US20160279232A1

US20160279232A1 - Gene-Deleted Variant Strain Of Porcine Pseudorabies Virus, Vaccine Composition, Method Of Making The Same And Use Thereof

Info

Publication number: US20160279232A1
Application number: US15/054,404
Authority: US
Inventors: Kegong Tian; Xuke Zhang; Jinzhong Sun; Feifei Tan
Original assignee: Pulaike Biological Engineering Co Ltd
Current assignee: Pulaike Biological Engineering Co Ltd
Priority date: 2014-08-22
Filing date: 2016-02-26
Publication date: 2016-09-29
Also published as: US10548972B2; US20160317650A1; CN104862286B; TW201612316A; JP2016531545A; US20160281065A1; EP3012322B1; DK3012322T3; US10201605B2; EP3012322A1; WO2016026264A1; CN104250640A; CN104862286A; EP3012322A4; JP6368725B2

Abstract

The present invention provides an attenuated strain of porcine pseudorabies virus (PRV), in which said attenuated strain of PRV is a variant strain of PRV with inactivation of gI/gE/11K/28K proteins. In addition, the present invention also provides a vaccine composition comprising the attenuated strain of PRV as an antigen, a preparation method and use thereof. Proved by immunogenicity and pathogenicity testing of the live vaccine, said live PRV vaccine can provide a good protection for pigs with no clinical signs observed, indicating excellent immune protection.

Description

This application is a continuation of U.S. Patent Application No. 14/901981, filed Dec. 29, 2015, which is a National Stage of PCT/CN2015/070221, filed Jan. 6, 2015, which claims the benefit of priority to CN 201410418379.8, filed Aug. 22, 2014.

FIELD OF THE INVENTION

This invention relates to a gene-deleted variant strain of porcine pseudorabies virus, a vaccine composition prepared therefrom, a method of making the same and a use thereof, belonging to the field of animal virology.

BACKGROUND

Pseudorabies, also called Aujeszky's disease, is an acute infectious disease caused by Suid herpesvirus 1 (SuHV1) belonging to the Alphaherpesvirinae subfamily for many kinds of livestock such as swine, cattle and sheep, as well as poultry and wild animals, with the main symptoms of fever, intense itching (except swine) and encephalomyelitis. Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms. Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and neurological signs, paralysis and a high death rate in piglets. Pseudorabies virus (PRV) with strong pantropic properties, neurotropic properties and latent infectivity, may establish long-term latent infection in the peripheral nervous system, and then the latently infected host starts to get sick when the latent virus is activated into the infectious virus.
According to recent researches, there are reports of new features of pseudorabies, of which the significant manifestations include that infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever in pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and the infection also can cause reproductive disorder symptoms such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. By means of prior art, vaccinated pigs cannot completely resist attacks by the wild virus, and still have symptoms like high fever, depression, partially or completely loss of appetite, with a infection rate of more than 30% and a mortality rate between 10% and 20%. According to literatures in the prior art, for example, Jin-mei Peng, et al., Identification and antigenic variation of new epidemiology of pseudorabies virus from swine. Chinese Journal of Preventive Veterinary Medicine, 2013, 35 (1):1-4; Tong Wu et al., Identification and Characterization of a pseudorabies virus isolated from a dead piglet born to vaccinated sow. Chinese Journal of Animal infectious diseases, 2013, 21 (3):1-7; Yu et al., Pathogenic Pseudorabies Virus, China, 2012. Emerging infectious Diseases. 2014, 20 (1):102-104; An et al., Pseudorabies virus variant in Bartha-K61-vaccinated pigs, China, 2012. Emerging infectious Diseases. 2013. 19 (11): 1749-1755, there is no vaccines capable of solving the pseudorabies caused by variant strains of porcine pseudorabies virus in the prior art.
The Chinese patent application CN103756977A has disclosed a gE and gI deleted variant strain of porcine pseudorabies virus, PRV-ZJ011G strain (of which the accession number is CGMCC No. 7957) and a vaccine prepared therefrom, of which the content of virus prior to being inactivated is 10^6.0TCID₅₀. Immunization with said vaccine could provide a 100% protection rate for 5 healthy piglets at 45 days of age. Said patent application, however, cannot successfully provide an attenuated live vaccine against new PRV strains, due to both humoral and cellular immunity resulted from proliferation of attenuated live PRV vaccine in vivo.
The Chinese patent application CN103981153A has disclosed the construction of a gene deleted variant strain of the pseudorabies virus labeled with two fluorescent markers, wherein a variant strain of pseudorabies virus with deletion of gE, gI, US9 and TK gene is inserted with GRP gene and RFP gene as labels at the site of deleted genes through homologous recombination. Whereas in this patent application said a gene deleted variant strain is used as a vector of antigen, we don't know if it has immunological competence itself, or how strong the virulence of the variant strain is, since there are more than 70 gene fragments for pseudorabies virus.
It has been disclosed by Chun-Hua Wang et al. (Chun-Hua Wang, Jin Yuan, Hua-Yang Qin, et al, A novel gE-deleted pseudorabies virus (PRV) provides rapid and complete protection from lethal challenge with the PRV variant emerging in Bartha-K61-vaccinated swine population in China, Vaccine 32 (2014)3379-3385) that 6-week-old piglets injected with PRVTJ-gE⁻live vaccines got a complete protection from challenge and didn't exhibit fever. Whereas as is known to those skilled in the art, the virulence of the PRV live vaccines depends on the age of piglets. Also according to the general experience in the art, the vaccines may not be safe for 7-day-old piglets even though they are safe for 6-week-old piglets. The live vaccines may spread among pigs, therefore the vaccine which is only safe for 6-week-old piglets cannot be ensured to be used clinically and a live vaccine which is safe for 7-day-old piglets, is required in the prior art to prevent effectively infection with the new variant strains of PRV.

SUMMARY OF INVENTION

In order to solve the deficiency of the prior art, the present invention provides an attenuated live strain of porcine pseudorabies virus for prevention and treatment of pseudorabies caused by mutated pseudorabies virus.
The main aim of present invention is to provide an attenuated strain of porcine pseudorabies virus, wherein said attenuated strain of porcine pseudorabies virus is a pseudorabies virus strain with inactivation of gI/gE/11K/28K proteins, preferably said PRV strain is a variant strain of PRV.
The inactivation of gI/gE/11K/28K proteins can be achieved by using well known methods in the art, including deletion of nucleotide sequence expressing the functional fragments of those above proteins from the gene, deletion of the whole ORF from the gene, or deletion or addition of one or more nucleotides whereby the gene cannot express functional proteins normally or the proteins expressed don't have their original function or have an extremely weak function.
As an embodiment of the present invention, the present invention provides an attenuated genetically engineered strain of porcine pseudorabies virus with deletion of gI/gE/11K/28K genes.
As an embodiment of the present invention, the whole ORF of gI/gE/11K/28K genes was deleted from the genome of said attenuated genetically engineered strain of pseudorabies virus.
As an embodiment of the present invention, said variant strain of pseudorabies virus is a virus strain of which gE protein has the sequence of SEQ ID NO. 5 or shares at least 95% homology to the sequence of SEQ ID NO. 5; preferably, said variant strain of pseudorabies virus is obtained through isolation, and when infection with said variant strain recurs in pigs previously immunized with attenuated gene-deleted strain of pseudorabies virus according to the prior art, the pigs still display clinical signs of infection with said variant strain, selected from high fever, depression and partial or complete loss of appetite; more preferably, said variant strain of pseudorabies virus is a variant strain of pseudorabies virus and when infection with said variant strain recurs in pigs previously immunized with attenuated strain of PRV with deletion of one or more of gE, TK and gI genes, according to the prior art, the pigs are still infected with pseudorabies, which optionally causes clinical signs of infection, selected from depression and loss of appetite among piglets at the age of 9-10 days.
Most preferably, said variant strain of pseudorabies virus, includes, but are not limited to, PRV HN1201 strain (pseudorabies virus, strain HN1201)(deposited in the China Center for Type Culture Collection on May, 20, 2013, of which the accession number is CCTCC NO. V 201311 and the address is Wuhan University, Wuhan, China); JS-2012 strain (Wu Tong, Qingzhan Zhang, Hao Zheng et al. Isolation and identification of PRV from piglets infected after immunization [J]. Chinese Journal of Animal Infectious Diseases. 2013, 21 (3): 1-7); PRV HeN1 strain (deposited in the China General Microbiological Culture Collection Center on May, 20, 2013, of which the accession number is CGMCC NO. 6656 and has been disclosed in the patent application CN102994458A); NVDC-PRV-BJ strain, NVDC-PRV-HEB strain and NVDC-PRV-SD strain (Xiuling Yu, Zhi Zhou, Dongmei Hu,et al. Pathogenic Pseudorabies Virus, China, 2012 Emerging Infectious Diseases, www.cdc.gov/eid ol. 20, No. 1, January 2014); PRV HN1202 strain (pseudorabies virus, strain HN1202) (deposited in the China Center for Type Culture Collection on Aug. 26, 2013, of which the accession number is CCTCC NO. V 201335 and the address is Wuhan University, Wuhan, China); PRV TJ strain (Chun-Hua Wang Jin Yuan, Hua-Yang Qin, et al, A novel gE-deleted pseudorabies virus (PRV) provides rapid and complete protection from lethal challenge with the PRV variant emerging in Bartha-K61-vaccinated swine population in China. Vaccine. 32 (2014) 3379-3385); a variant strain of pseudorabies virus PRV-ZJ01 (with the accession number, CGMCC No. 8170, and disclosed in CN103627678A).
As an embodiment of the present invention, said PRV strain is HN1201 strain, HN1202 strain, JS-2012 strain, PRV HeN1 strain, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain or NVDC-PRV-SD strain, PRV TJ strain or PRV-ZJ01 strain.
As an embodiment of the present invention, said attenuated strain of porcine pseudorabies virus is an attenuated strain of porcine pseudorabies virus with further inactivation of TK protein; preferably the nucleotide sequence at the location of TK in the genome of said attenuated strain of porcine pseudorabies virus encodes and expresses the amino acid sequence shown in SEQ.NO. 4 of the sequence listing.
As a preferred embodiment of the present invention, the nucleotide sequence at the location of TK in the genome of said attenuated strain of porcine pseudorabies virus is the nucleotide sequence shown in SEQ.NO. 3 of the sequence listing.
As a preferred embodiment of the present invention, the present invention provides an attenuated genetically engineered strain of porcine pseudorabies virus with deletion of gI/gE/11K/28K/TK genes.
As used herein, the term “variant strain of pseudorabies virus”, also called highly pathogenic PRV strain, refers to diseases with significant manifestations including infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever of pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and reproductive disorder symptoms caused by infection such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. Preferably, said variant strain of pseudorabies virus obtained through isolation, and when infection with said variant strain recurs in pigs previously immunized with attenuated gene-deleted strain of pseudorabies virus according to the prior art, the pigs still display clinical signs of infection with said variant strain, selected from selected from high fever, depression and partial or complete loss of appetite. Preferably, said variant strain of pseudorabies virus is a virus strain of which gE protein has the sequence of SEQ ID NO. 5 or shares at least 95% homology to the sequence of SEQ ID NO. 5. More preferably, said variant strain of pseudorabies virus is a variant strain of pseudorabies virus wherein, when infection with said variant strain recurs in pigs previously immunized with attenuated strain of porcine pseudorabies virus with deletion of one or more of gE, TK and gI genes, according to the prior art, the pigs are still infected with pseudorabies, which optionally causes clinical signs of infection selected from depression and loss of appetite among piglets at the age of 9-10 days. The term “homology” in the present invention refers to the level of similarity between two amino acid sequences or two nucleotide sequences. The homology between amino acid sequences or nucleotide sequences can be calculated by any appropriate methods well known in the art, for example, the target amino acid (or nucleotide) sequence and the reference amino acid (or nucleotide) sequence is aligned, and gaps can be induced if necessary to optimize the number of the identical amino acids (or nucleotides) between two aligned sequences, and the percentage of the identical amino acids (or nucleotides) between two aligned sequences can be calculated accordingly. Alignment of amino acid (or nucleotide) sequences and calculation of homology can be achieved by software well kwon in the art. Examples of such software include, but is not limited to, BLAST (which can be accessed through the website of the National Center for Biotechnology Information, NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi or can be found in Altschul S. F. et al, J. Mol. Biol, 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (which can be accessed through the website of the European Bioinformatics Institute, EBI, http://www.eji.ac.uk/Toolsa/clustalw2/, or can be found in Higgins D. G. et al, Methods in Enzymology, 266:383-402 (1996); Larkin M. A. et al, Bioinformatics (Oxford, England), 23 (21):2947-8 (2007)), and TCoffee (which can be accessed through the website of the Swiss Institute of Bioinformatics, SIB, http://tcoffee.vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cgi, or can be found in, Poirot O. et al, Nucleic Acids Res., 31 (13):3503-6 (2003); Notredame C. et al, J. Mol. Biol, 302 (1):205-17(2000)) etc. It is all within the knowledge scope of a person skilled in the art that when using the software to do sequence alignment, he can use the default parameters provided by the software or adjust the parameters provided by the software according to the actual condition.
The term “gI protein” is encoded by US7, and comprises 366 amino acids, with ORF located between 122298-123398.
The term “gE protein” is encoded by USB, and comprises 577 amino acids, with ORF located between 123502-125235.
The term “11K” is encoded by US9, and comprises 98 amino acids, with ORF located between 125293-125589.
The term “28K” is encoded by US2, and comprises 256 amino acids, with ORF located between 125811-126581.
The term “TK”, also called thymidine kinase, is encoded by UL23, and comprises 320 amino acids, with ORF located between 59512-60474.
The term “gI/gE/11K/28K” and “gI/gE/11K/28K/TK” in the present invention refers to “gI, gE, 11K and 28K” and “gI, gE, 11K, 28K and TK”, respectively, wherein “I” in the present invention refers to “and”, for example, “inactivation of gI/gE/11K/28K proteins” refers to inactivation of gI, gE, 11K and 28K proteins.
Unless otherwise stated, the term “PRV-gI-gE-11K-28K-TK−” in the present invention refers to deletion of gI, gE, 11K, 28K and TK genes.
As a preferred embodiment of the present invention, said attenuated genetic strain of porcine pseudorabies virus with deletion of gI/gE/11K/28K genes is attenuated genetically engineered virus strain of PRV HN1201 strain with deletion of gI/gE/11K/28K genes.
As a preferred embodiment of the present invention, said attenuated strain of porcine pseudorabies virus includes HN1201 strain, HN1202 strain, JS-2012 strain, PRV HeN1 strain, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain or NVDC-PRV-SD strain, with deletion of gI/gE/11K/28K.
As a preferred embodiment of the present invention, said attenuated strain of porcine pseudorabies virus is PRV HN1201 strain (pseudorabies virus, strain HN1201) with deletion of gI/gE/11K/28K genes using genetic engineering, wherein said PRV HN1201 strain is deposited in the China Center for Type Culture Collection on May, 20, 2013, of which the accession number is CCTCC NO. V 201311 and the address is Wuhan University, Wuhan, China.
As used herein, the term “attenuated” in the present invention refers to: compared with unmodified parent strain, the virulence of the gene-deleted pseudorabies virus strain is reduced, of which manifestations include reduction of numbers of dead pigs, numbers of pigs with fever, and duration of fever. If the statistically significant difference of one or more parameters for determination of severity of diseases for virus strains decreases, its virulence is attenuated.
Another aspect of the invention relates to a vaccine composition, wherein said vaccine composition comprises an immune amount of antigen of said attenuated strain of porcine pseudorabies virus and carrier; preferably the content of antigen of the attenuated strain of porcine pseudorabies virus is not less than 10^6.0TCID₅₀/ml.
As a preferred embodiment of the present invention, the antigen of said attenuated strain of porcine pseudorabies virus is live attenuated strain of porcine pseudorabies virus; said vaccine composition further comprises a cryoprotectant.
As an embodiment of the present invention, said vaccine composition comprises an immune amount of attenuated live vaccine of said variant strain of pseudorabies virus with deletion of gI/gE/11K/28K genes and carrier.
As a preferred embodiment of the present invention, said vaccine composition comprises an immune amount of attenuated live vaccine of said variant strain of pseudorabies virus with deletion of gI/gE/11K/28K/TK genes and carrier.
As a preferred embodiment of the present invention, said vaccine composition comprises an immune amount of attenuated live vaccine of a variant strain of pseudorabies virus with deletion of gI/gE/11K/28K genes, such as HN1201 strain, HN1202 strain, JS-2012 strain, PRV HeN1 strain, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain or NVDC-PRV-SD strain, PRV TJ strain or PRV-ZJ01 strain and carrier.
As a preferred embodiment of the present invention, said vaccine composition comprises an immune amount of attenuated live vaccine of variant strain of PRV strains with deletion of gI/gE/11K/28K/TK genes, such as HN1201 strain, HN1202 strain, JS-2012 strain, PRV HeN1 strain, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain or NVDC-PRV-SD strain, PRV TJ strain or PRV-ZJ01 strain and carrier.
Preferably, the antigen of said attenuated strain of porcine pseudorabies virus is attenuated live PRV strain; said vaccine composition further comprises a cryoprotectant.
As an embodiment of the present invention, said vaccine composition is attenuated live vaccine of the PRV strain with deletion of gI/gE/11K/28K genes.
Optionally, one or more compounds with adjuvant activity may be added to vaccines. It does not necessarily require such an adjuvant to achieve the efficacy of the live attenuated pseudorabies virus according to the present invention, but especially for a combination vaccine comprising the live attenuated pseudorabies virus according to the present invention and antigenic materials from another pathogenic virus or microorganism (see below), it will be worth adding an adjuvant. Adjuvants are non-specific stimulators of the immune system. They improve immune response of the host responding to a vaccine. Examples of adjuvants known in the art is include complete/incomplete Freund's adjuvant, vitamin E, non-ionic blocking copolymers, muramyl dipeptide, ISCOMs (immune stimulating complexes, refer to, for example the European patent EP 1099 42), saponins, mineral oil, vegetable oil, and Carbopol.
Therefore, in a preferred form of said embodiment, the live attenuated vaccine according to the present invention further comprises an adjuvant.
Other examples of pharmaceutically acceptable carriers or diluents can be used in the present invention, include stabilizers such as SPGA, carbohydrates (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein-containing agents such as bovine serum or skimmed milk and buffers (e.g. phosphate buffer).
Especially when such stabilizers are added to the vaccine, the vaccine is very suitable for freeze-drying. Therefore, in a more preferred form of said embodiment, the live attenuated vaccine is in a freeze-dried form.
In addition, said pseudorabies vaccine in the present invention can be used conjunctly with other inactivated pathogens or antigen to prepare combined vaccines or complex vacancies against various diseases including pseudorabies. As used herein, the term “combined vaccine” refers to a vaccine prepared with the virus mixture by mixing the pseudorabies virus in the present invention with at least one different virus. The term “complex vaccine” refers to a vaccine prepared from viruses and bacterium. For example, the pseudorabies virus in the present invention can be mixed or combined with classical swine fever virus, porcine reproductive and respiratory syndrome virus, porcine circovirus and/or haemophilus parasuis and mycoplasma.
As an embodiment of the present invention, said vaccine further comprises inactivated pathogens or antigen, preferably, said antigen comprises antigen of classical swine fever virus, antigen of porcine reproductive and respiratory syndrome virus, antigen of porcine circovirus and/or haemophilus parasuis or antigen of mycoplasma.
As an embodiment of the present invention, the attenuated virus strain in the present invention can be inserted by exogenous genes, said exogenous genes encode one or more antigens selected from a plurality of pathogens infecting pigs, said pathogens consist of porcine reproductive respiratory syndrome (PRRS) virus, porcine Influenza virus, porcine parvovirus, transmissible gastroenteritis virus, rotavirus, type 1 or type 2 porcine circovirus virus, Escherichia coli, Erysipelothrix rhusiopathiae, Bordetella bronchiseptica, Haemophilus parasuis, Mycoplasma hyopneumoniae and Streptococcus suis.
Preferably, said vaccine composition may further comprise medium, adjuvants and excipients.
The vaccine composition according to the present invention may also comprises medium, adjuvants and/or excipients. Physiological saline or distilled water can be used as medium.
Another aspect of the present invention relates to a method for preparing said vaccine composition, wherein said method comprises the steps: (1) said attenuated strain of porcine pseudorabies virus is amplified and cultured; and (2) a cryoprotectant is added into said attenuated strain of porcine pseudorabies virus amplified and cultured.
Another aspect of the present invention relates to a use of said vaccine composition for preparing medicine for treatment and prevention of pseudorabies.
As an embodiment of the present invention, said pseudorabies is pseudorabies caused by a variant strain of pseudorabies virus.
As used herein, the term “diseases relating to PRV” can further refer to diseases with significant manifestations including but not limited to infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever of pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and reproductive disorder symptoms caused by infection such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. The differences between above described symptoms and symptoms caused by infection of regular pseudorabies virus in the prior art are: in adult pigs (whose weight is above 50 kg), high fever of infected pigs (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion; sudden incidence of pseudorabies in newborn piglets and piglets below the age of 4 weeks, further resulting in massive death with a mortality of more than 90%; main manifestations in infected piglets including increased body temperature over 41° C., completely loss of appetite, obvious neurological signs and diarrhea; and in piglets just before or after being weaned, mainly respiratory symptoms, such as dyspnea, coughing and runny noses, etc.
As used herein, the term “prevention” refers to all behaviors to inhibit the infection of pseudorabies virus or delay the onset of the disease via administration of the vaccine composition according to the present invention. The term “treatment” refers to all behaviors to relieve or cure the symptoms caused by infection of PRV via administration of the vaccine composition according to the present invention.

ADVANTAGES OF THE PRESENT INVENTION

The strain in the present invention with less virulence could provide better immune protection, induce an earlier generation of antibodies and the challenge result after immunization shows that gE antibody is still negative.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic diagram showing construction of plasmid pUCgI/gE/11K/28KA-GFP-B;

FIG. 2 is a schematic diagram showing the location for deletion of gI/gE/11K/28K genes and location of homologous arms, USA and USB in the genome;

FIG. 3 is a gel electrophoresis pattern for comparing PCR fragments of PRV HN1201 strain before and after deletion of gI/gE/11K/28K genes through PCR method;

FIG. 4 is a schematic diagram showing the location for deletion of TK gene and location of homologous arms of TKA and TKB in the genome;

FIG. 5 is a gel electrophoresis pattern for comparing PCR fragments of PRV HN1201 strain before and after deletion of TK gene through PCR method.

SEQUENCE LISTING

SEQ ID NO. 1 is the nucleotide sequence of gI/gE/11K/28K genes in the PRV HN1201 strain.
SEQ ID NO. 2 is the nucleotide sequence of TK gene in the PRV HN1201 strain.
SEQ ID NO. 3 is the nucleotide sequence of location for deletion of TK gene in the PRV HN1201 strain.
SEQ ID NO. 4 is the amino acid sequence of location for deletion of TK gene in the PRV HN1201 strain.
SEQ ID NO. 5 is the amino acid sequence of gE in the PRV HN1201 strain.

DETAILED DESCRIPTION

The description of the present invention is further provided as follows with reference to the specific embodiments, and features and advantages of the present invention will become more apparent from the following description. However, these embodiments are only exemplary, but not forming any limitation to the scope of the present invention. It should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed, while those modification and alternatives should all fall within the scope of the present invention.
In the invention, the term “per pig” refers to the amount of vaccine each pig injected.
In the invention, the term “TCID₅₀” refers to 50% tissue culture infective dose, a way to represent viral infectivity.
Minimum Essential Medium (MEM) liquid medium is prepared with MEM dry powdered medium purchased from Life Technologies, Corp. according to the instruction.
Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.
In the present invention, the term “PBS” is the abbreviation for Phosphate Buffer Saline, and 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3rd edition.
The PRV HN1201 strain (pseudorabies virus, strain HN1201) used in the embodiments is deposited in the China Center for Type Culture Collection on May, 20, 2013, of which the accession number is CCTCC NO. V 201311 and the address is Wuhan University, Wuhan, China.
The PRV HN1202 strain (pseudorabies virus, strain HN1202) used in the embodiments is deposited in the China Center for Type Culture Collection on Aug. 26, 2013, of which the accession number is CCTCC NO. V 201335 and the address is Wuhan University, Wuhan, China.
PRV is the abbreviation for the term Pseudorabies virus.
In the following specific embodiments, the description of the present invention is further provided with examples of PRV HN1201 strain, NVDC-PRV-BJ strain, NVDCPRV-HEB strain, NVDC-PRV-SD strain and HN1202 strain.

EXAMPLE 1

Preparation of PRV HN1201 Strain With Deletion of gI/gE/11K/28K

1.1 Construction of a Transfer Vector for Recombinant PRV HN1201GFP Virus

According to the sequence of US segment (gI/gE/11K/28K) to be deleted, the homologous arms were designed at its two ends, called USA and USB, respectively. USA and USB were cloned into pUC19 vector and named pUCUSAB. Then GFP gene was cloned into pUCUSAB, to obtain a transfer vector for recombinant virus which was called pUCUSA-GFP-B. The homologous arms in the transfer vector are sequences of two sides of US, therefore the recombinant virus obtained after recombination, was US segment deleted, which comprised gI/gE/11K/28K. FIG. 1 is a schematic diagram showing construction of the transfer vector, and FIG. 2 shows the location of the homologous arms, USA and USB in the genome.

1.1.1 Amplification and Cloning of the Homologous Recombinant Arms

1.1.1.1 Design of Primers and Preparation of Templates

Two pairs of primers were designed for amplifying the homologous arms at two sides of segment to be deleted according to the gene sequence of HN1201 virus:
The upstream and downstream primers for the homologous arm USA at the left side are, respectively:

	USAF:
	CCGGAATTCTCGTCGTGGGCATCGTCATCAT
	(the underline portion refers to the EcoR I
	cutting site)

	USAR:
	CTATCTAGAataacttcgtataatgtatgctatacgaagttat
	CGGTACTGCGGAGGCTACGGAC
	(the underline portion refers to the Xba I
	cutting site, lowercase letters refer to the
	loxp site

The upstream and downstream primers for the homologous arm USB at the right side are, respectively:

USBF:

ACATGCATGCataacttcgtatagcatacattatacgaagttat

ACGGCAGGATCTCTCCGCGTCCC

(the underline portion refers to the SphI cutting

site, lowercase letters refer to the loxp site)

USBR:

CCCAAGCTTAGGAGGGGGCGGGGAGCGCGAGC

(the underline portion refers to the Hind III

cutting site)

Vero cells were transfected with PRV HN1201, and part of supernatant was harvested when the cytopathic effect of cells reached to 80%, for extracting genomic DNA of virus by using Geneaid Viral Nucleic Acid Extraction kit as the template for amplification of the homologous arms.

1.1.1.2 Amplification and Cloning of the Homologous Arms, USA and USB

USA and USB were amplified through PCR method by using TAKARA PrimeSTAR, of which the system and condition is as follows:


PRV HN1201 DNA	1	μL
PrimeSTAR	0.5	μL
2*primeSTAR GC buffer	25	μL
dNTP(25 mM)	4	μL
Upstream primer	0.5	μL
downstream primer	0.5	μL

	Water	Used for adjusting to a final
		volume of 50 μL


98° C.	2	min
98° C.	10	s
68° C.	1	min	}	30 cycles
	15	s
68° C.	5	min

USA and USB fragments amplified by PCR were separated by electrophoresis on agarose gel, and the target fragments were recovered with TIANGEN Gel Recovery Kit. USA fragment and pUC19 vector was digested by both of EcoR I and XbaI, and the target fragments were recovered, connected by T4 DNA ligase, and the product was transformed into DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified using enzyme digestion, and the correct plasmid after identification was named pUCUSA. pUCUSA and USB was digested by both of SalI and HindIII, and the target fragments were recovered, linked by T4 DNA ligase, and the product was transformed into DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCUSAB.

1.1.3 Amplification of Label Gene GFP

1.1.2.1 Removal of Multiple Cloning Site (MCS) of GFP Vector pAcGFP-C1

The pAcGFP-C1 plasmid (purchased from Clontech, Catalog No. 632470) was digested by Bgl II and Sma I, and the linearized vector was recovered, linked by T4 DNA Ligase after filling-in with DNA Polymerase I Large (Klenow) Fragment, and transformed into the competent cell DH5α to obtain MCS deleted GFP plasmid, named pAcGFPΔMCS.

1.1.2.2 Amplification of GFP Gene

The primers for amplifying GFP were designed according to the sequence of pAcGFP-C 1 vector.

	Upstream primer
	CMVU:
	ACGCGTCGACTAGTTATTAATAGTAATCAATTACG
	(the underline portion refers to the SalI
	cutting site.)

	Downstream primer
	SV40R:
	ACATGCATGCCTAGAATGCAGTGAAAAAAATGC
	((the underline portion refers to the Sph I
	cutting site.)

GFP gene was amplified with pAcGFPΔMCS plasmid as the template, of which the system and condition is as follows:


pAcGFPΔMCS	1	μL
primeSTAR	0.5	μL
2*primeSTAR GC buffer	25	μL
dNTP(25 mM)	4	μL
Upstream primer CMVU	0.5	μL
Downstream primer SV40R	0.5	μL

	Water	Used for adjusting to a final
		volume of 50 μL


94° C.	2	min
94° C.	30	s
60° C.	30	s	30 cycles	{close oversize brace}
72° C.	2	min
72° C.	5	min

A target band was recovered by electrophoresis on agarose gel for further linking.

1.1.3 Linking of GFP Label Gene and pUCUSAB

GFP was digested with both of Sal and Sph I, and the target fragments were recovered, linked to pUCUSB plasmid which had been through the same double enzyme digestion, and the product was transformed into the competent cell DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCUSA-GFP-B.

1.2 Acquisition of Recombinant Virus Containing GFP

1.2.1 Acquisition of Recombinant Virus Through Co-Transfection of Vero Cells With the Transfer Vector and HN1201 DNA

Co-transfection of vero cells was conducted by using lipofectin technique, wherein 3 μg PRV-HN1201 viral genomic DNA and 5 μg the transfer vector pUCUSA-GFP-B was transfected, in accordance with procedures of Lipofectamine 2000 Protocol (Invitrogen, Catalog No. 11668030). Cells were incubated at 37° C. in an incubator containing 5% CO₂. The supernatant of cell culture, i.e. P0 recombinant virus, named rPRV-GFP-US−, was collected 36-48h after transfection, or until the cytopathic effect was visible and infected cells exhibited fluorescence.

1.2.2 Plaque Purification of Recombinant Viruses

When infected with the obtained PO recombinant virus rPRV-GFP-US−, vero cells infected were covered with 2% agarose with low melting point. After 48h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence, a plaque with a green fluorescence was picked and freeze-thawed 3 times in −70° C., inoculated at 10-fold serial dilutions into vero cells previously laid in six-well plates. Such plaque with a green fluorescence was continued to be picked for purification. After 8 rounds of plaques purification, a purified recombinant virus rPRV-GFP-US−which was free of wild-type virus HN1201 and with deletion of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) was obtained.

1.3 Deletion of GFP Label Gene in the gI/gE/US9/US2 (i.e. gI/gE/11K/28K) Segment-Deleted Recombinant Virus

pBS185 plasmid expressing Cre enzyme (purchased from addgene, Cre enzyme recognizes loxP sites at downstream of USA and upstream of USB, wherein USA and USB are homology arms, and deletes sequence between two loxp sites) and genomic DNA of recombinant virus rPRV-GFP-US− was co-transfected into vero cells, with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection. After serial dilution, PO virus harvested was inoculated for plaque screening; fluorescence-negative plaque was picked for the next round of purification. After 2 rounds of screening and purification, a fluorescence-negative virus was obtained, and named vPRV-US−. PCR identification result after extraction and purification of viral genomic DNA, showed deletion of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment, and indicated that GFP label gene had been deleted. The result showed a successful purification of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus containing no GFP label gene.

1.4 Confirmation of PRV HN1201 Strain With Deletion of US Segment

The viral genome of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus and wild-type virus, was extracted and identified by PCR, with the following primers:

	USDCF:
	TACATCGTCGTGCTCGTCTTTGGC

	USDCR:
	AGCTCGTGCGTCTCGGTGGTG

The size of PCR amplification product of the wild-type virus was 6286 bp, the size of PCR amplification fragment of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus was 1960 bp.
PCR assay result confirmed that ORF of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment had been completely missing.

EXAMPLE 2

Preparation of PRV HN1201 Strain With Deletion of gI/gE/11K/28K/TK

2.1 Construction of a Transfer Vector for Recombinant PRV HN1201GFP Virus

According to the sequence of TK gene to be deleted, the homologous arms at its two ends were designed, called TKA and TKB, respectively. TKA and TKB were cloned into pUC19 vector and named pUCTKAB. Then GFP gene was cloned into pUCTKAB, to obtain a transfer vector for recombinant virus which was called pUCTKA-GFP-B. The homologous arms in the transfer vector are sequences of two sides of TK, therefore the recombinant virus obtained after recombination, was TK gene deleted. FIG. 4 shows the location of homologous arms, TKA and TKB in the genome.

2.1.1 Amplification and Cloning of the Homologous Recombinant Arms

2.1.1.1 Design of Primers and Preparation of Template

Two pairs of primers were designed for amplifying the homologous arms at two sides of TK gene according to the gene sequence of HN1201 virus:
The upstream and downstream primers for the homologous arm TKA at the left side are, respectively:

	TKAF:
	CCGGAATTCGTAGTGCCGGTTGCCCACGTACA
	(the underline portion refers to the EcoR I
	cutting site)

	TKAR:
	CTAGTCTAGAataacttcgtatagtacacattatacgaagttat
	CGCTCAGGCTGCCGTTCTGC
	(the underline portion refers to the Xba I
	cutting site, lowercase letters refer to the
	loxp site)

The upstream and downstream primers for the homologous arm TKB at the right side are, respectively:

	TKBF:
	ACATGCATGCataacttcgtataatgtgtactatacgaagttat
	AACGACGACGGCGTGGGAGG
	(the underline portion refers to the SphI
	cutting site, lowercase letters refer to the
	loxp site)

	TKBR:
	CCCAAGCTTAGGGCGACGGCGAAGAAGAGC
	(the underline portion refers to the Hind III
	cutting site)

2.1.1.2 Amplification and Cloning of the Homologous Arms, TKA and TKB

TKA and TKB were amplified through PCR method by using TAKARA PrimeSTAR, of which the system and condition is as follows:

	Water	Used for adjusting to a final
		volume of 50 μL


98° C.	2	min
98° C.	10	s
68° C.	1	min	}	30 cycles
	15	s
68° C.	5	min

TKA and TKB fragments amplified by PCR were separated by electrophoresis on agarose gel, and the target fragments were recovered with TIANGEN Gel Recovery Kit. TKA fragment and pUC19 vector was digested with both of EcoR I and XbaI, and the target fragments were recovered, linked by T4 DNA ligase, and the product transformed into DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified after enzyme digestion, and the correct plasmid after identification was named pUCTKA. pUCTKA and TKB was digested with both of SalI and HindIII, and the target fragments were recovered, linked by T4 DNA ligase, and the product transformed into DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCTKAB.

2.1.2 Amplification of Label Gene GFP

2.1.2.1 Removal of Multiple Cloning Site (MCS) of GFP Vector pAcGFP-C1

The pAcGFP-C1 plasmid (purchased from Clontech, Catalog No. 632470) was digested with Bgl II and Sma I, and the linearized vector was recovered, linked by T4 DNA Ligase after filling-in with DNA Polymerase I Large (Klenow) Fragment, and the product was transformed into the competent cell DH5α to obtain MCS deleted GFP plasmid, named pAcGFPΔMCS.

2.1.2.2 Amplification of GFP Gene

The primers for amplifying GFP were designed according to the sequence of pAcGFP-C1 vector.

GFP gene was amplified with the template of pAcGFPΔMCS plasmid, of which the system and condition is as follows:

	Water	Used for adjusting to a final
		volume of 50 μL


94° C.	2	min
94° C.	30	s
60° C.	30	s
72° C.	2	min	30 cycles	{close oversize brace}
72° C.	5	min

2.1.3 Linking of GFP Label Gene and pUCTKAB

GFP was digested with both of Sal and Sph I, and the target fragments were recovered, linked to pUCTKAB plasmid which had been through the same double enzyme digestion, and the linked product was transformed into the competent cell DH5α. The transformation mix was spread onto plates containing ampicillin, and incubated at 37° C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCTKA-GFP-B.

2.2 Acquisition of Recombinant Virus Containing GFP

2.2.1 Acquisition of Recombinant Virus Through Co-Transfection of Vero Cells With the Transfer Vector and vPRV-gI-gE-11K-28K-DNA

Co-transfection of vero cells was conducted by using lipofectin technique, wherein 3 μg vPRV-gI-gE-11K-28K− viral genomic DNA and 5 μg the transfer vector pUCTKA-GFP-B was transfected, in accordance with procedures of Lipofectamine 2000 Protocol (Invitrogen, Catalog No. 11668030). Cells were incubated at 37 ° C. in an incubator containing 5% CO₂. The supernatant of cell culture, i.e. PO recombinant virus, named rPRV-GFP-gI-gE-11K-28K-TK−, was collected 36-48 h after transfection, or until the cytopathic effect was visible and infected cells exhibited fluorescence.

2.2.2 Plaque Purification of Recombinant Virus rPRV-GFP-gI-gE-11K-28K-TK−

When infected with the obtained PO recombinant virus rPRV-GFP-gI-gE-11K-28K-TK−, vero cells infected were covered with 2% agarose with low melting point. After 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence, a plaque with a green fluorescence was picked and freeze-thawed 3 times in −70 ° C., inoculated at 10-fold serial dilutions into vero cells previously laid in six-well plates. Such plaque with a green fluorescence was continued to be picked for purification. After 11 rounds of plaques purification, a purified recombinant virus rPRV-GFP-gI-gE-11K-28K-TK− which was free of PRV-gI-gE-11K-28K-TK− and with deletion of five genes was obtained.

2.3 Deletion of GFP Label Gene in gI/gE/11K/28K/TK Deleted Recombinant Virus

The pBS185 plasmid expressing Cre enzyme (purchased from addgene, Cre enzyme recognizes mutated loxP sites at downstream of TKA and upstream of TKB, wherein TKA and TKB are homology arms, and deletes sequence between two loxp sites) and genomic DNA of recombinant virus rPRV-GFP-gI-gE-11K-28K-TK− was co-transfected into vero cells, with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection. After serial dilution, P0 virus harvested was inoculated for plaque screening; fluorescence-negative plaque was picked for the next round of purification. After 2 rounds of screening and purification, a fluorescence-negative virus was obtained, and named PRV-gI-gE-11K-28K-TK−. PCR identification result after extraction and purification of viral genomic DNA, showed deletion of TK gene, and also indicated that GFP label gene had been deleted. The result showed a successful purification of gI-gE-11K-28K-TK− deleted virus containing no GFP label gene.

2.4 Confirmation of PRV HN1201 Strain With Deletion of gI/gE/11K/28K/TK

The primers used for identifying deletion of gI/gE/11K/28K were the same as above.
The viral genome of gI/gE/11K/28K/TK-deleted virus and wild-type virus, was extracted and identified by PCR, with the following primers:

TKDCF: cctacggcaccggcaagagca
TKDCR: cgcccagcgtcacgttgaagac

The size of PCR amplification product of the wild-type virus was 1566 bp, the size of PCR amplification fragment of TK deleted virus was 742 bp (refer to FIG. 5).

EXAMPLE 3

Preparation of PRV HN1201 Strain With Deletion of gI/gE

PRV HN1201 strain with deletion of gI/gE was prepared by reference to the method in Example 1 of CN103756977A.

EXAMPLE 4

Pathogenicity Test of Gene-Deleted PRV Strain

25 7-day-old piglets which were negative for pseudorabies antibodies and pseudorabies antigen were randomly divided into 5 groups (A, B, C, D and blank control group), each with 5 piglets. Grouping conditions and challenge conditions are shown in Table 1.

TABLE 1

Grouping of animals in the pathogenicity test

Group	Strain used for inoculation	Dose

A	PRV HN1201 strain with	inoculated with 1 ml
	deletion of gI/gE/11K/28K	(10^7.0TCID₅₀/ml)/piglet by
	prepared in Example 1	intranasal instillation
B	PRV HN1201 strain with	inoculated with 1 ml
	deletion of	(10^7.0TCID₅₀/ml)/piglet by
	gI/gE/11K/28K/TK	intranasal instillation
	prepared in Example 2
C	PRV HN1201 strain with	inoculated with 1 ml
	deletion of gI/gE prepared	(10^7.0TCID₅₀/ml)/piglet by
	in Example 3	intranasal instillation
D	PRV HN1201 strain	inoculated with 1 ml
		(10^7.0TCID₅₀/ml)/piglet by
		intranasal instillation
Blank	DMEM medium	inoculated with 1 ml/piglet
control		by intranasal instillation

After inoculation of virus, the temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 2.

TABLE 2

Pathogenicity of different genes-deleted
PRV HN1201 strains in 7-day-old piglets

Group	Number	Clinical signs	Death status

A	A1	Normal body temperature, no clinical	Survived
		signs
	A2	Body temperature increased for 1 day,	Survived
		no clinical signs
	A3	Normal body temperature, no clinical	Survived
		signs
	A4	Normal body temperature, no clinical	Survived
		signs
	A5	Body temperature increased for 1 day,	Survived
		no clinical signs
B	B1	Normal body temperature, no clinical	Survived
		signs
	B2	Normal body temperature, no clinical	Survived
		signs
	B3	Normal body temperature, no clinical	Survived
		signs
	B4	Normal body temperature, no clinical	Survived
		signs
	B5	Normal body temperature, no clinical	Survived
		signs
C	C1	Body temperature increased for 1 day,	Survived
		slightly depression, loss of appetite
	C2	Body temperature increased for 1 day,	Survived
		slightly depression, loss of appetite
	C3	Body temperature increased for 1 day,	Survived
		slightly depression, loss of appetite
	C4	Body temperature increased for 1 day,	Survived
		slightly depression, loss of appetite
	C5	Body temperature increased for 1 day,	Survived
		slightly depression, loss of appetite
D	D1	Body temperature increased for 3 days,	Died on day
		depression, completely loss of	3 after
		appetite, neurological signs such as	challenge
		staying lying, dyspnea, trembling,
		convulsions, turning around, and
		making strokes with their arms
	D2	Body temperature increased for 4 days,	Died on day
		depression, completely loss of	4 after
		appetite, staying lying, dyspnea,	challenge
		trembling and convulsions.
	D3	Body temperature increased for 4 days,	Died on day
		depression, completely loss of	4 after
		appetite, neurological signs such as	challenge
		staying lying, dyspnea, trembling,
		convulsions, turning around, and
		making strokes with their arms
	D4	Body temperature increased for 4 days,	Died on day
		depression, completely loss of	4 after
		appetite, neurological signs such as	challenge
		staying lying, dyspnea, trembling,
		convulsions, turning around, and
		making strokes with their arms
	D5	Body temperature increased for 4 days,	Died on day
		depression, completely loss of	4 after
		appetite, neurological signs such as	challenge
		staying lying, dyspnea, trembling,
		convulsions, and making strokes with
		their arms
Blank	K1	Normal	Survived
control	K2	Normal	Survived
	K3	Normal	Survived
	K4	Normal	Survived
	K5	Normal	Survived

It showed in the results that inoculation with PRV HN1201 strain in 7-day-old piglets could lead to 100% death (5/5) of inoculated piglets, while the virulence of PRV HN1201 strain with deletion of gI/gE/11K/28K was significantly decreased, which could only make the temperature of 2 piglets increased, without any clinical signs. Inoculation with PRV HN1201 strain with deletion of gI/gE in 7-day-old piglets could still lead to common clinical signs such as increased body temperature and depression etc., indicating remaining virulence; while PRV HN1201 strain with deletion of gI/gE/11K/28K/TK gene had completely lost its virulence.

EXAMPLE 5

Preparation of the Live Gene-Deleted PRV Vaccines

5.1 Proliferation of Vaccine Virus

The virus seed of PRV HN1201 strain with deletion of gI/gE/11K/28K prepared in Example 1, PRV HN1201 strain with deletion of gI/gE/11K/28K/TK prepared in Example 2 and PRV HN1201 strain with deletion of gI/gE prepared in Example 3 was diluted at 5×10⁴fold, and then inoculated into a monolayer of ST cell. After 1 h adhesion, 1000 ml of DMEM medium containing 2% fetal calf serum was added into ST cell, which was then placed at 37° C. in a roller bottle with a rotation speed of 6 rph. The cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing the medium and the virus titer was assessed. The virus solution was preserved at low temperature.

5.2 Preparation of a Protective Agent

40 g of sucrose and 8 g of gelatin was added into every 100 ml of deionized water, and the solution was autoclaved (under 121° C. for 30 min) after fully melted.

5.3 Preparation of Vaccine Virus Suspension

The virus solution prepared and preserved in Example 5.1 was mixed with the protective agent prepared and preserved in Example 5.2 at a volume ratio of 1:1, distributed into sterilized bottles, each of which containing 2.6 ml and the mixed virus solution was freeze-dried. The vaccine was tested and determined to be free of contamination of bacterium and exogenous viruses and the content of virus was consistent with that before freeze-drying. The batch number of PRV HN1201 strain with deletion of gI/gE/11K/28K prepared in Example 1, PRV HN1201 strain with deletion of gI/gE/11K/28K/TK prepared in Example 2 and PRV HN1201 strain with deletion of gI/gE prepared in Example 3 were 20140501, 20140502 and 20140503, respectively.

EXAMPLE 6

Immunogenicity Assay of the Live Gene-Deleted PRV Vaccines

12 9-day-old piglets which were negative for PRV antibodies and PRV antigens were randomly divided into 5 groups, each with 5 piglets, and the piglets were injected with the vaccines prepared in Example 5 according to Table 3. The vaccine control group was inoculated with the live PRV vaccine, Bartha K-61strain purchased from HIPRA, Spain, Batch No. 42RH, at the dosage from the protocol. The blank control group was inoculated with 1 mL/piglet of DMEM medium. The piglets were challenged with 1□10^7.0TCID₅₀/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (The results are shown in Table 3), the blood of piglets in all the experimental groups and control groups was collected respectively before challenge.

TABLE 3

Grouping of animals in the pathogenicity test

Group	Vaccines injected	Dose

Group I	Batch No.	inoculated with 1 ml
	20140501	10^6.0TCID₅₀/piglet by
		intramuscular injection
Group II	Batch No.	inoculated with 1 ml
	20140502	10^6.0TCID₅₀/piglet by
		intramuscular injection
Group III	Batch No.	inoculated with 1 ml
	20140503	10^6.0TCID₅₀/piglet by
		intramuscular injection
Vaccine control	Live PRV	inoculated with 2 ml
group 2	vaccine	10^6.0TCID₅₀/piglet by
		intramuscular injection
Blank control	DMEM	inoculated with 1 mL/piglet
group	medium	by intramuscular injection

The piglets were challenged with 1□10^7.0TCID₅₀/piglet (1 ml/piglet) of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (The results are shown in Table 5).

TABLE 5

clinical status and challenge status for piglets challenged
after immunization with live PRV vaccines

	clinical signs and death
Group	status	Rate of protection

Group I	Normal body temperature,	100% (5/5)
	normal appetite, no
	abnormal clinical signs,
	survived
Group II	Normal body temperature,	100% (5/5)
	normal appetite, no
	abnormal clinical signs,
	survived
Group III	After immunization, body	100% (5/5)
	temperature increased,
	slightly depression and
	loss of appetite. After
	challenge, normal body
	temperature, normal
	appetite, no abnormal
	clinical signs, survived
Vaccine	Body temperature of three	80% (4/5)
control	piglets increased for 7-10
group	days, depression, loss of
	appetite, one died.
Blank	Body temperature of three	0% (0/5)
control	piglets increased for 7-10
group	days, depression in all
	piglets, partially or
	completely loss of
	appetite, significant
	clinical signs, two piglets
	died on day 4 after
	challenge, and all died
	within 5 days after
	challenge.

The result from Table 5 indicated that immunizing piglets with the gene-deleted PRV vaccines prepared in example 5 can blocked virus infection (i.e. displaying clinical signs), and provide 100% (5/5) protection rate for piglets, while all the piglets in the blank control group died by day 5 after challenge, therefore the PRV vaccines in three experimental groups can provide excellent protection, showing excellent immune protection and safety; meanwhile it indicated that either deletion of gI/gE/11K/28K or deletion of gI/gE/11K/28K/TK for PRV strain would not affect the immunogenicity. For the vaccine group with only deletion of gI/gE, the clinical signs such as increased body temperature could not be avoided, while the vaccine still possessed good immunogenicity. Whereas the commercial vaccines in the prior art cannot provide a full protection to pigs.

EXAMPLE 7

Construction of Gene-Deleted Variant Strains of NVDC-PRV-BJ Strain, NVDCPRV-HEB Strain and NVDC-PRV-SD Strain, HN1202 PRV Variant Strain

gI/gE/11K/28K genes and gI/gE/11K/28K/TK genes were deleted from the parent strains, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain and NVDC-PRV-SD strain (Xiuling Yu, Zhi Zhou, Dongmei Hu,et al. Pathogenic Pseudorabies Virus, China, 2012 Emerging Infectious Diseases, www.cdc.gov/eid ol. 20, No. 1, January 2014) (the applicant promises to open it to public for 20 year from the patent application date according to provisions of Guidelines for Patent Examination), HN1202 strain (deposited in the China Center for Type Culture Collection on Aug. 26, 2013, of which the accession number is CCTCC NO. V 201335 and the address is Wuhan University, Wuhan, China), according to methods in Example 1 and 2. The names of the attenuated strains obtained were NVDC-PRV-BJ with deletion of gI/gE/11K/28K/TK, NVDCPRV-HEB with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD with deletion of gI/gE/11K/28K/TK, and PRVHN1202 with deletion of gI/gE/11K/28K/TK. The deletion of genes was verified through comparison of PCR results with that of parent strains respectively.

EXAMPLE 8

Preparation of Vaccine Compositions of the Attenuated Variant Strains of NVDC-PRV-BJ Strain, NVDC-PRV-HEB Strain and NVDC-PRV-SD Strain, HN1202 PRV Strain

Each attenuated vaccine strains prepared in Example 7 was proliferated according to the method from Example 5.1, mixed with the protective agent (prepared by adding 40 g of sucrose and 8 g of gelatin into every 100 ml of deionized water, and autoclaved (under 121° C. for 30 min) after fully melted) at a volume ratio of 1:1 and the mixed vaccine compositions were freeze-dried. The batch numbers of NVDC-PRV-BJ strain with deletion of gI/gE/11K/28K/TK, NVDCPRV-HEB strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD strain with deletion of gI/gE/11K/28K/TK and PRV HN1201 strain with deletion of gI/gE/11K/28K/TK were Q01, Q02, Q03 and Q04, respectively.

EXAMPLE 9

Pathogenicity Test of the Virus Strains Prepared in Example 7

Pathogenicity test was conducted according to the method in Example 4, in which the piglets were randomly divided into 5 groups, each with 5 piglets, inoculated with 1 ml (10^7.0TCID₅₀/ml) of NVDC-PRV-BJ strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-HEB strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD strain with deletion of gI/gE/11K/28K/TK, and PRV HN1202 strain with deletion of gI/gE/11K/28K/TK by intranasal instillation, respectively. The results showed that all the piglets were alive in each group, with normal body temperature and no clinical signs. It proved that the virulence of mutated PRV strain was reduced through deletion of gI/gE/11K/28K/TK genes.

EXAMPLE 10

Immunogenicity Assay of the Vaccines Prepared in Example 8

Immunogenicity assay of the vaccines prepared in Example 8 was conducted according to the method and dose in Example 6, in the meanwhile the piglets in the vaccine control group were inoculated with the live PRV vaccine, HB-98 strain Batch No. 1308011-1 (purchased from China Animal Husbandry Industry Co., Ltd. Chengdu Medical Equipments Factory). The piglets were challenged with 1□10^7.0TCID₅₀/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (the results are shown in Table 6).

TABLE 6

clinical status and challenge status for piglets challenged
after immunization with live PRV vaccines

		clinical signs and death	Rate of
Group	Vaccines	status	protection

Group IV	Q01	Normal body		100% (5/5)
		temperature, normal
		appetite, no abnormal
		clinical signs, survived
Group V	Q02	Normal body		100% (5/5)
		temperature, normal
		appetite, no abnormal
		clinical signs, survived
Group VI	Q03	Normal body		100% (5/5)
		temperature, normal
		appetite, no abnormal
		clinical signs, survived
Group VII	Q04	Normal body		100% (5/5)
		temperature, normal
		appetite, no abnormal
		clinical signs, survived
Vaccine	the live PRV	Body temperature of five	80% (4/5)
control	vaccine, HB-	piglets increased for 7-10
group	98 strain	days, loss of appetite, one
	Batch No.	piglet died and four
	1308011-1	survived.
Blank	DMEM	Body temperature of all	0% (0/5)
control	medium	piglets increased,
group		depression in all piglets,
		partially or completely
		loss of appetite,
		significant clinical signs,
		two piglets died on day 4
		after challenge, and all
		died within 5 days after
		challenge.

The result from Table 6 indicated that immunizing piglets with the PRV vaccines prepared in Example 8 can block virus infection (i.e. displaying clinical signs), and provide 100% (5/5) protection rate for piglets, while the vaccine control group can only provide 80% (4/5) protection rate for piglets, and all the piglets in the blank control group died by day 5 after challenge, therefore the PRV vaccines of the present invention can provide excellent protection. In addition, the piglets exhibited substantially no clinical signs, indicating excellent immune protection of the PRV vaccines relative to live vaccines in the prior art.

EXAMPLE 11

Monitoring of gB Antibodies After Immunization With Different Strain Vaccines

15 piglets at the age of around 13 days which were negative for PRV antigens and PRV antibodies were randomly divided into 5 groups, each with 5 piglets. Groups 1-3 were injected with the vaccine prepared in Example 5,which is PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, with Batch No. 20140502, the live PRV vaccine Bartha K-61 strain, with Batch No. 66KR, purchased from HIPRA, Spain, and the live PRV vaccine, K-61, with Batch No. 195-B59B purchased from Boehringer Ingelheim (US) respectively. All the dose for immunization is 1 ml/piglet (for commercial vaccine, 1 piglet dosage/piglet, according to protocols; the PRV HN1201 with deletion of gI/gE/11K/28K/TK vaccine, 10^6.0TCID₅₀/piglet). The blank control group was inoculated with 1 mL/piglet of DMEM medium. The blood of piglets was collected on day 8, 10, 12, 14 and 21 after immunization, and gB antibody was determined according to the protocol of gB ELISA antibody detection kit (purchased from Biochek, Batch No. F S5763, Expiry Date: Jan. 7, 2015) after the serum was separated. The detailed results of detection are shown in Table 7 below.

TABLE 7

Results of detection of gB antibodies of piglets after immunization.

	Before	Day 8 after	Day 10 after
	immunization	immunization	immunization

Group	No. of piglet	OD405nm	S/P	OD405nm	S/P	OD405nm	S/P

PRV HN1201	1#	0.184	0.025	0.398	0.469	0.439	0.555
strain with	2#	0.170	−0.004	0.369	0.409	0.453	0.584
deletion of	3#	0.172	0.000	0.263	0.189	0.360	0.390
gI/gE/11K/28K/	4#	0.181	0.019	0.320	0.307	0.494	0.669
TK vaccine	5#	0.182	0.021	0.339	0.347	0.400	0.474
with Batch No.
20140502
Bartha K-61	6#	0.177	0.010	0.223	0.106	0.243	0.147
	7#	0.176	0.008	0.256	0.174	0.286	0.237
	8#	0.167	−0.010	0.224	0.108	0.246	0.154
	9#	0.186	0.029	0.221	0.102	0.219	0.098
	10#	0.175	0.006	0.242	0.145	0.277	0.218
K-61	11#	0.162	−0.019	0.195	0.059	0.185	0.035
	12#	0.16	−0.023	0.174	0.009	0.192	0.052
	13#	0.167	−0.007	0.182	0.028	0.218	0.113
	14#	0.16	−0.023	0.199	0.068	0.201	0.073
	15#	0.17	0.000	0.219	0.115	0.225	0.129

	Day 12 after	Day 14 after	Day 21 after
	immunization	immunization	immunization

Group	No. of piglet	OD405nm	S/P	OD405nm	S/P	OD405nm	S/P

PRV HN1201	1#	0.471	0.621	0.678	1.051	1.069	1.863
strain with	2#	0.510	0.702	0.631	0.953	0.984	1.686
deletion of	3#	0.453	0.584	0.496	0.673	0.619	0.928
gI/gE/11K/28K/	4#	0.596	0.881	0.687	1.070	0.844	1.396
TK vaccine,	5#	0.602	0.893	0.547	0.779	0.690	1.076
Batch No.
20140502
Bartha K-61	6#	0.275	0.214	0.290	0.245	0.570	0.827
	7#	0.302	0.270	0.317	0.301	0.418	0.511
	8#	0.283	0.231	0.309	0.285	0.315	0.297
	9#	0.211	0.081	0.223	0.106	0.316	0.299
	10#	0.272	0.208	0.299	0.264	0.486	0.652
K-61	11#	0.239	0.162	0.274	0.244	0.314	0.338
	12#	0.205	0.082	0.211	0.096	0.277	0.251
	13#	0.248	0.183	0.25	0.188	0.449	0.655
	14#	0.256	0.202	0.285	0.27	0.321	0.354
	15#	0.28	0.258	0.3	0.305	0.385	0.505

Note:
evaluation criteria: negative, S/P value ≦0.499; positive, S/P value ≧0.500.

In conclusion, the antibody test results showed that, all gB antibodies turned positive on day 12 after immunization with PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, while not all the gB antibodies had turned positive on day 21 after immunization with the two control vaccine. It showed that PRV HN1201 strain with deletion of gI/gE/11K/28K/TK could provide earlier immune protection.

EXAMPLE 12

Monitoring of gE Antibodies After Immunization With Four Genes Deleted Strain Vaccine and Challenge

15 piglets at the age of around 13 days which were negative for PRV antigens and PRV antibodies were randomly divided into 3 groups, each with 5 piglets. Groups 1-3 were injected with the vaccine prepared in Example 5,which is PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, with Batch No. 20140502, the live PRV vaccine, Bartha K-61 strain, with Batch No. 66KR, purchased from HIPRA, Spain, and the live PRV vaccine, K-61, with Batch No. 195-B59B purchased from Boehringer Ingelheim (US). All the dose for immunization is 1 ml/piglet (for commercial vaccine, 1 piglet dosage/piglet, according to protocols; the PRV HN1201 with deletion of gI/gE/11K/28K/TK vaccine, 10^6.0TCID₅₀/piglet). The piglets were challenged with 10^7.0TCID₅₀/piglet, 1 ml/piglet of PRV HN1201 strain on day 21 after immunization. The blood of piglets was collected daily continuously from day 7 to day 14 after challenge, and gE antibody was determined according to the protocol of gE ELISA antibody detection kit (purchased from IDEXX Co., Batch No. AK650, Expiry Date: Jun. 13, 2015) after the serum was separated. The results showed that gE antibody was still negative (If the value of S/N is less or equal to 0.60, the sample should be determined as PRV gE antibody positive) on Day 14 after challenge when the piglets were immunized with the vaccine prepared in Example 5, PRV HN1201 with deletion of gI/gE/11K/28K/TK with Batch No. 20140502, while gE antibody became positive at different level when the piglets were immunized with the two commercial vaccines. The detailed results of deletion are shown in Table 8 below.

TABLE 8

Results of detection of gE antibody of piglets after immunization.

	No	Before	Day 7 after	Day 8 after	Day 9 after	Dayb10 after
	of	challenge	challenge	challenge	challenge	challenge

Group	piglet	OD650nm	S/N	OD650nm	S/N	OD650nm	S/N	OD650nm	S/N	OD650nm	S/N

PRV	1#	1.024	1.041	0.917	0.932	0.956	0.972	0.860	0.874	0.863	0.877
HN1201	2#	1.006	1.008	0.979	0.980	0.931	0.932	0.889	0.890	0.780	0.781
with	3#	1.070	1.072	0.990	0.991	1.007	1.009	0.970	0.971	0.929	0.930
deletion	4#	1.052	1.054	0.795	0.796	0.899	0.872	0.972	0.943	1.000	0.970
of	5#	0.969	0.970	0.912	0.913	0.915	0.916	0.922	0.923	0.683	0.684
gI/gE/11K/
28K/TK,
vaccine
with
Batch
No.
20140502
Bartha	6#	1.045	1.078	0.634	0.654	0.684	0.706	0.587	0.606	0.518	0.535
K-61	7#	1.063	1.097	0.788	0.813	0.758	0.782	0.664	0.685	0.612	0.632
	8#	1.008	1.040	0.897	0.926	0.857	0.884	0.784	0.809	0.783	0.808
	9#	1.017	1.050	0.720	0.743	0.637	0.657	0.599	0.618	0.467	0.482
	10#	0.987	1.019	0.871	0.899	0.701	0.723	0.656	0.677	0.655	0.676
K-61	11#	0.905	0.934	0.946	0.976	0.698	0.720	0.643	0.664	0.618	0.638
	12#	1.024	1.057	0.898	0.927	0.773	0.798	0.688	0.710	0.760	0.784
	13#	1.030	1.063	0.957	0.928	0.965	0.936	0.913	0.886	0.732	0.710
	14#	0.963	0.934	0.757	0.734	0.899	0.872	0.972	0.943	1.000	0.970
	15#	0.944	0.916	0.747	0.725	0.591	0.573	0.543	0.527	0.531	0.515

		Day 11 after	Day 12 after	Day 13 after	Day 14 after
	No of	challenge	challenge	challenge	challenge

Group	piglet	OD650nm	S/N	OD650nm	S/N	OD650nm	S/N	OD650nm	S/N

PRV	1#	0.884	0.898	0.877	0.891	0.871	0.885	0.880	0.894
HN1201	2#	0.854	0.855	0.780	0.781	0.793	0.794	0.732	0.733
with	3#	0.907	0.908	0.905	0.906	0.904	0.905	1.067	1.069
deletion	4#	0.965	0.936	0.864	0.838	0.997	0.967	0.929	0.901
of	5#	0.623	0.624	0.718	0.719	0.784	0.785	0.718	0.719
gI/gE/11K/
28K/
TK
vaccine,
with
Batch
No.
20140502
Bartha	6#	0.552	0.570	0.482	0.497	0.463	0.478	0.456	0.471
K-61	7#	0.664	0.685	0.533	0.550	0.499	0.515	0.478	0.493
	8#	0.749	0.773	0.647	0.668	0.700	0.722	0.753	0.777
	9#	0.450	0.464	0.410	0.423	0.432	0.446	0.433	0.447
	10#	0.633	0.653	0.699	0.721	0.684	0.706	0.676	0.698
K-61	11#	0.568	0.586	0.472	0.487	0.472	0.487	0.449	0.463
	12#	0.745	0.769	0.659	0.680	0.659	0.680	0.714	0.737
	13#	0.785	0.761	0.678	0.658	0.505	0.490	0.425	0.412
	14#	0.965	0.936	0.864	0.838	0.997	0.967	0.929	0.901
	15#	0.578	0.561	0.528	0.512	0.457	0.443	0.398	0.386

The above results indicated that the vaccine strains in the present invention has a better immunogenicity than commercial vaccine in the prior art, and after immunization therewith a faster generation of the antibody can be achieved, and the effective amplification of virus in the body of pigs can be blocked, and gE antibody is negative.
Those are only preferred embodiments of the present invention as described above, which cannot be used to limit the present invention. Any change, substitution or modification etc., which are within the spirit and principle of the invention, should be included within the scope of protection of the present invention.

Claims

What is claimed is:

1. An attenuated strain of porcine pseudorabies virus comprising a first attenuated porcine pseudorabies virus strain, wherein the first attenuated strain of porcine pseudorabies comprises a porcine pseudorabies virus strain with inactivation of gI/gE/11K/28K protein.

2. The attenuated strain of porcine pseudorabies virus of claim 1, wherein the first attenuated porcine pseudorabies virus strain is a variant strain of pseudorabies virus.

3. The attenuated strain of porcine pseudorabies virus of claim 1, wherein a whole ORF is deleted from a gI/gE/11K/28K gene of the first attenuated porcine pseudorabies virus strain.

4. The attenuated strain of porcine pseudorabies virus of claim 2, wherein the variant strain of pseudorabies virus comprises a virus strain in which gE protein has 95% or greater homology with SEQ ID NO. 05.

5. The attenuated strain of porcine pseudorabies virus of claim 4, wherein said variant strain of pseudorabies virus is obtained through isolation, and when infection with said variant strain occurs in pigs previously immunized with a second attenuated gene deleted porcine pseudorabies virus strain, wherein the second attenuated gene deleted porcine pseudorabies virus strain is prepared according to the prior art, the pigs display clinical signs of infection selected from the group consisting of high fever, depression, and partial or complete loss of appetite.

6. The attenuated strain of porcine pseudorabies virus of claim 5, wherein when exposed to said variant strain of pseudorabies virus, pigs previously immunized with the second attenuated porcine pseudorabies virus strain develop a pseudorabies infection, and wherein the second attenuated porcine pseudorabies vaccine is a prior art strain with deletion of one or more of the group consisting of gE, TK and gI genes.

7. The attenuated strain of claim 6, wherein the pseudorabies infection comprises clinical signs of infection selected from the group consisting of depression and loss of appetite among piglets at the age of 9-10 days.

8. The attenuated strain of porcine pseudorabies virus of claim 1, wherein the first porcine pseudorabies virus strain is selected from the group consisting of an HN1201 strain, HN1202 strain, JS-2012 strain, PRV HeN1 strain, NVDC-PRV-BJ strain, NVDCPRV-HEB strain or NVDC-PRV-SD strain, PRV TJ strain, and PRV-ZJ01 strain.

9. The attenuated strain of porcine pseudorabies virus of claim 1, wherein the first attenuated strain of porcine pseudorabies virus strain comprises a gene variation resulting in inactivation of TK protein.

10. The attenuated strain of porcine pseudorabies virus of claim 9, wherein the gene variation comprises a nucleotide sequence located at a site corresponding to a TK gene of the first attenuated porcine pseudorabies virus strain, and wherein the nucleotide sequence encodes for SEQ ID NO. 4.

11. A vaccine composition, comprising an immunizing amount of an antigen of an attenuated strain of porcine pseudorabies and a carrier, wherein the attenuated strain of porcine pseudorabies comprises a genetic variation resulting in inactivation of gI/gE/11K/28K protein.

12. The vaccine composition of claim 11, wherein the immunizing amount comprises at least 10^6.0TCID₅₀/ml of the attenuated strain of porcine pseudorabies virus.

13. The vaccine composition of claim 11, wherein the antigen comprises a live attenuated strain of porcine pseudorabies virus, and wherein the vaccine composition further comprises a cryoprotectant.

14. The vaccine composition of claim 11, further comprising an inactivated pathogen or antigen.

15. The vaccine composition of claim 14, wherein the inactivated pathogen or antigen is selected from the group consisting classical swine fever virus, antigen of porcine reproductive and respiratory syndrome virus, antigen of porcine circovirus, antigen of haemophilus parasuis, and antigen of mycoplasma.

16. A method of treating and preventing pseudorabies infection, comprising immunizing a pig with an antigen comprising a porcine pseudorabies virus strain with inactivation of gI/gE/11K/28K protein.

17. The method of claim 16, wherein the porcine pseudorabies virus strain comprises a virus strain in which gE protein has 95% or greater homology with SEQ ID NO. 05.