invention, for example, the method for diagnosing cancer.
  • Such an antibody may also be contacted with lymphocytes having the amino acid sequence of CDR3 of the present invention to activate them. The lymphocytes thus activated may be used to treat cancer. Preferably, lymphocytes obtained from a cancer patient are activated and, if necessary, proliferated, and the cancer therapy is conducted by returning the lymphocytes to the patient. Such an antibody may also be used to enrich the WT1-specific T-cells of interest. For example, such an antibody may be used to enrich the WT1-specific T-cells in a cancer patient, thereby assisting the cancer therapy.
  • In a further aspect, the present invention provides a method for identifying the position and size of a solid cancer, the method including: administering the peripheral blood lymphocytes of the present invention described above after being labeled with a detectable label, and then examining the location and quantity of the label. The label may be a known label, such as radioactive label, e.g. Tecnecium-99, and fluorescent label. Methods for labeling cells are also known. Detection of labels and quantification of signals are also known in the art; they can be performed using a radiation counter, by fluorescence assay, or by obtaining a tissue sample by biopsy.
  • The present invention is illustrated in greater detail below with reference to Examples, but it should be understood that the present invention is not construed as being limited thereto.
    • EXAMPLE 1
  • A. Experimental Methods and Materials Used
  • (1) Cells
  • Peripheral blood samples were obtained from five healthy volunteers (HV1 to HV5) and four HLA-A*2402-positive AML patients (AML1 to AML4). Bone marrow samples and peripheral blood samples were obtained from five HLA-A*2402-positive MDS patients (MDS1 to MDS5). More specifically, peripheral blood was obtained before treatment and at weeks 4, 8, 12, and 42 of treatment from ALM1. Peripheral blood was obtained before treatment and at weeks 4, 8, 12, and 42 of treatment from ALM2. Peripheral blood was obtained before treatment and at weeks 4 and 8 of treatment from ALMS. Peripheral blood was obtained before treatment and at week of treatment from ALM4. From MDS1, bone marrow and peripheral blood were obtained before treatment; and peripheral blood was obtained at weeks 4, 8, and 12 of treatment. Peripheral blood and bone marrow before treatment were collected from MDS1 to MDS5. The peripheral blood samples obtained were subjected to Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) density gradient centrifugation and peripheral blood mononuclear cells (PBMCs) were separated and stored frozen at −170° C. until use. The treatment on the patients was conducted using WT1 peptide immunotherapy. The amino acid sequence of the WT1 peptide used in the treatment is Cys-Tyr-Thr-Trp-Asn-Gln-Met-Asn-Leu (SEQ ID No.: 3393). This peptide was administered by intradermal injection at an interval of two weeks.
  • (2) Flow cytometric analysis and sorting
  • Initially, 2×106 PBMCs per sample were stained with PE-conjugated HLA-A*2402-WT1 235-243 tetramers (MBL, Tokyo, Japan) in FACS buffer (PBS containing 2% fetal bovine serum) for 30 minutes at 37° C. Subsequently, they were stained with monoclonal antibodies labeled with five different fluorescent dyes as described below for 25 minutes on ice in dark: FITC-labeled anti-CD4, CD14, CD16, CD19, and CD56, anti-CD3-PerCP, anti-CD8-APC-Cy7 (BD Bioscience, San Jose, Calif.), anti-CD45RA-APC, and anti-CCR7-PE-Cy7 (BD Pharmingen, San Diego, Calif.). The stained cells were washed twice in FACS buffer. Sorting was performed using the FACSAria system (BD Biosciences) and data analysis was performed using the FACSDiva software (BD Biosciences). As a result, single HLA-A*2402-WT1 235-243 tetramer+CD3+CD8+ cells were obtained from the fraction of CD4−CD14−CD16−CD19−CD56− cells and were defined as WT1-Tet+ cells.
  • (3) cDNA Synthesis of the TCR-β Chain from the Single Cells Sorted
  • To eliminate DNA contamination for RT-PCR of sufficient single cells, cDNA synthesis was carried out, and all the steps of PCR were performed in a different clean bench. Single WT1-Tet+ cells were sorted directly in a PCR tube containing 15 μl of a cDNA reaction mixture. The cDNA reaction mixture contained the following components in lysis buffer (1× cDNA buffer containing 0.5% Triton X-100): reverse transcriptase (SuperScript III, Invitrogen, Carlsbad, Calif.), 0.5 mM dNTPs (Invitrogen), 20 units (U) of Rnase inhibitor(Invitrogen), 100 μg/ml gelatin (Roche, Indianapolis, Ind.), 100 pg/ml tRNA (Roche), and a 200 nM primer (5′-CACCAGTGTGGCCTTTTG-3′ (SEQ ID No.: 3394)) specific for the TCR-β chain constant region. After the sorting, the samples were incubated for 90 minutes at 50° C. for cDNA synthesis, and then incubated for 5 minutes at 95° C. for terminating the reaction.
  • (4) Semi-Nested Multiplex-PCR
  • Ten μl of a synthesized cDNA product obtained by the above procedure was added to 40 μl of a reaction mixture. The reaction mixture contained 1> PCR buffer, 2 mM MgCl2, 0.25 mM dNTPs, 1.25 U DNA polymerase (Platinum Tag DNA Polymerase, Invitrogen), a 5 nM mixture of 24 different Vβ-family-specific forward primers (shown in Table 1), and 5 nM 3′-Cβ reverse primer (5′-GCTTCTGATGGCTCAAACACAGC-3′ (SEQ ID No.: 3395)). The procedure of PCR was as follows: a pre-PCR heating step at 95° C. for 2 minutes, followed by 40 cycles of a denaturing step at 95° C. for 45 seconds, an annealing step at 57° C. for 45 seconds, and an extension step at 72° C. for 50 seconds.
  • TABLE 1
    S2 TRBV2 GGTCACACAGATGGGACAGGAAGT
    (SEQ ID No.: 3396)
    S2 TRBV3 CCCAGACTCCAAAATACCTGGTCA
    (SEQ ID No.: 3397)
    S5 TRBV4 TACGCAGACACCAA<GA>ACACCTGGTCA
    (SEQ ID No.: 3398)
    S1 TRBV5 ACAGCAAGTGAC<TAG>CTGAGATGCTC
    (SEQ ID No.: 3399)
    S7 TRBV6 GTGTCACTCAGACCCCAAAATTCC
    (SEQ ID No.: 3400)
    S4 TRBV7-1 GTGTGATCCAATTTCAGGTCATAC
    (SEQ ID No.: 3401)
    S3 TRBV7-3 ATGTAACT<CT>TCAGGTGTGATCCAA
    (SEQ ID No.: 3402)
    S1 TRBV9 ACAGCAAGTGAC<TAG>CTGAGATGCTC
    (SEQ ID No.: 3403)
    S1 TRBV10 CCAAGACACAAGGTCACAGAGACA
    (SEQ ID No.: 3404)
    S4 TRBV11 CAGTCTCCCAGATATAAGATTATAGAG
    (SEQ ID No.: 3405)
    S4 TRBV12 GGTGACAGAGATGGGACAAGAAGT
    (SEQ ID No.: 3406)
    S8 TRBV13 CTGATCAAAGAAAAGAGGGAAACAGCC
    (SEQ ID No.: 3407)
    S6 TRBV14 ATAGAAGCTGGAGTTACTCAGTTC
    (SEQ ID No.: 3408)
    S8 TRBV15 CAAGATACCAGGTTACCCAGTTTG
    (SEQ ID No.: 3409)
    S5 TRBV18 TGCAGAACCCAAGACACCTGGTCA
    (SEQ ID No.: 3410)
    S5 TRBV19 CACTCAGTCCCCAAAGTACCTGTT
    (SEQ ID No.: 3411)
    S2 TRBV20 GAGTGCCGTTCCCTGGACTTTCAG
    (SEQ ID No.: 3412)
    S6 TRBV21 AAGGTCACCCAGAGACCTAGACTT
    (SEQ ID No.: 3413)
    S6 TRBV23 ACAAAGATGGATTGTACCCCCGAA
    (SEQ ID No.: 3414)
    S7 TRBV24 GTTACCCAGACCCCAAGGAATAGG
    (SEQ ID No.: 3415)
    S1 TRBV25 GATCACTCTGGAATGTTCTCAAACC
    (SEQ ID No.: 3416)
    S3 TRBV27 GTGACCCAGAACCCAAGATACCTC
    (SEQ ID No.: 3417)
    S2 TRBV28 GTAACCCAGAGCTCGAGATATCTA
    (SEQ ID No.: 3418)
    S3 TRBV29 TCCAGTGTCAAGTCCATAGCCAAGTC
    (SEQ ID No.: 3419)
    S5 TRBV30 GTCAGATCTCAGACTATTCATCAATGG
    (SEQ ID No.: 3420)
  • Next, the PCR products were subjected to screening PCR. One μl of each PCR product was placed in separate 8 tubes and 24 μl of a reaction mixture was added to each of the tubes. The reaction mixture contained 1× PCR buffer, 2 mM MgCl2. 0.2 mM dNTPs, 1.0 U of Platinum Tag DNA polymerase, one set of forward primers selected from the 8 screening sets S1 to S8, shown in Table 1, and 5′-Cβ reverse primer (5′-GGAACACGTTTTTCAGGTCCT-3′ (SEQ ID No.: 3421)) (150 nM each). The procedure of PCR was as follows: a pre-PCR heating step at 95° C. for 2 minutes, followed by 35 cycles of a denaturing step at 94° C. for 45 seconds, an annealing step at 57° C. for 45 seconds, and an extension step at 72° C. for 40 seconds.
  • To verify positive reactions in the 8 screening PCRs, 5 μl of each screening PCR product was subjected to 2% agarose gel electrophoresis, followed by further PCR. This PCR was performed 35 cycles using 150 nM each of the VP-specific forward primers contained in the screening sets that were confirmed as positive. The positive reaction was verified by 2% agarose gel electrophoresis. A cell-free system was used as negative contrast, and three wells were prepared for the negative contrast in the same manner as above. The experiment was performed according to the same procedure.
  • (5) Determination and Analysis of the Sequences of the Complementarity-Determining region 3 (CDR3) of TCR-β
  • Amplified fragments of the TCR-β gene were purified using the PCR Purification Kit (Qiagen, Valencia, Calif.). Corresponding TCR VR-specific forward primers were used for sequencing. The ABI PRIAM BigDye Terminator v 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, Calif., USA) was used for sequencing, and the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for analysis. The sequence data on CDR3 were analyzed by comparing the sequences with those available from the website of the IMGT human TCR gene database (imgt.cines.fr).
  • B. Results
  • The sequences of the gene for the Vβ chain, the J region sequences, D region sequences, N region sequences, CDR3 nucleotide sequences, and CDR3 amino acid sequences of WT1-specific CTLs derived from healthy individuals and cancer patients (AML1 to AML4 and MDS1 to MDSS) are shown in FIGS. 1A-1 to 1ZZZ-3. The clonality of each WT1-specific CTL is shown in FIGS. 2A-1 to 2VVVV-3. The CDR3 nucleotide sequences are shown in SEQ ID Nos.: 1-1696 (since clones #24.29 and #28.92 have the identical CDR3 nucleotide sequence, only clone #24.29 is shown in the Sequence Listing), and the CDR3 amino acid sequences are shown in SEQ ID Nos.: 1697-3392 (since clones #2.53 and #28.58 have the identical CDR3 amino acid sequence, and so do clones #24.29 and #28.92, only clones #2.53 and #24.19 are shown in the Sequence Listing). Among the AML patients, AML1 and AML2 responded to the treatment, but AML3 and AML4 did not. The response of the MDS patients to the treatment has not been determined.
  • As can be seen from FIGS. 2A-1 to 2VVVV-3, in the healthy individuals (HV1 to HV4), the clonality of WT1-specific CTL having any of the CDR3 polynucleotides or CDR3 peptides is 1 for almost all the clones, and 2 or 3 for rare clones; however, all the cancer patients before therapy (AMLs and MDSs) have a multiplicity of clonality of the WT1-specific CTLs having any of the CDR3 polynucleotides or CDR3 peptides without exception. The number of the clonality was larger and the types of such cells were more abundant in the cancer patients than in the healthy individuals.
  • The increases in clonality and in types of cells having a multiplicity of clonality in patients before therapy indicate a possibility that defense and attack against cancer cells has already been launched in the patients and suggest that cancer cell are already present in the patients.
  • Also, as can be seen from FIGS. 2A-1 to 2VVVV-3, the AML patients who responded to WT1 peptide immunotherapy had a larger number of types of clones with a multiplicity of clonality than the healthy subjects and non-responsive patients before the therapy. AML1 (responder): 10 types (clonality of 58 in total); AML2 (responder): 12 types (clonality of 93 in total); AML3 (non-responder): 9 types (clonality of 27 in total); and AML4 (non-responder): 3 types (clonality of 10 in total). Healthy individuals HV1-5 had clones with a multiplicity of clonality in a range of 0 to 2 types.
  • The clones that already have a multiplicity of clonality before the therapy tend to further increase the clonality or maintain their clonality by WT1 peptide immunotherapy. It is also considered that WT1 peptide immunotherapy is more likely to be successful when there are clones of as many types as possible, which gives increased number and types of effective WT1-specific CTL clones as a whole.
  • As can be seen from FIGS. 2A-1 to 2VVVV-3, WT1-specific CTLs were observed in which the clonality increased either temporarily or continuously (including the cases where the clonality increased from 0 to 1 or more) in the AML patients during the period of WT1 peptide immunotherapy. The exemplary clones exhibiting such behavior include clones #02.28, #05.034, #05.135, #05.219, #09.65, #12.04, #13.13, #27.016, and #28.83 from AML (patient 1—a responder), and clones #02.27, #05.035, #05.141, #05.219, #06.009, #12.04, #12.20, #15.44, #20.068, and #27.032 from AML (patient 1—a non-responder). For example, from the change in the clonality of clone #02.28 from AML patient 1, it is found that the therapeutic effect was high at the onset of the treatment and at week 4.
  • An increase in the clonality of a certain clone indicates that the WT1 peptide immunotherapy showed its effect for a certain period of time. Even if the clonality of certain clones may increase temporarily and then decrease, the clonality of other WT1-specific CTLs would increase to complement the effect. Considering the effect on cancer cells, a larger increase in the clonality is more desired. Therefore, the larger becomes the increase in the clonality or the more abundant become the types of clones with increased clonality after the WT1 peptide immunotherapy, the responsiveness to the WT1 peptide immunotherapy is considered to have been high.
    • INDUSTRIAL APPLICABILITY
  • The present invention may provide pharmaceutical compositions useful for anti-cancer therapy, cancer test kits or reagents, reagents for cancer research, and the like. Therefore, the present invention may find use in the fields of pharmaceuticals for cancer therapy, of cancer test kits or reagents, and of cancer research.

Claims (8)

1. A method for assaying the clonality of a WT1-specific CTL, comprising:
(a) sorting single WT1-specific CTLs in a sample;
(b) contacting a peptide from a single WT1-specific CTL with an antibody against a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1697-3392; and
(c) measuring the clonality of WT1-specific CTLs that comprise an identical amino acid sequence selected from the group consisting of SEQ ID NOs: 1697-3392, thereby characterizing said WT1-specific CTLs as having a multiplicity of clonality if said clonality is greater than 1; and/or
measuring the number of types of WT1-specific CTLs that have a multiplicity of clonality.
2. The method of claim 1, wherein the antibody in step (b) is immobilized on a chip.
3. A method for diagnosing cancer in an HLA-A*2402-positive subject, comprising assaying the clonality of a WT1-specific CTL using the method of claim 1 in a sample obtained from the subject before a therapy,
wherein the subject is determined to have an increased possibility of developing cancer when a WT1-specific CTL having a multiplicity of clonality is present.
4. The method of claim 3, wherein an increased clonality of WT1-specific CTLs having a clonality of 3 or more, or an increasingly abundant number of types of WT1-specific CTLs having a clonality of 3 or more, indicates an increased possibility of developing cancer.
5. A method for testing the sensitivity of an HLA-A*2402-positive subject to WT1 peptide immunotherapy, comprising assaying the clonality of a WT1-specific CTL using the method of claim 1 in a first sample obtained from the subject before the immunotherapy and in a second sample obtained from a subject non-responsive to the immunotherapy,
wherein the subject is determined to have sensitivity to the immunotherapy when the types of WT1-specific CTLs having a multiplicity of clonality in the subject are more abundant than in the subject non-responsive to the immunotherapy.
6. The method of claim 5, wherein an increasingly abundant number of types of WT1-specific CTLs having a multiplicity of clonality indicates an increased sensitivity to the immunotherapy.
7. A method for monitoring WT1 peptide immunotherapy in an HLA-A*2402-positive subject, comprising assaying the clonality of a WT1-specific CTL using the method of claim 1 in a first sample obtained from the subject before the immunotherapy and in a second sample obtained from the subject after the immunotherapy,
wherein the subject is determined to have responded to the immunotherapy when the clonality of a WT1-specific CTL increases after the immunotherapy compared to before the immunotherapy.
8. The method of claim 7, wherein an increased clonality of WT1-specific CTLs after the immunotherapy, or an increasingly abundant number of types of WT1-specific CTLs having a multiplicity of clonality after the immunotherapy, indicates increased responsiveness to the immunotherapy.
US16/857,005 2007-03-05 2020-04-23 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them Abandoned US20210017599A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/857,005 US20210017599A1 (en) 2007-03-05 2020-04-23 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
JP2007-054215 2007-03-05
JP2007054215 2007-03-05
PCT/JP2008/053469 WO2008108257A1 (en) 2007-03-05 2008-02-28 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them
US52970110A 2010-03-26 2010-03-26
US14/184,979 US10669584B2 (en) 2007-03-05 2014-02-20 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them
US16/857,005 US20210017599A1 (en) 2007-03-05 2020-04-23 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/184,979 Division US10669584B2 (en) 2007-03-05 2014-02-20 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them

Publications (1)

Publication Number Publication Date
US20210017599A1 true US20210017599A1 (en) 2021-01-21

Family

ID=39738141

Family Applications (4)

Application Number Title Priority Date Filing Date
US12/529,701 Expired - Fee Related US10093977B2 (en) 2007-03-05 2008-02-28 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them
US14/184,816 Abandoned US20140315758A1 (en) 2007-03-05 2014-02-20 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them
US14/184,979 Expired - Fee Related US10669584B2 (en) 2007-03-05 2014-02-20 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them
US16/857,005 Abandoned US20210017599A1 (en) 2007-03-05 2020-04-23 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US12/529,701 Expired - Fee Related US10093977B2 (en) 2007-03-05 2008-02-28 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them
US14/184,816 Abandoned US20140315758A1 (en) 2007-03-05 2014-02-20 Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them
US14/184,979 Expired - Fee Related US10669584B2 (en) 2007-03-05 2014-02-20 Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene, and use of them

Country Status (11)

Country Link
US (4) US10093977B2 (en)
EP (4) EP3173480A3 (en)
JP (3) JP5808079B2 (en)
KR (3) KR101773690B1 (en)
CN (2) CN103374576A (en)
AU (1) AU2008222061B2 (en)
BR (1) BRPI0808341A2 (en)
CA (1) CA2679045A1 (en)
MX (2) MX343633B (en)
TW (2) TWI615469B (en)
WO (1) WO2008108257A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11859009B2 (en) 2021-05-05 2024-01-02 Immatics Biotechnologies Gmbh Antigen binding proteins specifically binding PRAME

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1640458B1 (en) 2003-06-27 2011-12-28 International Institute of Cancer Immunology, Inc. Method of selecting patients suitable for wt1 vaccine
WO2005045027A1 (en) 2003-11-05 2005-05-19 International Institute Of Cancer Immunology, Inc. Wt1-origin hla-dr-binding antigen peptide
WO2008105462A1 (en) 2007-02-27 2008-09-04 International Institute Of Cancer Immunology, Inc. Method for activation of helper t cell and composition for use in the method
HUE025636T2 (en) * 2007-07-27 2016-04-28 Immatics Biotechnologies Gmbh Novel immunogenic epitopes for immunotherapy
GB0721686D0 (en) * 2007-11-05 2007-12-12 Medinnova As Polypeptides
US10654892B2 (en) 2010-10-05 2020-05-19 International Institute Of Cancer Immunology, Inc. Method for activating helper T cell
CN105968191A (en) 2011-06-28 2016-09-28 株式会社癌免疫研究所 Receptor gene for peptide cancer antigen-specific T cell
US9539299B2 (en) 2011-10-27 2017-01-10 International Institute Of Cancer Immunology, Inc. Combination therapy with WT1 peptide vaccine and temozolomide
WO2013074916A1 (en) 2011-11-18 2013-05-23 Board Of Regents, The University Of Texas System Car+ t cells genetically modified to eliminate expression of t- cell receptor and/or hla
EP2844770A4 (en) * 2012-05-04 2016-08-10 Nuclea Biotechnologies Inc Mrm-ms signature assay
ES2655031T3 (en) * 2012-07-02 2018-02-16 Sumitomo Dainippon Pharma Co., Ltd. Transdermal preparation of cancer antigenic peptide
CA2884366A1 (en) * 2012-09-12 2014-03-20 International Institute Of Cancer Immunology, Inc. Antigen-specific helper t-cell receptor genes
GB2508414A (en) * 2012-11-30 2014-06-04 Max Delbrueck Centrum Tumour specific T cell receptors (TCRs)
AR094026A1 (en) 2012-12-17 2015-07-08 Otsuka Pharma Co Ltd METHOD FOR ACTIVATING THE T HELPER CELL
JP6250288B2 (en) * 2013-01-30 2017-12-20 株式会社医学生物学研究所 T cell receptor and use thereof
CN105142656B (en) 2013-03-12 2019-05-10 大日本住友制药株式会社 Aqueous liquid composition
CN106170297A (en) * 2013-09-20 2016-11-30 纪念斯隆-凯特琳癌症中心 Combination/complementary therapy for WT 1 positive diseases
US11390921B2 (en) 2014-04-01 2022-07-19 Adaptive Biotechnologies Corporation Determining WT-1 specific T cells and WT-1 specific T cell receptors (TCRs)
JP6933898B2 (en) * 2014-04-24 2021-09-08 ボード オブ リージェンツ, ザ ユニバーシティ オブ テキサス システムBoard Of Regents, The University Of Texas System Application of induced pluripotent stem cells to manufacture adoptive cell therapy products
EP3067366A1 (en) * 2015-03-13 2016-09-14 Max-Delbrück-Centrum Für Molekulare Medizin Combined T cell receptor gene therapy of cancer against MHC I and MHC II-restricted epitopes of the tumor antigen NY-ESO-1
TWI726920B (en) * 2015-10-14 2021-05-11 耶魯大學 Genome-scale t cell activity array, methods of making the same, method of identifying immune modulator using the same, and use thereof
RU2019116312A (en) 2016-11-14 2020-12-14 Фред Хатчинсон Кэнсер Рисерч Сентер HIGH AFFINITY TCR SPECIFIC TO THE T-ANTIGEN OF THE POLYOMAVIRUS OF MERKEL CELLS AND THEIR APPLICATION
WO2018170338A2 (en) * 2017-03-15 2018-09-20 Fred Hutchinson Cancer Research Center High affinity mage-a1-specific tcrs and uses thereof
WO2018231958A1 (en) * 2017-06-13 2018-12-20 Adaptive Biotechnologies Corp. Determining wt-1 specific t cells and wt-1 specific t cell receptors (tcrs)
DE102017114737A1 (en) * 2017-06-30 2019-01-03 Immatics Biotechnologies Gmbh New T cell receptors and their use in immunotherapy
US11919937B2 (en) 2018-01-09 2024-03-05 Board Of Regents, The University Of Texas System T cell receptors for immunotherapy
EP3793577A4 (en) * 2018-05-16 2022-03-02 Fred Hutchinson Cancer Research Center Merkel cell polyomavirus t antigen-specific tcrs and uses thereof
CN112469733B (en) * 2018-07-12 2022-04-19 深圳华大生命科学研究院 MART-1(27-35) epitope-specific T cell receptor
CN111116754A (en) * 2018-10-30 2020-05-08 天津亨佳生物科技发展有限公司 Specific TCR aiming at EGFR L858R gene mutation and application thereof
GB201817821D0 (en) * 2018-10-31 2018-12-19 Ospedale San Raffaele Srl TCR and peptides
BR112021008973A8 (en) * 2018-11-09 2023-05-02 Juno Therapeutics Inc SPECIFIC T CELL RECEPTORS FOR MESOTHELIN AND THEIR USE IN IMMUNOTHERAPY
EP3670530A1 (en) * 2018-12-18 2020-06-24 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft Cd22-specific t cell receptors and adoptive t cell therapy for treatment of b cell malignancies
US20220251167A1 (en) * 2019-06-21 2022-08-11 St. Jude Children's Research Hospital, Inc. T-Cell Receptor for Treating Fibrolamellar Hepatocellular Carcinoma
WO2021060343A1 (en) * 2019-09-24 2021-04-01 オンコセラピー・サイエンス株式会社 T-cell receptor expressed by human t-cells that recognize peptide derived from urlc10 or peptide derived from depdc1
CN116322715A (en) * 2020-05-18 2023-06-23 得克萨斯州大学系统董事会 Engineered T cell receptors and methods of use
CN111665359A (en) * 2020-07-11 2020-09-15 成都益安博生物技术有限公司 Lung cancer peripheral blood TCR marker and detection kit and application thereof
CN113092761A (en) * 2021-03-15 2021-07-09 成都益安博生物技术有限公司 Peripheral blood TCR marker of diffuse large B cell lymphoma and detection kit and application thereof
CN113109564A (en) * 2021-03-15 2021-07-13 成都益安博生物技术有限公司 Peripheral blood TCR marker of acute myelocytic leukemia and detection kit and application thereof

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4923799A (en) 1984-02-06 1990-05-08 The Ontario Cancer Institute T cell specific cDNA clone
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
EP0602178A4 (en) 1991-08-28 1995-10-25 Wistar Inst T cell receptor-based therapy for rheumatoid arthritis.
US5364787A (en) 1992-03-23 1994-11-15 Idaho Research Foundation Genes and enzymes involved in the microbial degradation of pentachlorophenol
US20060134641A1 (en) * 1992-05-22 2006-06-22 Franklin Richard L Treating viral infections with krill enzymes
US5494794A (en) * 1992-10-20 1996-02-27 Emory University Detection of mitochondrial DNA mutations associated with Alzheimer's disease and Parkinson's disease
US5672509A (en) * 1993-08-25 1997-09-30 Pfizer Inc. hPDE IV-C: a human phosphodiesterase IV isozyme
KR100262838B1 (en) 1996-04-16 2003-03-15 기시모토 다다미쓰 Method of detecting solid cancer cells and histological heterotypia and method of examining tissue for bone marrow transplantation and peripheral blood stem cell transplantation
US5942422A (en) * 1996-11-14 1999-08-24 The Trustees Of Columbia University In The City Of New York Method for generating a directed, recombinant fusion nucleic acid
GB9710820D0 (en) 1997-05-27 1997-07-23 Univ Dundee Immunological method
US6013444A (en) 1997-09-18 2000-01-11 Oligotrail, Llc DNA bracketing locus compatible standards for electrophoresis
WO1999027957A1 (en) 1997-12-03 1999-06-10 The Immune Response Corporation Vaccination and methods against multiple sclerosis using specific tcr vbeta peptides
US6090593A (en) * 1998-05-13 2000-07-18 The United States Of America As Represented By The Secretary Of The Air Force Isolation of expressed genes in microorganisms
JP2002515243A (en) 1998-05-19 2002-05-28 アヴィデックス リミテッド Multivalent T cell receptor complex
CN102198266A (en) 1998-07-31 2011-09-28 株式会社国际癌症免疫研究所 Cancer antigens based on tumor suppressor gene WT1 product
US20030072767A1 (en) 1998-09-30 2003-04-17 Alexander Gaiger Compositions and methods for WT1 specific immunotherapy
US20030235557A1 (en) 1998-09-30 2003-12-25 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
MXPA01003344A (en) 1998-09-30 2004-04-21 Corixa Corp Compositions and methods for wt1 specific immunotherapy.
GB9823897D0 (en) 1998-11-02 1998-12-30 Imp College Innovations Ltd Immunotherapeutic methods and molecules
CA2362099C (en) 1999-02-23 2014-05-13 Baylor College Of Medicine T cell receptor v.beta.-d.beta.-j.beta. sequence and methods for its detection
EP1287357A2 (en) 2000-06-02 2003-03-05 Memorial Sloan-Kettering Cancer Center Artificial antigen presenting cells and methods of use thereof
ATE383375T1 (en) 2001-03-22 2008-01-15 Int Inst Cancer Immunology Inc WTI-MODIFIED PEPTIDE
DE60238958D1 (en) 2001-06-29 2011-02-24 Chugai Pharmaceutical Co Ltd A cancer vaccine with a cancer antigen based on the product of the tumor suppressing gene WT1 and a cationic liposome
CA2476995A1 (en) 2001-09-18 2003-03-27 Kyogo Itoh Method of detecting cellular immunity and application thereof to drugs
EP1447091A4 (en) 2001-09-28 2008-02-13 Institute Of Can International Novel method of inducing antigen-specific t cells
WO2003028758A1 (en) 2001-09-28 2003-04-10 Haruo Sugiyama Novel method of inducing antigen-specific t cells
CN1688708A (en) 2002-01-09 2005-10-26 曼盛基因技术有限公司 Gene sequence method for testing T cell propagation
US7214492B1 (en) * 2002-04-24 2007-05-08 The University Of North Carolina At Greensboro Nucleic acid arrays to monitor water and other ecosystems
AU2003242305A1 (en) 2002-06-12 2003-12-31 Chugai Seiyaku Kabushiki Kaisha Hla-a24-restricted cancer antigen peptide
JP4611022B2 (en) 2002-09-12 2011-01-12 株式会社癌免疫研究所 Cancer antigen peptide preparation
WO2004063706A2 (en) * 2003-01-08 2004-07-29 Maxx Genetech Co., Ltd. Method of detecting over-expression of t-cell receptor genes by real-time pcr
EP1640458B1 (en) * 2003-06-27 2011-12-28 International Institute of Cancer Immunology, Inc. Method of selecting patients suitable for wt1 vaccine
WO2005037868A2 (en) * 2003-10-16 2005-04-28 Case Western Reserve University Methods of treating nfat-related disorders
WO2005045027A1 (en) 2003-11-05 2005-05-19 International Institute Of Cancer Immunology, Inc. Wt1-origin hla-dr-binding antigen peptide
US20070238099A1 (en) 2003-12-08 2007-10-11 Cohen Irun R Antigen Receptor Variable Region Typing
US7576183B2 (en) * 2003-12-24 2009-08-18 Los Alamos National Security, Llc Structure-based receptor MIMICS targeted against bacterial superantigen toxins
US7622119B2 (en) 2004-03-31 2009-11-24 International Institute Of Cancer Immunology, Inc. Cancer antigen peptides derived from WT1
GB0411771D0 (en) 2004-05-26 2004-06-30 Avidex Ltd Nucleoproteins displaying native T cell receptor libraries
US7674456B2 (en) * 2004-06-14 2010-03-09 Charles Wiseman Breast cancer cell lines and uses thereof
GB0427585D0 (en) 2004-12-16 2005-01-19 Avidex Ltd Assay
WO2008026927A2 (en) 2006-08-30 2008-03-06 Academisch Medisch Centrum Process for displaying t- and b-cell receptor repertoires
JP2009278927A (en) 2008-05-23 2009-12-03 Tohoku Univ Antibody fragment imitating t-cell receptor and method for producing the same
CN105968191A (en) 2011-06-28 2016-09-28 株式会社癌免疫研究所 Receptor gene for peptide cancer antigen-specific T cell

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11859009B2 (en) 2021-05-05 2024-01-02 Immatics Biotechnologies Gmbh Antigen binding proteins specifically binding PRAME

Also Published As

Publication number Publication date
KR20170101317A (en) 2017-09-05
US20140315758A1 (en) 2014-10-23
EP3173480A3 (en) 2017-08-16
CN101668853A (en) 2010-03-10
US20140315735A1 (en) 2014-10-23
WO2008108257A1 (en) 2008-09-12
TW201514299A (en) 2015-04-16
EP2116596A4 (en) 2010-04-07
TWI615470B (en) 2018-02-21
EP3173480A2 (en) 2017-05-31
CN101668853B (en) 2013-07-31
MX2009009589A (en) 2009-09-21
EP3492590A2 (en) 2019-06-05
JP6268129B2 (en) 2018-01-24
EP2857508A3 (en) 2015-04-15
EP2857508A2 (en) 2015-04-08
MX343633B (en) 2016-11-11
JP5832572B2 (en) 2015-12-16
TWI615469B (en) 2018-02-21
EP3492590A3 (en) 2019-06-19
KR101669279B1 (en) 2016-10-26
KR101773690B1 (en) 2017-08-31
AU2008222061B2 (en) 2014-03-20
JP2014176382A (en) 2014-09-25
KR20150103385A (en) 2015-09-10
KR20090127273A (en) 2009-12-10
US20100190163A1 (en) 2010-07-29
JP2016005466A (en) 2016-01-14
US10669584B2 (en) 2020-06-02
TW200844225A (en) 2008-11-16
US10093977B2 (en) 2018-10-09
KR101900639B1 (en) 2018-09-19
JP5808079B2 (en) 2015-11-10
CA2679045A1 (en) 2008-09-12
EP2116596A1 (en) 2009-11-11
CN103374576A (en) 2013-10-30
BRPI0808341A2 (en) 2014-07-01
AU2008222061A1 (en) 2008-09-12
JPWO2008108257A1 (en) 2010-06-17

Similar Documents

Publication Publication Date Title
US20210017599A1 (en) Cancer antigen-specific t-cell receptor gene, peptide encoded by the gene, and use of them
US10648036B2 (en) Receptor gene for peptide cancer antigen-specific T cell
AU2013270605B2 (en) Cancer antigen-specific T-cell receptor gene, peptide encoded by the gene and use of them

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION