US20120134969A1 - Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells - Google Patents

Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells Download PDF

Info

Publication number
US20120134969A1
US20120134969A1 US13/322,195 US201013322195A US2012134969A1 US 20120134969 A1 US20120134969 A1 US 20120134969A1 US 201013322195 A US201013322195 A US 201013322195A US 2012134969 A1 US2012134969 A1 US 2012134969A1
Authority
US
United States
Prior art keywords
crbn
cells
pharmaceutical composition
gene
cerebral cortex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/322,195
Inventor
Hiroshi Handa
Hideki Ando
Takumi Itoh
Kentaro Hotta
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Celgene Corp
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Assigned to TOKYO INSTITUTE OF TECHNOLOGY reassignment TOKYO INSTITUTE OF TECHNOLOGY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ANDO, HIDEKI, HANDA, HIROSHI, HOTTA, KENTARO, ITOH, TAKUMI
Publication of US20120134969A1 publication Critical patent/US20120134969A1/en
Assigned to CELGENE CORPORATION reassignment CELGENE CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TOKYO INSTITUTE OF TECHNOLOGY
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45Transferases (2)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02019Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders

Definitions

  • the present invention relates to a pharmaceutical composition used for treating a disease of cerebral cortex and the like, a method comprising administering the pharmaceutical composition to a non-human animal and inducing proliferation of neural stem cells or neural progenitor cells of the non-human animal and differentiation of these cells into nerve cells, and a method for screening for a therapeutic drug for a disease of cerebral cortex and the like.
  • a factor that induces differentiation into nerve cells can be newly discovered, it would enable regenerating nerve cells, and using them for treating a disease of cerebral cortex such as Alzheimer's disease.
  • the present invention was completed under the foregoing technical background with an aim to provide a novel factor that induces differentiation into nerve cells.
  • CRBN cereblon
  • CRBN is a protein that forms a ubiquitin ligase complex and its amino acid sequence is also publicly known; however, it has never been known before that CRBN functions to induce proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells.
  • Higgins et al. describing the relationship between CRBN and the brain (J. J. Higgins et al., (2004), Neurology, 63, 1927-1931). Higgins et al. have reported that a family lineage involving mild mental retardation is observed to bear a mutated crbn gene. However, this report does not suggest that CRBN has the aforementioned functions.
  • the present invention was accomplished based on the foregoing findings.
  • the present invention provides the following [1] to [11].
  • a pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
  • the pharmaceutical composition according to [1] or [2] comprising the nucleic acid encoding CRBN and a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN.
  • a method comprising administering the pharmaceutical composition according to any of [1] to [7] to a non-human animal and differentiating a neural stem cell or a neural progenitor cell of the non-human animal into a nerve cell.
  • a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex comprising contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
  • a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex comprising culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
  • CRBN contained in the pharmaceutical composition of the present invention induces proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells. Accordingly, the pharmaceutical composition of the present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, CRBN is also useful as a target substance for the development of a novel therapeutic drug for a disease of cerebral cortex.
  • FIG. 1 shows fluorescence microscopic pictures of zebrafish embryos.
  • the upper left shows a normal embryo
  • the upper right shows an embryo in which the crbn gene is overexpressed
  • the lower left shows an embryo in which the lhx2 gene is knocked down
  • the lower right shows an embryo in which the lhx2 gene is knocked down while the crbn gene is overexpressed.
  • FIG. 2 shows microscopic pictures of zebrafish embryos.
  • the picture on the right shows an embryo in which the crbn gene is overexpressed and the picture on the left shows an untreated embryo. Both pictures were taken at the same magnification.
  • FIG. 3 shows microscopic pictures of zebrafish, into which crbn gene-overexpressing cells (fluorescently labeled with rhodamine) are transplanted.
  • the top pictures and the bottom pictures were taken at 200-fold magnification and 100-fold magnification, respectively.
  • the pictures on the left column are bright-field images and the pictures on the right column are fluorescent images.
  • FIG. 4 shows electrophoresis images for the detection of the ubiquitin ligase activity of a CRBN complex (FH-CRBN complex) using an in vitro reaction system.
  • the images on the left, middle, and right show ubiquitin, Cul4A, which is a CRBN complex-forming factor, and ubiquitinated CRBN, respectively, each detected by immunoblotting. Mock indicates the case of the use of a control experimental sample.
  • FIG. 5 shows an electrophoresis image for the detection of the ubiquitin ligase activity of the CRBN complex in live cells.
  • FIG. 6 shows close-up pictures of zebrafish heads in which glia cells were fluorescently stained.
  • the left part of the picture corresponds to the front end portion.
  • the picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN.
  • FIG. 7 shows close-up pictures of zebrafish heads in which serotonin-producing cells were fluorescently stained. These pictures were taken from the dorsal side of the brain. The top part of the picture corresponds to the front end portion. The picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN. In the Figure, numbers 1 , 2 , and 3 indicates the pineal gland, the ventral posterior tuberculum, and the raphe nucleus, respectively.
  • FIG. 8 shows pictures of zebrafish in which undifferentiated cells are transplanted into the cerebral ventricle.
  • Pictures A to D show the cases in which cells that do not express CRBN are transplanted
  • pictures E to H show the cases in which cells that express CRBN are transplanted.
  • Pictures A and E are bright-field images
  • pictures B and E are fluorescence images of Alexa Fluor (R) (indicating the distribution of tubulin)
  • pictures C and G are fluorescence images of rhodamine (indicating the distribution of donor cells)
  • pictures D and H are fluoresce images of Alexa Fluor (R) and rhodamine.
  • the pharmaceutical composition of the present invention comprises 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
  • CRBN is a known protein, and the base sequence of the gene encoding CRBN (crbn gene) is also published in a database.
  • the base sequences of human-derived crbn gene, mouse-derived crbn gene, rat-derived crbn gene, and zebrafish-derived crbn gene are registered in Entrez Gene under Gene ID: 51185, Gene ID: 58799, Gene ID: 297498, and Gene ID: 445491, respectively.
  • Naturally-derived CRBN and crbn gene may be used, while modified CRBN capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of naturally-derived CRBN and a gene encoding this modified form may be used.
  • the pharmaceutical composition of the present invention may contain any of CRBN, a nucleic acid encoding CRBN, and a stem cell or a neural progenitor cell in which CRBN is expressed as an active ingredient.
  • the pharmaceutical composition containing these substances as an active ingredient can be prepared and used in a similar manner to a known drug containing a protein, a nucleic acid, a stem cell, and a progenitor cell as an active ingredient.
  • the nucleic acid encoding CRBN may be either DNA or RNA.
  • the nucleic acid is preferably inserted in an appropriate vector so that it can act on neural stem cells in the brain.
  • a vector examples include a virus vector.
  • the virus vector include an adenovirus vector, a retrovirus vector, and a lentivirus vector.
  • the stem cell in which CRBN is expressed is preferably an iPS cell derived from the patient him/her-self so as to be able to avoid rejection; however, other stem cells such as ES cells, adult stem cells, and cord blood stem cells may also be used.
  • CRBN may be expressed in stem cells, and it is preferably overexpressed.
  • a method for expressing or overexpressing CRBN can be carried out in accordance with, for example, the method of Ando et al. (Ando and Okamoto, Mar. Biotechnol. 8(3): 295-303, 2006), while it may also be carried out by other methods such as other microinjection methods, the caged RNA method (Ando et al., Nat. Genet. 28: 317-325, 2001), the electroporation method, the calcium phosphate method, the DEAE dextran method, the virus method, sonoporation method, and the transposon method.
  • the pharmaceutical composition of the present invention can be administered by injection, drip infusion, and the like into the cerebral ventricle, the skin, the intraperitoneal cavity, the vein, the artery, or the spinal marrow fluid.
  • CRBN acts on the neural stem cells or neural progenitor cells in the brain, except for the case in which it is administered into the cerebral ventricle, it is preferable to provide such a treatment that would enable passage of CRBN through the blood brain barrier.
  • a treatment methods such as binding CRBN with essential endogenous substances that are actively taken up, carrying out structural modification of CRBN so as to avoid recognition by efflux transporters, and reducing the molecular weight to such a size that contains only a minimum functional domain may be possible.
  • stem cells or neural progenitor cells are used as active ingredients, the pharmaceutical composition is directly administered into the cerebral ventricle.
  • the dose of the pharmaceutical composition of the present invention is preferably administered in an amount of approximately 0.5 mg to 100 mg; when a nucleic acid encoding CRBN is administered, it is preferably administered in an amount of approximately 1 mg to 200 mg; and when a stem cell or a neural progenitor cell in which CRBN is expressed is administered, preferably 500 cells to 5000 cells are administered in a volume of approximately 50 ⁇ l to 500 ⁇ l.
  • the injection fluid and the drip infusion fluid may contain components that are normally contained in these solutions.
  • a component include a liquid carrier (such as potassium phosphate buffer, physiological saline, Ringer's solution, distilled water, polyethylene glycol, plant oil and fat, ethanol, glycerin, dimethyl sulfoxide, and polypropylene glycol), antimicrobial agents, local anesthetics (such as procaine hydrochloride and dibucaine hydrochloride), buffer (such as tris-HCl buffer and hepes buffer), and osmotic pressure regulators (such as glucose, sorbitol, and sodium chloride).
  • a liquid carrier such as potassium phosphate buffer, physiological saline, Ringer's solution, distilled water, polyethylene glycol, plant oil and fat, ethanol, glycerin, dimethyl sulfoxide, and polypropylene glycol
  • antimicrobial agents such as procaine hydrochloride and dibucaine hydrochloride
  • buffer
  • the pharmaceutical composition of the present invention may contain: 1) in addition to CRBN, a protein that forms a ubiquitin ligase complex with CRBN, 2) in addition to a nucleic acid encoding CRBN, a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN, and 3) in addition to CRBN, a stem cell or a neural progenitor cell in which a protein that forms a ubiquitin ligase complex with CRBN are expressed.
  • Examples of the protein that forms a ubiquitin ligase complex with CRBN include DDB1 (Damaged DNA Binding protein), Cul4A (Cullin 4A), Cul4B (Cullin 4B), and Rod (RBX1).
  • DDB1 Damaged DNA Binding protein
  • Cul4A Cullin 4A
  • Cul4B Cullin 4B
  • Rod RBX1
  • these proteins are known proteins, and the base sequences of the genes encoding these proteins (i.e., ddb1 gene, cul4a gene, cul4b gene, and roc1 gene) are also published in a database.
  • the base sequences of human-derived ddb1 gene, mouse-derived ddb1 gene, rat-derived ddb1 gene, and zebrafish-derived ddb1 gene are registered in Entrez Gene under Gene ID: 1642, Gene ID: 13194, Gene ID: 64470, and Gene ID: 393599, respectively;
  • the base sequences of human-derived cul4a gene, mouse-derived cul4a gene, rat-derived cul4a gene, and zebrafish-derived cul4a gene are registered in Entrez Gene under Gene ID: 8451, Gene ID: 99375, Gene ID: 361181, and Gene ID: 394002, respectively;
  • the base sequences of human-derived cul4b gene, mouse-derived cul4b gene, rat-derived cul4b gene, and zebrafish-derived cul4b gene are registered in Entrez Gene under Gene ID: 8450, Gene ID: 72584, Gene ID: 302502, and Gene ID: 560313, respectively; and the base sequence
  • Each of these proteins and genes may be naturally-derived one, while a modified protein capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of a naturally-derived protein and a gene encoding this modified protein may be used.
  • the ubiquitin ligase complex contains, in addition to CRBN, three kinds of proteins, which are DDB1, CuL4A, and Roc1, or DDB1, CuL4B, and Roc1.
  • the pharmaceutical composition of the present invention preferably contains (or expresses) all these three kinds of proteins (or nucleic acids encoding these proteins), it may contain only one or some of them.
  • the pharmaceutical composition of the present invention can be used for the treatment of a disease of cerebral cortex or a surgical injury of cerebral cortex, or for regenerating cerebral cortex.
  • diseases of cerebral cortex include Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, progressive supranuclear palsy, and corticobasal degeneration.
  • the pharmaceutical composition of the present invention is intended to be used for humans, it may be administered to an animal other than humans to induce proliferation of the neural stem cells or neural progenitor cells or differentiation of these cells into nerve cells in these animals.
  • the target animals are mainly vertebrates, and examples thereof include mice, rats, monkeys, dogs, ferrets, hamsters, chickens, xenopus, zebrafish, and medaka.
  • CRBN CRBN induces proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells, as described in Examples. However, 70 to 80% of the genome synteny is conserved between humans and zebrafish (Nature Reviews Genetics 8, 353-367 (May 2007)). Accordingly, it is predicted that CRBN exhibits similar effects as those confirmed in zebrafish also in other vertebrates including humans.
  • the protein can be used for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex. This is specifically exemplified by the following methods (A) and (B).
  • a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex comprising the steps of contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
  • a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex comprising the steps of culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
  • the ubiquitin ligase activity can be measured in accordance with, for example, the method of Angers et al. (Nature, 443, 590-593, 2006) and the method of Groisman et al. (Cell, 113, 357-367, 2003).
  • whether or not the test substance has increased the ubiquitin ligase activity can be judged by measuring the ubiquitin ligase activity of a ubiquitin ligase complex containing CRBN without contacting with the test substance and making a comparison with the value thus obtained.
  • the substance thus selected by the method (A) acts to increase the ubiquitin ligase activity of the CRBN-containing ubiquitin ligase complex present in neural stem cells or neural progenitor cells in the living body. It is speculated that proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN are mediated by the ubiquitin ligase activity possessed by this complex. Accordingly, it is assumed that the substance that is selected by the method (A) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
  • neural stem cells to be used basically cells such as ES cells, iPS cells, and adult stem cells that are subjected to neuronal differentiation induction are employed. Further, neural stem cells such as ones derived from the subventricular zone of adult mice or the hippocampus of adult rats may also be used.
  • a method for measuring the expression level of CRBN can be carried out by, for example, a method using an antibody against CRBN, in situ hybridization method, the RT-PCR method, and Northern blotting method.
  • whether or not the test substance has increased the expression level of CRBN can be judged by culturing neural stem cells or neural progenitor cells in the absence of the test substance and measuring the expression level of CRBN, and then making a comparison with the value thus obtained.
  • the substance that is selected by the method (B) acts to increase the expression level of CRBN in neural stem cells or neural progenitor cells in the living body. Accordingly, it is assumed that the substance that is selected by the method (B) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
  • the expression of all the genes except the lhx2 gene i.e., the crbn gene, the six3.2 gene, and a gene encoding a protein composing an E3 ubiquitin ligase complex with crbn
  • this method was used to obtain the first data.
  • RNA lipofection into the prospective head region of the embryo was carried out.
  • the method of lipofection was entirely in accordance with the technique developed and published by Ando et al. (Ando and Okamoto, Efficient transfection strategy for the spatiotemporal control of gene expression in zebrafish. Mar. Biotechnol. 8(3): 295-303, 2006).
  • AMO antisense morpholino oligonucleotide
  • the basic principle is as follows: embryos in which one (A) of the two kinds of genes suggested to have a functional association is knocked down by the method described in (3) above are cultured up to six hours after fertilization (gastrula stage), and in the prospective forebrain region of the embryos, the expression of the other gene (B) is induced by the in vivo lipofection method described in (2) above.
  • A embryos in which one (A) of the two kinds of genes suggested to have a functional association is knocked down by the method described in (3) above are cultured up to six hours after fertilization (gastrula stage), and in the prospective forebrain region of the embryos, the expression of the other gene (B) is induced by the in vivo lipofection method described in (2) above.
  • Antibody staining of early neurons of zebrafish was performed by the following technique. The embryos 24 to 28 hours after fertilization were fixed at 4° C. for 12 hours in a 4% paraformaldehyde/phosphate buffer (pH 8.0). After washing four times with phosphate buffer, where each wash was performed for 15 minutes, blocking was carried out at normal temperature for one hour in a 5% newborn goat serum dissolved in 0.5% Triton X-100/phosphate buffer. Primary antibody reaction was carried out using a monoclonal anti-acetylated tubulin antibody diluted at 1:1000 in the same solution at 4° C. for 12 hours.
  • CRBN and a binding protein (referred to as a CRBN complex) were purified from a cell lysate solution of mammalian cells expressing CRBN fused with a FLAG epitope tag using M2 FLAG agarose beads (SIGMA). Subsequently, the CRBN complex thus purified was mixed with an aqueous solution containing Uba1 (E1), UbcH5b (E2), and a recombinant GST fusion ubiquitin (Ub) protein, and after addition of ATP, the mixture was left to stand at 30 to 37° C. for two hours.
  • E1 Uba1
  • E2 UbcH5b
  • Ub recombinant GST fusion ubiquitin
  • reaction was terminated by SDS, and self-ubiquitination and ubiquitination of the binding protein were visualized by polyacrylamide gel electrophoresis and immunoblotting, whereby the ubiquitin ligase activity was detected and measured.
  • This process was carried out basically in accordance with the method of Ohtake et al. MG132, which is a proteasome inhibitor, was applied to mammalian cells expressing CRBN fused with a FLAG epitope tag, and the cells were left still. Subsequently, the cells were disrupted, and from the resulting cell lysate solution, FLAG was purified and CRBN was extracted, and then immunoblotting was performed under similar, but stricter, conditions to the above, whereby the self-ubiquitination was detected and measured.
  • zebrafish Two-day-old zebrafish were used (for glia cell staining and serotonin-producing cell staining, zebrafish 56 hours and 49 hours after fertilization were used, respectively). Zebrafish were fixed with 4% paraformaldehyde (PFA) and then washed with phosphate buffer (PBS), followed by treatment with 10 ⁇ g/ml protease K for partial digestion of the epidermis. After the digestion reaction, the zebrafish were washed with PEST (PBS+0.5% Triton X-100) for 20 minutes and then fixed with PFA again. The fixed zebrafish were washed with PBST at room temperature for one hour, followed by blocking using PBST+5% goat serum.
  • PFA paraformaldehyde
  • PBS phosphate buffer
  • protease K protease K
  • the resulting specimens were reacted with a monoclonal anti-glia antibody (zrf-1/zrf-2) or a rabbit anti-serotonin antibody at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST+5% goat serum for one hour at room temperature, and secondary antibody reaction was carried out by substituting the antibody for a goat anti-mouse IgG antibody (Cy-2 conjugate for glia cell staining) or a goat anti-rabbit IgG antibody (Cy-5 conjugate for serotonin-producing cell staining) at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST at room temperature for one hour.
  • PBST was replaced by 30%, 50%, 70% glycerol/PBS and the whole zebrafish were mounted on glass slides to obtain preparations. Fluorescence was observed under excitation wavelength of Cy-2 and Cy-5 and the distribution of the glia cells or the serotonin-producing cells was recorded. It is to be noted that glia cells were observed from the lateral side of zebrafish, while the serotonin-producing cells were photographed from the dorsal side in order to observe the distribution of the cells along the midline.
  • a mixed solution of CRBN-coding RNA (700 ng/ ⁇ l) and 2% rhodamine dextran was injected into the zebrafish embryos at the 1-cell stage immediately after fertilization.
  • the embryos were cultured up to four hours after fertilization and 10 to 20 cells were collected by a suction capillary, which were injected into the diencephalic ventricle of embryos 30 hours after fertilization, whereby the cells were transplanted.
  • Zebrafish having undergone transplantation were reared up to three days after fertilization in zebrafish physiological saline (E3 Ringer) and then fixed with 4% paraformaldehyde.
  • primary antibody reaction and secondary antibody reaction were carried out using a monoclonal anti-acetylated tubulin antibody and an anti-mouse IgG antibody conjugated with Alexa Fluor (R) (excited at 488 nm), respectively. Then, while observing the fluorescently-labeled nerve cell axon, distribution of the transplanted cells labeled with rhodamine dextran (excited at 543 nm) was studied.
  • FIG. 1 Compared to the normal embryo ( FIG. 1 , upper left panel), brain shrinkage was observed in the lhx2 gene-knockdown embryo ( FIG. 1 , lower left panel). Meanwhile, similarly to the crbn gene-overexpressing embryo ( FIG. 1 , upper right panel), brain enlargement was observed in the embryo in which lhx2 gene was knocked down while crbn gene was overexpressed ( FIG. 1 , lower right panel). From this observation, it is considered that CRBN functions downstream of Lhx2, directly inducing proliferation of central nervous stem cells and differentiation of these cells into nerve cells.
  • mRNA encoding CRBN and a fluorescent substance were injected together into donor embryos so that CRBN was overexpressed.
  • the resulting blastula was transplanted into another individual and differentiation of donor-derived cells distributed in the cerebral ventricle was observed under a fluorescent microscope.
  • the transplanted donor-derived cells were significantly differentiated into the olfactory bulb, which is the telencephalon tissue of fish ( FIG. 3 , arrowhead).
  • CRBN-expressing cells were distributed into the cerebral ventricle, they differentiated into neural stem cells and migrated along a cell migration pathway called Rostral Migratory Stream (RMS) and differentiated into the brain tissue in the dorsal telencephalon, where the cerebral cortex develops in mammals.
  • RMS Rostral Migratory Stream
  • CRBN acts to proliferate and differentiate cells, while normally recognizing the spatial pattern of the brain.
  • the present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, it is also useful for the development of a novel therapeutic drug for a disease of cerebral cortex.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Psychology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)

Abstract

With an aim to provide a novel factor inducing proliferation of neural stem cells and differentiation of these cells into nerve cells, a pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed, a method including administering the pharmaceutical composition to a non-human animal and inducing proliferation of neural stem cells or neural progenitor cells of the non-human animal and differentiation of these cells into nerve cells, and a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, using CRBN, are provided.

Description

    TECHNICAL FIELD
  • The present invention relates to a pharmaceutical composition used for treating a disease of cerebral cortex and the like, a method comprising administering the pharmaceutical composition to a non-human animal and inducing proliferation of neural stem cells or neural progenitor cells of the non-human animal and differentiation of these cells into nerve cells, and a method for screening for a therapeutic drug for a disease of cerebral cortex and the like.
  • BACKGROUND ART
  • The recent advancements in research on nerve cells have given rise to the possibility of regenerating brain that is lost by Alzheimer's disease, trauma, and the like. In such brain regeneration, elucidation of the factor inducing differentiation into nerve cells is important.
  • With regard to induction of differentiation into nerve cells, Mangale et al. have recently reported that a protein called Lhx2 induces neural stem cells or neural progenitor cells to become the cortex, while inhibiting induction of those cells to become the hippocampus (Non Patent Literature 1).
  • CITATION LIST Non Patent Literature
    • Non Patent Literature 1: Mangale, V. S. et al., Science, Vol. 319, No. 5861, 304-309, 2008
    SUMMARY OF INVENTION Technical Problem
  • As described above, if a factor that induces differentiation into nerve cells can be newly discovered, it would enable regenerating nerve cells, and using them for treating a disease of cerebral cortex such as Alzheimer's disease.
  • The present invention was completed under the foregoing technical background with an aim to provide a novel factor that induces differentiation into nerve cells.
  • Solution to Problem
  • The present inventors conducted intensive studies to solve the aforementioned problem. As a result, the present inventors have found that 1) a protein called CRBN (cereblon) functions to differentiate stem cells into neural stem cells or neural progenitor cells, and further into nerve cells, 2) CRBN induces proliferation of central nervous stem cells or neural progenitor cells, and 3) CRBN functions downstream of Lhx2, which is a known cerebral cortex selector factor.
  • CRBN is a protein that forms a ubiquitin ligase complex and its amino acid sequence is also publicly known; however, it has never been known before that CRBN functions to induce proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells.
  • There is a report by Higgins et al. describing the relationship between CRBN and the brain (J. J. Higgins et al., (2004), Neurology, 63, 1927-1931). Higgins et al. have reported that a family lineage involving mild mental retardation is observed to bear a mutated crbn gene. However, this report does not suggest that CRBN has the aforementioned functions.
  • The present invention was accomplished based on the foregoing findings.
  • That is, the present invention provides the following [1] to [11].
  • [1] A pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
    [2] The pharmaceutical composition according to [1], wherein the nucleic acid encoding CRBN is inserted in a virus vector.
    [3] The pharmaceutical composition according to [1], comprising CRBN and a protein that forms a ubiquitin ligase complex with CRBN.
    [4] The pharmaceutical composition according to [1] or [2], comprising the nucleic acid encoding CRBN and a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN.
    [5] The pharmaceutical composition according to [1], comprising a stem cell or a neural progenitor cell in which CRBN and a protein that forms a ubiquitin ligase complex with CRBN are expressed.
    [6] The pharmaceutical composition according to any of [1] to [5], used for treating a disease of cerebral cortex or a surgical injury of cerebral cortex.
    [7] The pharmaceutical composition according to any of [1] to [5], used for regenerating cerebral cortex.
    [8] A method for comprising administering the pharmaceutical composition according to any of [1] to [7] to a non-human animal and proliferating a neural stem cell or a neural progenitor cell of the non-human animal.
    [9] A method comprising administering the pharmaceutical composition according to any of [1] to [7] to a non-human animal and differentiating a neural stem cell or a neural progenitor cell of the non-human animal into a nerve cell.
    [10] A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
    [11] A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
  • Advantageous Effects of Invention
  • CRBN contained in the pharmaceutical composition of the present invention induces proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells. Accordingly, the pharmaceutical composition of the present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, CRBN is also useful as a target substance for the development of a novel therapeutic drug for a disease of cerebral cortex.
  • BRIEF DESCRIPTION OF DRAWINGS
  • FIG. 1 shows fluorescence microscopic pictures of zebrafish embryos. In these pictures, the upper left shows a normal embryo, the upper right shows an embryo in which the crbn gene is overexpressed, the lower left shows an embryo in which the lhx2 gene is knocked down, and the lower right shows an embryo in which the lhx2 gene is knocked down while the crbn gene is overexpressed.
  • FIG. 2 shows microscopic pictures of zebrafish embryos. The picture on the right shows an embryo in which the crbn gene is overexpressed and the picture on the left shows an untreated embryo. Both pictures were taken at the same magnification.
  • FIG. 3 shows microscopic pictures of zebrafish, into which crbn gene-overexpressing cells (fluorescently labeled with rhodamine) are transplanted. The top pictures and the bottom pictures were taken at 200-fold magnification and 100-fold magnification, respectively. Also, the pictures on the left column are bright-field images and the pictures on the right column are fluorescent images.
  • FIG. 4 shows electrophoresis images for the detection of the ubiquitin ligase activity of a CRBN complex (FH-CRBN complex) using an in vitro reaction system. The images on the left, middle, and right show ubiquitin, Cul4A, which is a CRBN complex-forming factor, and ubiquitinated CRBN, respectively, each detected by immunoblotting. Mock indicates the case of the use of a control experimental sample.
  • FIG. 5 shows an electrophoresis image for the detection of the ubiquitin ligase activity of the CRBN complex in live cells.
  • FIG. 6 shows close-up pictures of zebrafish heads in which glia cells were fluorescently stained. The left part of the picture corresponds to the front end portion. The picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN.
  • FIG. 7 shows close-up pictures of zebrafish heads in which serotonin-producing cells were fluorescently stained. These pictures were taken from the dorsal side of the brain. The top part of the picture corresponds to the front end portion. The picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN. In the Figure, numbers 1, 2, and 3 indicates the pineal gland, the ventral posterior tuberculum, and the raphe nucleus, respectively.
  • FIG. 8 shows pictures of zebrafish in which undifferentiated cells are transplanted into the cerebral ventricle. Pictures A to D show the cases in which cells that do not express CRBN are transplanted, and pictures E to H show the cases in which cells that express CRBN are transplanted. Pictures A and E are bright-field images, pictures B and E are fluorescence images of Alexa Fluor (R) (indicating the distribution of tubulin), pictures C and G are fluorescence images of rhodamine (indicating the distribution of donor cells), and pictures D and H are fluoresce images of Alexa Fluor (R) and rhodamine.
  • DESCRIPTION OF EMBODIMENTS
  • Hereinbelow, the present invention will be described in detail.
  • The pharmaceutical composition of the present invention comprises 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
  • CRBN is a known protein, and the base sequence of the gene encoding CRBN (crbn gene) is also published in a database. For example, the base sequences of human-derived crbn gene, mouse-derived crbn gene, rat-derived crbn gene, and zebrafish-derived crbn gene are registered in Entrez Gene under Gene ID: 51185, Gene ID: 58799, Gene ID: 297498, and Gene ID: 445491, respectively. Naturally-derived CRBN and crbn gene may be used, while modified CRBN capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of naturally-derived CRBN and a gene encoding this modified form may be used.
  • The pharmaceutical composition of the present invention may contain any of CRBN, a nucleic acid encoding CRBN, and a stem cell or a neural progenitor cell in which CRBN is expressed as an active ingredient. The pharmaceutical composition containing these substances as an active ingredient can be prepared and used in a similar manner to a known drug containing a protein, a nucleic acid, a stem cell, and a progenitor cell as an active ingredient.
  • The nucleic acid encoding CRBN may be either DNA or RNA. The nucleic acid is preferably inserted in an appropriate vector so that it can act on neural stem cells in the brain. Examples of such a vector include a virus vector. Specific examples of the virus vector include an adenovirus vector, a retrovirus vector, and a lentivirus vector.
  • The stem cell in which CRBN is expressed is preferably an iPS cell derived from the patient him/her-self so as to be able to avoid rejection; however, other stem cells such as ES cells, adult stem cells, and cord blood stem cells may also be used. CRBN may be expressed in stem cells, and it is preferably overexpressed. A method for expressing or overexpressing CRBN can be carried out in accordance with, for example, the method of Ando et al. (Ando and Okamoto, Mar. Biotechnol. 8(3): 295-303, 2006), while it may also be carried out by other methods such as other microinjection methods, the caged RNA method (Ando et al., Nat. Genet. 28: 317-325, 2001), the electroporation method, the calcium phosphate method, the DEAE dextran method, the virus method, sonoporation method, and the transposon method.
  • No particular limitation is imposed on the administration method of the pharmaceutical composition of the present invention, and it can be appropriately determined according to the kind of the active ingredient, and the like. When CRBN or a nucleic acid encoding CRBN is used as active ingredients, the pharmaceutical composition can be administered by injection, drip infusion, and the like into the cerebral ventricle, the skin, the intraperitoneal cavity, the vein, the artery, or the spinal marrow fluid. Given that CRBN acts on the neural stem cells or neural progenitor cells in the brain, except for the case in which it is administered into the cerebral ventricle, it is preferable to provide such a treatment that would enable passage of CRBN through the blood brain barrier. As such a treatment, methods such as binding CRBN with essential endogenous substances that are actively taken up, carrying out structural modification of CRBN so as to avoid recognition by efflux transporters, and reducing the molecular weight to such a size that contains only a minimum functional domain may be possible. When stem cells or neural progenitor cells are used as active ingredients, the pharmaceutical composition is directly administered into the cerebral ventricle.
  • No particular limitation is imposed on the dose of the pharmaceutical composition of the present invention, and it can be appropriately determined according to the kind of the active ingredient, and the like. As for the daily dose for adults, when CRBN is administered, it is preferably administered in an amount of approximately 0.5 mg to 100 mg; when a nucleic acid encoding CRBN is administered, it is preferably administered in an amount of approximately 1 mg to 200 mg; and when a stem cell or a neural progenitor cell in which CRBN is expressed is administered, preferably 500 cells to 5000 cells are administered in a volume of approximately 50 μl to 500 μl.
  • When the pharmaceutical composition of the present invention is administered by injection or drip infusion, the injection fluid and the drip infusion fluid may contain components that are normally contained in these solutions. Examples of such a component include a liquid carrier (such as potassium phosphate buffer, physiological saline, Ringer's solution, distilled water, polyethylene glycol, plant oil and fat, ethanol, glycerin, dimethyl sulfoxide, and polypropylene glycol), antimicrobial agents, local anesthetics (such as procaine hydrochloride and dibucaine hydrochloride), buffer (such as tris-HCl buffer and hepes buffer), and osmotic pressure regulators (such as glucose, sorbitol, and sodium chloride).
  • The pharmaceutical composition of the present invention may contain: 1) in addition to CRBN, a protein that forms a ubiquitin ligase complex with CRBN, 2) in addition to a nucleic acid encoding CRBN, a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN, and 3) in addition to CRBN, a stem cell or a neural progenitor cell in which a protein that forms a ubiquitin ligase complex with CRBN are expressed. Examples of the protein that forms a ubiquitin ligase complex with CRBN include DDB1 (Damaged DNA Binding protein), Cul4A (Cullin 4A), Cul4B (Cullin 4B), and Rod (RBX1). Similarly to CRBN, these proteins are known proteins, and the base sequences of the genes encoding these proteins (i.e., ddb1 gene, cul4a gene, cul4b gene, and roc1 gene) are also published in a database. For example, the base sequences of human-derived ddb1 gene, mouse-derived ddb1 gene, rat-derived ddb1 gene, and zebrafish-derived ddb1 gene are registered in Entrez Gene under Gene ID: 1642, Gene ID: 13194, Gene ID: 64470, and Gene ID: 393599, respectively; the base sequences of human-derived cul4a gene, mouse-derived cul4a gene, rat-derived cul4a gene, and zebrafish-derived cul4a gene are registered in Entrez Gene under Gene ID: 8451, Gene ID: 99375, Gene ID: 361181, and Gene ID: 394002, respectively; the base sequences of human-derived cul4b gene, mouse-derived cul4b gene, rat-derived cul4b gene, and zebrafish-derived cul4b gene are registered in Entrez Gene under Gene ID: 8450, Gene ID: 72584, Gene ID: 302502, and Gene ID: 560313, respectively; and the base sequences of human-derived roc1 gene, mouse-derived roc1 gene, rat-derived roc1 gene, and zebrafish-derived roc1 gene are registered in Entrez Gene under Gene ID: 9978, Gene ID: 56438, Gene ID: 300084, and Gene ID: 449846, respectively. Each of these proteins and genes may be naturally-derived one, while a modified protein capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of a naturally-derived protein and a gene encoding this modified protein may be used. The ubiquitin ligase complex contains, in addition to CRBN, three kinds of proteins, which are DDB1, CuL4A, and Roc1, or DDB1, CuL4B, and Roc1. Although the pharmaceutical composition of the present invention preferably contains (or expresses) all these three kinds of proteins (or nucleic acids encoding these proteins), it may contain only one or some of them.
  • The pharmaceutical composition of the present invention can be used for the treatment of a disease of cerebral cortex or a surgical injury of cerebral cortex, or for regenerating cerebral cortex. Examples of the disease of cerebral cortex include Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, progressive supranuclear palsy, and corticobasal degeneration.
  • Although the pharmaceutical composition of the present invention is intended to be used for humans, it may be administered to an animal other than humans to induce proliferation of the neural stem cells or neural progenitor cells or differentiation of these cells into nerve cells in these animals. The target animals are mainly vertebrates, and examples thereof include mice, rats, monkeys, dogs, ferrets, hamsters, chickens, xenopus, zebrafish, and medaka.
  • It has been confirmed only in zebrafish that CRBN induces proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells, as described in Examples. However, 70 to 80% of the genome synteny is conserved between humans and zebrafish (Nature Reviews Genetics 8, 353-367 (May 2007)). Accordingly, it is predicted that CRBN exhibits similar effects as those confirmed in zebrafish also in other vertebrates including humans.
  • Because CRBN induces proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells, the protein can be used for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex. This is specifically exemplified by the following methods (A) and (B).
  • (A) A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising the steps of contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
  • (B) A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising the steps of culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
  • In the method (A), the ubiquitin ligase activity can be measured in accordance with, for example, the method of Angers et al. (Nature, 443, 590-593, 2006) and the method of Groisman et al. (Cell, 113, 357-367, 2003).
  • In the method (A), whether or not the test substance has increased the ubiquitin ligase activity can be judged by measuring the ubiquitin ligase activity of a ubiquitin ligase complex containing CRBN without contacting with the test substance and making a comparison with the value thus obtained.
  • The substance thus selected by the method (A) acts to increase the ubiquitin ligase activity of the CRBN-containing ubiquitin ligase complex present in neural stem cells or neural progenitor cells in the living body. It is speculated that proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN are mediated by the ubiquitin ligase activity possessed by this complex. Accordingly, it is assumed that the substance that is selected by the method (A) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
  • In the method (B), as the neural stem cells to be used, basically cells such as ES cells, iPS cells, and adult stem cells that are subjected to neuronal differentiation induction are employed. Further, neural stem cells such as ones derived from the subventricular zone of adult mice or the hippocampus of adult rats may also be used.
  • In the method (B), a method for measuring the expression level of CRBN can be carried out by, for example, a method using an antibody against CRBN, in situ hybridization method, the RT-PCR method, and Northern blotting method.
  • In the method (B), whether or not the test substance has increased the expression level of CRBN can be judged by culturing neural stem cells or neural progenitor cells in the absence of the test substance and measuring the expression level of CRBN, and then making a comparison with the value thus obtained.
  • The substance that is selected by the method (B) acts to increase the expression level of CRBN in neural stem cells or neural progenitor cells in the living body. Accordingly, it is assumed that the substance that is selected by the method (B) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
  • EXAMPLES
  • Hereinbelow, the present invention will be described in more detail with reference to Examples.
  • (Experimental Method) (1) Systemic Gene Overexpression in the Zebrafish Embryo
  • Adult fish were reared at a constant temperature of 28.5° C. and maintained and bred under a diurnal cycle of 14 hours of light-on and 10 hours of light-off. Fertilized eggs were secured by natural mating between males and females, and an aqueous solution of 600 ng/μl capped RNA synthesized in vitro was injected into the cytoplasm of the embryos before the first cleavage (1-cell stage) under conditions of a nitrogen gas pressure of 30 psi and a valve opening time of 30 msec (millisecond). Because the expression of all the genes except the lhx2 gene (i.e., the crbn gene, the six3.2 gene, and a gene encoding a protein composing an E3 ubiquitin ligase complex with crbn) has little impact on the embryonic development, even when systemically expressed, this method was used to obtain the first data.
  • (2) Localized Gene Overexpression in the Head of the Zebrafish Embryo
  • For studying the lhx2 gene, which exhibits non-specific dorsalization of the embryo when systemically expressed, and for precise experiments specifically examining the effect exerted on the brain volume, in vivo RNA lipofection into the prospective head region of the embryo was carried out. The method of lipofection was entirely in accordance with the technique developed and published by Ando et al. (Ando and Okamoto, Efficient transfection strategy for the spatiotemporal control of gene expression in zebrafish. Mar. Biotechnol. 8(3): 295-303, 2006).
  • (3) Gene Knockdown Using the Zebrafish Embryo
  • An aqueous solution of a 25-mer antisense morpholino oligonucleotide (AMO, Gene Tools, LLC) corresponding to the vicinity of the translation initiation codon in the cDNA sequence of the gene to be knocked down (700 ng/μl injection conditions were the same as those used for RNA) was injected into the embryos at the 1-cell stage. The sequence of AMO used for crbn gene knockdown is 5′ AGAGCTGTAGCTGGTTCCCCATTTC 3′, and that used for lhx2 gene knockdown is 5′ TCTGCAACCCAAGATTTCCGTGAGA 3′.
  • (4) Determination of Functional Hierarchy of Genes Using Zebrafish
  • This process was carried out entirely in accordance with the technique of Ando et al. (H. Ando et al., Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Dev. Biol. 287(2): 456-468, 2005) except for the following procedure. Head-specific gene expression was performed by the in vivo lipofection method described in (2) above instead of RNA uncaging (Japanese Patent Laid-Open No. 2002-315576, H. Ando et al., Photo-mediated gene activation using caged RNA/DNA in zebrafish embryos. Nat. Genet. 28, 317-325, 2001). The basic principle is as follows: embryos in which one (A) of the two kinds of genes suggested to have a functional association is knocked down by the method described in (3) above are cultured up to six hours after fertilization (gastrula stage), and in the prospective forebrain region of the embryos, the expression of the other gene (B) is induced by the in vivo lipofection method described in (2) above. When the effect of knocking down of A is rescued, whereas the effect of knocking down of B is not rescued by an inverted combination of A and B, within a 24-hour period after fertilization, it is determined that A lies functionally upstream of B.
  • (5) Immunohistochemistry
  • Antibody staining of early neurons of zebrafish was performed by the following technique. The embryos 24 to 28 hours after fertilization were fixed at 4° C. for 12 hours in a 4% paraformaldehyde/phosphate buffer (pH 8.0). After washing four times with phosphate buffer, where each wash was performed for 15 minutes, blocking was carried out at normal temperature for one hour in a 5% newborn goat serum dissolved in 0.5% Triton X-100/phosphate buffer. Primary antibody reaction was carried out using a monoclonal anti-acetylated tubulin antibody diluted at 1:1000 in the same solution at 4° C. for 12 hours. Then, after washing the embryos similarly with phosphate buffer, secondary antibody reaction was carried out using an anti-mouse antibody conjugated with Alexa Fluoro 488 (Molecular Probes) under the same conditions as those applied in the primary antibody reaction. The embryos were then washed with phosphate buffer and transparentized in 30%/50%/70% glycerol (dissolved in phosphate buffer), and then observed with a fluorescent microscope under excitation at 488 nm.
  • (6) Whole-Mount In Situ Hybridization
  • This process was carried out basically in accordance with the technique of Thisse et al. (Nat. Protcol. 3 (1) 59-69, 2008). The differences are that a 5 mg/ml Torula yeast RNA was used as a blocker in the probe hybridization solution and a 0.5% Blocking Reagent (Roche) was used as a blocker in the antibody reaction solution. The cDNA of the genes used as the probe (the six3.2 gene, the emx1 gene, the pax2.1 gene, the foxg1 gene, and the otx2 gene) are presents of the original provider. As the probe for the lhx2 gene, the one initially cloned by Ando was used. For the probes of the crbn gene and related genes, primers were designed based on the EST database of zebrafish and the probes were cloned from a cDNA library.
  • (7) Cell Transplantation
  • Nuclease-free water in which an appropriate concentration of rhodamine dextran (molecular weight 10,000) and a final centration of 600 ng/μl crbn RNA were dissolved was injected into the zebrafish embryos at the 1-cell stage under the conditions of the method described in (1) above, and the resulting embryos served as the donors. At three to four hours after fertilization of the donors, 10 to 50 cells were suctioned by a glass microcapillary under fluorescent microscopic observation, which were transplanted into the animal pole of the host embryos at the same stage. After culturing the host embryos for two days without adding any modification, localization of differentiation of the CRBN-expressing donor-derived cells was observed under a fluorescent microscope. Also, as a negative control, cells in which green fluorescence protein (GFP), which was assumed to have no effect on the embryonic development, was expressed were transplanted under the same conditions, and localization of the differentiation was compared between the experimental and control embryos.
  • (8) Detection and Measurement of the Ubiquitin Ligase Activity of CRBN Using an In Vitro Reaction System
  • This process was carried out basically in accordance with the method of Groisman et al. Firstly, CRBN and a binding protein (referred to as a CRBN complex) were purified from a cell lysate solution of mammalian cells expressing CRBN fused with a FLAG epitope tag using M2 FLAG agarose beads (SIGMA). Subsequently, the CRBN complex thus purified was mixed with an aqueous solution containing Uba1 (E1), UbcH5b (E2), and a recombinant GST fusion ubiquitin (Ub) protein, and after addition of ATP, the mixture was left to stand at 30 to 37° C. for two hours. Thereafter, the reaction was terminated by SDS, and self-ubiquitination and ubiquitination of the binding protein were visualized by polyacrylamide gel electrophoresis and immunoblotting, whereby the ubiquitin ligase activity was detected and measured.
  • (9) Detection and Measurement of the CRBN Ubiquitin Ligase Activity Using Live Cells
  • This process was carried out basically in accordance with the method of Ohtake et al. MG132, which is a proteasome inhibitor, was applied to mammalian cells expressing CRBN fused with a FLAG epitope tag, and the cells were left still. Subsequently, the cells were disrupted, and from the resulting cell lysate solution, FLAG was purified and CRBN was extracted, and then immunoblotting was performed under similar, but stricter, conditions to the above, whereby the self-ubiquitination was detected and measured.
  • (10) Fluorescent Staining of Glia Cells and Serotonin-Producing Cells
  • Two-day-old zebrafish were used (for glia cell staining and serotonin-producing cell staining, zebrafish 56 hours and 49 hours after fertilization were used, respectively). Zebrafish were fixed with 4% paraformaldehyde (PFA) and then washed with phosphate buffer (PBS), followed by treatment with 10 μg/ml protease K for partial digestion of the epidermis. After the digestion reaction, the zebrafish were washed with PEST (PBS+0.5% Triton X-100) for 20 minutes and then fixed with PFA again. The fixed zebrafish were washed with PBST at room temperature for one hour, followed by blocking using PBST+5% goat serum. The resulting specimens were reacted with a monoclonal anti-glia antibody (zrf-1/zrf-2) or a rabbit anti-serotonin antibody at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST+5% goat serum for one hour at room temperature, and secondary antibody reaction was carried out by substituting the antibody for a goat anti-mouse IgG antibody (Cy-2 conjugate for glia cell staining) or a goat anti-rabbit IgG antibody (Cy-5 conjugate for serotonin-producing cell staining) at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST at room temperature for one hour. After washing, PBST was replaced by 30%, 50%, 70% glycerol/PBS and the whole zebrafish were mounted on glass slides to obtain preparations. Fluorescence was observed under excitation wavelength of Cy-2 and Cy-5 and the distribution of the glia cells or the serotonin-producing cells was recorded. It is to be noted that glia cells were observed from the lateral side of zebrafish, while the serotonin-producing cells were photographed from the dorsal side in order to observe the distribution of the cells along the midline.
  • (11) Transplantation of CRBN-Expressing Cells into the Diencephalic Ventricle
  • A mixed solution of CRBN-coding RNA (700 ng/μl) and 2% rhodamine dextran was injected into the zebrafish embryos at the 1-cell stage immediately after fertilization. The embryos were cultured up to four hours after fertilization and 10 to 20 cells were collected by a suction capillary, which were injected into the diencephalic ventricle of embryos 30 hours after fertilization, whereby the cells were transplanted. Zebrafish having undergone transplantation were reared up to three days after fertilization in zebrafish physiological saline (E3 Ringer) and then fixed with 4% paraformaldehyde. Following the ordinary method, primary antibody reaction and secondary antibody reaction were carried out using a monoclonal anti-acetylated tubulin antibody and an anti-mouse IgG antibody conjugated with Alexa Fluor (R) (excited at 488 nm), respectively. Then, while observing the fluorescently-labeled nerve cell axon, distribution of the transplanted cells labeled with rhodamine dextran (excited at 543 nm) was studied.
  • (Experimental Results) (1) Determination of Functional Hierarchy of Lhx2 and CRBN
  • Compared to the normal embryo (FIG. 1, upper left panel), brain shrinkage was observed in the lhx2 gene-knockdown embryo (FIG. 1, lower left panel). Meanwhile, similarly to the crbn gene-overexpressing embryo (FIG. 1, upper right panel), brain enlargement was observed in the embryo in which lhx2 gene was knocked down while crbn gene was overexpressed (FIG. 1, lower right panel). From this observation, it is considered that CRBN functions downstream of Lhx2, directly inducing proliferation of central nervous stem cells and differentiation of these cells into nerve cells.
  • (2) CRBN Overexpression Experiment
  • In order to verify induction of differentiation into neural stem cells by CRBN in the cerebrum, a CRBN overexpression experiment was carried out in the forebrain and midbrain of the zebrafish embryos. As a result, both brains enlarged approximately 1.5 times in volume, while retaining their shape (FIG. 2, right). Moreover, the neuron network in the brain was morphologically normal (FIG. 2, right).
  • (3) Transplantation Experiment of CRBN-Overexpressing Cells
  • Firstly, mRNA encoding CRBN and a fluorescent substance (rhodamine) were injected together into donor embryos so that CRBN was overexpressed. The resulting blastula was transplanted into another individual and differentiation of donor-derived cells distributed in the cerebral ventricle was observed under a fluorescent microscope. As a result, the transplanted donor-derived cells were significantly differentiated into the olfactory bulb, which is the telencephalon tissue of fish (FIG. 3, arrowhead). This indicates that when the CRBN-expressing cells were distributed into the cerebral ventricle, they differentiated into neural stem cells and migrated along a cell migration pathway called Rostral Migratory Stream (RMS) and differentiated into the brain tissue in the dorsal telencephalon, where the cerebral cortex develops in mammals.
  • (4) Detection and Measurement of the Ubiquitin Ligase Activity of CRBN Using an In Vitro Reaction System
  • When CRBN (FH-CRBN complex) was added to an aqueous solution containing Uba1 (ubiquitin activating enzyme), UbcH5b (ubiquitin transfer enzyme), and a recombinant GST fusion ubiquitin protein (Ub/E1/E2), proteins that would not be detected in the absence of addition of CRBN were detected (FIG. 4, lane 2 in the left, middle, and right images). For ubiquitination of a protein, in addition to ubiquitin, three kinds of enzymes, namely a ubiquitin activating enzyme, a ubiquitin transfer enzyme, and a ubiquitin ligase are needed. Ubiquitinated proteins were not existent in lane 1 of the left, middle, and right images because no ubiquitin ligase was present. Meanwhile, in lane 2 of the left, middle, and right images, it is speculated that CRBN acted as a ubiquitin ligase to produce ubiquitinated proteins, which were detected by electrophoresis.
  • (5) Detection and Measurement of the CRBN Ubiquitin Ligase Activity Using Live Cells
  • When MG132 was added, a number of bands representing the CRBN-containing proteins were detected (FIG. 5, the right lane). In contrast, when MG132 was not added, very few bands representing the CRBN-containing proteins were detected (FIG. 5, the left lane).
  • It is considered that CRBN in live cells undergoes self-ubiquitination in cooperation with other factors and yields ubiquitinated proteins of various molecular weights. However, most of them are assumed to be degraded by intracellular proteasome. In the left lane of FIG. 5, it is speculated that proteasome was inhibited by MG132, enabling proteins produced through self-ubiquitination to remain, leading to detection of a number of bands. In contrast, in the right lane of FIG. 5, it is speculated that very few bands were detected because most of the proteins produced were degraded by proteasome.
  • (6) Fluorescent Staining of Glia Cells and Serotonin-Producing Cells
  • In the CRBN-overexpressing individual, glia cells (FIG. 6, the left picture) and serotonin-producing cells (FIG. 7, the left picture) were increased, while normal spatial distribution was maintained. This means that CRBN acts to proliferate and differentiate cells, while normally recognizing the spatial pattern of the brain.
  • (7) Transplantation of CRBN-Expressing Cells into the Diencephalic Ventricle
  • When the cells that do not express CRBN were transplanted, the cells did not differentiate into the brain tissue (FIG. 8A to D), whereas when the cells that express CRBN were transplanted, the cells differentiated into the brain tissue (FIG. 8E to H).
  • INDUSTRIAL APPLICABILITY
  • The present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, it is also useful for the development of a novel therapeutic drug for a disease of cerebral cortex.

Claims (11)

1. A pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
2. The pharmaceutical composition according to claim 1, wherein the nucleic acid encoding CRBN is inserted in a virus vector.
3. The pharmaceutical composition according to claim 1, comprising CRBN and a protein that forms a ubiquitin ligase complex with CRBN.
4. The pharmaceutical composition according to claim 1, comprising the nucleic acid encoding CRBN and a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN.
5. The pharmaceutical composition according to claim 1, comprising a stem cell or a neural progenitor cell in which CRBN and a protein that forms a ubiquitin ligase complex with CRBN are expressed.
6. The pharmaceutical composition according to claim 1, used for treating a disease of cerebral cortex or a surgical injury of cerebral cortex.
7. The pharmaceutical composition according to claim 1, used for regenerating cerebral cortex.
8. A method comprising administering the pharmaceutical composition according to claim 1 to a non-human animal and proliferating a neural stem cell or a neural progenitor cell of the non-human animal.
9. A method comprising administering the pharmaceutical composition according to claim 1 to a non-human animal and differentiating a neural stem cell or a neural progenitor cell of the non-human animal into a nerve cell.
10. A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising contacting a test substance with a ubiquitin ligase complex comprising CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
11. A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
US13/322,195 2009-05-25 2010-05-24 Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells Abandoned US20120134969A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2009-124811 2009-05-25
JP2009124811 2009-05-25
PCT/JP2010/058722 WO2010137547A1 (en) 2009-05-25 2010-05-24 Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/058722 A-371-Of-International WO2010137547A1 (en) 2009-05-25 2010-05-24 Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/629,452 Division US9611465B2 (en) 2009-05-25 2015-02-23 Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell

Publications (1)

Publication Number Publication Date
US20120134969A1 true US20120134969A1 (en) 2012-05-31

Family

ID=43222656

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/322,195 Abandoned US20120134969A1 (en) 2009-05-25 2010-05-24 Pharmaceutical composition containing nuclear factor involved in proliferation and differentiation of central neuronal cells
US14/629,452 Active US9611465B2 (en) 2009-05-25 2015-02-23 Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/629,452 Active US9611465B2 (en) 2009-05-25 2015-02-23 Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell

Country Status (5)

Country Link
US (2) US20120134969A1 (en)
EP (1) EP2436387B1 (en)
JP (1) JP5645816B2 (en)
CN (1) CN102448472A (en)
WO (1) WO2010137547A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014123267A1 (en) * 2013-02-07 2014-08-14 광주과학기술원 Method for producing crbn ko mouse and use thereof
WO2015127351A1 (en) * 2014-02-24 2015-08-27 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
US9365640B2 (en) 2011-04-29 2016-06-14 Celgene Corporation Methods for the treatment of cancer and inflammatory diseases using cereblon as a predictor
US9587281B2 (en) 2012-08-14 2017-03-07 Celgene Corporation Cereblon isoforms and their use as biomarkers for therapeutic treatment
US9611465B2 (en) 2009-05-25 2017-04-04 Celgene Corporation Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell
US9857359B2 (en) 2012-06-29 2018-01-02 Celgene Corporation Methods for determining drug efficacy using cereblon-associated proteins
US10092555B2 (en) 2014-06-27 2018-10-09 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
CN111830000A (en) * 2020-07-23 2020-10-27 南开大学 A method for targeting zebrafish embryos/juveniles with nanoparticle-loaded probes
US10816544B2 (en) 2017-02-03 2020-10-27 Celgene Corporation Methods for measuring small molecule affinity to cereblon
US10830762B2 (en) 2015-12-28 2020-11-10 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US11963520B2 (en) 2016-01-19 2024-04-23 Celgene Corporation Transgenic mouse expressing human cereblon

Families Citing this family (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9662319B2 (en) 2011-03-11 2017-05-30 Mayo Foundation For Medical Education And Research Methods and materials for assessing responsiveness to lenalidomide, thalidomide, and/or other thalidomide analogs
PH12013501837A1 (en) 2011-03-11 2013-11-18 Celgene Corp Use of 3-(5-amino-2-methyl-4-oxoquinazolin-3(4h)-yl)piperidine-2,6-dione in treatment of immune-related and inflammatory diseases
US10689609B2 (en) 2012-03-15 2020-06-23 Flodesign Sonics, Inc. Acoustic bioreactor processes
US10967298B2 (en) 2012-03-15 2021-04-06 Flodesign Sonics, Inc. Driver and control for variable impedence load
US9752113B2 (en) 2012-03-15 2017-09-05 Flodesign Sonics, Inc. Acoustic perfusion devices
US10322949B2 (en) 2012-03-15 2019-06-18 Flodesign Sonics, Inc. Transducer and reflector configurations for an acoustophoretic device
US9458450B2 (en) 2012-03-15 2016-10-04 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US9950282B2 (en) 2012-03-15 2018-04-24 Flodesign Sonics, Inc. Electronic configuration and control for acoustic standing wave generation
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US9745548B2 (en) 2012-03-15 2017-08-29 Flodesign Sonics, Inc. Acoustic perfusion devices
US10737953B2 (en) 2012-04-20 2020-08-11 Flodesign Sonics, Inc. Acoustophoretic method for use in bioreactors
AU2013299627C1 (en) 2012-08-09 2018-05-31 Celgene Corporation Methods of treating cancer using 3-(4-((4-(morpholinomethyl)benzyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione
WO2014172436A1 (en) 2013-04-17 2014-10-23 Signal Pharmaceuticals, Llc Combination therapy comprising a tor kinase inhibitor and a 5-substituted quinazolinone compound for treating cancer
EP2991651A1 (en) 2013-05-03 2016-03-09 Celgene Corporation Methods for treating cancer using combination therapy
US9745569B2 (en) 2013-09-13 2017-08-29 Flodesign Sonics, Inc. System for generating high concentration factors for low cell density suspensions
US20160282354A1 (en) 2013-11-08 2016-09-29 The Broad Institute, Inc. Compositions and methods for selecting a treatment for b-cell neoplasias
WO2015085172A2 (en) 2013-12-06 2015-06-11 Celgene Corporation Methods for determining drug efficacy for the treatment of diffuse large b-cell lymphoma, multiple myeloma, and myeloid cancers
WO2015105955A1 (en) 2014-01-08 2015-07-16 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US9744483B2 (en) 2014-07-02 2017-08-29 Flodesign Sonics, Inc. Large scale acoustic separation device
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11021699B2 (en) 2015-04-29 2021-06-01 FioDesign Sonics, Inc. Separation using angled acoustic waves
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
WO2017044793A1 (en) 2015-09-11 2017-03-16 The Brigham And Women's Hospital, Inc. Methods of characterizing resistance to modulators of cereblon
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
WO2018075830A1 (en) 2016-10-19 2018-04-26 Flodesign Sonics, Inc. Affinity cell extraction by acoustics
DK3425390T3 (en) * 2016-11-25 2021-02-15 Genuv Inc Composition for promoting differentiation and protection of neural stem cells and method for inducing neural regeneration using them
US12049482B2 (en) 2017-10-31 2024-07-30 The Brigham And Women's Hospital, Inc. Molecular switch-mediated control of engineered cells
KR102439221B1 (en) 2017-12-14 2022-09-01 프로디자인 소닉스, 인크. Acoustic transducer actuators and controllers

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070015194A1 (en) * 2005-07-12 2007-01-18 Mordechai Shohat Methods and kits for diagnosing and treating mental retardation

Family Cites Families (82)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3845770A (en) 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US4008719A (en) 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US5001116A (en) 1982-12-20 1991-03-19 The Children's Medical Center Corporation Inhibition of angiogenesis
US4994443A (en) 1982-12-20 1991-02-19 The Children's Medical Center Corporation Inhibition of angiogenesis
IE58110B1 (en) 1984-10-30 1993-07-14 Elan Corp Plc Controlled release powder and process for its preparation
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5391485A (en) 1985-08-06 1995-02-21 Immunex Corporation DNAs encoding analog GM-CSF molecules displaying resistance to proteases which cleave at adjacent dibasic residues
US4810643A (en) 1985-08-23 1989-03-07 Kirin- Amgen Inc. Production of pluripotent granulocyte colony-stimulating factor
JPS63500636A (en) 1985-08-23 1988-03-10 麒麟麦酒株式会社 DNA encoding multipotent granulocyte colony stimulating factor
US5073543A (en) 1988-07-21 1991-12-17 G. D. Searle & Co. Controlled release formulations of trophic factors in ganglioside-lipsome vehicle
IT1229203B (en) 1989-03-22 1991-07-25 Bioresearch Spa USE OF 5 METHYLTHETRAHYDROPHOLIC ACID, 5 FORMYLTHETRAHYDROPHOLIC ACID AND THEIR PHARMACEUTICALLY ACCEPTABLE SALTS FOR THE PREPARATION OF PHARMACEUTICAL COMPOSITIONS IN THE FORM OF CONTROLLED RELEASE ACTIVE IN THE THERAPY OF MENTAL AND ORGANIC DISORDERS.
US5120548A (en) 1989-11-07 1992-06-09 Merck & Co., Inc. Swelling modulated polymeric drug delivery device
KR0166088B1 (en) 1990-01-23 1999-01-15 . Cyclodextrin derivatives with increased water solubility and uses thereof
US5733566A (en) 1990-05-15 1998-03-31 Alkermes Controlled Therapeutics Inc. Ii Controlled release of antiparasitic agents in animals
US5580578A (en) 1992-01-27 1996-12-03 Euro-Celtique, S.A. Controlled release formulations coated with aqueous dispersions of acrylic polymers
EP1134293A3 (en) 1992-03-04 2004-01-07 The Regents of The University of California Comparative genomic hybridization (CGH)
US5441050A (en) 1992-12-18 1995-08-15 Neoprobe Corporation Radiation responsive surgical instrument
US5591767A (en) 1993-01-25 1997-01-07 Pharmetrix Corporation Liquid reservoir transdermal patch for the administration of ketorolac
US6114355A (en) 1993-03-01 2000-09-05 D'amato; Robert Methods and compositions for inhibition of angiogenesis
US5629327A (en) 1993-03-01 1997-05-13 Childrens Hospital Medical Center Corp. Methods and compositions for inhibition of angiogenesis
US8143283B1 (en) 1993-03-01 2012-03-27 The Children's Medical Center Corporation Methods for treating blood-born tumors with thalidomide
US5698579A (en) 1993-07-02 1997-12-16 Celgene Corporation Cyclic amides
IT1270594B (en) 1994-07-07 1997-05-07 Recordati Chem Pharm CONTROLLED RELEASE PHARMACEUTICAL COMPOSITION OF LIQUID SUSPENSION MOGUISTEIN
US5573758A (en) * 1995-04-28 1996-11-12 Allergan Method for reducing intraocular pressure in the mammalian eye by administration of potassium channel blockers
HU228769B1 (en) 1996-07-24 2013-05-28 Celgene Corp Substituted 2(2,6-dioxopiperidin-3-yl)phthalimides and -1-oxoisoindolines and their use for production of pharmaceutical compositions for mammals to reduce the level of tnf-alpha
DE122007000079I2 (en) 1996-07-24 2010-08-12 Celgene Corp SUBSTITUTED 2- (2,6-DIOXOPIPERIDIN-3-YL) -PHTHALIMIDES AND -1-OXOISOINDOLINES AND METHOD FOR REDUCING THE TNF-ALPHA MIRROR
US5635517B1 (en) 1996-07-24 1999-06-29 Celgene Corp Method of reducing TNFalpha levels with amino substituted 2-(2,6-dioxopiperidin-3-YL)-1-oxo-and 1,3-dioxoisoindolines
US6281230B1 (en) 1996-07-24 2001-08-28 Celgene Corporation Isoindolines, method of use, and pharmaceutical compositions
US5798368A (en) 1996-08-22 1998-08-25 Celgene Corporation Tetrasubstituted 2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolines and method of reducing TNFα levels
NZ334148A (en) 1996-08-12 2001-12-21 Celgene Corp 3-Substituted phenyl-ethyl or ethenyl derivatives terminated with a nitrile, alkane, carboxyl or carbamoyl group useful to reduce cytokine levels
US5955476A (en) 1997-11-18 1999-09-21 Celgene Corporation Substituted 2-(2,6-dioxo-3-fluoropiperidin-3-yl)-isoindolines and method of reducing inflammatory cytokine levels
US5874448A (en) 1997-11-18 1999-02-23 Celgene Corporation Substituted 2-(2,6 dioxo-3-fluoropiperidin-3-yl)-isoindolines and method of reducing TNFα levels
TR200101502T2 (en) 1998-03-16 2002-06-21 Celgene Corporation 2- (2,6-dioxopiperidin-3-yl) isoindoline derivatives, their preparation and use as inhibitors of inflammatory cytokines
US6927024B2 (en) 1998-11-30 2005-08-09 Genentech, Inc. PCR assay
CN1342146A (en) 1999-03-18 2002-03-27 塞尔基因公司 Substituted 1-oxo- and 1,3-dioxoisoindolines and their use in pharmaceutical compositions for reducing the content of inflammatory cytokines
WO2001042507A1 (en) 1999-12-09 2001-06-14 Advanced Research & Technology Institute Fluorescent in situ rt-pcr
US6458810B1 (en) 2000-11-14 2002-10-01 George Muller Pharmaceutically active isoindoline derivatives
US7091353B2 (en) 2000-12-27 2006-08-15 Celgene Corporation Isoindole-imide compounds, compositions, and uses thereof
US20030045552A1 (en) 2000-12-27 2003-03-06 Robarge Michael J. Isoindole-imide compounds, compositions, and uses thereof
CA2439402A1 (en) 2001-03-02 2002-09-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education Pcr method
JP2002315576A (en) 2001-04-23 2002-10-29 Inst Of Physical & Chemical Res Gene expression regulation method
US7981863B2 (en) 2001-09-19 2011-07-19 Neuronova Ab Treatment of Parkinson's disease with PDGF
US7393862B2 (en) 2002-05-17 2008-07-01 Celgene Corporation Method using 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione for treatment of certain leukemias
US7968569B2 (en) 2002-05-17 2011-06-28 Celgene Corporation Methods for treatment of multiple myeloma using 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione
AU2003247891A1 (en) 2002-07-08 2004-01-23 Merck & Co., Inc. Mitotic kinesin binding site
US7189740B2 (en) 2002-10-15 2007-03-13 Celgene Corporation Methods of using 3-(4-amino-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione for the treatment and management of myelodysplastic syndromes
US7122799B2 (en) 2003-12-18 2006-10-17 Palo Alto Research Center Incorporated LED or laser enabled real-time PCR system and spectrophotometer
US7244759B2 (en) 2004-07-28 2007-07-17 Celgene Corporation Isoindoline compounds and methods of making and using the same
NZ555886A (en) 2004-12-01 2009-12-24 Celgene Corp Methods and compositions using immunomodulatory compounds for the treatment of immunodeficiency disorders
US20080051379A1 (en) 2004-12-01 2008-02-28 Trustees Of Boston University Compositions and Methods for the Treatment of Peripheral B-Cell Neoplasms
EP1848433A2 (en) 2005-01-25 2007-10-31 Celgene Corporation Methods and compositions using 4-amino-2-(3-methyl-2,6-dioxopiperidin-3-yl)-isoindole-1-3-dione
US7504225B2 (en) 2005-05-12 2009-03-17 Applied Genomics, Inc. Reagents and methods for use in cancer diagnosis, classification and therapy
UA91560C2 (en) 2005-08-31 2010-08-10 Селджин Корпорэйшн Isoindole-imide compounds and compositions comprising and methods of using the same
US8445198B2 (en) 2005-12-01 2013-05-21 Medical Prognosis Institute Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20070128636A1 (en) 2005-12-05 2007-06-07 Baker Joffre B Predictors Of Patient Response To Treatment With EGFR Inhibitors
WO2007084992A2 (en) 2006-01-19 2007-07-26 The University Of Chicago Prognosis and therapy predictive markers and methods of use
EP2004193A2 (en) * 2006-03-13 2008-12-24 Merck & Co., Inc. Ophthalmic compositions for treating ocular hypertension
WO2008005281A2 (en) 2006-06-30 2008-01-10 Rosetta Inpharmatics Llc Genes associated with chemotherapy response and uses thereof
US8877780B2 (en) 2006-08-30 2014-11-04 Celgene Corporation 5-substituted isoindoline compounds
ME02420B (en) 2006-09-26 2016-09-20 Celgene Corp 5-substituted quinazolinone derivatives as anti-cancer agents
WO2008039475A2 (en) 2006-09-26 2008-04-03 The Board Of Trustees Of The University Of Arkansas A gene expression profiling based identification of genomic signatures of multiple myeloma and uses thereof
EP2235535B1 (en) 2007-12-07 2014-11-12 Celgene Corporation Biomarkers for predicting the sensitivity of cells to immunomodulatory compounds during treatment of non-hodgkin's lymphoma
US20100021437A1 (en) 2008-04-07 2010-01-28 The McLean Hospital Corporation Whitehead Institute for Biomedical Research Neural stem cells derived from induced pluripotent stem cells
US9034319B2 (en) 2008-05-26 2015-05-19 Yeda Research And Development Co. Ltd. Methods of treating cancer of the central nervous system
WO2010017515A2 (en) 2008-08-08 2010-02-11 Integrated Diagnostics Inc. Breast cancer specific markers and methods of use
US20120035347A1 (en) 2009-04-14 2012-02-09 Schering Corporation Interferon-alfa sensitivity biomarkers
EP2436387B1 (en) 2009-05-25 2018-07-25 Celgene Corporation Pharmaceutical composition comprising crbn for use in treating a disease of the cerebral cortex
CA2774871C (en) 2009-10-20 2018-05-29 Tokyo Institute Of Technology Screening method utilizing thalidomide-targeting factor
PL3202460T3 (en) 2010-02-11 2019-12-31 Celgene Corporation Arylmethoxy isoindoline derivatives and compositions comprising and methods of using the same
KR20130038838A (en) 2010-03-12 2013-04-18 셀진 코포레이션 Methods for the treatment of non-hodgkin's lymphomas using lenalidomide, and gene and protein biomarkers as a predictor
EP2619574B1 (en) 2010-09-15 2020-10-28 Almac Diagnostic Services Limited Molecular test for predicting responsiveness to dna-damage therapeutic agents in individuals having cancer
DK2683708T3 (en) 2011-03-11 2018-01-29 Celgene Corp SOLID FORMS OF 3- (5-AMINO-2-METHYL-4-OXO-4H-QUINAZOLIN-3-YL) -PIPERIDIN-2,6-DION AND PHARMACEUTICAL COMPOSITIONS AND APPLICATIONS THEREOF
US9662319B2 (en) 2011-03-11 2017-05-30 Mayo Foundation For Medical Education And Research Methods and materials for assessing responsiveness to lenalidomide, thalidomide, and/or other thalidomide analogs
PH12013501837A1 (en) 2011-03-11 2013-11-18 Celgene Corp Use of 3-(5-amino-2-methyl-4-oxoquinazolin-3(4h)-yl)piperidine-2,6-dione in treatment of immune-related and inflammatory diseases
AU2012249491B2 (en) 2011-04-29 2016-12-15 Celgene Corporation Methods for the treatment of cancer and inflammatory diseases using cereblon as a predictor
EP2705370A2 (en) 2011-05-06 2014-03-12 Xentech Markers for cancer prognosis and therapy and methods of use
ES2872967T3 (en) 2012-06-29 2021-11-03 Celgene Corp Methods to determine drug efficacy using IKZF3 (AIOLOS)
AU2013299627C1 (en) 2012-08-09 2018-05-31 Celgene Corporation Methods of treating cancer using 3-(4-((4-(morpholinomethyl)benzyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione
WO2014028445A2 (en) 2012-08-14 2014-02-20 Celgene Corporation Cereblon isoforms and their use as biomarkers for therapeutic treatment

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070015194A1 (en) * 2005-07-12 2007-01-18 Mordechai Shohat Methods and kits for diagnosing and treating mental retardation

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
Ando et al." Efficient transfection strategy for the spatiotemporal control of gene expression in zebrafish." Mar Biotechnol (NY). 2006 May-Jun;8(3):295-303. Epub 2006 Apr 18. *
Babin et al. "Zebrafish models of human motor neuron diseases: Advantages and limitations." Progress in Neurobiology(2014); 118: Pgs. 36-58. *
Bartlett "Fenner Conference: Regulation of neural stem cell differentiation in the forebrain." Immunology and Cell Biology 76, 414-418 (1998). *
Bartlett "Fenner Conference: Regulation of neural stem cell differentiation in the forebrain." Immunology and Cell Biology(1998); 76: Pgs. 414-418. *
Bisht et al. "Brain Drug Delivery System: A Comprehensive review on recent experimental and clinical findings."IJPSR( 2011); 2(4): Pgs.792-806. *
Higgins et al. "A mutation in a novel ATP-dependent Lon protease gene in a kindred with mild mental retardation" Neurology. 63(10): 1927-1931.(2004). *
Hsich et al. " Review: Critical Issues in Gene Therapy for Neurologic Disease." Human Gene Therapy (2002) 13: Pgs.579-604 *
Hsich et al. " Review: Critical Issues in Gene Therapy for Neurologic Disease." Human Gene Therapy 13:579-604 (2002). *
Ito et al. "Identification of a Primary Target of Thalidomide Teratogenicity." Science 327, 1345 -1350 (2010). *
Ito et al. Supplemental. "Identification of a Primary Target of Thalidomide Teratogenicity." Science 327, 1-28 (2010). *
Jakobsson et al. "Lentiviral Vectors for Use in the Central Nervous System." Molecular Therapy.(2006); 13( 3):Pgs. 484-493. *
Kobayashi et al. "Overexpression of the forebrain-specific homeobox gene six3 induces rostral forebrain enlargement in zebrafish." Development. (1998);125: Pgs. 2973-2982. *
Mochida et al. "Genetic Basis of Developmental Malformations of the Cerebral Cortex" Arch Neurol. 61:637-640 (2004). *
Nakamura et al. "Freud-1/Aki1, a Novel PDK1-Interacting Protein, Functions as a Scaffold To Activate the PDK1/Akt Pathway in Epidermal Growth Factor Signaling." Molecular and Cellular Biology, 28(19): 5996-6009 (2008). *
Neve et al. "Gene Delivery Into the Brain Using Viral Vectors." Chatper 20 of Gene Delivery into the Brain Using Viral Vectors (2002). *
Razek et al. "Disorders of Cortical Formation: MR Imaging Features" AJNR Am J Neuroradiol (2009); 30: Pgs. 4-11. *
Santana et al. "Can zebrafish be used as animal model to study Alzheimer's disease?." Am J Neurodegener Dis (2012);1(1):Pgs. 32-48. *
Science Daily (http://www.sciencedaily.com/releases/2011/08/110823180459.htm) *
Science Daily (http://www.sciencedaily.com/releases/2011/08/110823180459.htm). *
Shestopalov et al. "Oligonucleotide-based tools for studying zebrafish development." Zebrafish. (2010 ); 7(1):Pgs. 31-40. *
Suzuki et al."Stabe Transgene Expression From HSV Amplicon ectors in the Brain: Potential Involvement of Immunoregulatory Signals." Molecular Therapy.(2008);16(10): Pgs. 1727-1736. *
Thomas et al. "Progress and Problems With the Use of Viral Vectors for Gene." Nat Rev Genet. (2003);4(5):Pgs.346-58. *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9611465B2 (en) 2009-05-25 2017-04-04 Celgene Corporation Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell
US9365640B2 (en) 2011-04-29 2016-06-14 Celgene Corporation Methods for the treatment of cancer and inflammatory diseases using cereblon as a predictor
US10047151B2 (en) 2011-04-29 2018-08-14 Celgene Corporation Methods for the treatment of cancer and inflammatory diseases using cereblon as a predictor
US9857359B2 (en) 2012-06-29 2018-01-02 Celgene Corporation Methods for determining drug efficacy using cereblon-associated proteins
US9587281B2 (en) 2012-08-14 2017-03-07 Celgene Corporation Cereblon isoforms and their use as biomarkers for therapeutic treatment
WO2014123267A1 (en) * 2013-02-07 2014-08-14 광주과학기술원 Method for producing crbn ko mouse and use thereof
US10272117B2 (en) 2014-02-24 2019-04-30 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
WO2015127351A1 (en) * 2014-02-24 2015-08-27 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
US20170007645A1 (en) * 2014-02-24 2017-01-12 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
EP3450571A1 (en) 2014-02-24 2019-03-06 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
US10092555B2 (en) 2014-06-27 2018-10-09 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US10668057B2 (en) 2014-06-27 2020-06-02 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US11419861B2 (en) 2014-06-27 2022-08-23 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US10830762B2 (en) 2015-12-28 2020-11-10 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US11733233B2 (en) 2015-12-28 2023-08-22 Celgene Corporation Compositions and methods for inducing conformational changes in cereblon and other E3 ubiquitin ligases
US11963520B2 (en) 2016-01-19 2024-04-23 Celgene Corporation Transgenic mouse expressing human cereblon
US10816544B2 (en) 2017-02-03 2020-10-27 Celgene Corporation Methods for measuring small molecule affinity to cereblon
US11644461B2 (en) 2017-02-03 2023-05-09 Celgene Corporation Methods for measuring small molecule affinity to cereblon
CN111830000A (en) * 2020-07-23 2020-10-27 南开大学 A method for targeting zebrafish embryos/juveniles with nanoparticle-loaded probes

Also Published As

Publication number Publication date
JPWO2010137547A1 (en) 2012-11-15
US9611465B2 (en) 2017-04-04
EP2436387B1 (en) 2018-07-25
CN102448472A (en) 2012-05-09
EP2436387A1 (en) 2012-04-04
US20150232826A1 (en) 2015-08-20
JP5645816B2 (en) 2014-12-24
EP2436387A4 (en) 2013-07-17
WO2010137547A1 (en) 2010-12-02

Similar Documents

Publication Publication Date Title
US9611465B2 (en) Pharmaceutical composition containing core factor involved in proliferation and differentiation of central nervous cell
Pan et al. Tau accelerates α-synuclein aggregation and spreading in Parkinson’s disease
Kline-Smith et al. The microtubule-destabilizing kinesin XKCM1 regulates microtubule dynamic instability in cells
Zappala et al. Expression of pannexin1 in the CNS of adult mouse: cellular localization and effect of 4-aminopyridine-induced seizures
EP3105334B1 (en) Müller cell-specific promoter
Sundvik et al. The histaminergic system regulates wakefulness and orexin/hypocretin neuron development via histamine receptor H1 in zebrafish
EP2321417B1 (en) Stxbp1 as psychiatric biomarker in murine model system and its uses
EP3289090B1 (en) Promoter for the specific expression of genes in müller cells
CN109476716A (en) Methods of treating mitochondrial disorders
Adachi et al. Immunocytochemical localization of a neuron-specific diacylglycerol kinase β and γ in the developing rat brain
Elbaz et al. Reduced synaptic density and deficient locomotor response in neuronal activity‐regulated pentraxin 2a mutant zebrafish
Iborra‐Lázaro et al. CPT1C is required for synaptic plasticity and oscillatory activity that supports motor, associative and non‐associative learning
Hagiwara et al. Developmental expression of dystrophin on the plasma membrane of rat muscle cells
KR102296075B1 (en) epcam Variant Zebrafish and Uses Thereof
US8524228B2 (en) Netrin-1 compositions and methods of use thereof
Chiba et al. Sensory system-predominant distribution of leukotriene A4 hydrolase and its colocalization with calretinin in the mouse nervous system
Nagy et al. Neuronal overexpression of potassium channel subunit Kcnn1 prolongs survival of SOD1-linked ALS and A53T alpha-synuclein mouse models
Grigorev et al. Immunohistochemical studies of cell organization in the human epiphysis
MX2012003773A (en) Genes, methods, and compositions related to neurogenesis and its modulation.
Tello et al. Drosophila CASK regulates brain size and neuronal morphogenesis, providing a genetic model of postnatal microcephaly suitable for drug discovery
EP2666851A1 (en) Gene capable of regulating obesity/insulin sensitivity
US20240350581A1 (en) Methods for treatment of neuron degeneration
Gurdita Investigating the Mechanisms That Regulate Rod Photoreceptor Positioning and Connectivity in the Developing Murine Retina
Ali Mef2c transcription factor is required for the development of medium spiny neurons of the mouse striatum
Hamed The role of TRPC6 channel in the dentate gyrus and pathophysiology of traumatic brain injury

Legal Events

Date Code Title Description
AS Assignment

Owner name: TOKYO INSTITUTE OF TECHNOLOGY, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HANDA, HIROSHI;ANDO, HIDEKI;ITOH, TAKUMI;AND OTHERS;REEL/FRAME:027276/0531

Effective date: 20111018

AS Assignment

Owner name: CELGENE CORPORATION, NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:TOKYO INSTITUTE OF TECHNOLOGY;REEL/FRAME:031863/0488

Effective date: 20130926

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION