JP2009278927A - Antibody fragment imitating t-cell receptor and method for producing the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means or the like for quantitatively and sequentially analyzing what kinds of presentation action, CTL response and the like are exhibited on an infected cell by an antigen presenting a peptide derived from an HIV virus or the like, and understanding an HIV infection-controlling mechanism of the CTL. <P>SOLUTION: The peptide includes an antibody variable region having an amino acid sequence of each CDR region of TCR in each corresponding CDR region. Each kind of the antibodies includes the polypeptide as a constituent component, and has the antigen-recognizing ability similar to the TCR. The method for producing them, the probe for a complex of the HLA and a target antigen peptide, and the detection means or the detection reagent are also provided. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

The present invention is a molecule having a TCR-like binding power (antigen recognition ability) to a complex (pMHC) of a fragmented antigen-derived peptide and a major histocompatibility antigen complex (MHC) molecule. The present invention relates to a TCR-like anti-pHLA antibody, a polypeptide which is a constituent component thereof, a production method thereof, and the like.

In order for T cells responsible for cellular immunity, which is one response of acquired immunity, to recognize the antigen and activate itself, a ternary complex of antigen-derived peptide, MHC molecule, and T cell receptor (TCR) The formation of is important.

An antigen-derived peptide is a fragment of a foreign antigen that is fragmented in the cell. It binds between the α-helices of the MHC molecule, and the TCR recognizes the complex of this fragmented peptide and the MHC molecule (pMHC). It can be said that. The CD8 ⁺ T cell TCR recognizes an MHC Class I molecule and its binding peptide, and the CD4 ⁺ T cell TCR recognizes an MHC Class II molecule and its binding peptide.

To date, studies such as X-ray crystal structure analysis have revealed that TCR binds obliquely to MHC molecules and binding peptides (Non-patent Document 1). In addition, from the accumulation of data of crystal structure analysis, part of TCR complementarity determining region 3 (CDR3) and complementarity determining region 1 (CDR1) mainly contacted with the peptide and greatly related to antigen recognition specificity, Thus, a part of CDR1 and complementarity determining region 2 (CDR2) are involved in recognition of α-helix forming a pocket of MHC molecule (Non-patent Document 2).

TCR is a receptor involved in T cell antigen recognition and is also a factor that determines the characteristics of immune responses. Depending on the shape of the TCR, there are an αβ type composed of an α chain and a β chain, and a γδ type composed of a γ chain and a δ chain, both of which constitute a heterodimer via a disulfide bond. T cells express one type of receptor, αβ type or γδ type, and T cells with αβ type receptors are overwhelmingly more in comparison with the number of cells. The α chain, β chain, γ chain, and δ chain that make up the TCR are polypeptides with a molecular weight of 40,000-50,000, consisting of a variable region and a constant region, and are transmembrane molecules in which the variable region forms an immunoglobulin fold. is there. However, although it is stable as a membrane-bound molecule, its stability when prepared as a soluble molecule is low, and there are very few preparation examples. TCR has 6 CDRs, and diversity has been created by gene reorganization to support a wide range of antigen repertoires. Moreover, it has been reported that those CDR loops are very flexible and undergo structural changes upon contact with pMHC (Non-patent Documents 3 and 4). Therefore, the binding force is not as high as that of an antibody because the entropy loss due to structural constraints upon binding is greater than that of an antibody.

On the other hand, MHC molecules have a role of presenting antigen-derived peptides to TCR. MHC is a general term for genes encoding membrane-bound glycoproteins that are deeply involved in histocompatibility. Human MHC is called human leukocyte antigen (HLA). In the examples of the present specification, since human-derived MHC is used, it is hereinafter referred to as HLA. MHC molecules are roughly classified into two types, class I molecules and class II molecules, both of which are heterodimers in which two polypeptides are associated by non-covalent bonds. Furthermore, the presence of several alleles (alleles) has been reported, but the structure of the MHC class I molecule is a heterodimer of the heavy chain (α chain) encoded in the class I region and β ₂ microglobulin. Body (Non-Patent Document 4). At the tip of the molecule, a groove (pocket) is formed by the α1 domain and the α2 domain, and a peptide fragment of 8-10 residues is bound. On the other hand, in the MHC class II molecule, the α chain and β chain encoded in the class II region each form a heterodimer. In the HLA class II molecule, the α1 and β1 domains at the tip constitute a pocket, and a peptide fragment of 13 to (often -17) residues binds.

Another response of acquired immunity is humoral immunity. This is because the antibody molecule produced by activated mature B cells and the antigen form a complex and become a target of phagocytic cells, and also induces elimination of cells and bacteria by the complement system.

The basic structure of an antibody molecule is a heterodimer in which a light chain (L chain) consisting of about 220 amino acids and a heavy chain (H chain) consisting of about 440 amino acids are linked to each other by disulfide bonds. Is the body. Anti-binding fragment Fab (Antigen-Binding Fragment), which is composed of variable and constant regions for both L and H chains, and has a role of binding to antigen when divided at the part called hinge region, and crystalline fragment Fc Divided into (Crystallizable Fragment). Each of these is a part responsible for the main function of the antibody, and the former has the role of inducing the ability to bind to the antigen and the latter inducing the action to eliminate the antigen. Diversity to deal with various antigens is manifested by variable regions (VL / VH), and gene rearrangements and mutations into six CDRs are the basis of diversity. Currently, with the development of genetic engineering, it has become possible to produce recombinant antibodies using mammalian cells, E. coli, and the like. Furthermore, the development of antibody engineering has led to the development of small and more productive antibody molecules, Fv, VH and VL, which are heterodimers of antibody heavy chain variable region (VH) and light chain variable region (VL), as peptide linkers. A molecular form such as scFv linked with a thiol has been devised.

In general, it is said that the binding affinity of the H chain is higher than that of the L chain, but in most cases, the binding force originally retained by the complete antibody molecule cannot be exhibited by only one side. In addition, comparing the stability when each variable region is present alone, VL can exist stably as a monomer, whereas VH tends to be unstable and tends to form multimers. .

Comparing the TCR variable region and the antibody variable region described above, they are very similar in terms of their tertiary structure, CDR and framework regions, and CDR location. It can be said. In addition, in the case of antibodies, there is a report that the α chain is important for binding to pMHC in TCR, as the heavy chain variable region tends to mainly create binding force.

Among the many refractory diseases that surround us, Acquired Immuno Deficiency Syndrome (AIDS) via human immunodeficiency virus (HIV) is worldwide, mainly in African countries. A major outbreak has been reported. The lack of knowledge about HIV virus in the region and delays in preventive measures are mainly pointed out, but the cause of difficult cure is greatly affected by the infection characteristics of HIV virus and the avoidance of injury from T cells when AIDS develops. is doing.

In fact, the HIV-derived protein nef has been reported to down-regulate cell surface expression of HLA class I, that is, it may interfere with the damage of HIV-infected cells by cytotoxic T cells (CTL). It is thought to prevent the exposure of viral epitopes and further advance the disease state. Previous studies have suggested that this nef protein is a potent HIV epitope, and that there is a relationship between the presentation dynamics of nef-derived peptides to HLA class I and the CTL response that predominates depending on the progression of the disease state. It was. For example, an allele-specific CTL HLA-B35 shows the strongest response to an antigen presenting a peptide VY8 (VPLRPMTY) in the early stage of infection (Non-patent Document 5).

From the above points, it is possible to analyze quantitatively and temporally how the antigen presenting the peptide VY8 shows the dynamics of presentation on infected cells and also shows a strong CTL response. It can be said that it gives very important knowledge to understand the infection control mechanism.

As a probe for such pHLA (a complex of HLA and an antigen-derived peptide), firstly, a molecule prepared by making a naturally isolated TCR soluble is considered. However, TCR originally exists as a cell membrane-bound protein, and is further stabilized by forming a complex with CD3 antigen on the surface of T cells. Therefore, the preparation of soluble TCR molecules in many clones is extremely difficult. An example in which the transmembrane region of the α chain and β chain has been removed and the solubilized state is maintained only by the disulfide bond at the C terminus (Non-patent Document 6). An example of constructing a single chain TCR (Non-patent Document 7) has been reported. However, most soluble TCR preparations still have major problems in the stability of their construction molecules, and the construction of alternative molecules for TCRs that exhibit high affinity, high solubility, and high stability has been the subject of HIV research. It is expected to contribute greatly to

Currently, generally used antibody production methods include the hybridoma method in which antibody-producing cells collected from immunized animals are fused with cancer cells and immortalized, and human antibodies are applied to bacteriophage coat proteins hosted in E. coli. There is a phage display method that displays and selects from a phage antibody pool. Furthermore, as mice that can introduce human chromosomes and produce human antibodies have been developed, there is still great interest in antibody production. However, methods for immunizing animals and antibody production methods using phage display methods are random for epitopes, and are therefore suitable for efficient production of antibodies that recognize a specific site, such as having a TCR epitope. However, there is a need to develop new antibody production methods.

JP 2006-506053 A Rui, S., Sara, ES, Steve, SG, Cole, TT, James, MS, Stanley, GN (1995) Evidence that the antigen receptors of cytotoxic T lymphocytes interact with a common recognition pattern on the H-2Kb molecule Immunity 3 (5), 573-582 Lukasz, KC, Phillip, DH, Bridget, CM, Mattew, RC, David, MK (2005) High-affinity, Peptide-specific T Cell Receptors can be Generated by Mutations in CDR1, CDR2, CDR3 J. Mol. Biol 346, 223-239 Benjamin, E.W., George, F.G., Jessica, R.W., John E.L., John, I.B., Bent, K.J., Van der Merwe, P.A. (1999) TCR Binding to Peptide-MHC Stabilizes a Flexible Recognition Interface Immunity 10, 357-365 Cristopher, KG, Degano, M., Stanfield, RL, Brunmark, A., Jackson MR, Peterson PA, Teyton, L., Wilson, LA (1996) An ab T Cell Receptor Structure at 2.5Å and Its Orientation in the TCR -MHC complex Science 274, 209-219 Ueno, T., Motozono, C., Dohki, S., Mwimanzi, P., Rauch, S., Facklar, OT, Oka, S., Takiguchi, M. (2008) CTL-Mediated Selective Pressure Influences Dynamic Evolution and Pathogenic Functions of HIV Nef1 J. Immunol 108, 1107-1116 Jonathan, MB, Meir, G., Penio, TT, Emma, B., Malkit, S., Pieere, R., Bent, KJ (2003) Stable, soluble T-cell receptor molecules for crystallization and therapeutics Protein Eng. 16 (9), 707-711 Kieke, MC, Shusta, EV, Boder, ET, Teyton, L., Wittrup, KD, Kranz, DM (1999) Selection of functional T cell receptor mutants from a yeast surface-display library Proc. Natl. Acad. Sci. USA 96, 5651-5656

The present invention aims to solve the above-described problems. That is, the main object of the present invention is to provide a TCR-like anti-pHLA antibody which is a molecule having a TCR-like binding power (antigen recognition ability) to pMHC, and a polypeptide which is a component thereof, and HIV virus Analyze quantitatively and temporally what kind of presentation kinetics and CTL response the antigen presenting the peptide derived from shows on infected cells, etc., to understand the mechanism of CTL HIV infection control Is to provide.

  The present inventor has conducted intensive research to solve the above-mentioned problems, paying attention to the structural similarity between the antibody variable region and the TCR variable region, and TCR-like binding by a technique of transplanting the CDR of the TCR into the framework region of the antibody molecule. The above problems have been solved and the present invention has been completed by producing polypeptide molecules having strength.

That is, the present invention relates to each aspect shown below.
[Aspect 1] A polypeptide comprising an antibody variable region having the amino acid sequence of each CDR region of TCR in each corresponding CDR region.
[Aspect 2] The polypeptide according to Aspect 1, which is a TCR of a human T cell exhibiting specificity for a peptide derived from a viral protein bound to HLA class I.
[Aspect 3] The polypeptide according to Aspect 2, wherein the viral protein is nef of HIV virus.
[Aspect 4] The polypeptide according to Aspect 3, wherein the peptide derived from the nef protein of HIV virus consists of the amino acid sequence: VPLRPMTY.
[Aspect 5] The polypeptide according to any one of Aspects 1 to 4, wherein HLA class I is HLA-B35.
[Aspect 6] The polypeptide according to any one of Aspects 1 to 5, comprising a variable region of an antibody heavy chain having the amino acid sequence of the CDR region of the TCR β chain in the CDR region.
[Aspect 7] The polypeptide according to Aspect 6, wherein the amino acid sequence of the variable region of the antibody heavy chain is represented by SEQ ID NO: 1.
[Aspect 8] Amino acid sequence of each CDR region of the TCR β chain shown below:
The polypeptide according to embodiment 6 or 7, having at least one amino acid sequence selected from (1) CDR1: SGHAT; (2) CDR2: FQNNGV; and (3) CDR3: ASSLDLVSTEAFF.
[Aspect 9] The polypeptide according to Aspect 8, comprising the amino acid sequence represented by SEQ ID NO: 10 or SEQ ID NO: 14.
[Aspect 10] The polypeptide according to any one of Aspects 1 to 5, comprising a light chain antibody variable region having the amino acid sequence of the CDR region of the TCRα chain in the CDR region.
[Aspect 11] The polypeptide according to Aspect 10, wherein the amino acid sequence of the variable region of the antibody light chain is represented by SEQ ID NO: 2.
[Aspect 12] Amino acid sequence of each CDR region of the α chain of TCR shown below:
The polypeptide according to embodiment 10 or 11, having at least one amino acid sequence selected from (1) CDR1: TSGFYG; (2) CDR2: NALDG; and (3) CDR3: AVTDNYGQNFV.
[Aspect 13] The polypeptide according to Aspect 12, comprising the amino acid sequence represented by SEQ ID NO: 12 or SEQ ID NO: 16.
[Aspect 14] An Fv antibody having the ability to recognize an antigen of TCR, comprising the polypeptide according to any one of aspects 6 to 9 and the polypeptide according to any one of aspects 10 to 13.
[Aspect 15] TCR antigen-recognizing ability comprising the polypeptide according to any one of aspects 6 to 9 and the single-chain polypeptide comprising the polypeptide according to any one of aspects 10 to 13. scFv antibody.
[Aspect 16] The amino acid sequence of each CDR region corresponding to the TCR is transplanted into each CDR region of the antibody variable region, and the obtained polypeptide and the structural information of the TCR are simulated by homology modeling, and the CDR is based on the result. The method for designing an amino acid sequence of a polypeptide or antibody according to any one of aspects 1 to 15, which comprises optimizing the position of the loop.
[Aspect 17] A nucleic acid molecule encoding the amino acid sequence of the polypeptide or antibody according to any one of claims 1 to 15.
[Aspect 18] A nucleic acid molecule encoding an amino acid sequence designed based on the method according to Aspect 16.
[Aspect 19] A nucleic acid molecule encoding the polypeptide according to Aspect 9, consisting of the base sequence represented by SEQ ID NO: 13.
[Aspect 20] A nucleic acid molecule encoding the polypeptide according to Aspect 13, consisting of the base sequence represented by SEQ ID NO: 15.
[Aspect 21] A nucleic acid molecule encoding the scFv antibody according to Aspect 15.
[Aspect 22] A replicable cloning vector or expression vector containing the nucleic acid molecule according to any one of Aspects 17 to 21.
[Aspect 23] Any one of Aspects 1 to 15, comprising culturing a host cell transformed with the vector according to Aspect 22, expressing the nucleic acid in the host cell, recovering and purifying the single-chain polypeptide. A method for producing the polypeptide or antibody according to claim 1.
[Aspect 24] A pharmaceutical composition comprising the polypeptide or antibody according to any one of Aspects 1 to 15 as an active ingredient.
[Aspect 25] A probe, detection means or test reagent for a complex of HLA and a target antigen peptide, comprising the polypeptide or antibody according to any one of Aspects 1 to 15.

  According to the present invention, a TCR-like anti-pHLA antibody, which is a molecule having TCR-like binding power (antigen recognition ability) to pHLA, and a polypeptide which is a component thereof are produced, and its binding activity is evaluated and confirmed. I was able to do it.

The present invention relates to a polypeptide comprising an antibody variable region having the amino acid sequence of each CDR region of TCR in each corresponding CDR region, that is, a TCR-like anti-pHLA antibody, a polypeptide that is a component thereof, and the like.

There is no particular limitation on the type, specificity (reactivity), etc. of T cells that provide TCR. For example, various human T cells having specificity for various viruses such as HIV virus can be exemplified. For example, human T cells exhibiting specificity for peptides derived from viral proteins bound to HLA class I (ie, they are fragmented), particularly peptides derived from HIV viral proteins such as the nef protein Can be mentioned. Examples of HLA class I allyl include HLA-B35, HLA-A2, HLA-A24, HLA-B7, and HLA-B51. Furthermore, naive T cells having specificity for various antigen-presenting cells such as dendritic cells, monocytes, macrophages, etc., which present peptides derived from proteins derived from various viruses bound to HLA class II as target antigens Or an effector T cell etc. may be sufficient.

  From the similarity of diversity creation function in gene reorganization in antibody and TCR, polypeptide containing variable region of antibody heavy chain having amino acid sequence of CDR region of TCRβ chain in CDR region, and amino acid of CDR region of TCRα chain A polypeptide comprising a light chain antibody variable region having a sequence in the CDR region is preferable from the viewpoint of a stable structure and high binding activity.

The antibody (template antibody) that is the counterpart to which each CDR of the TCR is transplanted has a stable structure, an established expression system in a recombinant cell, and the amino acid sequence of the variable region has already been determined. In view of the above, it can be appropriately selected from known arbitrary antibodies. In addition, the origin of these antibodies is not particularly limited and can be appropriately selected from antibodies derived from mammals such as humans, rats and mice. In particular, in consideration of antigenicity when administered to the human body. Human-derived antibodies are preferred.

As a preferred example of the CDR contained in the polypeptide of the present invention, a peptide (VY8) having an amino acid sequence of “VPLRPMTY” derived from the HIV virus nef protein and HLA-B35 bound as shown in the Examples. CDRs contained in the TCR of cytotoxic T cell clones that react specifically with the complex can be mentioned. That is, for example, the amino acid sequence of each CDR region of the α chain of TCR shown below:
(1) CDR1: TSGFYG; (2) CDR2: NALDG; and (3) CDR3: AVTDNYGQNFV, or
Amino acid sequence of each CDR region of the TCR β chain shown below:
A polypeptide having at least one amino acid sequence selected from (1) CDR1: SGHAT; (2) CDR2: FQNNGV; and (3) CDR3: ASSLDLVSTEAFF is preferred.

  The “polypeptide” means a molecule that is a polymer of amino acids, and the number of amino acids contained therein is not particularly limited, but usually has a molecular weight of about 10,000 to tens of thousands.

The polypeptide may be modified by adding any peptide tag known to those skilled in the art (for example, c-myc tag and His-tag) so that the polypeptide can be efficiently purified using affinity chromatography. . In addition, an arbitrary structure such as a signal peptide and a linker peptide can be added as necessary. Furthermore, as described in the Examples, it is also possible to produce a multivalent antibody via streptavidin by fusing an avidin tag to the polypeptide of the present invention.

  The above-mentioned linker peptide or the like is a single polypeptide constituting the single-chain polypeptide or scFv of the present invention using any genetic means such as recombinant technology and any technical means known to those skilled in the art such as peptide chemical synthesis. It can be appropriately introduced into the chain polypeptide.

  The amino acid sequence of the polypeptide of the present invention can be designed by any method known to those skilled in the art. That is, the amino acid sequence of each CDR region corresponding to the TCR is transplanted into each CDR region of the antibody variable region, and if necessary, the obtained polypeptide and the structural information of the TCR are simulated by homology modeling. Based on the above, it is possible to design the amino acid sequence of the polypeptide or antibody of the present invention by optimizing the position of the CDR loop.

  Here, the homology modeling and the optimization of the CDR loop position itself can be performed using a technique known to those skilled in the art, for example, SWISS-MODEL. In addition, optimization of the position of the CDR loop can be achieved, for example, by inserting a part of the CDR sequence of the original antibody (template antibody) as described in the examples, It is carried out by adjusting the position of the CDR loop in the polypeptide of the present invention by appropriately deleting residues or by deleting residues in the antibody FR region. Such a three-dimensional immunoglobulin model is described in, for example, WO92 / 22653.

As a preferred example of the polypeptide of the present invention designed by such a method, SEQ ID NO: 10 or SEQ ID NO: 14 as a polypeptide comprising the variable region of an antibody heavy chain having the amino acid sequence of the CDR region of the TCR β chain in the CDR region. And the amino acid represented by SEQ ID NO: 12 or SEQ ID NO: 16 as a polypeptide comprising a light chain antibody variable region having the CDR region amino acid sequence of the TCRα chain in the CDR region. Mention may be made of polypeptides consisting of sequences.

The present invention further relates to various antibodies having such a polypeptide as a constituent component and having the same antigen recognition ability as TCR. Examples of such antibodies include Fv antibody and scFv antibody. For scFv, refer to Rosenburg and Moore (Ed.), “The Pharmacology of Monoclonal Antibodies”, Vol. 113, Springer-Verlag, New York, pp. 269-315 (1994).

  Further, Fab antibody molecules, various bispecific antibodies (BsAb), and diabody antibodies that are a kind of BsAb (see, for example, WO2007 / 108152 pamphlet and JP-A-2004-242638) are also examples of antibodies in the present invention. It can be mentioned as a form.

When a nucleic acid molecule encoding the polypeptide or antibody of the present invention is prepared, as described in the following examples, it can be totally synthesized by an overlap PCR method based on a pre-designed amino acid sequence. . As long as the “nucleic acid” is a molecule that encodes a single-chain polypeptide, its chemical structure and acquisition route are not particularly limited, and include, for example, cDNA, chemically synthesized DNA, mRNA, and the like.

Specifically, it can be isolated from a cDNA library by hybridization based on the sequence described in the literature or by the polymerase chain reaction (PCR) technique. Once isolated, the DNA is placed in an expression vector, which is then placed in an E. coli cell, COS cell, Chinese hamster ovary cell (CHO cell), or myeloma cell that does not produce immunoglobulin. A host cell can be transfected and a monoclonal antibody synthesized in the recombinant host cell. The PCR reaction can be performed by a method known in the art, or a method or modification method substantially similar thereto. For example, R. Saiki, et al., Science, 230: 1350, 1985; R. Saiki, et al., Science, 239: 487, 1988; HA Erlich ed., PCR Technology, Stockton Press, 1989; DM Glover et al. ed., “DNA Cloning”, 2nd ed., Vol. 1, (The Practical Approach Series ), IRL Press, Oxford University Press (1995); MA Innis et al. Ed., “PCR Protocols: a guide to methods and applications”, Academic Press, New York (1990)); MJ McPherson, P. Quirke and GR Taylor (Ed.), PCR: a practical approach, IRL Press, Oxford (1991); MA Frohman et al., Proc. Natl. Acad. Sci. USA, 85, 8998-9002 (1988) Alternatively, it can be performed according to a modified or modified method. In addition, the PCR method can be performed using a commercially available kit suitable for the PCR method, and can also be performed according to a protocol clarified by the kit manufacturer or the kit vendor.

  For hybridization, refer to L. Grossman et al. (Ed.), “Methods in Enzymology”, Vol. 29 (Nucleic Acids and Protein Synthesis, Part E), Academic Press, New York (1974), etc. it can. For example, Sanger et al., Proc. Natl. Acad. Sci. USA 74: 5463-5467 (1977) can be referred to for sequencing of nucleic acids such as DNA. General recombinant DNA technology is also described in J. Sambrook, EF Fritsch & T. Maniatis (ed.), “Molecular Cloning: A Laboratory Manual (2nd edition)”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and DM Glover et al. (Ed.), “DNA Cloning”, 2nd ed., Vol. 1 to 4, (The Practical Approach Series), IRL Press, Oxford University Press (1995), etc. .

  Furthermore, a polypeptide having an amino acid sequence in which several amino acids are substituted, deleted, or inserted in the FR region may be used as long as it does not substantially affect the above activity of the polypeptide. A nucleic acid molecule encoding a polypeptide having such a deleted, substituted or added amino acid may be, for example, a site-directed mutagenesis method (such as point mutagenesis and cassette mutagenesis), gene homologous recombination method, It can be easily prepared by appropriately combining nucleic acid modification methods well known to those skilled in the art, such as a primer extension method and a PCR method.

  Here, “modification” of a nucleic acid means insertion, deletion or substitution of a base in at least one codon encoding an amino acid residue in the obtained original nucleic acid. For example, there is a method of altering the amino acid sequence itself constituting a single-chain polypeptide by replacing a codon encoding an original amino acid residue with a codon encoding another amino acid residue.

  Alternatively, the nucleic acid encoding the single-chain polypeptide can be modified so that the codon (optimum codon) suitable for the host cell is used without changing the amino acid itself. Thus, by changing to an optimal codon, it is possible to improve the expression efficiency of the polypeptide in the host cell.

  The nucleotide sequences of suitable nucleic acid molecules encoding the polypeptides consisting of the amino acid sequences represented by SEQ ID NO: 14 and SEQ ID NO: 16 are shown in SEQ ID NO: 13 and SEQ ID NO: 15, respectively.

  The polypeptide of the present invention can be produced using methods known to those skilled in the art, for example, various means such as genetic engineering techniques or chemical synthesis. As genetic engineering techniques, for example, a replicable cloning vector or expression vector containing the above nucleic acid molecule is prepared, and a host cell is transformed with this vector by an appropriate method known to those skilled in the art. The nucleic acid molecule can be expressed in the host cell by culturing the obtained host cell, and the resulting polypeptide can be recovered and purified. Two types of vectors each containing nucleic acid molecules encoding two types of polypeptides that constitute an Fv antibody are introduced into the same host cell, or two types of nucleic acid molecules encoding each of the two types of polypeptides are used. It can also be contained in the same vector.

  Here, “replicable expression vector” and “expression vector” refer to a piece of DNA (usually double-stranded), in which the DNA contains Can be inserted with foreign DNA fragments. Foreign DNA is defined as heterologous DNA, which is DNA that is not found naturally in the subject host cell. Vectors are used to carry foreign or heterologous DNA into a suitable host cell. Once in the host cell, the vector can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (foreign) DNA can be generated. In addition, the vector contains the elements essential to allow translation of the foreign DNA into a polypeptide. Thus, many molecules of polypeptides encoded by foreign DNA can be synthesized rapidly.

  Such vectors are operably linked with an appropriate control sequence so that the DNA sequence is expressed in an appropriate host (ie, so that foreign DNA can be expressed). It means a DNA construct containing the determined DNA sequence. Such control sequences include transcriptional promoters, arbitrary operator sequences to control such transcription, sequences encoding appropriate mRNA ribosome binding sites, enhancers, reardenylation sequences, and transcription and translation. Examples include an array that controls the end of (translation). Further, the vector can appropriately contain various sequences known to those skilled in the art, for example, restriction enzyme cleavage sites, marker genes (selection genes) such as drug resistance genes, signal sequences, leader sequences, and the like as necessary. These various sequences or elements can be appropriately selected and used by those skilled in the art depending on conditions such as the type of foreign DNA, the host cell used, the culture medium, and the like.

  The vector can be in any form such as a plasmid, a phage particle, or simply a genomic insert. Once introduced into a suitable host by transformation, the vector can replicate or function independently of the resident genome. Alternatively, the vector may be one that is integrated into the genome.

  Any cell known to those skilled in the art can be used as the host cell. For example, typical host cells include prokaryotic cells such as E. coli and Chinese hamster ovary cells (CHO cells). ), Mammalian cells such as human-derived cells, and eukaryotic cells such as yeast and insect cells.

Transformation of these host cells can be performed according to methods known in the art, such as calcium phosphate method, lipofection, particle gun, (electro) poration method and the like. For example, the following documents can be referred to.

  The single-chain polypeptide thus expressed in the host cell transformed with the above expression vector is preferably recovered from the culture medium as a generally secreted polypeptide, but it is produced directly without a secretion signal. If so, it can be recovered from the host cell lysate. If the polypeptide is membrane bound, it can be released from the membrane using a suitable detergent (eg, Triton-X100).

  The purification operation can be performed by appropriately combining arbitrary methods known to those skilled in the art. For example, centrifugation, hydroxylapatite chromatography, gel electrophoresis, dialysis, fractionation on ion exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica, chromatography on heparin sepharose, anion or cation It is suitably purified by resin chromatography (polyaspartic acid column etc.), chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, and affinity chromatography. Affinity chromatography is one of the preferred purification techniques with high efficiency utilizing the affinity with a peptide tag of a single-chain polypeptide.

  Since the recovered polypeptide is often contained in the insoluble fraction, the purification operation is preferably performed after the polypeptide is solubilized and denatured. This solubilization treatment can be performed using any agent known to those skilled in the art as a dissociating agent such as alcohols such as ethanol, guanidine hydrochloride, and urea. Furthermore, it is possible to associate (unwind) the thus purified polypeptide, and to separate and recover the Fv antibody and the like formed.

  The association treatment means returning a single polypeptide to a state having a desired biological activity by returning the polypeptide to an appropriate spatial arrangement. Therefore, the association treatment also has the meaning of returning the polypeptides or domains to the associated state, so it can also be referred to as “reassociation”, and in the sense of having the desired biological activity. It can also be called reconstruction, or it can be called refolding. The association treatment can be performed by any method known to those skilled in the art. For example, the concentration of the denaturing agent (for example, guanidine hydrochloride) in the buffer solution containing the single-chain polypeptide is decreased stepwise by, for example, dialysis. The method is preferred. In this process, it is possible to promote the oxidation reaction by appropriately adding an aggregation inhibitor and an oxidizing agent to the reaction system. Separation and recovery of the formed Fv antibody and the like can also be performed by any method known to those skilled in the art.

  The polypeptide or antibody of the present invention can be used as a probe for a complex of HLA and a target antigen peptide. In particular, it has been shown that cancer antigens are also presented to HLA, and CTL attacks cancer cells based on their antigen recognition. Therefore, the polypeptide or antibody of the present invention can be used as a probe, detection means or test reagent for tumor (cancer) cells. For this purpose, any labeling substance known to those skilled in the art, such as an enzyme, protein, fluorescent substance, magnetic bead, and radioactive labeling substance, is imparted to the polypeptide or antibody of the present invention by an appropriate method. I can do it. Furthermore, the polypeptide or antibody of the present invention can take the form of a multimer through such a labeling substance.

  As shown in the examples below, the polypeptide or antibody of the present invention has TCR-like binding power, and therefore consists of the polypeptide or antibody of the present invention, a nucleic acid, a vector, and a transformed host cell. Those selected from the above are useful as active ingredients of pharmaceutical compositions.

  The effective amount of the active ingredient of the pharmaceutical composition of the present invention can be appropriately determined by those skilled in the art depending on, for example, the therapeutic purpose, the type of tumor, site and size of the subject to be administered, various conditions of the patient, administration route, etc. I can do it. A typical single dose or daily dose will depend on the above conditions and, if possible, first in vitro and then, for example, using assays known in the art for tumor cell survival or growth. In addition, appropriate dose ranges can be determined with appropriate animal models that can extrapolate dose ranges for human patients. Book

  The pharmaceutical composition of the invention includes various pharmaceutically acceptable ingredients well known to those skilled in the art, in addition to the active ingredients, according to various conditions such as the types of active ingredients, pharmaceutical forms, administration methods / purposes, pathological conditions to be administered, etc. (For example, carriers, excipients, buffers, stabilizers, etc.) can be added as appropriate. The pharmaceutical composition of the present invention is a tablet, solution, powder, gel, spray, or microcapsule, colloidal distribution system (liposome, microemulsion, etc.), macroemulsion, etc., depending on the above various conditions. Various drug forms are possible.

  Examples of administration methods include intravenous, intraperitoneal, intracerebral, intraspinal, intramuscular, intraocular, intraarterial, in particular intrabiliary or intralesional injection or injection, and sustained release system formulations. It is done. The active substances according to the invention can be administered continuously by infusion or by bulk injection.

  Sustained release formulations are generally of a form from which the active substance of the present invention can be released for a period of time, and suitable examples of sustained release preparations include solid hydrophobic polymers containing proteins. A semipermeable carrier is included, which is in the form of a molded product, such as a film or microcapsule.

  The pharmaceutical composition of the present invention is prepared by methods known to those skilled in the art, such as the Japanese Pharmacopoeia Manual Editorial Committee, 13th revised Japanese Pharmacopoeia Manual, issued on July 10, 1996, Yodogawa Shoten Co., Ltd. In view of the description, it can be appropriately selected and manufactured from among them.

  In the specification and drawings, the terms are based on the meanings of terms commonly used in the art or according to the IUPAC-IUB Commission on Biochemical Nomenclature.

  Hereinafter, the present invention will be described in detail with reference to examples. However, the examples are merely provided for the purpose of describing the present invention and for reference to specific embodiments thereof. These exemplifications are for explaining specific specific embodiments of the present invention, but are not intended to limit or limit the scope of the invention disclosed in the present application. In the present invention, it should be understood that various embodiments based on the idea of the present specification are possible.

  All examples were performed using standard techniques well known to those skilled in the art unless otherwise indicated. For example, in DNA cloning, J. Sambrook, EF Fritsch & T. Maniatis, “Molecular Cloning”, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and DM Glover et al. Ed., “DNA Cloning ", 2nd ed., Vol. 1 to 4, (The Practical Approach Series), IRL Press, Oxford University Press (1995); especially in PCR, HA Erlich ed., PCR Technology, Stockton Press, 1989; DM Glover et al. ed., “DNA Cloning”, 2nd ed., Vol. 1, (The Practical Approach Series), IRL Press, Oxford University Press (1995) and MA Innis et al. ed., “PCR Protocols”, Academic Press , New York (1990), and when using commercially available reagents or kits, the attached protocols (protocols) and attached chemicals are used.

The experimental methods used in the following examples are as follows.
Transformation:
1. Principle New genetic information is introduced into Escherichia coli by treating the Escherichia coli with Ca ²⁺ or the like and incorporating the plasmid into a competent cell that facilitates incorporation of foreign plasmids. At this time, there are a method of incorporating a plasmid by heat shock and a method of electroporation in which E. coli is instantaneously perforated by applying a voltage to E. coli. The heat shock method is mainly used for transformation, but electroporation has the advantage of good transformation efficiency and is therefore used for library preparation.

2. Things to prepare: Transformation by heat shock Competent cells JM109 strain or BL21 (DE3) strain Plasmid About 10 ng
LB / Amp (+) agar plate
1.6 ml LB medium test tube medium.
・ Transformation by electroporation E. coli DH12S
About 10ng of plasmid
Electroporator cuvette sterile eppendorf tube

3. Transformation by heat shock Add about 10 ng of plasmid to competent cells and leave on ice for 30 min. Heat shock at 42 ° C for 90 sec, then transfer to ice and leave for 2 min. Add 800 μl of LB medium and shake at 37 ° C for 60 min. Centrifuge at 6000 rpm for 5 min at room temperature, and discard the supernatant, leaving about 100 μl. Suspend the cell pellet with the remaining medium solution and apply it to the LB / Amp (+) plate in a clean bench. If the cells are JM109 strains, leave them at 37 ° C, and if they are BL21 strains, leave them at 28 ° C for 12-16 hours.

4). Transformation by poration 40 μl of E. coli DH12S strain and 1 μl of plasmid were mixed in a sterile Eppendorf tube, transferred to a cuvette, and left on ice for 15 min. Set the instrument to 1500V, 25mA, 50μF, 150Ω. Set cuvette on device and pulse. Quickly add 800 μl LB medium, transfer to a sterile Eppendorf tube, and cure at 37 ° C for 1 hour. Inoculate Amp concentration (0.1 mg / ml) in 20 ml LB medium and continue to culture.

Inoculation and transfer, induction of expression:
1. Principle When mass-culturing, increase colonies of E. coli on the plate to some extent in a test tube, and then transfer to a Sakaguchi flask. In the case of a secretory expression system, if the medium is changed to a new 2 × YT medium before induction of expression, the protein expression level is improved. Moreover, since the 2 × YT medium is rich in protein, it is coprecipitated with the target protein during salting out, and the yield of the target protein is improved.

In the pET system and tac and lac expression systems, the overproduced lac repressor binds to the lac operon until expression is induced by IPTG (isopropyl-b- _D (-)-thiogalactopyranoside). Therefore, the expression of the target protein arranged downstream of the lac operon is suppressed. By introducing IPTG, the lac repressor binds to IPTG and does not bind to the lac operon, so the expression of the target protein located downstream of the lac operon is started. The lac repressor recognizes lactose in nature, but when lactose is used, it is degraded by b-galactosidase of E. coli and does not work as an expression inducer for a long time, so IPTG that does not undergo degradation by b-galactosidase is used. .

2. Things to prepare / inoculate
3ml LB test tube medium
100mg / ml ampicillin solution Sterilized toothpick / planting
250ml 2 × YT medium
100mg / ml ampicillin solution / expression induction collection bottle
0.5M IPTG
100mg / ml ampicillin solution

3. Inoculation In a clean bench, add 100 mg / ml ampicillin solution to a 3 ml test tube medium to a final concentration of 0.1 mg / ml. Plow the colo with a toothpick and throw it into a test tube. (Do not puck the satellite at this time.) Cover the mouth and lid of the test tube with a burner, and cover. Shake at 28 ° C overnight (over 16 hours).

4). Transplanting Perform the following operations in a clean bench.
Gently pour the mouth of the Sakaguchi flask with a lid with a burner and remove the lid. Add ampicillin solution to a final concentration of 0.1 mg / ml. Gently rub the mouth of the test tube with a burner. Pour the culture in the test tube into the Sakaguchi flask. Gently pour the mouth and lid of the Sakaguchi flask with a burner. Incubate with shaking at 28 ° C. When OD600 = 0.8, add 0.8 M IPTG to a final concentration of 1 mM. Shake overnight at 28 ℃ and 120min-1.

Recovery from the soluble fraction:
1. Principle When the target protein is sufficiently secreted out of E. coli, it is first separated into cells and a culture supernatant, and then the culture supernatant is salted out with ammonium sulfate.

2. Things to prepare Ammonium sulfate
(60% (w / w) of the supernatant weight of the medium. When all is added, it becomes 80% saturation)
PBS

3. Salting out and solubilizing the salted out protein First, the medium containing the cells is transferred to a collection bottle and centrifuged at 4 ° C. and 7000 rpm for 20 minutes to separate the cells and the culture supernatant.
Subsequently, the following operation is performed at 4 ° C.
Add ammonium sulfate little by little while stirring with a stirrer and leave at 4 ° C for more than 8 hours. Open the salted-out sample in a collection bottle, centrifuge at 4 ° C, 7000 rpm, 50 min, and discard the supernatant. Add about 10 ml of 50 mM Tris-HCl / 200 mM NaCl to each collection bottle, and leave it at 4 ° C for 1 day to allow the precipitate to soak. The solubilized sample is transferred to a dialysis membrane, and ammonium sulfate is removed by dialysis against 50 mM Tris-HCl / 500 mM NaCl. The dialyzed sample is collected in a falcon tube, centrifuged at 4 ° C., 7000 rpm, 20 min, and (His) 6-tag purification is performed using the supernatant. Dialysis against PBS to remove imidazole.

Protein recovery and rewinding from the insoluble fraction:
1. Principle Most of the proteins that exist as insoluble in Escherichia coli cells in the secretory expression system are caught on the membrane during the process of being released outside the cell membrane by the action of the pel-B signal peptide. It is thought that the intramolecular disulfide bond of the intracellular membrane fraction protein is correctly formed by the action of the E. coli chaperonin. Perform the return.

2. Collection and rewinding of insoluble fraction of secretory expression system The microbial cells are sonicated (170 W, 15 min), and the microbial cell lysate is centrifuged at 10000 rpm for 40 min to collect the precipitate. Add 10 ml of 6 M guanidine hydrochloride / 20 mM Tris-HCl / 500 mM NaCl / 5 mM imidazole to the precipitate per liter of culture and leave overnight. Centrifuge at 10000 rpm for 30 min and purify (His) 6-tag using the supernatant. The protein concentration of the eluted fraction is measured, diluted to 7.5 μM or less, and rewound by step dialysis with 3M, 2M, 1M, 0.5M, 0M guanidine hydrochloride / 50 mM Tris-HCl / 200 mM NaCl / 1 mM EDTA. When the guanidine hydrochloride concentration is 1M, L-arginine hydrochloride is added to 0.4M.

Metal chelate (His) 6-tag affinity chromatography:
1. Principle Proteins prepared in large quantities using microorganisms can be easily and quickly purified using the (His) 6-tag consisting of six histidine residues fused and expressed at the N-terminus or C-terminus. is there. The imidazole ring on the side chain of the histidine residue has one unshared electron pair at pH 8.0 and coordinates it to a divalent positively charged transition metal ion (Co ²⁺ , Ni ²⁺ , Cu ²⁺ , Zn ²⁺ ) can do. Due to its affinity, a protein having a (His) 6-tag is specifically adsorbed and separated on a chromatographic support on which metal ions are immobilized. The adsorbed target protein is eluted by flowing a buffer containing 50 mM to 1 M imidazole.

2. Things to prepare ・ Binding Buffer: Used for pre-washing and washing before sample loading.
5 mM imidazole
6M Gu-HCl
PBS pH 7.9
・ Wash Buffer: Used for washing.
20 mM imidazole or 40 mM imidazole
6M Gu-HCl
PBS pH 7.9
・ Elute Buffer: Used for elute.
100 mM imidazole, 200 mM imidazole or 300 mM imidazole
6M Gu-HCl
PBS pH 7.9
・ 8 x Charge Buffer: Used to fix Ni ²⁺ .
400 mM NiSO ₄ in H ₂ O
Dissolve in Milli-Q water. Note that salt will precipitate if PBS is used.
Actually, 0 mM imidazole, 6 M Gu-HCl, PBS (pH 7.9) and 500 mM imidazole (or 1 M imidazole), 6 M Gu-HCl, PBS (pH 7.9) are stocked, and two kinds of buffers are mixed. Thus, each imidazole concentration buffer is prepared.

3. Operation Mix the resin to homogenize, pour onto the column, and let stand. Pre-wash with 10 ml of Binding Buffer, but do not disturb the column surface by pipetting when pouring the solution onto the column. Subsequently, the sample is loaded, and the eluate is collected as (through fraction). Wash with 10 ml of wash buffer and collect the eluate as (wash fraction). Add elute buffer and collect in a Falcon tube. The absorbance at 280 nm of each fraction is measured, and an appropriate amount is prepared and analyzed as a sample for SDS-PAGE.

Phage preparation:
1. Principle In this study, a phage display system using a helper phage / phagemid system is employed. In addition to transformation with a phagemid, supply of a coat protein by helper phage infection is required. Filamentous bacteriophage M13 secreted onto the medium can be precipitated in the presence of PEG6000 and soluble phage are prepared by dissolving the pellet in buffer.

2. Things to prepare-Phagemid-E. coli (DH12S, JM109)
・ Helper phage M13K07
・ LB medium ・ Ampicillin ・ Kanamycin ・ 20% Polyethylene glycol (PEG) 6000 2.5M NaCl
・ Blocking Buffer (Super BlockTM Blocking Buffer in PBS: PIERCE)
・ Tween20

3. The Escherichia coli DH12S strain is transformed by electroporation using the phagemid for manipulation, and after curing for 1 hour, the cells are cultured in 20 ml LB medium containing ampicillin at a final concentration of 100 μg / ml for 4 to 5 hours. Add 20 μl of helper phage M13K07 (1 × 10 ¹¹ cfu / ml) and shake for 1 h at 100 rpm. Kanamycin is added to a final concentration of 50 μg / ml and cultured with shaking at O / N. The cells are collected by centrifugation at 4 ° C. and 7000 rpm for 20 min, 5 ml of 20% PEG6000 / 2.5 M NaCl is added to the collected medium, and the mixture is left on ice for 1 h. Centrifuge at 10000rpm for 20min at 4 ℃, carefully remove the supernatant, and dissolve the precipitate in 850μl Blocking Buffer-T.

Biopanning:
1. Principle In order to obtain a target clone from a vast number of antibody libraries, it is necessary to screen phage antibodies using some selection method. As a main technique, an immunotube, a technique using a magnetic bead, or the like is used, and any of them is a selection technique for a purified antigen. Here, as a method for screening pMHC, we describe a method that has been performed with reference to previous reports and panning operations using magnetic beads used in our laboratory.

2. Things to prepare-Prepared phage antibody (usually dissolved in 850 μl PBS after PEG precipitation)
・ PBS
・ PBS-T (0.05% Tween20 (v / v))
・ Blocking Buffer
・ 20mM MES Buffer (pH7.0)
・ Soluble VL fragment (10μg / ml)
・ JM109 glycerol stock ・ 20ml LB medium ・ 0.1mg / ml Amp (+) LB plate (square type No. 2 Petri dish)
・ 50mg / ml Kanamycin
・ Biotinylated pMHC

3. A phage antibody library displaying the engineered antibody variable region is prepared. Place 800 μl of Blocking Buffer and 1 μg of antigen pMHC molecule in magnetic beads that have been washed with PBS, and gently agitate for 1 hour to immobilize the antigen. Remove the supernatant while immobilizing the magnetic beads, and wash 3 times with Blocking Buffer-T to remove the non-biotinylated antigen. Add the prepared phage library and shake for 1 h. If the open sandwich method is used, 1 μg of soluble VL is added at this point. Remove the supernatant and wash with Blockng Buffer-T (5 min x 5). Change the washing solution to PBS-T and wash again for 5 minutes x 5 times. Wash once with PBS, and then add 750 μl of 10% glycine-hydrochloric acid (pH 2.0) and shake for 10 minutes. The collected phages are mixed with 250 μl and neutralized, and then added to E. coli JM109 culture solution (LB 20 ml) cultured at OD ₆₀₀ = 0.3 to 0.5 (shaking at 100 / min for 1 h). Transfer to a 50 ml Falcon tube, centrifuge at 6000 rpm for 15 min at room temperature, and then deposit the precipitate on a square LB plate (Amp +). After overnight plate culture, add about 3 ml of sterilized LB medium to the plate and spread well. Collect with Pipetman, transfer to 20 ml of LB and re-prepare the phage library. Repeat the above operation for several rounds. After the 2nd round, it was put into a system to which no antigen was bound and shaken for 1 h to remove non-specifically adsorbed phage.

ELISA:
1. Principle ELISA (enzyme linked immunosorbent assay) is a technique in which a primary antibody is bound to an antigen and measured with an enzyme-labeled secondary antibody. In this study, an open sandwich ELISA was used as the measurement system, and the luminescence was quantitatively measured using anti-c-myc mouse monoclonal IgG HRP conjugate as the enzyme-labeled detection antibody.

2. Things to prepare-PBS
・ PBS-T (0.05% Tween20 (v / v))
・ Blocking Buffer
・ Soluble VL fragment (10μg / ml)
Primary antibody anti-c-myc mouse monoclonal IgG HRP conjugate (diluted 2000 times with PBS)
・ Streptavidin ・ Biotinylated pMHC
・ ECL ^TM Western Blotting Detection Reagent
・ 96-well plate ・ Fluorescan

3. operation
Streptavidin solution (1 mg / ml) is added to a 96-well plate at 100 μl / well and allowed to stand overnight for immobilization. Collect the streptavidin solution, add 200 μl / well of Blocking Buffer, and let stand for 1 h. A biotinylated antigen is added and left to stand for 1 h to immobilize the antigen. After removing the non-biotinylated antigen with PBS-T, the supernatant of the cultured bacterial cells and the culture supernatant are added and gently shaken for 1 h to bind the antibody to the antigen. After removing the supernatant, wash with PBS-T for 5 minutes x 5 times. Add primary antibody diluted in PBS and shake gently for 1 h. After removing the supernatant, wash with PBS-T for 5 minutes x 5 times. Add Western Blotting Reagent and measure luminescence intensity with Fluorescan

SDS-polyacrylamide gel electrophoresis (SDS-PAGE):
1. Principle A method of separating proteins into polypeptide chains. Since SDS binds to a polypeptide and gives a negative charge, it migrates in the positive pole direction regardless of the original charge of the polypeptide chain, and the protein can be separated according to the molecular weight.

2. Items to prepare-30% acrylamide solution (100ml)
acrylamide 29.2g
bis-acrylamide 0.8g
ddH ₂ O to 100ml
・ Lower gel buffer (pH8.8) (100ml)
Tris 18.17g (1.8M)
SDS 0.40g
・ Upper gel buffer (pH6.8) (100ml)
Tris 6.06g (0.8M)
SDS 0.40g
・ 10% ammonium persulfate (APS)
APS 10mg
H ₂ O 100μl
・ N, N, N ', N'-tetramethylethylenediamine (TEMED)
・ 2-propanol
・ 100% TCA (W / v)
・ 2% DOC (sodium deoxycholate)
・ Sample buffer (pH6.8) (100ml)
Tris 0.76g (62.8mM)
SDS 2.30g
100% glycerol 8ml
・ 10 x bromophenol blue solution (BPB solution)
BPB 1mg
100% grycerol 100μl
H ₂ O 900μl
This is used as 10x during sample preparation.
・ Β-mercaptoethanol
・ Acetone
・ 10 x running buffer (1L)
Tris 30g
glycine 144g
SDS 10g
・ Staining solution
coomassie brilliant blue R-280 2.8g
methanol 280ml
acetic acid 80ml
H ₂ O 200ml
・ Destaining liquid
methanol 100ml
acetic acid 100ml
H ₂ O 800ml
・ Gel plate ・ Clip ・ Spacer ・ Comb ・ Migration tank ・ Dyeing and destaining case ・ Hybrid bag

3. Gel preparation After the gel plate is wiped clean with ethanol and water, the gel plate is assembled with a spacer in between. Prepare a lower gel solution with the required composition, add 35% of 10% APS and 5μl of TEMED (each for one gel), mix well, and then pour. After superposing 2-propanol to polymerize the gel, remove 2-propanol and prepare an upper gel solution. Add 10% APS and TEMED and mix well, then pour into a gel plate and insert comb.

4). Sample preparation Samples should be prepared so that the amount of protein per sample is about 8 μg. If it is a protein solution of sufficient concentration, prepare as follows. If not, concentrate the sample.
sample x μl
H ₂ O (8-x) μl
sample buffer 12μl
10 x BPB solution 2μl
β-mercaptoethanol 1μl
total 20μl
These samples are mixed and boiled at 100 ° C. for 5 minutes.
If the sample concentration is insufficient, concentrate the sample with TCA, add the sample to an eppen, and add water to make a total of 1 ml. Add 8 μl of 2% DOC and move the Eppen up and down and mix well. Add 70 μl of 100% TCA, mix well, and leave at room temperature for 10 minutes. Centrifuge at 12000 rpm for 10 minutes, carefully remove the supernatant, and add 800 μl of acetone. After centrifugation at 12000 rpm for 5 minutes, carefully remove the supernatant and dry it up. Add 5 μl of water to make the above sample.

5. Remove the electrophoresis spacer, assemble the gel plate, and place it in the electrophoresis tank filled with running buffer. Pour running buffer from above the electrophoresis tank and apply the sample. Run at a constant voltage of 100V and stop the run when the BPB marker is at the tip.

6). Remove the gel from the staining and destaining gel plate, place it in a case, and leave it for about 1 hour after adding the staining solution. Return the staining solution, lightly wash the gel, and then add the destaining solution.

Western blotting:
1. principle
After SDS-PAGE, the protein is adsorbed on the membrane, and the target protein is detected using a specific antibody of the target protein as a probe. Used for the presence or absence of target protein, quantification, and analysis of apparent molecular weight. Although there is a method using a radioisotope as a detection method, in this embodiment, detection is performed by oxidation chemiluminescence of luminol by horseradish peroxidase.

2. Things to prepare ・ transfer buffer
Tris 21.2g
glycine 100.9g
H ₂ O to 800ml
* Store in this state and add methanol to 20 vol% when using.
・ PBS-T (0.05% Tween20 / PBS)
・ Blocking buffer (8% skim milk (DIFCO))
・ Detection antibody (HRP conjugate)
・ ECLTM Western blotting detection kit (Amersham Pharmacia)
・ Transfer device ・ Membrane (ECLTM Nitrocellulose membrane)
・ Filter paper (Whatman 3MM)

3. operation
Soak two pieces of lower gel filter paper, one membrane, and one large filter paper (size that covers the spacer) in the transfer buffer. Immerse the lower gel after SDS-PAGE in transfer buffer for 30 minutes. The filter paper, filter paper, membrane, gel, and large filter paper are stacked in this order on the transfer device, and transferred at a constant current of 170 mA for 40 minutes. Place membrane in blocking buffer for 1 hour and wash 3 times with PBS-T (15 min, 5 min, 5 min). Apply the membrane to the detection antibody for 30 minutes and wash 3 times with PBS-T (15 minutes, 5 minutes, 5 minutes). After wiping the membrane with Kimwipe, add 1 ml each of detection reagent 1 and 2 of the ECL ™ Western blotting detection kit on the membrane and let stand for 1 minute. Wipe off the detection reagent thoroughly with Kimwipe, and shoot with LAS1000.

Surface plasmon resonance (SPR):
1. As another means for quantitatively evaluating the binding activity in principle, an experiment by surface plasmon resonance was performed. This method irradiates light to an inert metal plate with molecules attached, and measures the difference (SPR angle) between the incident light and reflected light when the surface plasmon wave and the evanescent wave resonate (surface plasmon phenomenon). Is. As the SPR angle increases as different molecules bind to the molecules on the inert metal plate and the mass of the inert metal plate increases, the interaction can be observed by following this.

2. Things to prepare-Surface Plasmon Resonance (SPR)
Activation reagent
EDC (N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimide hydrochloride)
NHS (N-hydroxysuccinimide)
100 μg / ml streptavidin
10 mM acetate buffer
1M ethanolamine hydrochloride sensor chip (CM5)

3. Dissolve the operation streptavidin in ultrapure water to a concentration of 1 mg / ml. Prior to immobilization, 1M sodium acetate solution (pH 5.0) is added to the streptavidin solution to a final concentration of 10 mM, and immobilized on cyclomethyldextran by amino coupling method using an amino coupling kit. An analyte sample is flowed on the sample to be immobilized, and a ligand solution is further flowed.

In this example, a clone in which a peptide (VY8) having an amino acid sequence consisting of VPLRPMTY was presented to HLA-B35, which is a kind of HLA class I, was employed as a target antigen. On the other hand, as a control, HLA-B35 presenting a peptide having the sequence RPQVPLRPMTY was used. For pHLA presenting VY8, X-ray crystal structure analysis has already been completed and the structure is already known (Smith, KJ, Reid, SW, Stuart, DI, McMichael, AJ, Jones, EY, Bell, JI (1996) An altered position of the alpha 2 helix of MHC class I is revealed by the crystal structure of HLA-B * 3501 Immunity 4, 203 -213) and extremely strong cytotoxicity against cells presenting this antigen. The CTLs shown were cloned (Non-patent Document 5), and it was determined that the CDRs of these TCRs were highly likely to be highly sensitive, and were determined as target antigens.

Among the CTL clones highly sensitive to the antigen presenting VY8, those showing high homology to the TCA-α chain were confirmed. Of these, 139 TCR CDRs were transplanted. This clone expresses αβ-type TCR, and the base sequence and amino acid sequence of α chain and the amino acid sequence and nucleotide sequence of β chain of 139 clones are shown in FIG. 1 and FIG. 2, respectively.

Next, among the antibodies produced by the present inventors, the TCR CDR-grafted antibody emphasizes structural stability and expression level in the E. coli expression system rather than antibody clones with high sequence homology. Therefore, the gold surface recognition antibody G4B10, which is a human antibody, was adopted as the VH domain as the most relevant clone. For the same reason, the anti-PHB antibody 3d3, which is a human antibody, was adopted as the VL domain as the VL domain. The amino acid sequences and nucleotide sequences of these regions are shown in FIGS. 3 and 4, respectively.

In general, the binding activity between TCR and antigen is considered to be low, so even if the flexibility is taken into account, a significant structural change upon binding to pHLA becomes an extra energy barrier and may lead to loss of binding force. It was done. Based on this assumption, we thought that it was necessary to transplant so that the phase of the loop was as close as possible before and after CDR transplantation. Therefore, TCR-like antibodies were constructed in consideration of the following matters.
[Points to note when designing]
1. 1. Transplant the CDR of the TCR β chain into the antibody VH domain and the CDR of the TCR α chain into the antibody VL domain due to the similarity of the diversity creation mechanism in the gene reorganization. 2. Transplant so that the numbering of amino acid sequences is equal between CDR and antibody. The structural information of the template TCR and the prepared TCR-like antibody is simulated by homology modeling using SWISS-MODEL (http; // SWISS-MODEL.expasy.org//), superimposed on SWISS PDB Viewer, and the position of the CDR Adjust 4. 4. If the length of the grafted CDR loop is short, insert a part of the CDR sequence possessed by the template antibody, and if it is too long, delete amino acid residues as appropriate. If the CDR loop is still too long or the start position of the CDR region is misaligned, optimize the CDR loop phase while removing residues in the antibody FR region.

  Tables 1 and 2 below show the amino acid sequence of each CDR in the VL domain of the corresponding 139 α chain and anti-PHB antibody 3d3, and the amino acid sequence of each CDR of the corresponding 139 β chain and the VH domain of antibody G4B10. Indicates.

First, the primary sequence of a TCR-like antibody was designed in consideration of the above-mentioned design considerations 1 to 3 (Mutant VH1: SEQ ID NO: 9). Furthermore, as a result of grafting each CDR corresponding to the 139β chain to each CDR of the VH region of antibody G4B10, it was predicted that the CDR1 start point was shifted, and the CDR2 and CDR3 loops were longer than the TCR model. I thought it was necessary.
First, for CDR1, 5 residues were deleted from the C-terminal side of the FR region 1 of the antibody. For CDR2, the Gly residue at position 49 in the antibody framework region was deleted in order to correct the shift of the CDR start point. Furthermore, in order to shorten the CDR loop, we considered deleting two residues from the region where the antibody-derived CDR remains. The amino acid residues in the vicinity of the antibody paratope should be less sterically hindered as well as maintain flexibility, and aspartic acid at positions 45 and 47 was removed. Finally, for CDR3, we considered that C-terminal F108 and F109 play a role in supporting the CDR region, not the TCR paratope, and one of them was deleted. After the adjustment, the CDR loop shapes could be brought close to each other. The amino acid sequence (Mutant VH2: SEQ ID NO: 10) obtained as a result of homology modeling with the redesigned amino acid sequence is shown below. The amino acid sequence surrounded by a square frame is derived from each CDR of TCR, and the underlined amino acid sequence is derived from each CDR derived from an antibody.

  Similarly, the primary sequence of the TCR-like antibody was designed by transplanting each CDR corresponding to the 139α chain into each CDR of the VL region of the anti-PHB antibody 3d3 (Mutant VL1: SEQ ID NO: 11). Since CDR1 and CDR3 were predicted to have very close loop shapes, we considered adjusting only CDR2. This time, since the CDR loop was short, the loop was reconstructed using amino acid residues contained in the CDR of the template antibody. The amino acid sequence (Mutant VL2: SEQ ID NO: 12) obtained as a result of homology modeling with the redesigned amino acid sequence is shown below. The amino acid sequence surrounded by a square frame is derived from each CDR of TCR, and the underlined amino acid sequence is derived from each CDR derived from an antibody.

Next, the region corresponding to the framework (FR) region of each polypeptide that is a component of the TCR-like antibody designed in this way is the base sequence derived from the template antibody, and the transplanted CDR region is the most frequently used in E. coli. High codons were selected and the nucleotide and amino acid sequences of the VH region (gG4B10: FIG. 5) and VL region (g3d3: FIG. 6) of the TCR-like anti-pHLA antibody were determined. Based on the nucleotide sequence determined in this way, total synthesis of genes encoding each region of the TCR-like anti-pHLA antibody was performed by overlap extension PCR using the primers shown below.

After that, each gene was mixed in a microtube to 10 pmol, and subjected to electrophoresis using 2% agarose gel which was subjected to PCR reaction at an annealing temperature of 57 ° C. to 58 ° C. using polymerase KOD ^+. Then, a DNA fragment considered to be the objective was excised and purified. And its purification products, each 2 ^nd PCR using primers B1, B6, A1, A6 striking the ends of said primers was performed. Thereafter, similarly to the 1 ^st PCR, it was excised and purified using 2% agarose gel. The purified gene fragment and the secretory expression vector pRA2 were digested overnight with Nco I / Sac II. The digest was excised and purified by 0.8% agarose gel electrophoresis. Thereafter, ligation was performed using each fragment, and the vector of the present invention into which the gene was inserted was prepared. The outline of the above vector construction is shown in FIG.

139-B1 (SEQ ID NO: 17)
NNNNCCATGGCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAAGTGAAAAAACCGGGCGCGTCAGTGAAAATTTCCTGCAAG

139-B2 (SEQ ID NO: 18)
TGTCCCGGGGCCTGACGCACCCAGTTGATCCAGTAGGTCGCATGGCCGCTTCCAGACGCCTTGCAGGAAATTTTCACTGACGCGCC

139-B3 (SEQ ID NO: 19)
TGCGTCAGGCCCCGGGACAAGGGCTTGAATGGATGTTTCAGAACAACGGCGTGTCTACCCGTTATAGCCCGTCCTTCCAGGG

139-B4 (SEQ ID NO: 20)
GTCGTCAGAACGCAGGCGGCTCAGTTCCATGTAGGCGGTGCTGGTGGAGGTGTCACGGGTCATGGTGACACGGCCCTGGAAGGACGGGCTATAACG

139-B5 (SEQ ID NO: 21)
AGCCGCCTGCGTTCTGACGACACGGCCGTGTATTACTGTGCGAGCAGCCTGGATCTGGTGAGCACCGAAGCGTTTTGGGGCCAAGGCACCACGGTCACC

139-B6 (SEQ ID NO: 22)
NNNNACCCGCGGAACCATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCGCTAGCTGAGGAGACGGTGACCGTGGTGCCTTGGC

139-A1 (SEQ ID NO: 23)
NNNNCCATGGCCGACATCGTGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACC

139-A2 (SEQ ID NO: 24)
GGGCTTTCCCTGGTTCATGTTGATACCAATGTAAATAGCCATAAAAGCCGCTGGTTGCCCGGCAAGTGATGGTGACTCTGTCTCCTACAGATGCAG

139-A3 (SEQ ID NO: 25)
GGTATCAACATGAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAACGCGCTGGATGGCAATTTGCAAGGTGGGGTCACATCAAGGTTCAG

139-A4 (SEQ ID NO: 26)
GTAATAAGTTGCAAAATCTTCAGGTTGCAGAGTGCTGATGGTGAGAGTGAAATCTGTCCCAGATCCACTGCCACTGAACCTTGATGTGACCCCACCTTG

139-A5 (SEQ ID NO: 27)
GCACTCTGCAACCTGAAGATTTTGCAACTTATTACTGTGCGGTGACCGATAACTATGGCGAGAACTTTGTGTTCGGCGGGACCAAAGTGGATATCAAAC

139-A6 (SEQ ID NO: 28)
NNNNCCGCGGCCGCACGTTTGATATCCACTTTGGTCCCGCCGAA

[Manufacturing of TCR-like antibody Fv fragment]
The TCR-like anti-pHLA antibody VL and VH were each prepared separately using the expression vector obtained in Example 1, and these were subsequently confused to produce the TCR-like antibody Fv. First, BL21 (DE3) strain was transformed with each vector, and cultured with shaking at 250 ml scale to OD ₆₀₀ ≈0.8. Thereafter, expression was induced by adding isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 1 mM. Since expression as an insoluble granule was observed, it was solubilized with a Tris-HCl solution containing 5 mM imidazole and 6 M guanidine hydrochloride. The purity of the 100 mM imidazole elution fraction after purification by metal chelate affinity chromatography was confirmed by sodium lauryl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (FIG. 8).

From the results of SDS-PAGE, it was judged that both VH and VL fragments were purified to high purity. The elution fractions were mixed in an equal amount so that each amount was 40 μM, and a rewinding operation by a step dialysis method was performed. The solubilization rate was about 60%.

  The unwinded product was subjected to gel filtration chromatography using Superdex75 and SDS-PAGE to analyze multimer formation. The results are shown in FIG. 9 and FIG. Equal fractions of VL and VH fragments were confirmed in the elution fraction of (2) in FIG. 9. This elution fraction was designated as Fv, and the produced TCR-like antibody was heterozygous in the same manner as Fv of the natural antibody. Confirmed to form a body. In (3), VH and VL domain monomers were detected, and it was observed that they could exist stably after CDR grafting alone.

  Subsequently, formation of the secondary structure of the prepared Fv was evaluated by CD spectrum measurement. The results are shown in FIG. 11 below. The TCR-like antibody Fv was used for the measurement after concentrating the dimer fraction after gel filtration. As a control, a gold surface recognition antibody Fv G4B10-b2 that was secreted and expressed in the culture supernatant and whose secondary structure was guaranteed was employed. A characteristic waveform as shown in Table 3 below appeared due to the difference in spectral absorption due to the secondary structure.

Fv used as a control remarkably represented the minimum near 217 nm derived from the β sheet. On the other hand, although the prepared TCR-like antibody could not confirm a clear maximum or minimum in the vicinity, the waveform near 200 nm showed a behavior different from that of a normal random coil. This suggests that multiple structures are mixed in the purified product, or that Fv is slightly randomized. It cannot be determined at this stage whether this phenomenon is due to a decrease in the total amount of b structure associated with CDR grafting or due to molecules denatured during the concentration process. Immediately after gel filtration, it was confirmed to exist as a complete heterodimer, and the presence of a certain amount of β sheet was predicted. In addition to these, it is considered that the result suggests inclusion of a random coil.

[Preparation of single chain antibody scFv]
From the results of Example 2, it was considered that complementation of the interaction between VH-VL domains of the TCR-like anti-pHLA antibody leads to the construction of a molecule having a more secondary structure. Specifically, a single chain antibody scFv in which VH-VL is linked by a polypeptide linker is constructed, and it is considered that weak VH-VL interaction is promoted by structural constraints, and the state of association is improved. Next, an attempt was made to construct a single-chain antibody scFv.

First, for the TCR-like antibody VH domain, gene amplification of the gene portion was performed using the primers 139-B1 and 139-B6 described above. For the TCR-like antibody VL domain, a primer G4B10-3d3scFv3rd encoding the C-terminal sequence of VH, the G3 linker (Gly ₄ Ser) ₃ , and the N-terminus of the VL fragment was designed, and gene amplification was performed using 139-A6 Went. Using each of the PCR amplified fragment and the 139-B1,139-A6, it was 2 ^nd PCR. The amplified fragment was digested with Nco I / Sac II and cloned into the secretory expression vector pRA1. FIG. 12 shows a vector map of the constructed single chain antibody scFv.

G4B10-3d3scFv3rd (SEQ ID NO: 29)
CACCACGGTCACCGTCTCCTCAGGCGGGGGCGGTAGCGGCGGTGGCGGGTCGGGCGGTGGCGGATCCGACATCGTGATGACCCAGTCTCCATC

Escherichia coli BL21 (DE3) strain was transformed with the thus constructed single-chain antibody vector, and shaking culture was performed on a 250 ml scale to OD ₆₀₀ ≈0.8. IPTG was added to a final concentration of 1 mM to induce expression. In order to confirm the expression as an insoluble fraction in the cells, solubilization was performed with a Tris-HCl solution containing 5 mM imidazole and 6 M guanidine hydrochloride. After purification by metal chelate chromatography, SDS-PAGE was performed using the 100 mM imidazole elution fraction, and the degree of purification was confirmed. As a result, it was confirmed by SDS-PAGE that a high-purity protein solution could be prepared (Fig. 13).

This 100 mM imidazole elution fraction was diluted to 10 μM, and then unwinding was performed using a step dialysis method. Using the unwound product, gel filtration chromatography with Superdex 75 (FIG. 14) and SDS-PAGE (FIG. 15) were performed. From this result, it was clarified that the eluted fractions of (4) and (5) were considered as monomers, and the prepared TCR-like antibody scFv could be prepared as a monomer.

Next, after concentrating the eluted fraction of the TCR-like antibody scFv monomer, CD spectrum measurement was performed to evaluate its secondary structure. The results are shown in FIG. As a control, scFv (G4B10-G3 linker-3d3) in a state where no CDR was transplanted was prepared under the same conditions as those for unwinding the TCR-like antibody and used for measurement. In scFv in which VH-VL domains are linked by a linker, an increase indicating a b structure near 200 nm was clearly observed compared to Fv, and it can be said that a molecule rich in β structure could be prepared.

[Preparation of single chain antibody scFv]
Next, an attempt was made to prepare a TCR-like antibody scFv that can be immobilized on a substrate as a ligand. There are few lysine residues contained in both VH and VL domains, and there are few residues that give side chains to the solvent surface. When the antibody is immobilized by amine coupling, it may cause loss of binding ability or structural change. I was reminded. Therefore, it is thought that maintaining the heterodimeric structure and good orientation can be achieved if the Lys residues that are abundant on the biotin fusion tag are predominantly bound during amine coupling. ScFv was prepared.

First, the vector constructed in Example 1 was digested with Nco I / Sac II, then recombined with the biotin tag fusion vector pRA biotag, and the scFv gene was inserted in place of the VH fragment contained in this biotin tag fusion vector. The vector was constructed. After confirming the expression as intracellular insoluble granules, solubilized with a Tris-HCl solution containing 5 mM imidazole and 6 M guanidine hydrochloride, scFv was prepared according to the same procedure as in Example 3. The solubilization rate after purification was about 100%.

FIG. 18 and FIG. 19 show the results of SDS-PAGE using each elution fraction when performing metal chelate chromatography and gel filtration chromatography using Superdex75. It was confirmed that the biotin fusion antibody scFv could be prepared as a monomer (FIGS. 19, (3), (4)). Furthermore, the result of SDS-PAGE of each fraction after gel filtration chromatography is shown (FIG. 20). Using the prepared elution fraction of scFv monomer, it was mixed with 1/8 molar equivalent of streptavidin (SIGMA), and further mixed gently at 4 ° C. overnight to prepare a tetramer. . Thereafter, the results of rechromatography with superdex200 are shown in FIG. When scFv is used, there is no fear of dissociating Fv. Therefore, the fraction of * eluted without being rejected by the size exclusion fraction is expected to be a tetramer of scFv.

[Evaluation of binding activity using TCR-like antibody scFv]
pHLA tetramer was added as an analyte. The production procedure of pHLA tetramer was obtained by adding 1/8 molar equivalent of streptavidin divided into 10 times per hour and then inverting and mixing overnight. The scFv monomer prepared through gel filtration was fixed to 3306RU on the sensor chip by amine coupling. The result of the SPR test is shown in FIG. 22 below.

The immobilized TCR-like antibody scFv showed a concentration-dependent binding activity to the analyte pHLA tetramer (the response value increased as the pHLA tetramer concentration increased). An attempt was made to fit the binding curve, but it was not fit because it was different from the normal binding model. Compared with the 1: 1 Langumuir binding model, it is suggested that the sensorgram is a composite of two-phase bonds: early binding immediately after injection and fast dissociation, and slow and slow dissociation observed during injection. .

The general TCR-pHLA interaction is said to exhibit the property of fast bond dissociation rate, and the former matches the target binding phase as a reflection of the CDR characteristics of TCR. However, Rheinnecker et al.'S multivalentization and verification of the binding speed give the knowledge that the complexization of the bonded phase accompanying multivalentization (Rheinnecker, M., Hardt, C., Ilag, LL, Kufer, P., Gruber, R., Hoess, A., Lupas, A., Rottenberger, C., Plueckthun, A., Pack, P. (1996) Multivalent antibody fragments with high functional affinity for a tumor-associated carbohydrate antigen J. Immunol 157 (7 ) 2989-2997). Therefore, it can be understood that the latter combination is a change in the target combination due to factors such as the collision frequency.

[Flow cytometry (FCM) using streptavidin fusion beads]
Since the binding activity of the TCR-like antibody scFv was shown in Example 5, the scFv binding activity was confirmed in a measurement system using FCM. TCR-like antibody tetramer was applied to FCM using streptavidin fusion beads reported by Anderson et al. (Anderson, LN, Haines, LR, Pearson, TW (2003) An Effective and Rapid Methods for Functional Characterization of Immunoadsorbents Using POROS Beads and Flow Cytometry J. Proteome 3, 228-234). Binding activity was detected using the tetramer fraction of scFv constructed in Example 4 and streptavidin fusion beads solidified with pHLA. The beads were mixed with an antigen pHLA solution prepared in excess of the binding capacity for 1 hour, and washed twice with PBS-Tween20 (0.5%). Multivalent antibodies were produced using PE-labeled streptavidin (Invitrogen). The scFv tetramer and pHLA ⁺ beads were mixed in ice, and the fluorescence intensity of the beads was detected using a FACS Caliber (Becton Dickinson). The obtained results are shown in FIG. Also in FCM, it was supported that the TCR-like antibody scFv has a binding activity to the target antigen. Furthermore, nonspecific binding by strreptavdin is not dominant, and the possibility that TCR-like antibody scFv has nonspecific interaction with streptavidin was newly shown.

Similar experiments were performed using Fv. The results are shown in FIG. Analysis using Fv confirms weak binding to pHLA, but it is very inferior to scFv. Therefore, it can be said that the result of this experiment also reflected that the linker was effective.

[SPR test using pHLA monomer as analyte]
Although the binding activity of the TCR-like antibody scFv was confirmed from FIG. 22, a binding curve that could not be assigned to two-phase binding and was not suitable for kinetic analysis was obtained. In order to confirm that the binding phase showing a slow bond dissociation rate is derived from the multivalent effect as described above, and to obtain a binding curve that can withstand the binding activity evaluation, an SPR test using an analyte as the pHLA monomer was conducted. went. In addition, for immobilization of scFv, in order to immobilize in a milder state, it is immobilized on the substrate via Streptavidin on the scFv fused with biotin, and further fixed at a measurement temperature of 10 ° C, the minimum recommended detection temperature. It was set so as to suppress denaturation of the modified scFv as much as possible. The obtained sensorgram is shown in FIG. 25 and FIG.

Also in this measurement system, it was confirmed that the TCR-like antibody scFv and the target pHLA showed significant binding. In addition, the binding phase with fast dissociation showed significant concentration dependence, and this was regarded as TCR-like binding. Using FIG. 25, fitting with a 1: 1 Langumuir binding model was performed, but it did not fit. However, since the binding phase with fast bond dissociation was assigned as a TCR-like bond that does not include multivalent effects, we attempted to analyze the bond dissociation equilibrium constant from the Scatchard plot in the equilibrium state.

In FIG. 27, in order to shorten the time for the binding to reach equilibrium, a highly concentrated analyte solution was prepared and measured. It was confirmed that the binding activity was concentration-dependent (the response value increased as the pHLA monomer concentration increased). A Scatchard plot was performed immediately before the end of injection as an equilibrium value, and a binding parameter of K _D = 1.2 × 10 ⁻⁴ M was obtained. FIG. 28 shows the results of the Scatchard plot.

In FIG. 26, in order to obtain an equilibrium state of binding, the analyte concentration, injection time, and antigen immobilization amount were devised, but no equilibrium state was created. The non-specific interaction of pHLA with streptavidin can be considered as a cause of not reaching the equilibrium state. Empirically, it is known that pHLA and streptavidin interact non-specifically. In fact, when we look at Jones et al. And Weber et al. The bond dissociation equilibrium constant is calculated based on non-sensorgram (Jones, LL, Brophy, SE, Bankovich, AJ, Colf, LA, Hanick, NA, Garcia, KC, Kranz, DM (2006) Engineering and Characterization of a Stabilized a1 / a2 Module of the Class I Major Histcompatibility Complex Product L ^d J. Mol. Biol 281 (35), 25734-25744; Weber, KS, Donermeyer, DL, Allen, PM, Kranz, DM (2005) Class II -restricted T cell receptor engineered in vitvo for higher affinity retains peptide specificity and function Proc. Natl. Acad. Sci. USA 102 (52), 19033-19038). In the present embodiment as well, a Scatchard plot was created on the assumption that a state just before the end of injection was a pseudo equilibrium state. The results are shown in FIG. 28, and it is considered that a certain degree of accuracy is added to the calculated dissociation equilibrium constant because of the correlation between the binding values.

[Evaluation of antigen specificity of TCR-like antibody]
Antigen specificity of the TCR-like antibody scFv was evaluated using the same SPR test measurement system. In this section, the analyte concentration was fixed at 39 μM, and target pHLA (VY8) and control pHLA (RY11) were added. The amino acid sequence of RY11 is “RPQVPLRPMTY”. The results are shown in FIG.

  A binding phase with a fast binding rate specific to the target pHLA was confirmed. However, the binding phase was not observed with pHLA as a control. This measurement result shows that the TCR-like antibody scFv has the specificity to discriminate the difference of 3 residues of the displayed peptide, and supports the above-mentioned assignment that the binding with a high binding speed is the TCR-like binding mode. It can be said that.

In addition, a difference was observed between the target antigen and the control for the binding phase showing a slow binding rate. In general, it is known that there is a certain cross-activity between TCR and pHLA, and a TCR-like antibody may show the same cross-activity. At the same time, if the two-step binding mode of TCR-pHLA interaction proposed by Wu et al. Is also dependent, it is possible that the interaction with the HLAa chain, which is a common part other than the peptide, has been detected (Wu, LC , Tuot, DS, Lyons, DS, Garcia KC, Davis, MM (2002) Two-step binding mechanism for T-cell receptor recognition of peptide MHC Nature 418, 552-6
). In fact, it is suggested that there is a difference in the three-dimensional structure of the peptide between the crystal structure analysis data of pHLA presenting VY8 and the structure of RY11 that was modeled based on it, and this binding phase is not TCR-like. It is thought that the vicinity of the α helix that forms the peptide-accommodating groove is involved. Thus, it was confirmed that the TCR-like antibody scFv has specificity for discriminating amino acid differences of 3 residues.

  HLA class I plays an important role in the immune response by CTL. Recent reports have shown that cancer antigens are also presented to HLA, and CTLs attack cancer cells based on their antigen recognition. Therefore, a TCR-like anti-pHLA antibody such as scFv antibody having the ability to recognize TCR antigens composed of the polypeptide of the present invention bears the same mechanism, and has a cancer cytotoxic effect by inducing antibody-dependent cytotoxic activity. I can expect. In addition, autoimmune diseases that develop due to reduced immune tolerance function and rejection of transplanted fragments, which are the subject of transplantation medicine, are mainly caused by pHLA, and such TCR-like anti-pHLA antibodies may act as antagonist antibodies. If possible, it is thought that an inflammation relieving effect can be obtained. Thus, the polypeptide of the present invention and the TCR-like anti-pHLA antibody have the potential to be applied to molecular target therapy and drug delivery.

The amino acid sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) of the α chain of 139 clones of TCR are shown. Each CDR is an amino acid sequence surrounded by a square frame. The nucleotide sequence (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of the 139 clone TCR β chain are shown. Each CDR is an amino acid sequence surrounded by a square frame. The nucleotide sequence (SEQ ID NO: 5) amino acid sequence (SEQ ID NO: 6) of the VH domain of the gold surface recognition antibody G4B10 is shown. Each CDR is an amino acid sequence surrounded by a square frame. The nucleotide sequence (SEQ ID NO: 7) amino acid sequence (SEQ ID NO: 8) of the anti-PHB antibody 3d3 VL domain is shown. Each CDR is an amino acid sequence surrounded by a square frame. The base sequence (SEQ ID NO: 13) and amino acid sequence (SEQ ID NO: 14) of the VH region of the TCR-like anti-pHLA antibody are shown. Each CDR is an amino acid sequence surrounded by a square frame. The base sequence (SEQ ID NO: 15) and amino acid sequence (SEQ ID NO: 16) of the VL region of the TCR-like anti-pHLA antibody are shown. Each CDR is an amino acid sequence surrounded by a square frame. The outline | summary of the vector construction which expresses polypeptide of this invention is shown. The result of solubilizing the expression product as an insoluble granule in the cell and confirming the purity by sodium lauryl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is shown. The result of the gel filtration chromatography using Superdex75 with respect to a rewinding product is shown. The result of SDS-PAGE after the gel filtration chromatography of the unwinding product is shown. The result of CD spectrum measurement of the prepared TCR-like anti-pHLA antibody Fv is shown. The structure of the vector of the single chain antibody scFv is shown. The result of solubilizing the expression product as the TCR-like antibody scFv and confirming the purity by sodium lauryl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is shown. The result of the gel filtration chromatography using Superdex75 with respect to the rewinding product of TCR like antibody scFv is shown. The result of SDS-PAGE after the gel filtration chromatography of the unwinding product of TCR-like antibody scFv is shown. The results of CD spectrum measurement of the prepared TCR-like antibody scFv are shown. The structure of a biotin tag fusion vector is shown. The results of solubilizing an expression product as a biotin fusion antibody scFv and confirming the degree of purification by sodium lauryl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) are shown. The result of the gel filtration chromatography using Superdex75 with respect to the unwinding product of biotin fusion antibody scFv is shown. The result of SDS-PAGE after the gel filtration chromatography of the unwinding product of biotin fusion antibody scFv is shown. The result of re-chromatography with tetramer superdex200 is shown. The result of bead labeling experiment using TCR-like antibody scFv tetramer is shown. The result of bead labeling experiment using TCR-like antibody scFv tetramer is shown. The result of bead labeling experiment using TCR-like antibody Fv tetramer is shown. The result of the SPR test in the measurement system using pHLA monomer as the analyte is shown. The result of an SPR test (after reference cell pointing) in a measurement system using pHLA monomer as an analyte is shown. The result of the SPR test which made pHLA monomer an analyte for equilibrium value calculation is shown. The result of a Scatchard plot is shown. The result of antigen specificity evaluation of TCR-like antibody scFv is shown.

Claims (25)

A polypeptide comprising an antibody variable region having the amino acid sequence of each CDR region of TCR in each corresponding CDR region. The polypeptide according to claim 1, which is a TCR of a human T cell exhibiting specificity for a peptide derived from a viral protein bound to HLA class I. The polypeptide according to claim 2, wherein the viral protein is nef of HIV virus. The polypeptide according to claim 3, wherein the peptide derived from the HIV virus nef protein consists of the amino acid sequence: VPLRPMTY. The polypeptide according to any one of claims 1 to 4, wherein HLA class I is HLA-B35. The polypeptide according to any one of claims 1 to 5, comprising a variable region of an antibody heavy chain having the amino acid sequence of the CDR region of the TCR β chain in the CDR region. The polypeptide according to claim 6, wherein the amino acid sequence of the variable region of the antibody heavy chain is represented by SEQ ID NO: 1. Amino acid sequence of each CDR region of the TCR β chain shown below:
The polypeptide according to claim 6 or 7, which has at least one amino acid sequence selected from (1) CDR1: SGHAT; (2) CDR2: FQNNGV; and (3) CDR3: ASSLDLVSTEAFF. The polypeptide according to claim 8, which consists of the amino acid sequence represented by SEQ ID NO: 10 or SEQ ID NO: 14. The polypeptide according to any one of claims 1 to 5, comprising a light chain antibody variable region having the amino acid sequence of the CDR region of the TCR α chain in the CDR region. The polypeptide according to claim 10, wherein the amino acid sequence of the variable region of the antibody light chain is represented by SEQ ID NO: 2. Amino acid sequence of each CDR region of the α chain of TCR shown below:
The polypeptide according to claim 10 or 11, which has at least one amino acid sequence selected from (1) CDR1: TSGFYG; (2) CDR2: NALDG; and (3) CDR3: AVTDNYGQNFV. The polypeptide according to claim 12, comprising the amino acid sequence represented by SEQ ID NO: 12 or SEQ ID NO: 16. The Fv antibody which has the antigen recognition ability of TCR which consists of the polypeptide as described in any one of Claims 6-9, and the polypeptide as described in any one of Claims 10-13. An scFv antibody having the ability to recognize TCR antigens, comprising a single-chain polypeptide comprising the polypeptide according to any one of claims 6 to 9 and the polypeptide according to any one of claims 10 to 13. . The amino acid sequence of each CDR region corresponding to the TCR is transplanted into each CDR region of the antibody variable region, the obtained polypeptide and the structural information of the TCR are simulated by homology modeling, and the position of the CDR loop is determined based on the result. The method for designing an amino acid sequence of a polypeptide or antibody according to any one of claims 1 to 15, comprising optimization. A nucleic acid molecule encoding the amino acid sequence of the polypeptide or antibody according to any one of claims 1 to 15. A nucleic acid molecule encoding an amino acid sequence designed based on the method according to claim 16. A nucleic acid molecule encoding the polypeptide according to claim 9, which consists of the base sequence represented by SEQ ID NO: 13. The nucleic acid molecule encoding the polypeptide according to claim 13, comprising the base sequence represented by SEQ ID NO: 15. A nucleic acid molecule encoding the scFv antibody of claim 15. A replicable cloning vector or expression vector containing the nucleic acid molecule according to any one of claims 17-21. A method according to any one of claims 1 to 15, comprising culturing a host cell transformed with the vector of claim 22, expressing the nucleic acid in the host cell, recovering and purifying the single-chain polypeptide. A method for producing the polypeptide or antibody according to Item. A pharmaceutical composition comprising the polypeptide or antibody according to any one of claims 1 to 15 as an active ingredient. A probe, detection means or test reagent for a complex of HLA and a target antigen peptide, comprising the polypeptide or antibody according to any one of claims 1 to 15.

Images