US20180155764A1 - Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same - Google Patents

Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same Download PDF

Info

Publication number
US20180155764A1
US20180155764A1 US15/576,923 US201615576923A US2018155764A1 US 20180155764 A1 US20180155764 A1 US 20180155764A1 US 201615576923 A US201615576923 A US 201615576923A US 2018155764 A1 US2018155764 A1 US 2018155764A1
Authority
US
United States
Prior art keywords
target nucleic
nucleic acid
target
temperature
value
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/576,923
Inventor
Takashi Nagano
Kensuke MIYAJIMA
Kenji Narahara
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mizuho Medy Co Ltd
Original Assignee
Mizuho Medy Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mizuho Medy Co Ltd filed Critical Mizuho Medy Co Ltd
Assigned to MIZUHO MEDY CO., LTD. reassignment MIZUHO MEDY CO., LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MIYAJIMA, Kensuke, NAGANO, TAKASHI, NARAHARA, KENJI
Publication of US20180155764A1 publication Critical patent/US20180155764A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/107—Temperature of melting, i.e. Tm
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence

Definitions

  • the present invention relates to a detection kit for improving the PCR method and further for measuring multiple target nucleic acids, and art related to the same.
  • the multiple target nucleic acids may be: a first pair of influenza A viruses and influenza B viruses; a second pair of influenza and RSV/human metapneumovirus; a third pair of Chlamydia trachomatis and Nisseria gonorrhoeae , which may cause sexually transmitted diseases; a fourth pair of Mycoplasma pneumoniae and resistance factor thereof; and so on.
  • the conditions of patients are similar to each other and also infection of the same expands simultaneously. So, it is conceivable to distinguish the multiple target nucleic acids from each other to make a diagnosis, thereby deciding on a course of treatment.
  • Considering the resistance factor is effective for selecting/judging medication against thereto, or the like.
  • a first process of performing independent measurement for each of the multiple target nucleic acids, respectively, and a second process of distinguishing the multiple target nucleic acids from each other by means of different pilot dyes or the like, respectively can be conceived.
  • the melting curve analysis method after having simultaneously processed amplification reaction.
  • temperature is gradually increased/decreased to make distinction and judgment with respect to the multiple target nucleic acids based on both of first temperature wherein a change rate of fluorescent signals shows a peak and second temperature wherein the target nucleic acid is melt (the melting curve analysis method).
  • the first process of performing the independent measurement requires long time and high costs.
  • the second process of distinguishing different labeling substances from each other costs too much because the second process needs not only preparing plural kinds of labeled reagents but also complicated wavelength-setting in an analyzer.
  • a case by means of the melting curve analysis method costs less than the above. However, since the temperature must be gradually changed, it is necessary to take about 5 to 10 minutes for changing the temperature in order to conduct precise analysis.
  • Reference 1 Japanese application Laid-open No. 2002-136300 discloses: preparing a plurality of reaction vessels containing different reaction solution from each other; and performing amplification and detection with the plurality of reaction vessels, respectively.
  • Reference 2 Japanese application Laid-open No. 2004-203 discloses simultaneously amplifying multiple genes by means of one reaction vessel containing one kind of reaction solution.
  • Distinction is carried out by using different pilot dyes for each of the multiple genes. So, a plurality of optical systems installed in an analyzer are needed as many as the used pilot dyes. In other words, the analyzer costs too much. This is a serious problem.
  • Reference 3 Japanese application Laid-open No. 2008-173127 discloses simultaneously amplifying multiple genes by means of one reaction vessel containing one kind of reaction solution.
  • Dissociation temperature of PCR products and labeled probes should be changed for every gene. After amplification, while temperature is gradually increased from a lower temperature side to a higher temperature side, dissociation curve analysis, which is a synonym of “melting curve analysis”, of monitoring fluorescence values is carried out. Distinction is carried out by monitoring existence or nonexistence of a peak depending on base sequence at the respective dissociation temperature.
  • Reference 4 Japanese unexamined patent application publication ⁇ Translation of PCT application> No. 2012-513215 discloses simultaneously amplifying multiple genes by means of one reaction vessel.
  • Dissociation temperature of PCR products and melting temperature of primers are changed for every gene. Distinction is carried out by monitoring fluorescence at the respective melting temperature.
  • one cycle includes: a denaturation step; and an annealing and elongation step.
  • the melting temperature of PCR products is changed for every gene. Accordingly, too many conditions should be taken into consideration, design of the profile is also difficult, and time for measurement must be too long.
  • an object of the present invention is to provide a kit for detecting multiple target nucleic acids capable of simultaneously amplifying and detecting multiple genes by means of one reaction vessel containing one kind of reaction solution and one label.
  • a first aspect of the present invention provides a kit for together detecting multiple target nucleic acids differing from each other, comprising: solution, the multiple target nucleic acids including a first target nucleic acid and a second target nucleic acid; defining: T 0 as denaturation temperature; T 1 as annealing temperature; T 2 as elongation temperature; and T 3 as second target detection temperature, T 0 through T 3 being set up such that a condition that T 0 is higher than T 2 ; T 2 is not lower than T 1 ; and T 1 is higher than T 3 is satisfied, the solution being capable of containing the first target nucleic acid and the second target nucleic acid therein, at the denaturation temperature T 0 , first double-stranded hydrogen bond of the first target nucleic acid being cut off to be dissociate into first two single strands, second double-stranded hydrogen bond of the second target nucleic acid being cut off to be dissociate into second two single strands, respectively, the solution further containing therein:
  • each of the first labeling substance and the second labeling substance is selected from a group consisting of: a QProbe (registered trademark) probe; an Eprobe (registered trademark) probe; and a TaqMan (registered trademark) probe.
  • the fluorescent signals may be shown by quenching light when the annealing occurs. Alternatively, the fluorescent signals may be shown by emitting light when the annealing occurs.
  • the first target nucleic acid is at least one of a Mycoplasma pneumoniae P gene and a Chlamydia trachomatis endogeneous plasmid gene
  • the second target nucleic acid is at least one of internal control composition and a Nisseria gonorrhoeae CMT gene, respectively.
  • the multiple target nucleic acids can be detected by means of one kind of mixed-solution and one kind of labeling substances.
  • Distinction of the multiple target nucleic acids can be carried out without melting curve analysis. Accordingly, measuring time can be remarkably shortened, thereby providing excellent practical performance.
  • the present inventors have developed a kit for detecting nucleic acids by means of one kind of fluorescent labels and one reaction vessel containing one kind of reaction solution. Condition setting with respect to annealing temperature of probes and temperature change profiles in the PCR method has been incorporated within the present kit.
  • the present kit uses four kinds of temperature including: denaturation temperature T 0 (95 Centigrade); annealing temperature T 1 (70 Centigrade); elongation temperature T 2 (72 Centigrade); and second target detection temperature T 3 (55 Centigrade).
  • the multiple target nucleic acids are a first target nucleic acid and a second target nucleic acid.
  • a third target nucleic acid or more can be added thereto by adding further setting such as third target detection temperature T 4 (T 3 >T 4 ), or the like.
  • a first target nucleic acid 10 and a second target nucleic acid 20 are targets to be detected.
  • the solution 2 does not contain the at least one of the first target nucleic acid 10 and the second target nucleic acid 20 . Therefore, fluorescent signals and amplification regarding the not contained target nucleic acid will not be carried out in the following explanation.
  • the temperature is decreased from the denaturation temperature T 0 to reach the annealing temperature T 1 , regarding the first target nucleic acid 10 , a first target's F-primer 13 specifically bonds with a complementary sequence of the first single strand 11 , and a first target's R-primer 14 specifically bonds with another complementary sequence of the second single strand 12 , respectively.
  • a second target's F-primer 23 specifically bonds with a complementary sequence of the first single strand 21
  • a second target's R-primer 24 specifically bonds with another complementary sequence of the second single strand 22 , respectively.
  • the first target's probe 15 labeled by means of the first labeling substance 16 specifically bonds with a specific part of the first single strand 11 derived from the first target nucleic acid 10 , thereby the first labeling substance 16 outputs first fluorescence signals.
  • the annealing temperature T 1 is higher than the second target detection temperature T 3 .
  • the second target's probe 25 labeled by means of the second labeling substance 26 does not bond with the first single strand 21 derived from the second target nucleic acid 20 , thereby the second labeling substance 26 outputs no fluorescence signal at this time.
  • the deoxyribonucleoside triphoshate 31 bonds therewith to elongate, respectively.
  • the deoxyribonucleoside triphoshate 31 bonds therewith to elongate, respectively.
  • the first target's probe 15 labeled by the first labeling substance 16 specifically bonds with a specific part of the first single strand 11 derived from the first target nucleic acid 10 , and the first fluorescent signals of the first labeling substance 16 change. This is the same as that of FIG. 37 ( b ) .
  • the temperature is the second target detection temperature T 3 . Accordingly, also the second target's probe 25 labeled by the second labeling substance 26 bonds with the first single strand 21 derived from the second target nucleic acid 20 , and the second fluorescent signals of the second labeling substance 26 also change.
  • first labeling substance 16 and the second labeling substance 26 are identical.
  • the multiple target nucleic acids can be respectively detected during a series of continuing steps by means of the reaction vessel containing one kind of reaction solution.
  • Embodiments of detecting multiple nucleic acids by means of three kinds of probes will now be explained more concretely.
  • the QProbe (registered trademark) method the Eprobe (registered trademark) method, and the TaqMan (registered trademark) method have been used.
  • Necessary information for operation including: primer sequences; base sequences of the respectivEprobes; and material of nucleic acid samples will be also shown.
  • a pair of primers used for the PCR method in Embodiment 1 are as shown in Table 1.
  • sequence No. 1 and sequence No. 2 (primer pair for P adhesin gene) sequences recited in the report (The Journal Of Infectious Diseases, 1996; 173; 1445-52) by leven et al. have been used.
  • Mycoplasma pneumnoniae is a pathogenic organism of Mycoplasma pneumonia.
  • P protein is membrane protein derived from Mycoplasma pneumoniae .
  • Gene fragments (sequences amplified by a pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2) encode the P1 protein.
  • pMYC is a plasmid DNA produced by artificial synthesizing the gene fragments to be incorporated into a pMD20T vector. Production of the plasmid DNA has been performed by requesting custom synthesis to the Takara Bio Inc.
  • pICM5 is a plasmid DNA produced by artificial synthesizing a sequence including a complementary sequence to the pair of the primers to be incorporated into a pMD20T vector. Production of the plasmid DNA has been performed by requesting custom synthesis to the Takara Bio Inc.
  • First length of the pMYC plasmid is 2942 [bp]
  • second length of the pICM5 plasmid is 2886 [bp].
  • the number of copies per 1 [ ⁇ l] has been calculated. After that, by means of TE buffer solution (10 [mM] Tris-HCl, 1.0 [mM] EDTA pH: 8.0), the pMYC plasmid has been diluted to be 1 ⁇ 10 [copies/ ⁇ l], and the pICM5 plasmid has been diluted to be 1 ⁇ 10 [copies/ ⁇ l], respectively.
  • MYC QP is one QProbe specifically annealing the pMYC plasmid
  • IC QP is another QProbe specifically annealing the pICM5 plasmid.
  • fluorescent dye for both of “MYC QP” and “IC QP” “BODIPY FL” (registered trademark) has been used to label “C” at 3′ ends, respectively.
  • Production of the QProbes has been performed by requesting custom synthesis to the NIPPON STEEL & SUMIKIN Eco-Tech Corporation.
  • a first Tm value for “MYC QP” that is the QProbe specifically annealing the pMYC plasmid of the first target is set up to be higher than another Tm value for the primers to perform first detection during amplification reaction.
  • a second Tm value for “IC QP” that is the QProbe specifically annealing the pICM5 plasmid of the second target is set up to be lower than changes (70 Centigrade to 95 Centigrade) of temperature during the amplification reaction to perform second detection after the amplification reaction.
  • Table 3 and Table 4 show composition of the PCR reaction solution and the reaction conditions respectively, and FIG. 1 shows a graph of the changes of temperature of the mixed solution.
  • Light Cycler nano system (registered trademark of the Roche Diagnostics K.K.) has been used.
  • the combination of 510 to 528 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement. Fluorescence values have been measured at the denaturation step (95 Centigrade) and the elongation step (72 Centigrade) for every cycle. Furthermore, after the amplification reaction has been completed, at a step for detecting the second target (95 Centigrade and 55 Centigrade), fluorescence measurement has been performed.
  • FIG. 2 shows fluorescent measurement conditions at the final cycle of the amplification reaction and at the second target detection step.
  • fn fluorescence intensity value in n cycle calculated according to Formula 1
  • fhyb.n fluorescence intensity value at the elongation step in n-th cycle
  • fden.n fluorescence intensity value at the denaturation step in n-th cycle
  • fe fluorescence intensity value at the second target detection step calculated according to Formula 1′
  • fhyb.e fluorescence intensity value (55 Centigrade) at the second target detection step
  • fden.e fluorescence intensity value (95 Centigrade) at the second target detection step.
  • Fn relative value in n-th cycle assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 1 is equal to a value of “1”
  • Fe relative value at the second target detection step assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 1′ is equal to a value of “1”.
  • F44 which is a value of Fn at the final cycle of the amplification reaction has been used for judgment of the existence or nonexistence of the first target nucleic acid.
  • Fs measured value regarding the second target.
  • Fs has been used for determination of the existence or nonexistence of the second target nucleic acid.
  • the F44 value of the measurement sample has been compared with Threshold 1. And, when the F44 value of the measurement sample is lower than Threshold 1, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • Threshold 1 an average of F44 values of the negative reference (reagent TE buffer added thereto instead of DNA) minus three times the standard deviation (hereinafter, called as “mean ⁇ 3SD”) has been used.
  • the Fs value has been compared with Threshold 2, and when the Fs value is lower than Threshold 2 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • FIG. 3 shows a flow chart of the determination method related thereto.
  • the pMYC plasmid has been used for Mycoplasma pneumoniae P1 genes
  • the pICM5 plasmid has been used for the internal control composition
  • the PCR has been performed thereon.
  • a first Tm value of 72.5 Centigrade has been set for a sequence of MYC QP, and a second Tm value of 57.5 Centigrade has been set for a sequence of IC QP. For this reason, it has been estimated that probes anneal only MYC QP during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • Table 5 shows the value of the Fs.
  • the amplification curve is shown in FIG. 6 .
  • the value ⁇ 0.116 of Fs is lower than Threshold 2, and it has been revealed that the 1.5 objective region of the pICM5 plasmid has been amplified.
  • Table 5 shows the value of the Fs.
  • the amplification curve related thereto is shown in FIG. 7 .
  • Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with the QProbe method.
  • the primers, probes, reaction solution composition, and nucleic acids have been used for the PCR method as the same as Embodiment 1.
  • Table 6 shows reaction conditions in Embodiment 2.
  • FIG. 8 shows fluorescent measurement conditions at the final cycle of the amplification reaction and at the second target detection step.
  • Embodiment 2 fe has been calculated as follows. Calculation other than fe has been carried out as the same as Embodiment 1.
  • fe fluorescence intensity value at the second target detection step
  • fhyb.e fluorescence intensity value (55 Centigrade) at the second target detection step
  • fden. 44 fluorescence intensity value (95 Centigrade) at the final cycle of amplification reaction.
  • the F44 value of the measurement sample has been compared with Threshold 3. And, when the F44 value of the measurement sample is lower than Threshold 3, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs value has been compared with Threshold 4, and when the Fs value is lower than Threshold 4 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • Mycoplasma pneumoniae P1 genes and internal control composition have been detected based on the Eprobe method.
  • Embodiment 3 The same primers and nucleic acid samples for PCR as Embodiment 1 have been used.
  • Table 8 shows probe information used for the PCR in Embodiment 3.
  • a specific region for Eprobe has been selected referring to Tm values calculated by means of “Edesign” software produced by the K. K. Dnaform.
  • MYC EP is one Eprobe specifically annealing the pMYC plasmid
  • IC EP is another Eprobe specifically annealing the pICM5 plasmid.
  • fluorescent dye for both of “MYC EP” and “IC EP” “D514” has been used.
  • the nineteenth “T” from 5′ end of “MYC EP” and the ninth “T” from 5′ end of “IC EP” have been labeled, respectively.
  • Embodiment 3 has been calculated with the following Formula. The other calculations have been carried out as the same as Embodiment 1.
  • Embodiment 3 Determination in Embodiment 3 has been performed using the method shown below.
  • the F40 value of the measurement sample has been compared with Threshold 5. And, when the F40 value of the measurement sample is higher than Threshold 5, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs value has been compared with Threshold 6, and when the Fs value is higher than Threshold 6, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • FIG. 13 shows a flow chart of the determination method related thereto.
  • a first Tm value of 76.4 Centigrade has been set for a sequence of MYC EP, and a second Tm value of 59.8 Centigrade has been set for a sequence of IC EP. For this reason, it has been estimated that probes anneal only MYC EP during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • a value 4.254 of Fs is higher than Threshold 6, and it has been revealed that the objective region of the pICM5 plasmid has been amplified.
  • Table 11 shows the value of the Fs.
  • the amplification curve related thereto is shown in FIG. 17 .
  • Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are combined even with the Eprobe method.
  • Table 12 shows information of the probes used for the PCR method in Embodiment 4.
  • Probes used for PCR in this Embodiment Probe Length name Sequence (5′ ⁇ 3′) (bp) MYC Taq CCCTCGACCAAGCCAACCTCCAGCTC 26 (SEQ ID No. 3) IC Taq AGTGGGACTCACCAACC 17 (SEQ ID No. 4)
  • a specific region for the TaqMan probe has been selected referring to Tm values calculated according to the nearest neighbor method.
  • MYC Taq is one TaqMan probe specifically annealing the pMYC plasmid
  • IC Taq is another TaqMan probe specifically annealing the pICM5 plasmid.
  • fluorescent dye for both of “MYC Taq” and “IC Taq” “FAM” (registered trademark) has been used to be labeled at 5′ end and “TAMRA” (registered trademark) has been used to be labeled at 3′ end, respectively.
  • Embodiment 4 thyb.e has been defined as a fluorescence intensity value (50 Centigrade), and the same calculation except this point as Embodiment 1 has been conducted.
  • the F44 value of the measurement sample has been compared with Threshold 7. And, when the F44 value of the measurement sample is higher than Threshold 7, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs value has been compared with Threshold 8, and when the Fs value is higher than Threshold 8, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • a first Tm value of 75.8 Centigrade has been set for a sequence of MYC Taq, and a second Tm value of 53.7 Centigrade has been set for a sequence of IC Taq. For this reason, it has been estimated that probes anneal only MYC Taq during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • Table 15 shows the value of the Fs.
  • the amplification curve is shown in FIG. 20 .
  • a value 0.177 of Fs is higher than Threshold 8, and it has been revealed that the objective region of the pICM5 plasmid has been amplified.
  • Table 15 shows the value of the Fs.
  • the amplification curve related thereto is shown in FIG. 21 .
  • Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with even the TaqMan probe method.
  • Mycoplasma pneumoniae P1 genes and internal control composition have been detected by means of actual specimens.
  • first total DNA has been used, the first total DNA having been extracted from first pharynx wiping liquid of which Mycoplasma pneumoniae has been determined to be positive (tested by the BML, Inc.) according to the LAMP method (Japanese registered patent No. 3313358) by means of a “QIAamp” DNA mini Kit (registered trademark of the QIAGEN).
  • the F44 value of the measurement sample has been compared with Threshold 9. And, when the F44 value of the measurement sample is lower than Threshold 9, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs value has been compared with Threshold 10, and when the Fs value is lower than Threshold 10, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • Threshold 10 the value of “mean ⁇ 3SD” with respect to Fs of the positive sample has been used.
  • a value ⁇ 0.235 of Fs is lower than Threshold 10, and it has been revealed that the objective region of the pICM5 plasmid has been amplified.
  • Table 16 shows the value of the Fs.
  • the amplification curve related thereto is shown in FIG. 25 .
  • Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with the actual clinical specimens.
  • the present invention is also applicable for identifying subtypes and/or single nucleotide polymorphism of pathogenic organisms causing infectious diseases.
  • pCT plasmids Production of pCT plasmids has been performed by requesting custom synthesis to the Hokkaido System Science Co., Ltd.
  • Gene fragments of common endogenous plasmids (pLGV440) of Chlamydia trachomatis which are pathogenic organisms causing Chlamydia infection have been artificially synthesized into plasmid DNA to be incorporated into a pUC57 vector, thereby having prepared the pCT plasmids.
  • Production of pNG plasmids has also been performed by requesting custom synthesis to the Hokkaido System Science Co., Ltd.
  • Gene fragments of cytosine DNA methyl transferase (CMT) of Neisseria gonorrhoeae which is a pathogenic organism causing gonorrhea have been artificially synthesized into plasmid DNA to be incorporated into a pUCS7 vector, thereby having prepared the pNG plasmids.
  • CMT cytosine DNA methyl transferase
  • First length of the pCT plasmid is 3064 [bp]
  • second length of the pNG plasmid is 3059 [bp].
  • Primer pairs used in the PCR method in Embodiment 6 are as shown in Table 17.
  • CT QP is one QProbe specifically annealing the pCT plasmid
  • NG QP is another QProbe specifically annealing the pNG plasmid.
  • BODIPY FL registered trademark
  • the combination of 510 to 528 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement.
  • Fluorescence values have been measured at the denaturation step (95 Centigrade) and the elongation step (68 Centigrade) for every cycle. Furthermore, after the amplification reaction has been completed, at a step for detecting the second target (95 Centigrade and 55 Centigrade), fluorescence measurement has been performed.
  • the F44 value of the measurement sample has been compared with Threshold 1. And, when the F44 value of the measurement sample is lower than Threshold 11, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs value has been compared with Threshold 12, and when the Fs value is lower than Threshold 12, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • a first Tm value of 73.4 Centigrade has been set for a sequence of CT QP, and a second Tm value of 62.5 Centigrade has been set for a sequence of NG QP. For this reason, it has been estimated that probes anneal only CT QP during the temperature range (from 68 Centigrade to 95 Centigrade) in the PCR.
  • a value ⁇ 0.111 of Fs is lower than Threshold 12, and it has been revealed that the objective region of the pNG plasmid has been amplified.
  • Table 21 shows the value of the Fs.
  • the amplification curve related thereto is shown in FIG. 29 .
  • Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with two items of genes.
  • the second target detection step has been carried out in an inserted manner, and detection of Mycoplasma pneumoniae P1 genes and internal control composition has been performed based on the QProbe method.
  • the primers, probes, reaction solution composition, and nucleic acids have been used for the PCR method as the same as Embodiment 1.
  • Table 22 shows reaction conditions thereof.
  • FIG. 30 is a graph of changes of temperature in the amplification reaction.
  • Embodiment 7 In analysis of Embodiment 7, the same steps as Embodiment 1 except the following calculation have been carried out.
  • fen fluorescence intensity value in n times second target detection step calculated according to Formula 4; fhyb.en: fluorescence intensity value (55 Centigrade) in n times second target detection step; and fden.en: fluorescence intensity value (95 Centigrade) in n times second target detection step.
  • Fen relative value in n times second target detection step assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 4 is equal to a value of “1.”
  • Fs1 measurement value in first time second target detection step
  • Fs2 measurement value in second time second target detection step
  • Fs3 measurement value in third time second target detection step
  • Fs4 measurement value in fourth time second target detection step
  • the F41 value of the measurement sample has been compared with Threshold 13. And, when the F41 value of the measurement sample is lower than Threshold 13, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs1 value has been compared with Threshold 14, and when the Fs1 value is lower than Threshold 14, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs2 value has been compared with Threshold 15, and when the Fs2 value is lower than Threshold 15 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs3 value has been compared with Threshold 16, and when the Fs3 value is lower than Threshold 16 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • the Fs4 value has been compared with Threshold 17, and when the Fs4 value is lower than Threshold 17 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • a value ⁇ 0.057 of Fs2 has been higher than Threshold 15, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified up to the identification limit until the second time second target detection step.
  • a value ⁇ 0.084 of Fs3 has been lower than Threshold 16, and it has been revealed that the objective region of the pICM5 plasmid has been amplified beyond the identification limit until the third time second target detection step.
  • a value ⁇ 0.192 of Fs4 has also been lower than Threshold 17.
  • Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The amplification curves are shown in FIG. 33 .
  • a value ⁇ 0.058 of Fs1 has been higher than Threshold 14, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified beyond the identification limit until the first time second target detection step.
  • a value ⁇ 0.068 of Fs2 has been also higher than Threshold 15, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified beyond the identification limit until the second time second target detection step.
  • a value ⁇ 0.109 of Fs3 has been lower than Threshold 16, and it has been revealed that the objective region of the pICM5 plasmid has been amplified beyond the identification limit until the third time second target detection step.
  • a value ⁇ 0.154 of Fs4 has also been lower than Threshold 17.
  • Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The amplification curves are shown in FIG. 34 .
  • FIG. 1 is a graph showing changes of temperature within mixed-solution in Embodiment 1 according to the present invention.
  • FIG. 3 is a flow chart showing a determination method in Embodiment 1 according to the present invention.
  • FIG. 4 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 1 according to the present invention.
  • FIG. 5 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 1 according to the present invention.
  • FIG. 6 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 1 according to the present invention.
  • FIG. 7 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 1 according to the present invention.
  • FIG. 8 is a timing explanatory diagram of fluorometry in Embodiment 2 according to the present invention.
  • FIG. 9 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 2 according to the present invention.
  • FIG. 10 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 2 according to the present invention.
  • FIG. 11 is a graph showing changes fluorescence intensity regarding a second target nucleic acid in Embodiment 2 according to the present invention.
  • FIG. 12 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 2 according to the present invention.
  • FIG. 13 is a flow chart showing a determination method in Embodiment 3 according to the present invention.
  • FIG. 14 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 3 according to the present invention.
  • FIG. 15 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 3 according to the present invention.
  • FIG. 16 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 3 according to the present invention.
  • FIG. 17 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 3 according to the present invention.
  • FIG. 18 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 4 according to the present invention.
  • FIG. 19 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 4 according to the present invention.
  • FIG. 20 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 4 according to the present invention.
  • FIG. 22 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 5 according to the present invention.
  • FIG. 23 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 5 according to the present invention.
  • FIG. 25 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 5 according to the present invention.
  • FIG. 26 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 6 according to the present invention.
  • FIG. 27 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 6 according to the present invention.
  • FIG. 28 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 6 according to the present invention.
  • FIG. 29 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 6 according to the present invention.
  • FIG. 30 is a graph showing changes of temperature within mixed-solution in Embodiment 7 according to the present invention.
  • FIG. 31 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 7 according to the present invention.
  • FIG. 32 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 7 according to the present invention.
  • FIG. 33 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 7 according to the present invention.
  • FIG. 34 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 7 according to the present invention.
  • FIG. 35 is an enlarged view of changes of temperature in Embodiment 1 according to the present invention.
  • FIG. 36 is an explanatory diagram of mixed-solution composition in Embodiment 1 according to the present invention.
  • FIG. 37( a ) is an explanatory diagram of a denaturation step in Embodiment 1 according to the present invention.
  • FIG. 37( b ) is an explanatory diagram of an annealing step in Embodiment 1 according to the present invention.
  • FIG. 37( c ) is an explanatory diagram of an elongation step in Embodiment 1 according to the present invention.
  • FIG. 37( d ) is an explanatory diagram of an elongation-completed step in Embodiment 1 according to the present invention.
  • FIG. 38( a ) is an explanatory diagram of the denaturation step in Embodiment 1 according to the present invention.
  • FIG. 38( b ) is an explanatory diagram of the annealing step in Embodiment 1 according to the present invention.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Provided is a kit for detecting multiple target nucleic acids capable of simultaneously amplifying and detecting multiple genes by means of one reaction vessel containing one kind of reaction solution and one kind of labels. Solution may contain first target nucleic acid (10) and second target nucleic acid (20) each of which dissociates at denaturation temperature T0. The solution further contains: DNA polymerase (30); a first target's primer (13) at annealing temperature T1 bonding with first single strands derived from the first target nucleic acid; a second target's primer (23) at annealing temperature T1 bonding with second single strands derived from the second target nucleic acid; a first target's probe (15) at annealing temperature TI bonding with the first single strands derived from the first target nucleic acid; and a second target's probe (25) at second target detection temperature T3 which is lower than the annealing temperature T1 and elongation temperature T2 bonding with the second single strands derived from the second target nucleic acid. A condition that: T0 is higher than T2; T2 is not lower than T1; and T1 is higher than T3 is satisfied.

Description

    BACKGROUND OF THE INVENTION 1. Field of the Invention
  • The present invention relates to a detection kit for improving the PCR method and further for measuring multiple target nucleic acids, and art related to the same.
    • 2. Description of the Related Art
  • In genetic screening, it is necessary to measure multiple target nucleic acids in many cases.
  • For example, the multiple target nucleic acids may be: a first pair of influenza A viruses and influenza B viruses; a second pair of influenza and RSV/human metapneumovirus; a third pair of Chlamydia trachomatis and Nisseria gonorrhoeae, which may cause sexually transmitted diseases; a fourth pair of Mycoplasma pneumoniae and resistance factor thereof; and so on.
  • Regarding the multiple target nucleic acids in some pairs of the above, the conditions of patients are similar to each other and also infection of the same expands simultaneously. So, it is conceivable to distinguish the multiple target nucleic acids from each other to make a diagnosis, thereby deciding on a course of treatment.
  • Considering the resistance factor is effective for selecting/judging medication against thereto, or the like.
  • As for only one measurement item, it is also helpful to set up internal control composition as means for confirming whether or not the measurement itself has been well done.
  • This is performed by: beforehand preparing a nucleic acid sequence to be amplified, the sequence not concerning a target gene of a detection object; and enabling to confirm whether or not the reaction has been well processed notwithstanding the existence or nonexistence of the target nucleic gene.
  • In this way, whether or not whether the reagent and the device for the measurement have acted effectively can be checked within the measurement system.
  • As mentioned above, in order to detect the multiple target nucleic acids, a first process of performing independent measurement for each of the multiple target nucleic acids, respectively, and a second process of distinguishing the multiple target nucleic acids from each other by means of different pilot dyes or the like, respectively can be conceived.
  • Alternatively, it is also possible to carry out the melting curve analysis method after having simultaneously processed amplification reaction. In this method after the amplification reaction, temperature is gradually increased/decreased to make distinction and judgment with respect to the multiple target nucleic acids based on both of first temperature wherein a change rate of fluorescent signals shows a peak and second temperature wherein the target nucleic acid is melt (the melting curve analysis method).
  • The first process of performing the independent measurement requires long time and high costs. The second process of distinguishing different labeling substances from each other costs too much because the second process needs not only preparing plural kinds of labeled reagents but also complicated wavelength-setting in an analyzer.
  • A case by means of the melting curve analysis method costs less than the above. However, since the temperature must be gradually changed, it is necessary to take about 5 to 10 minutes for changing the temperature in order to conduct precise analysis.
  • Reference 1 (Japanese application Laid-open No. 2002-136300) discloses: preparing a plurality of reaction vessels containing different reaction solution from each other; and performing amplification and detection with the plurality of reaction vessels, respectively.
  • So, reagent preparation and dispensing operations must be conducted for every item of the plurality of reaction vessels. There is a problem that it requires a long time.
  • Reference 2 (Japanese application Laid-open No. 2004-203) discloses simultaneously amplifying multiple genes by means of one reaction vessel containing one kind of reaction solution.
  • Distinction is carried out by using different pilot dyes for each of the multiple genes. So, a plurality of optical systems installed in an analyzer are needed as many as the used pilot dyes. In other words, the analyzer costs too much. This is a serious problem.
  • Reference 3 (Japanese application Laid-open No. 2008-173127) discloses simultaneously amplifying multiple genes by means of one reaction vessel containing one kind of reaction solution.
  • Dissociation temperature of PCR products and labeled probes should be changed for every gene. After amplification, while temperature is gradually increased from a lower temperature side to a higher temperature side, dissociation curve analysis, which is a synonym of “melting curve analysis”, of monitoring fluorescence values is carried out. Distinction is carried out by monitoring existence or nonexistence of a peak depending on base sequence at the respective dissociation temperature.
  • If temperature is changed speedily upon the melting curve analysis, it becomes difficult to identify melting temperature for each gene. Accordingly, there is a problem that extra time of about 5 to 10 minutes after PCR is required.
  • Reference 4 (Japanese unexamined patent application publication <Translation of PCT application> No. 2012-513215) discloses simultaneously amplifying multiple genes by means of one reaction vessel.
  • Dissociation temperature of PCR products and melting temperature of primers are changed for every gene. Distinction is carried out by monitoring fluorescence at the respective melting temperature.
  • In an ordinary PCR profile, one cycle includes: a denaturation step; and an annealing and elongation step. In Reference 4, the melting temperature of PCR products is changed for every gene. Accordingly, too many conditions should be taken into consideration, design of the profile is also difficult, and time for measurement must be too long.
  • Furthermore, there is another problem that temperature must be drastically changed to task the device.
    • LIST OF CITED REFERENCES
    • Reference 1: Japanese application Laid-open No. 2002-136300;
    • Reference 2: Japanese application Laid-open No. 2004-203;
    • Reference 3: Japanese application Laid-open No. 2008-173127;
    • Reference 4: Japanese unexamined patent application publication (Translation of PCT application) No. 2012-513215; and
    • Reference 5: Japanese registered patent No. 4724380.
    OBJECTS AND SUMMARY OF THE INVENTION
  • In view of the above, an object of the present invention is to provide a kit for detecting multiple target nucleic acids capable of simultaneously amplifying and detecting multiple genes by means of one reaction vessel containing one kind of reaction solution and one label.
  • A first aspect of the present invention provides a kit for together detecting multiple target nucleic acids differing from each other, comprising: solution, the multiple target nucleic acids including a first target nucleic acid and a second target nucleic acid; defining: T0 as denaturation temperature; T1 as annealing temperature; T2 as elongation temperature; and T3 as second target detection temperature, T0 through T3 being set up such that a condition that T0 is higher than T2; T2 is not lower than T1; and T1 is higher than T3 is satisfied, the solution being capable of containing the first target nucleic acid and the second target nucleic acid therein, at the denaturation temperature T0, first double-stranded hydrogen bond of the first target nucleic acid being cut off to be dissociate into first two single strands, second double-stranded hydrogen bond of the second target nucleic acid being cut off to be dissociate into second two single strands, respectively, the solution further containing therein: a first target's primer at the annealing temperature T1 specifically bonding with either of the first two single strands into which the first target nucleic acid has been dissociated; a second target's primer at the annealing temperature T1 specifically bonding with either of the second two single strands into which the second target nucleic acid has been dissociated; a first target's probe at the annealing temperature T1 specifically bonding with either of the first two single strands into which the first target nucleic acid has been dissociated, the first target's probe including a first labeling substance changing first fluorescent signals thereof when the first target's probe specifically bonds with either of the first two single strands; DNA polymerase; deoxyribonucleoside triphoshate at the elongation temperature T2 bonding by action of the DNA polymerase with both of the first two single strands into which the first target nucleic acid has been dissociated and the second two single strands into which the second target nucleic acid has been dissociated; and a second target's probe at the annealing temperature T1 bonding with neither the first two single strands into which the first target nucleic acid has been dissociated nor the second two single strands into which the second target nucleic acid has been dissociated, the second target's probe at the second target detection temperature T3 bonding with the second two single strands into which the second target nucleic acid has been dissociated, the second target's probe including a second labeling substance changing second fluorescent signals thereof when the second target's probe specifically bonds with either of the second two single strands.
  • It is preferable that each of the first labeling substance and the second labeling substance is selected from a group consisting of: a QProbe (registered trademark) probe; an Eprobe (registered trademark) probe; and a TaqMan (registered trademark) probe.
  • The fluorescent signals may be shown by quenching light when the annealing occurs. Alternatively, the fluorescent signals may be shown by emitting light when the annealing occurs.
  • It is preferable that the first target nucleic acid is at least one of a Mycoplasma pneumoniae P gene and a Chlamydia trachomatis endogeneous plasmid gene, and the second target nucleic acid is at least one of internal control composition and a Nisseria gonorrhoeae CMT gene, respectively.
    • Effect of Invention
  • As mentioned above, according to the present invention, the multiple target nucleic acids can be detected by means of one kind of mixed-solution and one kind of labeling substances.
  • Distinction of the multiple target nucleic acids can be carried out without melting curve analysis. Accordingly, measuring time can be remarkably shortened, thereby providing excellent practical performance.
    • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The present inventors have developed a kit for detecting nucleic acids by means of one kind of fluorescent labels and one reaction vessel containing one kind of reaction solution. Condition setting with respect to annealing temperature of probes and temperature change profiles in the PCR method has been incorporated within the present kit.
  • As shown in FIG. 35, the present kit uses four kinds of temperature including: denaturation temperature T0 (95 Centigrade); annealing temperature T1 (70 Centigrade); elongation temperature T2 (72 Centigrade); and second target detection temperature T3 (55 Centigrade).
  • The four kinds of temperature are set up such that a condition that T0>T2>=T1>T3 is satisfied.
  • Of course, the above temperature vales are mere examples, and may be variously changed as mentioned later.
  • Herein, the multiple target nucleic acids are a first target nucleic acid and a second target nucleic acid. However if needed, a third target nucleic acid or more can be added thereto by adding further setting such as third target detection temperature T4 (T3>T4), or the like.
  • Referring now to FIG. 36, elements of the present kit will now be explained.
  • First, in the present kit, it is assumed that a first target nucleic acid 10 and a second target nucleic acid 20 are targets to be detected.
  • Hereinafter for the simplicity of explanation, only a case where both of the first target nucleic acid 10 and the second target nucleic acid 20 are contained in solution 2 within a vessel 1, that is, a case of positive and positive will be explained below. Details of the solution 2 will be mentioned later.
  • Needless to say, in another case where at least one target is negative, the solution 2 does not contain the at least one of the first target nucleic acid 10 and the second target nucleic acid 20. Therefore, fluorescent signals and amplification regarding the not contained target nucleic acid will not be carried out in the following explanation.
  • As shown in FIG. 37 (a), when temperature of the solution 2 is increased to reach the denaturation temperature T0, hydrogen bonds of double strands of the first target nucleic acid 10 and the second target nucleic acid 20 are respectively cut off to be dissociated into respective first and second two single strands (from the first target nucleic acid 10 to a first single strand 11 and a second single strand 12, from second target nucleic acid 20 to a first single strand 21 and a second single strand 22).
  • As shown in FIG. 37 (b), the temperature is decreased from the denaturation temperature T0 to reach the annealing temperature T1, regarding the first target nucleic acid 10, a first target's F-primer 13 specifically bonds with a complementary sequence of the first single strand 11, and a first target's R-primer 14 specifically bonds with another complementary sequence of the second single strand 12, respectively.
  • Furthermore, similar to the above, regarding the second target nucleic acid 20, a second target's F-primer 23 specifically bonds with a complementary sequence of the first single strand 21, and a second target's R-primer 24 specifically bonds with another complementary sequence of the second single strand 22, respectively.
  • At the annealing temperature T1 shown in FIG. 37 (b), the first target's probe 15 labeled by means of the first labeling substance 16 specifically bonds with a specific part of the first single strand 11 derived from the first target nucleic acid 10, thereby the first labeling substance 16 outputs first fluorescence signals.
  • On the other hand, the annealing temperature T1 is higher than the second target detection temperature T3. For this reason, the second target's probe 25 labeled by means of the second labeling substance 26 does not bond with the first single strand 21 derived from the second target nucleic acid 20, thereby the second labeling substance 26 outputs no fluorescence signal at this time.
  • As shown in FIG. 37 (c), when the temperature is increased from the annealing temperature T1 to the elongation temperature T2, amplification reaction progresses advances as follows. This is because the solution 2 contains an amount sufficient for repeating PCR cycles of DNA polymerase 30 and deoxyribonucleoside triphoshate 31.
  • Regarding the first target nucleic acid 10, from the first target's F-primer 13 bonding with the first single strand 11, and from the first target's R-primer 14 bonding with the second single strand 12, the deoxyribonucleoside triphoshate 31 bonds therewith to elongate, respectively.
  • Regarding the second target nucleic acid 20, from the second target's F-primer 23 bonding with the first single strand 21, and from the second target's R-primer 24 bonding with the second single strand 22, the deoxyribonucleoside triphoshate 31 bonds therewith to elongate, respectively.
  • As clear comparing FIG. 37 (d) with FIG. 36, upon the amplification reaction has been completed, both of the first target nucleic acid 10 and the second target nucleic acid 20 have been doubled.
  • Returning to a step shown in FIG. 37 (a) again to repeat the above steps of FIG. 37 (a) through FIG. 37 (d) enables to repeat the amplification reaction and changes of fluorescent signals by means of the first labeling substance 16.
  • Next referring now to FIG. 38, a case where the temperature is decreased from the denaturation temperature T0 to the second target detection temperature T3 will now be explained.
  • As shown in FIG. 38 (a), at the denaturation temperature T0, the situation is the same as that of FIG. 37 (a).
  • However, upon the temperature is decreased to reach the second target temperature detection temperature T3, the situation is as shown in FIG. 38 (b) differing from FIG. 37 (b).
  • Namely, as shown in FIG. 38 (b), the first target's probe 15 labeled by the first labeling substance 16 specifically bonds with a specific part of the first single strand 11 derived from the first target nucleic acid 10, and the first fluorescent signals of the first labeling substance 16 change. This is the same as that of FIG. 37 (b).
  • However, the temperature is the second target detection temperature T3. Accordingly, also the second target's probe 25 labeled by the second labeling substance 26 bonds with the first single strand 21 derived from the second target nucleic acid 20, and the second fluorescent signals of the second labeling substance 26 also change.
  • Herein, it is preferable that the first labeling substance 16 and the second labeling substance 26 are identical.
  • As a result, capturing the difference caused by the changes of the first and second fluorescent signals according to the second labeling substance 26 enables to judge the existence or nonexistence (positivity/negativity) of the second target nucleic acid 20.
  • In addition as clear from the above-mentioned, it may be understood that the multiple target nucleic acids can be respectively detected during a series of continuing steps by means of the reaction vessel containing one kind of reaction solution.
  • Hereinafter, Embodiments of detecting multiple nucleic acids by means of three kinds of probes will now be explained more concretely. In the Embodiments, the QProbe (registered trademark) method, the Eprobe (registered trademark) method, and the TaqMan (registered trademark) method have been used.
  • Necessary information for operation including: primer sequences; base sequences of the respectivEprobes; and material of nucleic acid samples will be also shown.
    • Embodiment 1 <Detection of Mycroplasma Pneumoniae P1 Genes and Internal Control Composition According to the QProbe Method>
  • Detection of Mycoplasma pneumoniae P1 genes and internal control composition according to the QProbe method has been performed.
    • <Material and Steps> (Primer)
  • A pair of primers used for the PCR method in Embodiment 1 are as shown in Table 1.
  • TABLE 1
    Primers used for PCR in this Embodiment
    Primer Length
    name Sequence (5′→3′) (bp)
    MYC F GCCACCCTCGGGGGCAGTCAG 21
    (SEQ ID No. 1)
    MYC F GAGTCGGGATTCCCCGCGGAGG 22
    (SEQ ID No. 2)
  • As sequence No. 1 and sequence No. 2, (primer pair for P adhesin gene) sequences recited in the report (The Journal Of Infectious Diseases, 1996; 173; 1445-52) by leven et al. have been used.
    • (Nucleic Acid Sample)
  • Nucleic acid samples used for the PCR method in Embodiment 1 are shown below.
  • (pMYC)
  • Mycoplasma pneumnoniae is a pathogenic organism of Mycoplasma pneumonia. P protein is membrane protein derived from Mycoplasma pneumoniae. Gene fragments (sequences amplified by a pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2) encode the P1 protein. pMYC is a plasmid DNA produced by artificial synthesizing the gene fragments to be incorporated into a pMD20T vector. Production of the plasmid DNA has been performed by requesting custom synthesis to the Takara Bio Inc.
  • (pICM5)
  • In order to be capable of amplifying pICM5 plasmid by means of common primers of the pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2, pICM5 is a plasmid DNA produced by artificial synthesizing a sequence including a complementary sequence to the pair of the primers to be incorporated into a pMD20T vector. Production of the plasmid DNA has been performed by requesting custom synthesis to the Takara Bio Inc.
    • (Preparation of Nucleic Acid Sample)
  • First length of the pMYC plasmid is 2942 [bp], and second length of the pICM5 plasmid is 2886 [bp].
  • Based on the first and second length and the concentration [μg/μl] of plasmid solution, the number of copies per 1 [μl] has been calculated. After that, by means of TE buffer solution (10 [mM] Tris-HCl, 1.0 [mM] EDTA pH: 8.0), the pMYC plasmid has been diluted to be 1×10 [copies/μl], and the pICM5 plasmid has been diluted to be 1×10 [copies/μl], respectively.
    • (Probe)
  • Information of thEprobe used for the PCR method in Embodiment 1 is as shown in Table 2.
  • TABLE 2
    Probes used for PCR in this Embodiment
    Probe Length
    name Sequence (5′→3′) (bp)
    MYC QP CCCTCGACCAAGCCAACCTCCAGCTC 26
    (SEQ ID No. 3)
    IC QP AGTGGGACTCACCAACC 17
    (SEQ ID No. 4)
  • Based on a basic sequence of PCR products capable of being amplified by means of the pair of primers in Table 1, a specific region for SEQ ID NO: 3 and SEQ ID NO: 4 has been selected referring to Tm values calculated with a QProbe design support tool on the J-Bio21 Center home pages.
  • “MYC QP” is one QProbe specifically annealing the pMYC plasmid, and “IC QP” is another QProbe specifically annealing the pICM5 plasmid. As fluorescent dye for both of “MYC QP” and “IC QP”, “BODIPY FL” (registered trademark) has been used to label “C” at 3′ ends, respectively. Production of the QProbes has been performed by requesting custom synthesis to the NIPPON STEEL & SUMIKIN Eco-Tech Corporation.
    • (Conditions of PCR and Fluorescence Measurement)
  • In Embodiment 1, among two kinds of target nucleic acids to be amplified within one vessel containing one kind of reaction liquid, a first Tm value for “MYC QP” that is the QProbe specifically annealing the pMYC plasmid of the first target is set up to be higher than another Tm value for the primers to perform first detection during amplification reaction.
  • In addition, a second Tm value for “IC QP” that is the QProbe specifically annealing the pICM5 plasmid of the second target is set up to be lower than changes (70 Centigrade to 95 Centigrade) of temperature during the amplification reaction to perform second detection after the amplification reaction.
  • Table 3 and Table 4 show composition of the PCR reaction solution and the reaction conditions respectively, and FIG. 1 shows a graph of the changes of temperature of the mixed solution.
  • TABLE 3
    Composition of PCR solution in QProbe method
    Solution composition Final concentration
    MilliQ(TM) water —
    PCR buffer x1
    dNTP Mix 150 μM
    MYC F 0.20 μM
    MYC R 0.60 μM
    MYC QP 0.15 μM
    IC QP 0.15 μM
    KOD exo (−) DNA Polymerase 0.0125 U/μl
    Target nucleic acid —
    The above has been prepared to be 20 μL
  • TABLE 4
    Reaction conditions in QProbe method
    Reaction steps Temperature (° C.) Time(s)
    Initial denaturation 95 T0 120
    Amplification 95 T0 10 (FL measurement)
    (1-44 cycles) 70 T 1  10
    72 T2 10 (FL measurement)
    Second target NA detecting 95 T0 10 (FL measurement)
    55 T3 10 (FL measurement)
  • For the PCR and the fluorescence measurement, “Light Cycler nano system” (registered trademark of the Roche Diagnostics K.K.) has been used.
  • The combination of 510 to 528 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement. Fluorescence values have been measured at the denaturation step (95 Centigrade) and the elongation step (72 Centigrade) for every cycle. Furthermore, after the amplification reaction has been completed, at a step for detecting the second target (95 Centigrade and 55 Centigrade), fluorescence measurement has been performed.
  • FIG. 2 shows fluorescent measurement conditions at the final cycle of the amplification reaction and at the second target detection step.
    • (How to Process Data)
  • Analysis software provided with the Light Cycler nano system does not support an analysis method of using the QProbes. Accordingly, correction calculation has been performed on obtained raw data as follows, referring to a method disclosed in Reference 5 (Japanese registered patent No. 4724380).
  • For every cycle of the amplification reaction and the second target detection step, calculation has been carried out according to the following formulae.

  • fn=fhyb.n/fden.n  (Formula 1)

  • fe=thyb.e/fden.e  (Formula 1′)
  • herein,
    fn: fluorescence intensity value in n cycle calculated according to Formula 1;
    fhyb.n: fluorescence intensity value at the elongation step in n-th cycle;
    fden.n: fluorescence intensity value at the denaturation step in n-th cycle;
    fe: fluorescence intensity value at the second target detection step calculated according to Formula 1′;
    fhyb.e: fluorescence intensity value (55 Centigrade) at the second target detection step; and
    fden.e: fluorescence intensity value (95 Centigrade) at the second target detection step.
  • Next, for every cycle of the amplification reaction and the second target detection step, calculation has been carried out according to the following formulae.

  • Fn=fn/f10  (Formula 2)

  • Fe=fe/f10  (Formula 2′)
  • herein,
    Fn: relative value in n-th cycle assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 1 is equal to a value of “1”; and
    Fe: relative value at the second target detection step assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 1′ is equal to a value of “1”.
  • F44 which is a value of Fn at the final cycle of the amplification reaction has been used for judgment of the existence or nonexistence of the first target nucleic acid.
  • Further calculation has been carried out according to the following formula.

  • Fs=Fe−F44  (Formula 3)
  • herein,
    Fs: measured value regarding the second target.
  • The value of Fs has been used for determination of the existence or nonexistence of the second target nucleic acid.
  • Determination according to the QProbe method has been performed using the method shown below.
  • The F44 value of the measurement sample has been compared with Threshold 1. And, when the F44 value of the measurement sample is lower than Threshold 1, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 1, an average of F44 values of the negative reference (reagent TE buffer added thereto instead of DNA) minus three times the standard deviation (hereinafter, called as “mean−3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 2, and when the Fs value is lower than Threshold 2 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 2, the value of “mean−3SD” of a sample to which only the pMYC plasmid is added has been used. FIG. 3 shows a flow chart of the determination method related thereto.
  • As nucleic acid samples, the pMYC plasmid has been used for Mycoplasma pneumoniae P1 genes, the pICM5 plasmid has been used for the internal control composition, and the PCR has been performed thereon.
  • A first Tm value of 72.5 Centigrade has been set for a sequence of MYC QP, and a second Tm value of 57.5 Centigrade has been set for a sequence of IC QP. For this reason, it has been estimated that probes anneal only MYC QP during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • Since the fluorescence measurement with respect to the second target detection step has been carried out at 95 Centigrade and 55 Centigrade which is lower than the Tm value of IC QP, it has been estimated that extinction of both of MYC QP and the IC QP has been simultaneously detected according to measured values at the second target detection step.
  • Regarding an amplification curve of the negative reference, extinction has not observed until 44 cycles when the PCR ends. This is because a value 0.998 of F44 is not lower than a value 0.997 of Threshold 1. At this time, “mean−3SD” is equal to 0.997 to be regarded as Threshold 1 for the first target detection in Embodiment 1, thereby being shown in Table 5. The amplification curve related thereto is also shown in FIG. 4.
  • Regarding another amplification curve of the pMYC plasmid of the first target nucleic acid, extinction caused by annealing of MYC QP has been observed from about 28 cycles.
  • It has been revealed that a value 0.913 of F44 has been lower than Threshold 1, and further that a first objective region of the pMYC plasmid has been amplified. At this time, “mean−3SD” of Fs has been equal to −0.056 to be regarded as Threshold 2 for the second target detection, thereby being shown in Table 5. The amplification curve related thereto is also shown in FIG. 5.
  • Regarding an amplification curve of the pICM5 plasmid of the second target nucleic acid, no extinction has been observed during the amplification reaction. This is because a value 0.997 of F44 is not lower than a value 0.997 of Threshold 1. A value −0.118 of Fs has been lower than Threshold 2.
  • The above-mentioned results have revealed that the objective region of the pMYC plasmid has been not amplified, further that the objective region of the pICM5 plasmid has been amplified.
  • Table 5 shows the value of the Fs. The amplification curve is shown in FIG. 6.
  • TABLE 5
    Values used for determination in QProbe method
    TE pMYC pICM5 pMYC pICM5
    F44 0.998 0.913 0.997 0.912
    F44    0.997 ※1 — — —
    (Average −
    3SD)
    Fe 0.971 0.862 0.879 0.796
    Fs −0.027  −0.051  −0.118  −0.116 
    Fs —   −0.056 ※2 — —
    (Average −
    3SD)
    ※1 Threshold 1
    ※2 Threshold 2
  • Regarding an amplification curve upon both the pMYC plasmid of the first target nucleic acid and the pICM5 plasmid of the second target nucleic acid have been added to the solution, extinction caused by annealing of MYC QP has been observed from about 28 cycles as the same as the above-mentioned amplification curve of the pMYC plasmid. A value 0.912 of F44 has been lower than Threshold 1, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • The value −0.116 of Fs is lower than Threshold 2, and it has been revealed that the 1.5 objective region of the pICM5 plasmid has been amplified. Table 5 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 7.
  • After the PCR has been completed, agarose electrophoresis has been performed onto these PCR products. First objective PCR products with respect to the pMYC plasmid-added sample have been confirmed at near 206 [bp], and second objective PCR products with respect to the pICM5 plasmid-added sample have been confirmed at near 150 [bp].
  • According to the above-mentioned results, it has been revealed that Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with the QProbe method.
    • Embodiment 2
  • <Detection of Mycopiasma Pneumoniae P1 Genes and Internal Control Composition Based on QProbe Method while Changing Profile at Second Detection Step>
  • According to a method of changing the profiles at the second detection step in Embodiment 1, Mycoplasma pneumoniae P1 genes and internal control composition have been detected based on the QProbe method.
  • The primers, probes, reaction solution composition, and nucleic acids have been used for the PCR method as the same as Embodiment 1. Table 6 shows reaction conditions in Embodiment 2.
  • TABLE 6
    Reaction conditions after profile at second
    NA target detecting step is changed
    Reaction steps Temperature(° C.) Time(s)
    Initial denaturation 95 T0 120
    Amplification 95 T0 10 (FL measurement)
    (1-44 cycles) 70 T 1  10
    72 T2 10 (FL measurement)
    Second target NA detecting 55 T3 10 (FL measurement)
  • At the second target detection step in Embodiment 2, fluorescence measurement has been conducted at 55 Centigrade. FIG. 8 shows fluorescent measurement conditions at the final cycle of the amplification reaction and at the second target detection step.
  • In Embodiment 2, fe has been calculated as follows. Calculation other than fe has been carried out as the same as Embodiment 1.

  • fe=fhyb.e/fden.44
  • herein,
    fe: fluorescence intensity value at the second target detection step;
    fhyb.e: fluorescence intensity value (55 Centigrade) at the second target detection step;
    fden. 44: fluorescence intensity value (95 Centigrade) at the final cycle of amplification reaction.
  • Determination in Embodiment 2 has been performed as below.
  • The F44 value of the measurement sample has been compared with Threshold 3. And, when the F44 value of the measurement sample is lower than Threshold 3, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 3, an average of F44 values of the negative reference minus three times the standard deviation (hereinafter, called as “mean−3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 4, and when the Fs value is lower than Threshold 4 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 4, the value of “mean−3SD” of a sample to which only the pMYC plasmid is added has been used.
  • Regarding an amplification curve of the negative reference, extinction has not observed until 44 cycles when the PCR ends. This is because a value 0.998 of F44 is not lower than a value 0.997 of Threshold 3. At this time, “mean−3SD” is equal to 0.997 to be regarded as Threshold 3 for the first target detection in this Embodiment, thereby being shown in Table 7. The amplification curve related thereto is also shown in FIG. 9.
  • Regarding another amplification curve of the pMYC plasmid of the first target nucleic acid, extinction caused by annealing of MYC QP has been observed from about 28 cycles. It has been revealed that a value 0.912 of F44 has been lower than Threshold 3, and further that the objective region of the pMYC plasmid has been amplified.
  • At this time, “mean−3SD” of Fs has been equal to −0.052 to be regarded as Threshold 4 for the second target detection, thereby being shown in Table 7. The amplification curve related thereto is also shown in FIG. 10.
  • Regarding an amplification curve of the pICMS plasmid, no extinction has been observed during the amplification reaction. This is because a value 0.997 of F44 is not lower than a value 0.997 of Threshold 3. A value −0.170 of Fs has been lower than Threshold 4.
  • The above-mentioned results have revealed that the objective region of the pMYC plasmid has been not amplified, further that the objective region of the pICM5 plasmid has been amplified. Table 7 shows the value of Fs. The amplification curve is shown in FIG. 11.
  • TABLE 7
    Values used for determination in QProbe method after
    profile at second NA target detecting step is changed
    TE pMYC pICM5 pMYC pICM5
    F44 0.998 0.912 0.997 0.911
    F44    0.997 ※1 — — —
    (Average −
    3SD)
    Fe 0.961 0.869 0.827 0.797
    Fs −0.037  −0.043  −0.170  −0.114 
    Fs —   −0.052 ※2 — —
    (Average −
    3SD)
    ※1 Threshold 3
    ※2 Threshold 4
  • Regarding an amplification curve upon both the pMYC plasmid of the first target nucleic acid and the pICM5 plasmid of the second target nucleic acid have been added to the solution as the above-mentioned amplification curve of the pMYC plasmid, extinction caused by annealing of MYC QP has been observed from about 28 cycles. A value 0.911 of F 44 has been lower than Threshold 3, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • The value −0.114 of Fs is lower than Threshold 4, and it has been revealed that the objective region of the pICM5 plasmid has been amplified. Table 7 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 12.
  • According to the above results, it has been revealed that upon using the fluorescence intensity value (95 Centigrade) at the final cycle of the amplification reaction (fden.44) the second target can be detected.
    • Embodiment 3
  • <Detection of Mycoplasma pneumoniae P1 Genes and Internal Control Composition Based on Eprobe Method>
  • Mycoplasma pneumoniae P1 genes and internal control composition have been detected based on the Eprobe method.
  • The same primers and nucleic acid samples for PCR as Embodiment 1 have been used. Table 8 shows probe information used for the PCR in Embodiment 3.
  • TABLE 8
    Probes used for PCR in this Embodiment
    Probe Length
    name Sequence (5′→3′) (bp)
    MYC EP CCCTCGACCAAGCCAACCTCCAGCTC 26
    (SEQ ID No. 3)
    IC EP AGTGGGACTCACCAAC 16
    (SEQ ID No. 5)
  • A specific region for Eprobe has been selected referring to Tm values calculated by means of “Edesign” software produced by the K. K. Dnaform.
  • “MYC EP” is one Eprobe specifically annealing the pMYC plasmid, and “IC EP” is another Eprobe specifically annealing the pICM5 plasmid. As fluorescent dye for both of “MYC EP” and “IC EP”, “D514” has been used. The nineteenth “T” from 5′ end of “MYC EP” and the ninth “T” from 5′ end of “IC EP” have been labeled, respectively.
  • Production of the Eprobes has been performed by requesting custom synthesis to the Eurofins Genomics K.K. The PCR reaction solution composition and the reaction conditions are shown in Table 9 and Table 10.
  • TABLE 9
    Composition of PCR solution in EProbe method
    Solution composition Final concentration
    MilliQ(TM) water —
    PCR buffer ×1
    dNTP Mix 150 μM
    MYC F 0.20 μM
    MYC R 0.80 μM
    MYC EP 0.40 μM
    IC EP 0.40 μM
    KOD exo (−) DNA Polymerase 0.0125 U/μl
    Target nucleic acid —
    The above has been prepared to be 20 μL
  • TABLE 10
    Reaction conditions in EProbe method
    Reaction steps Temperature(° C.) Time(s)
    Initial denaturation 95 T0 120
    Amplification 95 T0 10 (FL measurement)
    (1-40 cycles) 70 T 1  10
    72 T2 10 (FL measurement)
    Second target NA detecting 95 T0 10 (FL measurement)
    55 T3 10 (FL measurement)
  • The combination of 530 to 548 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement.
  • Fs in Embodiment 3 has been calculated with the following Formula. The other calculations have been carried out as the same as Embodiment 1.

  • Fs=Fe−F40
  • Determination in Embodiment 3 has been performed using the method shown below. The F40 value of the measurement sample has been compared with Threshold 5. And, when the F40 value of the measurement sample is higher than Threshold 5, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 5, an average of F40 values of the negative reference plus three times the standard deviation (hereinafter, called as “mean+3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 6, and when the Fs value is higher than Threshold 6, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 6, the value of “mean+3SD” of a sample to which only the pMYC plasmid is added has been used. FIG. 13 shows a flow chart of the determination method related thereto.
  • A first Tm value of 76.4 Centigrade has been set for a sequence of MYC EP, and a second Tm value of 59.8 Centigrade has been set for a sequence of IC EP. For this reason, it has been estimated that probes anneal only MYC EP during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • Since the fluorescence measurement with respect to the second target detection step has been carried out at 95 Centigrade and 55 Centigrade which is lower than the Tm value of IC EP, it has been estimated that emission of both of MYC EP and the IC EP has been simultaneously detected according to measured values at the second target detection step.
  • Regarding an amplification curve of the negative reference, emission has not observed until 40 cycles when the PCR ends. This is because a value 1.007 of F40 is not higher than a value 1.013 of Threshold 5. At this time, “mean+3SD” is equal to 1.013 to be regarded as Threshold 5 for the first target detection, thereby being shown in Table 11. The amplification curve related thereto is also shown in FIG. 14.
  • Regarding another amplification curve of the pMYC plasmid of the first target nucleic acid, emission caused by annealing of MYC EP has been observed from about 29 cycles. It has been revealed that a value 2.314 of F40 has been higher than Threshold 5, and further that the objective region of the pMYC plasmid has been amplified.
  • At this time, “mean+3SD” of Fs has been equal to 3.695 to be regarded as Threshold 6 for the second target detection, thereby being shown in Table 11. The amplification curve related thereto is also shown in FIG. 15.
  • Regarding an amplification curve of the pICM5 plasmid of the second target nucleic acid, no emission has been observed during the amplification reaction. This is because a value 1.012 of F40 is not higher than a value 1.013 of Threshold 5. A value 4.012 of Fs has been higher than Threshold 6.
  • The above-mentioned results have revealed that the objective region of the pMYC plasmid has been not amplified, further that the objective region of the pICM5 plasmid has been amplified. The value of Fs is shown in Table 11, and the amplification curve related thereto is also shown in FIG. 16.
  • TABLE 11
    Values used for determination in EProbe method
    TE pMYC pICM5 pMYC pICM5
    F40 1.007 2.314 1.012 2.355
    F40    1.013 ※1 — — —
    (Average +
    3SD)
    Fe 3.149 5.837 5.024 6.609
    Fs 2.142 3.523 4.012 4.254
    Fs —    3.695 ※2 — —
    (Average +
    3SD)
    ※1 Threshold 5
    ※2 Threshold 6
  • Regarding an amplification curve upon both the pMYC plasmid of the first target nucleic acid and the pICM5 plasmid of the second target nucleic acid have been added to the solution, emission caused by annealing of MYC EP has been observed from about 29 cycles as the same as the above-mentioned amplification curve of the pMYC plasmid. A value 2.355 of F40 has been higher than Threshold 5, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • A value 4.254 of Fs is higher than Threshold 6, and it has been revealed that the objective region of the pICM5 plasmid has been amplified. Table 11 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 17.
  • According to the above-mentioned results, it has been revealed that Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are combined even with the Eprobe method.
    • Embodiment 4
  • <Detection of Mycoplasma pneumoniae P1 Genes and Internal Control Composition Based on TaqMan Probe Method>
  • According to the TaqMan probe method, Mycoplasma pneumoniae P1 genes and internal control composition have been detected. The primers and nucleic acid samples have been used for the PCR method as the same of Embodiment 1.
  • Table 12 shows information of the probes used for the PCR method in Embodiment 4.
  • TABLE 12
    Probes used for PCR in this Embodiment
    Probe Length
    name Sequence (5′→3′) (bp)
    MYC Taq CCCTCGACCAAGCCAACCTCCAGCTC 26
    (SEQ ID No. 3)
    IC Taq AGTGGGACTCACCAACC 17
    (SEQ ID No. 4)
  • A specific region for the TaqMan probe has been selected referring to Tm values calculated according to the nearest neighbor method.
  • “MYC Taq” is one TaqMan probe specifically annealing the pMYC plasmid, and “IC Taq” is another TaqMan probe specifically annealing the pICM5 plasmid. As fluorescent dye for both of “MYC Taq” and “IC Taq”, “FAM” (registered trademark) has been used to be labeled at 5′ end and “TAMRA” (registered trademark) has been used to be labeled at 3′ end, respectively.
  • Production of the TaqMan probes has been performed by requesting custom synthesis to the Takara Bio Inc. Table 13 and Table 14 show composition of PCR solution and reaction conditions related thereto, respectively.
  • TABLE 13
    Composition of PCR solution in TaqMan Probe method
    Solution composition Solution composition
    MilliQ(TM) water —
    PCR buffer ×1
    dNTP Mix 150 μM
    MYC F 0.50 μM
    MYC R 0.50 μM
    MYC Taq 0.30 μM
    IC Taq 0.30 μM
    TaKaRa Ex Taq (TM) 0.025 U/μl
    Target nucleic acid —
    The above has been prepared to be 20 μL
  • TABLE 14
    Reaction conditions in TaqMan probe method
    Reaction steps Temperature(° C.) Time(s)
    Initial denaturation 95 T0 120
    Amplification 95 T0 5 (FL measurement)
    (1-44 cycles) 70 T 1  15
    72 T2 0 (FL measurement)
    Second target NA detecting 95 T0 5 (FL measurement)
    50 T3 15 (FL measurement) 
  • The combination of 530 to 548 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement.
  • At a step for detecting the second target (95 Centigrade and 50 Centigrade) after amplification reaction, fluorescence measurement has been performed.
  • In Embodiment 4, thyb.e has been defined as a fluorescence intensity value (50 Centigrade), and the same calculation except this point as Embodiment 1 has been conducted.
  • Determination in Embodiment 4 has been performed as below.
  • The F44 value of the measurement sample has been compared with Threshold 7. And, when the F44 value of the measurement sample is higher than Threshold 7, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 7, an average of F44 values of the negative reference plus three times the standard deviation (hereinafter, called as “mean+3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 8, and when the Fs value is higher than Threshold 8, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 8, the value of “mean+3SD” of a sample to which only the pMYC plasmid is added has been used.
  • A first Tm value of 75.8 Centigrade has been set for a sequence of MYC Taq, and a second Tm value of 53.7 Centigrade has been set for a sequence of IC Taq. For this reason, it has been estimated that probes anneal only MYC Taq during the temperature range (from 70 Centigrade to 95 Centigrade) in the PCR.
  • Since the fluorescence measurement with respect to the second target detection step has been carried out at 95 Centigrade and 50 Centigrade which is lower than the Tm value of IC Taq, it has been estimated that emission of both of MYC Taq and the IC Taq has been simultaneously detected according to measured values at the second target detection step.
  • Regarding an amplification curve of the negative reference, emission has not observed until 44 cycles when the PCR ends. This is because a value 1.028 of F44 is not higher than a value 1.028 of Threshold 7. At this time, “mean+3SD” is equal to 1.028 to be regarded as Threshold 7 for the first target detection, thereby being shown in Table 15. The amplification curve related thereto is also shown in FIG. 18.
  • Regarding another amplification curve of the pMYC plasmid of the first target nucleic acid, emission caused by annealing of MYC Taq has been observed from about 28 cycles. It has been revealed that a value 1.427 of F44 has been higher than Threshold 7, and further that the objective region of the pMYC plasmid has been amplified.
  • At this time, “mean+3SD” of Fs has been equal to 0.110 to be regarded as Threshold 8 for the second target detection, thereby being shown in Table 15. The amplification curve related thereto is also shown in FIG. 19.
  • TABLE 15
    Values used for determination in TagMan Probe method
    TE pMYC pICM5 pMYC pICM5
    F44 1.028 1.427 1.028 1.348
    F44    1.028 ※1 — — —
    (Average +
    3SD)
    Fe 1.060 1.536 1.158 1.525
    Fs 0.032 0.109 0.130 0.177
    Fs —    0.110 ※2 — —
    (Average +
    3SD)
    ※1 Threshold 7
    ※2 Threshold 8
  • Regarding an amplification curve of the pICM5 plasmid of the second target nucleic acid, no emission has been observed during the amplification reaction. This is because a value 1.028 of F44 is not higher than a value 1.028 of Threshold 7. A value 0.130 of Fs has been higher than Threshold 8.
  • The above-mentioned results have revealed that the objective region of the pMYC plasmid has been not amplified, further that the objective region of the pICM5 plasmid has been amplified.
  • Table 15 shows the value of the Fs. The amplification curve is shown in FIG. 20.
  • Regarding an amplification curve upon both the pMYC plasmid of the first target nucleic acid and the pICM5 plasmid of the second target nucleic acid have been added to the solution, emission caused by annealing of MYC EP has been observed from about 29 cycles as the same as the above-mentioned amplification curve of the pMYC plasmid. A value 1.348 of F40 has been higher than Threshold 7, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • A value 0.177 of Fs is higher than Threshold 8, and it has been revealed that the objective region of the pICM5 plasmid has been amplified. Table 15 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 21.
  • According to the above-mentioned results, it has been revealed that Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with even the TaqMan probe method.
    • Embodiment 5
  • <Detection of Mycoplasma Pneumoniae P1 Genes and Internal Control Composition Based on QProbe Method with Actual Specimen>
  • According to the QProbe method, Mycoplasma pneumoniae P1 genes and internal control composition have been detected by means of actual specimens.
  • As Mycoplasma pneumoniae P1 genes, first total DNA has been used, the first total DNA having been extracted from first pharynx wiping liquid of which Mycoplasma pneumoniae has been determined to be positive (tested by the BML, Inc.) according to the LAMP method (Japanese registered patent No. 3313358) by means of a “QIAamp” DNA mini Kit (registered trademark of the QIAGEN).
  • As negative samples, second total DNA has been used, the second total DNA having been extracted from second pharynx wiping liquid of which Mycoplasma pneumoniae has been determined to be negative according to the LAMP method by means of the “QIAamp” DNA mini Kit. PCR has been carried out under the same conditions other than this point as those of Embodiment 1.
  • The same calculation as Embodiment 1 has been performed on obtained raw data related thereto.
  • Determination in Embodiment 5 has been performed as below.
  • The F44 value of the measurement sample has been compared with Threshold 9. And, when the F44 value of the measurement sample is lower than Threshold 9, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 9, an average of F44 values of the negative reference minus three times the standard deviation (hereinafter, called as “mean−3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 10, and when the Fs value is lower than Threshold 10, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence). As Threshold 10, the value of “mean−3SD” with respect to Fs of the positive sample has been used.
  • Regarding an amplification curve of the negative reference, extinction has not observed until 44 cycles when the PCR ends. This is because a value 0.997 of F44 is not lower than a value 0.997 of Threshold 9. At this time, “mean−3SD” is equal to 0.997 to be regarded as Threshold 9 for the first target detection in this Embodiment, thereby being shown in Table 16. The amplification curve related thereto is also shown in FIG. 22.
  • Regarding another amplification curve of the positive reference of the first target nucleic acid, extinction caused by annealing of MYC QP has been observed from about cycles. It has been revealed that a value 0.951 of F44 has been lower than Threshold 9, and further that the objective region of the pMYC plasmid has been amplified.
  • At this time, “mean−3SD” of Fs has been equal to −0.132 to be regarded as Threshold for the second target detection, thereby being shown in Table 16. The amplification curve related thereto is also shown in FIG. 23.
  • Regarding an amplification curve of the pICM5 plasmid of the second target nucleic acid, no extinction has been observed during the amplification reaction. This is because a value 0.998 of F44 is not lower than a value 0.997 of Threshold 9. A value −0.227 of Fs has been lower than Threshold 10.
  • The above-mentioned results have revealed that the objective region of the pMYC plasmid has been not amplified, further that the objective region of the pICM5 plasmid has been amplified. A value of Fs is shown in Table 16, and the amplification curve related thereto is also shown in FIG. 24.
  • Regarding an amplification curve upon the positive reference of the first target nucleic acid has been added to the pICM5 plasmid of the second target nucleic acid, extinction caused by annealing of MYC QP has been observed from about 35 cycles as the same as the amplification curve of the positive reference. A value 0.953 of F44 has been lower than Threshold 9, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • A value −0.235 of Fs is lower than Threshold 10, and it has been revealed that the objective region of the pICM5 plasmid has been amplified. Table 16 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 25.
  • TABLE 16
    Values used for determination in QProbe
    method with actual specimen
    positive
    negative positive sample
    sample sample pICM5 pICM5
    F44 0.997 0.951 0.998 0.953
    F44    0.997 ※1 — — —
    (Average −
    3SD)
    Fe 0.920 0.824 0.771 0.718
    Fs −0.077  −0.127  −0.227  −0.235 
    Fs —   −0.132 ※2 — —
    (Average −
    3SD)
    ※1 Threshold 9
    ※2 Threshold 10
  • According to the above-mentioned results, it has been revealed that Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with the actual clinical specimens.
  • The present invention is also applicable for identifying subtypes and/or single nucleotide polymorphism of pathogenic organisms causing infectious diseases.
    • Embodiment 6 <Detection of Chlamydia Trachomatis Endogeneous Plasmid Gene and Neisseria Gonorrhoeae CMT Gene Based on QProbe Method>
  • According to the QProbe method, detection of Chlamydia trachomatis endogeneous plasmid genes and Neisseria gonorrhoeae CMT genes has been carried out.
  • (pCT)
  • Production of pCT plasmids has been performed by requesting custom synthesis to the Hokkaido System Science Co., Ltd. Gene fragments of common endogenous plasmids (pLGV440) of Chlamydia trachomatis which are pathogenic organisms causing Chlamydia infection have been artificially synthesized into plasmid DNA to be incorporated into a pUC57 vector, thereby having prepared the pCT plasmids.
  • (pNG)
  • Production of pNG plasmids has also been performed by requesting custom synthesis to the Hokkaido System Science Co., Ltd. Gene fragments of cytosine DNA methyl transferase (CMT) of Neisseria gonorrhoeae which is a pathogenic organism causing gonorrhea have been artificially synthesized into plasmid DNA to be incorporated into a pUCS7 vector, thereby having prepared the pNG plasmids.
  • First length of the pCT plasmid is 3064 [bp], and second length of the pNG plasmid is 3059 [bp].
  • Based on the first and second length and the concentration (μg/μl) of plasmid solution, the number of copies per 1 [μl] has been calculated. After that, by means of TE buffer solution (10 [mM] Tris-HCl, 1.0 [mM] EDTA pH: 8.0), both of the pCT plasmids and the pNG plasmids have been diluted to be 1×105 [copies/μl].
  • Primer pairs used in the PCR method in Embodiment 6 are as shown in Table 17.
  • TABLE 17
    Primers used for PCR in this Embodiment
    Probe Length
    name Sequence (5′→3′) (bp)
    CT F TGAGCACCCTAGGCGTTTGTACTCCGTCAC 30
    (SEQ ID No. 6)
    CT R GCACTTTCTACAAGAGTACATCGGTCAACGAAGAGG 36
    (SEQ ID No. 7)
    NG F GGGCGTGGTTGAACTGGCAAAAAGC 25
    (SEQ ID No. 8)
    NG R CAGTGATTTTGGCATTGGCGATATTGG 27
    (SEQ ID No. 9)
  • Information of thEprobes used in the PCR method in Embodiment 6 is as shown in Table 18.
  • TABLE 18
    Probes used for PCR in this Embodiment
    Probe Length
    name Sequence (5′→3′) (bp)
    CT QP TGCGGGCGATTTGCCTTAACCCCACC 26
    (SEQ ID No. 10)
    NG QP CTAAGCAAAATTCGAGGGGGAAAAC 25
    (SEQ ID No. 11)
  • Based on a basic sequence of PCR products capable of being amplified by means of the pair of primers of SEQ ID NO: 6 and SEQ ID NO: 7, a specific region for CT QP has been selected referring to Tm values calculated with a QProbe design support tool on the J-Bio21 Center home pages.
  • Based on a basic sequence of PCR products capable of being amplified by means of the pair of primers of SEQ ID NO: 8 and SEQ ID NO: 9, a specific region for NG QP has been selected referring to Tm values calculated with the QProbe design support tool on the J-Bio21 Center home pages.
  • “CT QP” is one QProbe specifically annealing the pCT plasmid, and “NG QP” is another QProbe specifically annealing the pNG plasmid. As fluorescent dye for both of “CT QP” and “NG QP”, “BODIPY FL” (registered trademark) has been used to label “C” at 3′ ends, respectively.
  • Production of the QProbes has been performed by requesting custom synthesis to the NIPPON STEEL & SUMIKIN Eco-Tech Corporation. Table 19 and Table 20 show composition of PCR solution and reaction conditions related thereto, respectively.
  • TABLE 19
    Composition of PCR solution
    Solution composition Final concentration
    MilliQ(TM) water —
    PCR buffer ×1
    dNTP Mix 150 μM
    CT F 0.20 μM
    CT R 0.60 μM
    CT QP 0.15 μM
    NG F 0.20 μM
    NG R 0.60 μM
    NG QP 0.15 μM
    KOD exo (−) DNA Polymerase 0.0125 U/μl
    Target nucleic acid —
    The above has been prepared to be 20 μL
  • TABLE 20
    Reaction conditions of CT NG in QProbe method
    Reaction steps Temperature(° C.) Time(s)
    Initial denaturation 95 T0 120
    Amplification 95 T0  5 (FL measurement)
    (1-44 cycles) 68 T1, T2 15 (FL measurement)
    Second target NA detecting 95 T0  5 (FL measurement)
    55 T3 12 (FL measurement)
  • The combination of 510 to 528 [nm] has been selected for excitation wavelength and fluorescent wavelength upon fluorescence measurement.
  • Fluorescence values have been measured at the denaturation step (95 Centigrade) and the elongation step (68 Centigrade) for every cycle. Furthermore, after the amplification reaction has been completed, at a step for detecting the second target (95 Centigrade and 55 Centigrade), fluorescence measurement has been performed.
  • The same calculation as that of Embodiment 1 has been performed on obtained raw data related thereto.
  • Determination according to the QProbe method has been performed using the method shown below.
  • The F44 value of the measurement sample has been compared with Threshold 1. And, when the F44 value of the measurement sample is lower than Threshold 11, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 11, an average of F44 values of the negative reference minus three times the standard deviation (hereinafter, called as “mean−3SD”) has been used.
  • Notwithstanding the first target nucleic acid is positive or negative, the Fs value has been compared with Threshold 12, and when the Fs value is lower than Threshold 12, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 12, the value of “mean−3SD” of a sample to which only the pNG plasmid is added has been used.
  • A first Tm value of 73.4 Centigrade has been set for a sequence of CT QP, and a second Tm value of 62.5 Centigrade has been set for a sequence of NG QP. For this reason, it has been estimated that probes anneal only CT QP during the temperature range (from 68 Centigrade to 95 Centigrade) in the PCR.
  • Since the fluorescence measurement with respect to the second target detection step has been carried out at 95 Centigrade and 55 Centigrade which is lower than the Tm value of NG QP, it has been estimated that extinction of both of CT QP and the NG QP has been simultaneously detected according to measured values at the second target detection step.
  • Regarding an amplification curve of the negative reference, extinction has not observed until 44 cycles when the PCR ends. This is because a value 0.998 of F44 is not lower than a value 0.996 of Threshold 11. At this time, “mean−3SD” is equal to 0.996 to be regarded as Threshold 11 for the first target detection in this Embodiment, thereby being shown in Table 21. The amplification curve related thereto is also shown in FIG. 26.
  • Regarding another amplification curve of the pCT plasmid of the first target nucleic acid, extinction caused by annealing of CT QP has been observed from about 28 cycles. It has been revealed that a value 0.720 of F44 has been lower than Threshold 11, and further that the objective region of the pCT plasmid has been amplified.
  • At this time, “mean−3SD” of Fs has been equal to −0.039 to be regarded as Threshold 12 for the second target detection, thereby being shown in Table 21. The amplification curve related thereto is also shown in FIG. 27.
  • Regarding an amplification curve of the pNG plasmid of the second target nucleic acid, no extinction has been observed during the amplification reaction. This is because a value 0.998 of F44 is not lower than a value 0.996 of Threshold 11. A value −0.065 of Fs has been lower than Threshold 12.
  • The above-mentioned results have revealed that the objective region of the pCT plasmid has been not amplified, further that the objective region of the pNG plasmid has been amplified. Table 21 shows the value of the Fs. The amplification curve is shown in FIG. 28.
  • TABLE 21
    Values used for determination of second item in QProbe method
    TE pCT pNG pCT pNG
    F44 0.998 0.720 0.998 0.729
    F44    0.996 ※1 — — —
    (Average −
    3SD)
    Fe 1.009 0.681 0.933 0.618
    Fs 0.011 −0.039  −0.065  −0.111 
    Fs —   −0.039 ※2 — —
    (Average −
    3SD)
    ※1 Threshold 11
    ※2 Threshold 12
  • Regarding an amplification curve upon both the pCT plasmid of the first target nucleic acid and the pNG plasmid of the second target nucleic acid have been added to the solution, extinction caused by annealing of CT QP has been observed from about 28 cycles as the same as the above-mentioned amplification curve of the pCT plasmid. A value 0.729 of F44 has been lower than Threshold 11, and it has been revealed that the objective region of the pCT plasmid has been amplified.
  • A value −0.111 of Fs is lower than Threshold 12, and it has been revealed that the objective region of the pNG plasmid has been amplified. Table 21 shows the value of the Fs. The amplification curve related thereto is shown in FIG. 29.
  • According to the above-mentioned results, it has been revealed that Mycoplasma pneumoniae P1 genes and internal control composition can be detected by means of one reaction vessel containing one kind of reaction solution and one kind of fluorescent labels when the method of designing probes and temperature profiles are incorporated with two items of genes.
    • Embodiment 7
  • <Detection of Mycoplasma pneumoniae P1 Genes and Internal Control Composition Based on QProbe Method to Detect Plural Times the Second Target in Amplification Reaction>
  • Not only after the final cycle but also during the amplification reaction, the second target detection step has been carried out in an inserted manner, and detection of Mycoplasma pneumoniae P1 genes and internal control composition has been performed based on the QProbe method.
  • The primers, probes, reaction solution composition, and nucleic acids have been used for the PCR method as the same as Embodiment 1. Table 22 shows reaction conditions thereof.
  • TABLE 22
    Reaction conditions of second target detecting
    step in QProbe method in Embodiment 7
    Reaction steps Temperature(° C.) Time(s)
    Initial denaturation 95 T0 120 
    Amplification 95 T0 10 (FL measurement)
    (1-20 cycles) 70 T 1 10
    72 T2 10 (FL measurement)
    Second target NA 95 T0 10 (FL measurement)
    detecting first time 55 T3 10 (FL measurement)
    Amplification 95 T0 10 (FL measurement)
    (21-27 cycles) 70 T 1 10
    72 T2 10 (FL measurement)
    Second target NA 95 T0 10 (FL measurement)
    detecting second time 55 T3 10 (FL measurement)
    Amplification 95 T0 10 (FL measurement)
    (28-34 cycles) 70 T 1 10
    72 T2 10 (FL measurement)
    Second target NA 95 T0 10 (FL measurement)
    detecting third time 55 T3 10 (FL measurement)
    Amplification 95 T0 10 (FL measurement)
    (35-41 cycles) 70 T 1 10
    72 T2 10 (FL measurement)
    Second target NA 95 T0 10 (FL measurement)
    detecting fourth time 55 T3 10 (FL measurement)
  • FIG. 30 is a graph of changes of temperature in the amplification reaction.
  • In analysis of Embodiment 7, the same steps as Embodiment 1 except the following calculation have been carried out.

  • fen = fhyb.en/fden.en  (Formula 4)
  • herein,
    fen: fluorescence intensity value in n times second target detection step calculated according to Formula 4;
    fhyb.en: fluorescence intensity value (55 Centigrade) in n times second target detection step; and
    fden.en: fluorescence intensity value (95 Centigrade) in n times second target detection step.

  • Fen=fen/f10  (Formula 5)
  • herein,
    Fen: relative value in n times second target detection step assuming that the fluorescence intensity value in the tenth cycle obtained according to Formula 4 is equal to a value of “1.”

  • Fs1=Fe1−F20  (Formula 6)

  • Fs2=Fe2−F27  (Formula 6′)

  • Fs3=Fe3−F34  (Formula 6″)

  • Fs4=Fe4−F41  (Formula 6″′)
  • herein,
    Fs1: measurement value in first time second target detection step;
    Fs2: measurement value in second time second target detection step;
    Fs3: measurement value in third time second target detection step; and
    Fs4: measurement value in fourth time second target detection step.
  • Determination has been performed using the method shown below.
  • The F41 value of the measurement sample has been compared with Threshold 13. And, when the F41 value of the measurement sample is lower than Threshold 13, it has been determined that the first target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 13, an average of F41 values of the negative reference minus three times the standard deviation (hereinafter, called as “mean−3SD”) has been used.
  • In the first time second target detection step, the Fs1 value has been compared with Threshold 14, and when the Fs1 value is lower than Threshold 14, it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 14, the value of “mean−3SD” regarding the Fs1 value of a sample to which only the pMYC plasmid is added has been used.
  • In the second time second target detection step, the Fs2 value has been compared with Threshold 15, and when the Fs2 value is lower than Threshold 15 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 15, the value of “mean−3SD” regarding the Fs2 value of a sample to which only the pMYC plasmid is added has been used.
  • In the third time second target detection step, the Fs3 value has been compared with Threshold 16, and when the Fs3 value is lower than Threshold 16 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 16, the value of “mean−3SD” regarding the Fs3 value of a sample to which only the pMYC plasmid is added has been used.
  • In the fourth time second target detection step, the Fs4 value has been compared with Threshold 17, and when the Fs4 value is lower than Threshold 17 it has been determined that the second target nucleic acid is positive (existence), otherwise negative (nonexistence).
  • As Threshold 17, the value of “mean−3SD” regarding the Fs4 value of a sample to which only the pMYC plasmid is added has been used.
  • Regarding an amplification curve of the negative reference, extinction has not observed until 41 cycles when the PCR ends. This is because a value 0.999 of F41 is not lower than a value 0.998 of Threshold 13. At this time, “mean−3SD” is equal to 0.998 to be regarded as Threshold 13 for the first target detection in this Embodiment, thereby being shown in Table 23. The amplification curve related thereto is also shown in FIG. 31.
  • Regarding another amplification curve of the pMYC plasmid of the first target nucleic acid, extinction caused by annealing of MYC QP has been observed from about 30 cycles. It has been revealed that a value 0.892 of F41 has been lower than Threshold 13, and further that the objective region of the pMYC plasmid has been amplified.
  • At this time, “mean−3SD” of Fs1 has been equal to −0.058, “mean−3SD” of Fs2 has been equal to −0.070, “mean−3SD” of Fs3 has been equal to −0.080, and “mean−3SD” of Fs4 has been equal to −0.087 to be regarded as Threshold 14, Threshold 15, Threshold 16, and Threshold 17 for the second target detection, respectively, thereby being shown in Table 23. The amplification curve related thereto is also shown in FIG. 32.
  • TABLE 23
    Values used for determination at second target
    detecting step in QProbe method in Embodiment 7
    TE pMYC pICM5 pMYC pICM5
    F20 0.999 0.999 0.999 0.999
    Fe1 0.941 0.941 0.941 0.941
    Fs1 −0.058  −0.058  −0.058  −0.058 
    Fs1 —   −0.058 ※2 — —
    (Average −
    3SD)
    F27 0.999 0.999 1.000 0.999
    Fe2 0.941 0.930 0.943 0.930
    Fs2 −0.058  −0.068  −0.057  −0.068 
    Fs2 —   −0.070 ※3 — —
    (Average −
    3SD)
    F34 0.999 0.949 1.000 0.951
    Fe3 0.941 0.870 0.916 0.842
    Fs3 −0.058  −0.079  −0.084  −0.109 
    Fs3 —   −0.080 ※4 — —
    (Average −
    3SD)
    F41 0.999 0.892 0.999 0.897
    F41    0.998 ※1 — — —
    (Average −
    3SD)
    Fe4 0.940 0.812 0.805 0.743
    Fs4 −0.058  −0.080  −0.192  −0.154 
    Fs4 —   −0.087 ※5 — —
    (Average −
    3SD)
    ※1 Threshold 13
    ※2 Threshold 14
    ※3 Threshold 15
    ※4 Threshold 16
    ※5 Threshold 17
  • Regarding an amplification curve of the pICM5 plasmid of the second target nucleic acid, no extinction has been observed during the amplification reaction except in the respective second target detection steps. This is because a value 0.999 of F41 is not lower than a value 0.998 of Threshold 13. A value −0.058 of Fs1 has been higher than Threshold 14, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified up to an identification limit until the first time second target detection step.
  • A value −0.057 of Fs2 has been higher than Threshold 15, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified up to the identification limit until the second time second target detection step.
  • A value −0.084 of Fs3 has been lower than Threshold 16, and it has been revealed that the objective region of the pICM5 plasmid has been amplified beyond the identification limit until the third time second target detection step.
  • A value −0.192 of Fs4 has also been lower than Threshold 17. Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The amplification curves are shown in FIG. 33.
  • Regarding an amplification curve upon both the pMYC plasmid of the first target nucleic acid and the pICM5 plasmid of the second target nucleic acid have been added to the solution, extinction caused by annealing of MYC QP has been observed from about 30 cycles as the same as the amplification curve of the pMYC plasmid. A value 0.897 of F41 has been lower than Threshold 13, and it has been revealed that the objective region of the pMYC plasmid has been amplified.
  • A value −0.058 of Fs1 has been higher than Threshold 14, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified beyond the identification limit until the first time second target detection step.
  • A value −0.068 of Fs2 has been also higher than Threshold 15, and it has been revealed that the objective region of the pICM5 plasmid has not been amplified beyond the identification limit until the second time second target detection step.
  • A value −0.109 of Fs3 has been lower than Threshold 16, and it has been revealed that the objective region of the pICM5 plasmid has been amplified beyond the identification limit until the third time second target detection step.
  • A value −0.154 of Fs4 has also been lower than Threshold 17. Table 23 shows the values of the Fs1, Fs2, Fs3 and Fs4. The amplification curves are shown in FIG. 34.
  • According to the above-mentioned results, also in a case where the second target detection step has been carried out in the inserted manner not only after the final cycle but also within the amplification reaction, it has been revealed that Mycoplasma pneumoniae P genes and internal control composition can be detected.
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a graph showing changes of temperature within mixed-solution in Embodiment 1 according to the present invention;
  • FIG. 2 is a timing explanatory diagram of fluorometry in Embodiment 1 according to the present invention;
  • FIG. 3 is a flow chart showing a determination method in Embodiment 1 according to the present invention;
  • FIG. 4 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 1 according to the present invention;
  • FIG. 5 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 1 according to the present invention;
  • FIG. 6 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 1 according to the present invention;
  • FIG. 7 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 1 according to the present invention;
  • FIG. 8 is a timing explanatory diagram of fluorometry in Embodiment 2 according to the present invention;
  • FIG. 9 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 2 according to the present invention;
  • FIG. 10 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 2 according to the present invention;
  • FIG. 11 is a graph showing changes fluorescence intensity regarding a second target nucleic acid in Embodiment 2 according to the present invention;
  • FIG. 12 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 2 according to the present invention;
  • FIG. 13 is a flow chart showing a determination method in Embodiment 3 according to the present invention;
  • FIG. 14 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 3 according to the present invention;
  • FIG. 15 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 3 according to the present invention;
  • FIG. 16 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 3 according to the present invention;
  • FIG. 17 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 3 according to the present invention;
  • FIG. 18 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 4 according to the present invention;
  • FIG. 19 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 4 according to the present invention;
  • FIG. 20 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 4 according to the present invention;
  • FIG. 21 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 4 according to the present invention;
  • FIG. 22 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 5 according to the present invention;
  • FIG. 23 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 5 according to the present invention;
  • FIG. 24 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 5 according to the present invention;
  • FIG. 25 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 5 according to the present invention;
  • FIG. 26 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 6 according to the present invention;
  • FIG. 27 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 6 according to the present invention;
  • FIG. 28 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 6 according to the present invention;
  • FIG. 29 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 6 according to the present invention;
  • FIG. 30 is a graph showing changes of temperature within mixed-solution in Embodiment 7 according to the present invention;
  • FIG. 31 is a graph showing changes of fluorescence intensity regarding a negative reference in Embodiment 7 according to the present invention;
  • FIG. 32 is a graph showing changes of fluorescence intensity regarding a first target nucleic acid in Embodiment 7 according to the present invention;
  • FIG. 33 is a graph showing changes of fluorescence intensity regarding a second target nucleic acid in Embodiment 7 according to the present invention;
  • FIG. 34 is a graph showing changes of fluorescence intensity regarding the first target nucleic acid and the second target nucleic acid in Embodiment 7 according to the present invention;
  • FIG. 35 is an enlarged view of changes of temperature in Embodiment 1 according to the present invention;
  • FIG. 36 is an explanatory diagram of mixed-solution composition in Embodiment 1 according to the present invention;
  • FIG. 37(a) is an explanatory diagram of a denaturation step in Embodiment 1 according to the present invention;
  • FIG. 37(b) is an explanatory diagram of an annealing step in Embodiment 1 according to the present invention;
  • FIG. 37(c) is an explanatory diagram of an elongation step in Embodiment 1 according to the present invention;
  • FIG. 37(d) is an explanatory diagram of an elongation-completed step in Embodiment 1 according to the present invention;
  • FIG. 38(a) is an explanatory diagram of the denaturation step in Embodiment 1 according to the present invention; and
  • FIG. 38(b) is an explanatory diagram of the annealing step in Embodiment 1 according to the present invention.
    •  BRIEF DESCRIPTION OF SYMBOLS
    • 1: Vessel
    • 2: Solution
    • 10: First target nucleic acid
    • 13: First target's F-primer
    • 14: First target's R-primer
    • 15: First target's probe
    • 16: First labeling substance
    • 20: Second target nucleic acid
    • 23: Second target's F-primer
    • 24: Second target's R-primer
    • 25: Second target's probe
    • 26: Second labeling substance
    • 30: DNA polymerase
    • 31: Deoxyribonucleoside triphoshate
    • T0: Denaturation temperature
    • T1: Annealing temperature
    • T2: Elongation temperature
    • T3: Second target detection temperature

Claims (7)

1. A kit for together detecting multiple target nucleic acids differing from each other, the kit comprising:
solution, the multiple target nucleic acids including a first target nucleic acid and a second target nucleic acid;
defining: T0 as denaturation temperature; T1 as annealing temperature; T2 as elongation temperature; and T3 as second target detection temperature, T0 through T3 being set up such that a condition that: T0 is higher than T2; T2 is not lower than T1; and T1 is higher than T3 is satisfied;
the solution being capable of containing the first target nucleic acid and the second target nucleic acid therein, at the denaturation temperature T0, first double-stranded hydrogen bond of the first target nucleic acid being cut off to be dissociate into first two single strands, second double-stranded hydrogen bond of the second target nucleic acid being cut off to be dissociate into second two single strands, respectively,
the solution further containing therein:
a first target's primer at the annealing temperature T1 specifically bonding with either of the first two single strands into which the first target nucleic acid has been dissociated;
a second target's primer at the annealing temperature T1 specifically bonding with either of the second two single strands into which the second target nucleic acid has been dissociated;
a first target's probe at the annealing temperature T1 specifically bonding with either of the first two single strands into which the first target nucleic acid has been dissociated, the first target's probe including a first labeling substance changing first fluorescent signals thereof when the first target's probe specifically bonds with either of the first two single strands;
DNA polymerase;
deoxyribonucleoside triphoshate at the elongation temperature T2 bonding by action of the DNA polymerase with both of the first two single strands into which the first target nucleic acid has been dissociated and the second two single strands into which the second target nucleic acid has been dissociated; and
a second target's probe at the annealing temperature T1 bonding with neither the first two single strands into which the first target nucleic acid has been dissociated nor the second two single strands into which the second target nucleic acid has been dissociated, the second target's probe at the second target detection temperature T3 bonding with the second two single strands into which the second target nucleic acid has been dissociated, the second target's probe including a second labeling substance changing second fluorescent signals thereof when the second target's probe specifically bonds with either of the second two single strands.
2. The kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1, wherein each of the first labeling substance and the second labeling substance is selected from a group consisting of: a QProbe (registered trademark) probe; an Eprobe (registered trademark) probe; and a TaqMan (registered trademark) probe.
3. The kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1, wherein the fluorescent signals are shown by quenching light when the annealing occurs.
4. The kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1, wherein the fluorescent signals are shown by emitting light when the annealing occurs.
5. The kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1, wherein the first target nucleic acid is a Mycoplasma pneumoniae P1 genes and the second target nucleic acid is internal control composition.
6. The kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1, wherein the first target nucleic acid is a Chlamydia trachomatis endogeneous plasmid gene and the second target nucleic acid is a Nisseria gonorrhoeae CMT gene.
7. A detection method, comprising:
using the kit for together detecting multiple target nucleic acids differing from each other as defined in claim 1;
a dissociating step of increasing temperature of the solution to the denaturation temperature T0 so as to dissociate the first target nucleic acid into the first two single strands, and to dissociate the second target nucleic acid into the second two single strands respectively;
a first target nucleic acid detecting step of decreasing the temperature of the solution to the annealing temperature T1 so as to detect whether or not the first target nucleic acid is contained in the solution based on the first fluorescent signals shown by the first target's probe;
an amplification step of setting up the temperature of the solution to the elongation temperature T2 so as to amplify the first two single strands into which the first target nucleic acid has been dissociated and the second two single strands into which the second target nucleic acid has been dissociated, respectively; and
a second target nucleic acid detecting step of decreasing the temperature of the solution to the second target detection temperature T3 so as to detect whether or not the second target nucleic acid is contained in the solution based on the second fluorescent signals shown by the second target's probe.
US15/576,923 2015-06-04 2016-05-10 Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same Abandoned US20180155764A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2015-113979 2015-06-04
JP2015113979 2015-06-04
PCT/JP2016/063831 WO2016194552A1 (en) 2015-06-04 2016-05-10 Detection kit for multiple target nucleic acids and detection method using same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2016/063831 A-371-Of-International WO2016194552A1 (en) 2015-06-04 2016-05-10 Detection kit for multiple target nucleic acids and detection method using same

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/205,364 Division US20210238653A1 (en) 2015-06-04 2021-03-18 Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same

Publications (1)

Publication Number Publication Date
US20180155764A1 true US20180155764A1 (en) 2018-06-07

Family

ID=57439990

Family Applications (2)

Application Number Title Priority Date Filing Date
US15/576,923 Abandoned US20180155764A1 (en) 2015-06-04 2016-05-10 Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same
US17/205,364 Pending US20210238653A1 (en) 2015-06-04 2021-03-18 Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/205,364 Pending US20210238653A1 (en) 2015-06-04 2021-03-18 Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same

Country Status (15)

Country Link
US (2) US20180155764A1 (en)
EP (1) EP3305912B1 (en)
JP (1) JP6720161B2 (en)
KR (1) KR102077577B1 (en)
CN (1) CN107849617B (en)
AU (1) AU2016269875B2 (en)
CA (1) CA2983428C (en)
DK (1) DK3305912T3 (en)
ES (1) ES2899826T3 (en)
MX (1) MX2017015673A (en)
MY (1) MY182821A (en)
PH (1) PH12017502015A1 (en)
SG (1) SG11201708920PA (en)
TW (1) TWI686481B (en)
WO (1) WO2016194552A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110621783A (en) * 2017-05-25 2019-12-27 豪夫迈·罗氏有限公司 Multiplex nucleic acid amplification assay
US20220042071A1 (en) * 2018-09-18 2022-02-10 Mizuho Medy Co., Ltd. Detection method using kit for detecting plurality of target nucleic acids

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112020019755A2 (en) * 2018-04-20 2021-01-26 Seegene, Inc. method and apparatus for detecting a plurality of target nucleic acid sequences in the sample

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS4724380Y1 (en) 1969-11-20 1972-08-01
AU726501B2 (en) 1996-06-04 2000-11-09 University Of Utah Research Foundation Monitoring hybridization during PCR
EP1295941B1 (en) * 2000-06-27 2009-12-16 National Institute of Advanced Industrial Science and Technology Novel nucleic acid probes and method of assaying nucleic acid by using the same
JP2002136300A (en) 2000-08-25 2002-05-14 Otsuka Pharmaceut Co Ltd Method for detecting leukemia chimera gene
JP4460228B2 (en) 2002-04-22 2010-05-12 日鉄環境エンジニアリング株式会社 New method for measuring nucleic acids
US20040022764A1 (en) * 2002-07-31 2004-02-05 Hanan Polansky Inhibition of microcompetition with a foreign polynucleotide as treatment of chronic disease
EP1411133B1 (en) * 2002-09-24 2009-01-07 Qiagen GmbH Enhanced coamplification of nucleic acids
US20050053950A1 (en) * 2003-09-08 2005-03-10 Enrique Zudaire Ubani Protocol and software for multiplex real-time PCR quantification based on the different melting temperatures of amplicons
EP2336358A1 (en) * 2008-05-06 2011-06-22 QIAGEN GmbH Simultaneous detection of multiple nucleic acid sequences in a reaction
CN102301007A (en) * 2008-12-10 2011-12-28 史密斯探测公司 Identification and differentiation of nucleic acid sequence using temperature-dependent hybridization
CN107083444B (en) * 2008-12-22 2023-03-14 犹他大学研究基金会 Monochromatic multiplex quantitative PCR
US8039215B2 (en) * 2009-03-10 2011-10-18 Roche Molecular Systems, Inc. Multiplex quantitative nucleic acid amplification and melting assay
CN101624629B (en) * 2009-07-24 2012-09-05 上海浩源生物科技有限公司 PCR detection method of multiple-target nucleic acid in single pipe and kit thereof
GB201100150D0 (en) * 2011-01-06 2011-02-23 Epistem Ltd Mutational analysis
JP5863162B2 (en) * 2011-06-17 2016-02-16 広島県 Target nucleic acid detection method
WO2013065574A1 (en) * 2011-10-31 2013-05-10 栄研化学株式会社 Method for detecting target nucleic acid

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110621783A (en) * 2017-05-25 2019-12-27 豪夫迈·罗氏有限公司 Multiplex nucleic acid amplification assay
US20220042071A1 (en) * 2018-09-18 2022-02-10 Mizuho Medy Co., Ltd. Detection method using kit for detecting plurality of target nucleic acids

Also Published As

Publication number Publication date
AU2016269875A1 (en) 2017-11-02
CA2983428C (en) 2021-12-07
WO2016194552A1 (en) 2016-12-08
CN107849617A (en) 2018-03-27
SG11201708920PA (en) 2017-11-29
TWI686481B (en) 2020-03-01
KR20170139150A (en) 2017-12-18
JPWO2016194552A1 (en) 2018-03-22
MX2017015673A (en) 2018-06-19
MY182821A (en) 2021-02-05
DK3305912T3 (en) 2021-12-06
ES2899826T3 (en) 2022-03-14
PH12017502015A1 (en) 2018-04-02
US20210238653A1 (en) 2021-08-05
BR112017026001A2 (en) 2018-11-06
EP3305912A4 (en) 2018-04-11
JP6720161B2 (en) 2020-07-08
AU2016269875B2 (en) 2019-05-09
CN107849617B (en) 2021-11-02
TW201708545A (en) 2017-03-01
EP3305912A1 (en) 2018-04-11
CA2983428A1 (en) 2016-12-08
KR102077577B1 (en) 2020-02-17
AU2016269875A2 (en) 2017-11-16
EP3305912B1 (en) 2021-10-06

Similar Documents

Publication Publication Date Title
US20210238653A1 (en) Kit for together detecting multiple target nucleic acids differing from each other and detection method using the same
CN102076849A (en) Method for detecting controls for nucleic acid amplification, and use thereof
EP2518164B1 (en) Probe for detecting mutation in exon 12 of NPM1 gene and use thereof
JP2018528780A (en) Improved detection of short homopolymer repeats
KR101684832B1 (en) A composition for determining the feline blood types by realtime PCR and a detection method using it
US20170260568A1 (en) Method For The Colorimetric Detection Of The Amplification Of A Target Nucleic Acid Sequence
KR20170003403A (en) Method for detecting food borne pathogens using digital PCR
AU2012287207A1 (en) Method to amplify nucleic acids to generate fluorescence labeled fragments of conserved and arbitrary products
AU2013204483B2 (en) Probe, and polymorphism detection method using the same
US8624017B2 (en) Probe, polymorphism detection method, method of evaluating drug efficacy or tolerance, disease prediction method and reagent kit
US20150132751A1 (en) Detecting Single Nucleotide Polymorphism Using Overlapped Primer and Melting Probe
US20130115597A1 (en) Method for detecting specific nucleic acid sequences
US20160053302A1 (en) Method for visual identification of pcr solutions for accurate reaction setup
JP6059453B2 (en) A method for detecting a plurality of gene polymorphisms at a single wavelength using a plurality of oligonucleotides modified with a fluorescent dye having the same or near detection wavelength
US20220042071A1 (en) Detection method using kit for detecting plurality of target nucleic acids
EP1743946A9 (en) Method and kit for the genotypification of hla-drb based on real time pcr
JP5860667B2 (en) Primer set for detecting EGFR exon 21L858R gene polymorphism and use thereof
JP2024536115A (en) Methods for testing nucleic acid amplification products
BR112017026001B1 (en) KIT FOR JOINTLY DETECTING MULTIPLE TARGET NUCLEIC ACIDS THAT DIFFER FROM EACH OTHER, AND DETECTION METHOD USING THE SAME
Alp et al. ORIGINAL RESEARCH COMPARISON OF CONVENTIONAL AND REAL TIME PCR METHODS TO DETERMINE THE ACE I/D AND ANGIOTENSINOGEN M235T POLYMORPHISMS
Rahman et al. A protocol for the rapid estimation of the genome size of an organism by using quantitative real-time PCR: A case study of the pineapple genome

Legal Events

Date Code Title Description
AS Assignment

Owner name: MIZUHO MEDY CO., LTD., JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:NAGANO, TAKASHI;MIYAJIMA, KENSUKE;NARAHARA, KENJI;REEL/FRAME:044223/0850

Effective date: 20171020

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION