CA3137128A1 - Genetic risk analysis for attention deficit/hyperactivity disorders and behavioral management thereof - Google Patents

Abstract

Methods and kits for assessing severity index for genetic risks of attention deficit/hyperactivity disorders. The present invention further relates to methods for behavioral management thereof. The methods and kits provide a risk analysis score (termed a "genetic risk attention deficit disorder score" (or "GRADDS"). The method for behavioral management of those depending upon his or her GRADDS is the precision behavioral management (or PBM") protocol. This can include precision addiction management and pro-dopamine lifestyle therapies and measures.

Description

GENETIC RISK ANALYSIS FOR ATTENTION DEFICIT/HYPERACTIVITY
DISORDERS AND BEHAVIORAL MANAGEMENT THEREOF
FIELD OF INVENTION
[0001] The present invention is directed to assessing severity index for genetic risks of attention deficit/hyperactivity disorders and the methods of behavioral management thereof.
RELATED APPLICATIONS

[0002] This Application claims the benefit of provisional United States Patent Application Serial No. 62/835,193, filed April 17, 2019, entitled "Genetic Risk Analysis For Attention Deficit Disorders And Behavioral Management Thereof', which is commonly assigned to the Assignee of the present invention and is hereby incorporated in reference in its entirety for all purposes.

[0003] This Application is also related to PCT Patent Publ. No.
WO/2016/007927, published January 14, 2016, entitled "Genetic Addiction Risk Analysis For RDS Severity Index," to Blum ("Blum '927 PCT Application"), which is commonly assigned to the Assignee of the present invention and is hereby incorporated in reference in its entirety for all purposes, including the sequence listing provided therein.

[0004] This Application is also related to PCT Patent Appl. No.
PCT/U520/23437, filed March 18, 2020, entitled "Genetic Addiction Risk Analysis For Post-Traumatic Stress Disorders And Behavioral Management Thereof," to Blum, which is commonly assigned to the Assignee of the present invention and is hereby incorporated in reference in its entirety for all purposes.
BACKGROUND OF THE INVENTION
Characteristics of attention deficit/hyperactivity disorder (ADHD)

[0005] Attention deficit/hyperactivity disorder (ADHD) is a complex disorder having multiple causes including genetics as impacted by one's environment. The condition is usually diagnosed in childhood, when difficulties arise during play and school, and it is marked by lack of concentration, short attention span, and physical restlessness [APA 1994;
APA 2000].

6 PCT/US2020/028870 ADHD often is blamed on bad parenting, or a "bad" attitude. However, brain-imaging studies have shown that children with this disorder have an underlying neurological dysfunction, which likely accounts for their behavior [Zametkin 1990; Lou 1998].
[0006] In the simplest terms, the brains of these children have yet to come fully "on-line." It is conjectured that while certain important brain pathways are working normally, cortical regions involved in attention, impulse control, and stimulus integration abilities, have yet to become fully active. ADHD is a widespread affliction that we are just beginning to understand. People with ADHD suffer from overload [Miller 2008]. That is, they have heightened awareness of incoming stimuli, particularly sight, sound, and touch. They are so bombarded by the normal stimuli in their environment that they cannot filter out the background noise, and they have trouble focusing or concentrating on a problem or a task. Because of their inability to focus, those with ADHD have trouble completing what they start. They have difficulties with making plans and even more difficulty in carrying out plans in an orderly fashion.

[0007] People with ADHD tend to be disorganized. Children have messy rooms;
adults have cluttered desks; daily activities tend to be chaotic. Attics and basements are likely to be filled with partly completed sewing projects, woodworking projects, repairs, and notebooks; desk drawers are likely to be cluttered with unfinished letters, outlines, and project plans. Many people with the disorder are highly intelligent, but they tend to be underachievers because they cannot concentrate or sustain interest. As a result, family, friends, teachers, and coworkers become impatient and expect them to fail. People with ADHD also have trouble adapting to change. Their life is so full of tumult that even a minor additional change in their routine can be upsetting or can even create a crisis, e.g., a parent goes away on a trip, a new teacher takes over a class, the family moves to a new city, or a pet dies.

[0008] ADHD afflicted people live under stress so severe they cannot tolerate frustration, and when they are frustrated, they are likely to become angry. The anger tends to come suddenly and explosively, accompanied by slamming doors, harsh words, tantrums, and leaving important meetings in a frenzy. Children get into fights; adults lose jobs and alienate friends.
Afterwards, they may be sorry, but the damage is done. With their high level of frustration, people with ADHD are impatient. They hate to wait in line, and delays of any kind can make them frantic. Whatever is going on ¨ a trip, a movie, a class, a discussion ¨
they want it to go quickly and be finished. Their impatience makes people with ADHD impulsive. As children, they leap into action without thinking of consequences. As adults, they drive too fast, use power tools carelessly, and plunge into activities without thinking of the danger.
The result is they often hurt themselves or others. People with ADHD have trouble with their orientation to time and space. They may have trouble differentiating their right hand from their left; they may have difficulty following a set of instructions, reading a map, or telling time. As babies or children they constantly are on the move, squirming, twisting, and getting into everything. As adults, they are restless, easily bored, rebellious when asked to follow a routine, and always on the move. It is noteworthy that some of these characteristics are tied to comorbid Oppositional Defiant Disorder (ODD) and conduct disorder (CD), separate from ADHD per se [Biederman 11 2007].

[0009] The diagnosis of ADHD is based on criteria outlined by the Diagnostic and Statistical Manual of the American Psychiatric Association ("DSM-IV") [APA 1994]. TABLE I
lists these criteria. There have been a number of similar criteria set out in earlier versions of the DSM. While the names have changed somewhat, all have embraced the letters ADD
in one form or another, representing the core of the disorder ¨ attention deficit disorder. The subtypes in the DMS-IV are ADHD-I representing predominately the inattentive type, ADHD-H
representing predominately the hyperactive-impulsive type, and ADHD-C, representing the combined type.

TABLE I
DSM-IV diagnostic criteria for attention-deficit/hyperactivity disorder A. Either (1) or (2) 1. six (or more) of the following symptoms of inattention have persisted for at least 6 months to a degree that is maladaptive and inconsistent with developmental level:
Inattention a. often fails to give close attention to details or makes careless mistakes in schoolwork, work or other activities b. often has difficulty sustaining attention in tasks or play activities c. often does not seem to listen when spoken to directly d. often does not follow through on instructions and fails to finish schoolwork, chores, or duties in the workplace (not due to oppositional behavior or failure to understand instructions) e. often has difficulty organizing tasks and activities f. often avoids, dislikes, or is reluctant to engage in tasks that require sustained mental effort (such as schoolwork or homework) g. often loses things necessary for tasks or activities (e.g., toys, school assignments, pencils, books, or tools) h. is often easily distracted by extraneous stimuli i. is often forgetful in daily activities 2. six (or more) of the following symptoms of hyperactivity-impulsivity have persisted for at least 6 months to a degree that is maladaptive and inconsistent with developmental level:
Hyperactivity a. often fidgets with hands or feet or squirms in seat b. often leaves seat in classroom or in other situations in which remaining seated is expected c. often runs about or climbs excessively in a situation in which it is inappropriate (in adolescents or adults, may be limited to subjective feelings of restlessness) d. often has difficulty playing or engaging in leisure activities quietly e. is often "on the go" or often acts as if "driven by a motor"
f. often talks excessively Impulsivity g. often blurts out answers before questions have been completed h. often has difficulty awaiting turn i. often interrupts or intrudes on others (e.g., butts into conversations or games) B. Some hyperactivity-impulsive or inattentive symptoms that caused impairment were present before age 7 years C. Some impairment from the symptoms is present in two or more settings (e.g., at school [or work] and at home) D. There must be clear evidence of clinically significant impairment in social, academic, or occupational functioning E. The symptoms do not occur exclusively during the course of a Pervasive Developmental Disorder, Schizophrenia, or other Psychotic Disorder and are not better accounted for by other mental disorder (e.g., Mood Disorder, Anxiety Disorder, Dissociative Disorder, or a Personality Disorder).
Code based on type:
314.01 Attention-Deficit/Hyperactivity Disorder, Combined Type: if both Criteria Al and A2 are met for the past 6 months 314.00 Attention-Deficit/Hyperactivity Disorder, Predominately Inattentive Type: if Criteria Al is met but Criteria A2 is not met for the past 6 months 314.01 Attention-Deficit/Hyperactivity Disorder, Predominately Hyperactive-Impulsive Type: if Criteria A2 is met but Criteria Al is not met for the past 6 months

[0010] There has been increased interest in ADHD as a heritable neuropsychiatric condition linked to pathogenesis of brain dopamine [Shaw 2007; Swanson 2007; Volkow 2007]. As discussed herein, ADHD as an important putative complex subtype of a general condition or umbrella disorder known as reward deficiency syndrome (RD S) [Blum 11 1996].
"RDS" refers to the breakdown of a cascade of neurotransmitters in the brain in which one reaction triggers another ¨ the reward cascade [Blum II 1990] ¨ and resultant aberrant conduct [Blum I 1996].
At the level of individual neurons, the reward cascade is catalyzed by a number of specific neurotransmitters, each of which binds to certain types of receptors and serves a specific function. The binding of the neurotransmitter to neuronal receptors triggers a reaction that is part of the cascade. Disruption of these intercellular cascades results in aberrant behavior of one form or another in RDS, including ADHD.

[0011] RDS has genetic and environmental influences, and it predisposes individuals to high risk for multiple addictive, impulsive, and compulsive behaviors. Depending on genes that control different parts of the reward neurotransmitter pathways, a person may display anything from mild anxiety, irritability, hyperactivity, or risk taking, to compulsive shopping, gambling, sexual behaviors, drug addiction, alcoholism, smoking, and even eating disorders. Of all of these conditions, one that is especially controversial and receives considerable media coverage, is ADHD [APA 1994; APA2000].

[0012] According to CHADD (Children and Adults with ADHD), 3.5 million school age children have ADHD [CHADD 2007]. ADHD usually persists throughout a person's lifetime.
It is not limited to children. Approximately one-half to two¨thirds of children with ADHD will continue to have significant problems with ADHD symptoms and behaviors as adults, where it impacts their lives on the job, within the family, and in social relationships. ADHD is recognized as a disability under federal legislation (the Rehabilitation Act of 1973; the Americans with Disabilities Act; and the Individuals with Disabilities Education Act).
Appropriate and reasonable accommodations are sometimes made at school for children with ADHD, and in the workplace for adults with ADHD, which help the individual to work more efficiently and productively. While teachers are not equipped to make a definitive diagnosis, they are a meaningful source of initiation of the process to attain a sound diagnosis [Biederman 2006]. However, less than half of those individuals who have been targeted by teachers receive appropriate diagnosis and corrective intervention. Of those who are diagnosed, few are receiving appropriate multi-modal treatment apart from pharmacological manipulation.
Moreover, pediatricians report that approximately 4% of their patients have ADHD. Boys are four times more likely to have this illness than girls.

[0013] Twin studies indicate that 75%-90% of ADHD is caused by genetic factors. If one person in a family is diagnosed with ADHD there is a 25%-35% probability that another family member also has ADHD, compared to a 4%-6% probability for someone in the general population. Between 10% and 35% of children with ADHD have a first degree relative with past or present ADHD. Approximately one-half of parents who had ADHD have a child with the disorder. There may be non-genetic factors as well, including prenatal exposure to nicotine by mothers who smoked, anoxia in the neonatal period of infancy, and childhood exposure to high quantities of lead.

Science of reward deficiency syndrome

[0014] RDS results from a dysfunction in the "brain reward cascade," a complex interaction among brain neurotransmitters in reward centers of the brain, which directly links abnormal craving behavior with a defect in at least the DRD2 dopamine receptor gene [Blum I 1990].
Dopamine is a powerful brain neurotransmitter that controls feelings of well being [Blum II
1990; Blum 1991; Blum I 1996]. Dopamine interacts with other powerful brain chemicals and neurotransmitters (e.g., serotonin and the opioids), which themselves are associated with control of moods. In individuals possessing an abnormality in the DRD2 dopamine receptor gene, the brain lacks sufficient numbers of dopamine receptor sites to use the normal amount of dopamine in reward centers and thus reduces the amount of dopamine produced in this area.
In individuals not possessing the variant in the dopamine receptor gene, but who have engaged in risky behaviors (such as cocaine abuse, extremely low caloric diet, high levels of stress over an extended period of time), the brain functions as though it had the DRD2genetic variant (or other specific gene variants) [Faraone 2003].

[0015] The overall effect is inadequate dopaminergic activity in brain reward centers. This defect drives individuals to engage in activities that will increase brain dopamine function.
Consuming large quantities of alcohol or carbohydrates (carbohydrate bingeing) stimulates the brain's production of, and utilization of, dopamine. So too does the intake of crack/cocaine and the abuse of nicotine. Also, it has been found that the genetic abnormality is associated with aggressive behavior, which also stimulates the brain's use of dopamine [Blum II 1996; Blum 2000].

[0016] RDS can be manifested in relatively mild or severe forms that follow as a consequence of an individual's biochemical inability to derive reward from ordinary, everyday activities. At least one genetic aberration has been identified that leads to an alteration in the reward pathways of the brain [Bowirrat 2005]. It is a variant form of the gene for the dopamine D2 receptor, called the Al allele. This genetic variant also is associated with a spectrum of impulsive, compulsive, and addictive behaviors. The concept of the RDS unites those disorders and may explain how simple genetic anomalies give rise to complex aberrant behaviors. While this polymorphic gene may play a significant role in ADHD predisposition, it must be tied to a certain subset of additional genes for the clinical expression of ADHD. This is called polygenic inheritance. Recent associations of certain alleles of both the dopamine D4 and dopamine D2genes and novelty seeking behavior have confirmed previous work suggesting polygenic inheritance [Comings 1996; Lee 2003].
Biology of reward

[0017] The reward system in the brain was discovered by accident in the 1950s by James Olds [Olds 1956]. Olds had been studying brain mechanisms of attention using laboratory rats, when he mistakenly placed electrodes in a region of the limbic system. When the electrodes were attached so that the animals could self-stimulate this region by pressing a lever, rats would press the lever almost nonstop, as much as 5,000 times an hour. The animals would stimulate themselves to the exclusion of everything else except sleep. They also would endure tremendous pain and deprivation for an opportunity to press the lever. Olds had clearly found an area in the limbic system that provided a powerful reward for these animals.

[0018] Later research on human subjects revealed that the electrical stimulation of the medial hypothalamus in the limbic system produced a feeling of quasi-orgasmic sexual arousal. If certain other areas of the brain were stimulated, an individual experienced a type of light-headedness that banished negative thoughts [Olds 1956; Blum 2000]. These discoveries demonstrated that pleasure is a distinct neurological function that is linked to a complex reward and reinforcement system. During the past several decades, research has been able to better define some of the brain regions and neurotransmitters involved in reward [Blum I 1996; Blum 2000]. A neuronal circuit deep in the brain involving the limbic system, the nucleus accumbens, and the globus pallidus, appears to be critical in the expression of reward [Wise 1984].
Although each substance of abuse or each addictive behavior may act on different parts of this circuit, the end result is the same: Dopamine appears to be the primary neurotransmitter released in brain reward sites [Koob 1988].
Cascade Theory of Reward

[0019] Considerable attention has been devoted to the investigation of the neurochemical and neuroanatomical systems that underlie a variety of substance-seeking behaviors. In healthy people, neurotransmitters work together in a pattern of stimulation or inhibition, the effects spreading downward, like a cascade, from stimulus input to complex patterns of response leading to feelings of well-being (the "Cascade Theory Of Reward") [Stein 1986; Blum II
1990; Cloninger 1993]. Although this neurotransmitter system is very complex and still not completely understood, the main central reward areas in the human brain's mesolimbic system are summarized below.

[0020] As can be seen in FIGS. 1A-1B, the following interactions take place in brain reward areas [Blum 1991; Stein 1986]: (1) Serotonin in the hypothalamus indirectly activates opiate receptors and causes a release of enkephalins in the ventral tegmental region A10. The enkephalins inhibit the firing of gamma-aminobutyric acid neurotransmitter (GABA), which originates in the substantia nigra A9 region. (2) GABA' s normal role, acting through GABA
B receptors, is to inhibit and control the amount of dopamine released at the ventral tegmental regions for action at the nucleus accumbens. When dopamine is released in the nucleus accumbens, it activates dopamine D2 receptors, a key reward site. This release also is regulated by enkephalins acting through GABA. The supply of enkephalins is controlled by the amount of the neuropeptidases, which destroy them. (3) Dopamine also may be released into the amygdala. From the amygdala, dopamine exerts an effect on neurons within the hippocampus (i.e., the dopamine stimulates the hippocampus and the CA and cluster cells stimulate dopamine D2 receptors). (4) An alternate pathway involves norepinephrine in the locus ceruleus whose fibers project into the hippocampus at a reward area centering around cluster cells, which have not been precisely identified (designated as CAx). When GABA
A receptors in the hippocampus are stimulated, they cause the release of norepinephrine.

[0021] It is to be noted that the putative glucose receptor in the hypothalamus is intricately involved and links the serotonergic system with opioid peptides leading to the ultimate release of dopamine at the nucleus accumbens. In the brain reward cascade these interactions may be viewed as activities of subsystems of a larger system, taking place simultaneously or in sequence, merging in cascade fashion toward anxiety, anger, low self-esteem, or other unpleasant feelings, or toward craving of a substance that will reduce or eliminate the feelings (e.g., alcohol, carbohydrates, alcohol, and drugs) [Blum 11 1990].

[0022] The notion of dopamine as the final common pathway for a number of diverse drugs of abuse is supported by the findings of Ortiz and associates [Ortiz 1995]. They demonstrated that chronic administration of cocaine, morphine, or alcohol resulted in several biochemical adaptations in the mesolimbic dopamine system. They suggested that these adaptations may underlie changes in the structural and functional properties of the neuronal pathway of this system related to substance abuse [011at 1990; also see Imperato 1988].

[0023] Genetic anomalies, long-term continuing stress, or long-term abuse of substances can lead to a self-sustaining pattern of abnormal craving behavior in both animals and humans.
Research on nonhuman animals has provided support for the cascade theory of reward and its genetic links. Thus, Li and colleagues [Russell 1988; Zhou 1991; McBride 1993;

McBride 1994; Li 2006] developed strains of alcohol-preferring (P) and non-preferring (NP) rat lines. They found that the P rats have the following neurochemical profile: lower serotonin neurons in the hypothalamus; higher levels of enkephalin in the hypothalamus (due to a lower release); more GABA neurons in the nucleus accumbens; reduced dopamine supply at the nucleus accumbens; and reduced densities of dopamine D2 receptors in the mesolimbic areas.

[0024] In terms of genetics, especially as related to ADHD, a number of genes have been associated, and these candidate genes are all involved in the reward cascade.
Comings II
2000 described a subset of at least 42 gene variants, which associate with ADHD and contribute to the overall variance. Interestingly, these genes constitute the basis for the reward cascade including certain neurotransmitters but not limited to dopaminergic, serotonergic, enkephalinergic, catecholaminergic, cholinergic, GABAergic, androgen receptors, as well as other putative transmitters, hormones, and their receptors and enzymes (both anabolic and catabolic).

[0025] In recent years, a number of reviews of the neurochemical basis of ADHD
have emphasized the involvement of multiple neurotransmitters and emphasized that one single genetic defect cannot explain all of the data. Polygenic inheritance is uniquely capable of answering the question of how to account for both the range of comorbid disorders in ADHD
and their interaction, but it fails to provide us with a true model of subsets of genes and their contribution to the variance of the disorder in question. One example of polygenic inheritance for ADHD was tested by Comings I 2000. They found that three dopaminergic genes, DRD2, DAT1, and DBH, differentially associated with ADHD probands. Their results showed that these three genes were additive in their effect. Thus, individuals who had three out of three markers had the highest ADHD score; those with two of three had the next highest score; then one of three; and those with none of the three markers had the lowest ADHD
score [Comings 1996]. Moreover, this additive effect was also seen for a number of other related ADHD
behaviors (i.e., stuttering, obsessive compulsive disorder [OCD], tics, conduct disorder [CD]) and supports the polygenic hypothesis of ADHD. In other words, the different associated

26 PCT/US2020/028870 behaviors are due to similar sets of genes in that certain psychiatric disorders have a number of genes in common.
[0026] This suggests a four-part cascade sequence leading to a reduction of net dopamine release in a key reward area. Additional support for this idea came when investigators found that by administering substances that increase the serotonin supply at the synapse, or by stimulating dopamine D2 receptors directly, they could reduce craving for alcohol [McBride 1994]. Specifically, D2 receptor agonists reduced alcohol intake in high alcohol preferring rats, whereas D2 dopamine receptors antagonists increased alcohol drinking in these inbred animals [Dyr 1993].
Science of ADHD
Neuropsychogenetics of ADHD

[0027] In ADHD, the picture emerges of individuals suffering from overload, trying to adjust to a world that is too bright, too loud, too abrasive, and too rapidly changing for comfort. Early speculation about the causes of ADHD focused on such factors as marital disorder, poor parenting, brain damage, psychiatric illness, or alcoholism or drug abuse in the family.
Associated behaviors included CD and anti-social personality. Later these behaviors were shown to be linked hereditarily to substance use disorder (SUP). Most recently, research has begun to show a significant association between these behavioral disorders, ADHD, and specific genetic anomalies.

[0028] This leads to the inquiry as to what is the cause or basis of ADHD. It is an impulse disorder with genetic components that results from imbalances of neurotransmitters. Its effects can be eased by treatment and counseling. The biological basis for this disorder has been established by a number of investigators [Comings 1991; Biederman 1992]. In one study individuals with ADHD were found to have abnormal brain wave patterns [Lubar 1991]. Their beta waves (brain waves associated with concentration) are low, and their theta waves (associated with relaxation) are high, suggesting a state of drowsiness and daydreaming. It is not surprising, therefore, that activities associated with beta waves, e.g., watchful anticipation and problem solving, are difficult for individuals with ADHD to sustain. They like activities that permit them to stay in a theta state with a minimum of outside stimulation [Lubar 1991].
It may be that people with ADHD are afflicted with a defective filtering system such that their brainstem reticular formation does not block out irrelevant stimuli. These people appear to be aware of every sound, every object, every touch, and they all merge in disorganized behaviors that are difficult to tolerate. Non-essential stimuli get the same attention as those essential to work or relating to other people. At a deeper level, ADHD is a problem of communication among brain cells, or neurons, possibly involving the neurotransmitters that carry inter-neural messages. These brain messengers may be either in short supply for certain behaviors such as cravings (probably due to inadequate serotonergic and or dopaminergic function) or other attentional deficits, or they may be the result of too much norepinephrine rather than too little.
If the messengers that inhibit incoming stimuli are deficient, too many signals get through and create confusion.

[0029] At a still deeper level, the problem lies in the genes that lay down the blueprint for manufacturing neurotransmitters. People with ADHD have at least one defective gene, the DRD2 gene that makes it difficult for neurons to respond to dopamine, the neurotransmitter that is involved in feelings of pleasure and the regulation of attention.
Studies on genetic anomalies have implicated other dopaminergic genes such as the DRD4 receptor gene, the dopamine beta hydroxylase (Df3H) gene, and the dopamine transporter genes as causative factors in ADHD [Cook 1995; Waldman 1998], as well as gene variants involved in multiple neurotransmitter pathways.

[0030] Support for the role of genetics in ADHD includes evidence showing that it runs in families. For example, a number of studies have shown that fathers and/or mothers of ADHD

children tend to have antisocial personality and alcoholism. As early as 1971, James Morrison and Mark Stewart examined parents of 59 hyperactive children and 41 control children. In 21 of the families, at least 1 parent was alcoholic or had antisocial personality and other related behaviors. By contrast, only 4 of the control families were so affected. In a family study of parents and siblings of felons, there was an increased frequency of antisocial personality, alcoholism, and drug addiction in male relatives of hyperactive children [Cantwell 1972].

[0031] Numerous studies indicate that 20%-30% of siblings of ADHD children also have ADHD. This is 2-7 times the frequency found in non-ADHD children. These siblings also were 5 times more likely to have major depression than control children [Weiner 1977; August 1983]. Other studies showed that 22% of brothers and 8% of sisters of hyperactive children were hyperactive themselves. Interestingly, however, when ADD is considered without hyperactivity, the number of brothers and sisters affected was the same [Cantwell 1976]. In another study of ADHD children it was found that if neither parent had the syndrome, 11% of the siblings had ADHD. If one parent had ADHD, 34% of the siblings had ADHD
[Pauls 1986].

[0032] The observed fact that ADHD parents have an ADHD child does not prove that the problem is genetic. The question can be asked, was the behavior learned? One answer to the question is to look at siblings and half-siblings, both raised in the same environment. If ADHD
is learned, the frequency should be the same for both. In actuality, half-siblings who have only half the genetic similarity show a significantly decreased frequency of ADHD
[Safer 1973]. In a study of twins [Willerman 1973], it was found that if one identical twin had ADHD, the other also had ADHD. If non-identical twins had ADHD, only 17% of the other twins had ADHD.
This finding was confirmed in other independent studies.

[0033] Another approach is to look at the parents of ADHD children given up for adoption. If ADHD is a genetic disorder, the parents of children with the problem should show a higher frequency of ADHD, antisocial personality, or alcoholism than the adopting parents. In a study of ADHD children of ADHD parents who gave up their children at birth for adoption, it was found that the rate of antisocial personality, alcoholism, and ADHD was higher in the biological parents than in the adopting parents. In a study by Comings et at.
[Comings 1991], the investigators found that the Al allele of the dopamine D2 receptor gene was present in 49%
of a sample of ADHD children compared to only 27% of controls.

[0034] To some extent, people with ADHD can learn to cope. They can avoid situations that generate stress; avoid crowds and noisy environments; give themselves plenty of time and avoid tight deadlines; and avoid rapid changes in their environment. The most destructive coping strategy is self-medication with alcohol or drugs. Such substances give the illusion that they are making life easier and more pleasant, for the symptoms seem to disappear. But the addiction quickly takes over, and life becomes a nightmare [Faraone 1991].
Then, when they withdraw from alcohol or drugs, the ADHD problems return in full force.

[0035] The inherent tragedy here is that the ADHD person may be genetically at risk of developing an addiction. Possibly the same neurochemical imbalance in their brain that produces ADHD also produces a predisposition to addiction, Tourette syndrome, ODD, CD, and as well as other related behaviors [Comings 1991; Blum II 1996; Miller 2008].
Behavioral and electrophysiological diagnostic tools

[0036] The following assists in the understanding the need for behavioral and electrophysiological diagnostic tools and treatment thereof of ADHD.

[0037] In clinical settings, a number of rating scales have been utilized with mixed results for the diagnosis of ADHD. One set of commonly employed tools involves the Conners' Rating Scales [Conners 2006], an instrument that uses observer ratings and self-reports to help evaluate problem behaviors in children and adolescents. Another alternative utilized in a clinical setting to assist in properly diagnosing ADHD is a continuous performance test called T.O.V.A. (Test of Variables of Attention) [TOVA 2006]. The latest version of this test is computerized, and it is designed to identify a minimum of four types of attention failures. One type is marked by omission abnormalities when the patient's attention failure is measured by missing information. The problem with relying on this parameter is that omission errors have been associated with a wide spectrum, including schizophrenia and petit mal seizure disorder, in which the attention failure is marked by neurological absences. The second type is marked by commission abnormalities associated with impulsive behaviors, and it frequently is co-morbid with a cluster of anxiety disorders (e.g., obsessive compulsive behaviors, panic, and oppositional defiance). The third type is marked by abnormalities in reaction time. It is believed that this type is not specific for ADHD and is associated with slowing of response times as seen in classic psychomotor retardation, dysthymia, and major depression. The fourth type is response variability (either fast or slow). Of all the above, this is more closely related to ADHD
and is also common in adults that have obesity, alcoholism, and/or craving disorders. It is this fourth type that is most likely linked to dopaminergic deficiency. However, it is important to note that results of T.O.V.A. tests have been associated with a number of false negative diagnoses.

[0038] To test the relationship between response variability and dopaminergic deficiency, a study was embarked upon by the inventor of the present invention that examined associations between dopamine D2receptor variants and T.O.V.A. scores (including response variability), as well as a measure of brain electrical activity, the P300 event related brain potential [Noble 1994]. 100 patients entering the PATH Medical Clinic, New York City, were studied for a variety of medical complaints including neuropsychiatric, cardiovascular, and oncological problems. Each patient was given the T.O.V.A. and brain electrical activity mapping. When all the T.O.V.A. scores were summed (<1 standard deviation above the norm) a significant linear trend was observed, whereby increasing abnormal T.O.V.A. scores were associated with a percentage of patients having an abnormal prolonged P300 latency (normal being 300 plus age). Moreover, significant differences were found between the various scores (inattention, impulsivity, response time, and variability) and abnormal P300 latency [Braverman 2006]. In contrast, only variability response was significant for P300 amplitude. This site-specific association may be attributable to dopaminergic variants. It is well known that the DRD2 gene Al allele is associated with abnormalities in both the P300 latency and amplitude in well-screened alcoholics [Noble 1994]. Thus, the clinicians must be cautious in terms of utilizing only one diagnostic tool to diagnose ADHD. In additional embodiments, the methods can be employed together with one or more additional tests, including both Conners and T.O.V.A., as well as gene testing.
ADHD is a common disorder

[0039] Estimates of the frequency of the various types of ADHD, based on population surveys, have shown variable results. A fairly common range is illustrated in TABLE II.
The advantage of population based samples, in contrast to clinic based samples, is that individuals in the community who have not sought medical attention are included in the sample. In most locations, far fewer than 16%, and usually less than 4%, of the children in a given population receive treatment for a form of ADHD. This is contrary to the notion that the ADHD is over diagnosed and overtreated. In fact, the majority of symptomatic children are not treated. Other associated disorders include CD and ODD.
TABLE II
Prevalence of various types of ADHD in the general population Hyperactive/Impulsive 2.6 Inattentive 8.8 Combined 4.7 Total 16.1 M/F ratio 4:1 [Wolraich 1998].

[0040] While many of these children can be handled by appropriate teaching methods and do not require treatment, these figures suggest that ADHD-I at least, is probably under diagnosed and under treated. While the sex ratio for ADD-H and ADHD-C is 4:1, the sex ratio for ADD-I is closer to 1:1. This is a reflection of the fact that ADHD in girls tends to present as the inattentive type while boys are more likely to present as the hyperactive-impulsive or combined type. Symptoms of hyperactivity and impulsivity in school are obvious and disruptive, whereas symptoms of inattention are more subtle and non-disruptive; consequently, boys tend to be diagnosed and treated more than girls.
ADHD is a spectrum disorder

[0041] It has been known for many years that if an individual inherits enough genes to develop any given behavioral disorder, the risk of developing a second behavioral disorder is two to four times greater than for the general population. This is likely due to the fact that different behavioral disorders share some gene variants in common. Thus, the more a person exceeds the required threshold number of gene variants, the greater the likelihood of developing more than one behavioral problem, thus the term spectrum disorders. Some of the most common coexisting or comorbid spectrum disorders seen in individuals with ADHD are ODD, CD, major depressive disorder, anxiety disorders, OCD, bipolar disorder, learning disorders, and substance abuse disorder including alcoholism and drug addiction.
ADHD has lifelong effects

[0042] Having pointed out that much of the poor outcome in ADHD children is due to the comorbid presence of CD, the studies of a 1985 report of Howell and coworkers [Howell 1985]
should still be presented. While this longitudinal study did not distinguish between ADHD and ADHD plus CD, it did something no other study has done. The study compared the outcome of three groups of children instead of just ADHD children and controls.
Children in the early grade school years were evaluated on a continuum of ADHD symptoms and divided into three groups, those scoring in the highest 10% (ADHD group) those in the lowest 10%
(low ADHD
group) and the rest ("normal" group). They were then re-evaluated after they graduated from high school.

[0043] The remarkable finding was that in virtually every aspect of their life the low ADHD
group performed best, the normal individuals were intermediate and the ADHD
group performed worst. This should not be taken to suggest that children with ADHD
always underachieve. Again, it should be emphasized there are many examples in which the restless, workaholic, always-have-to-be-doing-something, I-need-to-be-my-own-boss, characteristics of ADHD subjects result in very successful lives. Thus, in the right combination, some of the symptoms that are being discussed in a negative light can be used to great advantage [Comings 2005].
Genes and ADHD

[0044] It has been proposed that ADHD is a polygenic disorder due to the additive effect of genes affecting dopamine, norepinephrine, serotonin, GABA, and other neurotransmitters [see, e.g., Comings 12000]. Some of the specific loci involved are dopamine genes DRD1, DRD2, DRD4, DRD5, dopamine¨beta-hydroxylase, and the dopamine transporter;
norepinephrine and epinephrine genes ADRA2A, ADRA2C, PNMT, norepinephrine transporter, MAOA, catechol-O-methyltransferase (COMT); serotonin genes TD02, HTR1A, HTR1DA, serotonin transporter; GABA genes GABRB3; androgen receptor and other genes. This model is consistent with present knowledge about ADHD including the following [Comings II 2000]:
(a) the increased frequency of ADHD in the relatives of ADHD probands, (b) the presence of a wide spectrum of comorbid behaviors (depression, anxiety, learning, CD, ODD, and substance abuse disorders) in ADHD probands and their relatives on both parental sides, (c) the close relationship to Tourette syndrome, (d) the failure to find the genes for Tourette syndrome using linkage analysis, (e) the brain imaging studies showing hypometabolism of the frontal lobes, (f) the relationship between dopamine D2receptor density and regional blood flow, (g) the correlation between cerebral spinal fluid homovanilic acid levels and DRD2 genotypes, (h) the correlation between tics and receptor density in Tourette syndrome, (i) the dopamine D2 motor hyperactivity of dopamine transporter and dopamine D3 receptor gene knockout mice, (j) the Le Moat 1991 and Shaywitz 1976 dopamine deficiency animal models of ADHD, (k) the norepinephrine models of ADHD, (1) the failure to explain ADHD
on the basis of any single neurotransmitter defect, (m) the response of ADHD
to dopamine and alpha-adrenergic agonists, (n) the small percentage of the variance of specific behaviors accounted for by each gene, and numerous other aspects of ADHD.

[0045] In one study [Brookes 2006], 1,038 single-nucleotide polymorphisms (SNPs) spanning 51 candidate genes involved in the regulation of neurotransmitter pathways, particularly dopamine, norepinephrine, and serotonin pathways, in addition to circadian rhythm genes, revealed interesting results. The analyses involved within-family tests of association in a sample of 776 DSM-IV ADHD combined-type cases ascertained for an international multi-centre ADHD gene project. The researchers found nominal significance with one or more SNPs in 18 genes, including the two most replicated findings in the literature:
DRD4 and DAT1.
Gene-wide tests, adjusted for the number of single nucleotide polymorphisms (SNPs) analyzed in each gene, identified associations with the following: serotonergic (TPH2), adrenergic (ARRB2, ADRB2), dopaminergic (DAT1), neurotransmitter metabolizing (MAO), pituitary development (HES1), enkephalinergic (PNMT), and synapase regulator (synaptophysin II [syp II]) gene polymorphisms.
Molecular genetics and ADHD

[0046] ADHD is not caused by poor parenting, family problems, poor teachers or schools, too much TV, food allergies or excess sugar. Instead, it is caused by biological and genetic factors that influence neurotransmitter activity in certain parts of the brain [Wallis. 2008]. Studies at the National Institute of Mental Health using positron emission tomography (PET) scans to observe the brain at work have shown a link between a person's ability to pay continued attention and the level of activity in the brain. In people with ADHD, the brain areas that control attention used less glucose, indicating that they were less active. It appears from this research that a lower level of activity in some parts of the brain may cause inattention and other ADHD
symptoms.
A dopamine model

[0047] Defects in dopamine metabolism have long been implicated in the etiology of ADHD.
There are many reasons for this [Comings 1991; Kirley 2003]: (1) Le Moat 1991 showed that lesions of the dopaminergic neurons of the ventral tegmental area resulted in hyperactivity, hyper-responsivity, poor response to stress, and a spectrum of other disorders. (2) Shaywitz 1976 showed that chemical destruction of frontal lobe dopaminergic neurons shortly after birth produced an animal model of ADHD that responded to stimulants. (3) Catecholamines in the cerebral spinal fluid (C SF) of children with Tourette syndrome showed significantly lower levels of homovanillic acid. Some have also reported low CSF homovanillic acid in children with ADHD, while more recent studies have shown a positive correlation between CSF
homovanillic acid and scores of hyperactivity and conduct disorder ADHD. (4) Brain imaging studies showed defects in the dopamine-rich striatum in ADHD [Krause 2003].
(5) Furthermore, brain imaging studies indicate hypofunctionality of the frontal lobes in ADHD
and Tourette syndrome. (6) Other studies have shown hyperactivity in knockout mice missing the dopamine transporter or DRD3 genes. (7) Further evidence demonstrated the effectiveness of dopaminergic agonists in the treatment of ADHD [la Fougere 2006]. The following are some of the specific dopaminergic genes that have been implicated in the etiology of ADHD.
See FIGS. IA-1B.

Dopamine D2 receptor gene (DRD2)

[0048] The first molecular genetic studies of ADHD were reported in 1991 by Comings et at.
following the discovery by Blum and associates linking DRD2 Al allele to severe alcoholism [Blum III 1990; Comings 1991]. They examined the prevalence of the Taq Al allele of the DRD2 gene in impulsive, compulsive, addictive behaviors. These results suggested that genetic variants at the DRD2 locus played a role in a range of impulsive, compulsive, addictive disorders, including ADHD. The prevalence of the D2A1 allele in these disorders ranged from 42.3 to 54.5%. While it was clear that the DRD2 was not a major gene causing these conditions, since it was usually not even present in half of the cases, it was also clear that the prevalence of the D2A1 allele was approximately two-fold higher than in controls.

[0049] An indication of the importance of the dopamine D2 receptor in Tourette syndrome comes from SPECT (single photon emission computed tomography) studies of monozygotic twins discordant for tic severity. For example, differences in D2receptor density in the head of the caudate nucleus predicted differences in phenotypic severity with the almost unheard of correlation coefficient of r = 0.99, p < 0.001, suggesting that striatal dopamine D2receptor density accounted for 98% of the variance of tic severity [Wolf 1996].

[0050] In a subsequent study of individuals who smoked at least one pack of cigarettes per day and were unable to quit on their own, it was found that 48% carried the Taq I
D2A1 allele and had trouble sleeping. The prevalence Taq I D2A1 allele was even higher in a large group of pathological gamblers. It was also verified in post-traumatic stress disorder.

[0051] The initial interpretation was that the DRD2 gene modified the effect of an unidentified major gene for Tourette syndrome and ADHD. The important feature is that the DRD2 gene accounted for less than 5% of the variance of a number of quantitative traits relating to ADHD
and other behaviors. As the number of genes showing a similar modest effect were identified (see below), and as the failure to find any gene causing a major effect continued, we and others began to favor the polygenic mode of inheritance for ADHD, Tourette syndrome, and other psychiatric disorders [Noble 2003].

[0052] Moreover, recent work indicates that other RDS related behaviors including adolescent excessive internet video gaming are significantly associated with the DRD2 Al allele.
Interestingly, in both Borderline Personality Disorder as well as healthy individuals, the presence of the DRD2 Al allele correlated with the commission of more time violations on a test sensitive to the integrity of the frontal lobes, and especially in the healthy subjects, with longer execution times. This work suggests that the DRD2 gene could exert an effect on executive functioning controlled by frontal brain systems.
Dopamine D2 receptors, regional blood flow, and response to methylphenidate

[0053] In reviews of published articles that examined striatal dopamine transporter (DAT) density in ADHD patients, Krause et al. [Krause 2003; Krause 2006] cited numerous neuroimaging findings of elevation in that region. Additionally, Krause et al.
[Krause 2005] investigated whether availability of striatal DAT may have an influence on the response of adult ADHD patients to methylphenidate, as measured with SPECT scans. They found that ADHD individuals with low DAT availability failed to respond to methylphenenidate therapy.

[0054] Also using SPECT technology, Volkow and colleagues [Volkow 1995]
examined the relationship between the effects of methylphenidate on regional blood flow and the density of dopamine D2 receptors in various regions of the brain. In some subjects, methylphenidate increased regional blood flow while in others it decreased blood flow. The changes in the frontal, temporal and cerebellar metabolism were related to the density of D2receptors ¨ the higher the density the greater the increases in blood flow. Methylphenidate decreased the relative metabolic activity of the basal ganglia. These results are consistent, indicating that genetic defects in dopamine metabolism, resulting in a hypo-dopaminergic state in the limbic system and frontal lobes, result in a compensatory increase in dopaminergic activity in the basal ganglia, and that methylphenidate reverses these through a combination of enhancing brain dopamine activity by inhibition of the dopamine transporter, with a secondary decrease in dopaminergic activity in the basal ganglia and a decrease in basal ganglia blood flow.

[0055] These studies are also consistent with the results of Castellanos and colleagues [Castellanos 1998] showing a positive correlation between the response to methylphenidate and CSF levels of homovanillic acid, a metabolite of dopamine whose levels in the CSF are related to D2 receptor density.

[0056] One of the intriguing aspects of the Volkow 1995 study was the finding that methylphenidate consistently increased cerebellar metabolism, despite the paucity of D2 receptors in this structure. This is consistent with the increasing evidence that the cerebellum plays an important role in attention, learning, and memory.

[0057] In support of the above studies, Noble et at. [Noble 1997] also found an association between the Taq I D2A1 genotype and regional blood flow. Using PET and 18F-deoxyglucose, they observed that Al carriers showed a significantly lower relative glucose metabolism in the putamen, nucleus accumbens, frontal and temporal gyri and medial prefrontal, occipito-temporal and orbital cortices than those with the A22 genotype. Noble and Blum and associates had previously shown that Taq I D2A1 carriers had a significantly decreased dopamine D2 receptor in the basal ganglia. In a different PET study, Farde et at.
[Farde 1997] observed a significant decrease in dopamine D2 receptor density in individuals with detachment, social isolation, and lack of intimate friendships.
Heterosis at the DRD2 gene

[0058] Within the past decade, Comings et at. have examined the role of the DRD2 gene in a range of behaviors, and have noticed a persistent tendency for quantitative behavioral scores to be highest in 12 heterozygotes, lowest in 11 homozygotes, and intermediate in 22 homozygotes. Most often the relationship is 12>>22>11 or 12 >>11 = 22. The presence of a greater effect in heterozygotes than either homozygote is termed heterosis.

[0059] Strong support for heterosis at the DRD2 gene comes from research by Jonsson et at.
1996. They compared the CSF levels of the dopamine breakdown product homovanillic acid to the DRD2 genotype using the Tag I D2A1 polymorphism. There was a remarkable similarity to the profile for the inattention score in the Tourette syndrome subjects, with 12 heterozygotes showing the highest inattention score, and the Sinsson 1996 subjects who were heterozygotes had the lowest levels of CSF homovanillic acid. The highest levels of homovanillic acid were seen in the 11 homozygotes, with the levels in 22 homozygotes being intermediate. This suggests that subjects with the lowest levels of CSF
homovanillic acid had the most symptoms of ADHD. While this is consistent with some studies showing a significantly lower level of CSF homovanillic acid in children with ADHD and Tourette syndrome, it seems to conflict with the studies of Castellanos 1998 showing a positive correlation among some aspects of symptom severity and response to methylphenidate, and CSF homovanillic acid levels. However, these studies only examined children with ADHD and did not include controls. While it is yet to be studied, those individuals carrying the Tag I D2A1 allele may not be those who respond best to methylphenidate.

[0060] Recent PET and SPECT studies of the relationship between the Tag I
genotypes of the DRD2 gene and number of dopamine D2 receptors in the striatum, support the effect of molecular heterosis producing the lowest level of D2 receptors in 12 heterozygotes, the highest levels in 11 homozygotes and high levels in 22 homozygotes. These combined results provide the first illustration of a direct connection between a genotype, a neurotransmitter level (dopamine), and ADHD symptoms. While the studies of homovanillic acid levels in ADHD
have been variable, these results suggest that some ADHD is associated with low CSF levels of homovanillic acid and this in turn is related to heterozygosity for the DRD2 Tag I alleles. In contrast, Noble 1994 found that the lowest level of D2 density was found in the 11 homozygote.

[0061] In an attempt to further our understanding of the role of genes in ADHD
as a subtype behavior of RDS, a research study was performed involving generational family-based subjects genotyped for three dopaminergic genes.
Dopamine transporter gene

[0062] The dopamine transporter is responsible for moving dopamine across the presynaptic membrane back into the nerve cell from which it was released. In a recent review of the literature [Comings 2005], the DAT lgene was considered an important candidate gene for ADHD, because it is a major dopaminergic gene, and it is the site of action of methylphenidate and dexedrine, widely used in the treatment of ADHD. These stimulant medications inhibit the transport process, resulting in an increase in synaptic dopamine. Cook 1995 reported a significant positive association between the 10 allele of the DAT1 gene and 49 cases of ADHD
using the haplotype relative risk procedure. When eight cases of undifferentiated ADD were added, the results were unchanged. Using the family based haplotype relative risk procedure, Gill 1997 also found a significant preferential transmission of the 10 allele in 40 parent-child sets.

[0063] Comings 2001 also observed a significant association between the 10 allele and ADHD
and a range of other behavioral variables in Tourette syndrome probands. For example, in a group of 352 Tourette syndrome probands and control subjects, the mean cumulative ADHD
score based on counts of DSM-III ADHD criteria, was 25.44 for those that were homozygotes versus 20.42 for those that were not 10/10 homozygotes. Consistent with these results, Malison 1995, using SPECT imaging, reported a significant increase in the level of dopamine transporter protein in the striatum of Tourette syndrome subjects compared to controls.

[0064] Knockout mice missing the DAT1 genes are very hyperactive. While these mice show increased motor activity in open field studies, they were dramatically more hyperactive in smaller spaces. This suggests that the stress of being confined contributes to the hyperactivity.
This is analogous to the contribution of the DRD2 gene to both hyperactivity and poor response to stress in humans. Studies of the DAT knockout mice showed a five-fold increase in brain dopamine levels, down-regulation of D2 receptors, uncoupling of D2receptor function, and a 57% decrease in body size. While the presence of hyperactivity in the absence of DAT1 genes may seem to conflict with the above results, suggesting hyperactivity in the presence of increased activity of the human DAT1 gene, the presence of compensatory and plastic changes in other dopaminergic systems occurring when major defects of the dopamine transporter are present from conception, may account for the differences. Alternatively, because of complex inhibitory and stimulatory loops, both increases and decreases (too much or too little) in the amount of receptor or transport protein may result in similar symptoms. In contrast to the above results, LaHoste 1996 did not find a significant increase in the frequency of the DAT1 10 allele in their group of ADHD subjects. They showed, instead, an increase in the prevalence of the 7 allele of the DRD4 gene.

[0065] Waldman 1998 have also examined the role of the DAT1 gene in ADHD. In their first report, they used the transmission disequilibrium technique (a family-based association test to examine the linkage between a genetic marker and a trait) to determine the role of the DAT1 gene in ADHD, ODD and CD in 123 families. They found a significant association between the DAT1 10 allele and ODD, CD, and hyperactivity-impulsivity. After controlling for the level of hyperactivity-impulsivity symptoms, the association with ODD
and CD was no longer significant, suggesting that the relationship between childhood ODD and CD was mediated through its effect on hyperactivity and impulsivity. In a subsequent report, they examined 74 ADHD probands, 79 siblings, and a control sample of 49 twins. The mean scores for hyperactivity/impulsivity, inattentiveness, ODD, CD, and depression and dysthymia were progressively lower across these three groups. The inclusion of parents allowed family based association studies. It was of interest that the greatest power came from discordant siblings.
Twelve of the 41 siblings were discordant for the high risk DAT1 alleles (10 repeat), and in 10 of these, the siblings carrying the high risk alleles had significantly higher scores for hyperactive-impulsive symptoms and for inattentive symptoms. The transmission disequilibrium test also showed association and linkage of the 10 repeat with the combined form of ADHD. Of the 10 studied, eight were positive for a role of the DAT1 gene in ADHD.

[0066] Winsberg 1999 examined the correlation between response to methylphenidate treatment and DATlgenotype in a series of 30 African-American children with ADHD. Of the responders, only 31% carried the 10/10 genotype while 86% of the non-responders carried the 10/10 genotype, suggesting that in this population 10/10 homozygosity is associated with a poor response to stimulant treatment. Although these interesting pharmacogenomic findings have been confirmed by some [Kirley 2003], they await further replication.

[0067] A prior meta-analysis concluded that there is a significant association between ADHD
and dopamine system genes, such as DAT1, but even more robust with regard to the DRD4 and DRD5 genes [Li 2006]. Of further interest, Mill 2006 presented evidence that polymorphisms in the DRD4 and DAT1 genes were associated with variation (compromise) in intellectual functioning among children diagnosed as having ADHD. The same authors further showed from longitudinal evidence that these polymorphisms predicted which children with ADHD
were at greatest risk for poor adult prognosis [see also Heiser 2004; Madras 2005; Larsson 2006].
Generational association studies of dopaminergic genes in RDS probands and family members

[0068] At this point, it is important to emphasize that polymorphisms of the dopamine D2 receptor gene are associated with RDS and a number of related impulsive, addictive, and compulsive behaviors. In an unpublished study with Joel Lubar from the University of Tennessee, Knoxville, and Judith Lubar at the Southwestern Biofeedback and Neurobehavioral Clinic, the authors genotyped 51 subjects from four generations derived from two multiply-affected families All subjects were genotyped for three of the dopaminergic genes (DRD2, DATi, and DBH). In this study 80% of all subjects (40 of 50) carried the DRD2 Taq 1A1 allele.
When compared with "highly screened controls called super controls" (1/30 or 3.3% of the controls carried the DRD2 Al allele), a highly significant association was observed. It is noteworthy that as the number of RDS behaviors increased in the subjects, the prevalence of the DRD2 Al allele also increased. This work allows one to utilize genotyping to access certain personality factors such as ADHD and other related RDS behaviors.
The role of polygenes as a diagnostic indicator

[0069] While there is much evidence for the involvement of the dopaminergic system and specific genes involved and treatment possibilities, other models including genes related to dopamine D4, dopamine D5, dopa decarboxylase gene, norepinephrine, adrenergic 2a and 2c, COMT, tryptophan 2,3-dioxygenase, and GABA should also be considered [see Comings 20011.

[0070] In terms of polygenic inheritance, others have observed that several genes are associated with ADHD, including DAT1, DBH, DRD4, DRD5 and 5HT1B. Moreover, linkage studies using affected sibling pairs and extended pedigrees have identified several chromosomal regions containing putative ADHD susceptibility genes. Chromosomal regions highlighted by replication across studies are accumulating evidence with increasing sample size and include chromosomes 5p13, 6q12, 16p13, and 17p11 [Arcos-Burgos 2004;
Asherson 2005].

[0071] Kent et at. [Kent 2005] found evidence to support the hypothesis that the gene BDNF
(brain-derived neurotrophic factor) located at 11p13 and encoding for a precursor peptide (proBDNF), is associated with ADHD. Additionally, Turic and others [Turic I
2005] found evidence that genes related to glutamate function such as SLC1A3 (Solute Carrier Family 1, member 3) in a family based study may contribute to susceptibility to ADHD.
Other genes that have been associated with ADHD susceptibility include the calcyon gene (DRD11p) [Laurin 2005]; beta hydroxylase gene [Inkster 2004]; NR4A2 gene [Smith 2005]; and the COMT gene [Turic 11 2005].

[0072] Understanding the genetic meaning of carrying the DRD2 and DAT1 polymorphisms to assist in the diagnosis of ADHD is of paramount importance. One must first consider the difference between a single-gene-single-cause concept as in the situation with Cystic Fibrosis or Huntington's disease, or even Muscular Dystrophy, compared to multiple genes involved in complex disorders such as ADHD [Comings 1996]. With regard to psychiatric genetic anomalies such as schizophrenia, bipolar disorder, Alzheimer disease, RDS, among other related behaviors, dopaminergic allelic presence does not necessarily diagnose the disorder. On the other hand if an individual carries one or more of these associated polymorphisms, the scientific evidence supports a diagnosis of predisposition and high probability that the subject is at greater risk for having the disorder in question or may at some time in the future present with typical clinical symptoms. Moreover, we do know from the use of Bayes theory to predict outcomes, that carriers born with the dopamine D2 receptor Al allele have a 74% chance that they would have RDS behavior [Blum III 1990; Blum III 1996].

[0073] This predisposition diagnosis is typical in that the same parameters and limitations that have been placed on other diseases such as so called oncogenes for cancer, as well as the gene for diabetes, are the same for RDS. There is a tendency in psychiatric genetics to think in terms of the single-gene¨single-disorder model and to lose sight of the fact that polygenic inheritance has its own distinct set of rules. There are some distinct issues that are relevant to the genetics of ADHD. A major point is that polygenic inheritance is far more complex than single gene inheritance. The ultimate truth about the role of any one gene involved in polygenic inheritance may require a summation across many different studies and the examination of the additive genes involved in both childhood and adult ADHD and their comorbid disorders.
Once the gene map of ADHD is uncovered, it will provide improved diagnosis (prevent over-diagnosis) and treatment (non-drug, non-addictive, efficacious and safe) of these very common disorders and demonstrate for all but the most recalcitrant critic that these are real biological entities.

[0074] Comings [Comings 2001] summarized the role of multiple genes in ADHD
providing a polygenic model for the etiology of ADHD including the following salient points modified herein:
= Multiple dopaminergic genes and other genes each contributing to a small percentage of the total variance.
= The co-morbidity between ADHD and substance abuse (common sets of genes affecting the frontal lobes and the reward pathways).
= The central role of the frontal lobes and ADHD and related disorders.
= The evidence from animals that defects of dopamine metabolism in the frontal lobes are important in ADHD.
= The secondary hypersensitivity of dopamine receptors in the basal ganglia leading to hyperactivity and tics.
= The close relationship between ADHD and Tourette syndrome.
= The role of norepinephrine genes in learning and language disorders involving parietal lobe attention centers.
= The role of serotonergic and GABAergic genes in the reward cascade.
= The role of enkephalinergic genes as they relate to dopamine release.

[0075] As stated above, attention deficit/hyperactivity disorder (ADHD) is a highly heritable childhood behavioral disorder affecting 5% of children and 2.5% of adults.
Common genetic variants contribute substantially to ADHD susceptibility, but no variants have been robustly associated with ADHD. However a 2019 genome-wide association meta-analysis of 20,183 individuals diagnosed with ADHD and 35,191 controls that identifies variants surpassing genome-wide significance in 12 independent loci, finding important new information about the underlying biology of ADHD. Associations are enriched in evolutionarily constrained genomic regions and loss-of-function intolerant genes and around brain-expressed regulatory marks.
Analyses of three replication studies: a cohort of individuals diagnosed with ADHD, a self-reported ADHD sample and a meta-analysis of quantitative measures of ADHD
symptoms in the population, support these findings while highlighting study-specific differences on genetic overlap with educational attainment. Strong concordance with GWAS of quantitative population measures of ADHD symptoms supports that clinical diagnosis of ADHD
is an extreme expression of continuous heritable traits.

[0076] This analysis reveals the following list: ADRA2A, COMT, DRD1, DRD4, HTR1B, LPHN3, MAOA, NOS1, SLC6A2/NET1, SLC6A3/DAT1, SLC6A4/5HTT, SNAP25, and TPH2. This is not an exhaustive lists because there could be even more gene polymorphisms that could contribute to the overall phenotype ADD/ADHD types.
Treatments for ADHD

[0077] The website for the American Academy of Child and Adolescent Psychiatry (AACP) states, "The goal of any type of ADHD treatment is to reduce symptoms and help the child function at a normal level. Treatment may include medication, therapy, family support, educational support, or a combination of these" [AA CP ADHD Guide].

[0078] Symptoms of ADHD often are treated with drugs, an approach that conforms to mainstream medical and regulatory guidelines. Common conventional therapies are targeted at suppressing symptoms by inhibiting, blocking, or (conversely) amplifying production, reception and/or disposal of various neurotransmitters (e.g., serotonin with selective serotonin reuptake inhibitors). These therapies carry some associated undesirable risks.
When pharmacological agents are administered to children, reactions often are polarized. Some critics object to the prospect of millions of children who are prescribed controlled substances that are potentially addictive and injurious to the brain. Others support the opportunity given to people diagnosed with ADHD (including adults) for receiving the clinical attention they deserve, including effective treatment, despite side effects. Whatever treatment option is chosen, in order to provide an effective outcome for individuals with ADHD, it is important to recognize the following: First, individuals may be born with a predisposition to behavioral symptoms associated with ADHD and other RDS disorders. Second, these various RDS
disorders involve complex interactions of neurotransmitters. Third, ADHD may be the precursor for multiple addictions including alcohol, drugs, food, sex, and even gambling. And fourth, there is an association between a severe form of alcoholism and defects in the D2 gene in the reward area of the brain and other dopaminergic genes (i.e., the dopamine transporter gene and the dopamine beta-hydroxylase gene) [Blum 11996; Pohjalainen 1998; Bowirrat 2005].
While the genetics are far more complex than these genes, carriers of dopaminergic gene variants, or genetic deficits including these or other gene subsets, can develop behavioral manifestations of RD S.
Pharmacological treatments Stimulants

[0079] Pharmacological treatment with psychostimulants is the most widely studied treatment for ADHD. Stimulant treatment has been used for childhood behavioral disorders since 1933.
While stimulant treatments are highly effective for 75%-90% of children with ADHD, at least four separate psychostimulant medications consistently reduce the core features of ADHD in literally hundreds of randomized controlled trials: methylphenidate, dextroamphetamine, pemoline, and a mixture of amphetamine salts.

[0080] These medications are metabolized, leave the body fairly quickly, and work for up to four hours. (Widely prescribed drugs, Concerta and Adderall, are believed to last 6-12 hours.) These medications have their greatest effects on symptoms of hyperactivity, impulsivity, and inattention, and the associated features of defiance, aggression, and oppositionality. They also improve classroom performance and behavior, promoting increased interaction with teachers, parents and peers.

[0081] Many double blind studies over the past 40 years have uniformly agreed that stimulants such as methylphenidate, dextro-amphetamine, as well as other substances, are very effective in the treatment of 70%-80% of children and adults with ADHD. One of the myths of ADHD
is that ADHD children show a paradoxical effect of being calmed by stimulants, while "normal" individuals are stimulated by them. However, studies have shown that the activity levels are decreased and attention levels are increased by stimulants in individuals with and without ADHD. The difference is that since the levels of hyperactivity and inattention are much higher in ADHD subjects, the improvement is relatively much greater, giving the impression that they respond, while non-ADHD subjects do not.

[0082] It is known that like the effect of serotonin re-uptake inhibitors on the serotonin transporters, stimulants inhibit both dopamine transporters and norepinephrine transporters.
Since hyperactivity is related to excessive dopamine activity in the basal ganglia, on the surface this would seem to make things worse instead of better. However, FIGS. 2A-2D
show how the stimulants work in ADHD. This results in a decrease in dopaminergic stimulation in the basal ganglia where the density of the D2 receptors is the highest. Of particular interest, there are few D2 receptors in the prefrontal lobe. Thus, dopamine activity in the prefrontal lobes is increased instead of decreased. This is consistent with a model of ADHD in which there is too little dopamine in the frontal lobes, resulting in symptoms of prefrontal lobe deficits and too much dopamine in the basal ganglia, such as motor hyperactivity and not infrequently, motor tics.
The stimulants correct both the prefrontal lobe deficiency of dopamine and the basal ganglion excess of dopamine.

[0083] Despite this indication of how uniquely suited stimulant medications are to the treatment of ADHD, they can have undesirable side effects such as insomnia, decreased appetite, stomachaches, headaches, and jitteriness. Some children may develop tics. Other side effects include rebound hyper-activity and psychosis. Pemoline has been associated with hepatotoxicity, so monitoring of liver function is necessary. Additionally, many still worry that ADHD children are receiving a form of "speed." Studies have shown that in order to obtain a "high," stimulants need to reach the brain very quickly. This requires intravenous or nasal administration, or the use of doses that exceed therapeutic recommendations.
At therapeutic oral doses, the stimulants used for treatment of ADHD do not cause a euphoric high. Perhaps the best indicator of this is that one of the hardest parts of the treatment for ADHD children is to get them to take their medication. This, however, is no guarantee that these drugs are never abused. It is important that children and adolescents with ADHD not have free access to their medications, since it is clear that these drugs can be abused when given nasally, or intravenously, or in high doses. Keeping track of the medications helps to ensure that they are not sold for illicit use.

[0084] In addition to the use of stimulant medications, a second class of medications that works primarily on norepinephrine pathways (e.g., clonidine, guanifacine, and atomoxetine, can also be quite effective [Perwien 2006; Spencer 2001; Spencer 2006]. Clonidine and guanifacine are especially useful in treating individuals with both ADHD and chronic tics (Tourette syndrome) since clonidine and guanifacine uniquely treat both ADHD and Tourette syndrome. Physicians are often reluctant to treat individuals with both ADHD and Tourette syndrome with stimulants, for fear of exacerbating the tics. However, consistent with the above mechanism of action of stimulants, significant exacerbation is unusual, and often the tics are unchanged or improve following stimulant treatment [Gadow 1992].

[0085] As discussed and described above, it is often the comorbid disorders such as ODD and CD that cause the greatest distress to parents of children with ADHD. Though experience of the inventor, the atypical neuroleptics such as risperidone, olanzipine, and molindone, can be very effective in the treatment of these comorbid conditions.

Other medications

[0086] For children with ADHD who do not respond to stimulants (10%-30%) or cannot tolerate the side effects, other alternatives may be available. However, other competitive solutions also have been tried with mixed results. The anti-depressant bupropion has been found to be superior to placebo, although the response is not as strong as stimulants. Well-controlled trials have shown tricyclic antidepressants to be superior to placebo but less effective than stimulants. Reports of sudden death of a few children in the early 1990s on the tricyclic compound desipramine led to great caution with the use of tricyclics in children.

[0087] Clonidine can be an effective mode of treatment of ADHD. Since it also treats motor and vocal tics, it is especially useful in the treatment of Tourette-syndrome children who also have ADHD. Neuroleptics have been found to be occasionally effective, yet the risk of movement disorders, such as tardive dyskinesia, makes their use problematic.
Lithium, fenfluramine, or benzodiazepines have not been found to be effective treatments for ADHD, nor have serotonin re-uptake inhibitors such as fluoxetine.

[0088] Another drug being tested is lisdexamfetamine dimesylate (LDX), a therapeutically inactive prodrug in which d-amphetamine is covalently bound to 1-lysine, a naturally occurring amino acid. Pharmacologically active d-amphetamine is released from LDX
following oral ingestion. A phase 2, randomized, double-blind, placebo- and active-controlled crossover study compared the efficacy and safety of LDX (30, 50, or 70 mg) with placebo, with mixed amphetamine salts (extended-release 10, 20, or 30 mg) included as a reference arm of the study, in 52 ADHD children aged 6-12 years in an analog classroom setting [Biederman 2007] . The primary efficacy measure was the Swanson, Kotkin, Agler, M-Flynn, and Pelham (SKAMP) Rating Scale. Secondary efficacy measures included the Permanent Product Measure of Performance (PERMP) Derived Measures, and the Clinical Global Impression (CGI) Scale.
Results showed that LDX treatment significantly improved scores on SKAMP-deportment, SKAMP-attention, PERMP-attempted, PERMP-correct, and CGI-improvement from baseline.
Adverse events were similar for both active treatments. In a laboratory classroom environment, LDX significantly improved ADHD symptoms versus placebo in school-age children with ADHD.
Over prescription of stimulants

[0089] Concerns have been raised that children, particularly active boys, are being overdiagnosed with ADHD and thus are receiving psychostimulants unnecessarily.
While recent reports suggest that overprescription and overdiagnosis are unfounded, a more important issue is that fewer children (2%-3% of school-aged children) are being treated for ADHD than suffer from it [Faraone 2003]. Treatment rates are lower for selected groups such as girls, minorities, and children receiving care through public service systems.
However, there have been major increases in the number of stimulant prescriptions since 1989, and methylphenidate is being manufactured at 2.5 times the rate of a decade ago [Comings 2005].
Nonetheless, some of the increase in use may reflect inappropriate diagnosis and treatment. In one study, the rate of stimulant use was twice the rate of parent-reported ADHD, based on standardized psychiatric interview [Comings 2005].

[0090] Moreover, in 2005, 4.4% of children (ages 0-19) and 0.8% of adults (ages 20 and older) used ADHD medications. During the period between 2000 and 2005, treatment prevalence increased rapidly (11.8% per year). In addition, global use of ADHD
medications rose threefold from 1993 to 2003, whereas global spending (US$2.4 billion in 2003) rose 9-fold, adjusting for inflation.

[0091] While a number of stimulant drugs are utilized to treat ADHD symptoms, a promising alternative approach involves a natural polypharmacy directed at correction and control of neurochemistry and dopamine D2receptor proliferation, while minimizing side effects [Blum 2006]. It also involves a noninvasive DNA based diagnostic test for the determination of predisposing sets of polymorphic genes and their interaction (known as epistasis). However, this treatment approach also can be accomplished in combination with known FDA-approved stimulants.
The polypharmacy and multigenetic approach

[0092] The polygenic inheritance of ADHD and its comorbid disorders makes the need for more than one medication (polypharmacy) easy to understand as an optimal treatment of complex cases. Thus, the involvement of variant dopamine genes resulting in ADHD and tics may require dopaminergic agonists (methylphenidate or dexedrine) or antagonists (haloperidol, pimozide, risperidone, etc.). The involvement of variant norepinephrine or epinephrine genes resulting in ADHD and behavioral dysregulation, may require a2-adrenergic agonists (e.g., clonidine, guanifacine, venlafaxine, and atomoxetine). The involvement of variant serotonergic genes resulting in depression and anxiety disorders may require selective serotonin re-uptake inhibitors (e.g., fluoxetine, sertraline, paroxetine, and fluvoxamine). The involvement of other variant genes resulting in ODD, CD, and other behaviors, may require medications such as valproic acid, molindone, and risperidone [Biederman 11 2007].

[0093] Parents often raise legitimate concerns when their children are placed on any medication, let alone two or more. Explaining ADHD in terms of a complex set of different genes affecting different neurotransmitters often helps to moderate these concerns. To this effect, the utilization of certain specific ingredients, which modify the brain reward cascade by targeting serotonergic, opioidergic, GABAergic, catecholaminergic, and acetylcholinergic pathways, can alter behaviors known to be associated with ADHD. Such a polypharmacy approach may include the utilization of a nutraceutical (nutrigenomic) approach targeted at enhancing slow dopamine release in the nucleus accumbens. One available nutraceutical combines the following: select amino acids (5-hydroxytyptophan, dl-Phenylalanine, 1-tyrosine, 1-glutamine); herbals (Rhodiola rosea, ferulic acid, ginkgo-biloba, ginseng, gotu kola, huperzine A); trace metals (chromium and zinc); macro minerals (calcium, magnesium, manganese); vitamins (ascorbic acid, d-alpha tocopheryl, niacin, pyridoxal-phosphate, B12);
and co-factors (biotin, folic acid, dimethylethanoiamine).

[0094] In an early study of healthy volunteers, a combination of amino acids and herbals showed positive results [Defrance 1977]. The researchers observed a significant amplitude enhancement of the P300 component of the cognitive event-related brain potentials, as well as improvement in cognitive processing speeds, after the subjects were given the amino acid formula. These improvements in normal volunteers are consistent with the observed facilitation of recovery of individuals with RDS, including substance abuse and ADHD, as well as with dopaminergic involvement in short term memory [Kimberg 1997].
Combination therapy: a long-term approach

[0095] The short-term safety and tolerability of psychostimulants has been reasonably well studied, and the risks associated with these compounds in the short term are generally acceptable. However, the amount of long-term effectiveness and safety data related to psychostimulant therapy is relatively small. Data that do exist suggest that long-term treatment with psychostimulants in appropriately diagnosed patients may be associated with salutary effects as well as relatively modest risks.

[0096] ADHD has an early onset and requires an extended course of treatment.
Research is needed to examine the long-term safety of treatment and to investigate whether other forms of treatment could be combined with psychostimulants to lower their doses as well as to reduce other problem behaviors found with ADHD. One important treatment goal is to develop a side-effect free natural product to augment psychostimulants with the ultimate goal of reducing the need for psychostimulants. Core to this therapeutic strategy would be to develop a product with mechanisms of action that would both increase the release of dopamine, and induce long term D2 receptor proliferation. Such a novel combination therapy would mimic stimulants like methylphenidate, and thus an additive and/or synergistic action should be expected.

[0097] In fact, combined therapies might be used to improve overall functioning by targeting symptoms of disorders that often accompany ADHD, such as CD, SUD, and learning disabilities. Moreover, because stimulants also can be abused, and because children with ADHD are at increased risk for substance-seeking behavior, concerns have been raised about the potential for abuse of stimulants by children taking medication or migrating to other drugs of abuse. In this regard, critics argue that many children who do not have true ADHD are medicated as a way to control non-ADHD disruptive behaviors. However, ironically, organizations like CHADD recommend the use of stimulants for school-aged children, comparing the pills to eyeglasses, braces, and allergy medications [CHADD
2007].

[0098] In this regard, the use of methylphenidate and amphetamine, which are the mainstay for the treatment of ADHD, has raised concerns because of their reinforcing effects. That is, the chronic use of these medicines during childhood or adolescence might induce changes in the brain that could facilitate drug abuse in adulthood. This concern was recently addressed by Thanos and colleagues [Thanos 2007]. They measured the effects of chronic treatment (8 months) with oral methylphenidate (1 or 2 mg/kg), which was initiated in periadolescent rats (postnatal day 30). Following this treatment, the rats were tested on cocaine self-administration. In addition, at 2 and 8 months of treatment, the investigators measured dopamine D2receptor (D2R) availability in the striatum using [(11)C]raclopride microPET
(muPET) imaging.

[0099] Animals treated for 8 months with 2 mg/kg of methylphenidate showed significantly reduced rates of cocaine self-administration at adulthood compared to vehicle-treated rats. D2R
availability in the striatum was significantly lower in rats after 2 months of treatment with methylphenidate (1 and 2 mg/kg) but significantly higher after 8 months of methylphenidate treatment than in the vehicle-treated rats. In vehicle-treated rats, D2R
availability decreased with age, whereas it increased in rats treated with methylphenidate. Because low D2R levels in the striatum are associated with a propensity for self-administration of drugs both in laboratory animals and in humans, this effect could underlie the lower rates of cocaine self-administration observed in the rats given 8 months of treatment with methylphenidate. Eight-month treatment with oral methylphenidate beginning in adolescence decreased cocaine self-administration (1 mg/kg) during adulthood which could reflect the increases in availability observed at this life stage since D2R increases are associated with reduced propensity for cocaine self-administration.

[0100] In contrast, 2-month treatment with methylphenidate started also at adolescence decreased D2R availability, which could raise concern that at this life stage, short treatments could possibly increase vulnerability to drug abuse during adulthood. These findings indicate that methylphenidate effects on D2R expression in the striatum are sensitive not only to length of treatment but also to the developmental stage at which treatment is given.
The authors suggested that future studies evaluating the effects of different lengths of treatment on drug self-administration are required to assess optimal duration of treatment regimes to minimize adverse effects on the propensity for drug self-administration in humans.

[0101] Little is known about the risks and characteristics of ADHD patients who misuse or divert their stimulant medications. As part of a 10-year longitudinal study of youths with ADHD, Wilens et at. [Wilens 2006] evaluated medication diversion or misuse in a young ADHD population. The investigators used structured psychiatric interviews for diagnosis, and a self-report questionnaire regarding medication use in medicated subjects with ADHD
compared with controls without ADHD receiving psychotropic medications for non-ADHD
treatment. Of 98 subjects receiving psychotropic medications (mean age of 20.8 5 years), 55 (56%) were ADHD subjects and 43 (44%) were controls receiving medications for other purposes. The authors found that 11% of the ADHD group reported selling their medications compared with no subjects in the control group. An additional 22% of the ADHD
group reported misusing their medications compared with 5% of the control subjects, and that those with CD or SUP accounted for the misuse and diversion. A minority of subjects reported escalating their doses and concomitant use with alcohol and drugs.
Interestingly, the data indicated that the majority of ADHD individuals, particularly those without CD
or SUP, used their medications appropriately. The authors' findings also highlighted the need to monitor medication use in ADHD individuals with CD or SUP and to carefully select agents with a low likelihood of diversion or misuse in this group. Based on this report, therefore, it may be helpful for individuals to be tested for candidate genes to determine a predisposition of substance seeking-behavior.

[0102] In terms of methamphetamine utilization, there are concerns related to its genotoxic effects. A study was conducted to investigate the index of cerebral and peripheral DNA damage in young and adult rats after acute and chronic methylphenidate exposure. The researchers used single cell gel electrophoresis (Comet assay) to measure early DNA damage in hippocampus, striatum, and total blood, as well as a micronucleus test in total blood samples. Their results showed that methylphenidate increased the peripheral index of early DNA damage in young and adult rats, which was more pronounced with chronic treatment and in the striatum compared to the hippocampus. Neither acute nor chronic methylphenidate treatment increased micronucleus frequency in young or in adult rats. Peripheral DNA damage was positively correlated with striatal DNA damage. These results suggest that methylphenidate may induce central and peripheral early DNA damage, but this early damage may be repaired [Andreazza 2007].

Alternative treatments

[0103] Because of the concern about the use of medications, many parents seek alternative methods of treatment of ADHD. Most clinicians agree that a combination of medication and behavioral modification is the most effective approach to the treatment of ADHD, even though the medications appear to contribute greater benefits. Children with ADHD may also respond well to adjustments in their education setting, e.g., taking advantage of an individualized educational plan. The following are some additional alternatives that are most often used.
EEG biofeedback

[0104] Electroencephalographic (EEG) biofeedback usually utilizes the feedback from a game played on a TV screen to attempt to train the brain to alter the levels of alpha, beta and delta waves. This tactic has the advantage that no drugs are used and appears to be effective in some cases. The disadvantage is that it can be expensive. Satisfactory double blind testing and evaluation of its effectiveness has been very difficult, and the effects may not be long lasting.
Herbal remedies

[0105] Numerous herbal remedies have been used by ADHD patients. Sometimes they seem to be effective, sometimes not, or their effectiveness may be short-lived.
Many parents turn to them because they are perceived as "natural." However, to be effective they must contain an active ingredient for which the identity is usually not known. In addition, a wide range of other ingredients may be present that are not necessary or may cause unknown, or worse yet, undesirable side effects. As physicians and pharmacologists, we suggest that using pure medications with known doses, known mechanisms of action and known side effects is always preferable.
Nutraceuticals

[0106] In contrast to herbal remedies, the composition of other nutraceuticals is more precisely known. They usually consist of amino acids, vitamins, minerals, and other known compounds.

Because they are closer to food substances than drugs, they do not have the same rigorous restrictions by the Federal Drug Administration that drugs do and can be purchased over the counter. Because a number of amino acids have direct or indirect effects on the levels of specific neurotransmitters, they have the potential of helping to control some of the symptoms of ADHD. Nutraceuticals have the advantage that double-blind studies [Blum I
1988] can be easily carried out. It is not unlikely that some combinations of the above compounds, carefully tested in double-blind studies, may play a supporting role in controlling some of the symptoms of ADHD [Blum 11988; Blum 11 1988; Blum 2000; Blum 2006; Blum 1991; Chen 2004].
Diets and vitamin supplements

[0107] Still further prior studies compared attentional abilities of two groups of children with ADHD, one group after treatment with Ritalin, and the other after treatment with dietary supplements (a mix of vitamins, minerals, phytonutrients, amino acids, essential fatty acids, phospholipids, and probiotics). Both groups showed significant improvement.
These findings support the effectiveness of food supplement treatment in improving attention and self-control in children with ADHD and suggest food supplement treatment of ADHD may be of equal efficacy to Ritalin treatment.
Dopaminergic and serotonergic releaser combination therapy

[0108] Another treatment for substance-seeking behaviors consists of agonist therapy (not antagonist therapy). This strategy involves administration of stimulant-like medications (e. g. , monoamine releasers) to alleviate withdrawal symptoms and prevent relapse. A
major limitation of this approach is that many candidate medicines possess significant abuse potential because of activation of mesolimbic dopamine neurons in central nervous system reward circuits. Previous data suggest that serotonin neurons can provide regulatory influence over mesolimbic dopamine neurons. Thus, it might be predicted that the balance between dopamine and serotonin transmission is important to consider when developing medications with reduced stimulant side effects.

[0109] Several issues have been disclosed and discussed herein related to the putative mechanisms related to ADHD behaviors. The potential development of dual dopamine/serotonin releasers for the treatment of substance use disorders has otherwise been discussed [Rothman 2007]. In this regard, there is evidence supporting the existence of a dual deficit in dopamine and serotonin function during withdrawal from chronic cocaine or alcohol abuse [Rothman 2007].

[0110] Rothman and associates further summarize studies that have tested the hypothesis that serotonin neurons can dampen the effects mediated by mesolimbic dopamine. For example, it has been shown that pharmacological manipulations that increase extracellular serotonin attenuate stimulant effects produced by dopamine release, such as locomotor stimulation and self-administration behavior.

[0111] Finally, they discuss their recently published data about PAL-287 (naphthylisopropylamine), a novel non-amphetamine dopamine/serotonin-releasing agent that suppresses cocaine self-administration but lacks positive reinforcing properties [Hiebel 2007].

[0112] Using this concept, the Synaptamine Complex (5G8839)TM was developed [Chen 2004]. TABLE III provides details about the ingredients of the synaptamine complex, as well as proposed brain targets and behavioral changes.
Table III
Synaptamine complex review Supplemental Restored Addictive Amino acid Expected ingredient brain substance deficiency behavior chemical abuse symptoms change D-Phenyl al anine or Enkephalins Heroin, Most reward Reward DL-Phenylalanine Endorphins alcohol, deficiency stimulation.
marijuana, syndrome (RD S) Anti-craving.
sweets, conditions sensitive Mild Supplemental Restored Addictive Amino acid Expected ingredient brain substance deficiency behavior chemical abuse symptoms change starches, to physical or antidepression.
chocolate, emotional pain. Mild improved tobacco Crave comfort and energy and pleasure. Desire focus. D-certain food or Phenylalanine drugs. D- promotes pain phenylalanine is a relief, increases known pleasure.
enkephalinase inhibitor.
L-Phenylalanine or Norepinephrin Caffeine, Most RD S Reward L-Tyrosine e Dopamine speed, conditions. stimulation.
cocaine, Depression, low Anti-craving.
marijuana, energy. Lack of Anti-depression.
aspartame, focus and Increased chocolate, concentration. energy.
alcohol, Attention-deficit Improved tobacco, disorder. mental focus.
sweets, starches L-Tryptophan or 5 Serotonin Sweets, Low self-esteem. Anti-craving.
hydroxytryptophan alcohol, Obsessive/compulsi Anti-depression.
(5HTP) starches, ye behaviors. Anti-insomnia.
ecstasy, Irritability or rage. Improved marijuana, Sleep problems. appetite control.
chocolate, Afternoon or Improvement in tobacco evening cravings, all mood and Negativity. Heat other serotonin intolerance. deficiency Fibromyalgia, SAD symptoms.
(winter blues).
GABA (Gamma- GABA Valium, Feeling of being Promotes amino butyric alcohol, stressed-out. calmness.
acid) marijuana, Nervous. Tense Promotes tobacco, muscles. Trouble relaxation.
sweets, relaxing.
starches L-Glutamine GABA (mild Sweets, Stress. Mood Anti-craving, enhancement) starches, swings. anti-stress.
Fuel source alcohol Hypoglycemia. Levels blood for entire sugar and mood.
brain GABA (mild enhancement).
Fuel source for entire brain.

[0113] To assist in amino-acid nutritional therapy, the use of a multi-vitamin/mineral formula is recommended. Many vitamins and minerals serve as co-factors in neurotransmitter synthesis.
They also serve to restore general balance, vitality and well-being to the reward deficiency syndrome (RDS) patient who typically is in a state of poor nutritional health.
The utilization of GABA is limited due to its polar nature and ability to cross the blood brain barrier and glutamate is used in a low level only to prevent over-inhibition of enkephalin breakdown and subsequent inhibition of gabaergic spiny neurons of the sub stania nigra.

[0114] As early as 2008 XV World Congress of Psychiatric genetics held in New York City, a number of new gene loci presented at the congress included: Nosl exon lf-VNTF;
NTF3;
CNTFR; NTRK2; rs2242447 (noradrenergic transporter gene); HTR1B; beta-tubulin 111;
MAP2; ADRA2A; and linkage to chromosome 3, 9, and 16 among others. Many of these risk alleles have been incorporated in the panels of the present invention.
Novel Nutrigenomic Investigations

[0115] Attention Deficit-Hyperactivity Disorder (ADHD) is a serious neuropsychiatric condition that affects approximately 8.7% of the adolescent population [Visser 2014] and 4.4%
of the adult population [Kessler 2006] in the United States. The world-wide prevalence of ADHD is estimated at 5.29% [Polanczyk 2007]. The disorder is characterized by impairments in attention, self-regulation (hyperactivity-impulsivity) and executive function [Barkley 1997], as well as problems with working memory (WM) [Barkley 1997; Alderson 2013;
Lenartowicz 2014]. These impairments cause significant underachievement in academic, occupational and interpersonal areas of life [Weiss 1993].

[0116] Prior research has focused on the contribution of neuroanatomic, neurotransmitter and genetic mechanisms to the pathophysiology of ADHD. Neuroimaging research reveals that ADHD is associated with dysfunction in prefrontal, cingulate and striatal brain regions [Bush 1999; Bush 2005].

[0117] Bledsoe et at. [Bledsoe 2013] using MRI, reported that ADHD children had reduced right, rostral anterior cingulate cortical thickness, which correlated with parental-teacher reports of the severity of their ADHD symptoms. Thus, children with thinner cortical tissue were rated as having more severe ADHD symptoms. These findings are consistent with Makris et at. [Makris 2007], who used structural MRI and found cortical thinning in the attention and executive function network of ADHD adults. They noted reduced cortical thickness in the right dorsolateral prefrontal, anterior cingulate and inferior parietal areas.

[0118] Dopamine (DA) neurons project from the substantia nigra to the basal ganglia, and support motor function, and they also project from the ventral mesencephalon to the forebrain, and play a vital role in motivation, reward, learning and WM [Girault 2004].
Synaptic levels of dopamine are influenced by the dopamine transporter (DAT), a protein that removes dopamine from the synapse and absorbs it into the presynaptic neuron. DAT
density was 70%
greater in adults with ADHD, compared to controls [Dougherty 1999], which was consistent with lower post synaptic levels of dopamine in ADHD. Using Single Photon Emission Computerized Tomography (SPECT), with ([Tc-99m]TRODAT-1), a radio-ligand specific for0 the dopamine transporter, researchers demonstrated that treatment with methylphenidate reduced DAT receptor binding sites which produced clinical improvement in ADHD
adults [Dresel 2000].

[0119] These researchers also reported increased striatal DAT receptor binding, in adult ADHD, which was reduced by methylphenidate treatment. [Krause 2000]. Volkow et at.
[Volkow 2001], working with Positron Emission Tomography (PET) and [11C]raclopride, a D2 receptor radio-ligand, and normal participants, demonstrated that oral methylphenidate increased extracellular dopamine in the brain. This is significant in light of the ability of methylphenidate to block the dopamine transporter and amplify the effect of dopamine in supporting attention [Volkow 2001]. Notably, Badgaiyan et at. [Badgalyan 2015]
in a PET

study reported that ADHD adults have reduced tonic (resting) release and increased phasic, task-related release of dopamine in the right caudate nucleus. The increase in phasic DA release may compensate for the reduced tonic baseline, as may be needed, in ADHD.
These studies collectively support the role of dopamine dysregulation in the pathophysiology of ADHD.

[0120] Dopamine plays a central role in cognitive functions [Nieoullon 2002]
and WM
[Takahashi 2012] and hippocampal D2 receptor availability correlates positively with memory, executive function and verbal fluency [Takahashi 2007]. Aalto et at. [Aalto 2005] used [11C]FLB457, a high affinity dopamine2 receptor ligand, in a PET study of vigilance and WM
with normal participants. They found that their visual, WM task increased D2 receptor binding in the bilateral, ventrolateral frontal cortex as well as in the left medial temporal cortex, including the amygdala and hippocampus. This result is consistent with Kemppainen et at.
[Kemppainen 2003] who reported reduced hippocampal D2 receptor activity in Alzheimer's Disease patients, which correlated with the patients' reduced memory and naming performance. The consistency in these two studies lies in the relationship between D2 receptor activation and WM performance. Seamans et at. [Seamans 2004] discuss the complex role of dopamine as a neuromodulator of prefrontal, cognitive function and suggest that dopamine modulates the breadth of information stored in prefrontal, WM networks.

[0121] Blum et at. [Blum I 1996] proposed that ADHD and other impulsive and compulsive disorders, including substance use disorder (SUP), may be subsumed under Reward Deficiency Syndrome (RDS). RDS disorders have a common proposed etiology in reduced sensitivity of the brain's reward circuitry to pleasurable environmental stimulation. Blum et at.
[Blum I 1996] attributed RDS to a variant in a gene (Al allele) that codes the DA D2 receptor.
Individuals with the Al allele have a decreased density of D2 receptors and a relative inability to experience pleasure associated with ordinary stimulation and activities.
The relationship between Al allele of the D2 receptor, RDS and ADHD is summarized in Blum I
1996.

Individuals with two copies of the Al allele are at greater risk for alcoholism, SUP and ADHD
compared to those with one or no Al alleles. The occurrence of the Al allele of the D2 receptor gene correctly classified 77% of alcoholics, while the absence of this allele accurately classified 72% of non-alcoholic research participants [Blum III 1990]. Comings, et at.
[Comings 1991]
found that the Al, D2 receptor allele was significantly more prevalent in ADHD
(46.2%) as compared to controls (24.5%). This allele was also more prevalent in patients with alcoholism, Tourette' s Syndrome and autism. ADHD is clearly a polygenic disorder and has a heritability of .75 [Takahashi 2005]. Although no single gene has a large, deterministic role, genes affecting dopamine activity make an important contribution to the expression of ADHD.

[0122] Blum et at. [Blum I 2016; Blum 11 2016] have summarized Blum' s work, over the last fifty years, in developing a pro-dopamine, nutrigenomic complex (KB220Z), to stabilize the activity of dopamine in RDS. This compound, which includes dopamine precursor amino acids and natural ingredients, was designed to correct the dysregulation of dopamine in the brain's mesolimbic reward system. The goal for this compound is dopamine homeostasis, relieving the cravings associated with addiction and the drive to action associated with impulsive disorders, including ADHD, that are subsumed under RDS. Previously, DeFrance et at.
[DeFrance.
1977], using normal participants, had demonstrated that an amino acid mixture increased the amplitude of the P300 evoked potential and decreased processing time in spatial orienting and continuous performance tests. The improvement in function in this early study is similar to that which would be expected from KB220Z with RDS disorders.

[0123] Consumption of KB220Z is expected to improve cognitive functions that utilize the D2 receptor. McLaughlin et at. [McLaughlin 2017] reported substantial improvements in semantic verbal fluency in an elderly male with mild memory impairment, following consumption of KB220Z. The participant demonstrated an average, baseline Animal Naming score of 14, placing him in the 30th percentile, for his age and gender, for semantic verbal fluency.

Following a single, acute dose of KB220Z the patient's verbal fluency score increased to 19 animal names, placing him in the 76%. Following discontinuance of KB220Z, the patient's verbal memory performance decreased to 13 animal names. Notably, with resumption of KB220Z, the patient's verbal fluency score improved to 24 animal names, placing his verbal semantic memory performance in the 98th percentile. These clinical results suggest that activation of the participant's D2 receptors was associated with a dramatic improvement in his semantic verbal fluency.

[0124] Steinberg et at. [Steinberg 2016] used quantitative EEG analysis (QEEG) and Low-resolution Electromagnetic Tomography (LORETA) to measure the effect of KB220Z
on WM
and brain electrical activity in an elderly adult with ADHD. The subject had long-standing issues with attention, organization, difficulties with sustained mental effort and procrastination.
He was tested during baseline and following consumption of a daily dose (1 ounce) of KB220Z.
The tasks included a resting EC condition as well as a WM task. The WM task required the participant to memorize and repeat random sequences of letters and numbers, in ascending order (numbers) and alphabetical order (letters). QEEG for the EC, resting condition, revealed that KB220Z produced an increase in absolute power in theta (4-8 Hz), alpha (8-12 Hz) and beta (12-25 Hz) frequency bands, in frontal (Fz), central (Cz) and parietal (Pz), midline locations. Right hemisphere EEG activity also increased in these bands in frontal (F4) and parietal (P4) locations.

[0125] LORETA was also used to study the sources of the EEG signals. LORETA
produces measures of current source density, which are estimates of current flow originating from the Brodmann areas of interest. Data are expressed in standard deviation (z score units) that represent current flow for the participant compared to an age and gender matched, normative EEG database. During the WM task we observed that KB220Z increased the z scores for theta (4-7 Hz), low alpha (8-10 Hz) and high alpha (11-13 Hz) current source density in the anterior cingulate, dorsal cingulate and posterior cingulate cortices (Brodmann areas 32, 24 and 31, respectively). Thus, pro-dopamine regulation increased EEG activity in areas of the brain known to support attention and WM. With KB220Z, the participant demonstrated an improvement in WM, from 13 to 14 correct letter-number sequences. This improvement in WM is consistent with the KB220Z's effect in activating DA and EEG activity, in the attention and WM areas of the brain. It has been confirmed by the present inventor that the participant in Steinberg 2016 had the Al allele of the D2 receptor gene.

[0126] In McLaughlin 2017 and Steinberg 2016, the participants were tested under baseline (no active agent, no placebo) and treatment (KB220Z) conditions, and the participants were aware of which condition was being used on each trial, raising the possibility of expectancy effects. The purpose is to replicate these findings using a double-blind, placebo-controlled, cross-over study, which protects the data from experimenter bias. The use of a placebo control allows for assessment of the physiological effects of KB220Z, beyond the impact of the participant's expectations [Jensen 2002; Onton 2005]
The development of the genetic addiction risk score (GARS)

[0127] There are many examples of association studies involving genes and polymorphisms especially of the ten reward genes measured in the GARS test. Alleles of genes that affect the synthesis, degradation, reception, and transport of neurotransmitters (like enkephalin, serotonin, GABA, and dopamine) and enzymes like Monoamine Oxidase (MOA) A and COMT in the reward pathway of the brain were candidates for selection for the GARS test if they contributed to hypodopaminergia. Comings and Blum proposed that functional defects in the genes for these neurotransmitters result in dopamine deficit, later identified as RDS. They suggested that individuals with hypodopaminergia are at risk for seeking reward from RDS
behaviors to satisfy their lack of natural rewards [Comings I 2000]. Some examples of functional research and studies that associated RDS behaviors with the risk alleles of the genes and second messengers that comprise the GARS test follow.
The development of precision addiction management

[0128] Blum et at. proposed that KB220Z; a mild neuro-nutrient formulation, can stimulate the D2 receptor [Blum I 2008; Blum II 2008]. Blum's group advocates instigating dopamine release, to cause the induction of D2-directed mRNA to direct the proliferation of D2 receptors in the brain [Blum 2012]. For example, DNA-directed compensatory overexpression of the DRD2 receptors (a form of gene therapy), resulted in a significant reduction in alcohol craving behavior in alcohol-preferring rodents [Thanos 2005] and self-administration of cocaine [Thanos 2008]. Thus, based on this model enhanced bioavailability of D2 receptors was shown to reduce craving.

[0129] Studies that showed rats with depleted neostriatal dopamine display increased sensitivity to dopamine agonists estimated to be 30-100 x in the 6-hydroxydopamine (6-OHDA) rotational model [Mandel 1993] were the basis for "denervation supersensitivity"
[Blum 2009]. Denervation supersensitivity was identified as a putative physiological mechanism to help explain the enhanced sensitivity following intense acute dopaminergic D2 receptor activation in the face of hypodopaminergia. In contrast, promotion of long-term (chronic low vs. intense acute) dopaminergic activation by lower potency dopaminergic repletion therapy has been shown in clinical and neuro imaging studies, to be an effective modality when used to treat RDS behaviors including Substance Use Disorders (SUP), Attention Deficit/Hyperactivity Disorder (ADHD), obesity and others, without side effects [Blum 12016; Blum 11 2016].

[0130] An unprecedented number of clinical studies validating this patented nutrigenomic technology for re-balancing brain chemistry, and optimizing dopamine sensitivity and function have been published. Here clinicians and neuroscientists are encouraged to continue to embrace the concept of "dopamine homeostasis" and search for safe, effective, validated and authentic means to achieve a lifetime of recovery, instead of reverting to anti-dopaminergic agents. Anti-dopaminergic agents are doomed to fail because chronic use continues and exacerbates hypodopaminergia while promoting powerful D2 agonists like bromocriptine and L-Dopa compromises needed balance [Blum 2017]. Increased resting state functional connectivity as well as an increased neuronal recruitment has been demonstrated acutely on fMRI in both animal and humans within 15 (animal) to 60 (human) minutes post administration of neuro nutrient therapy. These studies demonstrate neuronal dopamine firing in brain areas involved in reward processing and possible induced neuroplasticity and "dopamine homeostasis" [Blum 2015; Febo 2017]. The comprehensive role of dopamine as the mesolimbic system neurotransmitter underlying motivational function supports the low potency dopaminergic repletion therapy concept; sustainable, mild activation of D2 receptors [Blum 2012].

[0131] Accordingly, a need still remains for behavioral and electrophysiological diagnostic tools for ADHD and for the behavioral management thereof.
SUMMARY OF THE INVENTION

[0132] The present invention relate to methods and kits for assessing severity index for genetic risks of attention deficit/hyperactivity disorders and behavioral management thereof.

[0133] In general, in one embodiment, the invention features a method that includes the step of obtaining a biological sample from a subject. The method further includes the step of performing an allelic analysis on the biological sample to detect the presence of a plurality of predetermined alleles in the biological sample. The plurality of predetermined alleles include one or more alleles of BAIAP2. The one or more BAIAP2 alleles include one or more of polymophisms rs8079626, rs8079781, rs7210438, and rs4969385. The plurality of predetermined alleles further include one or more alleles of CHRNA4. The one or more CHRNA4 alleles include one or more of polymorphisms rs2273505 and rs3787141.
The plurality of predetermined alleles further include one or more alleles of COMT. The one or more COMT alleles include one or more of polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680. The plurality of predetermined alleles further include one or more alleles of DAT1. The one or more DAT1 alleles include one or more of polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15). The plurality of predetermined alleles further include one or more alleles of DBH. The one or more DBH alleles include polymorphism rs1108580. The plurality of predetermined alleles further include one or more alleles of DRD1. The one or more DRD1 alleles include polymorphism rs4532. The plurality of predetermined alleles further include one or more alleles of DRD2. The one or more DRD2 alleles include polymorphism rs1800497. The plurality of predetermined alleles further include one or more alleles of DRD3. The one or more DRD3 alleles include polymorphism rs6280. one or more alleles of DRD4. The one or more DRD4 alleles include one or more of polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR
in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3). The plurality of predetermined alleles further include one or more alleles of DRD5. The one or more DRD5 alleles include one or more of polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele. The plurality of predetermined alleles further include one or more alleles of HTR1B. The one or more HTR1B alleles include polymorphism rs6296. The plurality of predetermined alleles further include one or more alleles of OPRM1. The one or more OPRM1 alleles include polymorphism rs1799971. The plurality of predetermined alleles further include one or more alleles of SNAP25. The one or more SNAP25 alleles include one or more of polymorphisms rs66039806, rs362549, rs362987 and rs362998. The plurality of predetermined alleles further include one or more alleles of HTTLPR. The one or more HTTLPR alleles include polymorphism rs25531. The plurality of predetermined alleles further include one or more alleles of MAOA. The one or more MAOA alleles include polymorphism 30 bp repeat (promoter, X chrom only). The plurality of predetermined alleles further include one or more alleles of GABRB3. The one or more GABRB3 alleles include polymorphism CA-Repeat (171-201 bases, X chrom only).

[0134] Implementations of the invention can include one or more of the following features:

[0135] The method can further include identifying each of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample. The method can further include assigning a count for each of the alleles in the plurality of pre-determined alleles that was detected to be present in the biological sample. The count for a particular allele is the number of the particular allele detected to be present in the biological sample. The method can further include determining a risk score for the subject based upon the count.
The risk score can be the sum of the counts. The risk score can identify a severity of the genetic risk for attention deficit/hyperactivity disorder (ADHD). The method can further include administering treatment based upon the severity of the genetic addition risk identified for the subject. The treatment can include providing precision addictive/behavioral management based upon the severity of the genetic risk for ADHD. The precision addictive/behavioral management can include providing one or more neuro nutrient treatments that are targeted to the subject based upon the identification of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample.

[0136] The plurality of predetermined alleles can further include at least one of: (i) the one or more DRD4 alleles further includes polymorphism rs4646983; (ii) one or more alleles of SEMA3A, wherein the one or more SEMA3A alleles includes polymorphism rs139438618;
and (iii) one or more allelles of Amelo.

[0137] The plurality of predetermined alleles can include two or more alleles of BAIAP2. The two or more BAIAP2 alleles can include two or more of the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385. The plurality of predetermined alleles can further include two or more alleles of CHRNA4. The two or more CHRNA4 alleles can include the polymorphisms rs2273505 and rs3787141. The plurality of predetermined alleles can further include two or more alleles of COMT. The two or more COMT alleles can include two or more of the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680. The plurality of predetermined alleles can further include two or more alleles of DAT1. The two or more DAT1 alleles can include two or more of the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15). The plurality of predetermined alleles can further include two or more alleles of DRD4. The two or more DRD4 alleles can include two or more of the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3). The plurality of predetermined alleles can further include two or more alleles of DRD5. The two or more DRD5 alleles can include the polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/
148-bp allele. The plurality of predetermined alleles can further include two or more alleles of SNAP25. The two or more SNAP25 alleles can include two or more of the polymorphisms rs66039806, rs362549, rs362987 and rs362998.

[0138] The one or more BAIAP2 alleles can include all of the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385. The one or more CHRNA4 alleles can include all of the polymorphisms rs2273505 and rs3787141. The one or more COMT alleles can include all of the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680. The one or more DAT1 alleles can include all of the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15). The one or more DRD4 alleles can all of include the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3). The one or more DRD5 alleles can include all of the polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele. The one or more SNAP25 alleles can include all of the polymorphisms rs66039806, rs362549, rs362987 and rs362998.

[0139] The plurality of predetermined alleles can further include (i) the DRD4 allele of the polymorphism rs4646983; the SEMA3A allele of polymorphism rs139438618; and (iii) an allelle of Amelo.

[0140] In the plurality of predetermined alleles, the one or more BAIAP2 alleles only include the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385. In the plurality of predetermined alleles, the one or more CHRNA4 alleles only include the polymorphisms rs2273505 and rs3787141. In the plurality of predetermined alleles, the one or more COMT
alleles only include the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680. In the plurality of predetermined alleles, the one or more DAT1 alleles only include the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15). In the plurality of predetermined alleles, the one or more DBH alleles only include the polymorphism rs1108580. In the plurality of predetermined alleles, the one or more a DRD1 alleles only include the polymorphism rs4532. In the plurality of predetermined alleles, the one or more DRD2 alleles only include the polymorphism rs1800497. In the plurality of predetermined alleles, the one or more DRD3 alleles only include the polymorphism rs6280. In the plurality of predetermined alleles, the one or more DRD4 alleles only include the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3). In the plurality of predetermined alleles, the one or more DRD5 alleles only include the polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele. In the plurality of predetermined alleles, the one or more HTR1B alleles only include the polymorphism rs6296. In the plurality of predetermined alleles, the one or more OPRM1 alleles only include the polymorphism rs1799971. In the plurality of predetermined alleles, the one or more SNAP25 alleles only include the polymorphisms rs66039806, rs362549, rs362987 and rs362998. In the plurality of predetermined alleles, the one or more HTTLPR alleles only include the polymorphism rs25531. In the plurality of predetermined alleles, the one or more MAOA
alleles only include the polymorphism 30 bp repeat (promoter, X chrom only). In the plurality of predetermined alleles, the one or more GABRB3 alleles only include the polymorphism CA-Repeat (171-201 bases, X chrom only).

[0141] In the plurality of predetermined alleles, the one or more BAIAP2 alleles only include the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385. In the plurality of predetermined alleles, the one or more CHRNA4 alleles only include the polymorphisms rs2273505 and rs3787141. In the plurality of predetermined alleles, the one or more COMT
alleles only include the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680. In the plurality of predetermined alleles, the one or more DAT1 alleles only include the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15). In the plurality of predetermined alleles, the one or more DBH alleles only include the polymorphism rs1108580. In the plurality of predetermined alleles, the one or more a DRD1 alleles only include the polymorphism rs4532. In the plurality of predetermined alleles, the one or more DRD2 alleles only include the polymorphism rs1800497. In the plurality of predetermined alleles, the one or more DRD3 alleles only include the polymorphism rs6280. In the plurality of predetermined alleles, the one or more DRD4 alleles only include the polymorphisms rs1800955, rs4646983, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3). In the plurality of predetermined alleles, the one or more DRD5 alleles only include the polymorphisms VNTR
in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele. In the plurality of predetermined alleles, the one or more HTR1B alleles only include the polymorphism rs6296.
In the plurality of predetermined alleles, the one or more OPRM1 alleles only include the polymorphism rs1799971. In the plurality of predetermined alleles, the one or more SNAP25 alleles only include the polymorphisms rs66039806, rs362549, rs362987 and rs362998. In the plurality of predetermined alleles, the one or more HTTLPR alleles only include the polymorphism rs25531. In the plurality of predetermined alleles, the one or more MAOA
alleles only include the polymorphism 30 bp repeat (promoter, X chrom only).
In the plurality of predetermined alleles, the one or more GABRB3 alleles only include the polymorphism CA-Repeat (171-201 bases, X chrom only).

[0142] The plurality of predetermined alleles further include the SEMA3a allele that is only the polymorphism rs139438618, and at least one of the alleles of Amelo.

[0143] The plurality of predetermined alleles can only include (a) the one or more alleles of BAIAP2; (b) the one or more alleles of CHRNA4; (c) the one or more alleles of COMT; (d) the one or more alleles of DAT1; (e) one or more alleles of DBH; (f) the one or more alleles of DRD1; (g) the one or more alleles of DRD2; (h) the one or more alleles of DRD3; (i) the one or more alleles of DRD4; (j) the one or more alleles of DRD5; (k) the one or more alleles of HTR1B; (1) the one or more alleles of OPRM1; (m) the one or more alleles of SNAP25; (n) the one or more alleles of HTTLPR; (o) the one or more alleles of MAOA; and (p) the one or more alleles of GABRB3.

[0144] The plurality of predetermined alleles can only include (a) the one or more alleles of BAIAP2; (b) the one or more alleles of CHRNA4; (c) the one or more alleles of COMT; (d) the one or more alleles of DAT1; (e) one or more alleles of DBH; (f) the one or more alleles of DRD1; (g) the one or more alleles of DRD2; (h) the one or more alleles of DRD3; (i) the one or more alleles of DRD4; (j) the one or more alleles of DRD5; (k) the one or more alleles of HTR1B; (1) the one or more alleles of OPRM1; (m) the one or more alleles of SNAP25; (n) the one or more alleles of HTTLPR; (o) the one or more alleles of MAOA; (p) the one or more alleles of GABRB3; (q) the one or more alleles of SEMA3A; and (r) one or more alleles of Amelo.

[0145] The risk score in a first pre-determined range can identify a lower increased genetic risk for ADHD. The risk score in a second pre-determined range can identify a higher increased genetic risk for ADHD. For a higher increased genetic risk for ADHD identified subject, the treatment can include providing precision addictive/behavioral management tailored for persons with higher increased genetic risk for ADHD.

[0146] The first pre-determined range can be between 0% and 33% of the number of alleles in the plurality of predetermined alleles. The second pre-determined range can be between 33%
and 100% of the number of alleles in the plurality of predetermined alleles.

[0147] The risk score in a third pre-determined range can identify a moderate increased genetic risk for ADHD.

[0148] For a moderate increased genetic risk for ADHD identified subject, the treatment can include providing the precision addictive/behavioral management tailored for persons with moderate increased genetic risk for ADHD.

[0149] The first pre-determined range can be between 0% and 33% of the number of alleles in the plurality of predetermined alleles. The third pre-determined range can be between 33%
and 67% of the number of alleles in the plurality of predetermined alleles.
The second pre-determined range can be between 67% and 100% of the number of alleles in the plurality of predetermined alleles.

[0150] For a lower increased genetic risk for ADHD identified subject, the treatment can include providing the precision addictive/behavioral management tailored for persons with lower increased genetic risk for ADHD.

[0151] The treatment can further include promoting a pro-dopamine lifestyle for the subject.

[0152] The pro-dopamine lifestyle can be selected from a group consisting of talk therapies, life-style measures, support systems, mindfulness training, and neurofeedback.

[0153] The life-style measures can include a measure selected from a group consisting of diet, exercise, yoga, and meditation.

[0154] The treatment can further include a drug screen to monitor outcomes of the subject.

[0155] The drug screen can include a urine drug screen.

[0156] The subject can regain dopamine homeostasis.

[0157] The method can reduce one or more of stress, craving, and relapse of the subject.

[0158] The can further include the step of identifying each of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample. The can further include the step of assigning a count for each of the alleles in the plurality of pre-determined alleles that was detected to be present in the biological sample. The count for a particular allele can be the number of the particular allele detected to be present in the biological sample. The can further include the step of determining a risk score for the subject based upon the count.
The risk score can be the sum of the counts. The risk score can identify a severity of the genetic risk for a reward deficiency syndrome behavior. The risk score in a first pre-determined range can identify a lower increased genetic risk for the reward deficiency syndrome behavior. The risk score in a second pre-determined range can identify a higher increased genetic risk for the reward deficiency syndrome behavior. The can further include the step of, for a higher increased genetic risk for reward deficiency syndrome behavior identified subject, the treatment includes treating the subject for the reward deficiency syndrome behavior and further includes entry of the subject in a residential treatment program for the reward deficiency syndrome behavior of the subject and medically monitoring the reward deficiency syndrome behavior of the subject.

[0159] The reward deficiency syndrome behavior can be selected from a group consisting of addictive behaviors, impulse behaviors, obsessive compulsive behaviors, personality disorder behaviors, and combinations thereof.

[0160] The step of performing the allelic analysis can include utilizing a kit for detecting the presence of the plurality of predetermined alleles in the biological sample.

[0161] In general, in another embodiment, the invention features a kit that can be utilized to performing the allelic analysis for detecting the present of the plurality of predetermined alleles in the biological sample in the methods described above.
BRIEF DESCRIPTION OF THE DRAWINGS

[0162] FIGS. 1A-1B are (in combination) an illustration of the interactions taking place in brain reward regions.

[0163] FIGS. 2A-2D are diagrammatic representations of the mechanisms of action of stimulants in treating ADHD. FIG. 2A shows the basal unstimulated state with dopamine stored in the vesicles and low levels of dopamine in the synapse. FIG. 2B
shows the result of stimulation of the dopamine neuron with the vesicles releasing dopamine into the synapse and re-uptake of dopamine into the presynaptic neuron by the dopamine transporters. FIG. 2C
shows that in the presence of stimulants, the function of the dopamine transporters is partially blocked and the basal level of dopamine increases in the synapse. This results in the occupation of the presynaptic dopamine D2 receptors by dopamine. FIG. 2D shows that, when the nerve is now stimulated, because of the occupation of the presynaptic D2 receptors, the amount of dopamine released from the vesicles is decreased.

[0164] FIG. 3 is a graph of an example of PCR amplification of variants of dopamine receptor D4 (DRD4).

[0165] FIG. 4 is a schematic of the precision behavior management process (or protocol).
DETAILED DESCRIPTION

[0166] The present invention relate to methods and kits for assessing severity index for genetic risks of attention deficit/hyperactivity disorders. The present invention further relates to methods for behavioral management thereof. In some embodiments, the methods and kits provide a risk analysis score (termed a "genetic risk attention deficit disorder score" (or "GRADDS")). The method for behavioral management of those depending upon his or her GRADDS is terms the precision behavioral management (or "PBM") protocol.

[0167] ADHD is a complex disorder, usually appearing first in childhood, and having multiple causes including genetics as impacted by one's environment. Thus, to dispel myths about ADHD, this requires examination of the additive effects of multiple genes.
Further, and because polygenic inheritance is far more complex than single gene inheritance, an ultimate understanding of the role of any one gene involved in polygenic inheritance will require a summation across many different studies. While the use of psychostimulants has resulted in attenuation of behavioral symptoms in a high percentage of ADHD children, parents have been concerned about potential side effects. Thus, Applicant has derived novel concept of an adjunctive polypharmacy approach for the prevention and treatment of ADHD
rather than single neurochemical and/or neurogenetic targets (e.g., D1-D5, DAT1, DBH, COMT, 5HT1B, NR4A2, SLC1A3, BDNF, as well as loci at 4q13.2, 5q33.3, 11q22 and 17p11).

[0168] Because of advances in molecular pharmacology, nutrition, and molecular genetics, the legacy of RDS and subtype ADHD behavior will be reduced. To advance these goals, ADHD
can be diagnosed using specific DNA polymorphic analysis coupled with electrophysiological and computerized testing, especially in young children. In this regard, Larsson 2006 suggested that the finding of persistent cross-subtype (i.e., combined) and persistent subtype-specific genetic influences (i.e., primarily hyperactive-impulsive and inattentive disorders) are in line with a genetic basis for the DSM-IV classification of ADHD subtypes (Table I).
Finally, rather than a single pharmaceutical treatment approach, DNA-based personalized nutraceutical therapies can then be implemented in combination with a pro-dopamine lifestyle to lead to recovery of the individual.
Genetic Risk Profile for Attention¨Deficit Disorder Of All Types

[0169] The importance of genetic risk testing has great benefit based on the fact that the current diagnosis is not objective and relies mostly on teacher¨student and parent relationships and observations. There is indeed misdiagnosis and a real need for an objective assessment tool. In embodiments of the present invention a detailed panel can be utilized to capture variable risk for ADD and ADHD types.

[0170] In general, the performing an allelic analysis on a biological sample (i.e., the GRADDS
testing), which includes testing for the following panel of alleles:
(a) one or more alleles of BAIAP2, which one or more BAIAP2 alleles include at least one or more of polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) one or more alleles of CHRNA4, which one or more CHRNA4 alleles include at least one or more of polymorphisms rs2273505 and rs3787141;
(c) one or more alleles of COMT, which one or more COMT alleles include at least one or more of polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) one or more alleles of DAT1, which one or more DAT1 alleles include at least one or more of polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) one or more alleles of DBH, which one or more DBH alleles include polymorphism rs1108580;
(f) one or more alleles of DRD1, which one or more DRD1 alleles include polymorphism rs4532;
(g) one or more alleles of DRD2, which one or more DRD2 alleles include polymorphism rs1800497;
(h) one or more alleles of DRD3, which one or more DRD3 alleles include polymorphism rs6280;
(i) one or more alleles of DRD4, which one or more DRD4 alleles include one or more of polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR
in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);
(j) one or more alleles of DRD5, which one or more DRD5 alleles include one or more of polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele;
(k) one or more alleles of HTR1B, which one or more HTR1B alleles include polymorphism rs6296;
(1) one or more alleles of OPRIVI1, which one or more OPRIVI1 alleles include polymorphism rs1799971;

(m) one or more alleles of SNAP25, which one or more SNAP25 alleles include at least one or more of polymorphisms rs66039806, rs362549, rs362987 and rs362998;
(n) one or more alleles of HTTLPR, which one or more HTTLPR alleles include polymorphism rs25531;
(o) one or more alleles of MAOA, which one or more MAOA alleles include polymorphism 30 bp repeat (promoter, X chrom only); and (p) one or more alleles of GABRB3, which one or more GABRB3 alleles include polymorphism CA-Repeat (171-201 bases, X chrom only).

[0171] For example, the detailed panel can include each of the alleles set forth in TABLE IV:
TABLE IV
Variation Sequence Gene SNP Class ID No.
BAIAP2 rs8079626 SNV
BAIAP2 rs8079781 SNV
BAIAP2 rs7210438 SNV
BAIAP2 rs4969385 SNV
CHRNA4 rs2273505 SNV
CHRNA4 rs3787141 SNV
COMT rs6269 SNV 1 COMT rs4818 SNV 2 COMT rs4633 SNV 3 COMT rs933271 SNV 4 COMT rs1544325 SNV 5 COMT rs740603 SNV 6 COMT rs740601 SNV 7 COMT rs4646316 SNV 8 COMT rs174696 SNV 9 COMT rs165774 SNV 10 COMT rs9332377 SNV 11 COMT rs165599 SNV 12-15 COMT rs2020917 SNV 16 COMT rs4680 SNV 17 DAT 1 rs460700 SNV
DAT 1 rs37020 SNV
DAT 1 rs13161905 SNV
DAT 1 rs27048 SNV 18 DAT 1 rs6347 SNV 19 DAT 1 rs11133767 SNV
DAT 1 rs40184 SNV 20 DAT 1 rs2975292 SNV
DAT 1 rs2652511 SNV
DAT 1 VNTR IN 3-UTR/10-repeat allele VNTR
DAT1 40bp repeat (Exon 15) VNTR
DBH rs1108580 SNV
DRD1 rs4532 SNV 21 DRD2 rs1800497 SNV 22 DRD3 rs6280 SNV 23 DRD4 rs1800955 SNV 24 DRD4 rs4646984 SNV
DRD4 rs3758653 SNV 25 DRD4 rs936465 SNV
DRD4 VNTR in exon 3/7 repeat allele VNTR
DRD4 VNTR in exon 3/5 repeat allele VNTR
DRD4 7-11 repeats of 48bp (Intron 3) VNTR
DRD5 VNTR in exon 8/3- repeat allel VNTR
DRD5 Dinucleotide repeat/ 148-bp allele DINUCL
HTR1B rs6296 SNV 26 OPRM1 rs1799971 SNV 27 SNAP25 rs66039806 SNV
SNAP25 rs362549 SNV
SNAP25 rs362987 SNV
SNAP25 rs362998 SNV
HTTLPR 5-HTTLPR including rs25531 VNTR 28 30 bp repeat (promoter, X chrom 29 MAOA only*) VNTR
CA-Repeat (171-201 bases, X
GABRB3 chrom only*) DINUCL

[0172] A "single-nucleotide polymorphism" (also "SNP") is a substitution of a single nucleotide that occurs at a specific position in the genome. For example, at a specific base position in the human genome, the C nucleotide may appear in most individuals, but in a minority of individuals, the position is occupied by an A. This means that there is a SNP at this specific position, and the two possible nucleotide variations ¨ C or A ¨ are said to be the "alleles" for this specific position.

[0173] A "single-nucleotide variant" (also "SNV") is a variation in a single nucleotide without any limitations of frequency and may arise in somatic cells.

[0174] A "variable number tandem repeat" (or "VNTR") is a location in a genome where a short nucleotide sequence is organized as a tandem repeat.

[0175] A "dinucleotide" (or "DINUCL") is a variation of a nucleotide having two units.

[0176] Further, for example, the panel can include each of the alleles in TABLE IV (and, if desired, additional alleles).

[0177] In some embodiments of the, the panel can exclude one, two, or three of the genes/alleles listed above (a)-(p). For instance, the panel can include the genes (and one or more the particular alleles) in (a)-(1) and (n)-(p) in the absence of (m) (i.e., without HTR1B
allele having polymorphism rs6296 and even without any HTR1B alleles at all).

[0178] Additional alleles of can be added to the panel. These be for an allele of the one of the same gene listed above in (a)-(p), such as rs4646983 of DRD4. These can also be for allele of a different gene, such one or more alleles of SEMA3A, which can include polymorphism rs139438618 or such as one or more alleles of Amelo (for sex determination), which can include Amelo-F and/or Amelo-R.

[0179] The sequences of these alleles are described in further detail herein, including as set forth in SEQ. ID NOS. 1-29, and further including in Blum '927 PCT Application and the various references identified in the Reference section below and discussed herein (including Bonvicini 2016, Hawi 2003, Hasler 2017, Faraone 2010, and Bhaduri 2009).

[0180] Further, TABLE V provides sequences of certain polymorphisms used in methods of the present invention.
Gene SNP Sequence Chromosome AAACATTTATTTGGCCTTCG
CAGTG[ A/Es. AAATCTAATTT Chr.17: 81053072 on BAIAP2 rs8079626 CTTGAGTCTAAGAA GRCh38 TCCGCCTCTCCATCAACGGA
GGCCC V:TiGTCTAGGTTGT Chr.17: 81076348 on BAIAP2 rs8079781 GGAGGATGCTTGAG GRCh38 GGCTCATGGGCCTCGGTTTT
GCTGC[CIT_ AGTGGTCCGCG Chr.17: 81086380 on BAIAP2 rs7210438 CTGCGTTGGGTTCA GRCh38 TCAGCCCAGGGTGACTAAG
TGGGAG-C/T1ATTCTGTGGG Chr.17: 81095090 on BAIAP2 rs4969385 TCTTAAATGCTTTCA GRCh38 GCAGGGCGACCTCAGTCAC
AGTGCA CSTIGATGGCCACG
CHRNA4 rs2273505 CCCTCACCTACCACG Chr.20 : 63359526 TGCCAGCGGCCGCCTCTGCC
AGCTA[CIT CACTTTGCAGC Chr.20: 63358042 on CHRNA4 rs3787141 CGTGTTTGCAAACC GRCh38 GCATTTCTGAACCTTGCCCC
TCTGC[A/S AACACAAGGGG Chr.22: 19962429 on COMT rs6269 GCGATGGTGGCACT GRCh3 GCCTGCTGTCACCAGGGGC
GAGGCT[CiSIATCACCATCG Chr.22: 19963684 on COMT rs4818 AGATCAACCCCGACT GRCh3 CCAAGGAGCAGCGCATCCT
GAACCA C/TIGTGCTGCAGC Chr.22: 19962712 on COMT rs4633 ATGCGGAGCCCGGGA GRCh3 GTGGTTACTTTCTGGAGAGA
GCATG 1T/CIGGCATGCAGGA Chr.22: 19943884 on COMT rs933271 GC TGGAGGGGGGGT GRCh3 GAGACAAATTAGAAATGTC
AGTCTG[A/GIAGAGAGTGGT Chr.22: 19944145 on COMT rs1544325 AGGTAGCCAGATACT GRCh3 TGTGAGGCACTGAGGATGC
CCTCAC V(IiICGTGCATCTG Chr.22: 19957654 on COMT rs740603 CATGTGGCGTGCATG GRCh3 AACACAGAGCTGCCCTCTCT
GAATC -A/C CCGAACCGCCC Chr.22: 19963240 on COMT rs740601 ACCTTGGGGCCCTG GRCh38 CCCAGACCAGACACCAGGG
CAGAAA1C/TIGGCACAGGAC Chr.22: 19964609 on COMT rs4646316 CAAGGAGATGGGGTG GRCh38 CTGCGTCCGGCCGTATTCCA
GCTTT[C/TIAAAACAACAAA Chr.22: 19965653 on COMT rs174696 AAACAACAAAAACT GRCh38 AAACTGGACACTGCTGTTA
GCAGCC AlSIGACTAGGAGC Chr.22: 19965038 on COMT rs165774 ACGAGGGGCACAGCC GRCh38 AACCCCTCTCCTTGGGTGCC
TCTCC ITCATAGGCCTGA Chr.22: 19968169 on COMT rs9332377 GTTCCTGGCACTG GRCh38 TGTTAGCCCCATGGGGACG
ACTGCC(A/Gj GCCTGGGAAA Chr.22: 19969258 on COMT rs165599 CGAAGAGGAGTCAGC GRCh38 CTGGGGAGAAGTTGGGAAG
TCTGGC[TfciAGTGGGGCCG Chr.22: 19941361 on COMT rs2020917 GTGCCTGGTGACCTC GRCh38 CCAGCGGATGGTGGATTTC
GCTGGC11.:01TGAAGGACAA
COMT rs4680 GGTGTGCATGCCTGA
ATTTCCCTAATTAAACACCC
TATGAIA/S]CACCCCAGGCC Chr.5: 1429854 on DAT 1 rs460700 TGGGCTGCATGTGC GRCh38 AGGCAGCCATGGGCACTGG
CTCTGGI&T1 GTGGCACTGG Chr.5: 1418259 on DAT 1 rs37020 GCAGAGGCCTGAGCT GRCh38 TTCACAACCCCCTGAGTGTG
TCCCC[CT CATCCCATGTGC Chr.5: 1417097 on DAT 1 rs13161905 GCCCTGCTGCATG GRCh38 GCTTCCTGCTACCAGCAGGC
AGACT CII IGGATGGAGGTG Chr.5: 1412530 on DAT 1 rs27048 GAGGGGACGAGAGT GRCh38 CCATCGCCACGCTCCCTCTG
TCCTCP/V:3. GCCTGGGCCGT Chr.5: 1411297 on DAT 1 rs6347 GGTCTTCTTCATCA GRCh38 TCCAGGCCCCAGGAGCTGC
CGCAGC 'A/CIGGCAGTGGAA Chr.5: 1401465 on DAT 1 rs11133767 GGAAGGCACGTTCAG GRCh38 AAATCAAGTAATGATTGATT
TGTAG- A/GIAGTTTGAGTGA Chr.5: 1394962 on DAT 1 rs40184 GGCATCGGATCCCC GRCh38 GGCACCTGGACATGGCACC
TATGAG[C/OjCTGCAAAGCA Chr.5: 1419817 on DAT 1 rs2975292 GTTGGGTGGGGGTGG GRCh38 CTGGACATCCTGGGCCTTGG
CGGCC -C/I1GGGGGCTCCAT Chr.5: 1446274 on DAT 1 rs2652511 TCCTCCGCGCGCTG GRCh38 GCGACCCCAAGGATTACCT
CATTGA -A/G1GTAAGGGGTG Chr.9:133639992 on DBH rs1108580 GCCGCGAGTACCCAG Build GRCh38 GGGGCTCTGACACCCCTCA
AGTTCC 'C.T AAGCAGGGAA
DRD1 rs4532 TAGGGGTCAGTCAGA
TGGACGTCCAGCTGGGCGC
CTGCCT[Cf ' ' GACCAGCACT
DRD2 rs1800497 TTGAGGATGGCTGTG
GCCCCACAGGTGTAGTTCA
GGTGGC C,IIIACTCAGCTGG
DRD3 rs6280 CTCAGAGATGCCATA
GGGCAGGGGGAGCGGGCGT

DRD4 rs1800955 TCGAGGCGAGTCCGC
Chr.11 NC 000011.10 DRD4 rs4646984 (637305..640706) CCTCTTTGGTGAAGAGTCCA
TAGAAX:T TCTCTGCTGCG Chr.11: 636399 on DRD4 rs3758653 CTTTGC'AAGCACTT GRCh38 GGCTGCCTTGGGGCGAGAA
AGTACA ACTCAGCAAC Chr.11: 643568 on DRD4 rs936465 AGCTCAGCAGGCACC GRCh38 CGGAGACTCGCACTTTGACT
TGGTT[C ACATACACAGG Chr.6:77462543 on HTR1B rs6296 AGATCCGGATTCGC Build GRCh38 GGTCAACTTGTCCCACTTAG
ATGGCIA Ci )ACCTGTCCGAC
OPRM1 rs1799971 CCATGCGGTCCGAA
GACCTGGAAACGTACTGAG
CCCTGG A:(31ACTTTCATTCC Chr.20: 10289242 on SNAP25 rs362549 TCTAGAAAATTTGT GRCh38 GTCTGGATTATGATATATCG
GTATT C TCTAATGCCTCG Chr.20: 10296804 on SNAP25 rs362987 ACTTAAAACTCAT GRCh38 AAAAAGCCTGGGGCAATAA
TCAGGA GGAGTGGTGG Chr.20: 10296973 on SNAP25 rs362998 CCAGCCAGCCTGCTC GRCh38 CTCGCGGCATCCCCCCTGCA
5-HTTLPR CCCCC A:(31GCATCCCCCCT
including GCAGCCCCCCCAGC (for HTTLPR rs25531 rs25531) 30 bp repeat (promoter, X ACCGGCACCGGCACCAGTA
MAOA chrom only*) CCCGCACCAGT

[0181] In one embodiment, the PCR sequences for the DRD5 Dinucleotide repeat/
148-bp allele are provided in Table 1 of Hawi 2003. (50 CGTGTATGATCCCTGCAG30; 50 GCTCATGAGAAGAATGGAGTG30). Dinucleotide repeat microsatellite polymorphism (CT/GT/GA) located 18.5 kb from the 5' end of the gene is highly polymorphic with at least 12 possible alleles.

[0182] In one embodiment, the polymorphism rs139438618 of SEMA is disclosed in Zhou 2017.

[0183] The allelic analysis can be performed on a biological sample for the panel of genes/alleles using techniques known in the art, such as allelic analysis techniques that are similar to those described in Blum '927 PCT Application.

[0184] The information received from the analysis is both qualitative and quantitative, in that the biological sample provides an overall score (basically, a count of the number of alleles in the panel that were determined to be present) and also provides for which particular alleles were determined to be present. Such information will be utilized for identification and treatment of persons with ADHD.

[0185] As for the count of the number of alleles that are determined to be present, the following are the general ranges for a panel that contains X alleles in the panel:
Zero to 33% of X: Lower increased risk for ADHD
33% to 67% of X: Moderate increased risk for ADHD
67% to 100% of X: High increased risk for ADHD

[0186] For example, if the panel set forth above in TABLE IV is performed on a subject (which panels has 53 total alleles), the ranges would be as follows:
Score of Zero to 17: Lower increased risk for ADHD
Score of 18-35: Moderate increased risk for ADHD
Score of 36-54: High increased risk for ADHD

[0187] From a qualitative point of view, the particular alleles tested positive would be also pertinent, as these can be utilized to tune the treatment that is provided to the subject. I.e., the combination of alleles is relevant to precision behavioral management and treatment.
Precision Behavioral Management (PBM)

[0188] The present invention includes therapeutic method for treating ADHD
that includes the above-described allelic analysis of the gene/allele panel (which again is testing for genetic risk predisposition) and can include customization of neuronutrient supplementation to target the individual genetic allele variation(s), based on the testing results, and thereby deliver precision behavioral manamgent (PBM) to patients. Since part of the proposed GRADDS
panel contains GARS, Pro-Dopamine Regulation for ADHD could be developed and utilized in treatment and possibly even prophylaxsis's.

[0189] As discussed above, the genotyping testing taught and described for identified SNPs in individuals can be used for targeting precision nutrigenomics treatment.

[0190] FIG. 3 is an example of how simple genotyping for identified SNPs in individuals can be used to identify targets for precision nutrigenomics treatment. FIG. 3 is a graph of an example of PCR amplification of variants of dopamine receptor D4 (DRD4). DRD4 (Dopamine Receptor 4) variants detected via polymerase chain reaction (PCR) amplification with multiple control samples. 2R to 8R = six different 48 base pair (bp) repeat sequences.
2R repeats = 48 bp twice, 3R = thrice and so forth. Peak height (y-axis) indicates fluorescence signal amplitude, peak location (x-axis) indicates fragment size (bp). Fragment sizes are shown below the peaks (base pairs). Humans carry two copies of this variant and their lengths are from 2R to 11R.
Carrying one or both variants at 7R+ increases the risk of developing RDS.
This is one of the eleven established risk variants assessed by the GARS test.

[0191] Multiple repeats of DRD4 variants are associated with disorders within the RDS
spectrum [Huang 2002; Dragan 2009; Gervasini 2018]. In FIG. 3, six different 48 bp repeat sequences are identified, from 2 repeats (2R) to 8R. The DRD4, DRD2, catechol-methyltransferase (COMT) are among genes within the mesolimbic reward pathway with SNPs that contribute to RDS,

[0192] FIG. 4 is a schematic illustrating various elements related precision addiction management (PAM) and shows the interrelatedness of genetic testing (i.e., the GRADDS
testing), utilizing the testing with above-described gene/allele panel and a customized polymorphic matched nutraceutical therapeutics.

Coupling Genetic Testing with Precision Addiction Management (PAM)

[0193] In step 401, the genetic testing (i.e., the GRADDS testing) such as described and taught above is performed. From this testing, precision addictive/behavioral management (PAM) is designed, which can include, for example, neuro nutrient therapy based upon a particular individual's genetic risk profile.

[0194] In the GRADDS testing, the panel can be used to identify the overall count as well as a qualitative analysis as to what alleles in the panel were determined to be present. The treatment can then be tailored for the individual using the results of this testing.

[0195] This type of precision can be accomplished for each gene based allelic polymorphism primarily as it relates to major neurotransmitter pathways such serotonergic, endorphinergic, GABAergic, Glutaminergic, Cholinergic, and dopaminergic. This will enable the novel development of Precision Behavioral Management for ADHD treatment never before utilized.

[0196] By way of example, consider six different nutraceuticals of Maker's Nutrition (Hauppauge, NY), namely: (a) endogen tablets, (b) equigen tablets, (c) gabagen tablets, (d) metagen tablets, (e) serogen tables, and (f) polygen tablets. The general composition of these nutraceutical tablets are shown in TABLE VI below:
TABLE VI
Ingredient Endogen Equigen Gabagen Metagen Serogen Polygen Thiamine (as 15 mg 15 mg 15 mg 15 mg 15 mg 15 mg Thiamin HCL) Vitamin B6 (as 50 mg 50 mg 50 mg 50 mg 50 mg 50 mg Pyridoxa1-5-Phosphate) Vitamin B6 (as 10 mg 10 mg 10 mg 10 mg 10 mg 10 mg Pyridoxine HCL) Chromium 200 mcg 200 mcg 200 mcg 600 mcg 600 mcg 600 mcg (as Chromium Polynicotinate) mg 2200 mg 2000 mg 2200 mg 2000 mg 2200 mg Phenylalanine (DLPA) L-Tyrosine, USP 650 mg 700 mg 650 mg 700 mg 650 mg 700 mg Larch 425 mg 125 mg 430 mg 50 mg 360 mg 50 mg Arabinogalactans N-Acetyl 200 mg 250 mg 200 mg 150 mg 200 mg 250 mg Cystenine (NAC) Passion Flower 200 mg 300 mg 325 mg 325 mg 300 mg 325 mg Extract 3.5 (4%
Vitexins) Rhodiola Rosea 200 mg 250 mg 200 mg 250 mg 250 mg 250 mg Extract (3%
Rosavin, 1%
Salidroside) Griffonia Seed 100 mg 100 mg 100 mg 150 mg 150 mg 150 mg SE 99% 5-Hydroxy-tryptophan CoQ 10 30 mg 50 mg 50 mg 50 mg 30 mg 50 mg White Bark Pine 25 mg 25 mg 25 mg 25 mg 25 mg 25 mg L-Glutamine 25 mg 50 mg 75 mg 50 mg 50 mg 25 mg Organic Aloe 15 mg 15 mg 15 mg 15 mg 15 mg 15 mg Vera Gel Powder 200:1 #700 NADH 10 mg 15 mg 10 mg 15 mg 10 mg 10 mg Kosher GTF 0.4 mg 0.4 mg 0.4 mg 0.4 mg 0.4 mg 0.4 mg Chromium Yeast Other ingredients in include Lecithin, Dicalcium Phosphate, Microchrystalline Cellulose, Croscarmellose Sodium, Magnesium Dioxide, and Pharmaceutical Glaze. Amounts are calculated on a four-tablet basis.

[0197] TABLE VII provides the targets and mechanism of actions for certain of the ingredients in these tablets:
TABLE VII
Ingredient Therapeutic Target Mechanism of Actions L-Phenylalanine Dopamine Synthesis 20%
of this precursor amino-acid is converted to dopamine D-Phenylalanine Enkephalin/Endorphin Inhibition of the carboxypeptidase Catabolism (enkephalinase); thereby, increasing opioid peptide levels in brain L-Tyrosine Dopamine Synthesis Rate-limiting step in the synthesis of dopamine L-Glutamate GABA Synthesis Supplied in small amount to assist in balance of over-inhibiting GABA by natural opioid peptides Chromium Salts Serotonin Synthesis Chromium is known to increase the sensitivity of the insulin receptor thereby, reducing the carbohydrate ratio by one-third in the blood; This effect causes gut tryptophan to increase in the brain with a concomitant increase in serotonin synthesis 5-Hy droxytry ptophane Serotonin Synthesis Involved in the synthetic pathway to produce serotonin Rhodiola rosea Enzyme Inhibitor Rhodiola rosea has been shown to Increasing inhibit COMT activity thereby, Catecholamines increasing DA in the synapse as well as inhibiting MAO-A in the mitochondria, which increases vesicular DA in pre-synaptic neuron Pyridoxine Phosphate Enzyme Catalyst Assists in the synthesis of dopamine Passion Flower Benzodiazepine Receptor By stimulating the benzodiazepine Stimulant receptor, there is a reduction in anxiety due to stress from detoxification

[0198] By the allelic analysis utilizing the gene/allele panels described and taught above, a particular regime can then be selected aimed at addressing the therapeutic targets identified by this analysis. I.e.õ if the analysis favors that the therapy should include promoting GABA
synthesis and serotonin synthesis, this would favor utilizing metagen tablets that have 700 mg L-Tyrosine, 150 mg Griffonia Seed SE 99% 5-Hydroxy-tryptophan, and 600 mcg chromium, which are at the higher ranges for these ingredients (as comparted to the other tablets).
Promoting a Pro-Dopamine Lifestyle

[0199] Referring back to FIG. 4, step 402 is directed to providing the individual a pro-dopamine lifestyle, which can include talk therapies, life-style measures to promote natural endorphin and dopamine release (such as diet, exercise, yoga, meditation, etc.), and support systems.

[0200] A comprehensive treatment program that teaches a pro-dopamine lifestyle and uses urine drug screens (like the Comprehensive Analysis of Reported Drugs (CARD)) to monitor outcomes, and as a basis for therapeutic interactions, can be utilized in embodiments of the present invention. Further a pro-dopamine lifestyle with gentle prolonged D2 agonist therapy can be utilized to overcome DNA polymorphisms by promoting positive epigenetic effects Holistic modalities like exercise, low glycemic index diet, mindfulness training, neurofeedback, yoga, and meditation are known to support reward neurotransmission and naturally release dopamine the product of reward neurotransmission. These holistic pro dopamine modalities supported fellowship, can be used to induce feelings of well-being and thereby reduce craving and relapse.

[0201] These basic concepts underpin translational addiction-related research that assist the multitude of victims of genetically induced ADHD become the recipients of better therapeutic relapse-preventive tactics.

[0202] For example, the function of DAT1 is to clear excess dopamine released from the pre-neuron into the synapse and prevent uptake into the receptors on the next neuron. Much research, both biochemical and structural, has been performed to obtain clues about the mechanism of reuptake. The activity of clearing dopamine from the synapse is dependent on the variant form of this gene. So under normal conditions, the dopamine active transporter protein pumps the chemical messenger dopamine out of the synaptic cleft back into the cytosol of the pre-neuron cell. The DAT1 gene is located on chromosome 5 at p15. The gene has a variable number tandem repeats (VNTR) at the 3 'end of the gene and another in the intron 8 region.

[0203] The importance here is that differences in the VNTR, for example, lOR
vs. 9R have been shown to affect the basal level of expression (activity) of the transporter. Indeed it has been demonstrated that the 9R is a risk form because it has a much higher ability to clear DA
from the synaptic cleft compared to the 1OR allele. Therefore, carriers of the 9R are more prone to ADHD due to hypodopaminergia (low dopamine function). The regional brain distribution of the DAT includes high dopamine-containing neurons in the old reptilian limbic system similar to the DRD2 receptor distribution. The maximum expression of the DAT1 gene is found in a parts of the brain called the substantia nigra and ventral tegmentum area [brain regions containing large amounts of the inhibitory chemical messenger GABA that fine-tunes dopamine release at the reward site]. It is also interesting that DAT is co-localized with the D2 receptors.

[0204] Carriers of the 9R high activity of the DAT1 gene, requires a blocking action. Therefore based on this result the precision pro-dopamine variant can be chosen that contains a higher amount above normal of for example, L-Tyrosine. The rationale behind this enhancement is two ¨ fold: (1) L-Tyrosine is the rate limiting step in the brain synthesis of dopamine. As such, utilizing a higher mount of L-Tyrosine and subsequent increased amount of needed dopamine in the synapse, and (2) L-Tyrosine is also known to inhibit the action of the 9R DAT1 (high activity) and as such reduce synaptic dopamine clearance.
Recovery

[0205] In step 403 of FIG. 4, such activities of steps 401 and 402 are performed in tandem leading the subject regaining dopamine homeostasis. Detection of a predisposition (and thus an early diagnosis) through genetic testing couples with pharmacogenetic and pharmacogenomic monitoring, and appropriate urine drug screening, and treatment with pro-dopamine regulators can reduce stress, craving, and relapse and enhance well-being in the recovery community.

[0206] While embodiments of the invention have been shown and described, modifications thereof can be made by one skilled in the art without departing from the spirit and teachings of the invention. The embodiments described and the examples provided herein are exemplary only, and are not intended to be limiting. Many variations and modifications of the invention disclosed herein are possible and are within the scope of the invention. The scope of protection is not limited by the description set out above, but is only limited by the claims which follow, that scope including all equivalents of the subject matter of the claims.

[0207] The disclosures of all patents, patent applications, and publications cited herein are hereby incorporated herein by reference in their entirety, to the extent that they provide exemplary, procedural, or other details supplementary to those set forth herein.

[0208] Amounts and other numerical data may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a numerical range of approximately 1 to approximately 4.5 should be interpreted to include not only the explicitly recited limits of 1 to approximately 4.5, but also to include individual numerals such as 2, 3, 4, and sub-ranges such as 1 to 3, 2 to 4, etc. The same principle applies to ranges reciting only one numerical value, such as "less than approximately 4.5," which should be interpreted to include all of the above-recited values and ranges.
Further, such an interpretation should apply regardless of the breadth of the range or the characteristic being described.

[0209] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the presently disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently disclosed subject matter, representative methods, devices, and materials are now described.

[0210] Following long-standing patent law convention, the terms "a" and "an"
mean "one or more" when used in this application, including the claims.

[0211] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter.

[0212] As used herein, the term "about" and "substantially" when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments 20%, in some embodiments 10%, in some embodiments 5%, in some embodiments 1%, in some embodiments 0.5%, and in some embodiments 0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.

[0213] As used herein, the term "substantially perpendicular" and "substantially parallel" is meant to encompass variations of in some embodiments within 10 of the perpendicular and parallel directions, respectively, in some embodiments within 5 of the perpendicular and parallel directions, respectively, in some embodiments within 1 of the perpendicular and parallel directions, respectively, and in some embodiments within 0.5 of the perpendicular and parallel directions, respectively.

[0214] As used herein, the term "and/or" when used in the context of a listing of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase "A, B, C, and/or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
REFERENCES

[0215] Aalto, S., et at., "Frontal and temporal dopamine release during working memory and attention tasks in healthy humans: A Positron Emission Tomography study using the high-affinity dopamine D2 receptor ligand [11CFLB457]," Journal of Neuroscience, 2005;Mar:25(10):2471-2477 ("Aalto 2005") .

[0216] Alderson, R. M., et at., "Attention-Deficit Hyperactivity Disorder (ADHD) and working memory in adults: A meta-analytic review," Neuropsychology, 2013;27(3):287-302 ("Alderson 2013").

[0217] Andreazza, A. C., et at., "DNA damage in rats after treatment with methylphenidate," Prog Neuropsychopharmacol Biol Psychiatry, 2007;31:1282-8 ("Andreazza 2007").

[0218] American Academy of Child Adolescent Psychiatry (AACP), "A guide for families/getting treatment,"
http://www.aacap.org/cs/adhd a guide for families/
getting treatment ("AACP ADHD Guide").

[0219] American Psychiatric Association, Diagnostic and statistical manual of the American Psychiatric Association. Washington, DC, 2000 ("APA 2000").

[0220] American Psychiatric Association, Diagnostic and statistical manual of mental disorders (DSM-IV) Washington, D.C, 1994 ("APA 1994").

[0221] Arcos-Burgos, M., et at., "Attention-deficit/ hyperactivity disorder in a population isolate: linkage to loci at 4q13.2, 5q33.3, 11q22, and 17p11," Am J Hum Genet., 2004;75:998-1014 ("Arcos-Burgos 2004").

[0222] Asherson, P., et at., "Unravelling the complexity of attention-deficit hyperactivity disorder: a behavioural genomic approach," Br J Psychiatry, 2005;187:103-5 ("Asherson 2005").

[0223] August, G. J., et at., "Familial subtypes of childhood hyperactivity,"
J Nery Ment Dis., 1983;171:362-8 ("August 1983").

[0224] Badgaiyan R. D., et at., "Attenuated tonic and enhanced phasic release of dopamine in Attention Deficit Hyperactivity Disorder," PLoSOne, 2015;10:e0137326 ("Badgaiyan 2015").

[0225] Barkley, R., "Behavioral inhibition, sustained attention, and executive functions:
Constructing a unifying theory of ADHD," Psychological Bulletin., 1997;121(1):65-94 ("Barkley 1997").

[0226] Bhaduri, N., et al., "Study on DBH genetic polymorphisms and plasma activity in attention deficit hyperactivity disorder patients from Eastern India," Cell Mot Neurobiol., 2010Mar;30(2)265-74 ("Bhaduri 2010").

[0227] Biederman J., et al., "Lisdexamfetamine Dimesylate and mixed amphetamine salts extended-release in children with ADHD: A double-blind, placebo-controlled, crossover analog classroom study," Biol Psychiatry, 2007;62:970-6 ("Biederman II 200 7").

[0228] Biederman, J., et al., "Effect of comorbid symptoms of oppositional defiant disorder on responses to atomoxetine in children with ADHD: a meta-analysis of controlled clinical trial data," Psychopharmacology (Berl), 2007b; 190:31-41 ("Biederman II 200 7").

[0229] Biederman J., et al., "Comparison of parent and teacher reports of attention-deficit/hyperactivity disorder symptoms from two placebo-controlled studies of atomoxetine in children," Biol Psychiatry., 2006;60:1106-10 ("Biederman 2006").

[0230] Biederman, J., et al., "Further evidence for family-genetic risk factors in attention deficit hyperactivity disorder. Patterns of comorbidity in probands and relatives psychiatrically and pediatrically referred samples, Arch Gen Psychiatry, 1992;49:728-38 ("Biederman 1992").

[0231] Bledsoe, J. C., et al., "Anterior cingulate cortex and symptom severity in Attention-Deficit/Hyperactivity Di s order," Journal of Abnormal Psychology, 2013;122(2) :558-565 ("Bledsoe 2013").

[0232] Blum, K., et al., "Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUP and ADHD, "JBehav Addict., 2018Mar;
7(1):192-203 ("Blum 2018").

[0233] Blum, K., et at., "Dopamine homeostasis' requires balanced polypharmacy: Issue with destructive, powerful dopamine agents to combat America's drug epidemic," J
Syst Integr Neurosci., 2017;3:6,10.15761/JSIN.1000183 ("Blum 2017").

[0234] Blum, K., et at., "Fifty years in the development of a Glutaminergic-Dopaminergic optimization complex (KB220) to balance brain reward circuitry in Reward Deficiency Syndrome: A pictorial," Austin Addiction Sc., 2016; 1(2): 1-11 ("Blum 12016").

[0235] Blum, K., et at., "Fifty Years in the development of a glutaminergic-dopaminergic optimization complex (KB220) to balance brain reward circuitry in reward deficiency syndrome: a pictorial," Austin Addict Sci., 2016;1:1006 ("Blum 11 2016").

[0236] Blum, K., et al., "rsfIVIRI effects of KB220Z on neural pathways in reward circuitry of abstinent genotyped heroin addicts," Postgrad Med., 2015; 127:232-41, 10.1080/00325481.2015.994879 ("Blum 2015").

[0237] Blum, K., et at., "Neurogenetics and nutrigenomics of neuro-nutrient therapy for reward deficiency syndrome (RDS): clinical ramifications as a function of molecular neurobiological mechanisms, J Addict Res Ther, 2012;3:139,10.4172/2155-6105.1000139 ("Blum 2012").

[0238] Blum, K., et al., "Neurogenetics of dopaminergic receptor supersensitivity in activation of brain reward circuitry and relapse: proposing 'deprivation-amplification relapse therapy' (DART)," Postgrad Med., 2009; 121: 176-96,10.3810/pgm.2009.11.2087 ("Blum 2009").

[0239] Blum, K., et at., "Attention-deficit-hyperactivity disorder and reward deficiency syndrome," Neuropsychiatric Disease and Trament., 2008;4(5): 893 -917 ("Blum I
2008").

[0240] Blum, K., et at., "Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary," Theor Blot Med Model., 2008;5:24:10, 1186/1742-4682-5-24 ("Blum 11 2008").

[0241] Blum, K., et at., "DNA based customized nutraceutical 'gene therapy' utilizing a genoscore: a hypothesized paradigm shift of a novel approach to the diagnosis, stratification, prognosis and treatment of inflammatory processes in the human," Med Hypotheses, 2006a;66: 1008-18 ("Blum 2006").

[0242] Blum, K., et at., "Reward deficiency syndrome: a biogenetic model for the diagnosis and treatment of impulsive, addictive, and compulsive behaviors," J
Psychoactive Drugs, 2000;32(Suppl i¨iv):1-112 ("Blum 2000").

[0243] Blum, K., et at., "Reward deficiency syndrome," Am Sc., 1996;84:132 ("Blum I
1996").

[0244] Blum, K., et at., "The D2 dopamine receptor gene as a determinant of reward deficiency syndrome.," J R Soc Med., 1996b;89:396-400 ("Blum 11 1996").

[0245] Blum, K., et at., "Alcohol and the addictive brain: new hope for alcoholics from biogenetic research," New York: Free Press; 1991, 320 ("Blum 1991").

[0246] Blum, K., et al., "Ethanol and neuromodulator influences. A cascade model of reward,"
in 011at H. et at., (editors), Alcohol and behaviour: Basic and clinical aspects, Utrecht, Netherlands:VSP;1990 ("Blum I 1990").

[0247] Blum, K., et at., "Ethanol and Neuromodulator influences. A cascade model of reward.
In: 011at H., et at., (editors), Alcohol and Behaviour: Basic and Clinical Aspects Progress in Alcohol Research, Utrecht, Netherlands: VSP;1990 ("Blum 11 1990").

[0248] Blum, K., et at., "Allelic association of human dopamine D2 receptor gene in alcoholism, JAMA, 1990;263(15):2055-2060 ("Blum III 1990").

[0249] Blum, K., et at., "Enkephalinase inhibition and precursor amino acid loading improves inpatient treatment of alcohol and polydrug abusers: double-blind placebo-controlled study of the nutritional adjunct SAAVE," Alcohol., 1988;5:481-93 ("Blum 11988").

[0250] Blum, K., et at., "Neurogenetic deficits caused by alcoholism:
restoration by SAAVE, a neuronutrient intervention adjunct," J Psychoactive Drugs, 1988;20:297-313 ("Blum II
1988").

[0251] Bonvicini, C., et at., "Attention-deficit hyperactivity disorder in adults: A systematic review and meta-analysis of genetic, pharmacogenetic and biochemical studies,"
Mot Psychiatry, 2016Jul ;21(7): 872-884 ("Bonvicini 2016").

[0252] Bowirrat, A., et at., "Relationship between dopaminergic neurotransmission, alcoholism, and Reward Deficiency Syndrome," Am J Med Genet B Neuropsychiatr Genet., 2005;132:29-37 ("Bowirrat 2005").

[0253] Braverman, ER., et at., "Delayed P300 latency correlates with abnormal Test of Variables of Attention (TOVA) in adults and predicts early cognitive decline in a clinical setting," Adv Ther., 2006;23:582-600 ("Braverman 2006").

[0254] Brookes, K., et at., "The analysis of 51 genes in DSM-IV combined type attention deficit hyperactivity disorder: association signals in DRD4, DAT1 and 16 other genes," Mot Psychiatry, 2006;11:934-53 ("Brookes 2006").

[0255] Bush, G., et al., "Functional neuroimaging of Attention-Deficit/Hyperactivity Disorder:
A review and suggested future directions," Biological Psychiatry, 2005;57:1273-1284 ("Bush 2005").

[0256] Bush, G., et at., "Anterior cingulate cortex dysfunction in Attention-Deficit/Hyperactivity Disorder revealed by fM1t1 and the counting stroop,"
Biol Psychiatry, 1999;45:1542-1552 ("Bush 1999").

[0257] Cantwell, D. P., "Genetic factors in the hyperkinetic syndrome," J Am Acad Child Psychiatry, 1976;15:214-23 ("Cantwell 1976").

[0258] Cantwell, D. P., "Psychiatric illness in the families of hyperactive children," Arch Gen Psychiatry, 1972;27:414-7 ("Cantwell 1972").

[0259] Castellanos, F. X., et at., "Lack of an association between a dopamine-4 receptor polymorphism and attention-deficit/ hyperactivity disorder: genetic and brain morphometric analyses," Mot Psychiatry, 1998;3 :431-4 ("Castellanos 1998").

[0260] CHADD, CHADD 's educators manual, Landover, MD, 2007 ("CHADD 2007").

[0261] Chen, T. J., et at., "Narcotic antagonists in drug dependence: pilot study showing enhancement of compliance with SYN-10, amino-acid precursors and enkephalinase inhibition therapy," Med Hypotheses, 2004;63 :538-48 ("Chen 2004").

[0262] Cloninger, C. R., et at., "A psychobiological model of temperament and character," Arch Gen Psychiatry, 1993;50:975-90 ("Cloninger 1993").

[0263] Comings, D. E., et at., "Neurogenetic interactions and aberrant behavioral comorbidity of attention deficit hyperactivity disorder (ADHD): dispelling myths," Theor Biol Med Model, 2005;2:50,10.1186/1742-4682-2-50 ("Comings 2005").

[0264] Comings, D. E., "Clinical and molecular genetics of ADHD and Tourette syndrome.
Two related polygenic disorders," Ann N Y Acad Sci., 2001;931:50-83 ("Comings 2001").

[0265] Comings, D. E., et at., "Reward deficiency syndrome: genetic aspects of behavioral disorders," Prog Brain Res., 2000;126:325-41,10.1016/S0079-6123(00)26022-6 ("Comings I
2000").

[0266] Comings, D. E., et at., "Multivariate analysis of associations of 42 genes in ADHD, ODD and conduct disorder," Clin Genet., 2000;58:31-40 ("Comings 11 2000").

[0267] Comings, D. E., et at., "Polygenic inheritance of Tourette syndrome, stuttering, attention deficit hyperactivity, conduct, and oppositional defiant disorder:
the additive and subtractive effect of the three dopaminergic genes ¨ DRD2, D beta H, and DAT1," Am J Med Genet., 1996;67:264-88 ("Comings 1996").

[0268] Comings, D. E., et at., "The dopamine D2 receptor locus as a modifying gene in neuropsychiatric disorders," JAMA, 19910ct2;266(13)1:1793-800 ("Comings 1991").

[0269] Conners, C. K, CRS-R (Conners' Rating Scales-Revised), Minneapolis, MN:
Pearson Assessment Group; 2006 ("Conners 2006").

[0270] Cook, E. H., Jr., et at., "Association of attention-deficit disorder and the dopamine transporter gene," Am J Hum Genet., 1995;56:993-8 ("Cook 1995").

[0271] DeFrance, J. F., et at., "Enhancement of attentional processing by Kantroll in healthy humans: A pilot study," Clin Electroencephalography, 1977;28:68-75 ("DeFrance 1977").

[0272] Dougherty, D. D., et at., "Dopamine transporter density in patients with Attention Deficit Hyperactivity Disorder," Lancet., 1999Dec18-25;354(9196): 2132-3 ("Dougherty 1999").

[0273] Dragan, W. L., et at., "The association between dopamine D4 receptor exon III
polymorphism and intensity of PTSD symptoms among flood survivors," Anxiety Stress Coping, 2009;22:483-95,10.1080/10615800802419407 ("Dragan 2009").

[0274] Dresel, S., et at., "Attention Deficit Hyperactivity Disorder: binding of99mTcTRODAT-1 to the dopamine transporter before and after methylphenidate treatment,"
European Journal of Nuclear Medicine, 2000;27(10): 1518-1524 ("Dresel 2000").

[0275] Dyr, W., et at., "Effects of D1 and D2 dopamine receptor agents on ethanol consumption in the high-alcohol-drinking (HAD) line of rats, Alcohol, 1993;10:207-12 ("Dyr 1993").

[0276] Faraone, S. V., "Molecular Genetics of Attention Deficit Hyperactivity Disorder,"
Psychiatr Clin North Am., 2010Mar;33 (1) : 159-180 ("Faraone 2010").

[0277] Faraone, S. V., "Report from the 4th international meeting of the attention deficit hyperactivity disorder molecular genetics network," Am J Med Genet B
Neuropsychiatr Genet., 2003;121:55-9 ("Faraone 2003").

[0278] Faraone, S. V., et at., "A family-genetic study of girls with DSM-III
attention deficit disorder," Am J Psychiatry, 1991;148:112-7 ("Faraone 1991").

[0279] Farde, L., et at., "D2 dopamine receptors and personality traits," Nature, 1997;385(6617): 590 ("Farde 1997").

[0280] Febo, M., et at., "Dopamine homeostasis: brain functional connectivity in reward deficiency syndrome," Front Biosci. (Landmark Ed.), 2017;22:669-91,10.2741/4509 ("Febo 2017").

[0281] Gadow, K. D., et al., "Methylphenidate in hyperactive boys with comorbid tic disorder:
II.
Short-term behavioral effects in school settings," J Am Acad Child Adolesc Psychiatry, 1992;31:462-71 ("Gadow 1992").

[0282] Gervasini, G., et at., "Effect of dopamine receptor D4 (DRD4) haplotypes on general psychopathology in patients with eating disorders," Gene, 2018;10.1016/j .gene.2018.02.035 ("Gervasini 2018").

[0283] Gill, M., et at., "Confirmation of association between attention deficit hyperactivity disorder and a dopamine transporter polymorphism," Mot Psychiatry, 1997;2:311-3 ("Gill 1997").

[0284] Girault, J. A., et at., "The neurobiology of dopamine signaling," Arch Neurol., 2004; 61(5): 641-4 ("Girault 2004").

[0285] Hasler, R., et at., "Inter-hemispherical asymmetry in default-mode functional connectivity and BAIAP2 gene are associated with anger expression in ADHD
adults,"
Psychiatry Research: Neuroimaging, 2017Nov;269:54-61 ("Hasler 2017").

[0286] Hawi, Z., et at., "Linkage disequilibrium mapping at DAT1, DRD5 and DBH
narrows the search for ADHD susceptibility alleles at these loci," Mot Psychiatry, 2003Mar;8(3):299-308 ("Hawi 2003")

[0287] Heiser, P., et at., "Molecular genetic aspects of attention-deficit/hyperactivity disorder," Neurosci Biobehav Rev., 2004;28:625-41 ("Heiser 2004").

[0288] Hiebel, A. C., et at., "Probes for narcotic receptor mediated phenomena. 34. synthesis and structure-activity relationships of a potent mu-agonist delta-antagonist and an exceedingly potent antinociceptive in the enantiomeric C9-substituted 5-(3-hydroxypheny1)-N-phenylethylmorphan series," J Med Chem., 2007;50:65-75 ("Hiebel 2007").

[0289] Howell, D. C., et at., "Fifteen-year follow-up of a behavioral history of attention deficit disorder," Pediatrics, 1985;76:185-90 ("Howell 1985").

[0290] Huang, Y., et at., "Transmission disequilibrium test of DRD4 exon III
48bp variant number tandem repeat polymorphism and tic disorder," Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 2002;19:100-3 ("Huang 2002").

[0291] Imperato, A., et at., "Effects of locally applied D-1 and D-2 receptor agonists and antagonists studied with brain dialysis," Eur J Pharmacol., 1988;156:385-93 ("Imperato 1988").

[0292] Inkster, B., et at., "Linkage disequilibrium analysis of the dopamine beta-hydroxylase gene in persistent attention deficit hyperactivity disorder," Psychiatr Genet., 2004;14:117-20 ("Inkster 2004").

[0293] Jensen, 0., et at., "Frontal theta activity in humans increases with memory load in a working memory task," Eur. J. Neuroscience, 2002;15:1395-1399 ("Jensen 2002").

[0294] Jonsson, E., et at., "Dopamine-related genes and their relationships to monoamine metabolites in CSF," Blot Psychiatry, 1996;40:1032-43 ("Jonsson 1996").

[0295] Kemppainen, N., et at., "Hippocampal dopamine D2 receptors correlate with memory functions in Alzheimer's disease," Eur J Neurosci., 2003Jul;18(1):149-154 ("Kemppainen 2003").

[0296] Kent, L., et al., "Association of the paternally transmitted copy of common Valine allele of the Va166Met polymorphism of the brain-derived neurotrophic factor (BDNF) gene with susceptibility to ADHD,"Mol Psychiatry, 2005;10:939-43 ("Kent 2005").

[0297] Kessler, R. C., et at., "The prevalence and correlates of adult ADHD in the United States: Results from the National Comorbidity Survey Replication," Am J
Psychiatry, 2006Apr; 163 (4): 716-23 ("Kessler 2006").

[0298] Kimberg, D. Y., et al., "Effects of bromocriptine on human subjects depend on working memory capacity," Neuroreport., 1997;8:3581-5 ("Kimberg 1997").

[0299] Kirley, A., et at., "Association of the 480 bp DAT I allele with methylphenidate response in a sample of Irish children with ADHD," Am J Med Genet B
Neuropsychiatr Genet., 2003;121:50-4 ("Kirley 2003").

[0300] Koob, G. F., et at., "Cellular and molecular mechanisms of drug dependence," Science, 1988;242(4879):715-723 ("Koob 1988").

[0301] Krause, J., et at., "ADHD in adolescence and adulthood, with a special focus on the dopamine transporter and nicotine. Dialogues," Clin Neurosci., 2006;8:29-36 ("Krause 2006").

[0302] Krause, J., et at., "Influence of striatal dopamine transporter availability on the response to methylphenidate in adult patients with ADHD, "Europ Arch Psychiatry Clin Neurosci," 2005;255:428-31 ("Krause 2005").

[0303] Krause, J., et at., "The dopamine transporter and neuroimaging in attention deficit hyperactivity disorder," Neurosci Biobehav Rev., 2003;27:605-13 ("Krause 2003").

[0304] Krause, K. H., et at., "Increased striatal dopamine transporter in adult patients with Attention Deficit Hyperactivity Disorder: Effects of methylphenidate as measured by single photon emission computerized tomography," Neurosci Lett., 2000May12;285(2):107-("Krause 2000").

[0305] la Fougere, C., et at., "Value of 99mTc-TRODAT-1 SPECT to predict clinical response to methylphenidate treatment in adults with attention deficit hyperactivity disorder," Nuclear Med Commun., 2006;27:733-7 ("la Fougere 2006").

[0306] LaHoste, G. J., et at., "Dopamine D4 receptor gene polymorphism is associated with attention deficit hyperactivity disorder," Mot Psychiatry, 1996;1:121-4 ("LaHoste 1996").

[0307] Larsson, H., et at., "Genetic contributions to the development of ADHD
subtypes from childhood to adolescence," J Am Acad Child Adolesc Psychiatry, 2006;45:973-81 ("Larsson 2006").

[0308] Laurin, N., et at., "Association of the calcyon gene (DRD HP) with attention deficit/hyperactivity disorder," Mot Psychiatry, 2005;10:1117-25 ("Laurin 2005").

[0309] Le Moal, M., et at., "Mesocorticolimbic dopaminergic network:
functional and regulatory roles," Physiol Rev., 1991;71:155-234 ("Le Moat 1991").

[0310] Lee, H. J., et at., "D2 and D4 dopamine receptor gene polymorphisms and personality traits in a young Korean population," Am J Med Genet B Neuropsychiatr Genet., 2003;121:44-9 ("Lee 2003").

[0311] Lenartowicz, A. G., et at., "Electroencephalography correlates of spatial working memory deficits in Attention-Deficit/Hyperactivity Disorder: Vigilance, encoding, and maintenance," Journal of Neuroscience, 2014;34(4): 1171-1182 ("Lenartowicz 2014").

[0312] Li, D., et at., "Meta-analysis shows significant association between dopamine system genes and attention deficit hyperactivity disorder (ADHD)," Hum Mot Genet., 2006;15:2276-84 ("Li 2006").

[0313] Lou, H. C., et at., "The striatum in a putative cerebral network activated by verbal awareness in normals and in ADHD children," Eur J Neurol., 1998;5:67-74 ("Lou 1998").

[0314] Lubar, J. F., "Discourse on the development of EEG diagnostics and biofeedback for attention-deficit/hyperactivity disorders.," Biofeedback Self Regul., 1991;16:201-25 ("Lubar 1991").

[0315] Madras, B. K., et at., "The dopamine transporter and attention-deficit/hyperactivity disorder," Biol Psychiatry, 2005;57:1397-409 ("Madras 2005").

[0316] Makris, N., et at., "Cortical thinning of the attention and executive function networks in adults with Attention-Deficit\Hyperactivity Disorder," Cerebral Cortex, 2007;17(6):1364-1375 ("Makris 2007").

[0317] Malison, R. T., et at., "123Ibeta-CIT SPECT imaging of striatal dopamine transporter binding in Tourette' s disorder," Am J Psychiatry, 1995;152:1359-61 ("Mat/son 1995").

[0318] Mandel, R. J., et at., "A quantitative estimate of the role of striatal D-2 receptor proliferation in dopaminergic behavioral supersensitivity: the contribution of mesolimbic dopamine to the magnitude of 6-0HDA lesion-induced agonist sensitivity in the rat," Behav Brain Res., 1993;59:53-64,10.1016/0166-4328(93)90151-F ("Mandel 1993").

[0319] McBride, W. J., et at., "Regional serotoninlA receptors in the CNS of alcohol-preferring and -nonpreferring rats," Pharmacol Biochem Behay., 1994;49:7-12 ("McBride 1994").

[0320] McBride, W. J., et al., "Densities of dopamine D2 receptors are reduced in CNS regions of alcohol-preferring P rats," Alcohol, 1993;10:387-90 ("McBride 1993").

[0321] McLaughlin, T., et at., "Improvement of long-term memory as measured by semantic verbal fluency with acute intake of a pro-dopamine regulator (liquid nano variant KB220Z) in an elderly male: Are we targeting dopamine tone?" I Syst Integ Neurosci., 2017May;3(3), 10.15761/JSIN.1000165 ("McLaughlin 2017").

[0322] Mill, J., et at., "Prediction of heterogeneity in intelligence and adult prognosis by genetic polymorphisms in the dopamine system among children with attention-deficit/hyperactivity disorder: evidence from 2 birth cohorts," Arch Gen Psychiatry, 2006;63:462-9 ("Mill 2006").

[0323] Miller, D., et at., Overload: Attention deficit disorder and the addictive brain, Salt Lake City, Utah: Woodland Publishing Company; 2008 ("Miller 2008").

[0324] Nieoullon, A., "Dopamine and the regulation of cognition and attention," Progress in Neurobiology, 2002;67:53-83 ("Nieoullon 2002").

[0325] Noble, E. P, "D2 dopamine receptor gene in psychiatric and neurologic disorders and its phenotypes," Am J Med Genet B Neuropsychiatr Genet., 2003;116:103-25 ("Noble 2003").

[0326] Noble, E. P., et al., "D2 dopamine receptor polymorphism and brain regional glucose metabolism," Am J Med Genet., 1997;74:162-6 ("Noble 1997").

[0327] Noble, E. P., et al., "Prolonged P300 latency in children with the D2 dopamine receptor Al allele," Am J Hum Genet., 1994;54:658-68 ("Noble 1994").

[0328] Noble, E. P., et al., "Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism," Arch Gen Psychiatry, 1991Jul;48(7):648-54 ("Noble 1991").

[0329] Olds, J., "A preliminary mapping of electrical reinforcing effects in the rat brain," J
Comp Physiol Psychol, 1956;49:281-5 ("Olds 1956").

[0330] 011at, H., et al., Progress in alcohol research, Utrecht, Netherlands:VSP; 1990, ("Alcohol and behaviour: basic and clinical aspects"), 285 ("011at 1990").

[0331] Onton, J., et al., "Frontal midline EEG dynamics during working memory,"
Neuroimage, 2005;27:341-356 ("Onton 2005").

[0332] Ortiz, J., et al., "Biochemical actions of chronic ethanol exposure in the mesolimbic dopamine system," Synapse, 1995;21:289-98 ("Ortiz 1995").

[0333] Pauls, D. L., et al., "The inheritance of Gilles de la Tourette's syndrome and associated behaviors. Evidence for autosomal dominant transmission," N Engl J Med.
1986;315:993-7 ("Pauls 1986").

[0334] Perwien, A. R., et al., "Atomoxetine treatment in children and adolescents with attention-deficit hyperactivity disorder: what are the long-term health-related quality-of-life outcomes?" J Child Adolesc Psychopharmacol., 2006;16:713-24 ("Penvien 2006").

[0335] Pohjalainen, T., et al., "The Al allele of the human D2 dopamine receptor gene predicts low D2 receptor availability in healthy volunteers," Mot Psychiatry, 1998;3 :256-60 ("Pohjalainen 1998").

[0336] Polanczyk, G., et at., "The world-wide prevalence of ADHD: A systematic review and metaregres si on analysis," Am J Psychiatry, 2007June; 164 : 6,942-948 ("Polanczyk 2007").

[0337] Rothman, R. B., et at., "Dual dopamine/serotonin releasers as potential medications for stimulant and alcohol addictions," AAPS1, 2007;9:E1-10 ("Rothman 2007").

[0338] Russell, V. A., et at., "Effect of ethanol on 3Hdopamine release in rat nucleus accumbens and striatal slices," Neurochem Res., 1988;13:487-92 ("Russell 1988").

[0339] Safer, D. J., "A familial factor in minimal brain dysfunction," Behav Genet., 1973;3:175-86 ("Safer 1973").

[0340] Seamans, J. K., et al., "The principal features and mechanisms of dopamine modulation in the prefrontal cortex," Prog Neurobiol., 20045ep;74(1):1-58 ("Seamans 2004").

[0341] Seeman, P., et at., "Anti-hyperactivity medication: methylphenidate and amphetamine," Mot Psychiatry, 1998;3 :386-96 ("Seeman 1998").

[0342] Shaw, P., et at., "Polymorphisms of the dopamine d4 receptor, clinical outcome, and cortical structure in attention-deficit/
hyperactivity disorder," Arch Gen Psychiatry, 2007;64:921-31 ("Shaw 2007").

[0343] Shaywitz, B. A., et at., "Selective brain dopamine depletion in developing rats: an experimental model of minimal brain dysfunction," Science, 1976;191(4224):305-("Shaywitz 1976").

[0344] Smith, K. M., et at., "Identification and characterization of human polymorphisms in attention deficit hyperactivity disorder," Am J Med Genet B
Neuropsychiatr Genet., 2005;133:57-63 ("Smith 2005").

[0345] Spencer, T. J., et at., "Atomoxetine and adult attention-deficit/hyperactivity disorder:
the effects of comorbidity," J Clin Psychiatry, 2006;67:415-20 ("Spencer 2006").

[0346] Spencer, T., et at., "An open-label, dose-ranging study of atomoxetine in children with attention deficit hyperactivity disorder," J Child Adolesc Psychopharmacol., 2001;11:251-65 ("Spencer 2001").

[0347] Stein, L., et at., "Second messengers, natural rewards, and drugs of abuse," Clin Neuropharmacol,. 1986;9(Suppl 4):205-7 ("Stein 1986").

[0348] Steinberg, B., et at., "Low-resolution electromagnetic tomography (LORETA) of changed brain function provoked by pro-dopamine regulator (KB220Z) in one adult ADHD
case," Open J Clin Med Case Rep., 2016;1121 ("Steinberg 2016").

[0349] Swanson, J. M., et at., "Etiologic subtypes of attention-deficit/hyperactivity disorder:
brain imaging, molecular genetic and environmental factors and the dopamine hypothesis," Neuropsychol Rev., 2007;17:39-59 ("Swanson 2007").

[0350] Takahashi, H., et at., "Functional significance of central D1 receptors in cognition:
Beyond working memory," J. Cereb Blood Flow & Metab. 2012Jul;32(7):1248-1258 ("Takahashi 2012").

[0351] Takahashi, H., et at., "Memory and frontal lobe functions: Possible relations with dopamine D2 receptors in the hippocampus," Neuroimage, 2007Feb15;34(4):1643-9 ("Takahashi 2007").

[0352] Takahashi, H. et at., "SV. Attention-deficit hyperactivity disorder,"
Thelancet.com, 2005,Jul 16;366:237-246 ("Takahashi 2005").

[0353] Thanos, P. K., et at., "D2R DNA transfer into the nucleus accumbens attenuates cocaine self-administration in rats." Synapse, 2008;62:481-6,10.1002/syn.20523 ("Thanos 2008").

[0354] Thanos, P. K., et at., "Effects of chronic oral methylphenidate on cocaine self-administration and striatal dopamine D2 receptors in rodents," Pharmacol Biochem Behay., 2007;87:426-33 ("Thanos 2007").

[0355] Thanos, P. K., et al., "Dopamine D2R DNA transfer in dopamine D2 receptor-deficient mice: effects on ethanol drinking," Life Sc., 2005;77:130-9,10.1016/j .1fs.2004.10.061 ("Thanos 2005").

[0356] TOVA (Test of Variables of Attention), Los Alamitos, CA: The TOVA
Company;
2006 ("TOVA 2006").

[0357] Turic, D., et at., "A family based study implicates solute carrier family 1-member 3 (SLC1A3) gene in attention-deficit/hyperactivity disorder," Blot Psychiatry, 2005a;57:1461-6 ("Turic 12005").

[0358] Turic, D., et at., "A family based study of catechol-O-methyltransferase (COMT) and attention deficit hyperactivity disorder (ADHD)," Am J Med Genet B
Neuropsychiatr Genet., 2005b;133:64-7 ("Turic 11 2005").

[0359] Visser, S. N., et at., "Trends in the parent-report of health care provider-diagnosed and medicated attention-deficit/hyperactivity disorder: United States, 2003-2011,"
J Am Acad Child Adolsec Psychiatry, 2014Jan;53 (1): 34-46. e2 .PMID :24342384 ("Visser 2014").

[0360] Volkow, N. D., et at., "Depressed dopamine activity in caudate and preliminary evidence of limbic involvement in adults with attention-deficit/hyperactivity disorder," Arch Gen Psychiatry, 2007;64:932-40 ("Volkow 2007").

[0361] Volkow, N. D., et al., "Therapeutic doses of oral methylphenidate significantly increase extracellular dopamine in the human brain," Journal of Neuroscience, 2001;21:
1-5 ("Volkow 2001").

[0362] Volkow, N. D., et at., "Is methylphenidate like cocaine? Studies on their pharmacokinetics and distribution in the human brain," Arch Gen Psychiatry, 1995;52:456-63 ("Volkow 1995").

[0363] Waldman, I. D., et at., "The relation between childhood antisocial behavior and the dopamine transporter gene (DAT1). Mediation via hyperactivity-impulsivity," Am J Med Gen B Neuropsychiatr Genet, 1998;81:451-556 ("Waldman 1998").

[0364] Wallis, D., et at., "Genetics of attention deficit/hyper-activity disorder, J Pediatr Psychol., 2008Jun3;Epub ahead of print ("Wallis 2008").

[0365] Weiss, G., et at., Hyperactive children grown up, 2nd. Ed. New York:
Guilford Press.
1993 ("Weiss 1993").

[0366] Welner, Z., et at., "A controlled study of siblings of hyperactive children," J Nery Ment Dis., 1977;165:110-7 ("Weiner 1977").

[0367] Wilens, T. E., et at., "Characteristics of adolescents and young adults with ADHD who divert or misuse their prescribed medications," J Am Acad Child Adolesc Psychiatry, 2006;45:408-14 ("Wilens 2006").

[0368] Willerman, L., "Activity level and hyperactivity in twins," Child Dev., 1973;44:288-93 ("Willerman 1973").

[0369] Winsberg, B. G., et at., "Association of the dopamine transporter gene (DAT1) with poor methylphenidate response," J Am Acad Child Adolesc Psychiatry, 1999;38:1474-7 ("Winsberg 1999").

[0370] Wise, R. A., et at., "Brain reward circuitry: four circuit elements 'wired' in apparent series," Brain Res Bull., 1984;12:203-8 ("Wise 1984").

[0371] Wolf, S. S., et at., "Tourette syndrome: prediction of phenotypic variation in monozygotic twins by caudate nucleus D2 receptor binding. Science,"
1996;273(5279):1225-7 ("Wolf 1996").

[0372] Wolraich, M. L., et at., "Examination of DSM-IV criteria for attention deficit/hyperactivity disorder in a county-wide sample," J Dev Behav Pediatr., 1998;19:162-8 ("Wolraich 1998").

[0373] Zametkin, A. J., et at., "Cerebral glucose metabolism in adults with hyperactivity of childhood onset," N Engl J Med., 1990;323:1361-6 ("Zametkin 1990").

[0374] Zhou, F. C., et at., "Immunostained serotonergic fibers are decreased in selected brain regions of alcohol-preferring rats," Alcohol, 1991;8:425-31 ("Zhou 1991").

[0375] Zhou, H. et at., "Genetic Risk Variants Associated With Comorbid Alcohol Dependence and Major Depression," AMA Psychiatry, 2017;74(12):1234-1241 ("Zhou 2017").

Claims (28)

PCT/US2020/028870What is claimed is:

1. A method comprising the steps of:
obtaining a biological sample from a subject; and (ii) performing an allelic analysis on the biological sample to detect the presence of a plurality of predetermined alleles in the biological sample, wherein the plurality of predetermined alleles comprise:
(a) one or more alleles of BAIAP2, wherein the one or more BAIAP2 alleles comprise one or more of polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) one or more alleles of CHRNA4, wherein the one or more CHRNA4 alleles comprise one or more of polymorphisms rs2273505 and rs3787141;
(c) one or more alleles of COMT, wherein the one or more COMT alleles comprise one or more of polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) one or more alleles of DAT1, which the one or more DAT1 alleles comprise one or more of polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) one or more alleles of DBH, wherein the one or more DBH alleles comprise polymorphism rs1108580;

one or more alleles of DRD1, wherein the one or more DRD1 alleles comprise polymorphism rs4532;
(g) one or more alleles of DRD2, wherein the one or more DRD2 alleles comprise polymorphism rs1800497;
(h) one or more alleles of DRD3, wherein the one or more DRD3 alleles comprise polymorphism rs6280;
one or more alleles of DRD4, wherein the one or more DRD4 alleles comprise one or more of polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);
one or more alleles of DRD5, wherein the one or more DRD5 alleles comprise one or more of polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/ 148-bp allele;
(k) one or more alleles of HTR1B, wherein the one or more HTR1B
alleles comprise polymorphism rs6296;
(1) one or more alleles of OPRM1, wherein the one or more OPRM1 alleles comprise polymorphism rs1799971;
(m) one or more alleles of SNAP25, wherein the one or more SNAP25 alleles comprise one or more of polymorphisms rs66039806, rs362549, rs362987 and rs362998;
(n) one or more alleles of HTTLPR, wherein the one or more HTTLPR
alleles comprise polymorphism rs25531;
(o) one or more alleles of MAOA, wherein the one or more MAOA alleles comprise polymorphism 30 bp repeat (promoter, X chrom only); and (p) one or more alleles of GABRB3, wherein the one or more alleles comprise polymorphism CA-Repeat (171-201 bases, X chrom only).

2. The method of Claim 1 further comprising the steps of:
identifying each of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample;
(ii) assigning a count for each of the alleles in the plurality of pre-determined alleles that was detected to be present in the biological sample, wherein the count for a particular allele is the number of the particular allele detected to be present in the biological sample;
(iii) determining a risk score for the subject based upon the count, wherein (a) the risk score is the sum of the counts, and (b) the risk score identifies a severity of the genetic risk for attention deficit/hyperactivity disorder (ADHD), (iv) administering treatment based upon the severity of the genetic addition risk identified for the subject, wherein, (a) the treatment comprises providing precision addictive/behavioral management based upon the severity of the genetic risk for ADHD, and (b) the precision addictive/behavioral management comprises providing one or more neuro nutrient treatments that are targeted to the subject based upon the identification of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample.

3. The method of Claims 1 or 2, wherein the plurality of predetermined alleles further comprise at least one of:
(i) the one or more DRD4 alleles further comprise polymorphism rs4646983;
(ii) one or more alleles of SEMA3A, wherein the one or more SEMA3A alleles comprise polymorphism rs139438618; and (iii) one or more allelles of Amelo.

4. The method of Claims 1-2 or 3, wherein the plurality of predetermined alleles comprise:
(a) two or more alleles of BAIAP2, wherein the two or more BAIAP2 alleles comprise two or more of the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) two or more alleles of CHRNA4, wherein the two or more CHRNA4 alleles comprise the polymorphisms rs2273505 and rs3787141;
(c) two or more alleles of COMT, wherein the two or more COMT alleles comprise two or more of the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) two or more alleles of DAT1, which the two or more DAT1 alleles comprise two or more of the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) two or more alleles of DRD4, wherein the two or more DRD4 alleles comprise two or more of the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);

(f) two or more alleles of DRD5, wherein the two or more DRD5 alleles comprise the polymorphisms VNTR in exon 8/3-repeat allele and dinucleotide repeat/
148-bp allele; and (g) two or more alleles of SNAP25, wherein the two or more SNAP25 alleles comprise two or more of the polymorphisms rs66039806, rs362549, rs362987 and rs362998.

5. The method of Claims 1-2 or 3, wherein:
(a) the one or more BAIAP2 alleles comprise the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) the one or more CHRNA4 alleles comprise the polymorphisms rs2273505 and rs3787141;
(c) the one or more COMT alleles comprise the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) the one or more DAT1 alleles comprise the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) the one or more DRD4 alleles comprise the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);
(f) the one or more DRD5 alleles comprise the polymorphisms VNTR in exon repeat allele and dinucleotide repeat/ 148-bp allele; and (g) the one or more SNAP25 alleles comprise the polymorphisms rs66039806, rs362549, rs362987 and rs362998.

6. The method of Claim 5, wherein the plurality of predetermined alleles further comprise:
(i) the one or more DRD4 alleles further comprise polymorphism rs4646983;
(ii) the plurality of predetermined alleles further comprises the SEMA3A
allele comprising polymorphism rs139438618; and (iii) the plurality of predetermined alleles further comprises the allelle of Amelo.
7. The method of Claims 1 or 2, wherein (a) the one or more BAIAP2 alleles consist of the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) the one or more CHRNA4 alleles consist of the polymorphisms rs2273505 and rs3787141;
(c) the one or more COMT alleles consist of the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) the one or more DAT1 alleles consist of the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) the one or more DBH alleles consist of the polymorphism rs1108580;
(f) the one or more a DRD1 alleles consist of the polymorphism rs4532;
(g) the one or more DRD2 alleles consist of polymorphism rs1800497;
(h) the one or more DRD3 alleles consist of the polymorphism rs6280;
(i) the one or more DRD4 alleles consist of the polymorphisms rs1800955, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);

(j) the one or more DRD5 alleles consist of the polymorphisms VNTR in exon repeat allele and dinucleotide repeat/ 148-bp allele;
(k) the one or more HTR1B alleles consist of the polymorphism rs6296;
(1) the one or more OPRM1 alleles consist of the polymorphism rs1799971;
(m) the one or more SNAP25 alleles consist of the polymorphisms rs66039806, rs362549, rs362987 and rs362998;
(n) the one or more HTTLPR alleles consist of the polymorphism rs25531;
(o) the one or more MAOA alleles consist of the polymorphism 30 bp repeat (promoter, X chrom only); and (p) the one or more GABRB3 alleles consist of the polymorphism CA-Repeat (171-201 bases, X chrom only).

7. The method of Claims 1 or 2, wherein (a) the one or more BAIAP2 alleles consist of the polymophisms rs8079626, rs8079781, rs7210438, and rs4969385;
(b) the one or more CHRNA4 alleles consist of the polymorphisms rs2273505 and rs3787141;
(c) the one or more COMT alleles consist of the polymorphisms rs6269, rs4818, rs4633, rs933271, rs1544325, rs740603, rs740601, rs4646316, rs174696, rs165774, rs9332377, rs165599, rs2020917, and rs4680;
(d) the one or more DAT1 alleles consist of the polymorphisms rs460700, rs37020, rs13161905, rs27048, rs6347, rs11133767, rs40184, rs2975292, rs2652511, VNTR IN 3-UTR/10-repeat allele, and 40bp repeat (exon 15);
(e) the one or more DBH alleles consist of the polymorphism rs1108580;
(f) the one or more a DRD1 alleles consist of the polymorphism rs4532;

(g) the one or more DRD2 alleles consist of polymorphism rs1800497;
(h) the one or more DRD3 alleles consist of the polymorphism rs6280;
the one or more DRD4 alleles consist of the polymorphisms rs1800955, rs4646983, rs4646984, rs3758653, rs936465, VNTR in exon 3/7 repeat allele, VNTR in exon 3/5 repeat allele, and 7-11 repeats of 48bp (intron 3);
(j) the one or more DRD5 alleles consist of the polymorphisms VNTR in exon

8/3-repeat allele and dinucleotide repeat/ 148-bp allele;
(k) the one or more HTR1B alleles consist of the polymorphism rs6296;
(1) the one or more OPRM1 alleles consist of the polymorphism rs1799971;
(m) the one or more SNAP25 alleles consist of the polymorphisms rs66039806, rs362549, rs362987 and rs362998;
(n) the one or more HTTLPR alleles consist of the polymorphism rs25531;
(o) the one or more MAOA alleles consist of the polymorphism 30 bp repeat (promoter, X chrom only); and (p) the one or more GABRB3 alleles consist of the polymorphism CA-Repeat (171-201 bases, X chrom only).

9. The method of Claims 7 or 8, wherein the plurality of predetermined alleles further comprise:
the SEMA3 a allele consi sts of polymorphi sm rs139438618; and (iii) at least one of the alleles of Amelo.

10. The method of Claims 1-2, 4-5, 7, or 8, wherein the plurality of predetermined alleles consists of:
(a) the one or more alleles of BAIAP2;

(b) the one or more alleles of CHRNA4;
(c) the one or more alleles of COMT;
(d) the one or more alleles of DAT1;
(e) the one or more alleles of DBH;
the one or more alleles of DRD1;
(g) the one or more alleles of DRD2;
(h) the one or more alleles of DRD3;
(i) the one or more alleles of DRD4;
the one or more alleles of DRD5;
(k) the one or more alleles of HTR1B;
(1) the one or more alleles of OPRM1;
(m) the one or more alleles of SNAP25;
(n) the one or more alleles of HTTLPR;
(o) the one or more alleles of MAOA; and (p) the one or more alleles of GABRB3.

11. The method of Claims 3, 6, or 9, wherein the plurality of predetermined alleles consists of:
(a) the one or more alleles of BAIAP2;
(b) the one or more alleles of CHRNA4;
(c) the one or more alleles of COMT;
(d) the one or more alleles of DAT1;
(e) the one or more alleles of DBH;
the one or more alleles of DRD1;
(g) the one or more alleles of DRD2;

(h) the one or more alleles of DRD3;
the one or more alleles of DRD4;
the one or more alleles of DRD5;
(k) the one or more alleles of HTR1B;
(1) the one or more alleles of OPRM1;
(m) the one or more alleles of SNAP25;
(n) the one or more alleles of HTTLPR;
(o) the one or more alleles of MAOA;
(p) the one or more alleles of GABRB3;
(q) the one or more alleles of SEMA3A; and (r) the one or more alleles of Amelo.

12. The method of Claims 2-10 or 11, wherein the risk score in a first pre-determined range identifies a lower increased genetic risk for ADHD, (ii) the risk score in a second pre-determined range identifies a higher increased genetic risk for ADHD; and (iii) for a higher increased genetic risk for ADHD identified subject, the treatment comprises providing the precision addictive/behavioral management tailored for persons with higher increased genetic risk for ADHD.

13. The method of Claim 12, wherein (a) the first pre-determined range is between 0% and 33% of the number of alleles in the plurality of predetermined alleles; and (b) the second pre-determined range is between 33% and 100% of the number of alleles in the plurality of predetermined alleles.

14. The method of Claims 12 or 13, wherein the risk score in a third pre-determined range identifies a moderate increased genetic risk for ADHD.

15. The method of Claim 14, wherein, for a moderate increased genetic risk for ADHD
identified subject, the treatment comprises providing the precision addictive/behavioral management tailored for persons with moderate increased genetic risk for ADHD.

16. The method of Claims 14 or 15, wherein (a) the first pre-determined range is between 0% and 33% of the number of alleles in the plurality of predetermined alleles;
(b) the third pre-determined range is between 33% and 67% of the number of alleles in the plurality of predetermined alleles; and (c) the second pre-determined range is between 67% and 100% of the number of alleles in the plurality of predetermined alleles.

17. The method of Claims 12-15 or 16, wherein, for a lower increased genetic risk for ADHD identified subject, the treatment comprises providing the precision addictive/behavioral management tailored for persons with lower increased genetic risk for ADHD.

18. The method of Claims 2-16 or 17, wherein the treatment further comprises promoting a pro-dopamine lifestyle for the subject.

19. The method of Claim 18, wherein the pro-dopamine lifestyle is selected from a group consisting of talk therapies, life-style measures, support systems, mindfulness training, and neurofeedback.

20. The method of Claim 19, wherein the life-style measures comprise a measure selected from a group consisting of diet, exercise, yoga, and meditation.

21. The method of Claims 18-19 or 20, wherein the treatment further comprise a drug screen to monitor outcomes of the subject.

22. The method of Claim 21, wherein the drug screen comprises a urine drug screen.

23. The method of Claims 2-21 or 22, wherein the subject regains dopamine homeostasis.

24. The method of Claims 2-22 or 23, wherein the method reduces one or more of stress, craving, and relapse of the subject.

26. The method of Claim 1 further comprising the steps of:
identifying each of the alleles in the plurality of predetermined alleles that was detected to be present in the biological sample;
(ii) assigning a count for each of the alleles in the plurality of pre-determined alleles that was detected to be present in the biological sample, wherein the count for a particular allele is the number of the particular allele detected to be present in the biological sample;
(iii) determining a risk score for the subject based upon the count, wherein (a) the risk score is the sum of the counts, and (b) the risk score identifies a severity of the genetic risk for a reward deficiency syndrome behavior, (c) the risk score in a first pre-determined range identifies a lower increased genetic risk for the reward deficiency syndrome behavior, and (d) the risk score in a second pre-determined range identifies a higher increased genetic risk for the reward deficiency syndrome behavior;
(iii) for a higher increased genetic risk for reward deficiency syndrome behavior identified subject, the treatment comprises treating the subject for the reward deficiency syndrome behavior and further comprises entry of the subject in a residential treatment program for the reward deficiency syndrome behavior of the subject and medically monitoring the reward deficiency syndrome behavior of the subject.

26. The method of Claim 25, wherein the reward deficiency syndrome behavior is selected from a group consisting of addictive behaviors, impulse behaviors, obsessive compulsive behaviors, personality disorder behaviors, and combinations thereof.

27. The method of Claims 1-25 or 26, wherein the step of performing the allelic analysis comprises utilizing a kit for detecting the presence of the plurality of predetermined alleles in the biological sample.

28. A kit that can be utilized to performing the allelic analysis for detecting the present of the plurality of predetermined alleles in the biological sample comprising the methods of Claims 1-26 or 27.