US20130081151A1 - Molecular Engineering Of A Floral Inducer For Crop Improvement - Google Patents

Molecular Engineering Of A Floral Inducer For Crop Improvement Download PDF

Info

Publication number
US20130081151A1
US20130081151A1 US13/564,936 US201213564936A US2013081151A1 US 20130081151 A1 US20130081151 A1 US 20130081151A1 US 201213564936 A US201213564936 A US 201213564936A US 2013081151 A1 US2013081151 A1 US 2013081151A1
Authority
US
United States
Prior art keywords
plant
flowering
amino acid
modified
modification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
US13/564,936
Other versions
US9238820B2 (en
Inventor
Yiguo Hong
Steve Jackson
Chunyang Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Warwick
Original Assignee
University of Warwick
Plant Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Warwick, Plant Bioscience Ltd filed Critical University of Warwick
Assigned to THE UNIVERSITY OF WARWICK, PLANT BIOSCIENCE LIMITED reassignment THE UNIVERSITY OF WARWICK ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HONG, YIGUO, JACKSON, STEVE, LI, CHUNYANG
Publication of US20130081151A1 publication Critical patent/US20130081151A1/en
Application granted granted Critical
Publication of US9238820B2 publication Critical patent/US9238820B2/en
Assigned to THE UNIVERSITY OF WARWICK reassignment THE UNIVERSITY OF WARWICK ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: PLANT BIOSCIENCE LIMITED
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827Flower development or morphology, e.g. flowering promoting factor [FPF]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the invention relates to plants with altered flowering time, floral numbers and/or seed production and provides methods for producing such plants.
  • Flowering time in photoperiodic flowering plants is a key developmental switch that is affected by environmental signals perceived by the leaves.
  • An important component of the signalling pathway that regulates flowering is the Flowering Locus T (FT) gene.
  • FT Flowering Locus T
  • SAM shoot apical meristem
  • the mobile florigen has been shown to be encoded by the Flowering Locus T (FT) gene.
  • FT transcribes mRNA specifically in phloem cells but not in the SAM 3 .
  • Arabidopsis FT is a small globular 23 kd protein consisting of 175-amino acids (aa) with homology to the mammalian phosphatidylethanolamine binding protein (PEBP) or Raf kinase inhibitor protein. FT belongs to a group of six closely related proteins, which includes TFL1 and CENTRORADIALIS (CEN) of Antirrhinum.
  • PEBP mammalian phosphatidylethanolamine binding protein
  • CEN CENTRORADIALIS
  • the Flowering Locus T is a key component of the floral signalling pathway. FT is known to be involved in controlling flowering time. Surprisingly, the inventors have found that altering the amino acid sequence of the FT protein may also increase the number of flowers and seed yield. Applicants disclose that modification of FT leading to single amino acid changes provides novel gene alleles with the surprising potential for molecular breeding to increase crop productivity. Using an alanine scanning approach and a plant virus-based floral induction system, Applicants describe the molecular engineering of the Arabidopsis FT protein to produce a modified FT with an altered phenotype, for example enhanced ability to trigger flowering, resulting in more flowers and an increase in seed yield. Modification of conserved residues within the FT sequence results in an altered phenotype when the modified gene is expressed in plants.
  • the invention relates to transgenic plants expressing a modified FT gene or polynucleotide said gene encoding a modified amino acid (aa) sequence characterised in that said expression results in a phenotype that is different from the wild type phenotype and different from plants overexpressing wild type FT.
  • the gene is modified in such a way that a conservative residue in the FT aa sequence is altered.
  • Other aspects of the invention relate to methods for producing such plants.
  • the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits an altered flowering profile.
  • the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits one of the following phenotypes:
  • the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits increased flowering and increased fruit and/or seed production.
  • the invention relates to a method for producing a plant as defined above which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • the invention relates to a method for inducing increased flowering and increased seed production in a plant which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • the invention relates to an isolated nucleic acid molecule or sequence said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification results in an altered phenotype when said nucleic acid is introduced in a plant wherein said phenotypes is selected from:
  • the invention relates to an isolated nucleic molecule or sequence acid said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification consists of or may comprise a substitution of one or more of the following residues: V70, D73, R119, R173, D71, L67, S78 or Q140.
  • the invention relates to the use of an isolated nucleic acid encoding a modified polypeptide which may comprise an amino acid modification to alter the amount of flowers and/or seed and/or fruit yield in a plant.
  • the invention also relates to a modified plant which may comprise an isolated nucleic molecule or sequence acid said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification consists of or may comprise a substitution of one or more of the residues identified in table I, in particular in groups II-V.
  • FIG. 1 Comparison of FT amino acid sequences among Arabidopsis and other plant species.
  • the phosphatidylethanolamine binding protein (PEBP) domain and the putative amidation site are indicated.
  • the individual amino acid residues selected for modification are in bold.
  • the conserved amino acids (asterisked) among all species are indicated.
  • the numbering is based on the numbering of the Arabidopsis sequence. Where reference is made to the Arabidopsis ortholog, two amino acids must be subtracted from the numbering shown in FIG. 1 , as the Arabidopsis sequence contains two less amino-terminal amino acids than, for example, the rice ortholog.
  • FIG. 2 Construction of 14 virus-based floral induction vectors.
  • FIG. 3 FT V70A has enhanced biological activity in floral induction and seed production.
  • FIG. 4 FT V70A enhances floral induction.
  • FT V70A causes early floral bud formation and more flowers to be produced (a) although FT and FT V70A have a similar capacity to trigger plants to bolt (b).
  • Six SD N. tabacum Maryland Mammoth plants were inoculated with PVX/mFT (mFT), PVX/FT (FT), PVX/FT V70A (FT V70A ), or PVX/FT R173A (FT R173A ). Bolting was measured by the stem height and numbers of flowers and floral buds were counted at 21, 28 and 35 days post-inoculation (dpi).
  • FT R173A the loss-of-function mutant of FT (Table 1), was used as an additional control.
  • FIG. 5 Molecular analysis of FT V70A expression.
  • a-c Detection of viral transient FT RNA.
  • Viral transient FT RNA (a) and 18S rRNA (b) were detected in systemic young leaves by semi-quantitative RT-PCR.
  • Total RNA samples were extracted from young leaves collected from plants mock-inoculated or inoculated with the PVX-based gene expression vectors at 5-wpi, pre-treated with RNase-free DNase, and used for RT-PCR detection as previously described 12 .
  • RT-PCR products were sequenced to confirm the modified sequences (c). The sizes and positions of the 1-kb DNA ladder and the RT-PCR products are indicated.
  • FT protein Nucleotide mutations for changing the amino acids of the FT protein are underlined.
  • d-e Western blot analysis of FT protein (d) and the PVX coat protein (e) in SD N. tabacum Maryland Mammoth plants.
  • f Coomassie blue-stained gel showing equal loading of soluble proteins extracted from young leaves of plants mock-inoculated, or inoculated with PVX/mFT, PVX/FT, PVX/FT V70A or PVX/FT R173A at 5-wpi. The positions and sizes of the protein markers, FT and PVX CP are indicated.
  • FT R173A a newly identified loss-of-function mutant of FT (Table 1), was used as an additional control.
  • FIG. 6 Construction of FT over expression cassette for barley transformation. Coding sequences for the Arabidopsis FT and its novel alleles are to be amplified by PCR using high fidelity pfu polymerase, specific primers and cDNA clones ( FIG. 1 a ) as templates, digested with XhoI and SpeI, and cloned into the XhoI/SpeI sites of the binary vector pBract211 to produce pBract211/FT (control), pBract211/mFT (control) and pBract211/FT V70A .
  • the three expression cassettes are to be used for barley transformation.
  • FIG. 7 GFP expression via a virus-based vector in barley.
  • the infectious cDNA clone of the cocksfoot mild mosaic virus (CMMV) 17 was modified to produce a vector for in vitro production of a new species of subgenomic (sg) RNA.
  • This new sgRNA encodes the mRNA of the gene of interest to replace the viral coat protein gene and acts as mRNA for protein translation.
  • the GFP coding sequence was cloned in the newly constructed CMMV vector.
  • GFP green fluorescence (a; left: GFP fluorescence, middle: chlorophyll auto-fluorescence; right: merged image), revealed by Confocal microscopic examination.
  • no GFP specific fluorescence was observed in mock-inoculated barley plants (b).
  • FIG. 8 Improved production of tillers and heads with kernels by FT in barley.
  • the wild type Arabidopsis FT coding sequence was cloned in the newly constructed CMMV vector. Young barley plants were mixed inoculated with CMMVgenomic RNA and the sgRNA-FT or the sgRNA-GFP transcripts. The latter was used as a negative control. Viral expression of FT caused early plant development and increased number of tillers after 16 days post inoculation, compared with plants having GFP expression (a, b). After 65 days post-inoculation, FT-expressing barley plants (c) developed more heads with kernels (indicated by arrows) than GFP-expressing plants (d).
  • FIG. 9 FT V70A possesses an enhanced biological activity in floral induction and seed production in N. tabacum Maryland Mammoth (MM) in SD.
  • MM plants were mock inoculated (a, e, i) or treated with PVX/mFT (b, f, j), PVX/FT (c, g, k) or PVX/FT V70A (d, h, l) and grown in a 12-hr SD photoperiod of light at 25° C. Photographs were taken at 35- (a-d), 56- (e-h, k, 1) and 84- (i, j) days post inoculation. Mock-inoculated (i) or PVX/mFT (j)-treated plants eventually flowered and produced seedpods.
  • FIG. 10 Viral transient expression of FT V70A promote secondary budding and flowering in N. tabacum Maryland Mammoth (MM) in SD. MM plants were treated with PVX/FTV70A (a,b) or PVX/FT (c,d), and grown in a 12-hr photoperiod of light at 25° C. FTV70A (a, b) possesses an enhanced function in comparison to FT (c,d) in triggering development of lateral shoots from which axillary floral buds and flowers continued to develop. Mature seedpods produced from primary flowers were harvested at 70 days post inoculation (dpi). Remaining non-mature primary seedpods attach to plants treated with PVX/FT (c,d). Photographs were taken at 70 dpi. The outlined portions of plants are enlarged to show axillary shoots and newly developed floral buds (arrow).
  • FIG. 11 Viral transient expression of FT V70A promote secondary budding and flowering in N. tabacum Maryland Mammoth (MM) in SD. MM plants were treated with PVX/FT or PVX/FT V70A, and grown in a 12-hr photoperiod of light at 25° C. Expression of FT V70A induced further development of axillary shoots, secondary floral buds, flowers and seedpods (arrow, a-c). Mature seedpods produced from primary flowers were harvested at 70 days post of inoculation (dpi) of plants. Photographs were taken at 84 (a) or 98 dpi (b, c). The boxed sections of plants (i, ii) are enlarged to show axillary shoots and newly developed secondary floral buds and flowers.
  • FIG. 12 FT V70A enhances floral induction and seed production in N. tabacum Maryland Mammoth (MM) in SD.
  • Expression of FT or FTV70A from PVX/FT or PVX/FT V70A is effective to induce early bolting and flowering when compared to mock- or PVX/mFT-treatment (a, b).
  • MM plants treated from PVX/FT V70A produced significantly more numbers of flowers and seedpods than these treated with PVX/FT (b, c).
  • Bolting was measured by stem height and numbers of flowers and floral buds were counted at 21, 28 and 35 days post inoculation (dpi). Total primary and secondary seedpods were counted at 70 dpi and 105 dpi.
  • FIG. 13 Detection of viral transient expression of FT gene.
  • mFT mFT
  • FT PVX/FT
  • V70A PVX/FT V70A
  • b-d Direct sequencing of viral transient FT-specific RT-PCR products confirms the recombinant viruses maintained the non-sense (underlined) and deletion (A) double mutations in mFT, wild-type FT (start codon ATG is underlined) or sense mutation (underlined) in FTV70A during the course of experiments.
  • FIG. 14 RT-PCR Viral delivery and expression of Arabidopsis FT in SD MM tobacco plants. Detection of viral transient FT RNA (a, c) and 18S rRNA (b, d) in both inoculated (a, b) and systemic young (c, d) leaves by RT-PCR using primers PP82 and PP83 [Li C, Zhang K, Zeng X, Jackson S, Zhou Y and Hong Y (2009) A cis element within Flowering Locus T mRNA determines its mobility and facilitates trafficking of heterologous viral RNA. J Virol 83: 3540-3548].
  • FIG. 15 2M Transgenic Barley. Transformation of barley. The Spring barley, Golden Promise, transformed with pBract214-FT V70A, produce more heads than barley transformed with either pBract214-FT or pBract214-mFT. Photographs were taken at 2 months post-transformation.
  • FIG. 16 4M Transgenic Barley. Transgenic expression of FTV70A significantly increases barley yields. Grains were counted from heads of individual barley plants transformed with pBract211-mFT, pBract211-wtFT or pBract211-FTV70A. Comparing FTV70A-expressing to mFT-expressing barley transformants, the total number of grains per line/plant increased approx. 85.7%. Regenerated plants with zero copy of any of three transgene constructs were used as “Null transformation control”.
  • FIG. 17 FT T27A produces more flowers than FT in MM plants in SD.
  • the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits one of the following phenotypes:
  • Arabidopsis FT is a small globular protein consisting of 175-aa with homology to the mammalian phosphatidylethanolamine binding protein (PEBP) or Raf kinase inhibitor protein.
  • PEBP mammalian phosphatidylethanolamine binding protein
  • FT Raf kinase inhibitor protein.
  • the Flowering Locus T (FT) gene is highly conserved amongst different plant species. A comparison of FT amino acid sequences is shown in FIG. 1 . Particularly conserved are the PEBP domain and the amidation site.
  • Applicants identified 43 aa, including 9 aa within the conserved PEBP domain, 3 aa within a putative amidation site, the arginine residue at position 119 (R119),the glutamine residue at the position of 140 (Q140) and a number of N-terminal residues, as targets for molecular modification.
  • each amino acid was substituted with Alanine (Ala, A) to produce 43 different single amino acid-modified FT proteins (table 1). This was achieved by PCR and overlapping PCR-based mutagenesis using specific primers (Table 3, example 8). The sequence was then cloned into the potato virus X (PVX)-based floral induction system 12 ( FIG. 2 b ).
  • PVX potato virus X
  • a modified FT polynucleotide according to the invention is a modified nucleic acid sequence, i.e. a modified FT gene that differs from the wild type polynucleotide, gene or nucleic acid sequence in its sequence.
  • Wild type as used herein refers to a plant that has not been modified and is preferably of the same species.
  • the increase described herein may be two-fold or more, or describe an increase of at least 10-50%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50% or more.
  • transgenic means with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector which may comprise the nucleic acid sequence or an organism transformed with the nucleic acid sequences and expressing the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
  • transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the method of the invention are not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously.
  • transgenic also means that, while the nucleic acids according to the different embodiments of the invention are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified.
  • transgenic plants may refer to plants generated by methods that do not solely relay on traditional breeding. The plants may not carry a “transgene”, but may be generated through mutagenesis.
  • Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place.
  • Preferred transgenic plants are mentioned herein.
  • the modified FT polynucleotide encodes a modified polypeptide that differs from the wild type polypeptide in its amino acid sequence.
  • the modified polypeptide may comprise an amino acid modification, for example a deletion, addition or substitution.
  • the modification is an amino acid substitution of one or more amino acids within the sequence.
  • the modification consists of a single amino acid substitution.
  • the substitution may be conservative or non-conservative.
  • the substitution is a non conservative substitution, i.e. the amino acid is replaced with another amino acid that does not share the same chemical properties.
  • Most preferred are substitutions with a neutral amino acid that cause little change in protein structure, for example Alanine (Ala, A) or Phenylalanine (Phe, F).
  • a preferred substitution is one that causes little change in protein structure. For example, mutation to A allows protein folding while at the same time affecting the biological function of the peptide. Where the chemical properties of the particular amino acid that is altered are critical to wild-type function, alteration of said amino acid produces a different phenotype in the mutant plant.
  • amino acid substitutions other than those with A disclosed herein are also within the scope of the invention and that replacements with other amino acids, in particular those that allow protein folding but have different properties from the native residue are expected to have similar effects. Such replacements are therefore within the skill of the skilled person.
  • the corresponding codon must be altered and due to the degenerate code of the DNA, more than one alteration of the target codon may be possible to generate the desired substitution in the peptide.
  • the plant according to the invention exhibits a phenotype that is different from the wild type phenotype.
  • the plant exhibits an altered flowering profile.
  • the term flowering profile may relate to an increase in flowering and/or a change in flowering time.
  • Increased flowering as used herein is understood to mean increased numbers of flowers per plant, thus leading to an increase in seed yield.
  • Flowering time may be early or delayed. For example, plants that flower early start to flower one week earlier than plants expressing the wild-type FT. Plants that exhibit delayed flowering, start to flower one week later than plants expressing the wild-type FT.
  • altering the amino acid sequence of the FT protein may also increase the number of flowers and seedpods. An increase in seed yield was also observed (Table 1, FIG. 3 ).
  • the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits increased flowering and increased yield, i.e. increased fruit and/or seed production.
  • the modification is a substitution and said substitution may comprise or consists of substitution of V70 or T27 or both.
  • the substitution may be with A.
  • the codon encoding V70 and/or T27 may be changed to a codon encoding A (GCU, GCC, GCA, GCG).
  • the plant may further show altered flowering time.
  • the numbering of the amino acid residues as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequence. This numbering is shown in FIG. 1 .
  • V70 in the Arabidopsis FT amino acid sequence is the second V residue in the conserved PEBP domain (YTLVMVDPDVPSPSNPHLREYL).
  • the FT amino acid sequence in other species may comprise fewer or more amino acids (most typically, 1 to 2 additional or fewer amino acids)
  • the position of the second conserved V residue in the amino acid sequence may not be 70, but may be 69, 71 or 72.
  • the positions of the targeted residues according to the invention in some exemplified plant species are shown in FIG. 1 .
  • the modification is a substitution and said substitution may comprise or consists of substitution of the second conserved V in the PEBP domain which may comprise the following sequence or a sequence at least 90% homologous thereto: YTLVMVDPDVPSPSNPHLREYL.
  • an N terminal residue at about position 27 is modified.
  • a peptide sequence expressed by said plant is shown in SEQ ID NO. 44 and 45. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • the plant also shows early flowering at 21 days post inoculation, which is approx. one week earlier than plants inoculated with the recombinant virus expressing wild-type FT ( FIG. 4 ). Moreover, the plant is characterised in an increase in flowers, approx 72 flowers/plant compared to approx. 40 flowers per wild-type FT expressing plant ( FIG. 4 ).
  • the plant shows an increase in seed production or seed yield wherein said increase is about 10% to about 50% or more, for example about 30%.
  • the increase in flowering may be 10% to about 50% or more.
  • the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits no bolting and no flowering.
  • the substitution may comprise or consists of substitution of an amino acid at residues D73, R119 or R173.
  • the substitution may be with A.
  • the numbering of the targeted conserved amino acid residues as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences.
  • the conserved D at position 73 is the first D in the conserved PEBP domain.
  • the conserved R at position 173 is the first R residue in the amidation site. Combinations of the mutations listed above may also be used.
  • a peptide sequence expressed by said plant is shown in SEQ ID NO. 41 and 43. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H.
  • the substitution may comprise or consists of substitution of an amino acid at residues L67, S78,Q140, G16, L19, F22, K29 or V30.
  • the substitution may comprise or consists of substitution of an amino acid at residues L67, S78 or Q140. The substitution may be with A.
  • the numbering of the conserved amino acid residues targeted as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences.
  • L67 designates the first conserved L in the PEBP domain
  • S78 designates the second conserved S in the PEBP domain
  • Q140 designates the conserved Q in the external loop that is shown to be positioned closed to the Y85 within the ligand-binding sites. Combinations of the mutations listed above may also be used.
  • a peptide sequence expressed by said plant is shown in SEQ ID NO. 23 and 30. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits normal bolting but no flowering.
  • the substitution may comprise or consists of substitution of an amino acid at residue D71, Y85, N13, N4, D7, L9, V14, V15, D17 or V18.
  • the substitution may comprise or consists of substitution of an amino acid at residue D71 or Y85
  • the substitution may be with A.
  • D71 designates the first conserved D in the PEBP domain adjacent to a V residue (V70 for the Arabidopsis sequence).
  • the numbering of the conserved amino acid residues targeted as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences.
  • Y85 designates the second conserved Y towards the N terminus of the PEBP domain. Combinations of the mutations listed above may also be used.
  • a peptide sequence expressed by said plant is shown in SEQ ID NO. 31 and 40. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said modification is a substitution and said substitution consists of or is selected from a substitution at one or more of the following residues as listed in table 1, particularly those listed in groups II-V and most preferred those in group V
  • substitution is with A.
  • the modification is a substitution and said substitution consists of or is selected from a substitution at V70 and/or T27, for example V70A and/or T27A.
  • the plant also may comprise a regulatory sequence. This regulates expression of the polynucleotide in said plant.
  • the sequence may be a promoter sequence, for example an endogenous promoter or a promoter that drives constitutive overexpression of a gene.
  • Overexpression according to the invention means that the transgene is expressed at a level that is higher than expression driven by its endogenous promoter.
  • overexpression may be carried out using a strong promoter, such as the cauliflower mosaic virus promoter (CaMV35S), the rice actin promoter or the maize ubiquitin promoter or any promoter that gives enhanced expression.
  • CaMV35S cauliflower mosaic virus promoter
  • the rice actin promoter or the maize ubiquitin promoter or any promoter that gives enhanced expression.
  • an inducible promoter such as a stress-inducible promoter, for example the RubisCO small subunit promoter, or an ethylene, propylene, steroid or ethanol responsive promoter or a heat shock promoter may also be used.
  • a stress-inducible promoter for example the RubisCO small subunit promoter, or an ethylene, propylene, steroid or ethanol responsive promoter or a heat shock promoter
  • ectopic expression i.e. gene expression in a tissue in which it is normally not expressed.
  • enhanced or increased expression may be achieved by using transcription or translation enhancers or activators and may incorporate enhancers into the gene to further increase expression. This list is not considered limiting as the skilled person will be able to select a suitable promoter that is capable of driving sufficient expression of the gene to result in the production of the modified protein.
  • the invention also extends to harvestable parts of modified plants described herein such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs, which harvestable parts comprise a recombinant nucleic acid encoding a modified FT polypeptide.
  • the invention furthermore relates to products derived, preferably directly derived, from a harvestable part of such a plant, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins.
  • the invention relates to a method for producing a plant as disclosed herein which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • the invention thus relates to a method for producing a plant that produces more flowers and has increased fruit or seed production which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • a modified FT polynucleotide encodes a modified polypeptide wherein V70 or T27 or both are replaced with another amino acid.
  • the invention in another aspect, relates to a method for increasing flowering and seed production in a plant which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • the modified FT polynucleotide encodes a modified polypeptide wherein V70 and/or T27 is replaced with another amino acid.
  • the sequence which may comprise a modified FT polynucleotide sequence as described herein may further comprise a selectable marker that may be associated with the heterologous nucleic acid sequence, i.e., the structural gene operably linked to a promoter.
  • a selectable marker refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a plant or plant cell containing the marker.
  • the marker gene may be an antibiotic resistance gene whereby the appropriate antibiotic may be used to select for transformed cells from among cells that are not transformed.
  • the marker gene may be a herbicide resistance gene. Suitable markers will be known to those of skill in the art.
  • a plant is transformed with a vector which may comprise the sequence of interest.
  • vectors are disclosed herein.
  • the details of the construction of the vectors that may be used are known to those skilled in the art of plant genetic engineering.
  • the heterologous nucleic acid sequences utilized in the present invention may, for example, be introduced into plant cells using Ti plasmids, root-inducing (Ri) plasmids, or plant virus vectors, such as PVX.
  • transformation of plants in accordance with the invention i.e. the alteration of the genotype of a host plant by the introduction of a heterologous nucleic acid sequence
  • transformation may be carried out in essentially any of the various ways known to those skilled in the art of plant molecular biology.
  • transformation include infection by Agrobacterium, for example by infecting plant cells, an explant, a meristem or a seed, with transformed Agrobacterium tumefaciens. Under appropriate conditions known to those skilled in the art, the transformed plant cells are grown to form shoots, roots, and develop further into plants.
  • Another example is transfection using a viral vector, such as the PVX vector system as shown herein, electroporation or particle bombardment. This list is non limiting as the skilled person will be able to use a suitable system.
  • the plant according to the different aspects of the invention may be tobacco or barley.
  • the inventors have shown that a modified gene sequence derived from the Arabidopsis FT gene may direct the expression of a modified FT protein in tobacco and induce an altered phenotype compared to the wild type.
  • the skilled person would know that the invention is not limited to tobacco or barley which are used as a models plant in the experiments to illustrate the invention. Bearing in mind that the FT locus is conserved in many plant species, the skilled person would know that any monocot or dicot plant may be used according to the invention.
  • a dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus), Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae), Malvaceae, Rosaceae or Solanaceae.
  • the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species.
  • the plant is oilseed rape.
  • biofuel and bioenergy crops such as rape/canola, linseed, lupin and willow, poplar, poplar hybrids, switchgrass, Miscanthus or gymnosperms, such as loblolly pine.
  • turf grasses for golf courses include ornamentals for public and private gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant).
  • ornamentals for public and private gardens e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.
  • plants and cut flowers for the home African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant.
  • a monocot plant may, for example, be selected from the families Arecaceae, Amaryllidaceae or Poaceae.
  • the plant may be a cereal crop, such as wheat, rice, barley, maize, oat sorghum, rye, onion, leek, millet, buckwheat, turf grass, Italian rye grass, switchgrass, Miscanthus, sugarcane or Festuca species.
  • the plant according to the different aspects of the invention is a crop plant.
  • crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use or other non-food/feed use.
  • Preferred plants are maize, wheat, rice, oilseed rape, sorghum, soybean, potato, tomato, barley, pea, bean, field bean, cotton, lettuce, broccoli or other vegetable brassicas or poplar.
  • the plant may be selected from the plants shown in table 1 and may express a modified endogenous FT gene based on the endogenous gene identified in table 1.
  • the plant may be used for biofuel production.
  • the modified gene or polypeptide that is expressed in the plant according to the different aspects of the invention may be an exogenous gene, such as a modified Arabidopsis FT, expressed in a different plant species. Preferred plants are detailed above.
  • the invention also relates to using a modified gene based on the endogenous FT gene.
  • the endogenous FT gene is a FT Arabidopsis homologue or orthologue. Such genes are specified herein and known in the art.
  • the modified polypeptide or gene encodes an altered protein as set forth herein and is introduced and expressed or overexpressed in the plant. Preferred plants are detailed above.
  • the invention provides an isolated modified FT nucleic acid sequence encoding a modified FT polypeptide which may comprise an amino acid modification.
  • the modification may be a deletion, addition or substitution.
  • the modification is a substitution.
  • the isolated modified nucleic acid sequence is selected from a sequence encoding a polypeptide which may comprise a substitution at one of the following residues or a combination thereof: T27, V70, D73, R119, R173, D71, L67, S78 Q140 or FTG16, FTL19, FTF22, FTK29 or FTV30.
  • the polypeptide may have a single substitution at these residues.
  • a modified polypeptide wherein the residue Y85 is replaced with A.
  • the modified polypeptide has a single amino acid substitution selected from the substitutions above.
  • the modified nucleic acid sequence encodes a polypeptide which may comprise a substitution at residue V70 or T27 or both.
  • the corresponding codon must be altered and due to the degenerate code of the DNA, more than one alteration of the codon may be possible to generate the desired substitution.
  • a sequence or vector described herein encoding a modified FT protein is introduced as a transgene into the plant. This may be carried out by various methods as known in the field of plant genetic engineering, for example using transformation with Agrobacterium, PVX or particle bombardment.
  • the invention relates to a vector which may comprise a modified nucleic acid sequence that encodes a polypeptide as described herein.
  • the invention relates to a plant cell transformed with a vector or a gene sequence as described herein.
  • the invention relates to a host cell expressing a modified protein having a substitution at position V70 or T27 or both.
  • the plant cell may be a cell of a monocot or dicot plant as further defined herein.
  • a modified nucleic acid sequence encoding a polypeptide as described herein to alter flowering time and/or quantity and/or seed/fruit yield in a plant.
  • a modified nucleic acid sequence encoding a polypeptide which may comprise a substitution of residue V70 or T27 or both may be used to induce more flowering and increase seed yield in a plant. This may be carried out using the methods described herein.
  • the invention relates to a method for producing a mutant plant expressing an FT variant and which is characterised by one of the phenotypes described herein wherein said method uses mutagenesis and Targeting Induced Local Lesions in Genomes (TILLING) to target the gene expressing the FT polypeptide.
  • TILLING Targeting Induced Local Lesions in Genomes
  • lines that carry a specific mutation are produced that has a known phenotypic effect.
  • mutagenesis is carried out using TILLING where traditional chemical mutagenesis is flowed by high-throughput screening for point mutations. This approach does thus not involve creating transgenic plants.
  • the plants are screened for one of the phenotypes described herein, for example a plant that shows increased flowering and seed production.
  • the invention relates to a method for producing a plant exhibiting an altered phenotype selected from:
  • the method used to create and analyse mutations is targeting induced local lesions in genomes (TLLING), reviewed in Henikoff et al, 2004, Plant Physiology, 2004, 630-636.
  • seeds are mutagenised with a chemical mutagen, for example EMS.
  • the resulting M1 plants are self-fertilised and the M2 generation of individuals is used to prepare DNA samples for mutational screening.
  • DNA samples are pooled and arrayed on microtiter plates and subjected to gene specific PCR.
  • the PCR amplification products may be screened for mutations in the FT target gene using any method that identifies heteroduplexes between wild type and mutant genes.
  • dHPLC denaturing high pressure liquid chromatography
  • DCE constant denaturant capillary electrophoresis
  • TGCE temperature gradient capillary electrophoresis
  • the PCR amplification products are incubated with an endonuclease that preferentially cleaves mismatches in heteroduplexes between wild type and mutant sequences.
  • Cleavage products are electrophoresed using an automated sequencing gel apparatus, and gel images are analyzed with the aid of a standard commercial image-processing program. Any primer specific to the FT gene may be utilized to amplify the FT genes within the pooled DNA sample.
  • the primer is designed to amplify the regions of the FT gene where useful mutations are most likely to arise, specifically in the areas of the FT gene that are highly conserved and/or confer activity.
  • the PCR primer may be labelled using any conventional labelling method.
  • Rapid high-throughput screening procedures thus allow the analysis of amplification products for identifying a mutation conferring the reduction or inactivation of the expression of the FT gene as compared to a corresponding non-mutagenised wild type plant.
  • the seeds of the M2 plant carrying that mutation are grown into adult M3 plants and screened for the phenotypic characteristics associated with the FT gene. Loss of and reduced function mutants with increased yield and increased expression during leaf senescence compared to a wild type control may thus be identified.
  • the invention relates to a method for identifying a mutant plant which may comprise an FT variant polynucleotide sequence which may comprise identifying a mutant phenotype as described herein and analysing the FT polynucleotide sequence.
  • PCR mixtures contained 5 ⁇ l of 10 ⁇ reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of each primer, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of template DNA.
  • the resulting PCR products were purified using the QIAGEN Quick PCR Purification Kit, digested with ClaI and EagI, and then cloned into the ClaI/EagI sites of the PVX-based gene expression vectors 12 .
  • All other FT derivatives ( FIG. 2 ) were obtained by overlapping extension PCR. Each case involved designing two mutagenic primers B and C ( FIG. 2 ) that contained specific mutations and were partially complementary to each other. Two separate PCR reactions (5 ⁇ l of 10 ⁇ reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of each of primers A and B or C and D, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of template DNA) were performed to generate the 5′- and 3′-portions of the FT gene.
  • 10 ⁇ reaction buffer Promega
  • 0.2 mM dNTPs dATP, dGTP, dCTP and dTTP
  • 15 pmole of each of primers A and B or C and D 1.25 units of pfu DNA polymerase (Promega) and 50 ng of template DNA
  • the full-length FT derivative was then amplified through a third PCR (5 ⁇ l of 10 ⁇ reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of primer A and D, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of the 5′- and 3′-portions of FT gene PCR products), purified, restriction enzymes-digested, and cloned into PVX to produce each of the corresponding expression vectors ( FIG. 2 a ) as described above. The integrity of all recombinant clones and the presence of mutations were confirmed by sequencing.
  • nucleotide changes into the middle part (i.e. nucleotide 101-429) of the FT gene, two partially complementary primers B and C ( FIG. 2 ) were synthesised. Nucleotide changes were introduced into both primers in order to substitute the codon for the selected amino for mutation with the triple-nucleotide coding for alanine.
  • the two mutagenic primers coupled with either primer A or D were used in the overlapping extension PCRs as described in Example 1 to introduce specific modifications into the FT gene.
  • RNA transcripts from each recombinant PVX vector were produced by in vitro run-off transcription 12 .
  • a typical in vitro transcription reaction 50 ⁇ l containing 5 ⁇ l of 10 ⁇ buffer (Biolabs), 40 units of RNasin (Promega), 2 mM each of ATP, CTP, UTP and GTP, 0.5 mM m 7 GpppG (Biolabs), 2.5 ⁇ g of SpeI-linearised vector DNA, and 200 units of T7 RNA polymerase was incubated at 37° C. for 1 hr. RNA transcripts were further treated with 1 unit of RNase-free DNase (Promega) at 37° C.
  • Virus-treated SD MM plants developed virus-associated phenotypes including chlorotic lesions on inoculated leaves and mild chlorosis on young leaves after 7 to 14 days post-inoculation (dpi). Plants started to shoot at approx, 20 dpi and flowered at approx. 35 dpi if they were treated with a recombinant virus that expressed the wild-type Arabidopsis FT gene or its functional alleles. Plant growths (bolting) were measured weekly. Development of floral buds, flowers and seedpods were routinely checked and photographically recorded with a Nikon digital CoolPix 995 camera. Numbers of buds, fully-opened flowers and seedpods were counted.
  • Seedpods were then collected, the amounts of seeds were weighted, and seeds were tested for germination. Phenotypes in terms of bolting, flowering time, numbers of flowers seedpods per plant which were affected by the viral ectopic expression of various FT mutants were compared to that of plants expressing the wild-type Arabidopsis FT.
  • the function-enhanced FT mutant FT V70A represents a novel gene that may have great potential in agricultural biotechnology. This is confirmed by transforming crop plants with the modified FT gene and analysing whether expression of FT V70A in crops induces similar phenotypes to those obtained in tobacco, i.e. increased flowering, increased flower number and increased fruit and/or seed yield. To this end, three expression cassettes ( FIG. 6 ) are constructed for transformation of barley using a well-established transformation protocol 16 . This work is extended to crops including but not limited rice, wheat, maize, cotton, tomato, soybean, and brassicas, as well as horticultural and fruit crops, and ornamental species.
  • valine residue which was substituted with alanine in FT V70A was found to be conserved among Arabidopsis FT and its orthologs in rice, barley, wheat and other species. Therefore, mutation of these amino acids in these FT orthologs with Alanine is predicted to enhance their biological function to trigger early flowering, increase floret number, and enhance kernel (seed) production through plant transformation.
  • Phenotypes growth, flowering time, flower number, seed yield and productivity
  • Phenotypes growth, flowering time, flower number, seed yield and productivity
  • Copy numbers of transgenes in each transgenic line is determined and lines with a single copy of the relevant transgenes are selected for further analysis.
  • Transgene expression is analysed at the RNA and protein levels, which are then correlated with the phenotypic changes among transgenic lines transformed with the three different gene expression cassettes ( FIG. 6 ). It is anticipated that (1) increases in floral numbers is in particular beneficial to horticultural industry for breeding novel flower plants; and (2) increases in productivity is particularly beneficial to agriculture, food and biotechnology for breeding novel crops for high yields and for biofuel production.
  • Applicants' data demonstrate that the V70A substitution in the FT protein is responsible for the enhanced biological activity of FT V70A , enabling it to trigger flowering and cause increased flower numbers and seed yield. This finding is important in terms of engineering the FT protein for enhanced crop productivity.
  • Applicants' virus-based floral induction system revealed a number of other potentially useful alleles of FT that confer different flowering responses (Table 1). For instance, over-expression of Group IV mutants (i.e. no bolting and no flowering) may have a dominant negative effect on plants, e.g. lettuce, so that such crops remain vegetative growth.
  • Group IV mutants may be found in biomass crops for example to avoid energy being diverted into flowering processes (bolting and flowering), in particular for vegetatively species where a flowering/seed phase is not necessary for agricultural cultivation (e.g. sugar cane).
  • the Group IV mutants (no bolting, no flowering) could also have uses in fertility control, by preventing flowering altogether when flowering is not required, for example sugar beet, turfgrasss etc.
  • allelic series that confers a range of flowering characteristics is useful to molecular plant breeders, who, based on the present disclosure, could produce lines carrying a specific mutation that has a known phenotypic effect through targeted molecular breeding approaches, e.g. by screening for a specific FT mutation in TILLING populations.
  • Another potential application is the use of non seed-borne viral vectors expressing FT or FT V70A to promote flowering and seed production in breeding programmes or in recalcitrant plant species in germplasm collections.
  • the pools of FT mutants represent a unique resource for dissecting the molecular domains of the FT protein that are responsible for the long-distance movement and the cell-autonomous floral induction.
  • Hyg gene and CO2 Constans-like, AF490469 gene specific primers and probes [Bartlett J G, Alves S C, Smedley M, Snape J W, Harwood W A (2008) High-throughput Agrobacterium -mediated barley transformation. Plant Methods, 4: 22].
  • Primers were designed to the target sequences using Applied Biosystems software Primer Express, with the TaqMan Probe and Primer design module (see below). The reactions used Thermo ABGene Absolute QPCR Rox Mix (Cat number AB 1139).
  • the Hyg gene and the CO2 gene were assayed in multiplex.
  • the probes and primer final concentrations were 200 nM (Hyg) or 100nM (CO2).
  • the assay contained 5 ⁇ l of DNA solution, and was optimised for final DNA concentrations 1 to 10 ng/ ⁇ l (5 to 50 ng DNA in the assay).
  • PCRs were carried out in an Applied Biosystems AB17900 equipped with a 384 place plate.
  • the detectors used were FAM-TAMRA and VIC-TAMRA with Rox internal passive reference, and no 9600 emulation.
  • the PCR cycling conditions were 95° C. 15 minutes (enzyme activation), 40 cycles of 95° C. 15 seconds, 60° C. 60 seconds. Each sample was analysed twice.
  • Ct of Hyg minus the Ct of CO2 was calculated for each sample.
  • the samples were sorted by delta Ct, those with high ⁇ Ct values have low copy numbers, and those with low ⁇ Ct have high copy numbers of the Hyg gene.
  • Immature seeds were removed from the spikes and sterilised as previously described [Harwood W A, Ross S M, Cilento P, Snape J W: The effect of DNA/gold particle preparation technique, and particle bombardment device, on the transformation of barley ( Hordeum vulgare ). Euphytica 2000, 111:67-76]. The immature embryos were exposed using fine forceps and the embryonic axis removed.
  • the embryos were then plated scutellum side up on CI medium containing 4.3 g 1 ⁇ 1 Murashige & Skoog plant salt base (Duchefa), 30 g 1 ⁇ 1 Maltose, 1.0 g 1 ⁇ 1 Casein hydrolysate, 350 mg 1 ⁇ 1 Myo-inositol, 690 mg 1 ⁇ 1 Proline, 1.0 mg 1 ⁇ 1 Thiamine HCl, 2.5 mg 1 ⁇ 1 Dicamba (Sigma-Aldrich) and 3.5 g 1 ⁇ 1 Phytagel, with 25 embryos in each 9 cm Petri dish.
  • CI medium containing 4.3 g 1 ⁇ 1 Murashige & Skoog plant salt base (Duchefa), 30 g 1 ⁇ 1 Maltose, 1.0 g 1 ⁇ 1 Casein hydrolysate, 350 mg 1 ⁇ 1 Myo-inositol, 690 mg 1 ⁇ 1 Proline, 1.0 mg 1 ⁇ 1 Thiamine HCl, 2.5
  • Agrobacterium strain AGL1 containing pBract vectors was used in all experiments. All pBract vectors are based on pGreen [Hellens R P, Edwards E A, Leyland N R, Bean S, Mullineaux P M: pGreen: a versatile and flexible binary Ti vector for Agrobacterium -mediated plant transformation. Plant Mol Biol 2000, 42:819-832] and therefore need to be co-transformed into Agrobacterium with the helper plasmid pSoup. To enable the small size of pGreen, the pSa origin of replication required for replication in Agrobacterium, is separated into its' two distinct functions.
  • the replication origin (ori) is present on pGreen
  • the trans-acting replicase gene (RepA) is present on pSoup. Both vectors are required in Agrobacterium for pGreen to replicate.
  • pBract vector DNA and pSoup DNA were concurrently transferred to AGL1 via electroporation.
  • Plant Methods, 4: 22 medium without antibiotics and incubated on a shaker at 180 rpm at 28° C. overnight. This full strength culture was used to inoculate the prepared immature embryos. A small drop of Agrobacterium suspension was added to each of the immature embryos on a plate. The plate was then tilted to allow any excess Agrobacterium suspension to run off. Immature embryos were then gently dragged across the surface of the medium (to remove excess Agrobacterium ) before being transferred to a fresh CI plate, scutellum side down. Embryos were co-cultivated for 3 days at 23-24° C. in the dark.
  • embryos were transferred to fresh CI plates containing 50 mg 1 ⁇ 1 hygromycin, 160 mg 1 ⁇ 1 Timentin (Duchefa) and 1.25 mg 1 ⁇ 1 CuSO 4 .5H 2 O. Embryos were sub-cultured onto fresh selection plates every 2 weeks and kept in the dark at 24° C.
  • transition medium containing 2.7 g 1 ⁇ 1 Murashige & Skoog modified plant salt base (without NH 4 NO 3 ) (Duchefa), 20 g 1 ⁇ 1 Maltose, 165 mg 1 ⁇ 1 NH 4 NO 3 , 750 mg 1 ⁇ 1 Glutamine, 100 mg 1 ⁇ 1 Myo-inositol, 0.4 mg 1 ⁇ 1 Thiamine HCl, 1.25 mg 1 ⁇ 1 CuSO 4 .5H 2 O, 2.5 mg 1 ⁇ 1 2,4-Dichlorophenoxy acetic acid (2,4-D) (Duchefa), 0.1 mg 1 ⁇ 1 6-Benzylaminopurine (BAP), 3.5 g 1 ⁇ 1 Phytagel, 50 mg 1 ⁇ 1 Hygromycin and 160 mg 1 ⁇ 1 Timentin in low light.
  • T transition medium
  • BAP 6-Benzylaminopurine
  • embryo derived callus was transferred to regeneration medium in full light at 24° C., keeping all callus from a single embryo together.
  • Regeneration medium was the same as the transition medium but without additional copper, 2,4-D or BAP.
  • Transformed plants developed a strong root system in the hygromycin containing medium in 1-2 weeks and were then transferred to soil and grown under the same conditions as the donor plants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physiology (AREA)
  • Peptides Or Proteins (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

A plant comprising a modified Flowering Locus (FT) polynucleotide expressing a modified polypeptide exhibits altered flowering time, floral numbers and/or increased seed production. Different mutant sequences conferring different phenotypes are disclosed.

Description

    RELATED APPLICATIONS AND INCORPORATION BY REFERENCE
  • This application is a continuation-in-part application of international patent application Serial No. PCT/GB2011/050440 filed 7 Mar. 2011, which published as PCT Publication No. WO 2011/107808 on 9 Sep. 2011, which claims benefit of GB patent application Serial No. 1003702.6 filed 5 Mar. 2010.
  • The foregoing applications, and all documents cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
  • FIELD OF THE INVENTION
  • The invention relates to plants with altered flowering time, floral numbers and/or seed production and provides methods for producing such plants.
  • BACKGROUND OF THE INVENTION
  • Flowering time in photoperiodic flowering plants is a key developmental switch that is affected by environmental signals perceived by the leaves. An important component of the signalling pathway that regulates flowering is the Flowering Locus T (FT) gene. When a plant is induced to flower a phloem-mobile signal termed “florigen” is produced which is transported through the phloem translocation stream to the shoot apical meristem (SAM) where it induces floral development1,2. In Arabidopsis, the mobile florigen has been shown to be encoded by the Flowering Locus T (FT) gene. FT transcribes mRNA specifically in phloem cells but not in the SAM3. Its protein product, however, functions at the shoot apex4-6 . Arabidopsis FT is a small globular 23 kd protein consisting of 175-amino acids (aa) with homology to the mammalian phosphatidylethanolamine binding protein (PEBP) or Raf kinase inhibitor protein. FT belongs to a group of six closely related proteins, which includes TFL1 and CENTRORADIALIS (CEN) of Antirrhinum.
  • There is collective evidence that the Arabidopsis FT protein7,8 and its tomato SFT9, rice Hd3a10 and Cucurbit Cm-FTL½11 orthologs act as a component of the non cell-autonomous flowering signal that is transported through the phloem into the SAM, whilst the role of FT mRNA movement in long-distance florigenic signalling remains unknown12. Once FT is present in the SAM, it interacts with a bZIP transcription factor, FD, encoded by Flowering Locus D to activate floral identity genes such as APETELA 1 and SUPPRESSOR OF OVEREXPRESSION OF CO1. The latter activates LEAFY and induces flowering4,6. Natural genetic variation in genes controlling the expression of the rice FT ortholog Hd3a, and in Hd3a itself, contribute to diversity of flowering time in cultivated rice13. Overexpression of FT in transgenic plants from several species is associated with early flowering. U.S. Pat. No. 6,225,530 describes an isolated polynucleotide encoding an FT polypeptide. Hanzawa et al also describes modified FT and their expression sequence in plants14.
  • Flowering time and quantity of flowers (and seed) are crucial aspects of crop yield and quality and there is a need in agriculture to create new tools to control the time and amount of flowering and seed production in a wide variety of plant species. As well as enhancing plant productivity by increasing flowering, in certain plant species it is desirable to delay or prevent flowering altogether. The present invention is aimed at addressing these needs. Bioengineering of FT or creating novel FT alleles by TILLING, mutation breeding and selection of FT may provide useful alleles for breeding of novel crops to enhance productivity to meet rapid increase of global demand for food, feed and fuel.
  • Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention.
  • SUMMARY OF THE INVENTION
  • The Flowering Locus T (FT) is a key component of the floral signalling pathway. FT is known to be involved in controlling flowering time. Surprisingly, the inventors have found that altering the amino acid sequence of the FT protein may also increase the number of flowers and seed yield. Applicants disclose that modification of FT leading to single amino acid changes provides novel gene alleles with the surprising potential for molecular breeding to increase crop productivity. Using an alanine scanning approach and a plant virus-based floral induction system, Applicants describe the molecular engineering of the Arabidopsis FT protein to produce a modified FT with an altered phenotype, for example enhanced ability to trigger flowering, resulting in more flowers and an increase in seed yield. Modification of conserved residues within the FT sequence results in an altered phenotype when the modified gene is expressed in plants.
  • Thus, the invention relates to transgenic plants expressing a modified FT gene or polynucleotide said gene encoding a modified amino acid (aa) sequence characterised in that said expression results in a phenotype that is different from the wild type phenotype and different from plants overexpressing wild type FT. The gene is modified in such a way that a conservative residue in the FT aa sequence is altered. Other aspects of the invention relate to methods for producing such plants.
  • In one aspect, the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits an altered flowering profile.
  • Specifically, the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits one of the following phenotypes:
      • (a) increased flowering;
      • (b) increased flowering and increased fruit and/or seed production;
      • (c) no bolting and no flowering;
      • (d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
      • (e) normal bolting and no flowering.
  • In one aspect, the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits increased flowering and increased fruit and/or seed production.
  • In another aspect, the invention relates to a method for producing a plant as defined above which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • In further aspect, the invention relates to a method for inducing increased flowering and increased seed production in a plant which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification.
  • In further aspect, the invention relates to an isolated nucleic acid molecule or sequence said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification results in an altered phenotype when said nucleic acid is introduced in a plant wherein said phenotypes is selected from:
      • (a) increased flowering;
      • (b) increased flowering and increased fruit and/or seed production;
      • (c) no bolting and no flowering;
      • (d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
      • (e) normal bolting and no flowering.
  • In another aspect, the invention relates to an isolated nucleic molecule or sequence acid said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification consists of or may comprise a substitution of one or more of the following residues: V70, D73, R119, R173, D71, L67, S78 or Q140.
  • In another aspect, the invention relates to the use of an isolated nucleic acid encoding a modified polypeptide which may comprise an amino acid modification to alter the amount of flowers and/or seed and/or fruit yield in a plant.
  • The invention also relates to a modified plant which may comprise an isolated nucleic molecule or sequence acid said nucleic acid encoding a modified polypeptide which may comprise an amino acid modification wherein said modification consists of or may comprise a substitution of one or more of the residues identified in table I, in particular in groups II-V.
  • Accordingly, it is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
  • It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
  • These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings.
  • FIG. 1 Comparison of FT amino acid sequences among Arabidopsis and other plant species. The phosphatidylethanolamine binding protein (PEBP) domain and the putative amidation site are indicated. The individual amino acid residues selected for modification are in bold. The conserved amino acids (asterisked) among all species are indicated. With respect to FIG. 1, the numbering is based on the numbering of the Arabidopsis sequence. Where reference is made to the Arabidopsis ortholog, two amino acids must be subtracted from the numbering shown in FIG. 1, as the Arabidopsis sequence contains two less amino-terminal amino acids than, for example, the rice ortholog.
  • FIG. 2 Construction of 14 virus-based floral induction vectors. (a) PVX vectors and list of primers used in their constructions. (b) Overlapping PCR to produce two overlapping products using primer set A and B, or C and D for construction of PVX/FTmutant. PVX/FT and PVX/mFT were constructed previously12. Outline of the PVX-based vector is indicated.
  • FIG. 3 FTV70A has enhanced biological activity in floral induction and seed production. (a-e) Different flowering phenotypes were observed in the SD N. tabacum Maryland Mammoth (MM) plants mock-inoculated (a), or inoculated with PVX/mFT (b), PVX/FT (d) or PVX/FTV70A (e) in the non-inductive LD, and MM plant in inducing SD condition (c). (f, g) Seedpods on SD N. tabacum Maryland Mammoth plants inoculated with PVX/FT (f) or PVX/FTV70A (g). (h) Analysis of average numbers of seedpods per inoculated plants in three separate experiments. Numbers of plants (n) used in each experiment are indicated. Student t-tests of all samples show significant differences (P=0.0002) in the numbers of seedpods per plants inoculated with PVX/FTV70A when compared with PVX/FT. (i) Sizes of seedpods. All plants (a, b, d-g) except the control (c) were growing in LD conditions. Photographs were taken at 7 weeks post inoculation (wpi) (a-e), 12-wpi (f, g) or 14-wpi (i).
  • FIG. 4 FTV70A enhances floral induction. FTV70A causes early floral bud formation and more flowers to be produced (a) although FT and FTV70A have a similar capacity to trigger plants to bolt (b). Six SD N. tabacum Maryland Mammoth plants were inoculated with PVX/mFT (mFT), PVX/FT (FT), PVX/FTV70A (FTV70A), or PVX/FTR173A (FTR173A). Bolting was measured by the stem height and numbers of flowers and floral buds were counted at 21, 28 and 35 days post-inoculation (dpi). FTR173A, the loss-of-function mutant of FT (Table 1), was used as an additional control.
  • FIG. 5 Molecular analysis of FTV70A expression. (a-c) Detection of viral transient FT RNA. Viral transient FT RNA (a) and 18S rRNA (b) were detected in systemic young leaves by semi-quantitative RT-PCR. Total RNA samples were extracted from young leaves collected from plants mock-inoculated or inoculated with the PVX-based gene expression vectors at 5-wpi, pre-treated with RNase-free DNase, and used for RT-PCR detection as previously described12. RT-PCR products were sequenced to confirm the modified sequences (c). The sizes and positions of the 1-kb DNA ladder and the RT-PCR products are indicated. Nucleotide mutations for changing the amino acids of the FT protein are underlined. (d-e) Western blot analysis of FT protein (d) and the PVX coat protein (e) in SD N. tabacum Maryland Mammoth plants. (f) Coomassie blue-stained gel showing equal loading of soluble proteins extracted from young leaves of plants mock-inoculated, or inoculated with PVX/mFT, PVX/FT, PVX/FTV70A or PVX/FTR173A at 5-wpi. The positions and sizes of the protein markers, FT and PVX CP are indicated. FTR173A a newly identified loss-of-function mutant of FT (Table 1), was used as an additional control.
  • FIG. 6 Construction of FT over expression cassette for barley transformation. Coding sequences for the Arabidopsis FT and its novel alleles are to be amplified by PCR using high fidelity pfu polymerase, specific primers and cDNA clones (FIG. 1 a) as templates, digested with XhoI and SpeI, and cloned into the XhoI/SpeI sites of the binary vector pBract211 to produce pBract211/FT (control), pBract211/mFT (control) and pBract211/FTV70A. The three expression cassettes are to be used for barley transformation.
  • FIG. 7 GFP expression via a virus-based vector in barley. The infectious cDNA clone of the cocksfoot mild mosaic virus (CMMV)17 was modified to produce a vector for in vitro production of a new species of subgenomic (sg) RNA. This new sgRNA encodes the mRNA of the gene of interest to replace the viral coat protein gene and acts as mRNA for protein translation. The GFP coding sequence was cloned in the newly constructed CMMV vector. Barley leaf tissues mixed inoculated with CMMVgenomic RNA and the new sgRNA-GFP transcripts showed GFP green fluorescence (a; left: GFP fluorescence, middle: chlorophyll auto-fluorescence; right: merged image), revealed by Confocal microscopic examination. However, no GFP specific fluorescence was observed in mock-inoculated barley plants (b). Viral expression of GFP mRNA in infected plants was readily detectible by RT-PCR (c). Bar=100 μm.
  • FIG. 8 Improved production of tillers and heads with kernels by FT in barley. The wild type Arabidopsis FT coding sequence was cloned in the newly constructed CMMV vector. Young barley plants were mixed inoculated with CMMVgenomic RNA and the sgRNA-FT or the sgRNA-GFP transcripts. The latter was used as a negative control. Viral expression of FT caused early plant development and increased number of tillers after 16 days post inoculation, compared with plants having GFP expression (a, b). After 65 days post-inoculation, FT-expressing barley plants (c) developed more heads with kernels (indicated by arrows) than GFP-expressing plants (d).
  • FIG. 9 FTV70A possesses an enhanced biological activity in floral induction and seed production in N. tabacum Maryland Mammoth (MM) in SD. MM plants were mock inoculated (a, e, i) or treated with PVX/mFT (b, f, j), PVX/FT (c, g, k) or PVX/FTV70A (d, h, l) and grown in a 12-hr SD photoperiod of light at 25° C. Photographs were taken at 35- (a-d), 56- (e-h, k, 1) and 84- (i, j) days post inoculation. Mock-inoculated (i) or PVX/mFT (j)-treated plants eventually flowered and produced seedpods.
  • FIG. 10 Viral transient expression of FTV70A promote secondary budding and flowering in N. tabacum Maryland Mammoth (MM) in SD. MM plants were treated with PVX/FTV70A (a,b) or PVX/FT (c,d), and grown in a 12-hr photoperiod of light at 25° C. FTV70A (a, b) possesses an enhanced function in comparison to FT (c,d) in triggering development of lateral shoots from which axillary floral buds and flowers continued to develop. Mature seedpods produced from primary flowers were harvested at 70 days post inoculation (dpi). Remaining non-mature primary seedpods attach to plants treated with PVX/FT (c,d). Photographs were taken at 70 dpi. The outlined portions of plants are enlarged to show axillary shoots and newly developed floral buds (arrow).
  • FIG. 11 Viral transient expression of FTV70A promote secondary budding and flowering in N. tabacum Maryland Mammoth (MM) in SD. MM plants were treated with PVX/FT or PVX/FTV70A, and grown in a 12-hr photoperiod of light at 25° C. Expression of FTV70A induced further development of axillary shoots, secondary floral buds, flowers and seedpods (arrow, a-c). Mature seedpods produced from primary flowers were harvested at 70 days post of inoculation (dpi) of plants. Photographs were taken at 84 (a) or 98 dpi (b, c). The boxed sections of plants (i, ii) are enlarged to show axillary shoots and newly developed secondary floral buds and flowers.
  • FIG. 12 FTV70A enhances floral induction and seed production in N. tabacum Maryland Mammoth (MM) in SD. Expression of FT or FTV70A from PVX/FT or PVX/FTV70A is effective to induce early bolting and flowering when compared to mock- or PVX/mFT-treatment (a, b). However, MM plants treated from PVX/FTV70A produced significantly more numbers of flowers and seedpods than these treated with PVX/FT (b, c). Bolting was measured by stem height and numbers of flowers and floral buds were counted at 21, 28 and 35 days post inoculation (dpi). Total primary and secondary seedpods were counted at 70 dpi and 105 dpi.
  • FIG. 13 Detection of viral transient expression of FT gene. (a) RT-PCR assay of viral transient FT gene in MM plants with mock inoculation (mock) or treated with PVX/mFT (mFT), PVX/FT (FT) or PVX/FTV70A (V70A). (b-d) Direct sequencing of viral transient FT-specific RT-PCR products confirms the recombinant viruses maintained the non-sense (underlined) and deletion (A) double mutations in mFT, wild-type FT (start codon ATG is underlined) or sense mutation (underlined) in FTV70A during the course of experiments. (f-g) Western blot analysis of the Arabidopsis FT protein and PVX CP. No endogenous or viral transient FT protein was detected in the mock-inoculated MM plant or in plant treated with PVX/mFT. However, expression of the Arabidopsis FT protein was readily detectable in MM plants treated with either PVX/FT or PVX/FTV70A (f). The viral CP was detected in plants treated with PVX/mFT, PVX/FT or PVX/FTV70A, but not in the mock-inoculated plant (g). Coomassie blue-stained gel indicates the equal loading of total soluable protein samples (h). The positions and sizes of 1.0-kb DNA and the protein markers (M) are indicated.
  • FIG. 14 RT-PCR Viral delivery and expression of Arabidopsis FT in SD MM tobacco plants. Detection of viral transient FT RNA (a, c) and 18S rRNA (b, d) in both inoculated (a, b) and systemic young (c, d) leaves by RT-PCR using primers PP82 and PP83 [Li C, Zhang K, Zeng X, Jackson S, Zhou Y and Hong Y (2009) A cis element within Flowering Locus T mRNA determines its mobility and facilitates trafficking of heterologous viral RNA. J Virol 83: 3540-3548].
  • FIG. 15 2M Transgenic Barley. Transformation of barley. The Spring barley, Golden Promise, transformed with pBract214-FTV70A, produce more heads than barley transformed with either pBract214-FT or pBract214-mFT. Photographs were taken at 2 months post-transformation.
  • FIG. 16 4M Transgenic Barley. Transgenic expression of FTV70A significantly increases barley yields. Grains were counted from heads of individual barley plants transformed with pBract211-mFT, pBract211-wtFT or pBract211-FTV70A. Comparing FTV70A-expressing to mFT-expressing barley transformants, the total number of grains per line/plant increased approx. 85.7%. Regenerated plants with zero copy of any of three transgene constructs were used as “Null transformation control”. Student's t-tests show there is a significant difference in grain production between FTV70A- and mFT-transgenic lines (p=0.017) as well as between FTV70A- and wtFT-transgenic lines (p=0.003) whilst there is no significant difference between mFT- and wtFT-transgenic lines (p=0.178).
  • FIG. 17 FTT27A produces more flowers than FT in MM plants in SD.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
  • The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, which are within the skill of the art. Such techniques are explained fully in the literature.
  • In a first aspect, the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits one of the following phenotypes:
      • (a) increased flowering;
      • (b) increased flowering and increased fruit and/or seed production;
      • (c) no bolting and no flowering;
      • (d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
      • (e) normal bolting and no flowering.
  • Arabidopsis FT is a small globular protein consisting of 175-aa with homology to the mammalian phosphatidylethanolamine binding protein (PEBP) or Raf kinase inhibitor protein. The Flowering Locus T (FT) gene is highly conserved amongst different plant species. A comparison of FT amino acid sequences is shown in FIG. 1. Particularly conserved are the PEBP domain and the amidation site. Through comparing the amino acid sequences of Arabidopsis FT and its orthologs from rice and other species, Applicants identified 43 aa, including 9 aa within the conserved PEBP domain, 3 aa within a putative amidation site, the arginine residue at position 119 (R119),the glutamine residue at the position of 140 (Q140) and a number of N-terminal residues, as targets for molecular modification.
  • In the experiments described herein, each amino acid was substituted with Alanine (Ala, A) to produce 43 different single amino acid-modified FT proteins (table 1). This was achieved by PCR and overlapping PCR-based mutagenesis using specific primers (Table 3, example 8). The sequence was then cloned into the potato virus X (PVX)-based floral induction system12 (FIG. 2 b). Using the wild-type FT and a non-sense mutant mFT as positive and negative controls12 respectively, Applicants found that viral ectopic expression of the fourteen FT derivatives (table 1), confirmed by semi-quantitative (sq)RT-PCR and western blot, produced five different phenotypes in the short-day (SD) Nicotiana tabacum Maryland Mammoth (MM) plants in the non-inductive long-day (LD) conditions (Table 1).
  • TABLE 1
    Effect of single amino acid mutation on biological
    functions of the Arabidopsis FT protein
    Group FT mutants Phenotypes*
    I FTV68A, FTP72A, FTP77A, Normal bolting and flowering
    FTG172A, FTR174A, FTS2A,
    FTI5A, FTR6A, FTP8A, FTV11A,
    FTS12A, FTR13A, FTD20A,
    FTP21A, FTN23A, FTR24A,
    FTS25A, FTI26A, FTL28A, FTT31A
    II FTL67A, FTS78A, FTQ140A, Normal bolting but delayed
    FTG16A, FTL19A, FTF22A, flowering
    FTK29A, FTV30A
    III FTD71A, FTY85A, FTI3A, FTN4A, Normal bolting but no
    FTD7A, FTL9A, FTV14A, FTV15A, flowering
    FTD17A, FTV18A
    IV FTD73A, FTR119A, FTR173A No bolting, no flowering
    V FTV70A, FTT27A Slightly early flowering
    but increasing floral
    numbers and seed production
    per treated plant
    *Phenotypes are compared to that of MM plants treated with PVX expressing the Arabidopsis wtFT protein
  • These data demonstrate that the different conserved amino acids identified herein have different influences on FT biological activity and without wishing to be bound by theory, it is likely that they may do this by affecting different aspects of FT protein function, e.g. non-cell-autonomous florigen signalling and/or cell-autonomous floral induction. The different aspects of the invention described herein make use of the specific amino acid changes in the FT polypeptide as detailed in table 1. Specifically, transgenic plants expressing a modified FT nucleotide encoding a FT peptide with an altered sequence as compared to the wild type sequence as described in any of the mutant groups I to V as defined above (or equivalent mutations in orthologous sequences) are within the scope of the invention.
  • A modified FT polynucleotide according to the invention is a modified nucleic acid sequence, i.e. a modified FT gene that differs from the wild type polynucleotide, gene or nucleic acid sequence in its sequence.
  • Wild type as used herein refers to a plant that has not been modified and is preferably of the same species. The increase described herein may be two-fold or more, or describe an increase of at least 10-50%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50% or more.
  • Generally, for the purposes of the invention, “transgenic”, “transgene” or “recombinant” means with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector which may comprise the nucleic acid sequence or an organism transformed with the nucleic acid sequences and expressing the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
      • (a) the nucleic acid sequences encoding proteins useful in the methods of the invention, or
      • (b) genetic control sequence(s) which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
      • (c) a) and b)
        • are not located in their natural genetic environment or have been modified by recombinant methods, it being possible for the modification to take the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp. A naturally occurring expression cassette—for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a polypeptide useful in the methods of the present invention, as defined herein—becomes a transgenic expression cassette when this expression cassette is modified by non-natural, synthetic (“artificial”) methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in U.S. Pat. No. 5,565,350 or WO 00/15815.
  • A transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the method of the invention are not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously. However, as mentioned, transgenic also means that, while the nucleic acids according to the different embodiments of the invention are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified. Specifically, transgenic plants may refer to plants generated by methods that do not solely relay on traditional breeding. The plants may not carry a “transgene”, but may be generated through mutagenesis. Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place. Preferred transgenic plants are mentioned herein. The modified FT polynucleotide encodes a modified polypeptide that differs from the wild type polypeptide in its amino acid sequence. The modified polypeptide may comprise an amino acid modification, for example a deletion, addition or substitution. Preferably, the modification is an amino acid substitution of one or more amino acids within the sequence. In one preferred embodiment, the modification consists of a single amino acid substitution. The substitution may be conservative or non-conservative. In one embodiment, the substitution is a non conservative substitution, i.e. the amino acid is replaced with another amino acid that does not share the same chemical properties. Most preferred are substitutions with a neutral amino acid that cause little change in protein structure, for example Alanine (Ala, A) or Phenylalanine (Phe, F).
  • A preferred substitution is one that causes little change in protein structure. For example, mutation to A allows protein folding while at the same time affecting the biological function of the peptide. Where the chemical properties of the particular amino acid that is altered are critical to wild-type function, alteration of said amino acid produces a different phenotype in the mutant plant. However, based on the information provided herein, those skilled in the art will appreciate that amino acid substitutions other than those with A disclosed herein are also within the scope of the invention and that replacements with other amino acids, in particular those that allow protein folding but have different properties from the native residue are expected to have similar effects. Such replacements are therefore within the skill of the skilled person.
  • A skilled person will appreciate that to achieve the desired amino acid substitutions, the corresponding codon must be altered and due to the degenerate code of the DNA, more than one alteration of the target codon may be possible to generate the desired substitution in the peptide.
  • The plant according to the invention exhibits a phenotype that is different from the wild type phenotype. In particular, the plant exhibits an altered flowering profile. The term flowering profile may relate to an increase in flowering and/or a change in flowering time. Increased flowering as used herein is understood to mean increased numbers of flowers per plant, thus leading to an increase in seed yield. Flowering time may be early or delayed. For example, plants that flower early start to flower one week earlier than plants expressing the wild-type FT. Plants that exhibit delayed flowering, start to flower one week later than plants expressing the wild-type FT. However, the inventors have surprisingly found that altering the amino acid sequence of the FT protein may also increase the number of flowers and seedpods. An increase in seed yield was also observed (Table 1, FIG. 3).
  • Thus, in a preferred embodiment, the invention relates to a transgenic plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits increased flowering and increased yield, i.e. increased fruit and/or seed production. The disclosure provides examples of such modifications. For example, the modification is a substitution and said substitution may comprise or consists of substitution of V70 or T27 or both. The substitution may be with A. Thus, in the modified FT polynucleotide, the codon encoding V70 and/or T27 may be changed to a codon encoding A (GCU, GCC, GCA, GCG). The plant may further show altered flowering time.
  • The numbering of the amino acid residues as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequence. This numbering is shown in FIG. 1. Thus, V70 in the Arabidopsis FT amino acid sequence is the second V residue in the conserved PEBP domain (YTLVMVDPDVPSPSNPHLREYL). Because the FT amino acid sequence in other species may comprise fewer or more amino acids (most typically, 1 to 2 additional or fewer amino acids), the position of the second conserved V residue in the amino acid sequence may not be 70, but may be 69, 71 or 72. The positions of the targeted residues according to the invention in some exemplified plant species are shown in FIG. 1. In other words, according to one embodiment of this aspect of the invention, the modification is a substitution and said substitution may comprise or consists of substitution of the second conserved V in the PEBP domain which may comprise the following sequence or a sequence at least 90% homologous thereto: YTLVMVDPDVPSPSNPHLREYL. In another embodiment, an N terminal residue at about position 27 is modified.
  • A peptide sequence expressed by said plant is shown in SEQ ID NO. 44 and 45. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • The correlation between the biological function and the expression of the engineered FTV70A protein was analysed in three separate experiments. SD MM tobacco plants that were mock-inoculated or treated with PVX/mFT carrying a mutated nontranslatable FT mRNA remained vegetative in LD (FIG. 3 a, b) while positive control plants (FIG. 3 c) and MM plants treated with PVX/FT that had the capacity to express normal FT protein flowered (FIG. 3 d). By contrast, viral ectopic expression of FTV70A triggered early floral bud formation and flowering (FIG. 4 a), and resulted in a marked increase in flower numbers per inoculated plants (FIG. 3 e), although both FT and FTV70A had a similar capacity to induce MM tobacco to bolt (FIG. 4 b). FTV70A-, but not FT-expressing MM tobacco plants were consistently found to bear significantly high numbers of seedpods (FIG. 3 f-h). The increased number of seedpods did not result in a reduced size of seedpods (FIG. 3 i). Consequently, total dry weight seed production was approx. 30% greater in plants treated with PVX/FTV70A compared to plants treated with PVX/FT. Moreover, seeds collected from the PVX/FT5A-treated plants were found to have the same germination vigour of the seeds as compared with normal MM tobacco seeds. The plant also shows early flowering at 21 days post inoculation, which is approx. one week earlier than plants inoculated with the recombinant virus expressing wild-type FT (FIG. 4). Moreover, the plant is characterised in an increase in flowers, approx 72 flowers/plant compared to approx. 40 flowers per wild-type FT expressing plant (FIG. 4).
  • Thus, according to one of the preferred aspects of the invention, the plant shows an increase in seed production or seed yield wherein said increase is about 10% to about 50% or more, for example about 30%. The increase in flowering may be 10% to about 50% or more.
  • In another embodiment, the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits no bolting and no flowering. In one embodiment, the substitution may comprise or consists of substitution of an amino acid at residues D73, R119 or R173. The substitution may be with A. As mentioned above, the numbering of the targeted conserved amino acid residues as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences. The conserved D at position 73 is the first D in the conserved PEBP domain. The conserved R at position 173 is the first R residue in the amidation site. Combinations of the mutations listed above may also be used.
  • A peptide sequence expressed by said plant is shown in SEQ ID NO. 41 and 43. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • In another embodiment, the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H. In one embodiment, the substitution may comprise or consists of substitution of an amino acid at residues L67, S78,Q140, G16, L19, F22, K29 or V30. In a preferred embodiment, the substitution may comprise or consists of substitution of an amino acid at residues L67, S78 or Q140. The substitution may be with A. As mentioned above, the numbering of the conserved amino acid residues targeted as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences. For example, L67 designates the first conserved L in the PEBP domain, S78 designates the second conserved S in the PEBP domain and Q140 designates the conserved Q in the external loop that is shown to be positioned closed to the Y85 within the ligand-binding sites. Combinations of the mutations listed above may also be used.
  • A peptide sequence expressed by said plant is shown in SEQ ID NO. 23 and 30. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • In another embodiment, the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said plant exhibits normal bolting but no flowering. In one embodiment, the substitution may comprise or consists of substitution of an amino acid at residue D71, Y85, N13, N4, D7, L9, V14, V15, D17 or V18. In one embodiment, the substitution may comprise or consists of substitution of an amino acid at residue D71 or Y85 The substitution may be with A. D71 designates the first conserved D in the PEBP domain adjacent to a V residue (V70 for the Arabidopsis sequence). As mentioned above, the numbering of the conserved amino acid residues targeted as used in this disclosure is based on the numbering of the Arabidopsis FT amino acid sequences. For example, Y85 designates the second conserved Y towards the N terminus of the PEBP domain. Combinations of the mutations listed above may also be used.
  • A peptide sequence expressed by said plant is shown in SEQ ID NO. 31 and 40. Homologous or orthologous sequences from other plants that carry the mutation at an equivalent position are within the scope of the invention.
  • In another aspect, the invention relates to a plant which may comprise and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide which may comprise an amino acid modification wherein said modification is a substitution and said substitution consists of or is selected from a substitution at one or more of the following residues as listed in table 1, particularly those listed in groups II-V and most preferred those in group V In one embodiment, substitution is with A. In one embodiment, the modification is a substitution and said substitution consists of or is selected from a substitution at V70 and/or T27, for example V70A and/or T27A.
  • In one embodiment, the plant also may comprise a regulatory sequence. This regulates expression of the polynucleotide in said plant. The sequence may be a promoter sequence, for example an endogenous promoter or a promoter that drives constitutive overexpression of a gene. Overexpression according to the invention means that the transgene is expressed at a level that is higher than expression driven by its endogenous promoter. For example, overexpression may be carried out using a strong promoter, such as the cauliflower mosaic virus promoter (CaMV35S), the rice actin promoter or the maize ubiquitin promoter or any promoter that gives enhanced expression. An inducible promoter, such as a stress-inducible promoter, for example the RubisCO small subunit promoter, or an ethylene, propylene, steroid or ethanol responsive promoter or a heat shock promoter may also be used. Also envisaged is ectopic expression, i.e. gene expression in a tissue in which it is normally not expressed. Alternatively, enhanced or increased expression may be achieved by using transcription or translation enhancers or activators and may incorporate enhancers into the gene to further increase expression. This list is not considered limiting as the skilled person will be able to select a suitable promoter that is capable of driving sufficient expression of the gene to result in the production of the modified protein.
  • The invention also extends to harvestable parts of modified plants described herein such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs, which harvestable parts comprise a recombinant nucleic acid encoding a modified FT polypeptide. The invention furthermore relates to products derived, preferably directly derived, from a harvestable part of such a plant, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins.
  • In another aspect, the invention relates to a method for producing a plant as disclosed herein which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification. In one embodiment, the invention thus relates to a method for producing a plant that produces more flowers and has increased fruit or seed production which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification. Preferably, a modified FT polynucleotide encodes a modified polypeptide wherein V70 or T27 or both are replaced with another amino acid.
  • In another aspect, the invention relates to a method for increasing flowering and seed production in a plant which may comprise introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide which may comprise an amino acid modification. Preferably, the modified FT polynucleotide encodes a modified polypeptide wherein V70 and/or T27 is replaced with another amino acid.
  • The sequence which may comprise a modified FT polynucleotide sequence as described herein may further comprise a selectable marker that may be associated with the heterologous nucleic acid sequence, i.e., the structural gene operably linked to a promoter. As used herein, the term “marker” refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a plant or plant cell containing the marker. The marker gene may be an antibiotic resistance gene whereby the appropriate antibiotic may be used to select for transformed cells from among cells that are not transformed. Alternatively, the marker gene may be a herbicide resistance gene. Suitable markers will be known to those of skill in the art.
  • A skilled person will appreciate that to carry out the methods of the invention, a plant is transformed with a vector which may comprise the sequence of interest. Such vectors are disclosed herein. The details of the construction of the vectors that may be used are known to those skilled in the art of plant genetic engineering. The heterologous nucleic acid sequences utilized in the present invention may, for example, be introduced into plant cells using Ti plasmids, root-inducing (Ri) plasmids, or plant virus vectors, such as PVX.
  • The transformation of plants in accordance with the invention, i.e. the alteration of the genotype of a host plant by the introduction of a heterologous nucleic acid sequence, may be carried out in essentially any of the various ways known to those skilled in the art of plant molecular biology. Examples of transformation include infection by Agrobacterium, for example by infecting plant cells, an explant, a meristem or a seed, with transformed Agrobacterium tumefaciens. Under appropriate conditions known to those skilled in the art, the transformed plant cells are grown to form shoots, roots, and develop further into plants. Another example is transfection using a viral vector, such as the PVX vector system as shown herein, electroporation or particle bombardment. This list is non limiting as the skilled person will be able to use a suitable system.
  • Many Arabidopsis homologues and orthologues have been identified and a non-limited selection of these is shown in table 2 below.
  • TABLE 2
    Plant FT gene
    Arabidopsis FT
    Soybean FT1
    Rice OsFTL1, OsFT2 (Hd3a), OsFTL3
    Barley HvFT1-HvFT5, VRN3
    Poplar PtFT2
    Wheat VRN3, TaFT
    Tomato SFT
    Cucurbit Cm-FTL1/2
    Maize ZCN
    Brassica BnFT
    Citrus CiFT
    Malus MdFT1, MdFT2
    Vitis VvFLT
    Spruce PaFT4
    Garden pea PsFTL
    Medicago MtFTLa, MtFTLb, MtFTLc
    Chenopodium CrFTL1, CrFTL2
    Pharbitis nil PnFT2
  • As shown herein, the plant according to the different aspects of the invention may be tobacco or barley. The inventors have shown that a modified gene sequence derived from the Arabidopsis FT gene may direct the expression of a modified FT protein in tobacco and induce an altered phenotype compared to the wild type. The skilled person would know that the invention is not limited to tobacco or barley which are used as a models plant in the experiments to illustrate the invention. Bearing in mind that the FT locus is conserved in many plant species, the skilled person would know that any monocot or dicot plant may be used according to the invention.
  • A dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus), Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae), Malvaceae, Rosaceae or Solanaceae. For example, the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species. In one embodiment, the plant is oilseed rape.
  • Also included are biofuel and bioenergy crops such as rape/canola, linseed, lupin and willow, poplar, poplar hybrids, switchgrass, Miscanthus or gymnosperms, such as loblolly pine. Also included are crops for silage (maize), grazing or fodder (grasses, clover, sanfoin, alfalfa), fibres (e.g. cotton, flax), building materials (e.g. pine, oak), pulping (e.g. poplar), feeder stocks for the chemical industry (e.g. high erucic acid oil seed rape, linseed) and for amenity purposes (e.g. turf grasses for golf courses), ornamentals for public and private gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant).
  • A monocot plant may, for example, be selected from the families Arecaceae, Amaryllidaceae or Poaceae. For example, the plant may be a cereal crop, such as wheat, rice, barley, maize, oat sorghum, rye, onion, leek, millet, buckwheat, turf grass, Italian rye grass, switchgrass, Miscanthus, sugarcane or Festuca species.
  • Preferably, the plant according to the different aspects of the invention is a crop plant. By crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use or other non-food/feed use.
  • Preferred plants are maize, wheat, rice, oilseed rape, sorghum, soybean, potato, tomato, barley, pea, bean, field bean, cotton, lettuce, broccoli or other vegetable brassicas or poplar. In another embodiment, the plant may be selected from the plants shown in table 1 and may express a modified endogenous FT gene based on the endogenous gene identified in table 1.
  • In one embodiment, the plant may be used for biofuel production.
  • The modified gene or polypeptide that is expressed in the plant according to the different aspects of the invention may be an exogenous gene, such as a modified Arabidopsis FT, expressed in a different plant species. Preferred plants are detailed above. Alternatively, the invention also relates to using a modified gene based on the endogenous FT gene. The endogenous FT gene is a FT Arabidopsis homologue or orthologue. Such genes are specified herein and known in the art. The modified polypeptide or gene encodes an altered protein as set forth herein and is introduced and expressed or overexpressed in the plant. Preferred plants are detailed above.
  • In another aspect, the invention provides an isolated modified FT nucleic acid sequence encoding a modified FT polypeptide which may comprise an amino acid modification. The modification may be a deletion, addition or substitution. Preferably, the modification is a substitution. The isolated modified nucleic acid sequence is selected from a sequence encoding a polypeptide which may comprise a substitution at one of the following residues or a combination thereof: T27, V70, D73, R119, R173, D71, L67, S78 Q140 or FTG16, FTL19, FTF22, FTK29 or FTV30. For example, the polypeptide may have a single substitution at these residues. Also envisaged is a modified polypeptide wherein the residue Y85 is replaced with A.
  • In one embodiment, the modified polypeptide has a single amino acid substitution selected from the substitutions above. In a preferred embodiment, the modified nucleic acid sequence encodes a polypeptide which may comprise a substitution at residue V70 or T27 or both. A skilled person will appreciate that to achieve the amino acid substitutions above, the corresponding codon must be altered and due to the degenerate code of the DNA, more than one alteration of the codon may be possible to generate the desired substitution.
  • A sequence or vector described herein encoding a modified FT protein is introduced as a transgene into the plant. This may be carried out by various methods as known in the field of plant genetic engineering, for example using transformation with Agrobacterium, PVX or particle bombardment.
  • In another aspect, the invention relates to a vector which may comprise a modified nucleic acid sequence that encodes a polypeptide as described herein. In a further aspect, the invention relates to a plant cell transformed with a vector or a gene sequence as described herein. Specifically, the invention relates to a host cell expressing a modified protein having a substitution at position V70 or T27 or both. The plant cell may be a cell of a monocot or dicot plant as further defined herein. Also within the scope of the invention is the use of a modified nucleic acid sequence encoding a polypeptide as described herein to alter flowering time and/or quantity and/or seed/fruit yield in a plant. For example, a modified nucleic acid sequence encoding a polypeptide which may comprise a substitution of residue V70 or T27 or both may be used to induce more flowering and increase seed yield in a plant. This may be carried out using the methods described herein.
  • In a further aspect, the invention relates to a method for producing a mutant plant expressing an FT variant and which is characterised by one of the phenotypes described herein wherein said method uses mutagenesis and Targeting Induced Local Lesions in Genomes (TILLING) to target the gene expressing the FT polypeptide. According to this method, lines that carry a specific mutation are produced that has a known phenotypic effect. For example, mutagenesis is carried out using TILLING where traditional chemical mutagenesis is flowed by high-throughput screening for point mutations. This approach does thus not involve creating transgenic plants. The plants are screened for one of the phenotypes described herein, for example a plant that shows increased flowering and seed production. The FT locus is then analysed to identify a specific FT mutation responsible for the phenotype observed. Plants may be bred to obtain stable lines with the desired phenotype and carrying a mutation in the FT locus. Thus, in one embodiment, the invention relates to a method for producing a plant exhibiting an altered phenotype selected from:
      • (a) increased flowering
      • (b) increased flowering and increased fruit and/or seed production;
      • (b) no bolting and no flowering;
      • (c) normal bolting and delayed flowering
      • (d) normal bolting and no flowering
        • said method which may comprise mutagenising a plant population and screening progeny derived from said population for said phenotype, identifying a plant exhibiting said phenotype and screening said plant for one or more point mutation in the FT locus.
  • Thus in one embodiment, the method used to create and analyse mutations is targeting induced local lesions in genomes (TLLING), reviewed in Henikoff et al, 2004, Plant Physiology, 2004, 630-636. In this method, seeds are mutagenised with a chemical mutagen, for example EMS. The resulting M1 plants are self-fertilised and the M2 generation of individuals is used to prepare DNA samples for mutational screening. DNA samples are pooled and arrayed on microtiter plates and subjected to gene specific PCR. The PCR amplification products may be screened for mutations in the FT target gene using any method that identifies heteroduplexes between wild type and mutant genes. For example, but not limited to, denaturing high pressure liquid chromatography (dHPLC), constant denaturant capillary electrophoresis (CDCE), temperature gradient capillary electrophoresis (TGCE), or by fragmentation using chemical cleavage. Preferably the PCR amplification products are incubated with an endonuclease that preferentially cleaves mismatches in heteroduplexes between wild type and mutant sequences. Cleavage products are electrophoresed using an automated sequencing gel apparatus, and gel images are analyzed with the aid of a standard commercial image-processing program. Any primer specific to the FT gene may be utilized to amplify the FT genes within the pooled DNA sample. Preferably, the primer is designed to amplify the regions of the FT gene where useful mutations are most likely to arise, specifically in the areas of the FT gene that are highly conserved and/or confer activity. To facilitate detection of PCR products on a gel, the PCR primer may be labelled using any conventional labelling method.
  • Rapid high-throughput screening procedures thus allow the analysis of amplification products for identifying a mutation conferring the reduction or inactivation of the expression of the FT gene as compared to a corresponding non-mutagenised wild type plant. Once a mutation is identified in a gene of interest, the seeds of the M2 plant carrying that mutation are grown into adult M3 plants and screened for the phenotypic characteristics associated with the FT gene. Loss of and reduced function mutants with increased yield and increased expression during leaf senescence compared to a wild type control may thus be identified.
  • In another aspect, the invention relates to a method for identifying a mutant plant which may comprise an FT variant polynucleotide sequence which may comprise identifying a mutant phenotype as described herein and analysing the FT polynucleotide sequence.
  • EXAMPLES
  • Having generally described this invention herein above, the following examples are provided to further describe the invention, to enable those skilled in the art to practice the full scope of this invention, including its best mode. The specifics of the examples which follow should not, however, be construed as limiting on the invention, as those skilled in the art will appreciate that variations, modifications and permutations of the specific details disclosed herein may yield useful results which, although differing in specific details, are nonetheless encompassed within the scope of the appended claims and equivalents thereof.
  • Example 1 Cloning of the FT Gene
  • The Arabidopsis FT derivatives encoding FTG172A, FTR173A and FTR174A were amplified by PCR using the corresponding sets of primers A and D (FIG. 2) and the plasmid PVX/FT carrying the wild type FT gene as the template12. PCR mixtures (50 μl) contained 5 μl of 10× reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of each primer, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of template DNA. The resulting PCR products were purified using the QIAGEN Quick PCR Purification Kit, digested with ClaI and EagI, and then cloned into the ClaI/EagI sites of the PVX-based gene expression vectors12.
  • All other FT derivatives (FIG. 2) were obtained by overlapping extension PCR. Each case involved designing two mutagenic primers B and C (FIG. 2) that contained specific mutations and were partially complementary to each other. Two separate PCR reactions (5 μl of 10× reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of each of primers A and B or C and D, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of template DNA) were performed to generate the 5′- and 3′-portions of the FT gene. The full-length FT derivative was then amplified through a third PCR (5 μl of 10× reaction buffer (Promega), 0.2 mM dNTPs (dATP, dGTP, dCTP and dTTP), 15 pmole of primer A and D, 1.25 units of pfu DNA polymerase (Promega) and 50 ng of the 5′- and 3′-portions of FT gene PCR products), purified, restriction enzymes-digested, and cloned into PVX to produce each of the corresponding expression vectors (FIG. 2 a) as described above. The integrity of all recombinant clones and the presence of mutations were confirmed by sequencing.
  • Example 2 Modification of the FT Gene
  • To modify the 5′- (i.e. any nucleotide in the first 100 nucleotides) or 3′- (i.e. any nucleotide in the last 100 nucleotides) end of the FT gene, specific primers (30-110 nucleotides) having substitution of the codon for a chosen amino acid with the triple-nucleotides coding for alanine were chemically synthesised. Of course, using this methodology, other substitute amino acids may be utilized and the mutants thus produced are tested in the same fashion to that described below. The mutagenic primer was used along with either primer A or D (FIG. 2A) in PCRs as described in Example 1 in order to introduce specific modifications into the FT gene.
  • To introduce nucleotide changes into the middle part (i.e. nucleotide 101-429) of the FT gene, two partially complementary primers B and C (FIG. 2) were synthesised. Nucleotide changes were introduced into both primers in order to substitute the codon for the selected amino for mutation with the triple-nucleotide coding for alanine. The two mutagenic primers coupled with either primer A or D were used in the overlapping extension PCRs as described in Example 1 to introduce specific modifications into the FT gene.
  • Example 3 Expression of the Modified Gene in Plants
  • RNA transcripts from each recombinant PVX vector (FIG. 2) were produced by in vitro run-off transcription12. A typical in vitro transcription reaction (50 μl containing 5 μl of 10× buffer (Biolabs), 40 units of RNasin (Promega), 2 mM each of ATP, CTP, UTP and GTP, 0.5 mM m7GpppG (Biolabs), 2.5 μg of SpeI-linearised vector DNA, and 200 units of T7 RNA polymerase) was incubated at 37° C. for 1 hr. RNA transcripts were further treated with 1 unit of RNase-free DNase (Promega) at 37° C. for 30 min and then mechanically inoculated on the plants at 5 to 6 leaf stage. Young short-day (SD) Nicotiana tabacum Maryland Mammoth (MM) plants were maintained in insect-free glasshouses at 25° C. with continuous lighting to give a long-day (LD, 16-hr) photoperiod. Viral ectopic over-expression of the wild type and modified FT genes was analysed both at the RNA and the protein levels as previously described12, and viral delivery of the wild type and modified FT genes was confirmed by sequencing.
  • Example 4 Analysis of Plants for Altered Phenotypes
  • Virus-treated SD MM plants developed virus-associated phenotypes including chlorotic lesions on inoculated leaves and mild chlorosis on young leaves after 7 to 14 days post-inoculation (dpi). Plants started to shoot at approx, 20 dpi and flowered at approx. 35 dpi if they were treated with a recombinant virus that expressed the wild-type Arabidopsis FT gene or its functional alleles. Plant growths (bolting) were measured weekly. Development of floral buds, flowers and seedpods were routinely checked and photographically recorded with a Nikon digital CoolPix 995 camera. Numbers of buds, fully-opened flowers and seedpods were counted. Seedpods were then collected, the amounts of seeds were weighted, and seeds were tested for germination. Phenotypes in terms of bolting, flowering time, numbers of flowers seedpods per plant which were affected by the viral ectopic expression of various FT mutants were compared to that of plants expressing the wild-type Arabidopsis FT.
  • Example 5 Transformation of Plants with the Modified Gene
  • The function-enhanced FT mutant FTV70A represents a novel gene that may have great potential in agricultural biotechnology. This is confirmed by transforming crop plants with the modified FT gene and analysing whether expression of FTV70A in crops induces similar phenotypes to those obtained in tobacco, i.e. increased flowering, increased flower number and increased fruit and/or seed yield. To this end, three expression cassettes (FIG. 6) are constructed for transformation of barley using a well-established transformation protocol16. This work is extended to crops including but not limited rice, wheat, maize, cotton, tomato, soybean, and brassicas, as well as horticultural and fruit crops, and ornamental species. Moreover, the valine residue which was substituted with alanine in FTV70A was found to be conserved among Arabidopsis FT and its orthologs in rice, barley, wheat and other species. Therefore, mutation of these amino acids in these FT orthologs with Alanine is predicted to enhance their biological function to trigger early flowering, increase floret number, and enhance kernel (seed) production through plant transformation.
  • Example 6 Analysis of Transformants for Altered Phenotypes
  • Viral delivery of wild-type and mutated FT mRNA was readily detected in systemic leaves of PVX-treated MM tobacco plants by RT-PCR (FIG. 5 a, b), indicating that an equivalent amount of FT mRNA was expressed from each of the corresponding recombinant viruses in the tested plants. Moreover, direct sequencing of the specific RT-PCR products demonstrated that the modifications introduced into the FT gene were stably maintained during the course of the experiments (FIG. 5 c). Using an antiserum specifically raised against FT peptides, Applicants detected a single band of approx. 20 kDa corresponding to the predicted size of the FT protein expressed in plants inoculated with PVX/FT and an R173A “loss-of-function” FT protein variant (Table 1) in plants inoculated with PVX/FTR173A (FIG. 2 a; FIG. 5 d). Surprisingly, in plants inoculated with PVX/FTV70A, two forms of FTV70A were consistently found, suggesting that FTV70A may have undergone post-translational modification and possibly that this modification may be required for the novel functionality of this synthetic protein. Consistent with the RT-PCR assays showing equivalent amounts of FT mRNA in the inoculated plants, similar amounts of the PVX CP were also detected (FIG. 5 e, f), demonstrating that the PVX-based expression system is able to deliver equal amounts of FT mRNA and its protein products in all inoculated MM tobacco plants.
  • Phenotypes (growth, flowering time, flower number, seed yield and productivity) of primary transformants are compared with that of plants transformed with control gene expression cassettes (FIG. 6). Copy numbers of transgenes in each transgenic line is determined and lines with a single copy of the relevant transgenes are selected for further analysis. Transgene expression is analysed at the RNA and protein levels, which are then correlated with the phenotypic changes among transgenic lines transformed with the three different gene expression cassettes (FIG. 6). It is anticipated that (1) increases in floral numbers is in particular beneficial to horticultural industry for breeding novel flower plants; and (2) increases in productivity is particularly beneficial to agriculture, food and biotechnology for breeding novel crops for high yields and for biofuel production.
  • Example 7 Possible Implications of the Function-Enhanced FtV70A in Molecular Breeding of Novel Crops
  • Applicants' data demonstrate that the V70A substitution in the FT protein is responsible for the enhanced biological activity of FTV70A, enabling it to trigger flowering and cause increased flower numbers and seed yield. This finding is important in terms of engineering the FT protein for enhanced crop productivity. In addition, Applicants' virus-based floral induction system revealed a number of other potentially useful alleles of FT that confer different flowering responses (Table 1). For instance, over-expression of Group IV mutants (i.e. no bolting and no flowering) may have a dominant negative effect on plants, e.g. lettuce, so that such crops remain vegetative growth. Another potential application of the Group IV mutants may be found in biomass crops for example to avoid energy being diverted into flowering processes (bolting and flowering), in particular for vegetatively species where a flowering/seed phase is not necessary for agricultural cultivation (e.g. sugar cane). The Group IV mutants (no bolting, no flowering) could also have uses in fertility control, by preventing flowering altogether when flowering is not required, for example sugar beet, turfgrasss etc.
  • Knowledge of such an allelic series that confers a range of flowering characteristics is useful to molecular plant breeders, who, based on the present disclosure, could produce lines carrying a specific mutation that has a known phenotypic effect through targeted molecular breeding approaches, e.g. by screening for a specific FT mutation in TILLING populations. Another potential application is the use of non seed-borne viral vectors expressing FT or FTV70A to promote flowering and seed production in breeding programmes or in recalcitrant plant species in germplasm collections. Furthermore, the pools of FT mutants, in particular, the non-flowering “loss-of-function” alleles in group III and IV (Table 1), represent a unique resource for dissecting the molecular domains of the FT protein that are responsible for the long-distance movement and the cell-autonomous floral induction.
  • Example 8 Quantitative Real-Time PCR for Determining Transgene Copy Number
  • Quantitative real-time PCR was carried out using Hyg gene and CO2 (Constans-like, AF490469) gene specific primers and probes [Bartlett J G, Alves S C, Smedley M, Snape J W, Harwood W A (2008) High-throughput Agrobacterium-mediated barley transformation. Plant Methods, 4: 22]. Primers were designed to the target sequences using Applied Biosystems software Primer Express, with the TaqMan Probe and Primer design module (see below). The reactions used Thermo ABGene Absolute QPCR Rox Mix (Cat number AB 1139). The Hyg gene and the CO2 gene were assayed in multiplex. The probes and primer final concentrations were 200 nM (Hyg) or 100nM (CO2). The assay contained 5 μl of DNA solution, and was optimised for final DNA concentrations 1 to 10 ng/μl (5 to 50 ng DNA in the assay). PCRs were carried out in an Applied Biosystems AB17900 equipped with a 384 place plate. The detectors used were FAM-TAMRA and VIC-TAMRA with Rox internal passive reference, and no 9600 emulation. The PCR cycling conditions were 95° C. 15 minutes (enzyme activation), 40 cycles of 95° C. 15 seconds, 60° C. 60 seconds. Each sample was analysed twice.
  • Final
    concen-
    tration
    Name Sequence in PCR
    HvHygF3 GGATTTCGGCTCCAACAATG
    200 nM
    SEQ ID No. 46
    HvHygR2 TATTGGGAATCCCCGAACATC 200 nM
    SEQ ID No. 47
    HvCon2F1 TGCTAACCGTGTGGCATCAC 100 nM
    SEQ ID No. 48
    HvCon2R1 GGTACATAGTGCTGCTGCATCTG 100 nM
    SEQ ID No. 49
    HvHygP Fam-CAGCGGTCATTGACTGGAG 200 nM
    SEQ ID No. 50 CGAGG-Tamra
    HvCon2P VIC-CATGAGCGTGTGCGTGTCT 100 nM
    SEQ ID No. 51 GCG-TAMRA
  • After PCR the Cycle Threshold (CT) values were obtained using the Applied Biosystems SDS software, after adjusting the background subtraction and threshold values, so that all amplification curves were close to mid-log amplification. The delta Ct value (Ct of Hyg minus the Ct of CO2) was calculated for each sample. The samples were sorted by delta Ct, those with high ΔCt values have low copy numbers, and those with low ΔCt have high copy numbers of the Hyg gene.
  • Example 9 Plant Material and Immature Embryo Isolation
  • Donor plants of the spring barley, Golden Promise, were grown under controlled environment conditions with 15° C. day and 12° C. night temperatures as previously described [Harwood W A, Ross S M, Cilento P, Snape J W: The effect of DNA/gold particle preparation technique, and particle bombardment device, on the transformation of barley (Hordeum vulgare). Euphytica 2000, 111:67-76]. Humidity was 80% and light levels 500 μmol·m−2·s−1 at the mature plant canopy level provided by metal halide lamps (HQI) supplemented with tungsten bulbs. Immature barley spikes were collected when the immature embryos were 1.5-2 mm in diameter. Immature seeds were removed from the spikes and sterilised as previously described [Harwood W A, Ross S M, Cilento P, Snape J W: The effect of DNA/gold particle preparation technique, and particle bombardment device, on the transformation of barley (Hordeum vulgare). Euphytica 2000, 111:67-76]. The immature embryos were exposed using fine forceps and the embryonic axis removed. The embryos were then plated scutellum side up on CI medium containing 4.3 g 1−1 Murashige & Skoog plant salt base (Duchefa), 30 g 1−1 Maltose, 1.0 g 1−1 Casein hydrolysate, 350 mg 1−1 Myo-inositol, 690 mg 1−1 Proline, 1.0 mg 1−1 Thiamine HCl, 2.5 mg 1−1 Dicamba (Sigma-Aldrich) and 3.5 g 1−1 Phytagel, with 25 embryos in each 9 cm Petri dish.
  • Example 10 Plasmids and Bacterial Strain
  • Agrobacterium strain AGL1 containing pBract vectors was used in all experiments. All pBract vectors are based on pGreen [Hellens R P, Edwards E A, Leyland N R, Bean S, Mullineaux P M: pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 2000, 42:819-832] and therefore need to be co-transformed into Agrobacterium with the helper plasmid pSoup. To enable the small size of pGreen, the pSa origin of replication required for replication in Agrobacterium, is separated into its' two distinct functions. The replication origin (ori) is present on pGreen, and the trans-acting replicase gene (RepA) is present on pSoup. Both vectors are required in Agrobacterium for pGreen to replicate. pBract vector DNA and pSoup DNA were concurrently transferred to AGL1 via electroporation.
  • Example 11 Agrobacterium-Mediated Transformation
  • The method of Tingay et al. [Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thornton S, Brettell R: Agrobacterium tumefaciens-mediated barley transformation. Plant J 1997, 11:1369-1376] was used to prepare a standard Agrobacterium inoculum for transformation. A 400 μl aliquot of standard inoculum was removed from −80° C. storage, added to 10 ml of MG/L [Bartlett J G, Alves S C, Smedley M, Snape J W, Harwood W A (2008) High-throughput Agrobacterium-mediated barley transformation. Plant Methods, 4: 22] medium without antibiotics and incubated on a shaker at 180 rpm at 28° C. overnight. This full strength culture was used to inoculate the prepared immature embryos. A small drop of Agrobacterium suspension was added to each of the immature embryos on a plate. The plate was then tilted to allow any excess Agrobacterium suspension to run off. Immature embryos were then gently dragged across the surface of the medium (to remove excess Agrobacterium) before being transferred to a fresh CI plate, scutellum side down. Embryos were co-cultivated for 3 days at 23-24° C. in the dark.
  • Example 12 Selection of Transformed Plants
  • After co-cultivation, embryos were transferred to fresh CI plates containing 50 mg 1−1 hygromycin, 160 mg 1−1 Timentin (Duchefa) and 1.25 mg 1−1 CuSO4.5H2O. Embryos were sub-cultured onto fresh selection plates every 2 weeks and kept in the dark at 24° C. After 4-6 weeks, embryos were transferred to transition medium (T) containing 2.7 g 1−1 Murashige & Skoog modified plant salt base (without NH4NO3) (Duchefa), 20 g 1−1 Maltose, 165 mg 1−1 NH4NO3, 750 mg 1−1 Glutamine, 100 mg 1−1 Myo-inositol, 0.4 mg 1−1 Thiamine HCl, 1.25 mg 1−1 CuSO4.5H2O, 2.5 mg 1−1 2,4-Dichlorophenoxy acetic acid (2,4-D) (Duchefa), 0.1 mg 1−1 6-Benzylaminopurine (BAP), 3.5 g 1−1 Phytagel, 50 mg 1−1 Hygromycin and 160 mg 1−1 Timentin in low light. After a further 2 weeks, embryo derived callus was transferred to regeneration medium in full light at 24° C., keeping all callus from a single embryo together. Regeneration medium was the same as the transition medium but without additional copper, 2,4-D or BAP. Once regenerated plants had shoots of 2-3 cm in length they were transferred to glass culture tubes containing CI medium, without dicamba or any other growth regulators but still containing 50 mg 1−1 hygromycin and 160 mg 1−1 Timentin. Transformed plants developed a strong root system in the hygromycin containing medium in 1-2 weeks and were then transferred to soil and grown under the same conditions as the donor plants.
  • Table 3 below shows primer sequences (SEQ ID No. 52-78)
  • TABLE 3
    Table 2 Primer sequences
    Primer Sequence (5′-3′)
    PP331 AAGATCATCGATGTCTATAAATATAAGAGACCCTC
    PP332 AGAAGCCGGCCGAAGTCTTCTTCCTCCGCAGCCAC
    PP527 TCTGGATCCACCATAACCGCAGTATAGAAG
    PP528 CTTCTATACTGCGGTTATGGTGGATCCAGA
    PP529 TCTGGATCCACCATCGCCAAAGTATAGAAG
    PP530 CTTCTATACTTTGGCGATGGTGGATCCAGA
    PP531 TCTGGATCCGCCATAACCAAAGTATAGAAG
    PP532 CTTCTATACTTTGGTTATGGCGGATCCAGA
    PP533 ACTTGGAACATCTGGCGCCACCATAACCAAAG
    PP534 CTTTGGTTATGGTGGCGCCAGATGTTCCAAGT
    PP535 ACTTGGAACATCCGCATCCACCATAACCAAAG
    PP536 CTTTGGTTATGGTGGATGCGGATGTTCCAAGT
    PP537 ACTTGGAACCGCTGGATCCACCATAACCAAAG
    PP538 CTTTGGTTATGGTGGATCCAGCGGTTCCAAGT
    PP539 CTCGGAGGTGAGGGTTGCTCGCACTTGGAACA
    PP540 TGTTCCAAGTGCGAGCAACCCTCACCTCCGAG
    PP541 CTCGGAGGTGAGGGTTCGCAGGACTTGGAACA
    PP542 TGTTCCAAGTCCTGCGAACCCTCACCTCCGAG
    PP543 ACCAACCAATGGAGCGCTTCTCGGAGGTGAG
    PP544 CTCACCTCCGAGAAGCGCTCCATTGGTTGGT
    PP545 TATAAACACGACCGCATGAATTCCTGCAGTG
    PP546 CACTGCAGGAATTCATGCGGTCGTGTTTATA
    PP547 TGTTGAAGTTCGCGCGCCACCCTGGTGCATAC
    PP548 GTATGCACCAGGGTGGCGCGCGAACTTCAACA
    PP549 GGAAGACGGCCGCTAAAGTCTTCTCGCTCCGCAGC
    PP551 GGAAGACGGCCGCTAAAGTCTCGCTCCTCCGCAGC
    PP552 GGAAGACGGCCGCTAAAGCGCTCTTCCTCCGCAGC
  • SEQUENCE LISTING
    Arabidopsis thaliana FT nucleic acid sequence (wild type)
    SEQ ID No 1
    ATGTCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTGTTGGAGA
    CGTTCTTGATCCGTTTAATAGATCAATCACTCTAAAGGTTACTTATGGCCA
    AAGAGAGGTGACTAATGGCTTGGATCTAAGGCCTTCTCAGGTTCAAAACA
    AGCCAAGAGTTGAGATTGGTGGAGAAGACCTCAGGAACTTCTATACTTTG
    GTTATGGTGGATCCAGATGTTCCAAGTCCTAGCAACCCTCACCTCCGAGA
    ATATCTCCATTGGTTGGTGACTGATATCCCTGCTACAACTGGAACAACCTT
    TGGCAATGAGATTGTGTGTTACGAAAATCCAAGTCCCACTGCAGGAATTC
    ATCGTGTCGTGTTTATATTGTTTCGACAGCTTGGCAGGCAAACAGTGTATG
    CACCAGGGTGGCGCCAGAACTTCAACACTCGCGAGTTTGCTGAGATCTAC
    AATCTCGGCCTTCCCGTGGCCGCAGTTTTCTACAATTGTCAGAGGGAGAG
    TGGCTGCGGAGGAAGAAGACTTTAG
    Arabidopsis thaliana FT polypeptide (wild type) SEQ ID No 2
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    GROUP I
    Arabidopsis thaliana FT polypeptide FTV68A SEQ ID 3
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTP72A SEQ ID 4
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTP77A SEQ ID 5
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTG172A SEQ ID 6
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR174A SEQ ID 7
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTS2A SEQ ID 8
    MAINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTI5A SEQ ID 9
    MSINARDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR6A SEQ ID 10
    MSINIADPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTP8A SEQ ID 11
    MSINIRDALI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTV11A SEQ ID 12
    MSINIRDPLI ASRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTS12A SEQ ID 13
    MSINIRDPLI VARVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR13A SEQ ID 14
    MSINIRDPLI VSAVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTD20A SEQ ID 15
    MSINIRDPLI VSRVVGDVLA PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTP21A SEQ ID 16
    MSINIRDPLI VSRVVGDVLD AFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTN23A SEQ ID 17
    MSINIRDPLI VSRVVGDVLD PFARSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR24A SEQ ID 18
    MSINIRDPLI VSRVVGDVLD PFNASITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTS25A SEQ ID 19
    MSINIRDPLI VSRVVGDVLD PFNRAITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTI26A SEQ ID 20
    MSINIRDPLI VSRVVGDVLD PFNRSATLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTL28A SEQ ID 21
    MSINIRDPLI VSRVVGDVLD PFNRSITAKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTT31A SEQ ID 22
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV AYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    GROUP II
    Arabidopsis thaliana FT polypeptide FTG16A SEQ ID 23
    MSINIRDPLI VSRVVADVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTL19A SEQ ID 24
    MSINIRDPLI VSRVVGDVAD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTF22A SEQ ID 25
    MSINIRDPLI VSRVVGDVLD PANRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTK29A SEQ ID 26
    MSINIRDPLI VSRVVGDVLD PFNRSITLAV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTV30A SEQ ID 27
    MSINIRDPLI VSRVVGDVLD PFNRSITLKA TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTL67A SEQ ID No 28
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTAVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTS78A SEQ ID No 29
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPANP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTQ140A SEQ ID No 30
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRA NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    GROUP III
    Arabidopsis thaliana FT polypeptide FTI3A SEQ ID 31
    MSANIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTN4A SEQ ID 32
    MSIAIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTD7A SEQ ID 33
    MSINIRAPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTL9A SEQ ID 34
    MSINIRDPAI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTV14A SEQ ID 35
    MSINIRDPLI VSRAVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTV15A SEQ ID 36
    MSINIRDPLI VSRVAGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTD17A SEQ ID 37
    MSINIRDPLI VSRVVGAVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTV18A SEQ ID 38
    MSINIRDPLI VSRVVGDALD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTD71A SEQ ID No 39
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV APDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTY85A SEQ ID No 40
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREALHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    GROUP IV
    Arabidopsis thaliana FT polypeptide FTD73A SEQ ID No 41
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPAVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR119A SEQ ID No 42
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHAV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTR173A SEQ ID No 43
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGARL                            175
    GROUP V
    Arabidopsis thaliana FT polypeptide FTV70A SEQ ID No 44
    MSINIRDPLI VSRVVGDVLD PFNRSITLKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMA DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
    Arabidopsis thaliana FT polypeptide FTT27A SEQ ID 45
    MSINIRDPLI VSRVVGDVLD PFNRSIALKV TYGQREVTNG LDLRPSQVQN  50
    KPRVEIGGED LRNFYTLVMV DPDVPSPSNP HLREYLHWLV TDIPATTGTT 100
    FGNEIVCYEN PSPTAGIHRV VFILFRQLGR QTVYAPGWRQ NFNTREFAEI 150
    YNLGLPVAAV FYNCQRESGC GGRRL                            175
  • REFERENCES
  • 1. Zeevaart, J. A. D. Annu. Rev. Plant Physiol. 27, 321-348 (1976).
  • 2. Corbesier, L. & Coupland, G. J. Exp. Bot. 57, 3395-3403 (2006).
  • 3. Tatada, S. & Goto, K. Plant Cell 15, 2856-2865 (2003).
  • 4. Abe, M. et al. Science 309, 1052-1056 (2005).
  • 5. An, H. et al. Development 131, 3615-3626 (2004).
  • 6. Wigge, P. et al. Science 309, 1056-1059 (2005).
  • 7. Corbesier, L. et al. Science 316, 1030-1033 (2007).
  • 8. Giavalisco, P. et al. Proteomics 6, 896-909 (2006).
  • 9. Lifschitz, E. et al. PNAS 103, 6398-6403 (2006).
  • 10. Tamaki, S. et al. Science 316, 1033-1036 (2007).
  • 11. Lin, M. K. et al. Plant Cell 19, 1488-1506 (2007).
  • 12. Li, C. et al. J. Virol. 83, 3540-3548 (2009).
  • 13. Takahashi, Y. et al. PNAS 106, 4555-4560 (2009).
  • 14. Hanzawa, Y., Money, T. & Bradley, D. PNAS 102, 7748-7753 (2005).
  • 15. Khush, G. S. Nat. Rev. Genet. 2, 815-822 (2001).
  • 16. Tingay, et al. Plant J. 11, 1369-1376 (1997).
  • 17. Ziegler, A. et al. Arch Virol DOI 10.1007/s00705-009-0468-8 (2009).
  • The invention is further described by the following numbered paragraphs:
      • 1. A transgenic plant comprising and expressing a modified FT polynucleotide said polynucleotide encoding a modified polypeptide comprising an amino acid modification wherein said plant exhibits one of the following phenotypes:
        • a) increased flowering and increased fruit and/or seed production;
        • b) increased flowering
        • c) no bolting and no flowering;
        • d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
        • e) normal bolting and no flowering.
      • 2. A plant according to paragraph 1 wherein said plant exhibits increased flowering and increased fruit and/or seed production.
      • 3. A plant according to paragraph 2 wherein said modification comprises or consists of an amino acid substitution at the second conserved V residue in the PEBP domain.
      • 4. A plant according to paragraph 3 wherein said conserved V residue is V70 or a V at a homologous position.
      • 5. A plant according to paragraph 2 wherein said modification comprises or consists of an amino acid substitution at T27 or at a homologous position.
      • 6. A plant according to paragraph 1 wherein said plant exhibits no bolting and no flowering.
      • 7. A plant according to paragraph 6 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: D73, R119 or R173.
      • 8. A plant according to paragraph 1 wherein said plant exhibits normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H.
      • 9. A plant according to paragraph 8 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: L67, S78 Q140, G16, L19, F22, K29 or V30.
      • 10. A plant according to paragraph 1 wherein said plant exhibits normal bolting and no flowering.
      • 11. A plant according to paragraph 10 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: D71 oY85, 13, N4, D7, L9, V14, V15, D17 or V18 .
      • 12. A plant according to any of paragraphs 1 to 11 wherein the amino acid substitution is with a neutral amino acid.
      • 13. A plant according to paragraph 12 wherein the amino acid substitution is with Alanine.
      • 14. A plant according to any of paragraphs 1 to 13 wherein the FT polynucleotide is operably linked to a regulatory sequence.
      • 15. A plant according to paragraph 14 wherein said regulatory sequence is a promoter.
      • 16. A plant according to any of paragraphs 1 to 15 wherein the plant is a monocot or dicot plant.
      • 17. A plant according to paragraph 16 wherein said plant is a crop plant.
      • 18. A plant according to paragraph 17 wherein said plant is selected from maize, wheat, rice, sorghum, soybean, sugar cane, sugar beet, forage grass, turfgrass, switchgrass, miscanthus, potato, tomato, barley, pea, bean, field bean, cotton, lettuce, sunflower, brassicas, such as canola, oilseed rape, or broccoli, or alfalfa, or poplar.
      • 19. A plant according to any of paragraphs 1 to 18 wherein said modified FT polynucleotide is a modified endogenous polynucleotide.
      • 20. A plant according to any of paragraphs 1 to 18 wherein said modified FT polynucleotide is a modified exogenous polynucleotide.
      • 21. Plant tissue or harvestable material derived from a plant according to any of paragraphs 1 to 20.
      • 22. A method for producing a plant as defined in any of paragraphs 1 to 20 comprising introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide comprising an amino acid modification.
      • 23. A method for increasing flowering and seed and/or fruit production in a plant comprising introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide comprising an amino acid modification.
      • 24. A method according to paragraph 23 wherein said modification comprises or consists of an amino acid substitution at residue V70 or T27 or both.
      • 25. An isolated nucleic acid said nucleic acid encoding a modified polypeptide comprising an amino acid modification wherein said modification results in an altered phenotype when said nucleic acid is introduced in a plant wherein said phenotypes is selected from:
        • a) increased flowering increased flowering and increased fruit and/or seed production;
        • b) increased flowering;
        • c) no bolting and no flowering;
        • d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
        • e) normal bolting and no flowering.
      • 26. An isolated nucleic acid said nucleic acid encoding a modified polypeptide comprising an amino acid modification wherein said modification consists of or comprises a substitution of one or more of the following residues: T27, V70, D73, R119, R173, D71, L67, S78, Q140 or G16, L19, F22, K29 or FTV30.
      • 27. An isolated nucleic acid according to paragraph 25 or 26 wherein said modification consists of or comprises a substitution at residue V70 or T27 or both.
      • 28. An isolated nucleic acid according to paragraph 26 or 27 wherein the amino acid is substituted with A.
      • 29. A vector comprising a nucleic acid as defined in any of paragraphs 25 to 28.
      • 30. The use of a nucleic acid as defined in any of paragraphs 25 to 28 or a vector as defined in paragraph 29 to increase flowering and/or seed and or fruit production in a plant.
      • 31. A plant comprising a nucleic acid as defined in any of paragraphs 25 to 28 or a vector as defined in paragraph 29.
      • 32. A method for producing a plant exhibiting an altered phenotype selected from:
        • a) increased flowering
        • b) increased flowering and increased fruit and/or seed production;
        • c) no bolting and no flowering;
        • d) normal bolting and delayed flowering
        • e) normal bolting and no flowering
          • said method comprising mutagenising a plant population and screening progeny derived form said population for said phenotype, identifying a plant exhibiting said phenotype and screening said plant for one or more point mutation in the FT locus.
  • Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.

Claims (32)

What is claimed is:
1. A transgenic plant comprising and expressing a modified Flowering Locus (FT) polynucleotide said polynucleotide encoding a modified polypeptide comprising an amino acid modification wherein said plant exhibits one of the following phenotypes:
a) increased flowering and increased fruit and/or seed production;
b) increased flowering
c) no bolting and no flowering;
d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
e) normal bolting and no flowering.
2. A plant according to claim 1 wherein said plant exhibits increased flowering and increased fruit and/or seed production.
3. A plant according to claim 2 wherein said modification comprises or consists of an amino acid substitution at the second conserved V residue in the PEBP domain.
4. A plant according to claim 3 wherein said conserved V residue is V70 or a V at a homologous position.
5. A plant according to claim 2 wherein said modification comprises or consists of an amino acid substitution at T27 or at a homologous position.
6. A plant according to claim 1 wherein said plant exhibits no bolting and no flowering.
7. A plant according to claim 6 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: D73, R119 or R173.
8. A plant according to claim 1 wherein said plant exhibits normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H.
9. A plant according to claim 8 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: L67, S78 Q140, G16, L19, F22, K29 or V30.
10. A plant according to claim 1 wherein said plant exhibits normal bolting and no flowering.
11. A plant according to claim 10 wherein said modification comprises or consists of an amino acid substitution selected from a substitution at one or more of the following residues: D71 oY85, 13, N4, D7, L9, V14, V15, D17 or V18.
12. A plant according to claim 1 wherein the amino acid substitution is with a neutral amino acid.
13. A plant according to claim 12 wherein the amino acid substitution is with Alanine.
14. A plant according to claim 1 wherein the FT polynucleotide is operably linked to a regulatory sequence.
15. A plant according to claim 14 wherein said regulatory sequence is a promoter.
16. A plant according to claim 1 wherein the plant is a monocot or dicot plant.
17. A plant according to claim 16 wherein said plant is a crop plant.
18. A plant according to claim 17 wherein said plant is selected from maize, wheat, rice, sorghum, soybean, sugar cane, sugar beet, forage grass, turfgrass, switchgrass, miscanthus, potato, tomato, barley, pea, bean, field bean, cotton, lettuce, sunflower, brassicas, such as canola, oilseed rape, or broccoli, or alfalfa, or poplar.
19. A plant according to claim 1 wherein said modified FT polynucleotide is a modified endogenous polynucleotide.
20. A plant according to claim 1 wherein said modified FT polynucleotide is a modified exogenous polynucleotide.
21. Plant tissue or harvestable material derived from a plant according to claim 1.
22. A method for producing a plant as defined in claim 1 comprising introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide comprising an amino acid modification.
23. A method for increasing flowering and seed and/or fruit production in a plant comprising introducing and expressing a modified FT polynucleotide in said plant wherein the polynucleotide encodes a modified polypeptide comprising an amino acid modification.
24. A method according to claim 23 wherein said modification comprises or consists of an amino acid substitution at residue V70 or T27 or both.
25. An isolated nucleic acid said nucleic acid encoding a modified polypeptide comprising an amino acid modification wherein said modification results in an altered phenotype when said nucleic acid is introduced in a plant wherein said phenotypes is selected from:
a) increased flowering increased flowering and increased fruit and/or seed production;
b) increased flowering;
c) no bolting and no flowering;
d) normal bolting and delayed flowering provided that the amino acid modification does not comprise Y85H or
e) normal bolting and no flowering.
26. An isolated nucleic acid said nucleic acid encoding a modified polypeptide comprising an amino acid modification wherein said modification consists of or comprises a substitution of one or more of the following residues: T27, V70, D73, R119, R173, D71, L67, S78, Q140 or G16, L19, F22, K29 or FTV30.
27. An isolated nucleic acid according to claim 25 wherein said modification consists of or comprises a substitution at residue V70 or T27 or both.
28. An isolated nucleic acid according to claim 26 wherein the amino acid is substituted with A.
29. A vector comprising a nucleic acid as defined in claim 25.
30. The use of a nucleic acid as defined in claim 25 to increase flowering and/or seed and or fruit production in a plant.
31. A plant comprising a nucleic acid as defined in claim 25 or a vector as defined in claim 29.
32. A method for producing a plant exhibiting an altered phenotype selected from:
a) increased flowering
b) increased flowering and increased fruit and/or seed production;
c) no bolting and no flowering;
d) normal bolting and delayed flowering
e) normal bolting and no flowering
said method comprising mutagenising a plant population and screening progeny derived form said population for said phenotype, identifying a plant exhibiting said phenotype and screening said plant for one or more point mutation in the FT locus.
US13/564,936 2010-03-05 2012-08-02 Molecular engineering of a floral inducer for crop improvement Expired - Fee Related US9238820B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB1003702.6A GB201003702D0 (en) 2010-03-05 2010-03-05 Molecular engineering of a floral inducer for crop improvement
GB1003702.6 2010-03-05
PCT/GB2011/050440 WO2011107808A1 (en) 2010-03-05 2011-03-07 Molecular engineering of a floral inducer for crop improvement

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2011/050440 Continuation-In-Part WO2011107808A1 (en) 2010-03-05 2011-03-07 Molecular engineering of a floral inducer for crop improvement

Publications (2)

Publication Number Publication Date
US20130081151A1 true US20130081151A1 (en) 2013-03-28
US9238820B2 US9238820B2 (en) 2016-01-19

Family

ID=42136547

Family Applications (1)

Application Number Title Priority Date Filing Date
US13/564,936 Expired - Fee Related US9238820B2 (en) 2010-03-05 2012-08-02 Molecular engineering of a floral inducer for crop improvement

Country Status (9)

Country Link
US (1) US9238820B2 (en)
EP (1) EP2542568A1 (en)
CN (1) CN102791729A (en)
AU (1) AU2011222740B2 (en)
BR (1) BR112012020122A2 (en)
CA (1) CA2789938A1 (en)
GB (1) GB201003702D0 (en)
MX (1) MX2012008975A (en)
WO (1) WO2011107808A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021041001A3 (en) * 2019-08-09 2021-05-27 Regents Of The University Of Minnesota AUGMENTED sgRNAS AND METHODS FOR THEIR USE TO ENHANCE SOMATIC AND GERMLINE PLANT GENOME ENGINEERING
US11408010B2 (en) * 2019-03-05 2022-08-09 Toyota Jidosha Kabushiki Kaisha Mutant-type flowering-inducing gene, transformed plant having the mutant-type flowering-inducing gene, and flowering regulation method using the mutant-type flowering-inducing gene
CN115386591A (en) * 2022-09-05 2022-11-25 中国科学院华南植物园 Molecular breeding method of monochantia sonchifolia

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104894142A (en) * 2015-06-11 2015-09-09 中国科学院西北高原生物研究所 Novel wheat gene TaMYB7D capable of adjusting and controlling synthesis and metabolism of anthocyanin
CN107739403B (en) * 2016-08-11 2020-12-22 中国农业科学院作物科学研究所 Protein related to plant flowering phase and coding gene and application thereof
CN106995839A (en) * 2017-03-20 2017-08-01 杭州师范大学 Application of the potato virus X in screening flowering of plant gene and rush bloom FT protein mutants
CN106978499B (en) * 2017-04-26 2019-07-19 中国农业科学院作物科学研究所 Transgenic soybean event GC1-1 external source Insert Fragment flanking sequence and its application
CN109371046A (en) * 2018-09-29 2019-02-22 上海交通大学 A kind of induction type oxin-antitoxin element for thermophilic microorganism genetic manipulation
CN112011545B (en) * 2019-05-29 2022-05-17 中国科学院分子植物科学卓越创新中心 Gene for regulating flowering time and biomass of plant and use thereof
CN110387376B (en) * 2019-08-16 2021-06-04 安徽省农业科学院作物研究所 Application of expression vector containing mung bean flowering gene VrFT5a
EP4165187A1 (en) * 2020-06-12 2023-04-19 Pioneer Hi-Bred International, Inc. Alteration of seed composition in plants
CN113072629A (en) * 2021-03-10 2021-07-06 中国农业科学院作物科学研究所 OsFTL1 and application of coding gene thereof in shortening heading period of rice
WO2023020938A1 (en) * 2021-08-16 2023-02-23 Nunhems B.V. Lettuce plant having delayed bolting

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070192904A1 (en) * 2003-05-16 2007-08-16 Agriculture Victoria Services Pty Ltd Flowering inhibition

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1048254C (en) 1993-12-09 2000-01-12 托马斯杰弗逊大学 Compounds and methods for site-directed mutations in eukaryotic cells
US6225530B1 (en) 1998-04-15 2001-05-01 The Salk Institute For Biological Studies Flowering locus T (FT) and genetically modified plants having modulated flower development
US6555732B1 (en) 1998-09-14 2003-04-29 Pioneer Hi-Bred International, Inc. Rac-like genes and methods of use
US20050066394A1 (en) * 2000-11-28 2005-03-24 Olga Danilevskaya Floral development genes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070192904A1 (en) * 2003-05-16 2007-08-16 Agriculture Victoria Services Pty Ltd Flowering inhibition

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Kardailsky et al.(Science 1999, December 3, Vol 286 1962-1965) *
Koornneef et al. (Mol Gen Genet, 1991, 229:57-66) *
Morrison et al. (Current Opinion in Chemical Biology Volume 5, Issue 3, 1 June 2001, Pages 302-307) *
Tamaki et al. (SCIENCE VOL 316 18 MAY 2007 pp. 1033-1035) *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11408010B2 (en) * 2019-03-05 2022-08-09 Toyota Jidosha Kabushiki Kaisha Mutant-type flowering-inducing gene, transformed plant having the mutant-type flowering-inducing gene, and flowering regulation method using the mutant-type flowering-inducing gene
WO2021041001A3 (en) * 2019-08-09 2021-05-27 Regents Of The University Of Minnesota AUGMENTED sgRNAS AND METHODS FOR THEIR USE TO ENHANCE SOMATIC AND GERMLINE PLANT GENOME ENGINEERING
CN115386591A (en) * 2022-09-05 2022-11-25 中国科学院华南植物园 Molecular breeding method of monochantia sonchifolia

Also Published As

Publication number Publication date
MX2012008975A (en) 2012-12-05
WO2011107808A1 (en) 2011-09-09
AU2011222740B2 (en) 2014-04-17
EP2542568A1 (en) 2013-01-09
BR112012020122A2 (en) 2016-11-29
CA2789938A1 (en) 2011-09-09
US9238820B2 (en) 2016-01-19
AU2011222740A1 (en) 2012-08-02
CN102791729A (en) 2012-11-21
GB201003702D0 (en) 2010-04-21

Similar Documents

Publication Publication Date Title
US9238820B2 (en) Molecular engineering of a floral inducer for crop improvement
ES2263214T3 (en) WHEAT RHT GEN FOR GENETIC CONTROL OF GROWTH AND VEGETABLE DEVELOPMENT.
CA2516645C (en) Abiotic stress responsive plant transcription factor polynucleotides and polypeptides and use thereof for generating transgenic plants
JP5323831B2 (en) Plant height regulatory genes and uses thereof
CN102803291B (en) There is the plant of the Correlated Yield Characters of enhancing and/or the abiotic stress tolerance of enhancing and prepare its method
WO2010115368A1 (en) Rice zinc finger protein transcription factor dst and use thereof for regulating drought and salt tolerance
MX2013009749A (en) Plants having enhanced yield-related traits and producing methods thereof.
CN105063063A (en) Plants having enhanced yield-related traits and method for making the same
JP4150590B2 (en) Identification and characterization of an anthocyanin mutant (ANT1) in tomato
MX2013009997A (en) Plants having enhanced yield-related traits and producing methods thereof.
US7754945B2 (en) Generation of plants with improved drought tolerance
US7968768B2 (en) Generation of plants with improved drought tolerance
WO2007148970A1 (en) Use of plant chromatin remodeling genes for modulating plant architecture and growth
CN108165557B (en) Application of wheat TaZCTC 2 gene in regulating and controlling flowering time of plants
US20150353950A1 (en) Transgenic plants
WO2011011273A9 (en) The use of dimerization domain component stacks to modulate plant architecture
CN1813067A (en) Trasngenic expression of a phytochrome a gene
US7626082B2 (en) Flowering induction
CN113549602B (en) Phyllostachys pubescens ascorbic acid peroxidase gene PeAPX1 and application thereof
KR102674984B1 (en) CaSIRF1 gene and Method for improving the resistance to the drought stress using CaSIRF1 in plants
CN112501184B (en) Soybean GmMT1 gene, vector containing GmMT1 gene, and preparation method and application thereof
CN110256543B (en) PwNAC1 gene and application of encoding protein thereof in plant stress resistance
WO2011122761A2 (en) Gsdl2 protein having a life-extension function for plants and a stress resistance function for plants, gene thereof, and use thereof
BRPI0718898A2 (en) METHOD FOR IMPROVEMENT CHARACTERISTICS RELATED TO PLANTS, CONSTRUCTION, USE OF THE SAME, PLANT, PART OF PLANT OR PLANT CELL, METHOD FOR PRODUCTION OF A TRANSGENIC PLANT, TRANSGENIC PLANT, PLANTABLE, PRODUCTS, A NUCLEIC ACID

Legal Events

Date Code Title Description
AS Assignment

Owner name: PLANT BIOSCIENCE LIMITED, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HONG, YIGUO;JACKSON, STEVE;LI, CHUNYANG;SIGNING DATES FROM 20120904 TO 20120918;REEL/FRAME:029164/0646

Owner name: THE UNIVERSITY OF WARWICK, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HONG, YIGUO;JACKSON, STEVE;LI, CHUNYANG;SIGNING DATES FROM 20120904 TO 20120918;REEL/FRAME:029164/0646

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: THE UNIVERSITY OF WARWICK, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PLANT BIOSCIENCE LIMITED;REEL/FRAME:038854/0341

Effective date: 20160301

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Expired due to failure to pay maintenance fee

Effective date: 20200119