US20160032369A1 - Method and kit for genetic analysis - Google Patents
Method and kit for genetic analysis Download PDFInfo
- Publication number
- US20160032369A1 US20160032369A1 US14/863,503 US201514863503A US2016032369A1 US 20160032369 A1 US20160032369 A1 US 20160032369A1 US 201514863503 A US201514863503 A US 201514863503A US 2016032369 A1 US2016032369 A1 US 2016032369A1
- Authority
- US
- United States
- Prior art keywords
- gene
- allele
- risk
- polymorphism
- alleles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16Z—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS, NOT OTHERWISE PROVIDED FOR
- G16Z99/00—Subject matter not provided for in other main groups of this subclass
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
- G16B25/10—Gene or protein expression profiling; Expression-ratio estimation or normalisation
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/30—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/165—Mathematical modelling, e.g. logarithm, ratio
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/40—Population genetics; Linkage disequilibrium
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
Definitions
- This disclosure relates to methods and kits for assessing severity index for alcohol abuse, drug abuse, and other reward deficiency syndromes.
- RDS Reward Deficiency Syndrome
- the molecule dopamine after binding to the dopamine D2 receptor has been associated with many behaviors (Dackis and Gold 1985; Di Chiara and Imperato 1988) and the DRD2 has been referred to as a reward gene [Blum et al 1990; Eisenberg 2007; Hietala I 1994; Hietala II 1994; Volkow 2001; Volkow 2002].
- the DRD2 gene and especially the TaqI A1 allele have been most associated with neuropsychiatric disorders in general, in alcoholism, and other addiction (carbohydrate) reward behaviors, it may also be involved in co-morbid antisocial personality disorder symptoms (especially in children and adults with attention deficit hyperactivity disorder (ADHD) or Tourette's Syndrome) and high novelty seeking.
- Dopamine has been called the “anti-stress molecule” and/or the “pleasure molecule.” [Blum 1990]. When dopamine is released into the synapse, it stimulates a number of receptors (D1-D5), which results in increased feelings of well-being and stress reduction [Picetti 2013].
- the mesocorticolimbic dopaminergic pathway plays an especially important role in mediating the reinforcement of natural rewards like food and sex, as well as unnatural rewards like drugs of abuse [Melis 2005]. Natural rewards include satisfaction of physiological drives (e.g., hunger and reproduction) and unnatural rewards are learned and involve satisfaction of acquired pleasures such as hedonic sensations derived from alcohol and other drugs, as well as from gambling and other risk-taking behaviors. [Blum 1996; Blum 2013; Blum 2014].
- an individual may not drink or use drugs but may have other RDS behaviors like overeating or intensive video gaming.
- Blum et al. [Blum 2011] found a very strong association of the dopamine D2 receptor A1 allele (100%) in one Family (A).
- every individual in Family B also has at least one dopaminergic high risk allele (100%) (48% carried the DRD2 A1 allele]).
- family B only three adult individuals had no addictive behaviors.
- the present invention satisfies the need to classify patients at genetic risk for drug/alcohol seeking behavior prior to or upon entry to residential and or non-residential chemical dependency and pain programs.
- This invention incorporates the utilization of an “allelic analysis,” which is an analysis used to determine the presence of particular alleles in the tested subject.
- allelic analysis is an analysis used to determine the presence of particular alleles in the tested subject.
- risk severity the percentage of prevalence of the risk alleles was determined using allelic analysis and a severity score based on percentage of these alleles was determined.
- the percentage-prevalence of risk alleles were calculated and severity ranked in 273 subjects as: All subjects tested positive for risk severity, 40.4% (having 9 or more RDS risk alleles), 30.9% (7 or 8 RDS risk alleles), and 28.7% (6 or less RDS risk alleles).
- the invention features a method of obtaining a risk score for evaluating stratification of a plurality of ranges for a genetic addiction risk.
- the method includes the step of obtaining a biological sample from a subject.
- the method further includes the step of performing an allelic analysis on the biological sample to determine the presence of a plurality of pre-determined alleles.
- Each of the alleles in the plurality of pre-determined alleles is associated with a gene in a plurality of pre-determined genes. There are at least ten genes in the plurality of pre-determined genes. There is at least one allele for each of the genes in the plurality of pre-determined genes.
- the method further includes the step of assigning a count for each of the alleles in the plurality of pre-determined alleles that was present in the biological sample.
- the method further includes the step of determining a risk score based upon the count, wherein the stratification of the plurality of ranges identifies a severity of the genetic addition risk.
- Implementations of the inventions can include one or more of the following features:
- the plurality of pre-determined alleles may include: (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- These pre-determined alleles are the alleles of SEQ ID NOS 1-8, DAT1 3′ 40 bp repeat, DRD4 48 bp repeat in intron 3, and GABARB3 (CA-dinucleotide repeat).
- DAT1 3′ 40 bp repeat, DRD4 48 bp repeat in intron 3, and GABARB3 are as disclosed in Kirchheiner 2007, Johnson 2008, and Feusner 2001, respectively.
- the risk score in a first range can be indicative of a low genetic addictive risk.
- the risk score in a second range can be indicative of a moderate genetic addictive risk.
- the risk score in the third range can be indicative of a high genetic addictive risk.
- the high range can be 4 and above.
- the low range can be from 0 to 1.
- the high range can be 8 and above.
- the low range can be from 0 to 3.
- the risk score can be the sum of the alleles in the plurality of pre-determined alleles found to be present in the biological sample.
- the step of determining the risk score does not include weighting results of the allelic analysis of the biological sample.
- the risk score can identify the stratification of a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- the invention features a method that includes a genotypic analysis of a panel of genes to identify a plurality of alleles.
- the plurality of alleles includes: (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- the invention features a kit for analyzing a panel of genes that includes primers for sequencing (5′ to 3′) consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- primers for sequencing 5′ to 3′ consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R
- the invention features a method of establishing a genetic risk stratification of a plurality of ranges for genetic addictive risk analysis.
- the method includes the step of selecting a plurality of alleles. Each of the alleles in the plurality of alleles is associated with a gene in a plurality of genes. There are at least ten genes in the plurality of genes. There is at least one allele for each of the genes in the plurality of genes.
- the method further includes the step of performing an allelic analysis using the plurality of alleles on a plurality of subjects.
- the plurality of subjects includes a statistically informative sample of subjects. Each of the subjects in the plurality of subjects have a non-allelic risk score.
- the non-allelic risk score having been determined independent of the allelic analysis.
- the method further includes the step of assigning a count for each of the alleles in the plurality of pre-determined alleles that was present in the biological sample.
- the method further includes the step of determining an allelic risk score for each subject in the plurality of subjects based upon the count.
- the method further includes the step of comparatively analyzing the non-allelic risk scores and the allelic risk scores.
- the comparative analysis results in establishing that the allelic risk score significantly predicts the non-allelic score of the plurality of subjects.
- the significant prediction is at a p-value of at most 0.05.
- Implementations of the inventions can include one or more of the following features:
- the p-value can be at most 0.01.
- At least five of the alleles in the plurality of alleles can be selected from the group consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- At least eight of the alleles in the plurality of alleles can be selected from the group consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- the step of comparatively analyzing can include utilizing logistic regression modeling.
- the non-allelic risk score can be based upon stratification of a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- the present invention relates to methods and kits for assessing severity index for alcohol abuse, drug abuse, and other reward deficiency syndromes.
- RDS such as alcoholism or even psychostimulant abuse
- problems in using a single diagnosis there are problems in using a single diagnosis. Instead, a new strategy for population-based studies has been discovered in which the investigator requires a representative control sample, removing confounding cases from the control group that may improve chances of finding significant differences between experimental and control groups. This approach however may risk a “lack of representation′ in the control group.” Even the use of stratified samples (weighting samples) may not be good enough.
- RDS The established concept of RDS must be considered to help define this complex array of behaviors, and associated molecular dysfunctions. Victims of RDS carry polymorphic genes in dopaminergic pathways that results in hypo-dopaminergic function caused by a reduced number of dopamine D2 receptors, reduced synthesis of dopamine (dopamine beta-hydroxylase), reduced net release of pre-synaptic dopamine, increased synaptic clearance due to a high number of dopamine transporter sites and low D2 receptor densities making them more vulnerable to addictive activities.
- the need for a unified set of related symptoms in the affected phenotype is important not only for population-based association studies, but also for linkage analysis.
- the RDS concept involves, shared genes and behavioral tendencies including dependence on alcohol, psycho-stimulants, marijuana, nicotine (smoking), opiates, epigenetic induced altered opiate receptor function, carbohydrates (sugar-binging), obesity, pathological gambling, sex addiction, aggression, stress, certain personality disorders, and including novelty seeking. While there are poly-genes involved the common theme in all of these substances and behaviors is that they induce pre-synaptic dopamine release at the NAc. Spectrum disorders such as ADHD, Tourette's syndrome and Autism are included due to dopamine dysregulation.
- a screened control group is essential for uncovering population-based associations where the disease in question may be very common. It is known that approximately one-third of the population meet lifetime criteria for common psychiatric disorders according to the results of the Epidemiological Catchment Area (ECA) survey. Since RDS is a “polygenic disorder” involving multiple genes and many polymorphisms and requires a threshold number of polygenes, unaffected individuals in the population also carry some of these genes. The dopamine D2 receptor gene (A1 allele) is present in about one-third of unscreened Americans (29.4% in 3329 subjects studied up until 2003). [Blum 2000].
- RDS is a basic phenotype covering many reward behaviors and pertinent psychiatric disorders including spectrum disorders that should be included in the future in DSM as a genetic umbrella for many psychiatric diagnoses.
- most recently RDS has been accepted as an important psychiatric disorder by SAGE publication and will appear in the Encyclopedia of Abnormal Psychology (2015).
- the reward genes have been extensively studied and include, but are not limited to D1-D5 receptors; Dopamine Transporter (DAT1); Serotonin 2a/c receptors; Serotonin transporter (5-HTTLPR); Mu opiate receptor (OPRM1); GABA receptor (GABRB3); catechol-o-methyltransferase (COMT) val158met; and MAO-A gene promoter VNTR among others. See TABLE 2.
- Applicant has discovered that evaluating using a polygenic test to determine stratified genetic risk of addictive patients entering treatment facilities suggest a paradigm shift in providing important information about an individual's predisposition to RDS based on a number of risk alleles. Validation of these results provides an impetus for appropriate and careful selection of a complete Gene Map for all addictive behaviors.
- the DAT1 genotype is the DAT1 3′ 40 bp repeat disclosed in Kirchheiner 2007.
- the DRD4 genotype is the DRD4 48 bp repeat in intron 3 disclosed in Johnson 2008.
- the GABARB3 CA-dinucleotide repeat is disclosed in Feusner 2001.
- Paper-and-pencil tests included the Drug History Questionnaire and Symptom Severity Questionnaires (73-Stranz & Welsh, 1995), and the Addiction Severity Index .
- Biological tests included: urine drug tests, breathalyzer test, and a blood based CBC test. Alcohol and drug use data was collected using the Addiction Survey Index-Multi-Media (ASI-MV).
- ASI-MV Addiction Survey Index-Multi-Media
- Saliva was collected using a minimally invasive process that requires a subject to spit into a collection tubes supplied by the Institute for Behavioral Genetics (IBG), University of Colorado Boulder, Boulder, Colo. Specimen tubes were labeled with a pre-defined ID and bar coded by Dominion Diagnostics in order to limit sampling errors. Subjects supplied 2 ml of saliva that was stabilized using a buffer consisting of sodium dodecyl sulfate, TRIS-EDTA buffer, pH 8.0 and proteinase K. Tubes were stored at room temperature at each treatment center and shipped to Dominion Diagnostics after they had enrolled 40 subjects. Patent saliva samples were then sent to AS at IBG for DNA extraction and isolation using protocols detailed elsewhere (74-Haberstick et al, 2014).
- the assays for Amelogenin, MAOA-uVNTR, DRD4, DAT1 and 5HTTLPR [were done in a single multiplex PCR reaction consisting of two ⁇ l of DNA (20 ng or less), 1.8 mM MgCl 2 , 180 ⁇ M each deoxynucleotide (dNTP, NEB), with 7′-deaza-2′-deoxyGTP (deaza-GTP, Roche Applied Science, Indianapolis, Ind.) substituted for one-half of the dGTP, 10% DMSO, forward (fluorescently labeled) and reverse primers (sequences and concentrations in TABLE 5, one unit of AmpliTaq Gold® polymerase (Life Technologies Grand Island, N.Y.) and 1 ⁇ PCR buffer II in a total volume of 20 ⁇ l.
- the assay for the dinucleotide repeat in GABRB3 was analyzed separate in a PCR reaction consisting of two ⁇ l of DNA (20 ng or less), 2.5 mM MgCl 2 , 200 ⁇ M each deoxynucleotide (dNTP, NEB), forward (fluorescently labeled) and reverse primers, one unit of AmpliTaq Gold® polymerase and 1 ⁇ PCR buffer II in a total volume of 20 ⁇ l. Amplifications were performed using a modified touchdown PCR method. [Anchordoquy 2003; Don 1992] A 95° C. incubation for 10 min was followed by two cycles of 95° C. for 30 s, 65° C. for 30 s, and 72° C. for 60 s.
- the annealing temperature was decreased every two cycles from 65° C. to 57° C. in 2° C. increments (10 cycles total), followed by 30 cycles of 95° C. for 30 s, 55° C. for 30 s, and 72° C. for 60 s, a final 30-min incubation at 72° C. and a hold at 4° C.
- Each 96 well plate included non-template and DNA standards of known genotype.
- the assay for rs25531 (A/G) is detailed elsewhere [Haberstick 2014].
- This SNP is located in the Long-form of the 5HTTLPR and allows determination of the L A and L G alleles.
- the 5HTTLPR site containing the SNP was amplified in a single PCR reaction composed as described above with the primers described in Hu 2005.
- the cycling conditions were a 95° C. incubation for 10 min followed by two cycles of 95° C. for 30 s, 65° C. for 30 s, and 72° C. for 60 s, two cycles of 95° C. for 30 s, 63° C. for 30 s, and 72° C. for 60 s, 30 cycles of 95° C. for 30 s, 61° C.
- PCR products and MspI digests were filter purified using Zymo Research (Irvine, Calif.) ZR-96 DNA Sequencing Clean-up Kits following manufacturer's directions.
- An aliquot of PCR products was combined with loading buffer containing size standard (Rox1000, Gel Company, San Francisco, Calif.) and analyzed with an ABI PRISM® 3130xl Genetic Analyzer (Life Technologies) using protocols supplied by the company. Data were analyzed with Genemapper software and the resulting allele sizes independently reviewed by two investigators.
- the SNP assays for TaqIA were done using a fluorogenic 5′ nuclease (Taqman®, ABI, Foster City, Calif.) method [Haberstick 2004] on an ABI Prism® 7000 Sequence Detection System via the allelic discrimination mode. [Livak 1999].
- the percentage-prevalence of risk alleles was calculated and severity ranked in 273 subjects as: All subjects texted positive for risk severity, 40.4% (having 9 or more RDS risk alleles), 30.9% (7 or 8 RDS risk alleles), and 28.7% (6 or less RDS risk alleles). Hardy Weinberg equilibrium (HWE) was confirmed for each gene using ⁇ 2 tests.
- an analysis was performed for genetic risk stratification for Reward Deficiency Syndrome (RDS).
- RDS Reward Deficiency Syndrome
- a low p-value (less than 0.05) is highly significant.
- the above results were particularly robust, as the p-values observed were around 0.01 and better. This is indicative that a relationship exists between the risk assessment generated from the cluster being tested and the risk severity of the group being investigated.
- the alleles of this tested panel was further evaluated by change a specific risk allele in the cluster as set forth in Example No. 1.
- the resultant data revealed a non-significant association with the ASI-Media version for alcohol severity.
- Standard weighting involves utilizing super controls against the ASI-Alcohol severity index as well as drug severity index. In this method the resultant odds ratios (OR) issue used to determine the appropriate algorithm for weighting each representative gene allele.
- the tested subjects were classified in ranges of low, moderate, and high gene additive risks for drugs and alcohol. For instance, for this panel of alleles, a score in the ranges of 0 to 1, 2 to 3, and 4 and above, correspond to low, moderate, and high for gene additive risks for drugs. Further, for instance, for this panel of alleles, a score in the ranges of 0 to 3, 4 to 7, and 8 and above, correspond to low, moderate, and high for gene additive risks for alcohol.
- the results of the allele analysis can be normalized, i.e., divide the score (or count) by the total possible score.
- This provides alternative ranges that can be classified as low, moderate, and high risk in view of the tested alleles. Such ranges would be, for example, 0 to 0.3, 0.31 to 0.59, and 0.6 to 1, and would be categorized as low, moderate, and high risk for the tested alleles. It is noteworthy that such ranges are not the same as those set forth above for the gene additive risks for drugs and alcohol. Rather, these provide a metric as to the percent of these alleles that a subject has in the panel, which alleles have been found to correlate with gene additive risks. Such normalized results thus provide a metric of where on the spectrum a subject falls, with the higher percentage indicating that the subject has a higher risk probability.
- TABLE 8 shows a genetic addition risk test results having a risk score and normalized risk score indicated.
- the risk allele count is based upon the positive indication of the alleles in the panel tested.
- the allelic analysis for the sample showed that for allele G of gene COMT, the result was “G,G” which gives a count of 2.
- the allelic analysis for the sample showed that for allele G of gene DRD1, the result was “A,A” which gives a count of 0.
- the allelic analysis for the sample showed that for allele C of gene DRD3, the results was “C,T” which gives a count of 1.
- the risk counts obtained for each of the tested alleles were then added up to yield the risk score, which, as shown in the sample of TABLE 8 was 12. As the maximum risk score was 22 (since 11 alleles were tested), the normalized score was 0.55 (which is also shown in TABLE 8).
- Such risk score of 12 is indicative of a patient having a high genetic addition risk for alcohol (because the risk score is above 8) and a high genetic addiction risk for drugs (because the risk score is above 4).
- Such a normalized risk score of 0.55 i.e., 55%) falls in the category of being a modest addiction risk on the normalized scale (which is a more conservative analysis). This reflects that there are multiple stratifications that can be utilized to determine genetic addictive risks.
- Candidate genes such as those for catechol-O-methyltransferase, melanocortin-1 receptor, guanosine triphosphate cyclohydrolase and mu-opioid receptor have been intensively investigated, and associations were found with sensitivity to pain as well as with analgesic requirements in states of acute and chronic pain.
- drug-metabolizing enzymes the impact of genetic variants of drug-metabolizing enzymes on the response to pharmacotherapy is generally well described.
- Polymorphisms of the cytochrome P450 enzymes influence the analgesic efficacy of codeine, tramadol, tricyclic antidepressants and nonsteroidal anti-inflammatory drugs.
- sensitivity and tolerance to morphine were determined in 2 strains of mice, BALB/cBy and C57BL/6By, their reciprocal F1 hybrids and seven of their recombinant inbred strains. Sensitivity was established based on locomotor activity following the administration of saline, 10 or 20 mg/kg of morphine hydrochloride while tolerance was established according to the “hot plate” method following the single or repeated administration of saline, 5, 10, or 20 mg/kg of morphine hydrochloride. Results indicate that both sensitivity and tolerance to morphine are genotype-dependent and their inheritance is characterized by dominance or partial dominance.
- methadone The most common treatment for opioid dependence is substitution therapy with another opioid such as methadone.
- the methadone dosage is individualized but highly variable, and program retention rates are low due in part to non-optimal dosing resulting in withdrawal symptoms and further heroin craving and use.
- Methadone is a substrate for the P-glycoprotein transporter, encoded by the ABCB1 gene, which regulates central nervous system exposure.
- MDR1 mutations often demonstrate pharmacogenetic consequences, and since opioids are among the P-glycoprotein substrates, opioid pharmacology may be affected by MDR1 mutations.
- the single nucleotide polymorphism A118G of the mu opioid receptor gene has been associated with decreased potency of morphine and morphine-6-glucuronide, and with decreased analgesic effects and higher alfentanil dose demands in carriers of the mutated G118 allele. Genetic causes may also trigger or modify drug interactions, which in turn can alter the clinical response to opioid therapy.
- paroxetine increases the steady-state plasma concentrations of (R)-methadone in extensive but not in poor metabolizers of debrisoquine/sparteine.
- codeine which should not be administered to poor metabolizers of debrisoquine/sparteine.
- Genetically precipitated drug interactions might render a standard opioid dose toxic and should, therefore, be taken into consideration. Mutations affecting opioid receptors and pain perception/processing are of interest for the study of opioid actions, but with modern practice of on-demand administration of opioids their utility may be limited to explaining why some patients need higher opioid doses; however, the adverse effects profile may be modified by these mutations.
- Mu opioid receptor delta-opioid receptor
- Such polymorphisms include a polymorphism in a gene encoding a Beta-adrenergic receptor; a polymorphism in a gene encoding an angiotensin converting enzyme (ACE); a polymorphism in a gene encoding an angiotensin 11 T1 receptor; a polymorphism in a gene encoding cholesteryl ester transfer protein; a polymorphism in a gene encoding a potassium channel; a polymorphism in a gene encoding a cytochrome P-450 enzyme, optionally CYP2D6; a polymorphism in a gene encoding a protein product of the HER2/neu oncogene; a polymorphism of the C825T gene; a polymorphism in the APOE gene locus); a polymorphism in the CT or TT allele of the dopamine D2 receptor gene; a SNP (polymorphism) designated AA, at nucleot
- Allelic analysis includes identifying at least one mutation that is a polymorphism selected from the group consisting of a polymorphism (Rs value of SNP) of a gene encoding DRD2 (Rsl800497, Rs6278, Rs6276, RslO79594, Rs 6275, Rsl801028, Rsl076560, Rs2283265, RslO79727, RslO76562, Rsll25394, Rs4648318, Rs4274224, Rs7131056, Rs4648317, Rsl799732, Rsl799978; 5HT2A (Rs6314, Rs3742278, Rs6561333, Rsl923886, Rs643627, Rs2770292, Rsl928040, Rs2770304, Rs594242, Rs6313; ANKKl (RS2734849, RS1800497, Rsll604671, Rs4938016); OPRKl (Rs35160174, Rs35373196, Rs34709943 RS6473797)
- Utilization of the genetic addictive risk analysis test in clinical practice should: (1) reduce denial; (2) reduce guilt; (3) reduce erroneous-prediction of relapse chance; (4) lead to appropriate therapeutic targets based on known gene polymorphisms and medication dosing; (5) improve drug selection and evaluation; (6) analyze patient risk for pain medication tolerance, dependence, and/or abuse; and (7) improve outcomes based on medical necessity.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medical Informatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Theoretical Computer Science (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Public Health (AREA)
- Pathology (AREA)
- Databases & Information Systems (AREA)
- Epidemiology (AREA)
- Data Mining & Analysis (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Primary Health Care (AREA)
- Evolutionary Computation (AREA)
- Computer Vision & Pattern Recognition (AREA)
- Bioethics (AREA)
- Software Systems (AREA)
- Artificial Intelligence (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
- This claims the benefit of provisional U.S. Patent Application Ser. No. 62/023,144, filed on Jul. 10, 2014, entitled “Genetic Addiction Risk Score (GARSRX™) Panel Predicts Addiction Severity Index for Alcohol and Drugs.” This patent application is commonly assigned to the Assignee of the present invention and is hereby incorporated herein by reference in its entirety for all purposes.
- This application is also related to, but does not claim the benefit, of U.S. patent application Ser. No. 13/092,894, filed Apr. 22, 2011, entitled “Genetic Risk Analysis In Reward Deficiency Syndrome,” and U.S. patent application Ser. No. 14/247,240, filed Apr. 7, 2014, entitled “Method to Assess Treatment Outcomes in Reward Deficiency Syndrome (RDS) Behaviors Utilizing Expression Profiling.” These patent applications are also hereby incorporated by reference in their entirety for all purposes.
- This disclosure relates to methods and kits for assessing severity index for alcohol abuse, drug abuse, and other reward deficiency syndromes.
- In 2013, it was noted in Blum 2013, Chapter 2, Section, 2.5, p. 39:
-
- When almost half-of the US population have indulged in illegal drug practices, when our presidential candidates are forced to dodge the tricky question of their past history involving illegal drug use, and when almost every American has sloshed down a martini or two in their life time, there must be a reason, there must be a need, there must be a natural response for humans to imbibe at such high rates. There is even a more compelling question surrounds the millions who seek out high risk novelty. Why do millions have this innate drive in face of putting themselves in Harm's way? Why are millions paying the price of their indiscretions in our jails, in hospitals, in wheel chairs and are lying dead in our cemeteries. What price must we pay for pleasure seeking or just plain getting “HIGH”? Maybe the answer lies within our brain. Maybe it is in our genome?
- Reward Deficiency Syndrome (RDS) was first defined by the inventor and his lab in 1996 as a putative predictor of impulsive and addictive behaviors. [Blum 2000; Blum 1996; Comings 2000]. See also TABLE 1.
-
TABLE 1 The Reward Deficiency Syndrome Behaviors (RDS). ADDITIVE BEHAVIORS IMPULSE BEHAVIORS OBESSIVE Substance Non Substance Spectrum Disruptive COMPULSIVE PERSONALITY Related Related Disorders Impulsive BEHAVIORS DISORDERS Alcohol Thrill seeking Attention- Anti-social Body Paranoid (novelty) deficit Dysmorphic Hyperactivity Cannabis Sexual Tourette and Conduct Hoarding Schizoid Sadism Tic Syndrome Opioids Sexual Autism Intermittent Trichotillo- Borderline Masochism Explosive mania (hair pulling) Sedatives/ Hypersexual Oppositional Excoriation Schizotypal Hypnotics Defiant (skin picking) Stimulants Gambling Exhibitionistic Non-suicidal Histrionic Self-Injury Tobacco Internet Narcissistic Gaming Glucose Avoidant Food Dependent - The molecule dopamine after binding to the dopamine D2 receptor has been associated with many behaviors (Dackis and Gold 1985; Di Chiara and Imperato 1988) and the DRD2 has been referred to as a reward gene [Blum et al 1990; Eisenberg 2007; Hietala I 1994; Hietala II 1994; Volkow 2001; Volkow 2002]. Although the DRD2 gene and especially the TaqI A1 allele have been most associated with neuropsychiatric disorders in general, in alcoholism, and other addiction (carbohydrate) reward behaviors, it may also be involved in co-morbid antisocial personality disorder symptoms (especially in children and adults with attention deficit hyperactivity disorder (ADHD) or Tourette's Syndrome) and high novelty seeking.
- Dopamine has been called the “anti-stress molecule” and/or the “pleasure molecule.” [Blum 1990]. When dopamine is released into the synapse, it stimulates a number of receptors (D1-D5), which results in increased feelings of well-being and stress reduction [Picetti 2013]. The mesocorticolimbic dopaminergic pathway plays an especially important role in mediating the reinforcement of natural rewards like food and sex, as well as unnatural rewards like drugs of abuse [Melis 2005]. Natural rewards include satisfaction of physiological drives (e.g., hunger and reproduction) and unnatural rewards are learned and involve satisfaction of acquired pleasures such as hedonic sensations derived from alcohol and other drugs, as well as from gambling and other risk-taking behaviors. [Blum 1996; Blum 2013; Blum 2014].
- In discussing RDS, insensitivity and inefficiency in the reward system is specifically referred to. There may be a common neurocircuitry, neuroanatomy and neurobiology for multiple addictions and for a number of psychiatric disorders. [Bowirrat 2005]. Due to specific genetic antecedents and environmental influences (epigenetic) a deficiency of the D2 receptors may predispose individuals to a high risk for multiple addictive, impulsive, and compulsive behaviors. It is well known that alcohol and other drugs of abuse, as well as most positive reinforces (i.e., sex, food, gambling, aggressive thrills) cause activation and neuronal release of brain dopamine and involvement of the Na+/K+-ATPase. Dopamine release can decrease negative feelings and satisfy abnormal cravings for alcohol, cocaine, heroin and nicotine which among others are linked to low dopamine function. [Rothman 2007].
- In doing association studies for which an investigator requires a representative control sample for a single RDS psychiatric diagnosis or for potential subsets of RDS, there are limitations that relate to controls poorly screened for multiple RDS behaviors and other related psychiatric disorders. Missing behaviors that are part of the RDS subset may be the reason for spurious results when genotyping for single subsets of RDS behaviors.
- For example, an individual may not drink or use drugs but may have other RDS behaviors like overeating or intensive video gaming. In support of this notion, Blum et al. [Blum 2011] found a very strong association of the dopamine D2 receptor A1 allele (100%) in one Family (A). In addition, every individual in Family B also has at least one dopaminergic high risk allele (100%) (48% carried the DRD2 A1 allele]). Moreover, in family B only three adult individuals had no addictive behaviors. When this was compared with results in which 55 RDS subjects carried the DRD2 A1 allele at 78.2% with the results of Noble 2003 in which 597 severe alcoholics at (49.3%) carried the A1 allele, there was a significant difference between these two groups (χ2=16.9, p<0.001). This demonstrated that the A1 allele prevalence increases with multiple RDS behaviors.
- The present invention satisfies the need to classify patients at genetic risk for drug/alcohol seeking behavior prior to or upon entry to residential and or non-residential chemical dependency and pain programs. This invention incorporates the utilization of an “allelic analysis,” which is an analysis used to determine the presence of particular alleles in the tested subject. In an embodiment of the present invention, it has been discovered that there are at least eleven risk alleles associated with ten candidate genes. To determine risk severity, the percentage of prevalence of the risk alleles was determined using allelic analysis and a severity score based on percentage of these alleles was determined.
- The genetic polymorphisms [DRD1=G; DRD2=A1; DRD3=C; DRD4=C; DAT1=9R; DRD4=7-11R; HTTLPR=S or L; MAOA=3.5-5R; COMT=G; OPRM1=G; and GABRB3=181] most associated with RDS risk were tested in 273 subjects. The percentage-prevalence of risk alleles were calculated and severity ranked in 273 subjects as: All subjects tested positive for risk severity, 40.4% (having 9 or more RDS risk alleles), 30.9% (7 or 8 RDS risk alleles), and 28.7% (6 or less RDS risk alleles). Without controlling for age or gender utilizing χ2 analysis, it was found that a significant predictive association between individuals with 7 or higher risk alleles and alcohol severity risk (χ2=8.38, df=1, p<0.004). Logistic regression results showed age (b=0.45, S.E.=0.11, Wald χ2=15.29, df=1, p<0.001) and having a greater number of RDS risk alleles (b=0.741, S.E.=0.29, Wald χ2=6.39, df=1, p=0.012) significantly predicted alcohol severity scores collected using the Addiction Severity Index Media Version (ASI-MV).
- In general, in one aspect, the invention features a method of obtaining a risk score for evaluating stratification of a plurality of ranges for a genetic addiction risk. The method includes the step of obtaining a biological sample from a subject. The method further includes the step of performing an allelic analysis on the biological sample to determine the presence of a plurality of pre-determined alleles. Each of the alleles in the plurality of pre-determined alleles is associated with a gene in a plurality of pre-determined genes. There are at least ten genes in the plurality of pre-determined genes. There is at least one allele for each of the genes in the plurality of pre-determined genes. The method further includes the step of assigning a count for each of the alleles in the plurality of pre-determined alleles that was present in the biological sample. The method further includes the step of determining a risk score based upon the count, wherein the stratification of the plurality of ranges identifies a severity of the genetic addition risk.
- Implementations of the inventions can include one or more of the following features:
- The plurality of pre-determined alleles may include: (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3. These pre-determined alleles are the alleles of SEQ ID NOS 1-8, DAT1 3′ 40 bp repeat, DRD4 48 bp repeat in intron 3, and GABARB3 (CA-dinucleotide repeat). In some instances, the DAT1 3′ 40 bp repeat, DRD4 48 bp repeat in intron 3, and GABARB3 (CA-dinucleotide repeat) are as disclosed in Kirchheiner 2007, Johnson 2008, and Feusner 2001, respectively.
- The risk score in a first range can be indicative of a low genetic addictive risk. The risk score in a second range can be indicative of a moderate genetic addictive risk. The risk score in the third range can be indicative of a high genetic addictive risk.
- For the genetic addictive risk for drugs, the high range can be 4 and above.
- For the genetic addictive risk for drugs, the low range can be from 0 to 1.
- For the genetic addictive risk alcohol, the high range can be 8 and above.
- For the genetic addictive risk for alcohol, the low range can be from 0 to 3.
- The risk score can be the sum of the alleles in the plurality of pre-determined alleles found to be present in the biological sample.
- The step of determining the risk score does not include weighting results of the allelic analysis of the biological sample.
- The risk score can identify the stratification of a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- In general, in another aspect, the invention features a method that includes a genotypic analysis of a panel of genes to identify a plurality of alleles. The plurality of alleles includes: (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- In general, in another aspect, the invention features a kit for analyzing a panel of genes that includes primers for sequencing (5′ to 3′) consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- In general, in another aspect, the invention features a method of establishing a genetic risk stratification of a plurality of ranges for genetic addictive risk analysis. The method includes the step of selecting a plurality of alleles. Each of the alleles in the plurality of alleles is associated with a gene in a plurality of genes. There are at least ten genes in the plurality of genes. There is at least one allele for each of the genes in the plurality of genes. The method further includes the step of performing an allelic analysis using the plurality of alleles on a plurality of subjects. The plurality of subjects includes a statistically informative sample of subjects. Each of the subjects in the plurality of subjects have a non-allelic risk score. The non-allelic risk score having been determined independent of the allelic analysis. The method further includes the step of assigning a count for each of the alleles in the plurality of pre-determined alleles that was present in the biological sample. The method further includes the step of determining an allelic risk score for each subject in the plurality of subjects based upon the count. The method further includes the step of comparatively analyzing the non-allelic risk scores and the allelic risk scores. The comparative analysis results in establishing that the allelic risk score significantly predicts the non-allelic score of the plurality of subjects. The significant prediction is at a p-value of at most 0.05.
- Implementations of the inventions can include one or more of the following features:
- The p-value can be at most 0.01.
- At least five of the alleles in the plurality of alleles can be selected from the group consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- At least eight of the alleles in the plurality of alleles can be selected from the group consisting of (a) allele G of gene DRD1; (b) allele A1 of gene DRD2; (c) allele C of gene DRD3; (d) allele C of gene DRD4; (e) allele 9R of gene DAT1; (f) allele 7-11R of gene DRD4; (g) allele S or L of gene HTTLPR; (h) allele 4R of gene MAOA; (i) allele G of gene COMT; (j) allele G of gene OPRM1; and (k) allele 181 of gene GABRB3.
- The step of comparatively analyzing can include utilizing logistic regression modeling.
- The non-allelic risk score can be based upon stratification of a reward deficiency syndrome selected from the group consisting of alcohol, psycho-stimulants, marijuana, nicotine, opiates, epigenetic induced altered opiate receptor function, carbohydrates, obesity, gambling, sex addiction, aggression, stress, personality disorders, and novelty seeking, ADHD, Tourette's syndrome, Autism, and combinations thereof.
- The present invention relates to methods and kits for assessing severity index for alcohol abuse, drug abuse, and other reward deficiency syndromes. In terms of a single subtype of RDS (such as alcoholism or even psychostimulant abuse), there are problems in using a single diagnosis. Instead, a new strategy for population-based studies has been discovered in which the investigator requires a representative control sample, removing confounding cases from the control group that may improve chances of finding significant differences between experimental and control groups. This approach however may risk a “lack of representation′ in the control group.” Even the use of stratified samples (weighting samples) may not be good enough. Super controls has been criticized by some on the grounds that their relatives will have rates of co-morbid disorders lower than that in the general population and may produce spurious co-aggregation of disorders within families. This argument is valid only if the same psychopathology that is removed from the control group is not excluded from among the probands and their relatives. This provides the rationale to encourage others to begin to carefully select true controls especially when dealing with complex traits such as RDS.
- In the case of finding a “pure” phenotype, especially in the psychiatric arena, it is unknown whether nature truly carved out the psychiatric disorders in the same fashion as is seen in the DSM-V. This is true because behaviors are very complex, whereby specific genes for behavioral tendencies (anxiety, impulsivity, compulsivity, harm avoidance, aggressiveness, addiction, etc.) only accounts for a small risk contribution to the overall phenotype. Therefore, there must be a shift in the emphasis to the “systems biological” approach, which takes into account the inter relationship of dysfunctional behaviors, the polygenic nature of psychiatric disorders, and the environment (epigenetic).
- The established concept of RDS must be considered to help define this complex array of behaviors, and associated molecular dysfunctions. Victims of RDS carry polymorphic genes in dopaminergic pathways that results in hypo-dopaminergic function caused by a reduced number of dopamine D2 receptors, reduced synthesis of dopamine (dopamine beta-hydroxylase), reduced net release of pre-synaptic dopamine, increased synaptic clearance due to a high number of dopamine transporter sites and low D2 receptor densities making them more vulnerable to addictive activities.
- The need for a unified set of related symptoms in the affected phenotype is important not only for population-based association studies, but also for linkage analysis. The RDS concept involves, shared genes and behavioral tendencies including dependence on alcohol, psycho-stimulants, marijuana, nicotine (smoking), opiates, epigenetic induced altered opiate receptor function, carbohydrates (sugar-binging), obesity, pathological gambling, sex addiction, aggression, stress, certain personality disorders, and including novelty seeking. While there are poly-genes involved the common theme in all of these substances and behaviors is that they induce pre-synaptic dopamine release at the NAc. Spectrum disorders such as ADHD, Tourette's syndrome and Autism are included due to dopamine dysregulation.
- A screened control group is essential for uncovering population-based associations where the disease in question may be very common. It is known that approximately one-third of the population meet lifetime criteria for common psychiatric disorders according to the results of the Epidemiological Catchment Area (ECA) survey. Since RDS is a “polygenic disorder” involving multiple genes and many polymorphisms and requires a threshold number of polygenes, unaffected individuals in the population also carry some of these genes. The dopamine D2 receptor gene (A1 allele) is present in about one-third of unscreened Americans (29.4% in 3329 subjects studied up until 2003). [Blum 2000].
- Applicant has discovered that a multifaceted non-specific RDS behaviors should be considered as the true “reward” phenotype (endophenotype) instead of a single subset RDS behavior such as alcoholism. This may be a paradigm shift in future association and linkage studies.
- Very few behaviors depend upon a single gene. Complexes of genes (polygenic) drive most of the populations' heredity-based behaviors, suggesting that genetic panels or algorithms organized into genetic indexes, such as Genetic Addiction Risk Assessment, can be valuable clinically to determine risk. Certainly abnormal functions of these brain systems can be due to specific genetic factors interacting with environmental factors and understanding the interactions of these components is likely to lead to better treatment.
- While there have been other reports that help establish the RDS concept, there are many genes and SNPs involved in developing a true Genetic Addiction Risk Assessment.
- The results of this may have direct implications for both the diagnosis and targeted treatment of RDS behaviors by analyzing the association of these reward genes and RDS behaviors. This underscores the potential involvement of at least D2 receptor dysfunction as an important genetic antecedent to addiction as a disease but not as the only risk gene. In keeping with the theory of common neurogenetic mechanisms, it is now believed by Applicant that RDS is a basic phenotype covering many reward behaviors and pertinent psychiatric disorders including spectrum disorders that should be included in the future in DSM as a genetic umbrella for many psychiatric diagnoses. In fact most recently RDS has been accepted as an important psychiatric disorder by SAGE publication and will appear in the Encyclopedia of Abnormal Psychology (2015). The reward genes have been extensively studied and include, but are not limited to D1-D5 receptors; Dopamine Transporter (DAT1); Serotonin 2a/c receptors; Serotonin transporter (5-HTTLPR); Mu opiate receptor (OPRM1); GABA receptor (GABRB3); catechol-o-methyltransferase (COMT) val158met; and MAO-A gene promoter VNTR among others. See TABLE 2.
-
TABLE 2 Advanced Genetic Addiction Risk Analysis Panel of Reward Genes Dopamine D1 Receptor Gene Mu-opiate Receptor Gene Dopamine D2 Receptor Gene GABA -B3 Receptor Gene Dopamine D3 Receptor Gene PENK Gene Dopamine D4 Receptor Gene Monoamine Oxidase A Gene Catechol-O-Methyltransferase Gene Serotonin 2a Receptor Cytochrome P450 Gene Network Gene Serotonin Transporter Gene NMDA receptor Gene - Applicant has discovered that evaluating using a polygenic test to determine stratified genetic risk of addictive patients entering treatment facilities suggest a paradigm shift in providing important information about an individual's predisposition to RDS based on a number of risk alleles. Validation of these results provides an impetus for appropriate and careful selection of a complete Gene Map for all addictive behaviors.
- While there has been a plethora of research on many reward gene polymorphisms and RDS risk including drugs and alcohol, there has not been a quantitative analysis revealing a method by which counting risk alleles result in a significant predictor of addiction severity. In fact, there has been a continual controversy concerning what if any candidate genes will actually predict severity. In earlier patents (such as U.S. Pat. No. 6,955,873, issued to Blum and other patent application suggested from 32 to hundreds of genes.
- A panel of genes and associated alleles have been discovered. This panel has shown to significantly predict clinical outcomes as determined by the self-reported ASI-Media version instrument. A pencil and paper test mandated in thirteen states across the United States and in many countries worldwide. As compared to TABLE 2 above (which that refers to a generalized list of reward genes), the panel includes the analysis of the genes and corresponding alleles set forth in TABLE 3.
-
TABLE 3 Genetic Addiction Risk Assessment Panel Sequence ID No Gene/Genotype Location/Genotype Risk Allele SEQ ID NO 1 MAOA-uVNTR (3′ 30 bp repeat) +nnnnn 3′ 30 base-pair Repeat 3.5-5R (R) on X chromosome only DAT1 (3′ 40 bp repeat) +nnnnn 3′ 40 Base-Pair Repeat 9R (R) ≦9R is short, >9R is long DRD4 (Intron 3 48 bp repeat) +nnnn Intron 3, 48 base-pair Repeat 7R+ (R) <7R is short, >7R is long SEQ ID NO 2 5HTTLPR (43 bp 5′ ins/ +nnnnn 43 base-pair 5′ S or L del) + rs25531 insertion/deletion SEQ ID NO 3 rs4532, DRD1 +48 A > G G SEQ ID NO 4 rs1800497, DRD2 TaqI A1 +nnnnn A > G A1 SEQ ID NO 5 rs6280, DRD3 (Gly-Ser) +nnnnn C > T C SEQ ID NO 6 rs1800955, DRD4 −521 C/T −521 C > T C SEQ ID NO 7 rs4680, COMT (Val-Met) +nnnnn A > G G SEQ ID NO 8 rs1799971, OPRM1 (Asn-Asg) +nnnnn A > G G GABRB3 (CA-dinucleotide repeat) +nnnn CA-Repeat (171-201) 181 - No one has ever previously reported an analysis focusing upon this combination of genes and respective alleles. In fact, any change in this list has shown to render this analysis into a non-significant predictor.
- In one embodiment, the DAT1 genotype is the DAT1 3′ 40 bp repeat disclosed in Kirchheiner 2007.
- In one embodiment, the DRD4 genotype is the DRD4 48 bp repeat in intron 3 disclosed in Johnson 2008.
- In one embodiment, the GABARB3 CA-dinucleotide repeat is disclosed in Feusner 2001.
- Participants were identified and enrolled in partnership with Inflexxion and eight geographically dispersed treatment centers located in the United States. The eight treatment centers included: Addiction Recovery Resource, Catholic Charities of Maine, Center for Psychiatric Medicine, G & G Holistic Addiction Treatment Center, Integrative Life Center, Malibu Beach Recovery Center, and Meadows Edge Recovery Center and Tennessee treatment center. In agreement with INGENE, LLC (Austin, Tex.) and Dominion Diagnostics (North Kingstown, R.I.), each treatment center agreed to identify, consent, and enroll 40 subjects. Study protocols were reviewed and approved by the University of Vermont, School of Medicine (Burlington, Vt.), and PATH Foundation (NY) Institutional Review Boards (IRB). For the patient protection the genotyping data was conformed to standard HIPPA and Genetic Information Non-Discrimination Act (GINA) practices mandated by law. The participants provided written informed consent.
- The subjects were interviewed and evaluated by a trained clinician for any substance dependency using a standard battery of diagnostic questionnaires and biological tests. Paper-and-pencil tests included the Drug History Questionnaire and Symptom Severity Questionnaires (73-Stranz & Welsh, 1995), and the Addiction Severity Index. Biological tests included: urine drug tests, breathalyzer test, and a blood based CBC test. Alcohol and drug use data was collected using the Addiction Survey Index-Multi-Media (ASI-MV).
- Severity scores were determined using a proprietary algorithm developed by Inflexxion. Scores on the severity ratings could range between ‘no real problem’ (0) to ‘extreme problem’ (9) and included questions about lifetime drug use. Clinically, scores on the severity ratings scales were utilized for identifying drug use problems and treatment planning. In these data, ASI alcohol and drug severity scores were slightly skewed to the left (Alcohol: skewness=−0.211, kurtosis=−1.473; Drugs: skewness=−0.922, kurtosis=−0.483), and suggested that this sample of patients had a greater number of subjects with lower rather than higher alcohol scores.
- Saliva was collected using a minimally invasive process that requires a subject to spit into a collection tubes supplied by the Institute for Behavioral Genetics (IBG), University of Colorado Boulder, Boulder, Colo. Specimen tubes were labeled with a pre-defined ID and bar coded by Dominion Diagnostics in order to limit sampling errors. Subjects supplied 2 ml of saliva that was stabilized using a buffer consisting of sodium dodecyl sulfate, TRIS-EDTA buffer, pH 8.0 and proteinase K. Tubes were stored at room temperature at each treatment center and shipped to Dominion Diagnostics after they had enrolled 40 subjects. Patent saliva samples were then sent to AS at IBG for DNA extraction and isolation using protocols detailed elsewhere (74-Haberstick et al, 2014).
- An index of the genes included in the genetic addiction risk score panel and the specific risk polymorphisms are provided in TABLE 4. Each genetic variant or polymorphism was selected on the basis of RDS and known contribution to a state of low dopaminergic or hypodopaminergic functioning in the brain reward circuitry.
-
TABLE 4 Genetic Addiction Risk Scale Genotype Panel Polymorphism Gene Variants Risk Allele Single Nucleotide Polymorphisms (SNPs) rs4532 Dopamine D1 Receptor (DRD1) A/G G rs1800497 Dopamine D2 Receptor (DRD2) A1 (A)/A2 (G) A1 rs6280 Dopamine D3 Receptor (DRD3) C/T C rs1800955 Dopamine D4 Receptor (DRD4) C/T C rs4680 Catechol-O-Methyltransferase (COMT) A (Met)/G (Val) G rs1799971 Mu-Opoid Receptor (OPRM1) A (Asn40)/G (Asp40) G Simple Sequence Repeats (Variable Number Tandem Repeats & Insertion/Deletions) 3′ 40 base-pair Repeat Dopamine Transporter Receptor (DAT1) 9 Repeat (R) 9R - The assays for Amelogenin, MAOA-uVNTR, DRD4, DAT1 and 5HTTLPR [were done in a single multiplex PCR reaction consisting of two μl of DNA (20 ng or less), 1.8 mM MgCl2, 180 μM each deoxynucleotide (dNTP, NEB), with 7′-deaza-2′-deoxyGTP (deaza-GTP, Roche Applied Science, Indianapolis, Ind.) substituted for one-half of the dGTP, 10% DMSO, forward (fluorescently labeled) and reverse primers (sequences and concentrations in TABLE 5, one unit of AmpliTaq Gold® polymerase (Life Technologies Grand Island, N.Y.) and 1×PCR buffer II in a total volume of 20 μl. The assay for the dinucleotide repeat in GABRB3 was analyzed separate in a PCR reaction consisting of two μl of DNA (20 ng or less), 2.5 mM MgCl2, 200 μM each deoxynucleotide (dNTP, NEB), forward (fluorescently labeled) and reverse primers, one unit of AmpliTaq Gold® polymerase and 1×PCR buffer II in a total volume of 20 μl. Amplifications were performed using a modified touchdown PCR method. [Anchordoquy 2003; Don 1992] A 95° C. incubation for 10 min was followed by two cycles of 95° C. for 30 s, 65° C. for 30 s, and 72° C. for 60 s. The annealing temperature was decreased every two cycles from 65° C. to 57° C. in 2° C. increments (10 cycles total), followed by 30 cycles of 95° C. for 30 s, 55° C. for 30 s, and 72° C. for 60 s, a final 30-min incubation at 72° C. and a hold at 4° C. Each 96 well plate included non-template and DNA standards of known genotype.
-
TABLE 5 Marker, Primer, and Resulting Size Ranges of polymorphisms characterized Size Conc. Range Gene Sequence (5′→3′) (nM) (bp) Amelogenin-F NED-CCC TGG GCT CTG 300 103,109 TAA AGA ATA GTG Amelogenin-R ATC AGA GCT TAA ACT 300 (X, Y) GGG AAG CTG MAO-uVNTR-F 6FAM-ACA GCC TGA CCG 200 291-381 TGG AGA AG MAO-uVNTR-R GAA CGG ACG CTC CAT 200 (2R-5R) TCG GA DAT1-F 6FAM-TGT GGT GTA GGG 300 200-600 AAC GGC CTG AG DAT1-R CTT CCT GGA GGT CAC 300 (3R-13R) GGC TCA AGG DRD4-F VIC-GCT CAT GCT GCT 600 279-711 GCT CTA CTG GGC DRD4-R CTG CGG GTC TGC GGT 600 (2R-11R) GGA GTC TGG 5HTTLPR-F NED-ATG CCA GCA CCT 600 376, AAC CCC TAA TGT 419-549 5HTTLPR-R GGA CCG CAA GGT GGG 600 (S, L- CGG GA XL) 5HTTLPR-Hu-F 6FAM-GCA ACC TCC CAG 500 138, 181 CAA CTC CCT GT 5HTTLPR-Hu-R GAG GTG CAG GGG GAT 500 (S, L) GCT GGA A GABRB3-F 6FAM-CTC TTG TTC CTG 500 171-201 TTG CTT TCA ATA CAC GABRB3-R CAC TGT GCT AGT AGA 500 TTC AGC TC -
TABLE 6 Sequences of certain polymorphisms used in to the methods of the present invention Polymorphism Sequence MAOA-uVNTR ACCGGCACCGGCACCAGTACCCGCACCAGT rs25531 CTCGCGGCATCCCCCCTGCACCCCC[A/G] GCATCCCCCCTGCAGCCCCCCCAGC rs4532 GGGGCTCTGACACCCCTCAAGTTCC[C/T] AAGCAGGGAATAGGGGTCAGTCAGA rs1800497 TGGACGTCCAGCTGGGCGCCTGCCT[C/T] GACCAGCACTTTGAGGATGGCTGTG rs6280 GCCCCACAGGTGTAGTTCAGGTGGC[C/T] ACTCAGCTGGCTCAGAGATGCCATA rs1800955 GGGCAGGGGGAGCGGGCGTGGAGGG[C/T] GCGCACGAGGTCGAGGCGAGTCCGC rs4680 CCAGCGGATGGTGGATTTCGCTGGC[A/G] TGAAGGACAAGGTGTGCATGCCTGA rs1799971 GGTCAACTTGTCCCACTTAGATGGC[A/G] ACCTGTCCGACCCATGCGGTCCGAA - A description of the assay for rs25531 (A/G) is detailed elsewhere [Haberstick 2014]. This SNP is located in the Long-form of the 5HTTLPR and allows determination of the LA and LG alleles. The 5HTTLPR site containing the SNP was amplified in a single PCR reaction composed as described above with the primers described in Hu 2005. The cycling conditions were a 95° C. incubation for 10 min followed by two cycles of 95° C. for 30 s, 65° C. for 30 s, and 72° C. for 60 s, two cycles of 95° C. for 30 s, 63° C. for 30 s, and 72° C. for 60 s, 30 cycles of 95° C. for 30 s, 61° C. for 30 s, and 72° C. for 60 s, a final 30-min incubation at 72° C. and a hold at 4° C. Following PCR amplification the PCR products were incubated [Wendland 2006] with five units of MspI (NEB, Ipswitch, Massachusetts) for 90 min at 37° C. A 97 bp restriction digest fragment is indicative of the LG allele. For the genetic addiction risk score coding, two combined alleles were reported: the S′ which consists of S, and LG alleles and L′ which consists of LA and extra-long alleles. Note that the S′ and L′ refer to composed activity bins and that these are not individual alleles per se. Each 96 well plate included non-template and DNA standards of known genotype.
- After amplification, PCR products and MspI digests were filter purified using Zymo Research (Irvine, Calif.) ZR-96 DNA Sequencing Clean-up Kits following manufacturer's directions. An aliquot of PCR products was combined with loading buffer containing size standard (Rox1000, Gel Company, San Francisco, Calif.) and analyzed with an ABI PRISM® 3130xl Genetic Analyzer (Life Technologies) using protocols supplied by the company. Data were analyzed with Genemapper software and the resulting allele sizes independently reviewed by two investigators.
- The SNP assays for TaqIA (rs1800497), COMT val158met (rs4680), DRD1 (rs4532), DRD3 (rs6280), DRD4-521C/T (rs1800955) and OPRM1 (rs1799971) were done using a fluorogenic 5′ nuclease (Taqman®, ABI, Foster City, Calif.) method [Haberstick 2004] on an ABI Prism® 7000 Sequence Detection System via the allelic discrimination mode. [Livak 1999].
- Reactions containing 20 ng of DNA were performed in 15 μl reactions with TaqMan® Universal PCR Master Mix using the standard cycling conditions. Primer and probe concentrations were 900 μM and 200 μM, respectively. Sequences of the TaqIA and COMT primers and probes are probes are provided in TABLE 7. All remaining assays were ordered directly from Life Technologies. Each 96 well plate included non-template and DNA standards of known genotype.
-
TABLE 7 Probe and Primer Sequences for COMT val158met and DRD2 Taq1A Polymorphisms Gene Probe/Primer Sequence (5′→3′) COMT T (met) probe VIC-ACCTTGTCCTTCATGCCAGCGAA AT-NFGMGB C (val) probe FAM-CCTTGTCCTTCACGCCAGCGA- NFQMGB Forward Primer TCGAGATCAACCCCGACTGT Reverse Primer AACGGGTCAGGCATGCA DRD2 T (A1) probe VIC-CCTGCCTTGACCAGC-NFQMGB C (A2) probe FAM-CTGCCTCGACCAGC-NFQMGB Forward Primer GTGCAGCTCACTCCATCCT Reverse Primer GCAACACAGCCATCCTCAAAG - Mean, standard deviations, chi-square and regression tests were performed using SPSS (Version 21.0). Fischer Exact Tests were used to test whether there were significant differences between the dichotomized alcohol and drug severity risk scores. For alcohol, scores at or below the mean of 4.65 were considered ‘low’ (0) while scores above the mean were considered ‘high’ (1). For drug severity scores, scores at or below 4 were considered ‘low’ (0) while scores above were considered ‘high’ (1). Regression analyses were used to examine the association between the genetic risk score and severity risk score measures, adjusting for sex (female=0, male=1) and age (continuous). Though, scores on both the alcohol and drug severity risk scales were slightly skewed towards lower values, the impact of square-root and log-transformations on the distribution of scores was examined. Along a priori lines, risk alleles were assigned a score of 1. An individual's genetic risk score was the sum of all risk alleles for that individual.
- The percentage-prevalence of risk alleles was calculated and severity ranked in 273 subjects as: All subjects texted positive for risk severity, 40.4% (having 9 or more RDS risk alleles), 30.9% (7 or 8 RDS risk alleles), and 28.7% (6 or less RDS risk alleles). Hardy Weinberg equilibrium (HWE) was confirmed for each gene using χ2 tests.
- In an embodiment of the present invention, an analysis was performed for genetic risk stratification for Reward Deficiency Syndrome (RDS). The genetic polymorphisms [DRD1=G; DRD2=A1; DRD3=C; DRD4=C; DAT1=9R; DRD4=7-11R; HTTLPR=S or L; MAOA=3.5-5R; COMT=G; OPRM1=G; and GABRB3=181] were tested in 393 participants (or subjects) of which 273 of these subjects completed the questionnaire and biological assessments.
- Without controlling for age or gender utilizing χ2 analysis, a significant predictive association was found between individuals with 7 or higher risk alleles and alcohol severity risk (χ2=8.38, df=1, p<0.004). Logistic regression results showed age (b=0.45, S.E.=0.11, Wald χ2=15.29, df=1, p<0.001) and having a greater number of RDS risk alleles (b=0.741, S.E.=0.29, Wald χ2=6.39, df=1, p=0.012) significantly predicted alcohol severity scores collected using the Addiction Severity Index Media Version (ASI-MV). Similar experiments were achieved for the ASI-Drug (opioids and psychostimulants) severity risk score as well.
- A low p-value (less than 0.05) is highly significant. The above results were particularly robust, as the p-values observed were around 0.01 and better. This is indicative that a relationship exists between the risk assessment generated from the cluster being tested and the risk severity of the group being investigated.
- The alleles of this tested panel (or cluster) was further evaluated by change a specific risk allele in the cluster as set forth in Example No. 1. The resultant data revealed a non-significant association with the ASI-Media version for alcohol severity.
- It was found that when the risk allele for the MAOA=3R was evaluated instead of the 4R (and keeping the other alleles of the cluster the same as in the example set forth above), no significant association was obtained (p=0.819).
- A similar finding was obtained for the COMT risk allele changing from the Val/met to the met/met (again keeping the other alleles of the cluster the same as in the example set forth above) whereby no significance was obtained in terms of association with alcohol severity predicted by the ASI-Media version (p=0.634).
- It was also found that significance was lost when the risk allele of the DAT1 was switched from the 9R to the 10R (p=0.728) (again keeping the other alleles of the cluster the same as in the example set forth above).
- It is also important that the analysis was predictive of alcohol severity when the subject carried 8 or more risk alleles. Testing 7; 6; 5; 4; 3; 2 and 1 did not predict risk. Similar findings were obtained for drug severity prediction except cut off was 4 and above as a predictor.
- In terms of weighting the genes and alleles, whereby the value of each risk allele may display a more powerful risk was also evaluated using the same dataset. Standard weighting involves utilizing super controls against the ASI-Alcohol severity index as well as drug severity index. In this method the resultant odds ratios (OR) issue used to determine the appropriate algorithm for weighting each representative gene allele.
- Since no super controls were used (no RDS behaviors in pro and in family), a number of genes that appeared to be more important to others in terms of for example relapse and drug reinstatement were evaluated.
- For example, the DRD2 A1 allele has been found to be significantly involved in relapse, mortality, and hospitalization. Previous studies involving association to addictive behaviors had identified a significance with only A1. Accordingly, the score value for a positive indication of the DRD2 A1 allele was given a value of 2 (instead of a score of 1 as previously scored in Example No. 1 for all positive indications of an allele). When this one weighing was done (and all other alleles remained weighted with a score of 1 for a positive indication), the results was less significant than in the Example, having a p-value equal to 0.059 (p=0.059). P-values were determined as set forth in X2 analysis.
- Repeating this weighting for only the COMT gene/allele resulted in a similar finding (p=0.600). Further, repeating this weighting for only the DAT1 gene also showed that the results were less significant (p=0.154).
- These comparative analysis data show that weighting of the allele analysis results (i.e., relative to one allele to the others) is not as significant as the combination of testing that is occurring within the cluster of genes/alleles. It is believed that an analysis with super controls may provide weighting of one or more of the genes/alleles; however, such weighting is not required. This further indicates the counting technique of risk alleles without the need for super controls.
- By this, it has now been a quantitation has been discovered that actually shows a predictive value when considering clinical outcome. It is one thing to evaluate for example drug and alcohol risk using case controls compared to single outcomes in terms of genetic polymorphisms but without actual prediction of clinical risk as determined by the ASI as one example, a list of genes and alleles is simply a guessing game.
- Using the cluster set forth in TABLE 3, the tested subjects were classified in ranges of low, moderate, and high gene additive risks for drugs and alcohol. For instance, for this panel of alleles, a score in the ranges of 0 to 1, 2 to 3, and 4 and above, correspond to low, moderate, and high for gene additive risks for drugs. Further, for instance, for this panel of alleles, a score in the ranges of 0 to 3, 4 to 7, and 8 and above, correspond to low, moderate, and high for gene additive risks for alcohol.
- It is further noted that the results of the allele analysis can be normalized, i.e., divide the score (or count) by the total possible score. This provides alternative ranges that can be classified as low, moderate, and high risk in view of the tested alleles. Such ranges would be, for example, 0 to 0.3, 0.31 to 0.59, and 0.6 to 1, and would be categorized as low, moderate, and high risk for the tested alleles. It is noteworthy that such ranges are not the same as those set forth above for the gene additive risks for drugs and alcohol. Rather, these provide a metric as to the percent of these alleles that a subject has in the panel, which alleles have been found to correlate with gene additive risks. Such normalized results thus provide a metric of where on the spectrum a subject falls, with the higher percentage indicating that the subject has a higher risk probability.
- TABLE 8 shows a genetic addition risk test results having a risk score and normalized risk score indicated.
-
TABLE 8 Genetic Addiction Risk Score Test Results PHYSICIAN SPECIMEN PATIENT Name: Dr. X Specimen Type: Name: Patient Y Address: Date Collected: Date of Birth: Time Collected: Accession ID: Date Received: Lab ID: Date Reported: Gender: Risk Allele Gene Location/Genotype Risk Allele Result Count Single Nuclecotide Polymorphisms (SNPs) COMT +nnnnn A > G G G, G 2 DRD1 +48 A > G G A, A 0 DRD2 +nnnnn A > G A A, A 2 DRD3 +nnnnn C >T C C, T 1 DRD4 −521 C > T C C, T 1 OPRM1 +nnnnn A > G G G, A 1 Variable Number Tandem Repeats & Insertion/Deletions DAT1 +nnnnn 3′ 40 Base- 9R S, L 1 Pair Repeat (R) ≦9R is short, >9R is long DRD4 +nnnn Intron 3, 48 base- >7, 8, 9, 10 or 11 (R) S, L 1 pair Repeat (R) <7R is short, >7R is long 5HTTPLPR +nnnnn 43 base-pair 5′ S or L S′, S′ 2 insertion/deletion MAOA +nnnnn 3′ 30 base- 4R 5R 0 pair Repeat (R) on X chromosome only Dinucleotide Repeats GABRA3 +nnnn CA-Repeat 181 181, 194 1 (171-201) Risk Allele Count 12 out of possible 22 RISK SCORE 12 NORMALIZED RISK SCORE 0.55 - As seen in TABLE 8, the risk allele count is based upon the positive indication of the alleles in the panel tested. For instance, the allelic analysis for the sample showed that for allele G of gene COMT, the result was “G,G” which gives a count of 2. Further, the allelic analysis for the sample showed that for allele G of gene DRD1, the result was “A,A” which gives a count of 0. Also, for instance, the allelic analysis for the sample showed that for allele C of gene DRD3, the results was “C,T” which gives a count of 1. The risk counts obtained for each of the tested alleles were then added up to yield the risk score, which, as shown in the sample of TABLE 8 was 12. As the maximum risk score was 22 (since 11 alleles were tested), the normalized score was 0.55 (which is also shown in TABLE 8).
- Such risk score of 12 is indicative of a patient having a high genetic addition risk for alcohol (because the risk score is above 8) and a high genetic addiction risk for drugs (because the risk score is above 4). Such a normalized risk score of 0.55 (i.e., 55%) falls in the category of being a modest addiction risk on the normalized scale (which is a more conservative analysis). This reflects that there are multiple stratifications that can be utilized to determine genetic addictive risks.
- The assessment of low, moderate, and high risk groups is quantified by the score received by using the panel of alleles. If a cut-off of counting eight alleles and above was used, a significant prediction using the ASI-alcohol severity index was not obtained. Moreover, this was true even if Applicant adhered to a strict allelic count based on the above presented risk alleles as seen in TABLE 3. However, when the cut-off point of seven risk alleles was utilized highly significant associations were observed.
- The fact that there are many risk alleles for a number of reward genes (especially for opiates as just one example), it was only when a process was used to identify a proper combination of genes and alleles (having a low p-value) that the relationship between this cluster and the risk score was found. It is a significant discovery that not only must a proper group of genes to test be selected, the proper alleles out of hundreds of SNPS must also be utilized.
- By this process of selecting genes and further selecting alleles to test to obtain a score that corresponds to observable low, moderate, and high risk ranges (with low p-value), Applicant has been able to create a useful test that can be readily and easily applied.
- As representative of the difficulty in selecting the proper group of genes and alleles, the following is indicative of testing for opiates.
- In terms of for example pain sensitivity certain candidate genes have been studied. Candidate genes such as those for catechol-O-methyltransferase, melanocortin-1 receptor, guanosine triphosphate cyclohydrolase and mu-opioid receptor have been intensively investigated, and associations were found with sensitivity to pain as well as with analgesic requirements in states of acute and chronic pain. In contrast, the impact of genetic variants of drug-metabolizing enzymes on the response to pharmacotherapy is generally well described. Polymorphisms of the cytochrome P450 enzymes influence the analgesic efficacy of codeine, tramadol, tricyclic antidepressants and nonsteroidal anti-inflammatory drugs. Together with further candidate genes, they are major targets of ongoing research in order to identify associations between an individual's genetic profile and drug response (pharmacogenetics). Moreover, sensitivity and tolerance to morphine were determined in 2 strains of mice, BALB/cBy and C57BL/6By, their reciprocal F1 hybrids and seven of their recombinant inbred strains. Sensitivity was established based on locomotor activity following the administration of saline, 10 or 20 mg/kg of morphine hydrochloride while tolerance was established according to the “hot plate” method following the single or repeated administration of saline, 5, 10, or 20 mg/kg of morphine hydrochloride. Results indicate that both sensitivity and tolerance to morphine are genotype-dependent and their inheritance is characterized by dominance or partial dominance.
- The most common treatment for opioid dependence is substitution therapy with another opioid such as methadone. The methadone dosage is individualized but highly variable, and program retention rates are low due in part to non-optimal dosing resulting in withdrawal symptoms and further heroin craving and use. Methadone is a substrate for the P-glycoprotein transporter, encoded by the ABCB1 gene, which regulates central nervous system exposure. ABCB1 genetic variability influenced daily methadone dose requirements, such that subjects carrying 2 copies of the wild-type haplotype required higher doses compared with those with 1 copy and those with no copies (98.3+/−10.4, 58.6+/−20.9, and 55.4+/−26.1 mg/d, respectively; P=0.029). In addition, carriers of the AGCTT haplotype required significantly lower doses than non-carriers (38.0+/−16.8 and 61.3+/−24.6 mg/d, respectively; P=0.04). Although ABCB1 genetic variability is not related to the development of opioid dependence, identification of variant haplotypes may, after larger prospective studies have been performed, provide clinicians with a tool for methadone dosage individualization. Studies of polymorphisms in the mu opioid receptor gene, which encodes the receptor target of some endogenous opioids, heroin, morphine, and synthetic opioids, have contributed substantially to knowledge of genetic influences on opiate and cocaine addiction. Other genes of the endogenous opioid and monoaminergic systems, particularly genes encoding dopamine beta-hydroxylase, and the dopamine, serotonin, and norepinephrine transporters have also been implicated.
- Moreover, genetically caused inactivity of cytochrome P450 (CYP) 2D6 renders codeine ineffective (lack of morphine formation), slightly decreases the efficacy of tramadol (lack of formation of the active O-desmethyl-tramadol) and slightly decreases the clearance of methadone. MDR1 mutations often demonstrate pharmacogenetic consequences, and since opioids are among the P-glycoprotein substrates, opioid pharmacology may be affected by MDR1 mutations. The single nucleotide polymorphism A118G of the mu opioid receptor gene has been associated with decreased potency of morphine and morphine-6-glucuronide, and with decreased analgesic effects and higher alfentanil dose demands in carriers of the mutated G118 allele. Genetic causes may also trigger or modify drug interactions, which in turn can alter the clinical response to opioid therapy.
- For example, by inhibiting CYP2D6, paroxetine increases the steady-state plasma concentrations of (R)-methadone in extensive but not in poor metabolizers of debrisoquine/sparteine. So far, the clinical consequences of the pharmacogenetics of opioids are limited to codeine, which should not be administered to poor metabolizers of debrisoquine/sparteine. Genetically precipitated drug interactions might render a standard opioid dose toxic and should, therefore, be taken into consideration. Mutations affecting opioid receptors and pain perception/processing are of interest for the study of opioid actions, but with modern practice of on-demand administration of opioids their utility may be limited to explaining why some patients need higher opioid doses; however, the adverse effects profile may be modified by these mutations. Nonetheless, at a limited level, pharmacogenetics can be expected to facilitate individualized opioid therapy. It has been demonstrated that the muOR 304G variant significantly reduces intrathecal fentanyl ED(50) for labor analgesia, suggesting women with the G variant may be more responsive to opioids and require less analgesic drugs. These findings for intrathecal fentanyl pharmacogenetics may have implications for patients receiving opioids in other settings.
- The following is a sampling of genes involved in the addictive process that can be informative relates to opiate addiction:
- Mu opioid receptor, delta-opioid receptor; the metabotropic receptors mGluR6 and mGluR8, nuclear receptor NR4A2 and cryptochrome 1 (photolyase-like), DRD gene (D1-D5), Dat1, DBH, proenkephalin (PENK) and prodynorphin (PDYN), CAMKII; GnRH; CYP2D6; BDNF; NT-3 genes; GABA receptor subunit genes on 5q33; GABA(A)gamma2; OPRM1; G-protein alpha subunits; OPRK1; alpha2-adrenoceptor; TTC12; ANKK1; NCAM1; ZCRB1; CYP2B6; CYP2C19; CYP2C9; interleukin-2; RGS-R7; Gbeta5; MAO-A; 287 A/G polymorphism of catechol-O-methyltransferase; serotonin transporter; Ca2+/cAMP responsive element binding protein; CNR1; ABCB1, P-glycoprotein, UGT2B7, and CREB.
- Such polymorphisms include a polymorphism in a gene encoding a Beta-adrenergic receptor; a polymorphism in a gene encoding an angiotensin converting enzyme (ACE); a polymorphism in a gene encoding an angiotensin 11 T1 receptor; a polymorphism in a gene encoding cholesteryl ester transfer protein; a polymorphism in a gene encoding a potassium channel; a polymorphism in a gene encoding a cytochrome P-450 enzyme, optionally CYP2D6; a polymorphism in a gene encoding a protein product of the HER2/neu oncogene; a polymorphism of the C825T gene; a polymorphism in the APOE gene locus); a polymorphism in the CT or TT allele of the dopamine D2 receptor gene; a SNP (polymorphism) designated AA, at nucleotide position-6 of the ANG gene; a polymorphism in a gene encoding Apo-A1; a polymorphism in a gene encoding Methylene Tetrahydrofolate Reductase (MTHFR), optionally a C677T polymorphism; a polymorphism in tumor necrosis factor (TNF) gene; a polymorphism in the carbohydrate responsive element-binding protein (ChREBP) gene; a polymorphism of the Leptin receptor gene; a polymorphism of the dopamine D2 receptors gene (DRD2); a polymorphism of any of the dopamine D1, D3, D4, and D5 genes; a dopamine D2 receptor polymorphism selected from the group consisting of Ser311cys and TaqlA; a polymorphism in a c-fos gene; a polymorphism in the c-jun gene; a polymorphism in the c-myc, gene; a polymorphism in a gene encoding Sterol Regulatory Element Protein-1 (SREBP-Ic); a polymorphism in a gene encoding mitochondrial glycerol-3-phosphate acetyltransferase gene (MGPAT); a polymorphism in a gene encoding the peroxisome proliferator-activated receptor (PPAR-gamma-2) gene; the Prol2Ala polymorphism of the PPARgamma gene; a polymorphism in a gene encoding Tryptophan 2, 3-Dioxygenase (TDO2); a polymorphism in a gene encoding TCP-I; a polymorphism in a gene encoding Mc4R; a polymorphism in a gene encoding CART; a polymorphism in a gene encoding interleukin-1 beta; a polymorphism in a gene encoding tumor necrosis factor-alpha; a polymorphism in a gene encoding an intracellular adhesion molecule; a polymorphism in a gene encoding interleukin-8, a polymorphism in a gene encoding and interleukin-10; a polymorphism in a gene encoding interferon-alpha; a polymorphism in a gene encoding Ras-Protein and (HLA-DRBl 0404 and OlOlor PTPN22 R620W); the Dopamine Receptor D3 Ser9Gly (-205-G/A, -7685-G/C) polymorphism; a polymorphism in a gene encoding Glutamine: fructose-6-phosphate amidotransferase (GFPT1 or GFPT 2), optionally polymorphisms in exon 14, optionally 1471V, or 3′ UTR; or a polymorphism in a gene encoding glucosamine 6-P acyltransferase; a polymorphism in Aggrecan proteoglycan allele 27; a polymorphism in a gene encoding 11-beta hydroxysteroid dehydrogenase typel; a polymorphism in a gene encoding FK506 binding protein 5; a polymorphism in a gene encoding serum/glucosteroid kinase; a polymorphism in a gene encoding tryptophan 2,3 dioxygenase; a polymorphism in a gene encoding Myelin; a polymorphism in a gene encoding a Myelin associated glycoprotein, optionally myelin oligodendrocyte glycoprotein (MOG), optionally a polymorphism in a tetranucleotide TAAA repeat (MOG4), C10991T SNP; a polymorphism in a gene encoding Edg2; a polymorphism in a gene encoding Fgfr2; a polymorphism in a gene encoding Decorin; a polymorphism in a gene encoding Brevican; a polymorphism in a gene encoding Neurotensin (NT) receptors-1; a polymorphism in a gene encoding Neurotensin (NT) receptor-2; a polymorphism in a gene encoding Neurotensin (NT) receptor-3; a polymorphism in a gene encoding Proenkephalin; a polymorphism in a gene encoding prodynorphin, optionally 946C>G; a polymorphism in a gene encoding Bdnf (Neurotrophic Factor, optionally BDNF Val66Met and -281 C>A, T allele of the C270T); a polymorphism in a gene encoding Sgk (Serum- and glucose-regulated kinase (SGK 1), optionally SNP lntron 6, Exon 8 (CC, CT, TT); a polymorphism in a gene encoding Gabl; Id2; a polymorphism in a gene encoding COMT; a polymorphism in a gene encoding ANKKl; a polymorphism in a gene encoding DATl; a polymorphism in a gene encoding DBH; a polymorphism in a gene encoding HTT; a polymorphism in a gene encoding HTRlA; a polymorphism in a gene encoding HTRlD; a polymorphism in a gene encoding HTR2A; a polymorphism in a gene encoding HTR2C, optionally 5-HT-2A, 5-HT 2B, 5-HT-4, and 5-HT-7); a polymorphism in a gene encoding ADRA2A; a polymorphism in a gene encoding ADRA2; a polymorphism in a gene encoding NET; a polymorphism in a gene encoding MAOA; a polymorphism in a gene encoding GABRA3; a polymorphism in a gene encoding GABRB3; a polymorphism in a gene encoding CNRl; a polymorphism in a gene encoding CNRA4; a polymorphism in a gene encoding NMDARl; a polymorphism in a gene encoding POMC; a polymorphism in a gene encoding MGPAT; a polymorphism in a gene encoding NYP; a polymorphism in a gene encoding AgRP; a polymorphism in a gene encoding OBR; a polymorphism in a gene encoding Mc3R:UCP-1; a polymorphism in a gene encoding GLUT4; a polymorphism in a gene encoding PDGS; a polymorphism in a gene encoding ALdB; a polymorphism in a gene encoding LNC2; a polymorphism in a gene encoding E23K Kir6.2; a polymorphism in a gene encoding steroid sulfatase (STS); a polymorphism G82G in PTPN1; the IVS6+G82A polymorphism; a polymorphism in a gene encoding Sulfonylurea receptor 1; a polymorphism in a gene encoding beta(3)-AR Trp64Arg; a polymorphism in a gene encoding PC1; a polymorphism in a GHRELIN gene; a polymorphism in a gene encoding FKBP5; a polymorphism in a gene encoding a VITAMIN D RECEPTOR, optionally BSMI AND FOKI; a polymorphism in a gene encoding lymphoid tyrosine phosphatase (LYP), optionally a polymorphism in a gene encoding protein tyrosine phosphatase-22 (PTPN22) gene, and a polymorphism in a gene encoding any sodium ATPAse.
- Allelic analysis includes identifying at least one mutation that is a polymorphism selected from the group consisting of a polymorphism (Rs value of SNP) of a gene encoding DRD2 (Rsl800497, Rs6278, Rs6276, RslO79594, Rs 6275, Rsl801028, Rsl076560, Rs2283265, RslO79727, RslO76562, Rsll25394, Rs4648318, Rs4274224, Rs7131056, Rs4648317, Rsl799732, Rsl799978; 5HT2A (Rs6314, Rs3742278, Rs6561333, Rsl923886, Rs643627, Rs2770292, Rsl928040, Rs2770304, Rs594242, Rs6313; ANKKl (RS2734849, RS1800497, Rsll604671, Rs4938016); OPRKl (Rs35160174, Rs35373196, Rs34709943 RS6473797) OPRMI (Rs510769, Rs553202, Rs514980, Rs561720, Rs534673, Rs524731, Rs3823010, Rs3778148, Rs7773995, RS495491, Rsl2333298, Rsl461773, Rsl381376, Rs3778151, Rs506247, Rs563649, Rs9479757, Rs2075572, Rsl0485057, Rs540825, Rs562859, Rs548646, Rs648007, Rs9322447, Rs681243, Rs609148, Rs3798687, Rs648893); COMT (Rs737864, Rs933271, Rs5993882, Rs740603, MTRs4646312, Rsl65722, Rs6269, Rsl7699); SLC6A3 (Rsl2516948, Rsl042098, Rs40184, Rsll564773, Rslll33767, Rs6876225, Rs3776512, Rs2270912, Rs6347, Rs27048, Rs37022, Rs2042449, Rs464069, Rs463379, Rs403636, Rs2617605, Rsl3189021, Rs6350, Rs2975223, Rs2963238, Rs 11564752 Rs2975226); HTR3B (Rs3758987, Rs2276307, Rs3782025, Rsl672717); NOS3 (Rs891512, Rsl808593, Rs2070744, Rs3918226, Rs7830); PPARG (Rsl801282, Rs2938392, Rsll75542, Rsl7036314, Rsl805192, Rs4684847, Rs2938392, Rs709157, Rs709158, Rsll75542); ChREBP (Rs3812316); FTO (Rs8050136, Rsl421084, Rs9939609, Rsl861868, Rs9937053, Rs9939973, Rs9940128, Rsl558902, RslO852521, Rsl477196, Rsll21980, Rs7193144, Rsl6945088, Rs8043757, Rs3751812, Rs9923233, Rs9926289, Rsl2597786, Rs7185735, Rs9931164, Rs9941349, Rs7199182, Rs9931494, Rsl7817964, Rs7190492, Rs9930506, Rs9932754, Rs9922609, Rs7204609, Rs8044769, Rsl2149832, Rs6499646, Rsl421090, Rs2302673); TNFalpha (Rsl799964, Rsl800629, Rs361525, Rsl800610, Rs3093662); MANEA (Rsll33503); LeptinOb (Rs4728096, Rsl2536535, Rs2167270, Rs2278815, Rsl0244329, Rsll763517, Rsll760956, RslO954173); PEMT (Rs4244593, Rs936108); MAO-A (Rs3788862, Rsl465108, Rs909525, Rs2283724, Rsl2843268, Rsl800659, Rs6323, Rsl799835, Rs3027400, Rs979606, Rs979605 Rsll37070); CRH (Rs7209436, Rs4792887, Rsll0402, Rs242924, Rs242941, Rs242940, Rs242939, Rs242938, Rsl73365, Rsl876831, Rsl876828, Rs937, Rs878886 Rs242948); ADIPOQ (Rsl7300539, Rs2241766); STS (Rsl2861247); VDR (Rsl7467825, Rs731236, Rsl544410, Rs2229828, Rs2228570, Rs2238136); DBI (Rs3091405, Rs3769664, Rs3769662, Rs956309, Rs8192506); GABRA6 (Rs3811995, Rs3219151, Rs6883829, Rs3811991); GABRB3 (Rs2912582, Rs2081648, Rsl426217, Rs754185, Rs890317, Rs981778, Rs2059574); MTHFR(Rs4846048, Rsl801131, Rsl801133, Rs2066470); MLXIPL[carbohydrate binding element] (Rs3812316, Rsl7145738); VEGF (Rs2010963, Rs833068, Rs3025000, Rs3025010, Rs3025039, Rs3025053); DRD4 (Rs936460, Rs41298422, Rs3758653, Rs936461, Rsl2720373, Rs747302, Rsl800955, Rs916455, Rs916457, Rs7 124601); CLOCK (Rsl801260, Rs934945, Rsl3033501); Melatonin (any polymorphism); Orexin (all polymorphisms), PENK (RS16920581, RS1437277, RS1975285, RS260998, RS2609997), and CBl (RS1049353).
- The question is which of all these genes will result in predicting clinical outcome. This challenge was overcome by the methodology of the present invention.
- The genetic addictive risk analysis methods and kits disclosed and taught herein have many industrial benefits for the entire RDS field.
- For instance, these will reduce/eliminate guessing related to administration of potent opioids to treat both acute and chronic pain. By implementing the genetic addictive risk analysis test, which has now shown to predict clinical severity (alcohol as an example) for addiction, will be seen as a tremendous breakthrough in the addiction field. In fact a focus group conducted with Dominion Diagnostics (the developer of the genetic test) revealed 100% excitement for its utilization in the addiction industrial space.
- One of the major issues in addiction treatment is quilt and denial of the pathological hypodopaminergic trait/state. With information provided by genetic addictive risk analysis, the patient/individual will be able to grasp and understand their risk just as if one was determining risk for other chronic diseases like diabetes.
- Other benefits include, but are not limited to, determination of medical monitoring (treatment medication) as a function of different reward gene polymorphisms.
- In addition, the development of personalized medicine has already been shown by targeting reward gene polymorphisms utilizing a variation of genetic addictive risk analysis for obesity. There is indeed a great need for the commercialization of a predictive genetic based test and an individual risk for all addictive behaviors as espoused in the RDS framework.
- Utilization of the genetic addictive risk analysis test in clinical practice should: (1) reduce denial; (2) reduce guilt; (3) reduce erroneous-prediction of relapse chance; (4) lead to appropriate therapeutic targets based on known gene polymorphisms and medication dosing; (5) improve drug selection and evaluation; (6) analyze patient risk for pain medication tolerance, dependence, and/or abuse; and (7) improve outcomes based on medical necessity.
- It has been shown that significant association of genetic risk stratification as a predictor of ASI testing. To Applicant's knowledge this is the only set of gene and respective alleles provide patient based information to assist the clinician with an objective biologically based diagnostic tool to support a novel treatment plan.
- While embodiments of the invention have been shown and described, modifications thereof can be made by one skilled in the art without departing from the spirit and teachings of the invention. The embodiments described and the examples provided herein are exemplary only, and are not intended to be limiting. Many variations and modifications of the invention disclosed herein are possible and are within the scope of the invention. Accordingly, other embodiments are within the scope of the following claims. The scope of protection is not limited by the description set out above, but is only limited by the claims which follow, that scope including all equivalents of the subject matter of the claims.
- The disclosures of all patents, patent applications, and publications cited herein are hereby incorporated herein by reference in their entirety, to the extent that they provide exemplary, procedural, or other details supplementary to those set forth herein.
-
- H. C. Anchordoquy et al., “Genotyping of three candidate genes after whole-genome preamplification of DNA collected from buccal cells,” Behav Genet. 2003, 33(1):73-8 (“Anchordoquy 2003”).
- K. Blum et al., “Buprenorphine Response as a Function of Neurogenetic Polymorphic Antecedents: Can Dopamine Genes Affect Clinical Outcomes in Reward Deficiency Syndrome (RDS)”J Addict Res Ther., 2014, 5 pii: 1000 (“Blum 2014”).
- K. Blum et al., Molecular Neurobiology of Addition Recovery: The 12 Steps Program and Fellowship, Springer Science & Business Media (2013) (“Blum 2013”).
- K. Blum et al., “Generational association studies of dopaminergic genes in reward deficiency syndrome (RDS) subjects: selecting appropriate phenotypes for reward dependence behaviors,” Int J. Environ Public Health, 2011, 8(12):4425-59 (“Blum 2011”).
- K. Blum et al., “Reward deficiency syndrome: a biological model for diagnostics and treatment of impulsive, additive, and compulsive behavior,” J. Psychoactive Drugs, 2000, 32 Suppl:1-iv, 1-112 (“Blum 2000”).
- K. Blum et al., “The D2 dopamine receptor gene as a determinant of reward deficiency syndrome,” J R Soc. Med, 1996, 89(7):396-400 (“Blum 1996”).
- K. Blum K. et al., “Allelic association of human dopamine D2 receptor gene in alcoholism,” JAMA, 1990, 263(15), 2055-2060 (“Blum 1990”).
- A. Bowirrat et al., “Relationship Between Dopaminergic Neurotransmission, Alcoholism, and Reward Deficiency Syndrome,” American Journal of Medical Genetics Part B (Neuropsychiatric Genetics), 2005 132B:29-37 (“Bowirrat 2005”).
- G. Di Chiara et al., “Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats,” Proc Natl Acad Sci USA, 1988, 85:5274-5278 (“Di Chiara 1988”).
- D. E. Comings et al., “Reward deficiency syndrome: genetic aspects of behavioral disorders,” Prog Brain Res, 2000, 126:325-41 (“Comings 2000”).
- C. Dackis et al., “Neurotransmitter and neuroendocrine abnormalities associated with cocaine use,” Psychiatr Med., 1985, 3(4):461-483 (“Dackis 1985”).
- R. H. Don et al., “‘Touchdown’ PCR to circumvent spurious priming during gene amplification,” Nucleic Acids Res., 1991, 19(14):4008 (“Don 1992”).
- D. T. Eisenberg et al., “Season of birth and dopamine receptor gene associations with impulsivity, sensation seeking and reproductive behaviors,” PLoS One, 2007, 2:e1216 (“Eisenberg 2007”).
- Jamie Feusner et al., “GABAA receptor β3 subunit gene and psychiatric morbidity in a post-traumatic stress disorder population,” Psych. Res Volume 2001, 104(2): 109-117.
- B. C. Haberstick, et al., “Simple Sequence Repeats In The National Logitudinal Study Of Adolescent Health: An Ethically Diverse Resource For Genetic Analysis Of Health Behavior,” Behav Genet., 2014, 44(5): 487-497 (“Haberstick 2014”).
- B. C. Haberstick, et al., “Genotyping of three single nucleotide polymorphisms following whole genome preamplication of DNA collected from buccal cells,” Behav Genet., 2004, 34:541-547 (“Haberstick 2004”).
- J. Hietala et al., “Striatal D2 dopamine receptor binding characteristics in vivo in patients with alcohol dependence,” Psychopharmacology (Berl), 1994, 116:285-290 (“Hietala I 1994”).
- J. Hietala J et al., “Striatal D2 dopamine receptor characteristics in neuroleptic-naive schizophrenic patients studied with positron emission tomography,” Arch Gen Psychiatry, 1994, 51:116-123 (“Hietala II 1994”).
- X. Hu et al., “An expanded evaluation of the relationship of four alleles to the level of response to alcohol and the alcoholism risk,” Alcohol Clin Exp Res. 2005, 29(1):8-16 (“Hu 2005”).
- K. A. Johnson et al., “Absence of the 7-Repeat Variant of the DRD4 VNTR Is Associated With Drifting Sustained Attention in Children With ADHD But Not In Controls,” American Journal of Medical Genetics Part B (Neuropsychiatric Genetics, 2008, 147B:927-937 (“Johnson 2008”).
- J. Kircheiner et al., “A 40-basepair VNTR polymorphism in the dopamine transporter (DAT1) gene and the rapid response to antidepressant treatment,” The Pharmacogenomics Journal, 2007, 7:48-55 (“Kircheiner 2007”).
- K. J. Livak, “Allelic discrimination using fluorogenic probes and the 5′ nuclease assay. Genetic Analysis,” Biomol Eng, 1999, 14:143-149 (“Livak 1999”).
- M. Melis et al., “The dopamine hypothesis of drug addiction: hypodopaminergic state,” Int Rev Neurobiol, 2005, 63:101-154 (“Melis 2005”).
- E. P. Noble, et al., “D2 dopamine receptor gene in psychiatric and neurologic disorders and its phenotypes,”Am J Med Genet B Neuropsychiatr Genet, 2003, 116B(1):103-25 (“Noble 2003”).
- R. Picetti et al., “Addiction and stress clues for cocaine pharmacotherapies,” Current Pharmaceutical Designs, 2013, 18(40), 7065-7080 (“Picetti 2013”).
- R. B. Rothman et al., “Dual dopamine/serotonin releasers as potential medications for stimulante and alcohol addictions,” AAPS J, 2007, 9(1):E1-E10 (“Rothman 2007”).
- N. D. Volkow et al., “Role of dopamine, the frontal cortex and memory circuits in drug addiction: insight from imaging studies,” Neurobiol Lern Mem, 2002, 78:610-24 (“Volkow 2002”).
- N. D. Volkow, et al., “Low level of brain dopamine D2 receptors in methamphetamine abusers: association with metabolism in the orbitofrontal cortex, Am J Psychiatry, 2001, 158:2015-2021 (“Volkow 2001”).
- J. R. Wendland et al., “Simultaneous genotyping of four functional loci of human SLC6A4, with a reappraisal of 5HTTLPR and rs25531,” Mol Psychiatr., 2006, 11:224-226 (“Wendland 2006”).
Claims (4)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14/863,503 US20160032369A1 (en) | 2014-07-10 | 2015-09-24 | Method and kit for genetic analysis |
US16/225,356 US20190112644A1 (en) | 2014-07-10 | 2018-12-19 | Method and kit for genetic analysis |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201462023144P | 2014-07-10 | 2014-07-10 | |
US14/796,989 US10072289B2 (en) | 2014-07-10 | 2015-07-10 | Genetic addiction risk analysis for RDS severity index |
US14/863,503 US20160032369A1 (en) | 2014-07-10 | 2015-09-24 | Method and kit for genetic analysis |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/796,989 Division US10072289B2 (en) | 2014-07-10 | 2015-07-10 | Genetic addiction risk analysis for RDS severity index |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US16/225,356 Continuation US20190112644A1 (en) | 2014-07-10 | 2018-12-19 | Method and kit for genetic analysis |
Publications (1)
Publication Number | Publication Date |
---|---|
US20160032369A1 true US20160032369A1 (en) | 2016-02-04 |
Family
ID=55065001
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/796,989 Active US10072289B2 (en) | 2014-07-10 | 2015-07-10 | Genetic addiction risk analysis for RDS severity index |
US14/863,503 Abandoned US20160032369A1 (en) | 2014-07-10 | 2015-09-24 | Method and kit for genetic analysis |
US14/863,551 Abandoned US20160032391A1 (en) | 2014-07-10 | 2015-09-24 | Method of establishing a genetic risk stratificastion for genetic addiction risk analysis |
US16/225,356 Abandoned US20190112644A1 (en) | 2014-07-10 | 2018-12-19 | Method and kit for genetic analysis |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/796,989 Active US10072289B2 (en) | 2014-07-10 | 2015-07-10 | Genetic addiction risk analysis for RDS severity index |
Family Applications After (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/863,551 Abandoned US20160032391A1 (en) | 2014-07-10 | 2015-09-24 | Method of establishing a genetic risk stratificastion for genetic addiction risk analysis |
US16/225,356 Abandoned US20190112644A1 (en) | 2014-07-10 | 2018-12-19 | Method and kit for genetic analysis |
Country Status (8)
Country | Link |
---|---|
US (4) | US10072289B2 (en) |
EP (2) | EP3751007A1 (en) |
DK (1) | DK3167080T3 (en) |
ES (1) | ES2813377T3 (en) |
HU (1) | HUE050896T2 (en) |
PL (1) | PL3167080T3 (en) |
PT (1) | PT3167080T (en) |
WO (1) | WO2016007927A1 (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP6935079B2 (en) * | 2017-05-09 | 2021-09-15 | 国立大学法人千葉大学 | Combination analysis of functional SNPs |
JP2022527379A (en) | 2019-03-18 | 2022-06-01 | ジェネウス ヘルス,エルエルシー | Genetic risk analysis and behavioral management for post-traumatic stress disorders |
CA3137128A1 (en) | 2019-04-17 | 2020-10-22 | Geneus Health, Llc | Genetic risk analysis for attention deficit/hyperactivity disorders and behavioral management thereof |
WO2020247490A1 (en) * | 2019-06-04 | 2020-12-10 | Genemarkers, Llc | Risk evaluation of genomic susceptibility to opioid addiction |
EP4022066A4 (en) * | 2019-08-27 | 2023-08-30 | Prescient Medicine Holdings, Inc. | Methods and systems for evaluation of risk of substance use disorders |
WO2021055856A1 (en) * | 2019-09-18 | 2021-03-25 | Millennium Health, LLC | Tool for predicting health and drug abuse crisis |
WO2021173869A1 (en) * | 2020-02-26 | 2021-09-02 | Ethan Russo | Methods and kits for treating or diagnosing cannabinoid hyperemesis syndrome |
AU2021314061A1 (en) * | 2020-07-23 | 2023-03-16 | The DNA Company Inc. | Systems and methods for determining a physiological profile using genetic information |
US12068066B2 (en) * | 2021-03-01 | 2024-08-20 | Kpn Innovations, Llc. | System and method for generating an addiction nourishment program |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110189161A1 (en) * | 2008-06-21 | 2011-08-04 | Kenneth Blum | Nutrigenomics methods and compositions |
US20120053070A1 (en) * | 2010-04-22 | 2012-03-01 | Kenneth Blum | Genetic Risk Analysis In Reward Deficiency Syndrome |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU6494798A (en) | 1997-02-03 | 1998-08-25 | Max-Delbruck-Centrum Fur Molekulare Medizin | Genomic sequence of the human mu-opioid receptor gene and the variants, polymorphisms and mutations thereof |
US6955873B1 (en) | 2000-08-04 | 2005-10-18 | Kenneth Blum | Diagnosis and treatment system for reward deficiency syndrome (RDS) and related behaviors |
US8688385B2 (en) * | 2003-02-20 | 2014-04-01 | Mayo Foundation For Medical Education And Research | Methods for selecting initial doses of psychotropic medications based on a CYP2D6 genotype |
US20050069936A1 (en) * | 2003-09-26 | 2005-03-31 | Cornelius Diamond | Diagnostic markers of depression treatment and methods of use thereof |
US20060062859A1 (en) * | 2004-08-05 | 2006-03-23 | Kenneth Blum | Composition and method to optimize and customize nutritional supplement formulations by measuring genetic and metabolomic contributing factors to disease diagnosis, stratification, prognosis, metabolism, and therapeutic outcomes |
EP2252705A1 (en) | 2008-02-22 | 2010-11-24 | Duke University | Methods and compositions for predicting success in addictive substance cessation and for predicting a risk of addiction |
-
2015
- 2015-07-10 DK DK15818821.9T patent/DK3167080T3/en active
- 2015-07-10 HU HUE15818821A patent/HUE050896T2/en unknown
- 2015-07-10 US US14/796,989 patent/US10072289B2/en active Active
- 2015-07-10 ES ES15818821T patent/ES2813377T3/en active Active
- 2015-07-10 EP EP20175356.3A patent/EP3751007A1/en active Pending
- 2015-07-10 EP EP15818821.9A patent/EP3167080B1/en active Active
- 2015-07-10 PL PL15818821T patent/PL3167080T3/en unknown
- 2015-07-10 WO PCT/US2015/040054 patent/WO2016007927A1/en active Application Filing
- 2015-07-10 PT PT158188219T patent/PT3167080T/en unknown
- 2015-09-24 US US14/863,503 patent/US20160032369A1/en not_active Abandoned
- 2015-09-24 US US14/863,551 patent/US20160032391A1/en not_active Abandoned
-
2018
- 2018-12-19 US US16/225,356 patent/US20190112644A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110189161A1 (en) * | 2008-06-21 | 2011-08-04 | Kenneth Blum | Nutrigenomics methods and compositions |
US20120053070A1 (en) * | 2010-04-22 | 2012-03-01 | Kenneth Blum | Genetic Risk Analysis In Reward Deficiency Syndrome |
Non-Patent Citations (2)
Title |
---|
Batel et al; Alcoholism: Clinical and Experimental Research, vol 22, 2008, pages 567-572 * |
Blum et al; Genetic Addiction Risk Score (GARS) : Testing For Polygenetic Predisposition and Risk to Reward Deficiency Syndrome (RDS), Gene Therapy Applications, Prof. Chunsheng Kang (Ed.) 2011; pages 327-362 * |
Also Published As
Publication number | Publication date |
---|---|
WO2016007927A1 (en) | 2016-01-14 |
PT3167080T (en) | 2020-09-01 |
EP3751007A1 (en) | 2020-12-16 |
US20160032391A1 (en) | 2016-02-04 |
ES2813377T3 (en) | 2021-03-23 |
US20160012180A1 (en) | 2016-01-14 |
DK3167080T3 (en) | 2020-08-31 |
EP3167080A4 (en) | 2018-01-17 |
EP3167080B1 (en) | 2020-05-27 |
US10072289B2 (en) | 2018-09-11 |
PL3167080T3 (en) | 2020-11-16 |
EP3167080A1 (en) | 2017-05-17 |
HUE050896T2 (en) | 2021-01-28 |
US20190112644A1 (en) | 2019-04-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10072289B2 (en) | Genetic addiction risk analysis for RDS severity index | |
Uhl et al. | Molecular genetics of addiction and related heritable phenotypes: genome‐wide association approaches identify “connectivity constellation” and drug target genes with pleiotropic effects | |
US20090197276A1 (en) | Methods and compositions for predicting compliance with an antidepressant treatment regimen | |
Corley et al. | Association of candidate genes with antisocial drug dependence in adolescents | |
US20070155772A1 (en) | Use of genetic polymorphisms that associate with efficacy of treatment of inflammatory disease | |
Hill et al. | Dopaminergic mutations: Within‐family association and linkage in multiplex alcohol dependence families | |
US10954563B2 (en) | Method for predicting the onset of extrapyramidal symptoms (EPS) induced by an antipsychotic-based treatment | |
US20110118133A1 (en) | Methods to identify patients at risk of developing adverse events during treatment with antidepressant medication | |
US20090281090A1 (en) | Biomarkers for the prediction of responsiveness to clozapine treatment | |
Class et al. | Patent application title: GENETIC ADDICTION RISK ANALYSIS FOR RDS SEVERITY INDEX | |
Class et al. | Patent application title: METHOD OF ESTABLISHING A GENETIC RISK STRATIFICASTION FOR GENETIC ADDICTION RISK ANALYSIS Inventors: Kenneth Blum (Austin, TX, US) Assignees: SYNAPTAMINE, INC. | |
US20130029862A1 (en) | Clinical application utilizing genetic data for effective medication management | |
Nawaz et al. | Association of single nucleotide polymorphisms in catechol-omethyltransferase and serine-threonine protein kinase genes in the Pakistani schizophrenic population: a study with special emphasis on cannabis and smokeless tobacco | |
Amstadter et al. | Selected summaries from the XVII World Congress of Psychiatric Genetics, San Diego, California, USA, 4–8 November 2009 | |
Kaneva et al. | Bipolar disorder in the Bulgarian Gypsies: Genetic heterogeneity in a young founder population | |
Maron et al. | The genetics of human anxiety disorders | |
US20070248955A1 (en) | Use Of Genetic Polymorphisms To Predict Drug-Induced Hepatotoxicity | |
US20140243237A1 (en) | Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene | |
Gaynor | Genetic and functional approaches to understanding suicidal behavior | |
Dalvie | Genetic analysis of bipolar disorder and alcohol use disorder | |
Kalsi | The molecular genetics of schizophrenia: A linkage study | |
Dai | Investigation of findings of recent schizophrenia genome wide association and linkage studies in Indonesian samples | |
Barr et al. | XIII World Congress on Psychiatric Genetics 2005 Sponsored by | |
Van Broeckhoven et al. | The Palais des Congrés Brussels, Belgium October 9–13, 2002 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: IGENE LLC, TEXAS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SYNAPTAMINE, INC.;REEL/FRAME:040231/0171 Effective date: 20161104 Owner name: SYNAPTAMINE, INC., TEXAS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BLUM, KENNETH;REEL/FRAME:040231/0031 Effective date: 20150710 |
|
STCV | Information on status: appeal procedure |
Free format text: EXAMINER'S ANSWER TO APPEAL BRIEF MAILED |
|
STCV | Information on status: appeal procedure |
Free format text: APPEAL READY FOR REVIEW |
|
STCV | Information on status: appeal procedure |
Free format text: ON APPEAL -- AWAITING DECISION BY THE BOARD OF APPEALS |
|
AS | Assignment |
Owner name: GENEUS HEALTH LLC, TEXAS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:IGENE LLC;REEL/FRAME:050383/0232 Effective date: 20190916 |
|
AS | Assignment |
Owner name: GENEUS HEALTH IP, LLC, WYOMING Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GENEUS HEALTH LLC;REEL/FRAME:051154/0386 Effective date: 20191120 |
|
AS | Assignment |
Owner name: FUNDING SOURCE INTERNATIONAL, LLC, FLORIDA Free format text: SECURITY INTEREST;ASSIGNOR:GENEUS HEALTH, LLC;REEL/FRAME:051749/0106 Effective date: 20200205 |
|
STCV | Information on status: appeal procedure |
Free format text: BOARD OF APPEALS DECISION RENDERED |
|
AS | Assignment |
Owner name: GENEUS HEALTH, LLC, TEXAS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GENEUS HEALTH IP, LLC;REEL/FRAME:052667/0038 Effective date: 20200511 |
|
STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
AS | Assignment |
Owner name: GENEUS HEALTH, LLC, TEXAS Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:FUNDING SOURCE INTERNATIONAL, LLC;REEL/FRAME:053248/0742 Effective date: 20200715 |
|
STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |
|
AS | Assignment |
Owner name: IVITALIZE IP HOLDINGS, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GENEUS HEALTH LLC;REEL/FRAME:059695/0609 Effective date: 20220324 |