US20100248235A1

US20100248235A1 - Biomarkers for autism spectrum disorders

Info

Publication number: US20100248235A1
Application number: US12/681,229
Authority: US
Inventors: Stephen W. Scherer; John B. Vincent
Original assignee: Individual
Current assignee: Individual
Priority date: 2007-10-04
Filing date: 2008-10-03
Publication date: 2010-09-30
Also published as: JP2014155507A; CA2701202C; JP5941099B2; JP2010539958A; WO2009043178A1; CA2701202A1; US20150322518A1; JP5680964B2; US10526653B2; US11254984B2; US20220136055A1; US20200157628A1

Abstract

Methods of determining the risk of ASD in an individual are provided which comprise identifying the presence of one or more genomic mutations in one or more of the genes, PTCHD1, SHANK3, NFIA, DPP6, DPP10, DYPD, GPR98, PQBP1, ZNF41 and FTSJ1.

Description

FIELD OF THE INVENTION

The present invention relates to genetic markers for Autism Spectrum Disorders (ASD).

BACKGROUND OF THE INVENTION

Autism is a heritable neurodevelopmental condition characterized by impairments in social communication and by a preference for repetitive activities. Autism is not a distinct categorical disorder but is the prototype of a group of conditions defined as Pervasive Developmental Disorders (PDDs) or Autism Spectrum Disorders (ASD), which include Asperger's Disorder, Childhood Disintegrative Disorder, Pervasive developmental disorder-not otherwise specified (PDD-NOS) and Rett Syndrome. ASD is diagnosed in families of all racial, ethnic and social-economic backgrounds with incidence roughly four times higher in males compared to females. Overall population prevalence of autism has increased in recent years to a current estimate of 20 in 10,000 with incidence as high as 60 in 10,000 for all autism spectrum disorders.
Data from several epidemiological twin and family studies provide substantial evidence that autism has a significant and complex genetic etiology. The concordance rate in monozygotic twins is 60-90% (Bailey 1995), and the recurrence rate in siblings of affected probands has been reported to be between 5-10% (Jones & Szatmari 1988) representing a 50 fold increase in risk compared to the general population. Although autism spectrum disorders are among the most heritable complex disorders, the genetic risk is clearly not conferred in simple Mendelian fashion.
In a minority of cases (˜10%), autism is part of a broader recognizable disorder (e.g. fragile X syndrome, tuberous sclerosis) or is associated with cytogenetically-detectable chromosome abnormalities. Moreover, co-morbidity of autism with microdeletion syndromes (e.g. William-Beuren and Sotos) and other genomic disorders (e.g. Prader-Willi/Angelman) suggests chromosomal imbalances are involved in the underlying etiology. The most frequent cytogenetic anomaly is an interstitial, maternally-inherited duplication of 15q11-13 (1-3%) encompassing the Prader Willi/Angelman Syndrome critical region. There are also a large number of cases with deletions in the q11.2 and q13.3 regions of chromosome 22. The 22q11.2 region is associated with velo-cardio-facial Syndrome and deletions at 22q13.3 appear to also represent a clinically definable syndrome. Both deletions are associated with the autistic phenotypes. Other chromosome loci associated with anomalies with a higher frequency of events observed in syndromic forms of ASD include 7q (see TCAG www.chr7.org), 2q37, 5p14-15, 17p11.2. In addition, reciprocal duplications overlapping the William-Beuren deletion region have been associated with the autism phenotype.
Genome-wide linkage scans have found evidence for susceptibility loci on almost all chromosomes with 7q yielding the most consistent results. Other loci with significant linkage include 2q (IMGSAC 2001), 3q and most recently 11p (AGP 10K study). In some instances, like 7q, there is considerable overlap between cytogenetic anomalies and linkage results. However, the lack of linkage found at 15q11-13 and 22q13.3 loci reflect considerable heterogeneity in ASD and suggest that these rearrangements are responsible for a particular ASD subtype involving genes that do not contribute to the phenotype in cytogenetically normal patients. Despite promising results, no specific genes within these linkage peaks have unequivocally been shown to contribute to autism.
Mutations associated with ASD have been reported in two neuroligin (NLGN3 and NLGN4) genes and more recently SHANK3; however, these account for only rare causes of ASD. Other genes have been implicated, but represent rare events or have not yet been validated by other studies.
Together these data suggest substantial genetic heterogeneity with the most likely cause of non-syndromic idiopathic ASD involving multiple epistatically-interacting loci.
The identification of large scale copy number variants (CNVs) represents a considerable source of genetic variation in the human genome that contributes to phenotypic variation and disease susceptibility found small inherited deletions in autistic kindreds suggesting possible susceptibility loci.
It would be desirable to identify genetic markers of ASD that facilitate in a determination of the risk of ASD in an individual, as well as to assist in the diagnosis of the condition.

SUMMARY OF THE INVENTION

A number of genetic markers have now been identified which are useful in assessing the risk of ASD in an individual, as well as being useful to diagnose the condition. The markers are useful both individually and in the form of a microarray to screen individuals for risk of ASD.
Thus, in one aspect of the present invention, a method of determining the risk of ASD in an individual is provided comprising:
probing a nucleic acid-containing sample obtained from the individual for a gene encoding PTCHD1, wherein a determination that the gene comprises a deletion of at least a portion of exon 1 is indicative of a risk of ASD in the individual.
In another aspect of the present invention, a method of determining the risk of ASD in an individual is provided comprising:
probing a nucleic acid-containing sample obtained from the individual for a mutation that modulates the expression of at least one gene selected from the group consisting of PTCHD1, SHANK3, NFIA, DPP6, DPP10, GPR98, PQBP1, ZNF41 and FTSJ1, wherein identification of a mutation that modulates the expression of at least one of said genes is indicative of a risk of ASD.
In another aspect of the invention, a method of determining the risk of ASD in an individual is provided comprising:
screening a biological sample obtained from the individual for abnormal levels of at least one gene product expressed by a gene selected from the group consisting of PTCHD1, SHANK3, NFIA, DPP6, DPP10, GPR98, PQBP1, ZNF41 and FTSJ1, wherein a determination that at least one of said gene products is expressed at a level that varies from the level in a healthy non-ASD individual is indicative of a risk of ASD.
In a further aspect of the invention, a method of determining the risk of ASD in an individual is provided comprising:
screening a nucleic acid-containing sample from the individual for genomic sequence variations that modulate the expression of PTCHD1.
These and other aspects of the present invention are described by reference to the following figures in which:

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a flow chart depicting the methodology used to identify ASD-specific CNVs;

FIG. 2 illustrates a genome-wide distribution of ASD-specific CNVs as described in Table 3;

FIG. 3 illustrates the chromosome 16p11.2 region as depicted in the Autism Chromosome Rearrangement Database;

FIG. 4 illustrates examples of CNVs observed in ASD families including probands having multiple de novo events (a); rearrangements in the SHANK3 gene (b); probands with chromosome X deletions (at PTCHD1) from female carriers (c) or inherited translocations in addition to an unrelated de novo deletion (d); overlapping events in unrelated probands either de novo (e) or inherited (f) at the DPP6 locus; and recurrent de novo events at chromosome 16p11.2 in unrelated probands either gains (h) or losses (g);

FIG. 5 illustrates examples of DPP6 and DPP10 ASD-related CNVs;

FIG. 6 illustrates examples of chromosome 22q11.2 and 16p11.2 ASD-related CNVs;

FIG. 7 illustrates the cDNA sequence (A) of the PTCHD1 gene and the corresponding amino acid sequence (B); and

FIG. 8 illustrates ASD-related missense mutations identified in Table 7.

DETAILED DESCRIPTION OF THE INVENTION

A method of determining the risk of an autism spectrum disorder (ASD) in an individual is provided comprising screening a biological sample obtained from the individual for a mutation that may modulate the expression of at least one gene selected from the group consisting of PTCHD1, SHANK3, NFIA, DPP6, DPP10, DPYD, GPR98, PQBP1, ZNF41 and FTSJ1. Such genes are referred to herein as “ASD-associated” genes.
The term “an autism spectrum disorder” or “an ASD” is used herein to refer to at least one condition that results in developmental delay of an individual such as autism, Asperger's Disorder, Childhood Disintegrative Disorder, Pervasive Developmental Disorder-Not Otherwise Specified (PDD-NOS) and Rett Syndrome (APA DSM-IV 2000).
In the present method of determining ASD risk in an individual, a biological sample obtained from the individual is utilized. A suitable biological sample may include, for example, a nucleic acid-containing sample or a protein-containing sample. Examples of suitable biological samples include saliva, urine, semen, other bodily fluids or secretions, epithelial cells, cheek cells, hair and the like. Although such non-invasively obtained biological samples are preferred for use in the present method, one of skill in the art will appreciate that invasively-obtained biological samples, may also be used in the method, including for example, blood, serum, bone marrow, cerebrospinal fluid (CSF) and tissue biopsies such as tissue from the cerebellum, spinal cord, prostate, stomach, uterus, small intestine and mammary gland samples. Techniques for the invasive process of obtaining such samples are known to those of skill in the art. The present method may also be utilized in prenatal testing for the risk of ASD using an appropriate biological sample such as amniotic fluid and chorionic villus.
In one aspect, the biological sample is screened for nucleic acid encoding selected genes in order to detect mutations associated with an ASD. It may be necessary, or preferable, to extract the nucleic acid from the biological sample prior to screening the sample. Methods of nucleic acid extraction are well-known to those of skill in the art and include chemical extraction techniques utilizing phenol-chloroform (Sambrook et al., 1989), guanidine-containing solutions, or CTAB-containing buffers. As well, as a matter of convenience, commercial DNA extraction kits are also widely available from laboratory reagent supply companies, including for example, the QIAamp DNA Blood Minikit available from QIAGEN (Chatsworth, Calif.), or the Extract-N-Amp blood kit available from Sigma (St. Louis, Mo.).
Once an appropriate nucleic acid sample is obtained, it is subjected to well-established methods of screening, such as those described in the specific examples that follow, to detect genetic mutations indicative of ASD, i.e. ASD-linked mutations. Mutations, such as genomic copy number variations (CNVs), which include gains and deletions of segments of DNA, for example, segments of DNA greater than about 1 kb, such as DNA segments between about 300 and 500 kb, as well as base pair mutations such as nonsense, missense and splice site mutations, including sequence mutations in both coding and regulatory regions of a gene, have been found to be indicative of ASD.
ASD-linked mutations such as CNVs are not restricted to a single chromosome, but rather have been detected on a multiple chromosomes such as the X chromosome, chromosome 15 and chromosome 21, and on various regions of the same chromosome such as at Xp11 and Xp22. Examples of CNVs that have been determined to be linked to ASD include a deletion on chromosome Xp22 including at least a portion of exon 1 of the PTCHD1 gene; a duplication on chromosome 15q11; and a deletion within the SHANK3 gene.
Genomic sequence variations of various types in different genes have been identified as indicative of ASD. CNVs in the DPP10 gene, including intronic gains, such as a 105 kb intronic gain, and exonic losses, such as a 478 kb exonic loss, both of which are more specifically identified in Table 1, have been identified; CNVs in the DPP6 gene, such as a 66 kb loss encompassing exons 2 and 3 and gains such as a CNV encompassing the entire DPP6 gene, a 270 kb exonic gain (exon 1), and a 16 kb intronic gain (see Table 1); CNVs in the SHANK3 gene such as a 276 kb loss; and CNVs in the DYPD gene such as a loss of the entire gene.
In one embodiment, genomic sequence variations that inhibit the expression of PTCHD1 have been linked to ASD. The terminology “inhibit expression” refers broadly to sequence variations that may inhibit, or at least reduce, any one of transcription and/or translation, as well as the activity of the PTCHD1 protein. For example, a CNV in the PTCHD1 gene comprising a large deletion of the coding region which results in at least a reduction of the expression of PTCHD1 protein has been found to be indicative of ASD. Although the CNV is not particularly restricted, the CNV deletion may include, for example, at least a portion of exon 1, but may additionally include surrounding regions as well, such as intron 1, in whole or in part, or a portion or more of the upstream region thereof.
Genomic sequence variations other than CNVs have also been found to be indicative of ASD, including, for example, missense mutations which result in amino acid changes in a protein that may also affect protein expression. In one embodiment, missense mutations in the PTCHD1 gene have been identified which are indicative of ASD, including missense mutations resulting in the following amino acid substitutions in the Ptchd1 protein: L73F, I173V, V195I, ML336-337II and E479G.
To determine risk of ASD in an individual, it may be advantageous to screen for multiple genomic mutations, including CNVs and other mutations as indicated above applying array technology. In this regard, genomic sequencing and profiling, using well-established techniques as exemplified herein in the specific examples, may be conducted for an individual to be assessed with respect to ASD risk/diagnosis using a suitable biological sample obtained from the individual. Identification of one or more mutations associated with ASD would be indicative of a risk of ASD, or may be indicative of a diagnosis of ASD. This analysis may be conducted in combination with an evaluation of other characteristics of the individual being assessed, including for example, phenotypic characteristics.
In view of the determination of gene mutations which are linked to ASD, a method for determining risk of ASD in an individual is also provided in which the expression or activity of a product of an ASD-linked gene mutation is determined in a biological protein-containing sample obtained from the individual. Abnormal levels of the gene product or abnormal levels of the activity thereof, i.e. reduced or elevated levels, in comparison with levels that exist in healthy non-ASD individuals, are indicative of a risk of ASD, or may be indicative of ASD. Thus, a determination of the level and/or activity of the gene products of one or more of PTCHD1, SHANK3, NFIA, DPP6, DPP10, DYPD, GPR98, PQBP1, ZNF41 and FTSJ1, may be used to determine the risk of ASD in an individual, or to diagnose ASD. As one of skill in the art will appreciate, standard assays may be used to identify and quantify the presence and/or activity of a selected gene product.
Embodiments of the invention are described by reference to the following specific examples which is not to be construed as limiting.

Example 1

DNA Samples and Population Structure

The study included 426 ASD families. All of the index cases met Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) criteria or on a clinical best estimate (Risi et al. J Am Acad Child Adolesc Psychiatry 2006; 45 (9):1094-103). Thirty-two of these carried a cytogenetic chromosome rearrangement; 18 were detected by karyotyping 328 of 412 samples that originated from child diagnostic centres at the Hospital for Sick Children in Toronto and from St. John's, Newfoundland; 14 were already known to carry karyotypic anomalies (see Table 1 for information on these 32 patients). Affected and unaffected siblings were also assessed, and 56% (237/426) had one child (simplex) and 44% (189/426) had more than one child (multiplex) with ASD. Most cases were screened for fragile X mutations (75%) and if detected they were not included in the study. Most experiments were performed on blood genomic DNA (80%), otherwise the source was cell lines, e.g. lymphoblast cell lines. Population ancestry was estimated using STRUCTURE (Falush et al. Genetics 2003; 164 (4):1567-87; Pritchard et al. Genetics 2000; 155 (2):945-59).

	TABLE 1

	Cytogenetic Analysis

Sample

Phenotype/Family

Breakpoint

CNV Analysis

	ID	type	Karyotype	Location	RefSeq Genes	Chr	CNV	Size (bp)	Location

1	NA0008-	Simplex family	46, XX, t(2; 6)(q32; p22)	2q33.1:	SATB2	2p11.2	Loss	917,200	89,056,400-89,973,600
	000	ASD, developmental	unknown	200,096,682-200,154,790
	(50863L)	dyspraxia		6p22.3:	No known genes	6p21.33	Gain	54,600	30,134,300-30,188,900
				21,561,566-21,644,040		11p13	Gain	54,200	35,332,700-35,386,900
						13q21.33	Loss	28,200	69,642,500-69,670,700
						14q11.2	Gain	549,300	21,490,300-22,039,600
						14q32.33	Loss	64,000	106,152,000-106,216,000
2	NA0005-	Simplex family	46, XX, t(4; 5)(q21; q13)	4q21.3	Several	1p13.2	Gain	128,963	112,783,876-112,912,839
	000	ASD, seizure	unknown			2q37.3	Loss	602,914	242,127,468-242,730,382
	(53601L)	disorder, obesity,						Error!
		macrocephaly						Hyperlink
								reference
								not valid.
						3q29	Loss	43,033	196,922,636-196,965,669
				5q14.2-q14.3:	Several	5q15	Loss	48,627	97,076,449-97,125,076
				82,802,678-91,285,973		5q21.3	Loss	13,000	109,391,000-109,404,000
						8p23.1	Gain	448,146	12,039,387-12,487,533
						14q11.2	Gain	223,579	19,272,965-19,496,544
						14q11.2	Gain	650,430	21,407,981-22,058,411
						15q11.2	Gain	1,642,961	18,446,422-20,089,383
								Error!
								Hyperlink
								reference
								not valid.
3	NA0039-	Simplex family	46, XX, der(22)t(14; 22)(q32; q13) pat	See CNV	See CNV	9q32	Gain	498,000	114,038,000-114,536,000
	000	ASD, submucous	inherited			14q32.33	Gain	1,436,000	104,920,000-106,356,000
	(69736)	cleft, globally				15q13.3	Gain	502,500	29,796,300-30,298,800
		developmentally				22q13.31-q31.33	Loss	3,231,700	46,277,400-49,509,100
		delayed, large ears,
		short forehead,
		distally tapere
		fingers, severe pes
		planovalgus
4	SK0283-	Simplex family	47, XX, ring chromosome 1	See CNV	See CNV	1p22.3	Gain	23,993	87,417,351-87,441,344
	003	ASD	de novo			1q21.2-q21.3	Gain	1,451,926	148,095,537-149,547,463
	(72309)					3p26.1	Loss	44,458	5,365,506-5,409,964
						4p13	Gain	95,508	44,762,996-44,858,504
						4q33	Loss	82,224	171,715,627-171,797,851
						5q31.3	Loss	355,649	140,658,658-141,014,307
						6p12.3	Gain	13,950	46,962,122-46,976,072
						7p14.1	Loss	102,939	38,041,635-38,144,574
						7q34	Loss	169,191	141,813,948-141,983,139
						14q11.2	Loss	583,148	21,455,546-22,038,694
						15q11.2	Loss	1,632,769	18,427,103-20,059,872
						17q21.31	Loss	140,746	41,570,665-41,711,411
5	SK0044-	Simplex family	46, XY, t(1; 2)(p22.1; p23)pat	1p31.1:	NEGR1	7p14.1	Gain	85,900	39,828,000-39,913,900
	003	ASD	der(13; 15)(q10; q10)mat	72,065,578-72,163,007
	(50067)		inherited	2p24.3:	No known genes
				12,376,807-12,733,637
				13q10: in
				progress
				15q10: in
				progress
6	SK0182-	Simplex family	46 XY, t(1; 9)(q25; p13)	1q24.2:	No known genes	2p24.3	Gain	15,100	14,304,500-14,319,600
	003	ASD	inherited	167,452,268-167,522,136
	(52065)			9p12: 45,695,701-45,737,008	No known genes	14q11.2	Gain	288,100	19,204,300-19,492,400
7	SK0335-	Simplex Family	46, XX, t(2; 10)(q22; q22.3)	2q23.1:	LOC401431, ATP6VOE2	2p13.3	Gain	374,900	70,152,900-70,527,800
	003	ASD, mental	unknown	148,938,284-149,125,547
	(72815)	retardation		10q23.31:	SLC16A12, PANK1,	3q29	Gain	43,033	196,922,636-196,965,669
				91,265,490-91,461,660	MPHOSPH1	5p13.1	Loss	272,618	38,534,384-38,807,002
						6p21.32	Gain	162,900	32,344,099-32,506,999
						8p23.1	Gain	21,783	12,264,620-12,286,403
						9q32	Gain	22,000	114,153,000-114,175,000
						14q11.2	Gain	331,503	21,717,112-22,048,615
						15q11.2	Gain	1,516,085	18,427,100-19,943,185
						16p11.2-11.1	Gain	266,336	34,325,041-34,591,377
						17q21.31	Gain	201,731	41,518,102-41,719,833
						20p12.1	Loss	27,500	14,973,800-15,001,300
8	SK0126-	Multiplex family	46, XY, t(2; 11)(p11.2; q13.3) pat	2p11.2:	No known genes	2q34	Loss	3,000	213,013,000-213,016,000
	003	ASD	inherited	89,117,655-89,158,494
	(59144)			11q13.1:	POLA2, CDC42EP2, DPF2
				64,821,333-64,861,285
9	SK0152-	Multiplex family	46, XY, inv(3)(p24; q24),	3p24: not		3p25.1-p24.3	Loss	1,409,600	15,125,800-16,535,400
	003	ASD, oral motor	t(5; 7)(p15p13)	available
	(41548L)	apraxia, poor balance	de novo	3q24: not available		3p12.3	Gain	55,000	78,902,000-78,957,000
		and coordination,		5p14.3:	CDH18	5p15.31-p15.2	Loss	3,429,389	9,275,811-12,705,200
		mild hypotonia, walks		19,825,926-19,883,410
		with a wide gait,		7p13: 46,618,434-46,733,542	No known genes	6q16.1	Loss	60,058	95,556,287-95,616,345
		severe language				7p14.1	Gain	35,243	38,096,725-38,131,968
		delay, moderate				10q11.22	Gain	455,130	47,030,119-47,485,249
		intellectual disability,				12p11.21	Gain	63,728	31,904,362-31,968,090
		some facial features				12q12	Loss	422,842	40,584,198-41,007,040
		of Cri du Chat				14q11.2	Gain	491,397	21,584,229-22,075,626
						14q32.33	Gain	22,269	106,223,861-106,246,130
						15q11.2	Loss	1,632,718	18,446,422-20,079,140
						16q21	Loss	91,432	63,768,909-63,860,341
						17q21.31	Gain	219,797	41,500,036-41,719,833
						18q12.2	Loss	816,914	32,174,061-32,990,975
10	SK0105-	Multiplex family	46, XY, inv(4)(p12; p15.3)mat	4p15.3:	No known genes	10q11.21	Gain	1,098,400	41,956,500-43,054,900
	003	ASD, primarily non-	inherited	12,173,445-12,335,572
	(27155L)	verbal, profound
		developmental delay
				4p12: 44,876,353-46,024,486	GABRG1 (breakpoint region	13q14.2	Gain	162,300	47,414,800-47,577,100
					is located in intron 7)
						16q21	Loss	56,600	61,854,900-61,911,500
						17q21.31	Gain	238,600	41,521,600-41,760,200
11	SK0205-	Simplex family	46, XX, del(5)(p15.1)	See CNV	See CNV	3q29	Gain	96,068	199,226,000-199,322,068
	004	ASD	de novo			5p15.33-p15.2	Loss	13,800,984	81,949-13,882,933
	(56242)					5q15	Loss	70,891	97,054,185-97,125,076
						10q11.22	Gain	1,121,866	46,363,383-47,485,249
						10q21.3	Loss	29,732	67,747,770-67,777,502
						10q26.3	Gain	244,432	135,079,000-135,323,432
						14q11.2	Gain	217,035	19,272,965-19,490,000
						15q11.2	Gain	1,662,300	18,427,100-20,089,400
						17q21.31	Gain	65,845	41,006,823-41,072,668
						17q21.31	Gain	187,028	41,521,621-41,708,649
						22q11.21	Gain	150,753	17,265,500-17,416,253

12	SK0061-	Simplex family	46, XY, t(5; 7)(q15; q31.32)	7q31.31:	No known genes	No CNV detected
	003	ASD, developmental	unknown	118,928,065-119,006,076
	(44951)	delay		5q14.3:	No known genes
				88,849,193-88,891,151

13	SK0195-	Simplex family	46, XY, t(5; 8; 17)(q31.1; q24.1; q21.3)	5q31.1:	KLHL3	2p16.1	Gain	47,900	57,314,000-57,361,900
	003	ASD	de novo	136,979,583-137,038,092
	(55310)			8q24.22:	No known genes	10q23.1	Loss	17,500	83,772,000-83,789,500
				132,448,049-132,512,973
				17q21.31:	LRRC37A2, ARL17P1,	14q11.2	Gain	288,100	19,204,300-19,492,400
				41,893,216-42,093,636	LOC641522, NSF
						17q21.31	Gain	644,700	41,521,600-42,166,300
14	SK0133-	Simplex family	46, XY, t(6; 7)(p11.2; q22)pat	6p12.1:	DST, c6orf65	2q37.1	Gain	314,000	232,076,000-232,390,000
	003	ASD	inherited	56,805,919-56,967,398
	(46012)			7q22.1:	No known genes	5q14.3	Gain	633,400	89,492,800-90,126,200
				97,933,646-97,973,368
						7q33	Loss	3,000	136,255,000-136,258,000
						8q23.2	Loss	32,000	111,182,000-111,214,000
						9p21.3	Loss	8,200	25,073,900-25,082,100
						11q25	Gain	369,000	133,855,000-134,224,000
						12q21.33	Gain	19,700	90,807,700-90,827,400
						13q21.32	Loss	2,500	65,576,300-65,578,800
15	SK0043-	Multiplex family	46, XY, t(6; 9)(q10; q12)	6q11.2-q12:	No known genes	8p23.2	Loss	35,040	3,984,190-4,019,230
	003	ASD	unknown	63,464,452-63,511,410
	(29346)			9q21.11:	PIP5K1B	15q11.2	Gain	1,713,200	18,376,200-20,089,400
				68,599,032-68,682,365
16	SK0181-	Simplex family	46, XY, t(6; 14)(q13; q21)	6q12: 69,241,818-69,279,457	No known genes	3p14.1-p13	Loss	5,346,900	65,286,300-70,633,200
	004	ASD	de novo	14q21.1-q21.2:	LRFN5, c14orf155, c14orf28,	4q28.3	Loss	254,000	135,282,000-135,536,000
	(52191)			40,807,716-44,806,460	BTBD5, KIAA0423, PRPF39,
					FKBP3, AK093422,
					KIAA1596, FANCM, c14orf106
17	SK0083-	Simplex family	46, XY, del(7)(q31.1q31.32)	7q31.1:	IMMP2L, LRRN3, DOCK4,	1q31.1	Loss	15,000	186,702,000-186,717,000
	003	ASD,	de novo	108,272,363-108,337,904	ZNF277P, IFRD1 . . . to . . .	2P23.3	Gain	26,300	25,138,000-25,164,300
	(50800L)	craniosynostosis,		7q31.31:	ASZ1, CFTR, CTTNBP2,	4q35.2	Gain	21,314	188,232,000-188,253,314
		developmental verbal		119,007,999-119,335,246	LSM8, ANKRD7	6p24.2	Gain	188,500	11,479,600-11,668,100
		dyspraxia, motor				7q31.1-q31.31	Loss	11,023,506	108,200,381-119,223,887
		delay				7q36.2	Loss	26,297	152,027,450-152,053,747
						8q24.21	Gain	48,000	127,951,000-127,999,000
						10p11.23	Gain	26,700	30,893,400-30,920,100
						14q11.2	Loss	219,458	19,272,965-19,492,423
						17q21.31	Loss	117,521	40,897,617-41,015,138
18	SK0131-	Simplex family	46, XX, del(7)(q31.2q32.2)(D7S486-,	7q31.1:	FOXP2, MDFIC, TFEC, TES,	2p22.2	Gain	67,740	37,848,232-37,915,972
	003	Autistic features,	D7S522-) de novo, WBS inv-2	113,181,975-113,518,235	CAV2, CAV1 . . . to . . . IRF5,	3p21.31	Gain	52,599	147,754,068-147,806,667
	(39989)	speech-language	de novo		TNPO3, TSPAN33, SMO,
		disorder		7q32.2:	FAM40B, KIAA0828	4q31.21	Gain	120,171	145,146,000-145,266,171
		(developmental		128,540,690-128,796,716		7p14.1	Gain	147,076	38,096,725-38,243,801
		verbal dyspraxia),				7q31.1-q32.2	Loss	15,486,721	113,335,000-128,821,721
		dysmorphic features,				8q13.3	Gain	261,985	72,881,221-73,143,206
		mild developmental				10q11.22	Gain	455,100	47,030,100-47,485,200
		delay, unable to				10q26.2	Gain	91,077	128,501,014-128,592,091
		cough/sneeze/laugh				13q21.33	Loss	44,235	69,634,065-69,678,300
		spontaneously				14q11.2	Loss	222,786	19,272,965-19,495,751
						14q11.2	Gain	637,249	21,462,466-22,099,715
						15q11.2	Gain	1,662,280	18,427,103-20,089,383
						17q12	Gain	29,984	31,471,515-31,501,499
						22q11.22	Gain	810,876	20,772,047-21,582,923
19	SK0002-	Simplex family	46, XX, inv(7)(p15.3; q22.1)	7p21.1:	No known genes	4q28.3	Gain	765,000	132,195,000-132,960,000
	003	ASD, psychosis	unknown	18,284,397-18,302,387
	(50002)			7q22.3:	SPRK2	5p15.1-15.2	Gain	239,100	14,940,400-15,179,500
				104,360,659-104,549,945		15q11.2	Gain	1,713,200	18,376,200-20,089,400
20	SK0211-	Simplex family	46, XX, inv(7)(q22q34)mat	7q21.3:	No known genes	7q22.1	Gain	379,000	100,393,000-100,772,000
	003	ASD, mild elevation	inherited	96,943,657-96,985,663
	(58892)	of lactate		7q34: 140,920,721-140,958,207	TAS2R4, TAS2R5	9p21.1	Loss	135,100	30,408,400-30,543,500
21	SK0040-	Multiplex family	46, XY, t(7; 8)(p15; q22), t	7p15.3:	No known genes	2q37.3	Loss	95,959	242,634,423-242,730,382
	003	ASD, ADHD, severe	(10; 11)(q26; q23)	21,825,126-21,869,196
	(55449)	anxiety attacks,	unknown	8q22.2:	STK3	10q21.3	Loss	144,903	67,734,600-67,879,503
		seizures, difficulties		99,652,299-99,823,618		11q22.3	Loss	62,995	104,729,456-104,792,451
		with fine and gross		10q26:	Multiple genes	14q11.2	Gain	219,458	19,272,965-19,492,423
		motor skills		127,985,179-131,365,091
						14q11.2	Gain	224,329	21,784,072-22,008,401
				11q23:	Multiple genes	15q11.2	Gain	1,662,280	18,427,103-20,089,383
				109,979,883-111,597,476
						22q11.22	Loss	515,645	21,031,117-21,546,762
						22q11.23	Gain	269,129	23,975,202-24,244,331
22	SK0145-	Simplex family	46, XX, t(7; 11)(q31; q25)mat	7q31.2:	No known genes	1p36.11	Gain	192,600	26,231,500-26,424,100
	003	ASD	inherited	114,573,150-114,611,613		2p24.2	Gain	14,233	17,416,366-17,430,599
	(67955)			11q25:	No known genes	3p23	Gain	28,509	34,844,620-34,873,129
				133,882,647-134,001,155		5p15.33	Gain	3,029,476	165,712-3,195,188
						6p22.2	Gain	25,841	25,576,804-25,602,645
						7p14.1	Gain	20,412	37,494,999-37,515,411
						8q13.3	Gain	28,933	72,911,162-72,940,095
						10p12.1	Loss	98,961	27,642,965-27,741,926
						12p12.3	Gain	37,831	18,855,833-18,893,664
						14q11.2	Gain	464,929	21,551,291-22,016,220
						15q23-24.1	Gain	435,603	70,053,228-70,488,831
						19q13.43	Gain	308,600	63,476,500-63,785,100
23	SK0031-	Simplex family	46, XY, t(7; 13)(q31.3; q21) mat	7q31.2:	ST7	5p13.2	Loss	3,000	36,495,800-36,498,800
	003	ASD, very little	inherited	116,270,156-116,458,896		6p22.1-21.33	Gain	79,600	29,967,200-30,046,800
	(68160L)	language, global		13q21.1:	No known genes	9p23	Loss	112,800	11,895,600-12,008,400
		developmental delays		54,559,087-54,739,454		14q32.2	Gain	772,400	99,015,100-99,787,500
						15q11.2	Gain	1,378,000	18,711,400-20,089,400
						17q21.31	Gain	597,300	41,569,000-42,166,300
						22q11.23	Gain	251,200	23,989,000-24,240,200
24	SK0073-	Simplex family	47, XX, idic(15)q13)	15q13: 28,918,525-31,848,963	LOC400968, LOC283755,	1q25.2	Gain	424,000	176,522,000-176,946,000
	003	ASD, developmental	de novo		POTE15, OR4M2,	2p23.3	Gain	703,500	24,701,300-25,404,800
	(57283L)	delay, delayed			OR4N4 . . . to . . .	4p16.3	Gain	997,460	1,692,240-2,689,700
		expressive and			ARHGAP11A, c15orf45,	4q35.1	Gain	311,000	185,856,000-186,167,000
		receptive language			GREM1, RYR3	5q31.1	Gain	93,000	134,426,000-134,519,000
						9p21.1	Loss	362,900	30,452,800-30,815,700
						14q11.2	Gain	414,900	21,660,700-22,075,600
						15q11.2-13.3	Gain	11,922,600	18,376,200-30,298,800
						16p11.2	Gain	1,543,900	28,062,200-29,606,100
						16p11.2	Gain	658,600	30,589,900-31,248,500
25	SK0218-	Multiplex family	46, XX, del(18)(q21)	18q21.32:	See CNV	12p13.33	Loss	92,328	1,760,084-1,852,412
	003	ASD, cleft palate,	de novo	55,690,398-55,884,029
	(60340)	club feet, mild-facial
		hypoplasia, heart				15q11.2	Loss	1,613,450	18,446,422-20,059,872
		defect				17q21.31	Gain	190,234	41,518,415-41,708,649
						18q21.32-q23	Loss	20,358,999	55,756,601-76,115,600
						19q13.42	Loss	68,786	59,971,717-60,040,503
						20p11.23	Gain	128,457	19,740,012-19,868,469
26	SK0215-	Simplex family	46, XY, t(19; 21)(p13.2; q22.12)	19p13.2:	EVI5L, FLJ22184, LRRC8E,	1p21.3	Loss	1,092,500	97,271,600-98,364,100
	006	ASD	inherited	7,804,294-7,896,711	MAP2K7, SNAPC2, CTXN1
	(58449)			21q22.12:	No known genes	17p11.1-p11.2	Gain	503,100	21,634,900-22,138,000
				36,091,999-36,191,098
27	SK0136-	Simplex family	46, X, der(Y)t(Y; 15) (q12; p11.2) pat	Not available		4p13	Gain	42,400	44,809,500-44,851,900
	003	ASD	inherited			8p23.2	Gain	234,580	2,335,310-2,569,890
	(51253)					8q24.23	Loss	138,000	137,757,000-137,895,000
						10p12.1	Loss	51,400	27,690,500-27,741,900
						15q11.2	Loss	558,300	18,676,700-19,235,000
						15q26.3	Gain	388,100	99,827,900-100,216,000
28	SK0243-	Simplex Family	46, XY, del(15)(q23q24.2)	See CNV	See CNV	1q21.1	Loss	333,539	145,700,996-146,034,535
	003	ASD	de novo			2p22.2	Gain	52,951	37,847,789-37,900,740
	(67941)					3q27.3	Gain	91,422	187,897,578-187,989,000
						7p22.3	Gain	29,778	141,322-171,100
						7p14.1	Loss	32,636	38,092,579-38,125,215
						10p13	Loss	1,570	13,096,593-13,098,163
						11p15.1	Gain	21,766	18,905,796-18,927,562
						15q23-q24.2	Loss	4,289,500	69,601,300-73,890,800
						17q12	Gain	38,247	31,463,252-31,501,499
						17q21.31	Gain	83,359	41,636,474-41,719,833
29	SK0245-	Simplex Family	46, XY, trp(15)(q11.2q13)	See CNV	See CNV	6q14.1	Loss	47,288	79,036,117-79,083,405
	005	ASD, epicanthal	de novo			7p14.1	Loss	57,861	38,067,354-38,125,215
	(68517)	folds, drooping eyes				10p13	Loss	2,538	13,095,625-13,098,163
						11p15.1	Loss	12,459	18,905,796-18,918,255
						14q11.2	Loss	219,458	19,272,965-19,492,423
						14q32.33	Gain	27,408	106,223,861 106,251,269
						15q11.2-q13.3	Gain	11,871,747	18,427,100 30,298,847
						19p13.2	Loss	132,251	6,902,567 7,034,818
30	NA0097-	Simplex Family	46, XX, t(11; 12)(q23.3; p13.3)	11q23: not		2p25.3-2p15	Gain	63,451,406^b	2,994 63,454,400
	000	ASD	unknown	available		3p24.2	Loss	159,273	25,980,400-26,139,673
	(82361L)					12p11.21	Gain	236,006	31,065,545-31,301,551
				12p13.32-p13.31:	Multiple genes	14q11.2	Gain	489,269	21,498,204 21,987,473
				4,341,718-7,918,138		Xp22.33-Xp22.31	Loss	5,825,311	34,419-5,859,730
31	SK0300-	Multiplex Family	46, X, inv(Y)(p11.2q11.2)pat	Not available		4p16.1	Gain	35,832	7,801,488-7,837,320
	003	ASD, NF1	inherited			5p15.33	Gain	124,630	752,190-876,820
	(77447)					6p25.1	Loss	215,567	4,200,904-4,416,471
						8q24.23	Loss	198,193	137,757,137-137,955,330
						11p15.4	Loss	54,390	6,845,440-6,899,830
						14q11.2	Loss	229,676	19,272,965-19,502,641
						15q11.2	Loss	1,908,356	18,427,103-20,335,459
									Error!
									Hyperlink
									reference not
									valid.
						15q21.2	Gain	183,903	48,583,127-48,767,030
						Xp11.23	Loss	83,750	47,643,250-47,727,000
32	SK0094-	Multiplex Family	46, XX, ins(21; ?)(p11.2; ?)	Not available		7q21.2	Loss	509,800	90,919,200-91,429,000
	005	ASD	unknown
	(49304)					9q32	Gain	211,000	112,463,000-112,674,000
						10q11.22	Gain	124,800	47,030,100-47,154,900
						14q32.33	Gain	186,000	105,829,000-106,015,000
						Xq23	Loss	888,000	112,325,000-113,213,000

Cytogenetic Analysis

Sample

Phenotype/Family

Breakpoint

CNV Analysis

	ID	type	Karyotype	Location	RefSeq Genes	AS/Str^a	RefSeq Genes	Comments

1	NA0008-	Simplex family	46, XX, t(2; 6)(q32; p22)	2q33.1:	SATB2	No/NS	No known genes	NFLD
	000	ASD, developmental	unknown	200,096,682-200,154,790
	(50863L)	dyspraxia		6p22.3:	No known genes	Yes/NS	ZNRD1,
				21,561,566-21,644,040			PPP1R11,
							RNF39, TRIM31
						No/NS	SLC1A2
						No/NS	No known genes
						No/NS	No known genes
						No/NS	No known genes
2	NA0005-	Simplex family	46, XX, t(4; 5)(q21; q13)	4q21.3	Several	Yes/NS	ST7L, CAPZA1	NFLD
	000	ASD, seizure	unknown			No/S	10 genes
	(53601L)	disorder, obesity,
		macrocephaly				No/NS	MUC20, MUC4
				5q14.2-q14.3:	Several	No/NS	No known genes
				82,802,678-91,285,973		Yes/NS	No known genes
						No/S	FAM86B1,
							DEFB130,
							LOC440053
						No/S	6 OR genes
						No/S	No known genes
						No/NS	LOC283755,
							POTE15,
							OR4M2, OR4N4
3	NA0039-	Simplex family	46, XX, der(22)t(14; 22)(q32; q13) pat	See CNV	See CNV	No/NS	7 genes	NFLD
	000	ASD, submucous	inherited			No/NS	6 genes	Unaffected sibling
	(69736)	cleft, globally				No/NS	CHRNA7	with ADHD has
		developmentally				Yes/NS	40 genes +	46, XX, der(14)
		delayed, large ears,					SHANK3	t(14; 22)(q32; q13)
		short forehead,
		distally tapere
		fingers, severe pes
		planovalgus
4	SK0283-	Simplex family	47, XX, ring chromosome 1	See CNV	See CNV	Yes/NS	No known genes	SK
	003	ASD	de novo			Yes/S	36 genes
	(72309)					Yes/S	No known genes
						Yes/S	No known genes
						Yes/NS	No known genes
						Yes/NS	6 genes
						No/NS	GPR116
						No/NS	STARD3NL,
							TARP
						No/NS	PRSS1
						No/S	No known genes
						No/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
						No/NS	KIAA1267
5	SK0044-	Simplex family	46, XY, t(1; 2)(p22.1; p23)pat	1p31.1:	NEGR1	No/NS	CDC2L5	SK
	003	ASD	der(13; 15)(q10; q10)mat	72,065,578-72,163,007
	(50067)		inherited	2p24.3:	No known genes
				12,376,807-12,733,637
				13q10: in
				progress
				15q10: in
				progress
6	SK0182-	Simplex family	46 XY, t(1; 9)(q25; p13)	1q24.2:	No known genes	No/NS	No known genes	SK
	003	ASD	inherited	167,452,268-167,522,136				Younger brother
	(52065)			9p12: 45,695,701-45,737,008	No known genes	No/S	6 genes	has the same
								translocation and
								severe speech
								and language
								disorder but does
								not meet ASD
								criteria on ADOS.
7	SK0335-	Simplex Family	46, XX, t(2; 10)(q22; q22.3)	2q23.1:	LOC401431, ATP6VOE2	Yes/NS	6 genes	Others
	003	ASD, mental	unknown	148,938,284-149,125,547				Non-Canadian
	(72815)	retardation		10q23.31:	SLC16A12, PANK1,	No/NS	MUC20, MUC4	family
				91,265,490-91,461,660	MPHOSPH1	Yes/S	LIFR
						Yes/NS	C6orf10, BTNL2
						No/NS	No known genes
						No/S	ORM1, ORM2
						No/S	No known genes
						No/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
						No/NS	No known genes
						No/S	KIAA1267
						Yes/S	C20orf133
8	SK0126-	Multiplex family	46, XY, t(2; 11)(p11.2; q13.3) pat	2p11.2:	No known genes	Yes/NS	ERBB4	Other
	003	ASD	inherited	89,117,655-89,158,494				Canadian Family
	(59144)			11q13.1:	POLA2, CDC42EP2, DPF2
				64,821,333-64,861,285
9	SK0152-	Multiplex family	46, XY, inv(3)(p24; q24),	3p24: not		Yes/S	12 genes	Other
	003	ASD, oral motor	t(5; 7)(p15p13)	available				Canadian Family
	(41548L)	apraxia, poor balance	de novo	3q24: not available		Yes/S	ROBO1	Previously
		and coordination,		5p14.3:	CDH18	Yes/S	8 genes	described in a
		mild hypotonia, walks		19,825,926-19,883,410				manuscript by
		with a wide gait,		7p13: 46,618,434-46,733,542	No known genes	No/S	No known genes	Harvard et al¹.
		severe language				No/NS	No known genes	The 3p25.1,
		delay, moderate				No/S	ANXA8	5p15.31-p15.2
		intellectual disability,				No/S	No known genes	and 18q12.2
		some facial features				Yes/S	YAF2, ZCRB1	deletions were
		of Cri du Chat				No/S	No known genes	identified in
						No/NS	No known genes	Harvard, C. et al
						No/S	LOC283755,	using BAC CGH.
							POTE15,	The deletion size
							OR4M2, OR4N4	has been refined
						Yes/NS	No known genes	here using SNPs.
						No/NS	KIAA1267	Older sibling also
						Yes/S	KIAA1328,	has ASD but has
							C18orf10,	a normal 46, XX
							FHOD3	karyotype
								Maternal aunt with
								schizophrenia and
								a maternal uncle
								with Down
								syndrome
10	SK0105-	Multiplex family	46, XY, inv(4)(p12; p15.3)mat	4p15.3:	No known genes	Yes/NS	RET,	SK
	003	ASD, primarily non-	inherited	12,173,445-12,335,572			RASGEF1A,	Described
	(27155L)	verbal, profound					BMS1L, ZNF11B,	previously in
		developmental delay					MGC16291,	Vincent et al.²
							GALNACT-2	Affected brother,
				4p12: 44,876,353-46,024,486	GABRG1 (breakpoint region	Yes/NS	MED4, NUDT15,	apparently
					is located in intron 7)		SUCLA2	unaffected mother
						Yes/NS	No known genes	and unaffected
						No/NS	KIAA1267	maternal
								grandfather all
								have the same
								inversion. Distal
								4p15.3 breakpoint
								maps ~12 Mb to a
								region previously
								indicated to show
								linkage to autism.
11	SK0205-	Simplex family	46, XX, del(5)(p15.1)	See CNV	See CNV	No/NS	LMLN,	SK
	004	ASD	de novo				LOC348840	FISH analysis with
	(56242)					Yes/S	>50 genes	subtelomeric
						No/NS	No known genes	probe (containing
						No/S	SYT15, ANXA8,	D5S2488) was
							ANXA8L1,	consistent with a
							PPYR1, GPRIN2	terminal deletion
						No/NS	CTNNA3	on 5p.
						No/S	SYCE1; CYP2E1
						No/S	OR4K1, OR4N2,
							OR4K5, OR4K2
						No/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
						No/S	No known genes
						No/NS	KIAA1267
						No/S	DGCR6, PRODH,
							DGCR2

12	SK0061-	Simplex family	46, XY, t(5; 7)(q15; q31.32)	7q31.31:	No known genes	No CNV detected	Other
	003	ASD, developmental	unknown	118,928,065-119,006,076		Non-Canadian
	(44951)	delay		5q14.3:	No known genes		Family
				88,849,193-88,891,151

13	SK0195-	Simplex family	46, XY, t(5; 8; 17)(q31.1; q24.1; q21.3)	5q31.1:	KLHL3	No/NS	No known genes	Other
	003	ASD	de novo	136,979,583-137,038,092				Canadian Family
	(55310)			8q24.22:	No known genes	Yes/NS	NRG
				132,448,049-132,512,973
				17q21.31:	LRRC37A2, ARL17P1,	No/NS	OR4K1, OR4N2,
				41,893,216-42,093,636	LOC641522, NSF		OR4M1, OR4K5,
							OR4Q3, OR4K2
						No/S	KIAA1267
14	SK0133-	Simplex family	46, XY, t(6; 7)(p11.2; q22)pat	6p12.1:	DST, c6orf65	Yes/NS	MGC43122,	Other
	003	ASD	inherited	56,805,919-56,967,398			NMUR1,	Canadian Family
	(46012)						MGC35154, NCL,	CNV seen at
							B3GNT7	11q25 is in the
				7q22.1:	No known genes	Yes/NS	CETN3,	same breakpoint
				97,933,646-97,973,368			LOC153364,	region as Sample
							POLR3G,	SK0145-003
							MASS1
						No/NS	No known genes
						No/NS	No known genes
						Yes/NS	No known genes
						No/S	No known genes
						Yes/NS	No known genes
						Yes/NS	No known genes
15	SK0043-	Multiplex family	46, XY, t(6; 9)(q10; q12)	6q11.2-q12:	No known genes	No/NS	CSMD1	SK
	003	ASD	unknown	63,464,452-63,511,410				Sibling also has
	(29346)			9q21.11:	PIP5K1B	No/S	LOC283755,	ASD but a normal
				68,599,032-68,682,365			POTE15,	46, XY karyotype
							OR4M2, OR4N4
16	SK0181-	Simplex family	46, XY, t(6; 14)(q13; q21)	6q12: 69,241,818-69,279,457	No known genes	Yes/S	13 genes	SK
	004	ASD	de novo	14q21.1-q21.2:	LRFN5, c14orf155, c14orf28,	No/NS	No known genes
	(52191)			40,807,716-44,806,460	BTBD5, KIAA0423, PRPF39,
					FKBP3, AK093422,
					KIAA1596, FANCM, c14orf106
17	SK0083-	Simplex family	46, XY, del(7)(q31.1q31.32)	7q31.1:	IMMP2L, LRRN3, DOCK4,	No/S	No known genes	Other
	003	ASD,	de novo	108,272,363-108,337,904	ZNF277P, IFRD1 . . . to . . .	Yes/NS	No known genes	Canadian Family
	(50800L)	craniosynostosis,		7q31.31:	ASZ1, CFTR, CTTNBP2,	Yes/S	No known genes	Described
		developmental verbal		119,007,999-119,335,246	LSM8, ANKRD7	Yes/NS	No known genes	previously in Feuk
		dyspraxia, motor				Yes/S	>50 genes	et al.³
		delay				Yes/NS	No known genes
						Yes/NS	No known genes
						Yes/NS	No known genes
						No/S	OR4K1, OR4N2,
							OR4M1, OR4K5,
							OR4Q3, OR4K2
						No/NS	PLEKHM1
18	SK0131-	Simplex family	46, XX, del(7)(q31.2q32.2)(D7S486-,	7q31.1:	FOXP2, MDFIC, TFEC, TES,	No/NS	No known genes	Other
	003	Autistic features,	D7S522-) de novo, WBS inv-2	113,181,975-113,518,235	CAV2, CAV1 . . . to . . . IRF5,	Yes/NS	CCR5, CCRL2,	Canadian Family
	(39989)	speech-language	de novo		TNPO3, TSPAN33, SMO,		CCR2	Described
		disorder		7q32.2:	FAM40B, KIAA0828	No/S	GYPE	previously in Feuk
		(developmental		128,540,690-128,796,716		No/NS	AMPH	et al.³
		verbal dyspraxia),				Yes/S	>50 genes
		dysmorphic features,				Yes/NS	MSC, TRPA1
		mild developmental				No/NS	ANXAB
		delay, unable to				Yes/S	DOCK1
		cough/sneeze/laugh
		spontaneously
						No/NS	No known genes
						No/NS	OR4K1, OR4N2,
							OR4M1, OR4K5,
							OR4Q3, OR4K2
						No/S	No known genes
						No/NS	LOC283755,
							POTE15,
							OR4M2, OR4N4
						No/NS	No known genes
						No/NS	6 genes
19	SK0002-	Simplex family	46, XX, inv(7)(p15.3; q22.1)	7p21.1:	No known genes	No/S	No known genes	Other
	003	ASD, psychosis	unknown	18,284,397-18,302,387				Non Canadian-
	(50002)			7q22.3:	SPRK2	No/S	No known genes	Family
				104,360,659-104,549,945		Yes/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
20	SK0211-	Simplex family	46, XX, inv(7)(q22q34)mat	7q21.3:	No known genes	No/NS	10 genes	Other
	003	ASD, mild elevation	inherited	96,943,657-96,985,663				Non Canadian
	(58892)	of lactate		7q34: 140,920,721-140,958,207	TAS2R4, TAS2R5	No/NS	No known genes	Family
								Mother and
								unaffected twin
								sister have the
								same karyotype;
								7q34 breakpoint
								overlaps with a
								ASD translocation
								patient
21	SK0040-	Multiplex family	46, XY, t(7; 8)(p15; q22), t	7p15.3:	No known genes	No/S	No known genes	Other
	003	ASD, ADHD, severe	(10; 11)(q26; q23)	21,825,126-21,869,196				Non-Canadian
	(55449)	anxiety attacks,	unknown	8q22.2:	STK3	No/S	CTNNA3	Family
		seizures, difficulties		99,652,299-99,823,618		No/NS	No know genes	Unaffected sister
		with fine and gross		10q26:	Multiple genes	No/NS	OR4K2, OR4N2,	with normal
		motor skills		127,985,179-131,365,091			OR4K1, OR4K5	female karyotype,
						No/NS	No known genes	has difficulties in
				11q23:	Multiple genes	No/S	LOC283755,	some muscles,
				109,979,883-111,597,476			POTE15,	difficulties with
							OR4M2, OR4N4	fine and gross
						No/NS	PRAME, SUHW2,	motor skills,
							SUHW1, GGTL4	severe anxiety
						No/S	CTA, LRP5L	attacks, not able
								to relate to peers
								and is affected by
								noise
22	SK0145-	Simplex family	46, XX, t(7; 11)(q31; q25)mat	7q31.2:	No known genes	Yes/NS	8 genes	Other
	003	ASD	inherited	114,573,150-114,611,613		Yes/NS	No known genes	Canadian Family
	(67955)			11q25:	No known genes	Yes/NS	No known genes	Apparently
				133,882,647-134,001,155		Yes/NS	28 genes	unaffected mother
						Yes/NS	LRRC16	has the same
						No/NS	No known genes	7q31.2 and 11q25
						Yes/NS	MSC	breakpoints
						No/S	PTCHD3
						No/NS	No known genes
						No/NS	No known genes
						Yes/NS	9 genes
						Yes/NS	18 genes
23	SK0031-	Simplex family	46, XY, t(7; 13)(q31.3; q21) mat	7q31.2:	ST7	Yes/NS	No known genes	Other
	003	ASD, very little	inherited	116,270,156-116,458,896		No/NS	HLA-A	Non Canadian
	(68160L)	language, global		13q21.1:	No known genes	No/NS	No known genes	Family
		developmental delays		54,559,087-54,739,454		Yes/S	8 genes
						No/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
						No/NS	6 genes
						No/S	CTA-246H3.1,
							LRP5L
24	SK0073-	Simplex family	47, XX, idic(15)q13)	15q13: 28,918,525-31,848,963	LOC400968, LOC283755,	Yes/NS	6 genes	SK
	003	ASD, developmental	de novo		POTE15, OR4M2,	Yes/NS	7 genes	Described
	(57283L)	delay, delayed			OR4N4 . . . to . . .	Yes/NS	12 genes	previously in
		expressive and			ARHGAP11A, c15orf45,	Yes/NS	CASP3,	Kwasnicka-
		receptive language			GREM1, RYR3		CCDC111,	Crawford et al.⁴
							MLF1IP, ACSL1
						Yes/S	No known genes
						Yes/NS	No known genes
						No/NS	No known genes
						Yes/S	>50 genes
						No/NS	>20 genes
						No/NS	>20 genes
25	SK0218-	Multiplex family	46, XX, del(18)(q21)	18q21.32:	See CNV	Yes/S	CACNA2D4,	SK
	003	ASD, cleft palate,	de novo	55,690,398-55,884,029			ADIPOR2,	As noted in the
	(60340)	club feet, mild-facial					LRTM2	Autism
		hypoplasia, heart				No/S	LOC283755,	Chromosome
		defect					POTE15,	Rearrangment
							OR4M2, OR4N4	Database there
						No/NS	KIAA1267	are 5 addition
						Yes/S	>50 genes	reported cases of
						No/NS	KIR3DP1,	abnormalities
							KIR2DL1,	involving 18q;
							KIR3DL1,	Sibling has a
							KIR2DL4,	normal 46, XY
							KIR2DS4	karyotype also is
						Yes/NS	RIN2	affected with
								autism and has
								oromotor
								difficulties.
26	SK0215-	Simplex family	46, XY, t(19; 21)(p13.2; q22.12)	19p13.2:	EVI5L, FLJ22184, LRRC8E,	Yes/S	FLJ35409, DPYD	Other
	006	ASD	inherited	7,804,294-7,896,711	MAP2K7, SNAPC2, CTXN1			Canadian Family
	(58449)			21q22.12:	No known genes	Yes/NS	FAM27L	Patient has an
				36,091,999-36,191,098				unaffected sister
								with the same
								karyotype
27	SK0136-	Simplex family	46, X, der(Y)t(Y; 15) (q12; p11.2) pat	Not available		No/NS	No known genes	SK
	003	ASD	inherited			No/NS	No known genes
	(51253)					No/NS	No known genes
						No/NS	PTCHD3
						No/NS	LOC283755
						No/NS	PCSK6, TARSL2,
							TM2D3, OR4F6
28	SK0243-	Simplex Family	46, XY, del(15)(q23q24.2)	See CNV	See CNV	No/NS	No known genes	SK
	003	ASD	de novo			No/NS	No known genes
	(67941)					No/S	KNG1, EIF4A2
						No/NS	No known genes
						No/NS	No known genes
						No/NS	No known genes
						No/NS	MRGPRX1
						Yes/S	55 genes
						No/NS	No known genes
						No/NS	No known genes
29	SK0245-	Simplex Family	46, XY, trp(15)(q11.2q13)	See CNV	See CNV	No/NS	No known genes	SK
	005	ASD, epicanthal	de novo			No/NS	No known genes
	(68517)	folds, drooping eyes				No/NS	TARP
						No/NS	MRGPRX1
						No/S	6 genes
						No/NS	No known genes
						Yes/S	>50 genes
						No/S	EMR4,
							FLG25758,
							MBD3L2, ZF557
30	NA0097-	Simplex Family	46, XX, t(11; 12)(q23.3; p13.3)	11q23: not		Yes/S	>50 genes	NFLD
	000	ASD	unknown	available		No/NS	No known genes
	(82361L)					No/S	DDX11, OVOS2
				12p13.32-p13.31:	Multiple genes	No/NS	No known genes
				4,341,718-7,918,138		Yes/S	21 genes
31	SK0300-	Multiplex Family	46, X, inv(Y)(p11.2q11.2)pat	Not available		Yes/NS	SORCS2	SK
	003	ASD, NF1	inherited			No/S	ZDHHC11
	(77447)					Yes/S	No known genes
						No/S	No known genes
						Yes/S	OR10A2,
							OR10A4,
							OR2D2, OR2D3
						No/NS	6 genes
						No/S	LOC283755,
							POTE15,
							OR4M2, OR4N4
						Yes/S	TRPM7, USP50
						No/S	ZNF630, SSX6
32	SK0094-	Multiplex Family	46, XX, ins(21; ?)(p11.2; ?)	Not available		Yes/NS	MTERF, AKAP9,	SK
	005	ASD	unknown				CYP51A1,
	(49304)						LOC401387
						No/NS	KIAA1958,
							C9orf80
						No/NS	No known genes
						No/NS	No known genes
						Yes/NS	No known genes

Affymetrix GeneChip Human Mapping 500K Array Set

For each sample, approximately 500,000 SNPs were genotyped using the combined two-chip Nspl and Styl GeneChip® Human Mapping Commercial or Early Access Arrays (Affymetrix, Inc., Santa Clara, Calif.) according to the manufacturer's instructions and as described previously (Kennedy et al. 2003 Nat Biotechnol. 21:1233-7, the contents of which are incorporated herein by reference). Briefly, 250 ng of genomic DNA was digested with Nspl and Styl restriction enzyme (New England Biolabs, Boston, Mass.), ligated to an adaptor and amplified by PCR. The PCR products were then fragmented with DNaseI to a size range of 250 bp to 2,000 bp, labelled, and hybridized to the array. After hybridization, arrays were washed on the Affymetrix fluidics stations, stained, and scanned using the Gene Chip Scanner 3000 7G and Gene Chip Operating System. Data has been submitted to the Gene Expression Omnibus database (accession GSE9222). Karyotypes were generated using standard clinical diagnostic protocols.

Characterization of Copy Number Variation

Nspl and Styl array scans were analyzed for copy number variation using a combination of DNA Chip Analyzer (dChip) (Li and Wong 2001 Genome Biology 2: 0032.1-0032.11), Copy Number Analysis for GeneChip (CNAG) (Nannya 2005 Cancer Res. 65:6071-9) and Genotyping Microarray based CNV Analysis (GEMCA) (Komura 2006 Genome Res. 16:1575-84). Each of these references is incorporated herein by reference.
Analysis with dChip (www.dchip.org) was performed as previously described (Zhao et al 2005 Cancer Res. 65:5561-70) in batches of ˜100 probands. Briefly, array scans were normalized at the probe intensity level with an invariant set normalization method. After normalization, a signal value was calculated for each SNP using a model-based (PM/MM) method. In this approach, image artifacts were identified and eliminated by an outlier detection algorithm. For both sets of arrays, the resulting signal values were averaged across all samples for each SNP to obtain the mean signal of a diploid genome. From the raw copy numbers, the inferred copy number at each SNP was estimated using a Hidden Markov Model (HMM).
For analyses with CNAG version 2.0 (www.genome.umin.jp), the reference pool was set to include all samples and performed an automatic batch pair-wise analysis using sex-matched controls. Test samples were compared to all samples within the reference pool and matched based on signal intensity standard deviations. The scan intensities for each ‘test’ sample were compared to the average intensities of the reference samples (typically the average of 5-12 samples) and used to calculate raw copy number changes. Underlying copy number changes were then inferred using a Hidden Markov Model (HMM) built into CNAG.
GEMCA analysis was performed essentially as described (Komura et al. Genome Res 2006; 16 (12):1575-84) with the exception that two designated DNA samples (NA10851 and NA15510) were used as references for pair-wise comparison to all proband experiments. These results were further filtered by only including those CNVs that were common to both pair-wise experiments.
CNVs were merged if they were detected in the same individual by more than one algorithm using the outside probe boundaries.

Controls and Autism Chromosome Rearrangement Database (ACRD)

Control samples consisted of (i) CNVs observed in 500 Europeans from the from the German PopGen project (Krawczak et al. Community Genet 2006; 9 (1):55-61), and CNVs found in a cohort of 1000 Caucasian non-disease controls from the Ontario population (ref. 24). The ACRD that had 834 putative CNVs or breakpoints mapped to the genome was established. A CNV was considered ASD-specific if it was >10 kb, contained at least three probes and at least 20% of its total length was unique when compared to controls.

CNV Validation Experiments and Balance Rearrangement Breakpoint Mapping

PCR validation of CNV calls was performed using Quantitative Multiplex PCR of short fluorescent fragments (QMPSF) (Redon et al. Nature. 444:444-54) or SYBR-Green 1 based real-time quantitative PCR (qPCR) using controls at the ACCN1, CFTR or FOXP2 loci (PMID: 14552656). For both methods, primers were designed using the program PRIMER3 (http://frodo.wi.mit.edu/). Balanced rearrangements were mapped primarily using FISH (Nannya et al. Cancer Res 2005; 65 (14):6071-9). The microdel program (Komura et al., ibid) was used to score CNV losses.
For QMPSF, short genomic sequences (140-220 bp) within putative CNVs were PCR amplified using dye-labelled primers corresponding to unique sequences. Each reaction also included co-amplified control amplicons corresponding to either ACCN1 or CFTR located at 17q11.2 and 7q31.2, respectively. Briefly, 40 ng of genomic DNA was amplified by PCR in a final volume of 25 μl using AmpliTaq® DNA polymerase (manufactured for Applied Biosystems by Roche Molecular Systems, Inc.) After an initial step of denaturation at 95° C. for 5 minutes conditions were as follows: 25 PCR cycles of 94° C. for 30 seconds, annealing at 60° C. for 45 seconds, and extension at 72° C. for 30 seconds. A final extension step at 72° C. for 15 minutes followed. QMPSF amplicons were separated on an ABI 3730xl DNA Analyzer (Applied. Biosystems, Foster City, Calif.), and analyzed using ABI GeneMapper® software version 3.7 (Applied Biosystems). After adjustment of control amplicons to the same heights, the QMPSF pattern generated from test DNA was superimposed to that of the control DNA. For each putative CNV locus, the copy number ratio was determined by dividing the normalized peak height obtained from the test DNA by that of the control DNA. Peak ratios of >1.4 and <0.7 were indicative of copy number gains and losses, respectively. At least two independent QMPSF assays were required for CNV confirmation.
SYBR Green I-based real-time qPCR amplification was performed using a Mx3005P quantitative PCR system (Stratagene, La Jolla, USA). Non-fluorescent primers were designed to amplify short genomic fragments (<140 bp) in putative CNV loci. Each assay also included amplification of a control amplicon corresponding to FOXP2 at 7q31.1 for comparison. After optimization of primer sets with control genomic DNA using ‘Brilliant® SYBR® Green QPCR Master Mix’ (Stratagene), test samples were assayed in 15 μl reaction mixtures in 96-well plates containing: 7.5 μl of reaction mix, 1.8 μl of primer, 6.0 ng of genomic DNA at 1.2 ng/μl, 0.225 μl of reference dye with 1:500 dilution, and 0.475 μl of water. PCR conditions consisted of 10 minutes of polymerase activation at 95° C., followed by 40 cycles of: 95° C. for 15 seconds and a single step at 60° C. for 1 minute for annealing and elongation. These steps were then followed by a final cycle of 95° C. for 1 minute, 55° C. for 30 seconds, and 95° C. for 30 seconds. Standard curve quantification was analyzed by MxPro-Mx3005P software (version 3.20 Build 340) to calculate copy number changes. Coefficient of variation (CV) was calculated on all sample Ct values to remove possible outlier when CV was greater than 1%. The average quantity of the putative CNV locus was divided by the average quantity of the control amplicon on FOXP2. Ratios of >1.4 and <0.7 were indicative of copy number gains and losses, respectively. Each putative CNV locus had at least two independent assays.

Results

Structural Variation Characteristics in ASD Cases

A total of 426 ASD index cases were tested for CNV content including 394 typical idiopathic cases and 32 others that were enrolled based on prior knowledge of having a cytogenetic abnormality. The Affymetrix 500k SNP array was used because it provided the highest resolution screen available for both SNP genotype and CNV data. Using the SNPs, the ancestry of each sample was categorized (to guide selection of controls). Backgrounds of the samples were found to be: 90.3%, 4.5%, 4.5%, and 0.7%, European, European/mixed, Asian, or Yoruban, respectively.
To maximize CNV discovery, three calling algorithms were used as described above (see FIG. 1) and common results between them were merged to identify a ‘full’ dataset of 3389 independent CNVs (˜8 CNVs per genome, mean size 390 kb) (see Table 4 below). To minimize potential false positives, a second dataset was generated whereby a CNV needed to be detected by two or more algorithms and/or on both the NspI or StyI microarrays (Pinto et al. Hum Mol Genet 2007; 16 Spec No 2:R168-73).
This ‘stringent’ dataset contained 1312 CNVs (˜3 CNVs per genome, mean size 603 kb). Using q-PCR, 48% (12/26) and 96% (48/50) of random CNVs were validated in the full and stringent collections, respectively.

TABLE 4

Summary of CNV in ASD and Controls

	POPGEN
	CONTROLS	AUTISM PROBANDS

All CNVs

Autism Specific¹

	Full	Stringent²	Full	Stringent²	Full	Stringent²

#samples	500	500	426	426	426	426
#CNVs	3695	1558	3389	1312	888	276
CNV/Genome³	7.4	3.1	8.0	3.1	2.1	0.65
Mean/Median Size	315/151	470/224	390/162	603/219	518/121	1082/194
(kb)
% Gain/Loss	59/41%	70/30%	58/42%	62/38%	61/39%	57/43%
Overlapping	3005/333	1226/142	2728/277	980/94	397/122	30/13
CNV/Loci (%)⁴	(81%)	(78%)	(80%)	(74%)	(44%)	(11%)
>1Mb CNV (%)	343	250	339	212	63	32
	(9%)	(16%)	(10%)	(16%)	(7%)	(12%)

¹Not seen in controls.
²Stringent dataset as called by >1 algorithms or arrays. Analysis with dChip was performed in batches of ~100 probands. For CNAG version 2.0, the reference pool was set to include all samples and performed an automatic batch pairwise analysis using sex-matched controls. For GEMCA two designated DNA samples (NA10851 and NA15510) were used as references for pairwise comparison to all proband experiments. These results were further filtered by only including those CNVs that werecommon to both pairwise experiments. In all instances CNVs were merged if they were detected in the same individual by more than one algorithm using the outside probe boundaries.
³CNV/genome breakdown by algorithm: dChip Merged (3.0/genome), CNAG Merged (5.6/genome), GEMCA (5.5/genome). Validation experiments using q-PCR and FISH are described in the text. Another form of validation comes from examining the trios where we can demonstrate inheritance in 48 (maternal is 25, paternal is 23) of the autism-specific stringent dataset. Also from the trios, 148 confirmed regions (inheritance assignment) in the stringent dataset that overlap with controls (maternalis 65, paternal is 83).
⁴Represents the total number of overlapping and/or recurrent CNVs, the number of overlapping/CNV loci, and the percentage of overlapping CNVs, out of the total dataset.

Five hundred European control samples were examined for their CNV content and similar numbers of CNVs (3695 in the full and 1558 in the stringent dataset) were found to those in the ASD cases (Table 4). This suggested germ-line chromosome instability was not a significant contributing mechanism. The ASD CNVs were then compared against the 500 European/Caucasian controls and the Database of Genomic Variants (a repository of structural variation in ‘non-disease’ populations) (Iafrate et al. Nat Genet 2004; 36 (9):949-51) to establish autism-specific CNV datasets. The subsequent analysis then focused on the 276 CNVs in the stringent autism-specific category, which mapped across all 23 chromosomes (FIG. 2), details of which are found in Table 3, below. Additional ASD-relevant CNV data is also found in the other categories in Table 5 (discussed below).

TABLE 3

FAM ID (DNA)	Sex	Type	Chr	start	stop	size	CNV	CNV Category

SK0215-006 (58449)	M	CHR	1	97,271,600	98,364,100	1,092,500	loss	CNVs confirmed de novo
SK0152-003 (41548L)	M	CHR	3	15,125,800	16,535,400	1,409,600	loss	CNVs confirmed de novo
SK0181-003 (52191)	M	CHR	3	65,286,300	70,633,200	5,346,900	loss	CNVs confirmed de novo
SK0205-004 (56242)	F	CHR	5	81,949	13,882,933	13,800,984	loss	CNVs confirmed de novo
SK0152-003 (41548L)	M	CHR	5	9,275,811	12,705,200	3,429,389	loss	CNVs confirmed de novo
SK0083-003 (50800L)	M	CHR	7	108,200,381	119,223,887	11,023,507	loss	CNVs confirmed de novo
SK0131-003 (39989)	F	CHR	7	113,335,000	128,821,721	15,486,722	loss	CNVs confirmed de novo
SK0262-003 (68609)	M	SPX	8	710,491	1,501,580	791,089	gain	CNVs confirmed de novo
SK0152-003 (41548L)	M	CHR	12	40,584,198	41,007,040	422,842	loss	CNVs confirmed de novo
MM0278-003 (57788)	M	SPX	12	114,170,000	132,388,000	18,218,001	gain	CNVs confirmed de novo
SK0243-003 (67941)	M	CHR	15	69,601,300	73,890,800	4,289,500	loss	CNVs confirmed de novo
NA0067-000 (65344L)	M	SPX	16	87,800,593	88,066,260	265,668	loss	CNVs confirmed de novo
SK0218-003 (60340)	F	CHR	18	55,756,601	76,115,600	20,358,999	loss	CNVs confirmed de novo
MM0109-003 (46486)	F	SPX	20	60,949,339	62,377,000	1,427,662	gain	CNVs confirmed de novo
SK0244-003 (69183)	M	SPX	21	42,974,148	43,328,084	353,936	gain	CNVs confirmed de novo
NA0039-000 (69736)	F	CHR	22	46,277,400	49,509,100	3,231,700	loss	CNVs confirmed de novo
MM0109-003 (46486)	F	SPX	22	49,243,247	49,519,949	276,703	loss	CNVs confirmed de novo
NA0097-000 (82361L)	F	CHR	X	34,419	5,859,730	5,825,312	loss	CNVs confirmed de novo
SK0306-004 (78681)	F	SPX	X	48,073,600	52,716,966	4,643,367	gain	CNVs confirmed de novo
SK0147-003 (47544L)	F	SPX	2	114,855,796	115,334,166	478,371	loss	CNVs Recurrent/Overlapping
SK0167-003 (60966L)	F	MPX	2	114,855,796	115,334,166	478,371	gain	CNVs Recurrent/Overlapping
SK0288-003 (75420)	F	SPX-MZ	2	115,141,880	115,247,000	105,121	gain	CNVs Recurrent/Overlapping
NA0030-000 (55240)	M	SPX	2	186,674,000	186,786,323	112,324	loss	CNVs Recurrent/Overlapping
SK0306-004 (78681)	F	SPX	2	186,674,000	186,771,130	97,131	loss	CNVs Recurrent/Overlapping
MM0220-003 (61180L)	M	MPX	6	118,799,000	119,117,000	318,001	gain	CNVs Recurrent/Overlapping
NA0025-000 (60490)	M	SPX	6	118,823,011	119,117,000	293,990	gain	CNVs Recurrent/Overlapping
SK0190-003 (54742)	M	SPX	7	152,698,000	154,478,000	1,780,000	gain	CNVs Recurrent/Overlapping
SK0115-003 (40555)	M	SPX	7	153,098,000	153,372,000	274,001	gain	CNVs Recurrent/Overlapping
SK0058-003 (59963)	M	MPX	7	153,539,745	153,556,533	16,789	gain	CNVs Recurrent/Overlapping
SK0143-003 (36812)	M	SPX	8	53,481,200	53,766,400	285,201	gain	CNVs Recurrent/Overlapping
MM0236-004 (46475)	M	MPX	8	53,724,445	53,996,124	271,680	gain	CNVs Recurrent/Overlapping
SK0270-003 (71341)	M	SPX	9	7,725,280	7,764,180	38,900	loss	CNVs Recurrent/Overlapping
MM0103-003 (42387)	M	MPX	9	7,725,283	7,760,233	34,951	loss	CNVs Recurrent/Overlapping
MM0272-003 (45563)	M	MPX	11	40,285,800	40,548,738	262,939	loss	CNVs Recurrent/Overlapping
SK0167-003 (60966L)	F	MPX	11	40,417,554	40,610,400	192,847	loss	CNVs Recurrent/Overlapping
SK0023-003 (58096)	M	SPX	13	66,470,851	66,660,289	189,438	gain	CNVs Recurrent/Overlapping
MM0299-003 (51674)	F	MPX	13	66,487,899	66,660,300	172,402	gain	CNVs Recurrent/Overlapping
MM0109-003 (46486)	F	SPX	16	21,441,805	22,688,093	1,246,289	gain	CNVs Recurrent/Overlapping
MM0289-003 (42267)	F	MPX	16	21,808,808	22,611,363	802,556	loss	CNVs Recurrent/Overlapping
MM0088-003 (45562)	F	MPX	16	29,559,989	30,235,818	675,830	loss	CNVs Recurrent/Overlapping
NA0133-000 (78119L)	F	SPX	16	29,559,989	30,085,308	525,320	gain	CNVs Recurrent/Overlapping
SK0091-004 (46407)	F	MPX	22	17,265,500	21,546,762	4,281,262	gain	CNVs Recurrent/Overlapping
SK0323-003 (80022)	M	MPX	22	18,683,900	19,427,000	743,101	gain	CNVs Recurrent/Overlapping
SK0123-004 (60536L)	M	MPX	22	47,717,300	48,318,828	601,528	gain	CNVs Recurrent/Overlapping
MM0102-003 (47598)	M	MPX	22	48,152,289	48,232,669	80,380	loss	CNVs Recurrent/Overlapping
NA0002-000 (52026)	M	SPX	7	153,585,000	153,651,462	66,463	loss	CNVs Recurrent/Overlapping/
								CNVs confirmed de novo
SK0073-003 (57283L)	F	CHR	15	18,376,200	30,298,800	11,922,600	gain	CNVs Recurrent/Overlapping/
								CNVs confirmed de novo
SK0245-005 (68517)	M	CHR	15	18,427,100	30,298,847	11,871,747	gain	CNVs Recurrent/Overlapping/
								CNVs confirmed de novo
SK0119-003 (35190)	M	MPX	22	17,014,900	19,786,200	2,771,300	loss	CNVs Recurrent/Overlapping/
								CNVs confirmed de novo
SK0297-003 (76066)	M	SPX-MZ	22	17,265,500	21,546,762	4,281,263	gain	CNVs Recurrent/Overlapping/
								CNVs confirmed de novo
MM0109-003 (46486)	F	SPX	17	40,555,289	41,089,766	534,478	loss	CNVs that are Singletons
MM0240-003 (43743)	F	MPX	17	40,555,289	41,128,323	573,035	loss	CNVs that are Singletons
NA0074-000 (63358)	M	SPX	1	41,463,611	41,924,314	460,704	gain	CNVs that are Singletons
SK0036-003 (29186)	F	SPX	1	57,936,233	58,514,629	578,396	gain	CNVs that are Singletons
MM0236-004 (46475)	M	MPX	1	60,369,200	61,426,300	1,057,101	gain	CNVs that are Singletons
MM0020-004 (47838)	M	MPX	1	65,649,086	65,713,423	64,338	gain	CNVs that are Singletons
NA0076-000 (63624)	M	SPX	1	91,930,266	92,330,344	400,078	gain	CNVs that are Singletons
SK0174-003 (64379L)	M	SPX	1	108,046,000	108,246,283	200,284	loss	CNVs that are Singletons
SK0283-003 (72309)	F	CHR	1	148,095,537	149,547,463	1,451,926	gain	CNVs that are Singletons
MM0011-003 (60566L)	M	MPX	1	165,908,677	166,028,402	119,726	loss	CNVs that are Singletons
SK0132-003 (30661)	M	MPX	1	186,673,899	186,716,570	42,672	loss	CNVs that are Singletons
NA0109-000 (72873)	M	SPX	1	212,037,558	212,471,000	433,443	loss	CNVs that are Singletons
SK0183-004 (52217)	M	SPX	1	238,633,145	239,606,926	973,781	loss	CNVs that are Singletons
MM0219-003 (46823)	M	MPX	2	34,155,700	34,253,221	97,522	loss	CNVs that are Singletons
MM0295-003 (46488)	M	MPX	2	34,662,196	34,780,515	118,320	loss	CNVs that are Singletons
NA0083-000 (66104L)	M	SPX	2	34,858,330	34,937,455	79,125	loss	CNVs that are Singletons
SK0270-003 (71341)	M	SPX	2	39,992,374	40,053,300	60,926	loss	CNVs that are Singletons
NA0055-000 (59448)	M	SPX	2	41,958,200	42,088,448	130,249	loss	CNVs that are Singletons
SK0301-003 (77203)	M	MPX	2	52,856,046	52,969,575	113,530	loss	CNVs that are Singletons
NA0027-000 (60421L)	M	MPX	2	121,623,000	121,684,915	61,915	loss	CNVs that are Singletons
NA0057-000 (59537)	M	SPX	2	125,496,832	125,890,571	393,740	loss	CNVs that are Singletons
MM0176-003 (62118L)	M	MPX	2	135,358,000	135,471,070	113,071	loss	CNVs that are Singletons
SK0225-003 (60921)	M	SPX	2	155,849,451	155,988,560	139,109	loss	CNVs that are Singletons
SK0192-003 (54877)	M	SPX	2	181,771,621	181,944,065	172,445	loss	CNVs that are Singletons
NA0007-000 (50611)	M	SPX	2	195,170,000	195,217,247	47,248	gain	CNVs that are Singletons
SK0283-003 (72309)	F	CHR	3	5,365,506	5,409,964	44,458	loss	CNVs that are Singletons
MM0210-004 (47376)	M	MPX	3	7,957,390	8,250,541	293,151	gain	CNVs that are Singletons
NA0044-000 (57097)	M	SPX	3	35,613,300	35,928,200	314,901	gain	CNVs that are Singletons
SK0021-008 (51504)	M	MPX	3	36,110,965	36,215,909	104,945	loss	CNVs that are Singletons
MM0154-003 (56678L)	F	MPX	3	50,089,500	50,199,200	109,701	gain	CNVs that are Singletons
SK0152-003 (41548L)	M	CHR	3	78,902,000	78,957,000	55,000	gain	CNVs that are Singletons
NA0044-000 (57097)	M	SPX	3	82,866,400	84,544,763	1,678,364	gain	CNVs that are Singletons
SK0023-003 (58096)	M	SPX	3	99,400,957	99,484,400	83,443	gain	CNVs that are Singletons
NA0018-000 (72622)	M	SPX	3	117,838,700	117,937,000	98,301	gain	CNVs that are Singletons
NA0003-000 (48474)	M	SPX	3	124,386,373	124,456,000	69,628	gain	CNVs that are Singletons
NA0090-000 (65410)	M	SPX	3	183,837,706	183,940,069	102,364	gain	CNVs that are Singletons
NA0044-000 (57097)	M	SPX	4	55,718,164	55,811,710	93,547	loss	CNVs that are Singletons
NA0016-000 (51524L)	F	SPX	4	114,333,509	114,416,051	82,542	loss	CNVs that are Singletons
SK0012-003 (58468L)	M	SPX	4	152,993,000	153,381,007	388,008	gain	CNVs that are Singletons
SK0103-005 (42258)	M	SPX	4	157,615,000	157,683,000	68,000	gain	CNVs that are Singletons
NA0037-000 (69812)	M	SPX	4	179,692,000	179,865,679	173,680	gain	CNVs that are Singletons
MM0299-003 (51674)	F	MPX	4	181,968,784	182,095,665	126,882	loss	CNVs that are Singletons
SK0266-003 (68257)	M	SPX	4	183,466,000	183,517,000	51,000	loss	CNVs that are Singletons
SK0002-003 (50002)	F	CHR	5	14,940,400	15,179,500	239,100	gain	CNVs that are Singletons
NA0078-000 (63727)	M	MPX	5	25,125,371	25,450,672	325,302	gain	CNVs that are Singletons
NA0076-000 (63624)	M	SPX	5	37,409,881	37,778,834	368,953	gain	CNVs that are Singletons
SK0335-003 (72815)	F	CHR	5	38,534,384	38,807,002	272,619	loss	CNVs that are Singletons
MM0143-004 (47386)	M	MPX	5	110,440,484	110,471,180	30,697	gain	CNVs that are Singletons
NA0023-000 (60504L)	F	SPX	5	113,104,916	113,178,000	73,084	loss	CNVs that are Singletons
SK0118-003 (52027)	M	SPX	5	122,834,399	123,029,036	194,638	loss	CNVs that are Singletons
SK0077-003 (48226)	M	SPX	5	128,968,799	129,433,000	464,201	gain	CNVs that are Singletons
SK0300-003 (77447)	M	CHR	6	4,200,904	4,416,471	215,568	loss	CNVs that are Singletons
MM0212-004 (62223L)	F	MPX	6	17,505,095	17,703,208	198,114	gain	CNVs that are Singletons
MM0300-003 (47836)	F	MPX	6	27,827,354	28,119,631	292,278	gain	CNVs that are Singletons
MM0225-004 (60826)	M	MPX	6	69,929,900	70,278,043	348,144	gain	CNVs that are Singletons
SK0217-003 (59279)	M	SPX	6	112,679,982	112,776,094	96,112	gain	CNVs that are Singletons
SK0326-003 (81155)	M	SPX	6	137,930,847	138,011,644	80,798	gain	CNVs that are Singletons
MM0088-003 (45562)	F	MPX	7	2,922,139	2,964,895	42,757	loss	CNVs that are Singletons
NA0147-000 (77123L)	M	SPX	7	3,946,854	4,002,686	55,833	loss	CNVs that are Singletons
SK0049-004 (59987L)	M	MPX	7	11,526,500	11,560,300	33,800	gain	CNVs that are Singletons
SK0132-003 (30661)	M	MPX	7	20,242,925	20,345,800	102,876	gain	CNVs that are Singletons
NA0145-000 (82058L)	M	SPX	7	47,742,927	48,775,200	1,032,274	loss	CNVs that are Singletons
SK0119-003 (35190)	M	MPX	8	17,706,313	17,738,524	32,211	loss	CNVs that are Singletons
SK0262-003 (68609)	M	SPX	8	18,623,000	19,442,500	819,500	gain	CNVs that are Singletons
SK0077-003 (48226)	M	SPX	8	42,971,601	43,820,300	848,699	gain	CNVs that are Singletons
SK0294-003 (76222)	M	SPX	8	73,762,894	73,798,241	35,348	gain	CNVs that are Singletons
SK0076-003 (38712)	F	SPX	8	83,989,256	84,141,278	152,022	gain	CNVs that are Singletons
MM0241-004 (45547)	M	MPX	8	87,230,811	87,498,988	268,178	gain	CNVs that are Singletons
MM0210-004 (47376)	M	MPX	8	104,166,572	104,947,190	780,618	gain	CNVs that are Singletons
SK0194-003 (55078)	M	SPX	8	123,539,127	123,644,422	105,296	loss	CNVs that are Singletons
SK0292-003 (75896)	F	MPX	8	130,467,000	130,529,193	62,194	loss	CNVs that are Singletons
MM0007-003 (59978)	M	MPX	9	5,099,530	5,235,490	135,961	gain	CNVs that are Singletons
MM0711-003 (63583L)	M	MPX	9	16,092,066	16,379,100	287,035	gain	CNVs that are Singletons
SK0015-003 (49932)	M	MPX	9	19,284,100	19,511,500	227,400	gain	CNVs that are Singletons
SK0015-003 (49932)	M	MPX	9	19,702,200	24,674,100	4,971,900	loss	CNVs that are Singletons
SK0278-003 (74431)	M	SPX	9	22,626,541	22,747,714	121,174	loss	CNVs that are Singletons
SK0148-005 (41350)	F	SPX	9	24,607,036	24,682,114	75,078	loss	CNVs that are Singletons
MM0020-004 (47838)	M	MPX	9	25,439,100	25,535,000	95,901	loss	CNVs that are Singletons
NA0105-000 (72085)	M	SPX	9	33,054,336	33,294,800	240,465	gain	CNVs that are Singletons
NA0147-000 (77123L)	M	SPX	9	84,957,060	85,054,672	97,613	loss	CNVs that are Singletons
SK0045-003 (58937)	M	MPX	9	109,446,000	109,837,000	391,000	gain	CNVs that are Singletons
MM0117-003 (59983)	M	MPX	10	2,313,505	2,407,102	93,598	loss	CNVs that are Singletons
MM0225-004 (60826)	M	MPX	10	4,976,040	5,124,511	148,472	gain	CNVs that are Singletons
MM1086-004 (76285)	M	MPX	10	31,256,118	31,604,509	348,392	loss	CNVs that are Singletons
MM0068-003 (60836)	M	MPX	10	68,139,200	68,246,027	106,828	loss	CNVs that are Singletons
NA0037-000 (69812)	M	SPX	10	104,641,000	104,786,777	145,778	loss	CNVs that are Singletons
SK0300-003 (77447)	M	CHR	11	6,845,440	6,899,830	54,391	loss	CNVs that are Singletons
SK0322-003 (79950)	M	SPX	11	33,159,190	33,462,070	302,881	gain	CNVs that are Singletons
MM0305-003 (47607)	M	MPX	11	68,053,777	68,204,900	151,123	gain	CNVs that are Singletons
NA0032-000 (55186)	M	SPX	11	76,114,600	76,140,500	25,900	gain	CNVs that are Singletons
MM0212-004 (62223L)	F	MPX	11	99,148,202	99,289,243	141,042	loss	CNVs that are Singletons
SK0167-003 (60966L)	F	MPX	11	101,131,785	101,246,901	115,117	loss	CNVs that are Singletons
MM0112-005 (46736)	M	MPX	11	116,789,980	116,855,347	65,368	gain	CNVs that are Singletons
MM0240-003 (43743)	F	MPX	11	117,452,000	117,539,000	87,001	gain	CNVs that are Singletons
SK0255-003 (68785)	M	SPX	11	124,303,460	124,719,976	416,517	gain	CNVs that are Singletons
NA0065-000 (62798L)	M	SPX	11	125,639,908	126,102,027	462,120	gain	CNVs that are Singletons
NA0172-000 (80993L)	M	SPX	12	3,727,911	3,879,230	151,320	loss	CNVs that are Singletons
SK0059-003 (29224)	M	SPX	12	10,431,082	10,445,300	14,218	gain	CNVs that are Singletons
SK0326-003 (81155)	M	SPX	12	46,170,200	46,365,774	195,575	gain	CNVs that are Singletons
SK0110-003 (24626)	M	SPX	12	50,520,400	50,573,516	53,116	gain	CNVs that are Singletons
NA0071-000 (64719L)	F	SPX	12	57,408,270	58,532,356	1,124,087	gain	CNVs that are Singletons
SK0305-003 (78621)	F	SPX	12	77,239,265	77,364,400	125,136	loss	CNVs that are Singletons
SK0301-003 (77203)	M	MPX	12	83,388,935	83,428,800	39,866	gain	CNVs that are Singletons
NA0093-000 (66999)	M	SPX	12	96,496,784	96,568,500	71,716	loss	CNVs that are Singletons
MM0711-003 (63583L)	M	MPX	12	96,576,486	96,639,686	63,201	loss	CNVs that are Singletons
SK0292-003 (75896)	F	MPX	12	101,568,000	101,586,000	18,001	gain	CNVs that are Singletons
NA0109-000 (72873)	M	SPX	12	110,646,607	110,800,000	153,394	gain	CNVs that are Singletons
MM0210-004 (47376)	M	MPX	12	125,446,000	125,757,000	311,000	gain	CNVs that are Singletons
SK0079-003 (48388)	M	MPX	13	17,960,300	18,492,994	532,694	gain	CNVs that are Singletons
NA0028-000 (58891L)	M	SPX	13	62,915,912	62,977,748	61,837	loss	CNVs that are Singletons
SK0326-003 (81155)	M	SPX	13	89,726,966	90,134,219	407,254	gain	CNVs that are Singletons
NA0048-000 (58569)	M	SPX	13	93,288,520	93,344,600	56,081	gain	CNVs that are Singletons
SK0326-003 (81155)	M	SPX	13	93,497,400	93,732,931	235,532	gain	CNVs that are Singletons
SK0254-003 (68687)	M	SPX	13	105,172,000	105,357,000	185,000	gain	CNVs that are Singletons
SK0121-003 (41288)	M	SPX	14	76,007,842	76,924,400	916,558	gain	CNVs that are Singletons
SK0031-003 (68160L)	M	CHR	14	99,015,100	99,787,500	772,400	gain	CNVs that are Singletons
SK0300-003 (77447)	M	CHR	15	48,583,127	48,767,030	183,904	gain	CNVs that are Singletons
SK0326-003 (81155)	M	SPX	15	97,406,000	97,961,522	555,523	gain	CNVs that are Singletons
SK0281-003 (72934)	M	SPX	16	57,542,779	57,579,900	37,122	loss	CNVs that are Singletons
MM0310-005 (60951)	M	MPX	16	80,972,252	80,983,135	10,884	loss	CNVs that are Singletons
SK0203-004 (56040)	M	MPX	16	82,603,600	82,687,900	84,300	gain	CNVs that are Singletons
SK0085-004 (30422)	M	MPX	17	3,836,592	3,998,867	162,276	gain	CNVs that are Singletons
SK0298-003 (77697)	M	SPX	17	76,914,079	77,771,141	857,063	gain	CNVs that are Singletons
SK0328-003 (82302)	M	SPX	18	13,794,043	14,743,900	949,858	gain	CNVs that are Singletons
SK0303-003 (78391)	F	MPX	18	28,383,551	28,448,100	64,550	loss	CNVs that are Singletons
SK0014-003 (41606)	M	SPX	18	52,531,252	53,165,421	634,169	gain	CNVs that are Singletons
SK0121-003 (41288)	M	SPX	19	33,693,363	33,762,805	69,442	loss	CNVs that are Singletons
NA0111-000 (73891)	M	SPX	19	57,836,600	58,246,200	409,601	gain	CNVs that are Singletons
NA0004-000 (47490)	M	SPX	19	58,634,965	58,958,584	323,620	gain	CNVs that are Singletons
NA0070-000 (64249L)	F	SPX	19	60,499,398	60,742,656	243,259	loss	CNVs that are Singletons
SK0047-003 (47173L)	F	SPX	19	61,910,800	62,644,900	734,100	loss	CNVs that are Singletons
NA0110-000 (72165)	M	SPX	19	63,050,356	63,193,800	143,445	loss	CNVs that are Singletons
SK0232-003 (59838)	M	MPX	19	63,483,000	63,771,100	288,100	gain	CNVs that are Singletons
MM0018-003 (59980)	M	MPX	20	11,319,093	11,424,900	105,808	loss	CNVs that are Singletons
SK0335-003 (72815)	F	CHR	20	14,955,730	15,011,214	55,485	loss	CNVs that are Singletons
SK0258-004 (67930)	M	SPX	20	45,468,000	45,673,300	205,300	gain	CNVs that are Singletons
MM0126-003 (54581)	M	MPX	21	22,839,570	22,938,377	98,808	loss	CNVs that are Singletons
SK0118-003 (52027)	M	SPX	21	28,060,406	28,250,400	189,995	loss	CNVs that are Singletons
SK0186-004 (52964)	M	SPX	X	22,962,800	23,119,000	156,200	loss	CNVs that are Singletons
MM0087-003 (59962L)	M	MPX	X	25,516,263	25,620,400	104,138	loss	CNVs that are Singletons
NA0100-000 (70601L)	M	SPX	X	44,395,900	45,060,800	664,901	gain	CNVs that are Singletons
SK0087-003 (60692L)	F	MPX	X	83,866,300	92,175,100	8,308,800	loss	CNVs that are Singletons
MM0020-004 (47838)	M	MPX	X	87,452,050	87,595,200	143,151	gain	CNVs that are Singletons
SK0228-003 (62083)	M	SPX	X	104,153,000	104,638,000	485,000	gain	CNVs that are Singletons
SK0088-003 (64798)	M	SPX	X	114,042,922	114,215,435	172,513	gain	CNVs that are Singletons
MM0087-003 (59962L)	M	MPX	X	130,406,000	130,695,499	289,500	gain	CNVs that are Singletons
NA0016-000 (51524L)	F	SPX	X	140,600,370	140,907,495	307,125	gain	CNVs that are Singletons
SK0234-003 (64340)	M	MPX	X	142,561,000	142,682,000	121,000	loss	CNVs that are Singletons
SK0320-003 (79449)	M	MPX	X	143,059,574	143,399,300	339,727	gain	CNVs that are Singletons
SK0123-004 (60536L)	M	MPX	X	147,974,000	148,479,449	505,449	gain	CNVs that are Singletons
SK0278-003 (74431)	M	SPX	1	188,543,244	188,935,335	392,092	gain	CNVs that overlap the ACRD
MM0149-003 (42382)	M	MPX	1	191,030,551	191,223,110	192,560	gain	CNVs that overlap the ACRD
SK0229-003 (62211)	M	SPX	1	242,451,000	243,113,489	662,489	gain	CNVs that overlap the ACRD
NA0016-000 (51524L)	F	SPX	1	243,172,012	243,301,056	129,044	gain	CNVs that overlap the ACRD
MM0063-003 (46687)	F	MPX	2	50,780,202	50,859,200	78,999	loss	CNVs that overlap the ACRD
SK0234-003 (64340)	M	MPX	2	54,171,783	54,345,700	173,917	gain	CNVs that overlap the ACRD
SK0188-003 (53664)	M	SPX	2	112,415,581	112,510,212	94,632	loss	CNVs that overlap the ACRD
MM0019-003 (42052)	M	MPX	2	201,286,000	201,317,066	31,067	loss	CNVs that overlap the ACRD
MM0296-003 (47829)	M	MPX	2	221,429,610	221,551,000	121,391	loss	CNVs that overlap the ACRD
NA0004-000 (47490)	M	SPX	2	235,797,267	236,239,000	441,734	gain	CNVs that overlap the ACRD
MM0068-003 (60836)	M	MPX	3	1,720,948	1,795,234	74,287	gain	CNVs that overlap the ACRD
NA0067-000 (65344L)	M	SPX	3	61,075,295	61,581,100	505,806	gain	CNVs that overlap the ACRD
MM0296-003 (47829)	M	MPX	4	328,851	542,862	214,012	gain	CNVs that overlap the ACRD
MM0228-004 (47602)	M	MPX	4	11,820,924	11,983,053	162,130	loss	CNVs that overlap the ACRD
NA0129-000 (77405)	M	SPX	4	38,109,899	38,349,444	239,546	gain	CNVs that overlap the ACRD
SK0188-003 (53664)	M	SPX	4	61,408,094	61,758,800	350,707	loss	CNVs that overlap the ACRD
SK0057-003 (40919)	M	SPX	4	74,105,700	74,464,300	358,600	gain	CNVs that overlap the ACRD
MM0176-003 (62118L)	M	MPX	4	91,220,121	91,309,602	89,482	loss	CNVs that overlap the ACRD
SK0012-003 (58468L)	M	SPX	4	162,387,402	163,362,655	975,254	gain	CNVs that overlap the ACRD
SK0012-003 (58468L)	M	SPX	4	173,324,616	174,954,056	1,629,441	gain	CNVs that overlap the ACRD
SK0166-003 (36773)	M	SPX	4	186,788,000	187,118,000	330,001	gain	CNVs that overlap the ACRD
SK0074-003 (60910L)	M	MPX	4	188,230,567	190,154,000	1,923,434	gain	CNVs that overlap the ACRD
SK0083-003 (50800L)	M	CHR	4	188,232,000	188,253,314	21,315	gain	CNVs that overlap the ACRD
MM0019-003 (42052)	M	MPX	4	190,172,765	191,306,043	1,133,279	gain	CNVs that overlap the ACRD
SK0188-003 (53664)	M	SPX	5	13,832,700	14,237,600	404,901	gain	CNVs that overlap the ACRD
NA0078-000 (63727)	M	MPX	5	79,336,190	79,613,516	277,327	loss	CNVs that overlap the ACRD
NA0145-000 (82058L)	M	SPX	5	89,445,869	90,172,900	727,032	gain	CNVs that overlap the ACRD
SK0167-003 (60966L)	F	MPX	5	120,343,925	120,474,000	130,076	gain	CNVs that overlap the ACRD
NA0019-000 (64122L)	M	SPX	5	120,964,000	121,095,213	131,214	gain	CNVs that overlap the ACRD
MM0215-004 (47095)	M	MPX	5	132,619,430	132,732,003	112,574	loss	CNVs that overlap the ACRD
SK0073-003 (57283L)	F	CHR	5	134,426,000	134,519,000	93,000	gain	CNVs that overlap the ACRD
SK0272-003 (70721)	F	SPX	6	77,622,920	77,673,932	51,012	loss	CNVs that overlap the ACRD
MM0225-004 (60826)	M	MPX	6	93,087,482	98,011,900	4,924,419	gain	CNVs that overlap the ACRD
SK0077-003 (48226)	M	SPX	6	95,461,800	95,581,304	119,504	loss	CNVs that overlap the ACRD
SK0087-003 (40450)	M	MPX	6	97,566,274	97,658,527	92,253	loss	CNVs that overlap the ACRD
SK0216-003 (58875)	M	SPX	6	153,519,631	153,791,029	271,398	gain	CNVs that overlap the ACRD
NA0061-000 (60383)	M	SPX	7	108,357,049	108,597,525	240,477	loss	CNVs that overlap the ACRD
SK0226-005 (61360)	M	SPX	7	118,462,717	118,679,189	216,473	loss	CNVs that overlap the ACRD
MM0218-004 (45553)	M	MPX	8	89,598,961	89,678,800	79,840	loss	CNVs that overlap the ACRD
SK0210-004 (57601)	M	MPX	9	28,577,800	29,218,800	641,000	loss	CNVs that overlap the ACRD
SK0273-003 (71182)	M	MPX	9	70,739,231	70,870,084	130,854	loss	CNVs that overlap the ACRD
SK0118-003 (52027)	M	SPX	9	111,652,000	112,212,452	560,453	gain	CNVs that overlap the ACRD
NA0066-000 (64119L)	M	SPX	9	116,528,784	116,612,329	83,546	loss	CNVs that overlap the ACRD
SK0102-004 (31899)	M	SPX	10	42,611,900	43,266,300	654,400	gain	CNVs that overlap the ACRD
SK0102-004 (31899)	M	SPX	10	44,988,900	45,468,800	479,900	gain	CNVs that overlap the ACRD
NA0109-000 (72873)	M	SPX	10	112,267,330	112,405,408	138,079	gain	CNVs that overlap the ACRD
SK0131-003 (39989)	F	CHR	10	128,501,014	128,592,091	91,078	gain	CNVs that overlap the ACRD
NA0138-000 (81816L)	M	SPX	10	133,285,000	133,604,999	320,000	gain	CNVs that overlap the ACRD
NA0113-000 (82366L)	M	SPX	11	9,984,119	10,667,800	683,682	loss	CNVs that overlap the ACRD
SK0218-003 (60340)	F	CHR	12	1,760,084	1,852,412	92,328	loss	CNVs that overlap the ACRD
NA0122-000 (76018L)	F	SPX	13	32,965,700	33,137,655	171,956	gain	CNVs that overlap the ACRD
NA0117-000 (73621)	M	SPX	13	42,511,458	42,599,200	87,743	gain	CNVs that overlap the ACRD
MM0154-003 (56678L)	F	MPX	13	54,651,953	55,025,229	373,277	gain	CNVs that overlap the ACRD
SK0328-003 (82302)	M	SPX	13	103,896,769	103,930,492	33,724	loss	CNVs that overlap the ACRD
MM0295-003 (46488)	M	MPX	13	113,361,712	113,646,000	284,289	gain	CNVs that overlap the ACRD
SK0305-004 (78621)	F	SPX	14	42,022,286	42,210,026	187,741	loss	CNVs that overlap the ACRD
SK0320-003 (79449)	M	MPX	14	45,537,581	45,653,418	115,838	loss	CNVs that overlap the ACRD
MM0225-004 (60826)	M	MPX	14	83,373,278	83,435,200	61,923	gain	CNVs that overlap the ACRD
MM0154-003 (56678L)	F	MPX	14	106,223,861	106,356,482	132,622	gain	CNVs that overlap the ACRD
NA0064-000 (63582L)	M	SPX	15	82,573,421	83,631,697	1,058,276	loss	CNVs that overlap the ACRD
MM0256-004 (46991)	M	MPX	15	87,922,400	87,993,909	71,510	gain	CNVs that overlap the ACRD
SK0266-003 (68257)	M	SPX	16	6,813,789	6,898,849	85,060	loss	CNVs that overlap the ACRD
NA0063-000 (60351)	M	SPX	16	73,397,667	73,657,067	259,400	loss	CNVs that overlap the ACRD
NA0095-000 (75414L)	M	SPX	16	74,576,356	74,613,000	36,645	loss	CNVs that overlap the ACRD
SK0284-003 (72687)	F	SPX	17	28,985,300	29,960,700	975,400	gain	CNVs that overlap the ACRD
SK0012-003 (58468L)	M	SPX	18	27,565,032	27,781,900	216,869	gain	CNVs that overlap the ACRD
SK0152-003 (41548L)	M	CHR	18	32,174,061	32,990,975	816,914	loss	CNVs that overlap the ACRD
SK0147-003 (47544L)	F	SPX	18	37,509,556	37,950,450	440,895	gain	CNVs that overlap the ACRD
SK0304-003 (78063)	M	SPX	18	46,101,841	46,218,000	116,160	gain	CNVs that overlap the ACRD
NA0138-000 (81816L)	M	SPX	18	69,282,461	69,330,584	48,124	loss	CNVs that overlap the ACRD
SK0023-003 (58096)	M	SPX	21	46,497,675	46,678,820	181,145	gain	CNVs that overlap the ACRD
NA0112-000 (72340)	M	SPX	X	38,250,331	38,371,333	121,003	gain	CNVs that overlap the ACRD
SK0283-003 (72309)	F	CHR	4	44,762,996	44,858,504	95,508	gain	CNVs that overlap the ACRD
MM0010-005 (47372)	M	MPX	4	44,773,367	44,846,800	73,434	gain	CNVs that overlap the ACRD
NA0093-000 (66999)	M	SPX	4	44,773,367	44,846,800	73,433	gain	CNVs that overlap the ACRD
MM0109-003 (46486)	F	SPX	4	189,538,747	189,825,000	286,254	gain	CNVs that overlap the ACRD
SK0112-003 (46100)	M	MPX	4	189,580,553	190,228,000	647,447	gain	CNVs that overlap the ACRD

Wide-ranging prevalence frequencies of cytogenetically detectable chromosomal abnormalities in ASD, and the inability of microarray scans to find balanced abnormalities, prompted karyotyping to be performed. Karyotyping (and FISH) also provided the ability to characterize the chromosomal context (e.g. ring chromosomes) of some of the CNV regions, something not possible using microarrays alone. Therefore, 313 unbiased idiopathic cases where blood was available were examined and 5.8% (18/313) cases were found to have balanced (11) or unbalanced (7) karyotypes (all unbalanced karyotypic changes (7) were also found by microarray analysis and are included in the CNV statistics). The genomic characteristics of all CNVs are shown in the Autism Chromosome Rearrangement Database (see FIG. 3). In this study, CNV loss and gain will typically equate to a standard deletion or duplication. In some cases a duplication of only part of a gene could lead to its disruption (Table 5), and there are also positional effects on gene expression to consider.

De Novo, Overlapping/Recurrent, and Inherited Structural Variants

Structural variants found in ASD cases were initially prioritized to possibly be etiologic if they were not in controls and, (i) de novo in origin (25 cases) (see Table 5 below), (ii) overlapping (27 cases at 13 loci) in two or more unrelated samples (see Table 7 below), (iii) recurrent (same breakpoints) in two or more unrelated samples (four cases at two loci), (iv) or inherited (the remainder). In a proof of principle analysis, CNVs were found at known ASD loci: NLGN4 and 22q, 15q, SHANK3 and NRXN1 in categories i, ii, iii, and iv, respectively. ASD structural variants found in controls (eg. NRXN1) could also be involved.

TABLE 5

De Novo Rearrangements in ASD cases

	FamID (DNA)¹	Sex	Type	Chromosome²	Size (bp)³	CNV	Genes⁴	Phenotype Comments⁵

1	SK0181-004 (52191)	M	CHR (SPX)	3p14.1-3p13 (a)	5,346,900	loss	13 genes	IQ = 107
				t(6; 14)(q13; q21)( k)	N/A	none	11 genes	Dysmorphology
2	SK0152-003 (41548)	M	CHR (MPX)⁶	3p25.1-p24.3 (a)	1,409,600	loss	12 genes	IQ = unknown
				5p15.31-p15.2 (a)	3,429,389	loss	8 genes
				12q12 (a)	422,842	loss	4 genes
				t(5; 7)(p15p13) (k)	N/A	none	CDH18
3	SK0215-006 (58449)	M	CHR (SPX)	1p21.3 (a)	1,092,500	loss	DPYD whole	IQ = 38, SLI
4	SK0205-004 (56242)	F	CHR (SPX)	5p15.33-5p15.2 (k)	13,800,984	loss	46 genes	IQ = unknown, Cri du chat
5	SK0083-003 (50800)	M	CHR (SPX)	7q31.1-q31.31 (k)	11,023,507	loss	25 genes	IQ = 76
6	SK0131-003 (39989)	F	CHR (SPX)	7q31.1-q32.2 (k)	15,486,722	loss	>50 genes	IQ = 95, SLI
7	SK0243-003 (67941)	M	CHR (SPX)	15q23-q24.2 (k)	4,289,500	loss	>50 genes	IQ = unknown, SLI
8	SK0073-003 (57283)	F	CHR (SPX)	15q11.2-q13.3 (k)	11,922,600	gain	>50 genes	IQ = unknown
9	SK0245-005 (68517)	M	CHR (SPX)	15q11.2-q13.3 (k)	11,871,747	gain	>50 genes	IQ = unknown
10	SK0218-003 (60340)	F	CHR (MPX)⁴	18q21.32-18q23 (k)	20,358,999	loss	>50 genes	IQ = unknown, seizures,
								dysmorphology
11	NA0039-000 (69736)	F	CHR (SPX)	22q13.31-q13.33 (k)	3,231,700	loss	41 genes	IQ = unknown
12	NA0097-000 (82361)	F	CHR (SPX)	Xp22.33-p22.31 (a)	5,825,311	loss	21 genes + NLGN4	IQ = unknown
13	SK0283-003 (72309)	F	CHR (SPX)	47, XX, ring chr1 (k)	N/A	gain	>50 genes	IQ = 38
14	SK0133-003 (46012	M	CHR (SPX)	t(5; 8; 17)(q31.1;	N/A	none	5 genes	IQ = unknown
				q24.1; q21.3) (k)
15	NA0002-000 (52026)	M	SPX	7q36.2 (a)	66,462	loss	DPP6 exonic	IQ = unknown
16	SK0262-003 (68609)	M	SPX	8p23.3 (a)	791,089	gain	DLGAP2 exonic	IQ = unknown
17	MM0278-003 (57788)	M	SPX	12q24.21-q24.33 (a)	18,218,000	gain	>50 genes	IQ = 36
18	NA0067-000 (65344)	M	SPX	16q24.3 (a)	265,667	loss	ANKRD11 exonic	IQ = unknown
19	MM0088-003 (45562)	F	MPX	16p11.2 (a)	675,829	loss	28 genes	IQ = 87
20	SK0102-004 (31899)	M	SPX	16p11.2 (a)	432,600	gain	24 genes	IQ = 74, Epilepsy
21	SK0244-003 (69183)	M	SPX	21q22.3 (a)	353,936	gain	4 genes	IQ = 80
22	MM0109-003 (46486)	F	SPX	20q13.33 (a)	1,427,661	gain	44 genes	IQ = unknown
				22q13.33 (a)	276,702	loss	13 genes + SHANK3
23	SK0119-003 (35190)	M	MPX⁴	22q11.21 (a)	2,771,300	loss	>50 genes	IQ = 58, VCF syndrome
24	SK0297-003 (76066)	M	SPX-MZ	22q11.21 (a)	4,281,262	gain	>50 genes	IQ = 107, dysmorphology
25	SK0306-004 (78681)	F	SPX	Xp11.23-11.22 (a)	4,643,367	gain	>50 genes	IQ = 87

¹Table is sorted based on family type. Probands with abnormal karyotypes (CHR) (1-14) are separated from probands belonging to simplex (SPX) and multiplex (MPX) families with normal karyotypes (15-25).
²De novo event detected by either karyotype (k) or microarray (a)
³De novo CNV/translocation has been confirmed by at least one of karyotype, FISH, or qPCR. CNV size is based on array results. The breakpoints have not been accurately defined, and CNVs may be smaller or larger than posted.
⁴When only a single gene is involved if the CNV intersects (suggesting it may disrupt the gene) the term ‘exonic’ is used and if the CNV encompasses the entire gene the term ‘whole’ is used.
⁵For multiplex families the de novo events were not detected in affected siblings.
**comment on case 25 that is also in Table 3(see entry #2

TABLE 6

Recurrent and overlapping loci in ASD

	Chromosome	FamID (DNA)	Sex	Type¹	Size (bp)²	CNV	Origin	Genes³	Phenotype Comments

1	2q14.1	SK0147-003 (47544)	F	SPX	478,370	loss	Paternal	DPP10 exonic	IQ = unknown, NF1
		SK0288-003 (75420)	F	SPX-MZ	105,120	gain	Paternal	DPP10 intronic	IQ = 83
2	2q32.1	SK0306-004 (78681)	F	SPX	97,130	loss	Unknown	None	IQ = 87
		NA0030-000 (55240)	M	SPX	112,323	loss	Unknown	None	IQ = unknown
3	6q22.31	MM0220-003 (61180)	M	MPX	318,000	gain	Paternal	PLN, c6orf204 whole	IQ = unknown
		NA0025-000 (60490)	M	SPX	293,989	gain	Paternal	PLN, c6orf204 whole	IQ = unknown
4	7q36.2	SK0190-003 (54742)	M	SPX	1,780,000	gain	Maternal	DPP6 whole	IQ = 82
		SK0115-003 (40555)	M	SPX	274,000	gain	Unknown	DPP6 exonic	IQ = unknown
		SK0058-003 (59963)	M	MPX	16,788	gain	Maternal	DPP6 intronic	IQ = 111
		NA0002-000 (52026)	M	SPX	66,462	loss	De novo	DPP6 exonic	IQ = unknown
5	8q11.23	SK0143-003 (36812)	M	SPX	285,200	gain	Unknown	UNQ9433 whole,	IQ = 66
								RB1CC1 exonic	Apraxia, CHD, Seizures
		MM0236-004 (46475)	M	MPX	271,679	gain	Unknown	RS1CC1 exonic	IQ = 99
6	9p24.1	SK0270-003 (71341)	M	SPX	38,900	loss	Unknown	none	IQ = 91, SLI
		MM0103-003 (42387)	M	MPX	34,950	loss	Paternal	none	IQ = 107
7	11p12	MM0272-003 (45563)	M	MPX	262,938	loss	Maternal	none	IQ = 111, Seizures
		SK0167-003 (60966)	F	MPX	192,846	loss	Unknown	none	IQ = 91
8	13q21.32	SK0023-003 (58096)	M	SPX	189,438	gain	Unknown	PCDH9 intronic	IQ = 91, Seizures
		MM0299-003 (51674)	F	MPX	172,401	gain	Paternal	PCDH9 intronic	IQ = 39
9	15q11.2-q13.3	SK0073-003 (57283)	F	CHR	11,922,600	gain	De novo	>50 genes	IQ = unknown
		SK0245-005 (68517)	M	CHR	11,871,747	gain	De novo	>50 genes	IQ = unknown
10	16p12.1	MM0109-003 (46486)	F	SPX	1,246,288	gain	Maternal	8 genes	IQ = unknown
		MM0289-003 (42267)	F	MPX	802,555	loss	Maternal	5 genes	IQ = 63
11	16p11.1	NA0133-000 (78119)	F	SPX	525,319	gain	Maternal	29 genes	IQ = unknown
		SK0102-004 (31899)	M	SPX	432,600⁴	gain	De novo	24 genes	IQ = 64, Epilepsy
		MM0088-003 (45562)	F	MPX	675,829	loss	De novo	32 genes	IQ = 87
12	22q11.2	SK0119-003 (35190)	M	MPX	2,771,300	loss	De novo	>50 genes	IQ = 58, VCF syndrome
		SK0091-004 (46407)	F	MPX	4,281,262	gain	Paternal	>50 genes	IQ = 126
		SK0297-003 (76066)	M	SPX-MZ	4,281,262	gain	De novo	>50 genes	IQ = 107, dysmorphology
		SK0323-003 (80022)	M	MPX	743,100	gain	Unknown	7 genes	IQ = unknown
13	22q13.31	SK0123-004 (60536)	M	MPX	601,528	gain	Maternal	none	IQ = 93
		MM0102-003 (47598)	M	MPX	80,380	loss	Maternal	none	IQ = 70

¹Families are grouped based on simplex (SPX), multiplex (MPX) and chromosomal abnormalities (CHR). Simplex families with affected monozygotic twins is denoted as SPX-MZ. The de novo cases also appear in Table 2 and some of the family pedigrees are shown in FIG. 2 and Supplemental FIG. 2.
²CNV size is based on array results. The breakpoints have not been accurately defined, and CNVs may be smaller or larger than posted.
³When only a single gene is involved if the CNV intersects (suggesting it may disrupt the gene) the term ‘exonic’ is used and if the CNV encompasses the entire gene the term ‘whole’ is used.
⁴CNV is only called by one algorithm

By testing parental DNA and validating CNVs, a de novo mutation rate of 7.1% (4/56) and 2.0% (1/49) was observed in idiopathic simplex and multiplex families, respectively. There was parental information for 13 of 18 cases discovered to carry cytogenetic abnormalities and 7 (6 simplex, 1 multiplex) of these were de novo in origin. Since only 1/7 (from a simplex family) of these was balanced and directly interrupting a gene, it was estimated that this class of rearrangements had much less of a contribution than CNVs to the total rate of de novo and structural variation in the present cohort.
The collective data identified 25 de novo cases (Table 5) and in three, two or more events were identified. Notably, in family SK0152 (FIG. 4 a) there were four de novo events. In MM019 (FIG. 4 b) there were two de novo deletions, one leading to haplo-insufficiency of SHANK3.
The 13 loci where overlapping ASD-specific CNVs were found are likely indicative of ASD-susceptibility since they arise in two or more unrelated families. In six, gains and losses often encompassing entire genes were observed at the same locus (Table 6) suggesting general gene dysregulation to be involved.
Using q-PCR or by assessing SNP patterns, 196 inherited CNVs (90 maternal and 106 paternal) were confirmed. No sub-grouping of these demonstrated obvious parent-of-origin effects (the two chromosome 15q11-q13 duplications detected were both de novo in origin). A 160 kb deletion was detected in a male inherited from a carrier mother, leading to a null PTCHD1 in the proband and his dizygotic twin brother (FIG. 4 c). There were also instances where apparently balanced inherited translocations were accompanied by de novo deletions in the offspring (eg. DPYD) (FIG. 4 d).

Candidate ASD-Susceptibility Genes and Loci Identified

New ASD candidates identified were those with a structural change (either de novo or found in two or more unrelated ASD cases, or for the X chromosome an allele being transmitted maternally from an unaffected carrier) specific to that gene, including ANKRD11, DLGAP2, DPP6, DPP10, DPYD, PCDH9 and PTCHD1 (Tables 5 and 6). As previously noted, NLGN4, SHANK3 and NRXN1 were also identified. The PCDH9 and NRXN1 genes are also found as CNVs in controls in the DGV (Database of Genomic Variants).
Additional positional candidate genes identified were those found interrupted by balanced cytogenetic breakpoints including NEGR1, PIP5K1B, GABRG1, KLHL3, STK3, ST7, SATB2 (Table 1). Moreover, 77 CNVs in the stringent dataset overlapped with the Autism Chromosome Rearrangement Database providing a second line of evidence for involvement (FIG. 2). For example, a 4.6 Mb de novo duplication at Xp11.23-11.22 was detected in a female SK0306-004 (Table 5) and a male in the database.
DPP6 and DPP10 emerge as being positional and functional candidates. DPP6 (˜1.5 Mb in size at 2q14.1) and DPP10 (˜1.3 Mb at 7q36.2) code for accessory trans-membrane dipeptidyl peptidase-like subunits that affect the expression and gating of Kv4.2 channels (KCND2). Kv4.2 channels function in regulation of neurotransmitter release and neuronal excitability in the glutamatergic synapse at the same sites where SHANK3 and the NLGN gene products are found. In addition, autism balanced breakpoints have been mapped near KCND2 at 7q31.
For DPP10 there are inherited CNV gains and losses (Table 5, FIG. 4). De novo and inherited CNVs were found at the multi-transcript DPP6 gene. A 66 kb de novo loss encompassing exons 2 and 3 is found in a male in family NA0002 (FIG. 4 e). In family SK0190, the male proband and an unaffected female sibling both carry a CNV gain inherited from an unaffected mother (FIG. 4 f) that encompassed the entire DPP6. A 270 kb gain was found in SK0115-003 that extends across the first exon (which may disrupt the functional gene) and SK0058-003 carries a maternally-inherited 16 kb intronic CNV gain (Table 1; FIG. 5).

Medical Genetics

Structural variants overlapping loci involved in medical genetic conditions including Waardenburg Type IIA (3p14.1), speech and language disorder (7q31), mental retardation (MR) (15q23-q24, 16p11.2) and velocardialfacial syndrome (VCFS) (22q13) were identified (Table 5), amongst others. Identification of the structural variant at these loci led to clinical re-assessment and either identification or refinement of the diagnosis, for additional syndromic features. Other instances (eg. SK0186-PTCHD1 deletion) (FIG. 4 c) prompted re-testing of the entire family and eventually a diagnosis of mild-ASD in a previously undiagnosed sibling. This family was then redesignated multiplex as opposed to simplex.
The identification of a de novo deletion (2.7 Mb) at 22q11.2 in two ASD brothers led to their re-examination and diagnosis for VCFS. The re-testing also further defined the siblings to be at opposite ends of the ASD spectrum (FIG. 6). Larger duplications (4.3 Mb) of this same region in two other ASD families (SK0289 and SK0091) did not cause VCFS (Table 6); however, in SK0091 the variant was inherited from a normal father and not found in an affected male sibling.
A recurrent ˜500 kb duplication at 16p11.2 in two ASD families (SK0102 and NA0133) (FIGS. 4 and 5) was also discovered. As with DPP6/DPP10 and 22q11.2, there were carriers of these structural variants without ASD. In a third family (MM0088), the proband has a larger 676 kb de novo deletion and it is only detected in one of two ASD siblings. (FIG. 4 g).
In sum, using the genome-wide scanning approach, numerous new putative-ASD loci (Tables 4 and 5, FIG. 2) were identified. Generally, ASD loci include (i) those that contain genes functioning in the PSD, (ii) and/or chromosomal regions previously shown to be involved in mental retardation, and (iii) involve dysregulation of gene expression.
CNVs that implicate ASD loci include the SHANK3, NLGN, and NRXN1-PSD genes and also identify novel loci at DPP6 and DPP10 (amongst others including PCDH9, RPS6KA2, RET from the full dataset) were identified.
Lastly, six unrelated ASD cases were identified (Table 6) that had either CNV gains or losses at the same locus which indicate that gene expression of genes in these regions are related to the development of speech and language and/or social communication in humans, as in SHANK3 and genes in the Williams-Beuren syndrome locus.

Example 2

PTCHD1 as a Marker of ASD

As set out above, a genome scan with Affymetrix 500K SNP Arrays was used to identify a CNV deletion on chromosome Xp22.11 that spans exon 1 of the PTCHD1 gene. Exon 1 is shown bolded in FIG. 7 spanning nucleotide positions 1-359. The Cdna sequence of the PTCHD1 gene (NM_—173495) as well as the amino acid sequence of the corresponding encoded protein is illustrated in FIG. 7 which illustrates a genomic size of:: 59325, an exon/coding exon count of 3 encoding a protein of 783 amino acids.
The deletion was determined to be an ˜156 kb deletion on Xp22.11 on a male proband. The physical position of this CNV is chrX:22,962,800-23,119,000 (UCSC 2004 Assembly). The deletion is flanked by SNP probes rs7055928 and rs1918560 (at 22.956 and 23.133 Mb from the Xp terminus, respectively). The most proximal and distal SNPs (from the Affymetrix SNP microarrays) within the deleted region, as determined by the SNP microarray analysis, are rs7879064 (23.119 Mb) and rs4828958 (22.972 Mb). PCR amplicons from within the deleted region were used to confirm the deletion by Qper (PCR primers and locations are given below). This deletion spans the entire exon 1 of the PTCHD1 gene (NM_—173495). Analysis of both Sty and Nsp chips data identified this event and was further validated using PCR and QPCR techniques. The following primers were used:

PTCHD-CNV1F

	ATTCGCAGTTCCTTCGTCTT	(SEQ ID NO: 1)

	PTCHD-CNV1R
	AAAGTGGATTGATCGGTTCC	(SEQ ID NO: 2)

	PTCHD-CNV2F
	GCTTGAGGACGTGTTTCTCC	(SEQ ID NO: 3)

	PTCHD-CNV2R
	CTAGGAGAGGTGGCGCTCT	(SEQ ID NO: 4)

This CNV is autism specific as it was not present in the Database of Genomic Variants (DGV) and in other controls. Furthermore, the segregation of this deletion was characterized in family and it was identified that the deletion was transmitted from a heterozygous mother. A male sibling also had language deficits.
Mutation screening of PTCHD1 in N=400 autism patients was conducted in the usual manner. The following primers were used:

PTCHD1-x1F

	AGCGTGCGCCTCGCCCT	(SEQ ID NO: 5)

	PTCHD1-x1R
	TCCTTGTCCAGGAGGCTGGGA	(SEQ ID NO: 6)

	PTCHD1-x1Bf
	GCGCCCGCTCTGCTCTA	(SEQ ID NO: 7)

	PTCHD1-x1Br
	TCCTTGTCCAGGAGGCTGGGA	(SEQ ID NO: 8)

	PTCHD1-x2-F
	GAATGTCCACCCTCTCCAAA	(SEQ ID NO: 9)

	PTCHD1-x2-R
	AAGGCTACTCCTGGCCTTTT	(SEQ ID NO: 10)

	PTCHD1-x3a-F
	CTTTGACCCAGTAGTCCCTCA	(SEQ ID NO: 11)

	PTCHD1-x3a-R
	GCACAAACCCCTTGGTGTA	(SEQ ID NO: 12)

	PTCHD1-x3b-F
	TGTGATTGGGTTTTACATATATGAGTC	(SEQ ID NO: 13)

	PTCHD1-x3b-R
	AGGTCAGATTTGAAGGCACAG	(SEQ ID NO: 14)

	PTCHD1-x3c-F
	AAAAATGCCCTGGAAGTGC	(SEQ ID NO: 15)

	PTCHD1-x3c-R
	TGTGTGAATTCTCATAACAACTCCT	(SEQ ID NO: 16)

The mutation screening revealed an I173V mutation.

Example 3

Identification of Additional Markers of ASD

By sequencing the entire coding region of PTCHD1 in 900 unrelated ASD cases, six missense mutations were identified in six unrelated ASD probands (Table 7, FIG. 8). For clinical details see Table 8.

TABLE 7

							XCI
							Status			No. of
							of			Control
				Sex of		Family	Carrier	Population	Frequency	Chromosomes
Subject ID	Exon	Mutation	Nucleotide	Proband	Transmission	Type	Mother	Ancestry	in ASD	Tested

Family 1	1	167-kb deletion, disrupts	M	Mother	Multiplex	Skewed	European	1 in 427	2067
		PTCHD1 gene at Xp22.11							(M = 769 F = 1298)
Family 1	1	167-kb deletion, disrupts	M	Mother	Multiplex	Skewed	European	1 in 427	2067
		PTCHD1 gene at Xp22.11							(M = 769 F = 1298)

Family 2	2	I173V	517A > G	M	Mother	Multiplex	Random	European\Mixed	2 in 900	659
										(M = 219 F = 220)
Family 3	2	I173V	517A > G	M	Mother	Simplex	Random	European	2 in 900	659
										(M = 219 F = 220)
Family 4	2	V195I	583G > A	M	Mother	Simplex	NC	European	1 in 900	659
										(M = 219 F = 220)
Family 5	2	ML336-7II	1008-9GC > TA	M	Mother	Simplex	Random	Asian	1 in 900	751*
										(M = 249 F = 251)
Family 6	3	E479G	1436A > G	M	Mother	Multiplex	Random	European	1 in 900	427
										(M = 137 F = 145)
Family 7	1	L73F	217C > T	M	Mother	Multiplex	NC	Not Available	1 in 900	427
										(M = 137 F = 145)

*Out of 751 control chromosomes tested, N = 92 were Asian

TABLE 8

Subject ID	Sex	Mutations	Clinical Details	Family History	Comments

Family 1	M	167-kb del	Meet ADI and ADOS-1 criteria for diagnosis of autism. Difficulty	Maternal history of	Severe colic
			with conversations, echoed words, repetitive interests, delay in social	learning problem and	during early
			use of language. Attention Deficit and Hyperactivity Disorder	articulation difficulties.	childhood
			(ADHD). No mental retardation (MR).	Paternal history of ADHD
			Non-Verbal IQ = 42% ile	like features.
Family 1	M	167-kb del	Meet ADI and ADOS-1 criteria for diagnosis of autism. Difficulty	Maternal history of	Severe colic
			with conversations, echoed words, repetitive interests, delay in social	learning problem and	during early
			use of language. Attention Deficit and Hyperactivity Disorder	articulation difficulties.	childhood
			(ADHD). No mental retardation (MR).	Paternal history of ADHD
			Non-Verbal IQ = 23% ile	like features.
Family 2	M	I173V	Meet ADI and ADOS-1 criteria for diagnosis of autism. Highly	Father had type II diabetes
			repetitive language and behaviour, motor mannerisms, extremely
			hyperactive, poor motor coordination and mental retardation,
			Lang: receptive = 40, <1% ile, expressive = 40, <1% ile
Family 3	M	I173V	Meet ADI and ADOS-1 criteria for diagnosis of autism. Meet ADI	No family history of PDD
			and ADOS-1 criteria for diagnosis of autism. ADI social score = 25,
			ADI communication score = 21, ADI Restricted, Repetitive, and
			Stereotyped Behavior Score = 11, ADI development score = 3, Normal
			IQ,
	M	V195I	Diagnosed with autism at the age of 3 years and 4 months. Meet ADI	No family history of PDD	FRX and head
			and ADOS-1 criteria for diagnosis of autism. Severe expressive and		CT scan was
			receptive language delay. No dysmorphology observed.		normal
Family 5	M	ML336-7II	Meet ADI and ADOS-1 criteria for diagnosis of autism. ADI social	Father died of leukemia	Minor
			score = 26, ADI communication score = 14, ADI stereotype score = 5		thalassemia
			ADI development score: 4, ADOS social + communication score =
			20, ADOS Restricted, Repetitive, and Stereotyped Behavior
			Score = 3,
			Some traits were observed that could be related to schizophrenia.
Family 6	M	E479G	Diagnosed with high functioning autism.	No family history of PDD
Family 7	M	L73F	Meet ADI and ADOS-1 criteria for diagnosis of autism

All these mutations resulted in the substitution of highly conserved amino acids, and were inherited from unaffected carrier mothers. Based on in silico protein modeling, three mutations (L73F, I173V, V195I) are present in a predicted amino acid loop that sits outside of the cell membrane. This loop is posited to interact with the ligand, Hh. Another mutation, the 2-amino acid substitution ML336-337II was present within a predicted transmembrane domain. Finally, the E479G mutation was present within a predicted cytoplasmic amino acid loop. In five out of six families, these mutations segregated with the phenotype. Controls (439) were tested for the I173V and V195I mutations, 500 controls for ML336-337II, and 282 controls for L73F and E479G. None of these mutations were present in controls. Furthermore, the fact that these mutations were all maternally inherited to male probands, and were not observed in our control populations, indicates that the mutations are associated with ASD. In turn, it is reasonable to assume that these mutations contribute to the etiology of autism, and perhaps in-combination with other disease-related loci, give rise to the ASD phenotype.
Interestingly, in two of the ASD families reported in Tables 7/8 (Family-2 & Family-4), other ASD-related CNVs were identified. In family 2, in addition to I173V mutation, a de novo ˜1.0 Mb loss at 1p21.3 resulting in deletion of the entire DPYD gene (NM_—000110.3) was identified. DPYD encodes a rate-limiting enzyme, dihydropyrimidine dehydrogenase (DPD), involved in pyrimidine metabolism. Complete DPD deficiency results in highly variable clinical outcomes, with convulsive disorders, motor retardation, and mental retardation being the most frequent manifestations. In Family-4, in addition to the V195I mutation, a 66 Kb de novo loss at 7q36.2 was identified resulting in deletion of DPP6 exon 3, and 33 amino acids towards the N-terminal end of the DPP6 protein. These cases evidence digenic involvement in ASD.
The ability of these PTCHD1-mutants to repress Gli2 expression was compared with wild type to determine if there was loss of function in the mutants. NIH10T1/2 fibroblasts were transfected with CMV-empty vector, a Gli-responsive promoter fused to the Luciferase gene (Gli2 pro), β-Gal (normalization) and PTCHD1 mutant expression plasmids. A mild loss of function of at least the E479G and ML336-7II mutants resulted in increased expression of Gli2 compared to wild type.

Claims

1. (canceled)

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. A method of determining the risk of ASD in an individual comprising:

probing a nucleic acid-containing sample obtained from the individual for a genomic sequence mutation in at least one gene selected from the group consisting of PTCHD1, SHANK3, NFIA, DPP6, DYPD, DPP10, GPR98, PQBP1, ZNF41 and FTSJ1, wherein identification of a mutation that modulates the expression of at least one of said genes is indicative of a risk of ASD.

18. A method as defined in claim 17, wherein the genomic sequence variation is in the PTCHD1 gene.

19. A method as defined in claim 17, wherein the genomic sequence mutation is a deletion of at least a portion of exon 1 of PTCHD1.

20. A method as defined in claim 17, wherein the genomic sequence mutation is an intronic gain in DPP10.

21. A method as defined in claim 17, wherein the genomic sequence mutation is an exonic loss in DPP10.

22. A method as defined in claim 17, wherein the genomic sequence mutation is an exonic loss encompassing at least a portion of exons 2 and 3 in DPP6.

23. A method as defined in claim 17, wherein the genomic sequence mutation is a gain in DPP6 selected from at least one of the group consisting of the entire DPP6 gene, a 270 kb exonic gain in exon 1 and a 16 kb intronic gain.

24. A method as defined in claim 17, wherein the genomic sequence mutation is a loss in the SHANK3 gene.

25. A method as defined in claim 17, wherein the genomic sequence mutation is a loss of the DYPD gene.

26. A method as defined in claim 17, wherein the genomic sequence mutation is at least one missense mutation in PTCHD1 resulting in at least one amino acid substitution in the encoded protein selected from the group consisting of L73F, I173V, V195I, ML336-337II and E479G.

27. A method as defined in claim 17, wherein the genomic sequence mutation is selected from the group consisting of a deletion of at least a portion of exon 1 of PTCHD1; an intronic gain in DPP10; an exonic loss in DPP10; an exonic loss encompassing at least a portion of exons 2 and 3 in DPP6; a gain in DPP6 selected from at least one of the group consisting of the entire DPP6 gene, a 270 kb exonic gain in exon 1 and a 16 kb intronic gain; a loss in the SHANK3 gene; a loss of the DYPD gene; and at least one missense mutation in PTCHD1 resulting in at least one amino acid substitution in the encoded protein selected from the group consisting of L73F, I173V, V195I, ML336-337II and E479G.

28. A method of determining the risk of ASD in an individual comprising:

screening a biological sample from the individual for abnormal levels of at least one gene product expressed by a gene selected from the group consisting of PTCHD1, SHANK3, NFIA, DPP6, DPP10, DYPD, GPR98, PQBP1, ZNF41 and FTSJ1, wherein a determination that at least one of said gene products is expressed at a level that varies from the expression level in a healthy non-ASD individual is indicative of a risk of ASD.

29. The method as defined in claim 28, wherein the biological sample is screened for abnormal levels of the PTCHD1 gene product.

30. A method of determining the risk of ASD in an individual comprising:

screening a nucleic acid-containing sample from the individual for at least one genomic sequence variation that modulates the expression of PTCHD1, wherein identification of at least one of said genomic sequence variations is indicative of a risk of ASD in the individual.

31. A method as defined in claim 30, wherein the genomic sequence variation is in the PTCHD1 gene.

32. A method as defined in claim 30, wherein the genomic sequence variation is a deletion of at least a portion of exon 1 of PTCHD1.

33. A method as defined in claim 30, wherein the genomic sequence variation is at least one missense mutation in PTCHD1 resulting in at least one amino acid substitution in the encoded protein selected from the group consisting of L73F, I173V, V195I, ML336-337II and E479G.