US20100216138A1

US20100216138A1 - Method for dna breakpoint analysis

Info

Publication number: US20100216138A1
Application number: US12/599,953
Authority: US
Inventors: Alexander Alan Morley
Original assignee: Monoquant Pty Ltd
Current assignee: Monoquant Pty Ltd
Priority date: 2007-06-01
Filing date: 2008-05-30
Publication date: 2010-08-26
Also published as: WO2008144841A1; US20090202999A1; EP2150628B1; EP2150628A4; JP2010528592A; CN101835900A; CN101835900B; JP5730568B2; US9145587B2; JP2015012873A; EP2150628A1; AU2008255569A1

Abstract

The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the break-point position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene break-point associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.

Description

FIELD OF THE INVENTION

The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the breakpoint position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene breakpoint associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.

BACKGROUND OF THE INVENTION

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
Chromosomal translocations bring the previously unlinked segments of the genome together by virtue of the exchange of parts between non-homologous chromosomes. Although some translocations are not associated with a new phenotype, others may result in disease due to the modulation of protein expression or the synthesis of a new fusion protein.
There are two main types of chromosomal translocations which occur, these being reciprocal translocations (also known as non-Robertsonian) and Robertsonian translocations. Further, translocations can be balanced (in an even exchange of material with no genetic information extra or missing) or unbalanced (where the exchange of chromosome material is unequal resulting in extra or missing genes).
Reciprocal (non-Robertsonian) translocations usually result in an exchange of material between non-homologous chromosomes and are found in about 1 in 600 newborns. Such translocations are usually harmless and may be found through prenatal diagnosis. However, carriers of balanced reciprocal translocations exhibit an increased risk of creating gametes with unbalanced chromosome translocations thereby leading to miscarriages or children with abnormalities.
Robertsonian translocations involve two acrocentric chromosomes that fuse near the centromere region with loss of the short arms. The resulting karyotype has only 45 chromosomes since two chromosomes have fused together. Robertsonian translocations have been observed involving all combinations of acrocentric chromosomes. The most common translocation involves chromosomes 13 and 14 and is seen in about 1 in 1300 persons. Like other translocations, carriers of Robertsonian translocations are phenotypically normal, but exhibit a risk of unbalanced gametes which lead to miscarriages or abnormal offspring. For example, carriers of Robertsonian translocations involving chromosome 21 exhibit a higher probability of having a child with Down syndrome.
Diseases which may result from the occurrence of a translocation include:

- Cancer—several forms of cancer are caused by translocations; this mainly having been described in leukemia (eg. acute myelogenous leukemia and chronic myelogenous leukemia).
- (ii) Infertility—this can occur where one of the would-be parents carries a balanced translocation, where the parent is asymptomatic but conceived foetuses are not viable.
- (iii) Down syndrome—in some cases this is caused by a Robertsonian translocation of about a third of chromosome 21 onto chromosome 14.
  Specific examples of chromosomal translocations and the disease with which they are associated include:
- t(2;5)(p23;q35)—anaplastic large cell lymphoma
- t(8;14) —Burkitt's lymphoma (c-myc)
- t(9;22)(q34;q11)—Philadelphia chromosome, CML, ALL
- t(11;14)—Mantle cell lymphoma (Bcl-1)
- t(11;22)(q24;q11.2-12)—Ewing's sarcoma
- t(14;18)(q32;q21)—follicular lymphoma (Bcl-2)
- t(17;22)—dermatofibrosarcoma protuberans
- t(15;17)—acute promyelocytic leukemia (pml and retinoic acid receptor genes)
- t(1;12)(q21;p13)—acute myelogenous leukemia
- t(9;12)(p24;p13)—CML, ALL (TEL-JAK2)
- t(X;18)(p11.2;q11.2)—Synovial sarcoma
- t(1;11)(q42.1;q14.3)—Schizophrenia
- t(1;19)—acute pre-B cell leukemia (PBX-1 and E2A genes).

The shorthand t(A;B)(p1;q2) is used to denote a translocation between chromosome A and chromosome B. The information in the second set of parentheses, when given, gives a precise location within the chromosome for chromosomes A and B respectively—with p indicating the short arm of the chromosome, q indicating the long arm, and the numbers of p and q refers to regions, bands and sub-bands seen when staining the chromosomes under microscope.
As detailed above, chronic myelogenous leukemia is an example of a neoplastic condition which is caused by a chromosomal translocation. However, unlike many neoplastic conditions, its treatment prospects are quite good if it can be effectively diagnosed and monitored.
In virtually all cases of chronic myelogenous leukemia, a specific translocation is seen. This translocation involves the reciprocal fusion of small pieces from the long arms of chromosome 9 and 22. The altered chromosome 22 is known as the Philadelphia chromosome (abbreviated as Ph1). When the breakpoint of the Ph1 chromosome was sequenced, it was found that the translocation creates a fusion gene by bringing together sequences from the c-ABL proto-oncogene and another BCR (breakpoint cluster region). The BCR-ABL fusion gene encodes a phosphoprotein (p210) that functions as a dysregulated protein tyrosine kinase and predisposes the cell to become neoplastic. This hypothesis is supported by finding that expression of p210 results in transformation of a variety of hematopoietic cell lines in vitro and that mice transgenic for the human BCR-ABL gene develop a number of hematologic malignancies. Another well studied example of a translocation generating cancer is seen in Burkitt's lymphoma. In some cases of this B cell tumor, a translocation is seen involving chromosome 8 and one of three other chromosomes (2, 14 or 22). In these cases, a fusion protein is not produced. Rather, the c-myc proto-oncogene on chromosome 8 is brought under transcriptional control of an immunoglobulin gene promoter. In B cells, immunoglobulin promoters are transcriptionally quite active, resulting in over expression of c-myc, which is known from several other systems to exhibit monogenic properties. Accordingly, this translocation results in aberrant high expression of an oncogenic protein.
The classical method of diagnosing chromosomal translocations, such as those observed in chronic myelogenic leukemia, is by karyotyping. For many translocations, however, it is now possible to detect the translocation by PCR, using primers which span the breakpoint. In some cases, the PCR technique can also be used for sensitive detection and monitoring of treatment. Monitoring to determine the effect of treatment has become increasingly important for diseases such as chronic myeloid leukemia and acute promyelocytic leukemia as increasingly effective treatment has been developed. For monitoring in these 2 diseases, the starting material for the PCR is RNA. The translocation breakpoint is within the introns of the respective genes and, as a consequence, RNA splicing removes the sequence of RNA transcribed by introns and results in only one or a very limited number of final mRNA products being produced, despite the very large number of different translocations which are present in the patient population.
However, the use of RNA as the starting material to detect and quantify the translocation by PCR suffers the disadvantage that RNA is a difficult molecule to work with due to its inherent susceptibility to degradation. DNA is a more stable molecule. However, the initial identification and characterisation of the breakpoint in the context of DNA is much more difficult since cluster regions of chromosomal fusion sites often span large introns of several tens of thousands of nucleotides. These sizes are too large for direct coverage by a single PCR reaction. There therefore exists an ongoing need to develop means for routinely conducting breakpoint analyses on DNA samples.
In work leading up to the present invention, a novel multiplex amplification reaction has been developed which enables the localisation and analysis of a breakpoint in a DNA sample. Despite the precise position of the breakpoint being unknown, the method of the present invention nevertheless enables diagnosis of the existence of the breakpoint in a DNA sample and the isolation and analysis of the breakpoint region using a relatively modest and simple multiplex amplification reaction. The design of this amplification reaction results in the advantage that generation of long PCR products is not required. Still further, the optional incorporation of a primer hybridisation tag region at the 5′ end of the amplification primers enables the rapid generation of large copy numbers of the amplicons generated using these primers and therefore facilitates the isolation and analysis of the amplicons.

SUMMARY OF THE INVENTION

Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
As used herein, the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source. Further, as used herein the singular forms of “a”, “and” and “the” include plural referents unless the context clearly dictates otherwise.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The subject specification contains nucleotide sequence information prepared using the programme PatentIn Version 3.1, presented herein after the bibliography. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (eg. <210>1, <210>2, etc). The length, type of sequence (DNA, etc) and source organism for each sequence is indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2, etc.). The sequence identifier referred to in the specification correlates to the information provided in numeric indicator field <400> in the sequence listing, which is followed by the sequence identifier (eg. <400>1, <400>2, etc). That is SEQ ID NO:1 as detailed in the specification correlates to the sequence indicated as <400>1 in the sequence listing
One aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
contacting a DNA sample with:

- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  The present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising:
  (i) contacting a genomic DNA sample with:
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  There is therefore preferably provided a method of identifying a gene breakpoint, said method comprising:
  (i) contacting a DNA sample with
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  The present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising:
  (i) contacting a DNA sample with:
- (a) one to thirty forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  According to this preferred embodiment there is provided a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
  (i) contacting a DNA sample with:
- (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  The present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
  (i) contacting a DNA sample with:
- (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
  (ii) amplifying the DNA sample of step (i);
  (iii) contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) isolating and sequencing said amplified DNA.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic representation of the strategy for amplification of the breakpoint region in the first round PCR. The forward primers for gene A and the reverse primers for gene B are preferably used in pools rather than individually. Only primer pairs which closely straddle the breakpoint will produce efficient amplification. The tags and tag primers are not shown. The strategy for the second round PCR is the same although the forward and reverse primers are just internal to their corresponding primers in the first round. In the case of chronic myeloid leukemia, gene A is the BCR gene and gene B is the ABL gene. Primer binding sites are staggered so that the maximum amplicon size does not exceed 1 kilobase.

FIG. 2 is a schematic representation of a protocol for isolation of the BCR-ABL translocation breakpoint in chronic myeloid leukemia.

FIG. 3 is an image of the results of electrophoresis showing amplified material from study of one patient. NFA was the pool of 6 forward BCR primers and NFA13 and NFA14 were 2 pools each containing 12 reverse ABL primers. NFA 13/14 was a pool containing the 24 ABL primers belonging to pools 13 and 14.

FIG. 4 is a representation of the sequences of the breakpoints in 4 patients with chronic myeloid leukemia. The numbers on the left are the Genbank base numbers for the BCR and ABL genes.

FIG. 5 shows the site of the DNA breakpoints in the ABL and BCR genes in the 27 patients with breakpoints isolated and identified. Blue regions in the ABL gene represent the exons 1a, 1b and E2. Red regions in the BCR gene represent exons 13, 14 and 15.

Isolation of the BCR-ABL Breakpoint in Chronic Myeloid Leukemia (CML)

Samples from 29 CML patients have been studied using the invention. In 27 of these patients the breakpoint sequences have been isolated and detailed sequencing information obtained. For one patient it has not been possible to amplify the BCR/ABL breakpoint. For the remaining patient a suspected breakpoint has been amplified. Sequence information shows the BCR gene at the 5′ end and ABL sequence at the 3′ end, however this breakpoint has not been confirmed with primers made specifically for the suspected regions.

FIG. 6 is a comparison of DNA-based and RNA-based quantification of minimal residual disease (MRD) in samples of blood from 16 patients with CML. ND=not detected. Y-axis shows the number of leukemic cells as a proportion of total cells. The DNA-based PCR used patient-specific primers synthesised using knowledge of the breakpoint sequence in the patient being studied, the RNA-based PCR was the conventional approach using reverse transcription followed by PCR using generic primers. Black symbols show MRD detected by both techniques, red symbols show disease detected only by DNA-PCR and blue symbols show disease not detected. DNA-based PCR appears to be approximately 2 orders of magnitude more sensitive than RNA-based PCR.

FIG. 7 is an illustration of the isolation of the PML-RARα breakpoint from a sample from the one patient with acute promyelocytic leukemia

DETAILED DESCRIPTION OF THE INVENTION

The present invention is predicated, in part, on the determination that gene translocation breakpoints can be routinely and easily identified, via DNA analysis, by sequentially performing two PCR reactions which use multiple primers directed to the genes flanking the breakpoint which are themselves tagged at their 5′ end with a DNA region suitable for use as a primer hybridisation site. The simultaneous use of multiple primers facilitates the performance of a short PCR, rather than the long PCRs which have been performed to date. By sequentially performing a second PCR using primers directed to gene regions internal to those used in the first reaction, amplification of a DNA molecule spanning the breakpoint region can be achieved in a manner which enables the identification and isolation of a smaller amplification product than has been enabled to date in terms of the analysis of genomic DNA. By incorporating unique tag regions which can themselves be targeted by a primer, amplification of the initial amplicon can be rapidly achieved, thereby overcoming any disadvantage associated with the use of a low concentration of starting primer directed to the genes flanking the breakpoint. The method of the present invention therefore provides a simple yet accurate means of identifying and analysing a gene breakpoint using DNA. To this end, it would be appreciated that although the method of the present invention is exemplified by reference to chronic myelogenic leukemia, this method can be applied to any situation in which a gene breakpoint is sought to be identified via a DNA sample.
Accordingly, in one aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with:

- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.

It should be understood that in a preferred embodiment of the present invention, where one primer is used in step (i)(a), it is preferable that two or more primers are used in step (i)(b). The converse applies where one primer is used in step (i)(b). Similarly, in another preferred embodiment, where one primer is used in step (iii)(a), it is preferable that two or more primers are used in step (iii)(b). The converse applies where one primer is used in step (iii)(b). Reference to the “flanking genes” 5′ and 3′ to the breakpoint should be understood as a reference to the genes or gene fragments on either side of the breakpoint. In terms of the 5′ and 3′ nomenclature which is utilised in the context of these genes/gene fragments, this should be understood as a reference to the 5′→3′ orientation of the sense strand of double stranded DNA from which the DNA of interest derives. Accordingly, reference to “the flanking gene 5′ to the breakpoint” should be understood as a reference to the sense strand of double stranded DNA. To this end, any reference to “gene” or “gene fragment” herein, to the extent that it is not specified, is a reference to the sense strand of double stranded DNA. Reference to the forward primer being directed to the antisense strand of the flanking gene 5′ to the breakpoint therefore indicates that the forward primer bears the same DNA sequence as a region of the sense strand 5′ to the breakpoint and therefore will bind to and amplify the antisense strand corresponding to that region.
Reference to “gene” should be understood as a reference to a DNA molecule which codes for a protein product, whether that be a full protein or a protein fragment. In terms of chromosomal DNA, the gene will include both intron and exon regions. However, to the extent that the DNA of interest is cDNA, such as might occur if the DNA of interest is vector DNA, there may not exist intron regions. Such DNA may nevertheless include 5′ or 3′ untranslated regions. Accordingly, reference to “gene” herein should be understood to encompass any form of DNA which codes for a protein or protein fragment including, for example, genomic DNA and cDNA.
Reference to a gene “breakpoint” should be understood as a reference to the point at which a fragment of one gene recombines with another gene or fragment thereof. That is, there has occurred a recombination of two genes such that either one or both genes have become linked at a point within one or both of the genes rather than the beginning or end of one gene being linked to the beginning or end of the other gene. That is, at least one of the subject genes has been cleaved and has recombined with all or part of another gene. The recombination of the two non-homologous gene regions may occur by any method including but not limited to chromosomal gene translocations or in vitro homologous recombinations (such as may occur where a DNA segment is being inserted into a vector or an artificial chromosome or where a vector portion thereof chromosomally integrates in a host cell).
Preferably, the subject gene breakpoint is a chromosomal gene translocation breakpoint. As detailed hereinbefore, chromosomal gene translocations are known to occur and, in some cases, lead to the onset of disease states. Since a gene translocation between two genes will not necessarily result in the breakpoint occurring at precisely the same nucleotide position on the two genes each time the translocation event occurs, it is not possible to assume that the breakpoint position in one patient, such as the Philadelphia chromosome breakpoint in one CML patient, will be the same in another patient. The method of the present invention enables the simple yet accurate determination of a gene breakpoint using DNA.
The present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising:
(i) contacting a genomic DNA sample with:

- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.

Reference to “DNA” should be understood as a reference to deoxyribonucleic acid or derivative or analogue thereof. In this regard, it should be understood to encompass all forms of DNA, including cDNA and genomic DNA. The nucleic acid molecules of the present invention may be of any origin including naturally occurring (such as would be derived from a biological sample), recombinantly produced or synthetically produced.
Reference to “derivatives” should be understood to include reference to fragments, homologs or orthologs of said DNA from natural, synthetic or recombinant sources. “Functional derivatives” should be understood as derivatives which exhibit any one or more of the functional activities of DNA. The derivatives of said DNA sequences include fragments having particular regions of the DNA molecule fused to other proteinaceous or non-proteinaceous molecules. “Analogs” contemplated herein include, but are not limited to, modifications to the nucleotide or nucleic acid molecule such as modifications to its chemical makeup or overall conformation. This includes, for example, modification to the manner in which nucleotides or nucleic acid molecules interact with other nucleotides or nucleic acid molecules such as at the level of backbone formation or complementary base pair hybridisation. The biotinylation or other form of labelling of a nucleotide or nucleic acid molecules is an example of a “functional derivative” as herein defined.
As detailed hereinbefore, the method of the present invention is predicated on the use of multiple oligonucleotide primers to facilitate the multiplexed amplification of a DNA sample of interest. In one embodiment of the present invention, the DNA sample of interest is a hybrid gene which comprises a portion of one gene (gene A) which is located 5′ to the translocation breakpoint and a second gene (gene B) which is located 3′ to the translocation breakpoint. In a particular embodiment, gene A is BCR and gene B is ABL. The identification of the existence and nature of a gene translocation breakpoint is achieved by using two or more forward primers directed to gene A and two or more reverse primers directed towards gene B. The primers directed to gene A are designed to hybridise at intervals along gene A and the primers directed to gene B are similarly designed to hybridise at intervals along gene B. In the first round PCR, the primers which will amplify the hybrid gene are the upstream primers which hybridise to that portion of gene A which lies 5′ to the breakpoint and the downstream primers which hybridise to that portion of gene B which lies 3′ to the breakpoint. Furthermore, since small amplicons are amplified more efficiently than larger amplicons, there will occur selection for amplification directed by the primer pair which hybridises closest to the breakpoint. The same principle holds for the second round primers and, since in one embodiment each second round primer corresponds to an individual first-round primer but hybridises internal to it with regard to the breakpoint, there will be further selection for amplification by the pair of the second round primers which bound the breakpoint. Without limiting the present invention in any way, the second round of PCR amplification provides additional specificity for amplification of the breakpoint region. Following the second round PCR, successful amplification of the sequence surrounding the breakpoint will be evident as a band of amplified material on electrophoresis.
Since it is not known precisely where the breakpoint lies, it is possible that one or more of the internal primers may not hybridise to their target region sequence due to this sequence having been effectively spliced out during the translocation event. However, in one embodiment, the forward and reverse primers selected for the first round amplification are directed to amplifying from the 5′ and 3′ end regions, respectively, of the gene fragments flanking the breakpoint. The second round primers are then directed to internal regions of the gene fragments flanking the breakpoint, that is, the regions which are closer to the breakpoint than the regions targeted by the first round primers. Again, it would be appreciated that since the precise location of the breakpoint is not known, one or more of these forward and/or reverse primers may not hybridise to the DNA sample due to their target region sequence having been spliced out. In terms of the second round “internal primers”, it should be understood that this is a reference to a population of primers of which at least one primer, but preferably all the primers, are designed to amplify the subject DNA from a point which, when considered in the context of the translocated gene itself (rather than the antisense strand or the amplification product), is 3′ of the most 3′ of the forward primers used in the first round amplification and 5′ of the most 5′ of the reverse primers used in the first round amplification. By using the approach of a two step amplification using progressively more internally localised primers, amplification of DNA spanning the breakpoint region can be achieved without the requirement to perform long PCRs or to generate very long and cumbersome amplification products.
Reference to a “primer” or an “oligonucleotide primer” should be understood as a reference to any molecule comprising a sequence of nucleotides, or functional derivatives or analogues thereof, the function of which includes hybridisation to a region of a nucleic acid molecule of interest (the DNA of interest also being referred to as a “target DNA”) and the amplification of the DNA sequence 5′ to that region. It should be understood that the primer may comprise non-nucleic acid components. For example, the primer may also comprise a non-nucleic acid tag such as a fluorescent or enzymatic tag or some other non-nucleic acid component which facilitates the use of the molecule as a probe or which otherwise facilitates its detection or immobilisation. The primer may also comprise additional nucleic acid components, such as the oligonucleotide tag which is discussed in more detail hereinafter. In another example, the primer may be a protein nucleic acid which comprises a peptide backbone exhibiting nucleic acid side chains. preferably, said oligonucleotide primer is a DNA primer.
Reference to “forward primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest by hybridising to the antisense strand of the target DNA.
Reference to “reverse primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest and in the PCR by hybridising to the sense strand of the target DNA.
The design and synthesis of primers suitable for use in the present invention would be well known to those of skill in the art. In one embodiment, the subject primer is 4 to 60 nucleotides in length, in another embodiment 10 to 50 in length, in yet another embodiment 15 to 45 in length, in still another embodiment 20 to 40 in length, in yet another embodiment 25 to 35 in length. In yet still another embodiment, primer is about 26, 27, 28, 29, 30, 31, 32, 33 or 34 nucleotides in length. Without limiting the invention in any way, the primers are designed in one embodiment to have a T_Mof 65 to 70° C. This enables the PCR to use a high annealing temperature, which minimises non-specific annealing and amplification. Each forward or reverse primer for the second round PCR is designed to hybridise to a sequence which is close, either downstream for the forward primer or upstream for the reverse primer, to the hybridisation sequence for its corresponding forward or reverse first-round primer. Designing the corresponding primers to hybridise to closely adjoining sequences minimises the probability that the translocation breakpoint will involve or occur between the hybridisation sequences. even if this does occur, the sequence surrounding the translation breakpoint can still be amplified by the immediately upstream or downstream, as the case may be, primer pair.
In the exemplified embodiment described herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy is in contrast to the strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. The advantages of the strategy of the present invention are that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
In terms of the number of primers which are used in the method of the invention, this can be determined by the person of skill in the art. With regard to the total number of primers, the variables which require consideration are the size of the gene region which is being targeted and the distance between the sequences to which the primers hybridise. In order to amplify PCR fragments which are no larger than about 1 kb, the primers can be designed to hybridise at intervals of approximately 500 bases. With regard to CML, nearly all BCR translocations involve one of two regions, each of approximately 3 kb in length. In this case, 12 outer forward primers and 12 corresponding inner primers may be used. The ABL gene, however, is larger, approximately 140 kb in length, and up to 280 outer reverse primers and 280 inner reverse primers may be used. In one particular embodiment, a combination of 6 forward primers and 24 reverse primers is used and in another embodiment a combination of 6 forward primers and 140 reverse primers. The primer number which is selected to be used will depend on the genes involved in the translocation and thus may vary from translocation to translocation and will involve consideration of the competing issues of the number of PCR reactions which are required to be performed versus the probability of generating non-specific products during a PCR reaction. As would be understood by the person of skill in the art, a large number of primers in each individual PCR reaction decreases the number of PCR reactions but increases the probability of non-specific amplification reactions.
In one embodiment, the method of the present invention is performed using at least three primers, in another embodiment at least four primers. In yet another embodiment said invention is performed using 6-10 primers, 6-15 primers, 6-20 primers, 6-25 primers or 6-30 primers. In still another embodiment there is used 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 primers.
There is therefore preferably provided a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with

- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  preferably, said gene breakpoint is a gene translocation breakpoint and still more preferably a chromosomal gene translocation breakpoint.

The primers which are used in the method of the present invention are of a relatively low individual concentration due to the starting primer pool comprising multiple individual primers. This reduces the risk of inducing inhibition of PCR. In order to facilitate a successful amplification result, it is therefore necessary to enable the generation of sufficient amplicons for detection and isolation. In one aspect of the present invention, this can be facilitated by tagging the primers with an oligonucleotide which can be used as a primer hybridisation site. In addition to the primers directed towards genes A and B, each PCR reaction may therefore also contain concentrations of two oligonucleotides which are directed to the tag, as a primer hybridisation site. These oligonucleotide sequences act as primers and enable efficient secondary amplification of the amplicons generated by the initial hybridisation and extension of the primers directed towards genes A and B. In one embodiment, the primer which is directed to the tag exhibits a T_Mof 65° C.-70° C. in order to minimise non-specific amplification. Thus these primers are directed towards overcoming the potential problem posed by the low concentrations of the primers directed towards A and B. Nevertheless, in some situations it may not be necessary to use one or both tag primers. For example, when there are only six forward primers for the BCR gene each primer may be at a concentration which is sufficient for relatively efficient amplification. Still further, it should be appreciated that the oligonucleotide tags provide an additional use when they are present in the final PCR round, since the tag primers can also be used for sequencing. Accordingly, although the tag is suitable for use as a site for primer hybridisation, it should be understood that the subject tag may also be useful for other purposes, such as a probe binding site in the context of Southern gel analysis or to enable isolation of the primer or the amplicon extended therefrom. To this end, the tag may comprise a non-nucleic acid component, such as a protein molecule or biotin which would enable isolation, for example by affinity chromatography, streptavidin binding or visualisation.
In order to ensure that these tags do not interfere with the extension of the primer, the primers are linked to the oligonucleotide tag at their 5′ end. Reference to “oligonucleotide tag” should therefore be understood as a reference to a nucleotide sequence of less than 50 nucleotides which is linked to the 5′ end of the forward and reverse primers of the present invention. In one embodiment, the tag is 25-30 bases in length. It should also be understood that consistently with the definitions provided in relation to the forward and reverse primers, the oligonucleotide tags herein described may also comprise non-nucleic acid components such as isolation or visualisation tags eg. biotin, enzymatic labels, fluorescent labels and the like. This enables quick and simple isolation or visualisation of the tagged primers or amplicons via non-molecular methods.
That the oligonucleotide tag is “operably linked” to the primer should be understood as a reference to those regions being linked such that the functional objectives of the tagged primer, as detailed hereinbefore, can be achieved. In terms of the means by which these regions are linked and, further, the means by which the subject oligonucleotide primer binds to its target DNA region, these correspond to various types of interactions. In this regard, reference to “interaction” should be understood as a reference to any form of interaction such as hybridisation between complementary nucleotide base pairs or some other form of interaction such as the formation of bonds between any nucleic or non-nucleic acid portion of the primer molecule or tag molecule with any other nucleic acid or non-nucleic acid molecule, such as the target molecule, a visualisation means, an isolation means or the like. This type of interaction may occur via the formation of bonds such as, but not limited to, covalent bonds, hydrogen bonds, van der Wals forces or any other mechanism of interaction. preferably, to the extent that the interaction occurs between the primer and a region of the target DNA, said interaction is hybridisation between complementary nucleotide base pairs. In order to facilitate this interaction, it is preferable that the target DNA is rendered partially or fully single stranded for a time and under conditions sufficient for hybridisation with the primer to occur.
Without limiting the present invention to any one theory or mode of action, the inclusion of an oligonucleotide tag which can itself function as a primer hybridisation site can assist in facilitating the convenient and specific amplification of the amplicon generated by the forward and reverse primers of the present invention. Accordingly, this overcomes somewhat the amplification limitation which is inherent where a relatively low starting concentration of the forward and reverse primers is used. Where the starting concentration of forward and reverse primers is sufficiently high, it may not be necessary to use a tag. Accordingly, in a preferred embodiment, the DNA sample of interest is contacted with both the forward and reverse primers of the present invention and primers directed to the oligonucleotide tags of the forward and reverse primers such that the amplification reaction of step (ii) proceeds in the context of all these primers. It should be understood, however, that although it is preferred that amplification based on both the gene primers and the tag primers is performed simultaneously, the method can be adapted to perform the tag primer based amplification step after the completion of the gene primer based amplification.
The DNA sequence of the tags may be the same or different. With respect to a first round amplification, the tags may be the same if the purpose is to amplify the initial amplification product. However, if one wishes to selectively enrich for amplicons containing the sequence of one of the flanking genes, the primer directed to the tag region of the primer of the gene of interest (eg. gene A) should differ to the primer directed to the tag region of the primer of the other gene (eg. gene B). In another example, in terms of a second or subsequent round of amplification, the tags which are used for sequencing would be required to be different to prevent the simultaneous sequencing of both strands.
The present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:

- (a) one to thirty forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  preferably said gene translocation breakpoint is a chromosomal gene translocation breakpoint.

It should be understood that the oligonucleotide primers and tags of the present invention should not be limited to the specific structure exemplified herein (being a linear, single-stranded molecule) but may extend to any suitable structural configuration which achieves the functional objectives detailed herein. For example, it may be desirable that all or part of the oligonucleotide is double stranded, comprises a looped region (such as a hairpin bend) or takes the form of an open circle confirmation, that is, where the nucleotide primer is substantially circular in shape but its terminal regions do not connect.
Facilitating the interaction of the nucleic acid primer with the target DNA may be performed by any suitable method. Those methods will be known to those skilled in the art.
Methods for achieving primer directed amplification are also very well known to those of skill in the art. In a preferred method, said amplification is polymerase chain reaction, NASBA or strand displacement amplification. Most preferably, said amplification is polymerase chain reaction. To this end, in one embodiment of the invention, a 20 minute hybridisation provides good amplification in the first round PCR.
Reference to a “sample” should be understood as a reference to either a biological or a non-biological sample. Examples of non-biological samples includes, for example, the nucleic acid products of synthetically produced nucleic acid populations. Reference to a “biological sample” should be understood as a reference to any sample of biological material derived from an animal, plant or microorganism (including cultures of microorganisms) such as, but not limited to, cellular material, blood, mucus, faeces, urine, tissue biopsy specimens, fluid which has been introduced into the body of an animal and subsequently removed (such as, for example, the saline solution extracted from the lung following lung lavage or the solution retrieved from an enema wash), plant material or plant propagation material such as seeds or flowers or a microorganism colony. The biological sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing. For example, a biopsy sample may require homogenisation prior to testing or it may require sectioning for in situ testing. Further, to the extent that the biological sample is not in liquid form, (if such form is required for testing) it may require the addition of a reagent, such as a buffer, to mobilise the sample.
To the extent that the target DNA is present in a biological sample, the biological sample may be directly tested or else all or some of the nucleic acid material present in the biological sample may be isolated prior to testing. It is within the scope of the present invention for the target nucleic acid molecule to be pre-treated prior to testing, for example inactivation of live virus or being run on a gel. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
Reference to “contacting” the sample with the primer should be understood as a reference to facilitating the mixing of the primer with the sample such that interaction (for example, hybridisation) can occur. Means of achieving this objective would be well known to those of skill in the art.
The choice of what type of sample is most suitable for testing in accordance with the method disclosed herein will be dependent on the nature of the situation, such as the nature of the condition being monitored. For example, in a preferred embodiment a neoplastic condition is the subject of analysis. If the neoplastic condition is a lymphoid leukemia, a blood sample, lymph fluid sample or bone marrow aspirate would likely provide a suitable testing sample. Where the neoplastic condition is a lymphoma, a lymph node biopsy or a blood or marrow sample would likely provide a suitable source of tissue for testing. Consideration would also be required as to whether one is monitoring the original source of the neoplastic cells or whether the presence of metastases or other forms of spreading of the neoplasia from the point of origin is to be monitored. In this regard, it may be desirable to harvest and test a number of different samples from any one mammal. Choosing an appropriate sample for any given detection scenario would fall within the skills of the person of ordinary skill in the art.
The term “mammal” to the extent that it is used herein includes humans, primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. kangaroos, deer, foxes). preferably, the mammal is a human or a laboratory test animal. Even more preferably the mammal is a human.
As detailed hereinbefore, in one embodiment the method of the present invention is performed as a sequential two step amplification using multiple second round primers each of which is directed to a gene region which is either 3′ (for the forward primers) or 5′ (for the reverse primers) to that which is targeted by the corresponding first round primers. The person of skill in the art would appreciate that in some cases it may not be necessary to conduct a second round amplification. The necessity to perform a second round amplification may also be obviated if a selective or enrichment step as described below is performed. This situation may arise when the sequence around the breakpoint is amplified very efficiently and there is very little non-specific amplification such that a clearly defined band of amplification product is observed on electrophoresis of the product of the first round amplification or if the subsequent selection step is very efficient. In general, however, it is expected that a sequential two step amplification process would be used in order to minimise non-specific amplification and to generate a relatively short amplification product which spans the breakpoint region. In general, it is expected that the amplification product would be less than 1.5 kb, less than 1 kb, less than 0.8 kb or less than 0.5 kb. It should be understood that depending on the size of the genes which have been translocated, the method of the invention may be adapted to incorporate third or fourth round amplification steps in order to further minimise non-specific amplification. This can be an issue owing to the number of primers present in the multiplexed reaction and to the fact that one of the genes participating in the translocation often contains multiple repetitive sequences such as Alu. Nevertheless, it is expected that the need for further rounds of amplification would be unlikely.
Although the method of the present invention has been designed such that the amplification steps can be sequentially performed directly on the amplification product of a previous amplification, this should not be understood as a limitation in terms of whether any additional steps are sought to be incorporated by the skilled person, such as enrichment/selection steps. For example, one may seek to select for the desired amplicons after the first round amplification and to thereafter conduct the second round amplification on their material alone. Methods which one could utilise to select or enrich include:

a selection step based on the unique oligonucleotide tags which are linked to the primers. Accordingly, since the tags themselves are also amplified and therefore form part of the amplicon, they could be used as a probe site to enable isolation of amplicons which are the result of both forward and reverse primer amplification and therefore should span the breakpoint. Alternatively, biotinylation of one of the tags provides means of identifying and isolating amplicons which have resulted from extension by either the forward or reverse primers. For example, by flooding the amplification product with biotinylated primer, the primer can act as a probe to identify the amplicons of interest and the biotinylation can provide a basis for isolating those amplicons. By ensuring that each of the primer groups of the present invention comprises a unique tag, it is possible to select out, with significant particularity, only specific amplicons of interest. In particular, the skilled person would seek to exclude amplicons which have been amplified by a forward primer but which have not then been amplified by a reverse primer, thereby indicating that the subject amplicon possibly does not extend across the breakpoint. By selecting out the amplicons which are most likely spanning the breakpoint, a subsequent round of amplification is more specifically targeted and less likely to generate unwanted amplicons as a result of either inherent cross-hybridisation of primers or the amplification of amplicons which do not flank both sides of the breakpoint.
(ii) One may seek to run the products on a gel and excise out only certain bands or regions which are likely to be relevant and thereafter subject these to a further amplification step. When a band is present on the gel after the second round amplification, if there are any problems in sequencing an attempt can be made to clean it up by cutting the product out of the gel and performing a series of PCR reactions using individual primers and/or smaller pools of primers. For example, one might use individual forward BCR primers and pools containing only 12 reverse ABL primers.
(iii) one may expose the amplified products to one or more rounds of bottleneck PCR in order to provide negative selection against non-specific amplified products.

Without limiting the application of the present invention to any one theory or mode of action, in a classical PCR, the primers and reaction conditions are designed so that primer hybridisation and extension of the forward and reverse primers occur at or close to the maximum efficiency so that the number of amplicons approximately doubles with each cycle resulting in efficient exponential amplification. Bottleneck PCR, however, is predicated on the use of forward and reverse primer sets where the primers of one set have been designed or are otherwise used under conditions wherein they do not hybridise and extend efficiently. Accordingly, although the efficient primer set will amplify normally, the inefficient set will not. As a consequence, when a sequence of interest is amplified, the number of amplicon strands is significantly less than that which would occur in a classical PCR. Efficient amplification only commences once amplicons have been generated which incorporate, at one end, the tag region of the inefficient primer. At this point, the primers directed to the tag regions effect a normal amplification rate. A “bottleneck” is therefore effectively created in terms of the generation of transcripts from the inefficient primer set.
A more severe bottleneck is usefully created where the inefficient primers are directed to commonly repeated sequences, such as an alu sequence. Amplification of unwanted product may result if such binding sites are closely apposed and if the inefficient primers can act as forward primers and reverse primers. However, owing to both primers being inefficient, amplification is initially extremely inefficient and there is a severe bottleneck. Efficient amplification only commences once amplicon strands have been generated which comprise the tag region of the inefficient primer at one end and its complement at the other. After any given number of cycles, the number of such amplicons is, however, substantially less than that which occurs during amplification of the sequence of interest. The amount of unwanted product at the end of the amplification reaction is correspondingly reduced.
Hybridisation and extension of an inefficient primer which has correctly hybridised to the sequence of interest followed in a subsequent cycle by hybridisation and extension of an efficient primer to the previously synthesised amplicon generates a template to which the tag primer can efficiently hybridise and extend. Since such molecules together with their complements provide upstream and downstream binding sites, each for an efficient primer (the tag primer and one member of the efficient set), succeeding cycles of amplification from such templates are both efficient and exponential. The result is that, after an initial lag or “bottleneck”, the overall rate of amplification speeds up in later cycles so that a near doubling of amplicon number with each cycle results. However, the net result is that there is negative selection against amplification of undesired amplicons as compared to amplicons of the sequence of interest, owing to the bottleneck at each end for the former and only at one end for the latter.
Accordingly, if the same number of commencing target sequences is considered and comparison to the amplification produced by classical PCR is made, application of the bottleneck PCR will produce a lesser increase in the number of amplicons of the sequence of interest and an even lesser increase in the number of amplicons of unwanted sequences. Although amplification of both wanted and unwanted products occurs, there is relative enrichment of the sequence of interest relative to the unwanted sequences. There is an inverse relationship between absolute amplification and enrichment since decreasing the efficiency of the inefficient primer set produces increased enrichment at the expense of lesser amplification.
Once the amplification rounds have been completed, the amplicons spanning the breakpoint region can be analysed. In a preferred embodiment, the subject amplicon is isolated by excision of a gel band containing that amplicon and sequenced in order to characterise the breakpoint region. To the extent that a band excised from a gel is to be analysed, it may be necessary to further amplify the DNA contained therein in order to provide sufficient material for sequencing. The oligonucleotide tags hereinbefore described provide a suitable primer hybridisation site to facilitate further amplification of the isolated amplicons.
As detailed hereinbefore, the method of the present invention provides a simple and routine means of identifying and characterising any breakpoint region, such as the nature, accuracy and stability of a site directed insertion of a gene into a chromosome or vector (this being important in the context of gene therapy), but in particular the chromosomal gene translocation breakpoints that are characteristic of many diseases. Examples of such translocations and diseases include, but are not limited to:

- t(2;5)(p23;q35)—anaplastic large cell lymphoma
- t(8;14) —Burkitt's lymphoma (c-myc)
- t(9;22)(q34;q11)—Philadelphia chromosome, CML, ALL (BCR-ABL recombination)
- t(11;14)—Mantle cell lymphoma (Bcl-1)
- t(11;22)(q24;q11.2-12)—Ewing's sarcoma
- t(14;18)(q32;q21)—follicular lymphoma (Bcl-2)
- t(17;22)—dermatofibrosarcoma protuberans
- t(15;17)—acute promyelocytic leukemia (pml and retinoic acid receptor genes)
- t(1;12)(q21;p13)—acute myelogenous leukemia
- t(9;12)(p24;p13)—CML, ALL (TEL-JAK2)
- t(X;18)(p11.2;q11.2)—Synovial sarcoma
- t(1;11)(q42.1;q14.3)—Schizophrenia
- t(1;19)—acute pre-B cell leukemia (PBX-1 and E2A genes).
  preferably, said chromosomal gene translocation is a BCR-ABL translocation or a PML-RARalpha translocation.
  According to this preferred embodiment there is provided a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
  (i) contacting a DNA sample with:
- (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
  (ii) amplifying the DNA sample of step (i);
  (iii) optionally contacting the amplicon generated in step (ii) with:
- (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) analysing said amplified DNA.
  preferably, said amplification steps are performed using 1-30 forward primers and 24-300 reverse primers.

In terms of the embodiment of the invention exemplified herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy may be contrasted to the prior art strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. One of the advantages of the strategy of the present invention is that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
The present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:

- (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
  (ii) amplifying the DNA sample of step (i);
  (iii) contacting the amplicon generated in step (ii) with:
- (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
  (iv) amplifying the DNA sample of step (iii);
  (v) isolating and sequencing said amplified DNA.
  More preferably, said DNA sequence is a blood derived sample.
  The method of the present invention has broad application including, but not limited to:
(i) enabling the design and generation of patient specific probes which can be used for the ongoing monitoring of a patient who is diagnosed with a disease condition characterised by chromosomal gene translocation. Results obtained by this means for chronic myeloid leukemia are shown in FIG. 6.
(ii) the analysis and monitoring of in vitro and in vivo gene transfection systems which are directed to integrating a gene or other DNA region into a chromosome, vector, plasmid, artificial chromosome or the like. Where the general site at which recombination should occur is known, the present invention can be applied to determine the specific point and nature of the integration (i.e. the breakpoint). It can also be used to monitor the ongoing stability of the genetic recombination event by virtue of enabling the generation of specific primers.

Accordingly, in yet another aspect there is provided a method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method hereinbefore defined.
Methods of screening for the subject breakpoint would be well known to those skilled in the art and include any suitable probe-based screening technique, such as PCR based methods. By virtue of the identification of the breakpoint region in accordance with the method of the invention, one can design an appropriate probe set to specifically amplify the subject breakpoint.
In one embodiment, said gene breakpoint is a chromosomal gene translocation breakpoint such as:

- t(2;5)(p23;q35)
- t(8;14)
- t(9;22)(q34;q11)
- t(11;14)
- t(11;22)(q24;q11.2-12)
- t(14;18)(q32;q21)
- t(17;22)
- t(15;17)
- t(1;12)(q21;p13)
- t(9;12)(p24;p13)
- t(X;18)(p11.2;q11.2)
- t(1;11)(q42.1;q14.3)
- t(1;19).
  In another embodiment, said condition is:
- anaplastic large cell lymphoma
- Burkitt's lymphoma
- CML, ALL
- Mantle cell lymphoma
- Ewing's sarcoma
- follicular lymphoma
- dermatofibrosarcoma protuberans
- acute promyelocytic leukemia
- acute myelogenous leukemia
- Synovial sarcoma
- Schizophrenia; or
- acute pre-B cell leukemia.

Still another aspect of the present invention is directed to a DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method hereinbefore defined.
The present invention is now described by reference to the following non-limiting examples and figures.

Example 1

Isolation of BCR/ABL Breakpoint Product from gDNA of Patient 1

Genomic DNA extracted by Qiagen Flexigene kit
1^stRound PCR (50 ng genomic DNA)—all reactions performed in duplicate
Forward primer pool—FA (Contains 7 forward BCR primers BCRF1-BCRF7 each with same 5′ tag sequence (A), Total 50 ng (7.14 ng each)
Reverse primer pool—R3/4 (Pool of 24 oligonucleotide reverse ABL primers, each with same 5′ tag sequence (C), Total 50 ng (2.08 ng each)
Forward and reverse tag sequence primers (A,C) —25 ng of each

PCR Conditions

1×PCR buffer, 5 mM MgCl₂, 0.75 ul dUTP (300 uM each), 0.4 ul Platinum Taq (2 U)

Cycling Conditions

95/4 min
(97° C./1 min, 65° C./20 min, 72° C./1 min)×5
(96° C./30 sec, 65° C./20 min, 72° C./1 min)×5
(92° C./30 sec, 65° C./20 min, 72° C./1 min)×10
2^ndRound PCR (1^stround reaction diluted 1/200 in sterile water)
Forward primer pool—NFA (Contains 7 forward internal BCR primers BFN1-BFN7 each with same 5′ tag sequence (B), Total 50 ng (7.14 ng each)
Reverse primer pool—RN3/4 (Pool of 24 oligonucleotide reverse internal ABL primers, each with same 5′ tag sequence (D), Total 50 ng (2.08 ng each)
Forward and reverse tags (B,D)—25 ng of each

PCR Conditions

1×PCR buffer, 5 mM MgCl₂, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)

Cycling Conditions

95/4 min
(94° C./30 sec, 65° C./10 min, 72° C./1 min) x10
(94° C./30 sec, 65° C./5 min, 72° C./1 min) x15

- PCR products (7 ul) resolved on 1.5% (v/v) agarose gel at 120 volts
  Identification of BCR/ABL Breakpoint from Patient 1
- PCR products resolved on 1.5% (v/v) agarose gel at 120 volt Band excised and purified via Flexigene kit
- Reamplification of Bands by PCR (1/1000 Dilution of Purified Product)
  Forward primer—Tag B (25 ng)
  Reverse primer—TagD (25 ng)
  PCR conditions

1×PCR buffer, 5 mM MgCl₂, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)

Cycling Conditions

95/4 min
(94° C./30 sec, 65° C./30 sec, 72° C./30 sec)×35

- PCR Product Sequenced with TagB primer (Flinders Sequencing Facility)

Confirmation of Breakpoint by PCR

- PCR performed on gDNA (50 ng) across breakpoint
  Patient 1 gDNA vs 10× Normal gDNA (several primer combinations)
  Forward primer—BCR (patient specific) (25 ng)
  Reverse primer—ABL (patient specific) (25 ng)

PCR Conditions

1×PCR buffer, 5 mM MgCl₂, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)

Cycling Conditions

95/4 min
(97° C./1 min, 65° C./30 sec, 72° C./30 sec)×5
(96° C./30 sec, 65° C./30 sec, 72° C./30 sec)×5
(92° C./30 sec, 65° C./30 sec, 72° C./30 sec)×25

- PCR products resolved on 3% (v/v) agarose gel at 120 volt

Band excised and purified via Qiagen minElute kit
Products sequenced with 5′ BCR specific primer to confirm BCR/ABL breakpoint (Flinders sequencing facility).
Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:

- design using standard criteria
- pairing with each BCR primer and testing by electronic PCR for amplification off the BCR template. Primers that fail this criterion are discarded.
- incorporation in a pool of 12 or 24 ABL primers, pairing the pool with each BCR primer, and testing by experimental PCR using a BCR template which has been previously produced by PCR amplification. Any pool that that produces amplification and thus fails this test is further analysed by testing each of the individual ABL primers to determine which is responsible for amplification. When identified, this primer is discarded.

The BCR and ABL primers used in Example 1 are shown in Example 2.

Example 2

Primers Used for Isolation of BCR-ABL Translocation Breakpoint in Chronic Myeloid Leukemia

BCR Primers

	1st Rd
	BCRF1-FT0	cttctccctgacatccgtgg

	BCRF2-FT0 (−5)	acacagcatacgctatgcacatgtg

	BCRF3-FT0	gaggttgttcagatgaccacgg

	BCRF4-FT1 (−10)	cagctactggagctgtcagaacag

	BCRF5-FT0	tgggcctccctgcatcc

	BCRF6-FT0	tccccctgcaccccacg

	2nd Rd
	BCRF1-FT1	tgacatccgtggagctgcagatgc

	BCRF2-FT1	acatgtgtccacacacaccccacc

	BCRF3-FT1	accacgggacacctttgaccctgg

	BCRF4-FT1 (−4)	ctggagctgtcagaacagtgaagg

	BCRF5-FT1	tccctgcatccctgcatctcctcc

	BCRF6-FT1	cccacgacttctccagcactgagc

The second round primers were internal to the first round primers and were used either for a second round together with internal ABL primers or for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
Various combinations of the forward and reverse primers can be used. In one embodiment, the protocol that was used was to set up 6 PCRs, each containing a different BCR primer and all 282 ABL primers
282 Reverse ABL Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer

	Tag A	gcaacactgtgacgtactggagg

	R1	gtctatctaaaattcacaaggaatgc

	R2	aggcaaagtaaaatccaagcaccc

	R3	cactcctgcactccagcctgg

	R4	caaccaccaaagtgcttttcctgg

	R5	atatggcatctgtaaatattaccacc

	R6	tgcctcggcctcccaaagtgc

	R7	agccaccacacccagccagg

	R8	aataactgttttctccccccaaaac

	R9	tgttttacaaaaatggggccatacc

	R10	acttaagcaaattctttcataaaaaggg

	R11	ctttcaattgttgtaccaactctcc

	R12	acctcctgcatctctccttttgc

	R13	aaataaagttttgagaaccataagtgg

	R14	caccatcacagctcactgcagc

	R15	aacctctttgagaatcggatagcc

	R16	aaataaagtacatacctccaattttgc

	R17	gacacattcctatgggtttaattcc

	R18	tgtaaaatatggtttcagaagggagg

	R19	gcaggtggataacgaggtcagg

	R20	ccagccaagaatttcaaagattagc

	R21	gaagggagatgacaaagggaacg

	R22	gcagaagaactgcttgaacctgg

	R23	gtggtcccagctactcgagagg

	R24	ccctcagcaaaactaactgaaaagg

	R25	tagaaaccaagatatctagaattccc

	R26	ccacgcccggcggaataaatgc

	R27	acaaaaaaagaggcaaaaactgagag

	R28	ctgggcgcagtggctcatgcc

	R29	tggctgtgaggctgagaactgc

	R30	ctgggcgacagagtgagactcc

	R31	aagtctggctgggcgcagtgg

	R32	aatggacaaaagaggtgaactggc

	R33	gatagagtgaaaacgcacaatggc

	R34	aattaaacagctaggtcaatatgagg

	R35	ggtctccactatcaagggacaag

	R36	aagcagctgttagtcatttccagg

	R37	aggcatcctcagattatggctcc

	R38	cctgagtaacactgagaccctgc

	R39	aacactcaagctgtcaagagacac

	R40	attcaggccaggcgcagtggc

	R41	taaatcgtaaaactgccacaaagc

	R42	cagaggagtaggagaaggaaaagg

	R43	ggtagctatctaccaagtagaatcc

	R44	atcagattggaaaaagtcccaaagc

	R45	ctcctgaaaagcacctactcagc

	R46	ctccttaaacctgaggtactggg

	R47	ttttctcctaatagaccaccattcc

	R48	ctgctgtattaccatcactcatgtc

	R49	ctggccaacatagtgaaaccacg

	R50	atttgaataggggttaaagtatcattg

	R51	cacttcagtggaagttggcatgc

	R52	gtttttcttcgaagtgataaacatacg

	R53	gctccttagtctatgtacctgtgg

	R54	tactctggcatggtaactggtgc

	R55	acaaaggactaggtctgtggagc

	R56	ccaagtttaccaaattaccaaagttacc

	R57	tgagccgatatcacgccactgc

	R58	tcccaataaaggttttggcccagg

	R59	ctgggtagcaaattagggaacagg

	R60	ctggccagaaaagacagttttatcc

	R61	ggttcccaggaagggataacacc

	R62	tcactccaggaggttccatttcc

	R63	aggcttggaaataagcagcagtgg

	R64	attcatacaatggaatactactcagc

	R65	taagtgatcctcccacctcaacc

	R66	tataagaggaagactggggctgg

	R67	tcatacttatgcaggttataggagg

	R68	caagatcacgccactgcactcc

	R69	aaaataaatagctggtgctcaagatc

	R70	caccagcctcattcaacagatgg

	R71	caatgcagcctcaacctcctgg

	R72	gttaggtcaggtgctcatgtctg

	R73	aagtttcaaaaggacatgtacaaaatg

	R74	tcctgaagaggctgcagcttcc

	R75	ctggtgcacattcccaagtgtgc

	R76	catgttggccatgttcttctgagg

	R77	ctcagcctcccgagtagctgg

	R78	aaagacatttaagaggagatgaggc

	R79	tgctgggattacaggcgtgagc

	R80	tgtgacttccatccgcagctcc

	R81	gacacttttgtggagctttcatgg

	R82	catgtgagggggcacgtcttgc

	R83	tcttctctatgagaaaagtggttgc

	R84	tggcaaaatgctatcgagctgcc

	R85	tatgaacacagccggcctcagg

	R86	gaggttgcagtgagctgagatcg

	R87	gtcaagcacccagtccgatacc

	R88	atctgggcttggtggcgcacg

	R89	gttaagcgggtcccacatcagc

	R90	cagccagtttcagtagaaagatgc

	R91	gacccaagcataaggggactagc

	R92	cccaaaaagtttacaagagaaattttc

	R93	cgcctgtagtcccagctactcg

	R94	cgcgtgatgcggaaaagaaatcc

	R95	tctactatgaaccctccttcagac

	R96	gtgctgggattacaggtgtgagc

	R97	ttatccaaatgtcccagggcagg

	R98	ctgccagcactgctcgccagc

	R99	gctactgcaggcagtgccttcc

	R100	catccaagcccaaggtgtcagg

	R101	tgtttgcatgtaatttcaggaagcc

	R102	gatccgtcactgttaacactcagg

	R103	ctcacagtcacaagctcctgagc

	R104	gagatgatgctggggtcacagg

	R105	ttagaagaatgggatcgcaaagg

	R106	cggtattcaaatatgaggtcaggc

	R107	gtaaatcctgctgccagtcttcc

	R108	acagggtcagacagagccttgg

	R109	agttattgatctaactatacaacaagc

	R110	aaagactaggggccggggacg

	R111	ctggtagaaataaagacaacaaagcc

	R112	gtgccaagtaattaaaagtttgaaacc

	R113	ggcttttgaagggagcaccacc

	R114	gaaggataaatacctatgatactttcc

	R115	ggcagggaaatactgtgcttcaag

	R116	gtggtgaaattccacctcagtacc

	R117	tcccaaagtgctgggattacagg

	R118	gaaattagcaaacaatgccaagacg

	R119	taagtattggaccgggaaggagg

	R120	ctatcattttgctcaaagtgtagcc

	R121	atttcacaaactacagaggccagg

	R122	tagacttctgtctctctatgctgc

	R123	tgagtgagctgccatgtgatacc

	R124	acttcacaccagcctgtccacc

	R125	taactcatatcctcagagagaccc

	R126	agaggttcctcgattcccctgc

	R127	gtgtcagcgtcccaacacaaagc

	R128	gaaagtggatgggcaagcattgc

	R129	gtgatcacctcacagctgcagg

	R130	gtttgtttagtcaaggcatttcacc

	R131	cctcagcctccagagtagctgg

	R132	taaaagaaaactcctccttcctgg

	R133	aatgtgctatgtctttaaatccatgg

	R134	agctggcaaatctggtaatataaaag

	R135	gcttgaacctggaaggtggagg

	R136	gcaggcatgctaagaccttcagc

	R137	cagctccatgaataactccacagg

	R138	gcttgaacccaggaggcagagg

	R139	atcgaagatgccactgcaagagg

	R140	ccaaccacacttcaggggatacc

	R141	cacgccagtccactgatactcac

	R142	gggtttcaccatgttggccagg

	R143	cccaacaaaggctctggcctgg

	R144	atgacagcagaggagcttcatcc

	R145	gcaggctacgagtaaaaggatgg

	R146	cgggtaaaatcttgcctccttcc

	R147	aaacttaaaccaatggtggatgtgg

	R148	agagactgaggaactgttccagc

	R149	gaaacggtcttggatcactgatcc

	R150	tgcgcatgatatcttgtttcaggg

	R151	ggcctccgtttaaactgttgtgc

	R152	gaatgctggcccgacacagtgg

	R153	tcttggtatagaaaagccagctgg

	R154	gcaaaagcccaagagcccctgg

	R155	ttctcccaaaatgagccccaagg

	R156	gtggtgacgtaaacaaaaggtacc

	R157	gcaaattccatgtgaatcttattggc

	R158	cctgatctatggaacagtggtgg

	R159	gttacaaacgttgcagtttgcaacg

	R160	gaaccccgtcaacagtgatcacc

	R161	acaggacctcaaggcaaggagc

	R162	catacctaaaatagaaatgtctatccc

	R163	gagttgcatatatgttttataaatccc

	R164	tgagcccacatccataaagttagc

	R165	accgcaacctttgccgcctgg

	R166	taaatattttgtatggagtcaccacc

	R167	aaagccaggagaaaaagttatgagg

	R168	tcccaaagtcccaggattacagg

	R169	tcactatggagcatctccgatgg

	R170	agttccctggaagtctccgagg

	R171	aaaataatcacccagcccacatcc

	R172	acaaaactacagacacagaaagtgg

	R173	tttgggaggctgaggtaggtgg

	R174	aaagacagtgaaacatctataaggg

	R175	cattttgggagaccagggcagg

	R176	gcatgggacagacacaaagcagc

	R177	gaataacaaagagagccggctgg

	R178	taaaccttttattgaaaattgtcaaatgg

	R179	cgcctcagcctcccaaagtgc

	R180	tacattagttttataggtccagtagg

	R181	gaaggtttattcatattaaaatgtgcc

	R182	ctggcttctgtggtttgagttgg

	R183	acagacctacctcctaaggatgg

	R184	gctagcttttgtgtgtaagaatggg

	R185	ggcctactcacacaatagaatacc

	R186	gcaccattgcactccagcctgg

	R187	gaaattaggataaaggttgtcacagc

	R188	cagaagtgttcaaggtgaaactgtc

	R189	ctgaatcatgaaatgttctactctgc

	R190	tgtcaacttgactgggccatacg

	R191	ctcccgtatagttgggattatagg

	R192	gcttggagttccttgaaattcttgg

	R193	cctggtggctccagttttctacc

	R194	aactcctgacctcatgatccacc

	R195	gctgggattacaggcatgagcc

	R196	ttctcctttatccttggtgacattc

	R197	tcccaaagtgctgggattacagg

	R198	gtcataagtcagggaccatctgc

	R199	ctgtttcattgatttccagactggc

	R200	gcaatctcggctcactgcaagc

	R201	gaagaagtgactatatcagatctgg

	R202	ttcaccatgttggccaggctgg

	R203	catcactgaagatgacaactgagc

	R204	gtccagcctgggcgatagagc

	R205	gaggaaagtctttgaagaggaacc

	R206	ggtacactcaccagcagttttgc

	R207	gagcaactggtgtgaatacatatgg

	R208	caatacctggcaccacatacacc

	R209	gggactacaggcatgtgccacc

	R210	cggtggctcacgcgtgtaatcc

	R211	caactgttaaatctctcatggaaacc

	R212	gacaaaggattagaaatgcaccc

	R213	ggaaatgttctaaaactggattgtgg

	R214	aataataatagccaggtgtggtagc

	R215	ctggaacactcacacattgctgg

	R216	ctgggtgacagagcgagactcc

	R217	cccaaatcatccccgtgaaacatgc

	R218	gaccctgcaatcccaacactgg

	R219	ctctcaggccttcaaactacacc

	R220	caggaaagggctcgctcagtgg

	R221	atctgcaaaagcagcagagcagg

	R222	gtacccatgacagacaagttttagg

	R223	cttatcccctactgtctcctttgg

	R224	ggatggtctcgatctcctgacc

	R225	aggttagagaccttcctctaatgc

	R226	agctgggattacaggtgcctgc

	R227	gctgaggcaggttggggctgc

	R228	acatttaacgtctcctaacttctcc

	R229	gtgctgcgattacaggtgtgagc

	R230	tatgacagcagtattatactatcacc

	R231	ctggggaccaaatctgaactgcc

	R232	gtagctattgttatttccaaaagagg

	R233	gcttgggaccccaggacaagg

	R234	cctggccaacatggggaaatcc

	R235	aattgcttgaacctgggaggtgg

	R236	gcctaagacccaaaagctattagc

	R237	catattaaagggccatattcaaattgg

	R238	ggatgtaaccagtgtatatcacagg

	R239	ggaagtttagtccacatcttctagc

	R240	gcacccacaggacaaccacacg

	R241	gggacgcgcctgttaacaaagg

	R242	gggctgggggccacgctcc

	R243	cgcaaaagtgaagccctcctgg

	R244	gaaatcctacttgatctaaagtgagc

	R245	tttgagcaacttggaaaaaataagcg

	R246	ttcccaaaagacaaatagcacttcc

	R247	ccattttgaaaatcacagtgaattcc

	R248	gaaaagaaaaccctgaattcaaaagg

	R249	tgctgaaaagaagcatttaaaagtgg

	R250	ctcttaccagtttcagagctttcc

	R251	ttttcagccaaaaatcaaggacagg

	R252	cttgagcccaggagtttgagacc

	R253	cgcctgtagtaccctctactagg

	R254	ggtaaagaaagaaggatttgaaaacc

	R255	taagagtaatgaggttaaagtttatgc

	R256	catttttattgtcacaggccatttgc

	R257	gccacgccttctcttctgccacc

	R258	tgcctctcctgactgcactgtg

	R259	ccatgctctaccacgcccttgg

	R260	cattcaggctggagtgcggtgg

	R261	cttaaaaattgtctggctaagacattg

	R262	ttgctcttgttgcccgggttgg

	R263	gagcttagaggaaaagtattatttcc

	R264	tggtgctgtgccagacgctgg

	R265	cagatctttttggctattgtcttgg

	R266	gaaggaaagggcctcccactgc

	R267	catgaaaaagcatgctggggagg

	R268	caaacataaaaaagctttaatagaagcc

	R269	tcccaactatgaaaaaatagaagacg

	R270	cacaaattagccgggcatggtgg

	R271	cttcctttactgagtctttctaaagc

	R272	tgtcctttgaaatgtaggtatgtgg

	R273	ggatcttgcaatactgacatctcc

	R274	atttgaaaagaactgaaggatctacc

	R275	gtgagctgagatctcgtctctgc

	R276	tttgtctgaaacagattctaaaagttgg

	R277	gcaggtgcctgtagtcccagc

	R278	gtttgagcttctaaaattcatggattc

	R279	gtggtaggtcaaaccgcaattcc

	R280	accaaatcagacatatcagctttgg

	R281	cacagaacggatcctcaataaagg

	R282	gttaactcctcccttctctttatgg

282 Reverse ABL Primers Used for the Second PCR Round and the Tag Sequence which was on the 5′ End of Each Primer

2nd Round

	Tag D	gtgttcagagagcttgatttccagg

	RN1	cccacttgatttttcccacatgg

	RN2	atttatttagatgaagtgaatattttcc

	RN3	atttagtttgtttaactgtgagtgc

	RN4	gtacagaagtgcttgatgcatacc

	RN5	aggcagataaaaattctccattagc

	RN6	acaagcacgagccacagcacc

	RN7	cgctcttgttgcccaggctgg

	RN8	cccaaaacagactttctagataacc

	RN9	ttcaaattgctttttttctactcacc

	RN10	gatctgaaaaaagtgacaggttgg

	RN11	cactgaaatttgaaaggaacatatgg

	RN12	tctggtgcagtggcctctagg

	RN13	accataagtggttttacctgatgg

	RN14	cccaggcgcaggtgattctcc

	RN15	ggtggctcacgcctgaaatcc

	RN16	cacagtccacgtgccacaatcc

	RN17	aatcatgttaacacatccctctcc

	RN18	gaagagagtgttgaaaggttaagc

	RN19	cgagaccatactggctaagatgg

	RN20	attagccacacaataaatgttctgg

	RN21	tttgaaaagcgttgcaatatgatgc

	RN22	ggttgcagtgagccgagatcg

	RN23	ggtgggaggactgcctgagc

	RN24	aacagagagaaaaaacacaaattacc

	RN25	gatatctagaattcccaaatacttgg

	RN26	gtgatagaattaaaggaaaaaataaacg

	RN27	attgttccttttctaaatattctacc

	RN28	cagcactttgggaggctgagg

	RN29	cacagaggtttcacagtgctgg

	RN30	aacttctgcttctgtccataatgc

	RN31	gcctgtaatcccagcactttgg

	RN32	gccagtaaacatatgaaaaggtgc

	RN33	aattatgtaaataaagagtgaaaagg

	RN34	cccctacacagaaaaaacaattcc

	RN35	tgagtgtcaaagaaaaatacaattgg

	RN36	atacacagagaaaatgagtccacc

	RN37	aacactccccttctctgtttagc

	RN38	gatattctttgcaacctaggatgc

	RN39	ctctaaaactaatcagcaatgtaacc

	RN40	cacctgtaatcccagcactttgg

	RN41	cgtaaaactgccacaaagcttgtagg

	RN42	gtggcagaggtgcaagcaagc

	RN43	acagaaatgacaaacgcatgtacc

	RN44	acactctcttagctaggctttgg

	RN45	gagcttggaatagggcagttcc

	RN46	ctgggttctttaaacatgtccagg

	RN47	tcaagaaaggacactgcagtggc

	RN48	catgcacacaaactatctcattcc

	RN49	tagccgggcatggtggcacg

	RN50	atcatgctgattgaatttcaaatagc

	RN51	ttggcatgcagggcagtgacc

	RN52	ggtggtgagataataacacctgc

	RN53	ttgctatataataatcatttgtgatcc

	RN54	cggtaactgttactctgggatgg

	RN55	aggctaggttcccttctcttcc

	RN56	gtagtgcctagcacagagaaagc

	RN57	ctagcctgggcaacaagagcg

	RN58	tctctctcctctctgggatcag

	RN59	gtttgaatatttgtatgcagcaagc

	RN60	tagaacaaattctggcttataaaagc

	RN61	ccactctacctttattccttgcc

	RN62	agaccagaatatgcaagcagagg

	RN63	ggacgttttgctggtgtctgcg

	RN64	aaggaacaaactgttgtcacatgc

	RN65	atgtagctgggactacaggtgc

	RN66	ggctcatgcctgtaatcccagc

	RN67	atgaggttttcacacaaaaagatgc

	RN68	tgggcgacagagcaagactcc

	RN69	aaatgtccctaaaagtgatcaacagc

	RN70	cagactcagttttacctcatcagc

	RN71	agtgatctttcctctttaacctcc

	RN72	ccagctattcaggaggccaagg

	RN73	cttaaacattatgacactgtcttgc

	RN74	ccaggtctatgaggccgttcc

	RN75	tccaaagcatccctacattatacc

	RN76	acatacatacatgcagtgactagc

	RN77	tacaggtgccagccaccatgc

	RN78	gcctgtaatcccagcactctgg

	RN79	gacagagtcccactcttgttgc

	RN80	gtgccttccaaagcagtgtagg

	RN81	tatcttactgggtatgtataatgcc

	RN82	caaaggaaatacgtcctaccagg

	RN83	ccttttctcacagacatgcttcc

	RN84	taaacacagtgagcagaatccc

	RN85	ataaagcaaacttctaaaagggtcc

	RN86	accactacactccagcctggg

	RN87	gatacctgggtcagagtaagtgc

	RN88	tgtaatctcagctacttgggagg

	RN89	gtgtcgtcttctcttcctctacg

	RN90	ctggctagtatgaggttggtgc

	RN91	ggactagccacatttcaaccagg

	RN92	gcagtatactgagaatttagtttcc

	RN93	gaggctgaggcaggagaatgg

	RN94	cattgtttgatgaaggtcaacagc

	RN95	cagacaagagtggctacggcag

	RN96	acgcccagccagattattcagg

	RN97	ggaaccagaaagaagtgcaaagg

	RN98	tgagccatcttggaggcaggc

	RN99	caggaccttcctacaaacctcc

	RN100	aacacaacatatctgaccttacgc

	RN101	gccttagaagtccagaggaaagc

	RN102	tgacgtacccagtagaccttcc

	RN103	ctctgcaagcctgggaaacagg

	RN104	gccttgtccccaagtcctaagg

	RN105	gcaaagggactcctggaattcc

	RN106	gctcctgcctgtaatcccagc

	RN107	gaaggaaacagaaaaagcagaggc

	RN108	cttactaccgttcttcttcactgg

	RN109	actattctgtttctttaggtttactgc

	RN110	cggtggctcacacctgtaatcc

	RN111	agccagagttctgtgctctagg

	RN112	taatttgcatttcgtgccgctcc

	RN113	cacttttaatacagatcccaatagg

	RN114	atgtattttttcttttcctgtcaagc

	RN115	aaatgttaacattattctccctaagg

	RN116	catatgcccagatcccgtctcc

	RN117	acaggtgtgagccgctgcacc

	RN118	gccaagacgtttacagttttggc

	RN119	aggaaacttctgaggatgatggg

	RN120	gctttatagggcagtctgaattcc

	RN121	ttagaataaaagttatctcgggagg

	RN122	taatttcttcagctttatccctcag

	RN123	cacatgactaattctctattcattcc

	RN124	aaagacctcaagaaaagagtcacc

	RN125	gacccataaagattatatgcccag

	RN126	aaagtactaatgcagtgtgtcagc

	RN127	gaggttcctcgattcccctgc

	RN128	ggagagcagaggaattcacagg

	RN129	agtaattagaaactgattctaagacg

	RN130	cataccattgccaatccagttcc

	RN131	attacgggtgcctgccactgc

	RN132	cagccaggcagaggagagagg

	RN133	ttttcattccaagtttctgtttggg

	RN134	tttcaaataggaatttggataatccc

	RN135	taagccgagatcacaccactgc

	RN136	ccttcagcgcattatatcttggc

	RN137	ccatctaatccatcttaaattcacc

	RN138	gagtggagactgcgccactgc

	RN139	aatcatgtgccaattaaaccatggc

	RN140	cccagggaccagaccagacc

	RN141	ctcactcaccagtgaaaatcagc

	RN142	ggttgctctcgaactcctgacc

	RN143	gttcccccagctcctttctgc

	RN144	agaaagatgtagaagggtccagc

	RN145	gggaaaaggtgtattatgcaagcg

	RN146	ctctctcagacctaatgcaaaagc

	RN147	aactatacatacagtatttgtattagc

	RN148	aaattaatgcaatccatgatccagg

	RN149	ctttctccactctaagagaaccc

	RN150	ttttggtgtgttcatattggctgc

	RN151	gcttccacaaatgacagacaaagg

	RN152	ggctcatgcttgtaatcccagc

	RN153	catatgaattgttgttcctttgtagg

	RN154	cactggtacaagtccaagagtcc

	RN155	gaccctgtgtctacttcctggg

	RN156	tatttgaactatctcttgaaatgtcc

	RN157	ctgattaaaaagtattacccttggc

	RN158	tttgaaactgcactcaataacttgg

	RN159	agtaatgtgtcatgatccaatggc

	RN160	gaaagcatttcccaatgtctcacc

	RN161	caatggacaaaaggcccaactgc

	RN162	tccagctctggcttttttgttaag

	RN163	acggagtctcactccgtgacc

	RN164	ctatgtcatagtcaagagactttgc

	RN165	gttcaagcgattctcctgtctcg

	RN166	ccacctaatacttaaatacggaagc

	RN167	acaacaaacttaatagtgaagtg

	RN168	ttacaggcgtgagtcaccatgc

	RN169	aacacctccaagaggccaaacg

	RN170	tactattggcaaatttcaattatatgg

	RN171	agcccacatcctaaaattcaataag

	RN172	gaaagtggataagtgtttgtctgg

	RN173	ggccaggcattcaagaccagc

	RN174	agccaacaacaaaaagacacaacc

	RN175	ttgagcccaggagttcaagacc

	RN176	cagactaaagatctcagagagaaac

	RN177	cgcttgtaatcccagcacttgg

	RN178	aaaagtgaaatcagaatttgtttcc

	RN179	caggcgtgagcaactgtgtcc

	RN180	ggtccagtaggatctcgtttgc

	RN181	actttgaaaatgttgttatagctggg

	RN182	ttccctgcatctaagtcttctcc

	RN183	agatatctaccattgaagagtttgc

	RN184	agtcttcacttcactttgttgtcc

	RN185	ccatgcaggtatgaaatataaaagc

	RN186	tgggtgacagagtgagactcc

	RN187	acagcaataccgggttaacatgc

	RN188	tttatgtaaaagatgaatgcgaggc

	RN189	ctactctgctactgggaacagg

	RN190	caaacgttagtctggcaaaatgcg

	RN191	tgcacgctaccacacccagc

	RN192	aattcttggatctgtgtgtttactgc

	RN193	taccagttatcattctctttctgc

	RN194	atccacccacctcggcctcc

	RN195	cactctgcctggcccttaatgg

	RN196	atagtttgtttaatatgccactaagg

	RN197	gcgtgagccaccgcacctgg

	RN198	ctccatcacacaaattttatgtggc

	RN199	agacggagtctcgttctgtcgc

	RN200	tcccaggttcaagccattctcc

	RN201	tattttgagagtctcactctgtcg

	RN202	gtctcgaactcctgacctcagg

	RN203	aaggaggtgaagagtgaactacg

	RN204	gtctcaggttttggacttacttgg

	RN205	tttacagatcttaaatgcattaggac

	RN206	gtacactgaacaaaggagacagg

	RN207	ctggtagtaatgcaaaatagcacc

	RN208	catttaatgtgaaatgaattataagcc

	RN209	gagacagggtttcactatgttgg

	RN210	ccagcactttggaaggctgagg

	RN211	gaaaccaagtatcatggtaaattgc

	RN212	cagtgagggctgctcagttcc

	RN213	gccaggtgcggtggctcacg

	RN214	catgcctgtaatcccagctacc

	RN215	atgtaaatggtacagtcactttagg

	RN216	cccacaatacagagaactcttacc

	RN217	tgaaacatgcagcccagtgtcc

	RN218	tgttttttctcctgccttcaatcc

	RN219	gctttcctgggtctccatctgg

	RN220	gcagccgcttgaaaacaaaacagc

	RN221	gatcacgttacatttgggggtgg

	RN222	taggctgaaaaactaaaatttgttgc

	RN223	ctcctttgggctcctttagtcc

	RN224	gcctcggcctcccaaagtgc

	RN225	aatgcctagagagatttggcagg

	RN226	gagatggggtttcactatgttgg

	RN227	tgtgatcttgccactgcactcc

	RN228	acttctcctccatttgtttcttcg

	RN229	cgtgcccgggctcagttctac

	RN230	ccaaaacaataaaatcacaatttggg

	RN231	ctgaactgccttagagtaaatccg

	RN232	atttctgtatcaggtctgtgttcc

	RN233	ggctgaccccttcactgtttcc

	RN234	caaaaattagccaggcatggtgg

	RN235	gcagtgagcagtgatcgcacc

	RN236	aaagactgtgaactaacttgtttgc

	RN237′1	tgccaagaattacacattattaggc

	RN238	ggccaggatgtcattaactttcc

	RN239	gtaagagctgacgtgtattgtgc

	RN240	cccggtgaggccgcacatcc

	RN241	cctgcgccttaaccccctcc

	RN242	cggcgcctaggggccatcg

	RN243	acttaaggaaacgaacatgacacc

	RN244	gagaccgagtcttgctgtgtcg

	RN245	gtattaattgaagatgatttggaatgc

	RN246	tctttaaaagactatcgctgaggc

	RN247	aaaagagacatcagtagagcatcc

	RN248	gttcatgttttctttgacgtctcc

	RN249	tttcgaaagttcaggctgagtgc

	RN250	gaccctcaaaacaatcctctaagg

	RN251	caaaacacacttagaaacaaactgc

	RN252	gcctgggcgacatagtgagacc

	RN253	ggcaggagaatggcgtgaacc

	RN254	tttgctcgttgcccaggctgg

	RN255	gcaacttaatgtgatagaataatagc

	RN256	cctccccttctgctgccagc

	RN257	ccacaacaatgtaaactcctctgg

	RN258	tactctccctagagttcgttccc

	RN259	gggtccccctttggccattcc

	RN260	gatcttggctcacttcaacctcc

	RN261	aggggaaatatttaaaccttgg

	RN262	aatgcaatggtgcatttacagagg

	RN263	tcattttatctatttctacatggtcc

	RN264	ggaagggaaatgcccatgaacc

	RN265	agtgaacattttctgcagcctcc

	RN266	caacaggacgtcaggcgatcc

	RN267	ccttcaggctgtcctgaaaagg

	RN268	agtctcactccatcgcccagg

	RN269	actgtgaacagtagttaactcagg

	RN270	gcatgcctgtaatccaagctgc

	RN271	gaaacaattctcttttcacacttgc

	RN272	ggctcatgcctgttatcccagc

	RN273	agaagaagcttagtcatatgtttgg

	RN274	cagatgcttgagccaaacaaatgg

	RN275	ctggcagacagagtgagactcc

	RN276	aatgtgtgaatattattcattacaggg

	RN277	gcaggagaattgcttgaacctgg

	RN278	ctttagtcaaattaaaacagtctatcc

	RN279	gatttctatctcctgcaaccacc

	RN280	ttcttgtgtaactactaaaaatctcc

	RN281	aaagggtcttcataaggctaatgg

	RN282	ctcttaaggattatttatatgaagacc

Example 3

Identification of the PML-RARalpha Breakpoint

Amplified patient DNA was electrophoresed on a 2% agarose gel. P is patient DNA, N is the normal DNA and W is the water control. The patient DNA was amplified using multiple RARα primers and a single PML primer

- a) Amplified patient DNA electrophoresed on a 2% agarose gel, P is patient DNA, N is the normal DNA and W is the water control. The patient DNA was amplified for one round using an RARα primer and a PML primer designed using the breakpoint sequence.
- b) The sequence chromatogram obtained from the patient DNA. The breakpoint between PML and RARα is shown.

Isolation of the PML-RARalpha Breakpoint in Acute Promyelocytic Leukemia

Two patients have been studied and the breakpoint has been isolated and sequenced in both. The primers used are shown in Example 4.

Example 4

Primers Used for Isolation of PML-RARalpha Translocation Breakpoint in Acute Promyelocytic Leukemia

PML Forward Primers

	1st Rd
	PML F1-FT1	caggaggagccccagagc

	PML F2-FT1	tcctggggatggttggatgc

	PML F3-FT1	tgaccccacagagtttacacagc

	PML F4-FT1	agtcagggcaggctctgcc

	PML F5-FT1	tattttggccccatccagaaagc

	PML F6-FT1	cacccagagtacagctttgttcc

	2nd Rd
	PML F1-FT2	gaggagccccagagcctgc

	PML F2-FT2	tggggatggttggatgcttacc

	PML F3-FT2	cccacagagtttacacagcttgc

	PML F4-FT2	caggctctgcccactcacc

	PML F5-FT2	ccatccagaaagcccaaagcc

	PML F6-FT2	ccagagtacagctttgttcctcattc

The second round primers were internal to the first round primers and were used for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
Various combinations of the forward and reverse primers can be used. 2 exemplary protocols were either to set up 6 PCRs, each containing a different PML primer and all 34 RARalpha primers, or to set up 1 PCR which contained all 6 forward and all 34 reverse primers.
34 Reverse RARalpha Reverse Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer

	Tag R1	gcagtacaaacaacgcacagcg

	RAR1	ctgccaccctccacagtccc

	RAR2	gccaagaccatgcatgcg

	RAR3	cccagggacaaagagactccc

	RAR4	caggaagcagacagtcttctagttcc

	RAR5	tgcctgtaatcccaacactttgg

	RAR6	tccctctggccaggatggg

	RAR7	atggggaatgggagtaggaagc

	RAR8	cagatcagttctcccctccagc

	RAR9	acaaaaaagaaacatgctcagagagg

	RAR10	tggtggcatgcatctgtagtcc

	RAR11	aggtgctctatagatgttagcatccc

	RAR12	ccaggacaggatggagatctgg

	RAR13	agggaacctgtgcattatccttgc

	RAR14	cagaagtcttgctttaaggaggagg

	RAR15	gggtacgtgaaactcaccaagg

	RAR16	cagagtgtggcaagcaaggg

	RAR17	aacattttaaaggtacaaataacgtggg

	RAR18	tagggagcaacagccattaagc

	RAR19	ggtgcactgtccagctctgg

	RAR20	actctcgctgaactcgcctgg

	RAR21	ctcggtctctggtggtacgc

	RAR22	gcaagaggtccgagctggg

	RAR23	ggaagaagtgaaacaagagatgaagg

	RAR24	cccagagaacaaaccggattagg

	RAR25	cccttcaaccttctccaatctgc

	RAR26	cccatgtccagtggtttaggg

	RAR27	gagattggtgggagacagatgg

	RAR28	cttctcagctcaaagttccagcg

	RAR29	gaatgggagagatgaccagagg

	RAR30	aagggcaagggggtatgtgg

	RAR31	ggaaggaagcatgggaacacc

	RAR32	ccatcaatgctctgtctgtctgg

	RAR33	gtgccgtgactgtgcttgg

	RAR34	acatcccattgacctcatcaagc

Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:

The BCR and ABL primers used in Example 1 are shown in Example 2.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

TABLE 1

Sequence
Identifier	Sequence

SEQ ID NO: 001	gtgggcccccccgtttccgtgtacagggcacctgca
	gggagggcaggcagctagcctgaaggctgatccccc
	cttcctgttagcacttttgatgggactagtggactt
	tggttcagaaggaagagctatgcttgttagggcctc
	ttgtctcctcccaggagtggacaaggtgggttagga
	gcagtttctccctgagtggctgc

SEQ ID NO: 002	caccacgtctggctaatttttgtatttttagtagag
	atggggtttcaacatgttagccaggctggtctcgaa
	ctcctgacctcaggtgatccacccgcctgggccctc
	caaagtgctgggattacaggcaggagccactgtgcc
	cggcctgacctcatatttgaataccgagttttagtt
	ctggaggagctgcaggttttatgaaaagggaacaca
	tttgattcctcagagcagccacaggccagctctctg
	aagtaaagtgcacgtgtgcatgtgtgtgcacactca
	cacacacgtacacacacattcacaaataactgtgcc
	cggcctgacctcatatttgaataccgagttttagtt
	ctggaggagctgcagg

SEQ ID NO: 003	tttgggaggctgaggcaggtggatcgcttgagctca
	ggagttggagaccagcctgaccaacatggtgaaacc
	ctgtgtctactaaaaatacaaagattagccgggcta
	ggcagtgggcacctgtaatcacaactgcttgggagg
	ctgagggaagagaatcgcttgaacccaggaggcgga
	ggttgcagtgagccgagcttgtgccactgcattcca
	gcctgggcgacagag

SEQ ID NO: 004	ggtctcactctgttgaactcctggtggcctcaaggg
	atcctcctacctcggcctcacaaagtattggaatta
	caggtgtgagtcactgcagctggccttcacttatca
	ctgtgaggagtaaacagctgcatggtgggcttaatg
	ccatctaacacgagtgactccatgttcagacagtag
	gatcacaaatgattattatatagcaatgaatggcca
	caggtacatagactaaggagccacatccctgct

SEQ ID NO: 005	cctccagctacctgccagccggcacttttggtcaag
	ctgttttgcattcactgttgcacatatgctcagtca
	cacacacagcatacgctatgcacatgtgtccacaca
	caccccacccacatcccacatcaccccgaccccctc
	tgctgtccttggaaccttattacacttcgagtcact
	ggtttgcctgtattgtgaaaccagctggatcc

SEQ ID NO: 006	ttatttataacaacattttcagcgtggcaactgcag
	tttcagaatggtggaattataccagtcagagagaga
	tgcaaatgatttaaaataggaagaaagcaggtgtct
	ggcccagaggaccagattaagaagaccccatgagag
	ttacaatagttagtgaaaatggtgcttctgcaaacc
	tcatgtctacagaagctggt

SEQ ID NO: 007	tgcaccttcataacataatctttctcctgggcccct
	gtctctggctgcctcataaacgctggtgtttccctc
	gtgggcctccctgcatccctgcatctcctcccgggt
	cctgtctgtgagcaatacagcgtgacaccctacgct
	gccccgtggtcccgggcttgtctctccttgcctccc
	tgttacctttctttctatctcttccttgccccg

SEQ ID NO: 008	gtgagctccgcctcctgtcagatcagtggcggcatt
	agtttctcataggagcatgaaatctattgtgaacag
	tacatgcgatggatccaggttgcgtgctcctagtga
	gaatctaatgcctgaggatctctcattgtctcttat
	cactcccagataggactgtctagttgcaggaaaaca
	agctcagggctcccactgattctacattacagtggg
	ttgtataattattatatattacaatgtaataataa

SEQ ID NO: 009	ggagtctgaggaggggaaggaggcaaggttggctcg
	gatcccagccagtaagtctgggtgtgg

SEQ ID NO: 010	cttctccctgacatccgtgg

SEQ ID NO: 011	acacagcatacgctatgcacatgtg

SEQ ID NO: 012	gaggttgttcagatgaccacgg

SEQ ID NO: 013	cagctactggagctgtcagaacag

SEQ ID NO: 014	tgggcctccctgcatcc

SEQ ID NO: 015	tccccctgcaccccacg

SEQ ID NO: 016	tgacatccgtggagctgcagatgc

SEQ ID NO: 017	acatgtgtccacacacaccccacc

SEQ ID NO: 018	accacgggacacctttgaccctgg

SEQ ID NO: 019	ctggagctgtcagaacagtgaagg

SEQ ID NO: 020	tccctgcatccctgcatctcctcc

SEQ ID NO: 021	cccacgacttctccagcactgagc

SEQ ID NO: 022	gcaacactgtgacgtactggagg

SEQ ID NO: 023	gtctatctaaaattcacaaggaatgc

SEQ ID NO: 024	aggcaaagtaaaatccaagcaccc

SEQ ID NO: 025	cactcctgcactccagcctgg

SEQ ID NO: 026	caaccaccaaagtgcttttcctgg

SEQ ID NO: 027	atatggcatctgtaaatattaccacc

SEQ ID NO: 028	tgcctcggcctcccaaagtgc

SEQ ID NO: 029	agccaccacacccagccagg

SEQ ID NO: 030	aataactgttttctccccccaaaac

SEQ ID NO: 031	tgttttacaaaaatggggccatacc

SEQ ID NO: 032	acttaagcaaattctttcataaaaaggg

SEQ ID NO: 033	ctttcaattgttgtaccaactctcc

SEQ ID NO: 034	acctcctgcatctctccttttgc

SEQ ID NO: 035	aaataaagttttgagaaccataagtgg

SEQ ID NO: 036	caccatcacagctcactgcagc

SEQ ID NO: 037	aacctctttgagaatcggatagcc

SEQ ID NO: 038	aaataaagtacatacctccaattttgc

SEQ ID NO: 039	gacacattcctatgggtttaattcc

SEQ ID NO: 040	tgtaaaatatggtttcagaagggagg

SEQ ID NO: 041	gcaggtggataacgaggtcagg

SEQ ID NO: 042	ccagccaagaatttcaaagattagc

SEQ ID NO: 043	gaagggagatgacaaagggaacg

SEQ ID NO: 044	gcagaagaactgcttgaacctgg

SEQ ID NO: 045	gtggtcccagctactcgagagg

SEQ ID NO: 046	ccctcagcaaaactaactgaaaagg

SEQ ID NO: 047	tagaaaccaagatatctagaattccc

SEQ ID NO: 048	ccacgcccggcggaataaatgc

SEQ ID NO: 049	acaaaaaaagaggcaaaaactgagag

SEQ ID NO: 050	ctgggcgcagtggctcatgcc

SEQ ID NO: 051	tggctgtgaggctgagaactgc

SEQ ID NO: 052	ctgggcgacagagtgagactcc

SEQ ID NO: 053	aagtctggctgggcgcagtgg

SEQ ID NO: 054	aatggacaaaagaggtgaactggc

SEQ ID NO: 055	gatagagtgaaaacgcacaatggc

SEQ ID NO: 056	aattaaacagctaggtcaatatgagg

SEQ ID NO: 057	ggtctccactatcaagggacaag

SEQ ID NO: 058	aagcagctgttagtcatttccagg

SEQ ID NO: 059	aggcatcctcagattatggctcc

SEQ ID NO: 060	cctgagtaacactgagaccctgc

SEQ ID NO: 061	aacactcaagctgtcaagagacac

SEQ ID NO: 062	attcaggccaggcgcagtggc

SEQ ID NO: 063	taaatcgtaaaactgccacaaagc

SEQ ID NO: 064	cagaggagtaggagaaggaaaagg

SEQ ID NO: 065	ggtagctatctaccaagtagaatcc

SEQ ID NO: 066	atcagattggaaaaagtcccaaagc

SEQ ID NO: 067	ctcctgaaaagcacctactcagc

SEQ ID NO: 068	ctccttaaacctgaggtactggg

SEQ ID NO: 069	ttttctcctaatagaccaccattcc

SEQ ID NO: 070	ctgctgtattaccatcactcatgtc

SEQ ID NO: 071	ctggccaacatagtgaaaccacg

SEQ ID NO: 072	atttgaataggggttaaagtatcattg

SEQ ID NO: 073	cacttcagtggaagttggcatgc

SEQ ID NO: 074	gtttttcttcgaagtgataaacatacg

SEQ ID NO: 075	gctccttagtctatgtacctgtgg

SEQ ID NO: 076	tactctggcatggtaactggtgc

SEQ ID NO: 077	acaaaggactaggtctgtggagc

SEQ ID NO: 078	ccaagtttaccaaattaccaaagttacc

SEQ ID NO: 079	tgagccgatatcacgccactgc

SEQ ID NO: 080	tcccaataaaggttttggcccagg

SEQ ID NO: 081	ctgggtagcaaattagggaacagg

SEQ ID NO: 082	ctggccagaaaagacagttttatcc

SEQ ID NO: 083	ggttcccaggaagggataacacc

SEQ ID NO: 084	tcactccaggaggttccatttcc

SEQ ID NO: 085	aggcttggaaataagcagcagtgg

SEQ ID NO: 086	attcatacaatggaatactactcagc

SEQ ID NO: 087	taagtgatcctcccacctcaacc

SEQ ID NO: 088	tataagaggaagactggggctgg

SEQ ID NO: 089	tcatacttatgcaggttataggagg

SEQ ID NO: 090	caagatcacgccactgcactcc

SEQ ID NO: 091	aaaataaatagctggtgctcaagatc

SEQ ID NO: 092	caccagcctcattcaacagatgg

SEQ ID NO: 093	caatgcagcctcaacctcctgg

SEQ ID NO: 094	gttaggtcaggtgctcatgtctg

SEQ ID NO: 095	aagtttcaaaaggacatgtacaaaatg

SEQ ID NO: 096	tcctgaagaggctgcagcttcc

SEQ ID NO: 097	ctggtgcacattcccaagtgtgc

SEQ ID NO: 098	catgttggccatgttcttctgagg

SEQ ID NO: 099	ctcagcctcccgagtagctgg

SEQ ID NO: 100	aaagacatttaagaggagatgaggc

SEQ ID NO: 101	tgctgggattacaggcgtgagc

SEQ ID NO: 102	tgtgacttccatccgcagctcc

SEQ ID NO: 103	gacacttttgtggagctttcatgg

SEQ ID NO: 104	catgtgagggggcacgtcttgc

SEQ ID NO: 105	tcttctctatgagaaaagtggttgc

SEQ ID NO: 106	tggcaaaatgctatcgagctgcc

SEQ ID NO: 107	tatgaacacagccggcctcagg

SEQ ID NO: 108	gaggttgcagtgagctgagatcg

SEQ ID NO: 109	gtcaagcacccagtccgatacc

SEQ ID NO: 110	atctgggcttggtggcgcacg

SEQ ID NO: 111	gttaagcgggtcccacatcagc

SEQ ID NO: 112	cagccagtttcagtagaaagatgc

SEQ ID NO: 113	gacccaagcataaggggactagc

SEQ ID NO: 114	cccaaaaagtttacaagagaaattttc

SEQ ID NO: 115	cgcctgtagtcccagctactcg

SEQ ID NO: 116	cgcgtgatgcggaaaagaaatcc

SEQ ID NO: 117	tctactatgaaccctccttcagac

SEQ ID NO: 118	gtgctgggattacaggtgtgagc

SEQ ID NO: 119	ttatccaaatgtcccagggcagg

SEQ ID NO: 120	ctgccagcactgctcgccagc

SEQ ID NO: 121	gctactgcaggcagtgccttcc

SEQ ID NO: 122	catccaagcccaaggtgtcagg

SEQ ID NO: 123	tgtttgcatgtaatttcaggaagcc

SEQ ID NO: 124	gatccgtcactgttaacactcagg

SEQ ID NO: 125	ctcacagtcacaagctcctgagc

SEQ ID NO: 126	gagatgatgctggggtcacagg

SEQ ID NO: 127	ttagaagaatgggatcgcaaagg

SEQ ID NO: 128	cggtattcaaatatgaggtcaggc

SEQ ID NO: 129	gtaaatcctgctgccagtcttcc

SEQ ID NO: 130	acagggtcagacagagccttgg

SEQ ID NO: 131	agttattgatctaactatacaacaagc

SEQ ID NO: 132	aaagactaggggccggggacg

SEQ ID NO: 133	ctggtagaaataaagacaacaaagcc

SEQ ID NO: 134	gtgccaagtaattaaaagtttgaaacc

SEQ ID NO: 135	ggcttttgaagggagcaccacc

SEQ ID NO: 136	gaaggataaatacctatgatactttcc

SEQ ID NO: 137	ggcagggaaatactgtgcttcaag

SEQ ID NO: 138	gtggtgaaattccacctcagtacc

SEQ ID NO: 139	tcccaaagtgctgggattacagg

SEQ ID NO: 140	gaaattagcaaacaatgccaagacg

SEQ ID NO: 141	taagtattggaccgggaaggagg

SEQ ID NO: 142	ctatcattttgctcaaagtgtagcc

SEQ ID NO: 143	atttcacaaactacagaggccagg

SEQ ID NO: 144	tagacttctgtctctctatgctgc

SEQ ID NO: 145	tgagtgagctgccatgtgatacc

SEQ ID NO: 146	acttcacaccagcctgtccacc

SEQ ID NO: 147	taactcatatcctcagagagaccc

SEQ ID NO: 148	agaggttcctcgattcccctgc

SEQ ID NO: 149	gtgtcagcgtcccaacacaaagc

SEQ ID NO: 150	gaaagtggatgggcaagcattgc

SEQ ID NO: 151	gtgatcacctcacagctgcagg

SEQ ID NO: 152	gtttgtttagtcaaggcatttcacc

SEQ ID NO: 153	cctcagcctccagagtagctgg

SEQ ID NO: 154	taaaagaaaactcctccttcctgg

SEQ ID NO: 155	aatgtgctatgtctttaaatccatgg

SEQ ID NO: 156	agctggcaaatctggtaatataaaag

SEQ ID NO: 157	gcttgaacctggaaggtggagg

SEQ ID NO: 158	gcaggcatgctaagaccttcagc

SEQ ID NO: 159	cagctccatgaataactccacagg

SEQ ID NO: 160	gcttgaacccaggaggcagagg

SEQ ID NO: 161	atcgaagatgccactgcaagagg

SEQ ID NO: 162	ccaaccacacttcaggggatacc

SEQ ID NO: 163	cacgccagtccactgatactcac

SEQ ID NO: 164	gggtttcaccatgttggccagg

SEQ ID NO: 165	cccaacaaaggctctggcctgg

SEQ ID NO: 166	atgacagcagaggagcttcatcc

SEQ ID NO: 167	gcaggctacgagtaaaaggatgg

SEQ ID NO: 168	cgggtaaaatcttgcctccttcc

SEQ ID NO: 169	aaacttaaaccaatggtggatgtgg

SEQ ID NO: 170	agagactgaggaactgttccagc

SEQ ID NO: 171	gaaacggtcttggatcactgatcc

SEQ ID NO: 172	tgcgcatgatatcttgtttcaggg

SEQ ID NO: 173	ggcctccgtttaaactgttgtgc

SEQ ID NO: 174	gaatgctggcccgacacagtgg

SEQ ID NO: 175	tcttggtatagaaaagccagctgg

SEQ ID NO: 176	gcaaaagcccaagagcccctgg

SEQ ID NO: 177	ttctcccaaaatgagccccaagg

SEQ ID NO: 178	gtggtgacgtaaacaaaaggtacc

SEQ ID NO: 179	gcaaattccatgtgaatcttattggc

SEQ ID NO: 180	cctgatctatggaacagtggtgg

SEQ ID NO: 181	gttacaaacgttgcagtttgcaacg

SEQ ID NO: 182	gaaccccgtcaacagtgatcacc

SEQ ID NO: 183	acaggacctcaaggcaaggagc

SEQ ID NO: 184	catacctaaaatagaaatgtctatccc

SEQ ID NO: 185	gagttgcatatatgttttataaatccc

SEQ ID NO: 186	tgagcccacatccataaagttagc

SEQ ID NO: 187	accgcaacctttgccgcctgg

SEQ ID NO: 188	taaatattttgtatggagtcaccacc

SEQ ID NO: 189	aaagccaggagaaaaagttatgagg

SEQ ID NO: 190	tcccaaagtcccaggattacagg

SEQ ID NO: 191	tcactatggagcatctccgatgg

SEQ ID NO: 192	agttccctggaagtctccgagg

SEQ ID NO: 193	aaaataatcacccagcccacatcc

SEQ ID NO: 194	acaaaactacagacacagaaagtgg

SEQ ID NO: 195	tttgggaggctgaggtaggtgg

SEQ ID NO: 196	aaagacagtgaaacatctataaggg

SEQ ID NO: 197	cattttgggagaccagggcagg

SEQ ID NO: 198	gcatgggacagacacaaagcagc

SEQ ID NO: 199	gaataacaaagagagccggctgg

SEQ ID NO: 200	taaaccttttattgaaaattgtcaaatgg

SEQ ID NO: 201	cgcctcagcctcccaaagtgc

SEQ ID NO: 202	tacattagttttataggtccagtagg

SEQ ID NO: 203	gaaggtttattcatattaaaatgtgcc

SEQ ID NO: 204	ctggcttctgtggtttgagttgg

SEQ ID NO: 205	acagacctacctcctaaggatgg

SEQ ID NO: 206	gctagcttttgtgtgtaagaatggg

SEQ ID NO: 207	ggcctactcacacaatagaatacc

SEQ ID NO: 208	gcaccattgcactccagcctgg

SEQ ID NO: 209	gaaattaggataaaggttgtcacagc

SEQ ID NO: 210	cagaagtgttcaaggtgaaactgtc

SEQ ID NO: 211	ctgaatcatgaaatgttctactctgc

SEQ ID NO: 212	tgtcaacttgactgggccatacg

SEQ ID NO: 213	ctcccgtatagttgggattatagg

SEQ ID NO: 214	gcttggagttccttgaaattcttgg

SEQ ID NO: 215	cctggtggctccagttttctacc

SEQ ID NO: 216	aactcctgacctcatgatccacc

SEQ ID NO: 217	gctgggattacaggcatgagcc

SEQ ID NO: 218	ttctcctttatccttggtgacattc

SEQ ID NO: 219	tcccaaagtgctgggattacagg

SEQ ID NO: 220	gtcataagtcagggaccatctgc

SEQ ID NO: 221	ctgtttcattgatttccagactggc

SEQ ID NO: 222	gcaatctcggctcactgcaagc

SEQ ID NO: 223	gaagaagtgactatatcagatctgg

SEQ ID NO: 224	ttcaccatgttggccaggctgg

SEQ ID NO: 225	catcactgaagatgacaactgagc

SEQ ID NO: 226	gtccagcctgggcgatagagc

SEQ ID NO: 227	gaggaaagtctttgaagaggaacc

SEQ ID NO: 228	ggtacactcaccagcagttttgc

SEQ ID NO: 229	gagcaactggtgtgaatacatatgg

SEQ ID NO: 230	caatacctggcaccacatacacc

SEQ ID NO: 231	gggactacaggcatgtgccacc

SEQ ID NO: 232	cggtggctcacgcgtgtaatcc

SEQ ID NO: 233	caactgttaaatctctcatggaaacc

SEQ ID NO: 234	gacaaaggattagaaatgcaccc

SEQ ID NO: 235	ggaaatgttctaaaactggattgtgg

SEQ ID NO: 236	aataataatagccaggtgtggtagc

SEQ ID NO: 237	ctggaacactcacacattgctgg

SEQ ID NO: 238	ctgggtgacagagcgagactcc

SEQ ID NO: 239	cccaaatcatccccgtgaaacatgc

SEQ ID NO: 240	gaccctgcaatcccaacactgg

SEQ ID NO: 241	ctctcaggccttcaaactacacc

SEQ ID NO: 242	caggaaagggctcgctcagtgg

SEQ ID NO: 243	atctgcaaaagcagcagagcagg

SEQ ID NO: 244	gtacccatgacagacaagttttagg

SEQ ID NO: 245	cttatcccctactgtctcctttgg

SEQ ID NO: 246	ggatggtctcgatctcctgacc

SEQ ID NO: 247	aggttagagaccttcctctaatgc

SEQ ID NO: 248	agctgggattacaggtgcctgc

SEQ ID NO: 249	gctgaggcaggttggggctgc

SEQ ID NO: 250	acatttaacgtctcctaacttctcc

SEQ ID NO: 251	gtgctgcgattacaggtgtgagc

SEQ ID NO: 252	tatgacagcagtattatactatcacc

SEQ ID NO: 253	ctggggaccaaatctgaactgcc

SEQ ID NO: 254	gtagctattgttatttccaaaagagg

SEQ ID NO: 255	gcttgggaccccaggacaagg

SEQ ID NO: 256	cctggccaacatggggaaatcc

SEQ ID NO: 257	aattgcttgaacctgggaggtgg

SEQ ID NO: 258	gcctaagacccaaaagctattagc

SEQ ID NO: 259	catattaaagggccatattcaaattgg

SEQ ID NO: 260	ggatgtaaccagtgtatatcacagg

SEQ ID NO: 261	ggaagtttagtccacatcttctagc

SEQ ID NO: 262	gcacccacaggacaaccacacg

SEQ ID NO: 263	gggacgcgcctgttaacaaagg

SEQ ID NO: 264	gggctgggggccacgctcc

SEQ ID NO: 265	cgcaaaagtgaagccctcctgg

SEQ ID NO: 266	gaaatcctacttgatctaaagtgagc

SEQ ID NO: 267	tttgagcaacttggaaaaaataagcg

SEQ ID NO: 268	ttcccaaaagacaaatagcacttcc

SEQ ID NO: 269	ccattttgaaaatcacagtgaattcc

SEQ ID NO: 270	gaaaagaaaaccctgaattcaaaagg

SEQ ID NO: 271	tgctgaaaagaagcatttaaaagtgg

SEQ ID NO: 272	ctcttaccagtttcagagctttcc

SEQ ID NO: 273	ttttcagccaaaaatcaaggacagg

SEQ ID NO: 274	cttgagcccaggagtttgagacc

SEQ ID NO: 275	cgcctgtagtaccctctactagg

SEQ ID NO: 276	ggtaaagaaagaaggatttgaaaacc

SEQ ID NO: 277	taagagtaatgaggttaaagtttatgc

SEQ ID NO: 278	catttttattgtcacaggccatttgc

SEQ ID NO: 279	gccacgccttctcttctgccacc

SEQ ID NO: 280	tgcctctcctgactgcactgtg

SEQ ID NO: 281	ccatgctctaccacgcccttgg

SEQ ID NO: 282	cattcaggctggagtgcggtgg

SEQ ID NO: 283	cttaaaaattgtctggctaagacattg

SEQ ID NO: 284	ttgctcttgttgcccgggttgg

SEQ ID NO: 285	gagcttagaggaaaagtattatttcc

SEQ ID NO: 286	tggtgctgtgccagacgctgg

SEQ ID NO: 287	cagatctttttggctattgtcttgg

SEQ ID NO: 288	gaaggaaagggcctcccactgc

SEQ ID NO: 289	catgaaaaagcatgctggggagg

SEQ ID NO: 290	caaacataaaaaagctttaatagaagcc

SEQ ID NO: 291	tcccaactatgaaaaaatagaagacg

SEQ ID NO: 292	cacaaattagccgggcatggtgg

SEQ ID NO: 293	cttcctttactgagtctttctaaagc

SEQ ID NO: 294	tgtcctttgaaatgtaggtatgtgg

SEQ ID NO: 295	ggatcttgcaatactgacatctcc

SEQ ID NO: 296	atttgaaaagaactgaaggatctacc

SEQ ID NO: 297	gtgagctgagatctcgtctctgc

SEQ ID NO: 298	tttgtctgaaacagattctaaaagttgg

SEQ ID NO: 299	gcaggtgcctgtagtcccagc

SEQ ID NO: 300	gtttgagcttctaaaattcatggattc

SEQ ID NO: 301	gtggtaggtcaaaccgcaattcc

SEQ ID NO: 302	accaaatcagacatatcagctttgg

SEQ ID NO: 303	cacagaacggatcctcaataaagg

SEQ ID NO: 304	gttaactcctcccttctctttatgg

SEQ ID NO: 305	gtgttcagagagcttgatttccagg

SEQ ID NO: 306	cccacttgatttttcccacatgg

SEQ ID NO: 307	atttatttagatgaagtgaatattttcc

SEQ ID NO: 308	atttagtttgtttaactgtgagtgc

SEQ ID NO: 309	gtacagaagtgcttgatgcatacc

SEQ ID NO: 310	aggcagataaaaattctccattagc

SEQ ID NO: 311	acaagcacgagccacagcacc

SEQ ID NO: 312	cgctcttgttgcccaggctgg

SEQ ID NO: 313	cccaaaacagactttctagataacc

SEQ ID NO: 314	ttcaaattgctttttttctactcacc

SEQ ID NO: 315	gatctgaaaaaagtgacaggttgg

SEQ ID NO: 316	cactgaaatttgaaaggaacatatgg

SEQ ID NO: 317	tctggtgcagtggcctctagg

SEQ ID NO: 318	accataagtggttttacctgatgg

SEQ ID NO: 319	cccaggcgcaggtgattctcc

SEQ ID NO: 320	ggtggctcacgcctgaaatcc

SEQ ID NO: 321	cacagtccacgtgccacaatcc

SEQ ID NO: 322	aatcatgttaacacatccctctcc

SEQ ID NO: 323	gaagagagtgttgaaaggttaagc

SEQ ID NO: 324	cgagaccatactggctaagatgg

SEQ ID NO: 325	attagccacacaataaatgttctgg

SEQ ID NO: 326	tttgaaaagcgttgcaatatgatgc

SEQ ID NO: 327	ggttgcagtgagccgagatcg

SEQ ID NO: 328	ggtgggaggactgcctgagc

SEQ ID NO: 329	aacagagagaaaaaacacaaattacc

SEQ ID NO: 330	gatatctagaattcccaaatacttgg

SEQ ID NO: 331	gtgatagaattaaaggaaaaaataaacg

SEQ ID NO: 332	attgttccttttctaaatattctacc

SEQ ID NO: 333	cagcactttgggaggctgagg

SEQ ID NO: 334	cacagaggtttcacagtgctgg

SEQ ID NO: 335	aacttctgcttctgtccataatgc

SEQ ID NO: 336	gcctgtaatcccagcactttgg

SEQ ID NO: 337	gccagtaaacatatgaaaaggtgc

SEQ ID NO: 338	aattatgtaaataaagagtgaaaagg

SEQ ID NO: 339	cccctacacagaaaaaacaattcc

SEQ ID NO: 340	tgagtgtcaaagaaaaatacaattgg

SEQ ID NO: 341	atacacagagaaaatgagtccacc

SEQ ID NO: 342	aacactccccttctctgtttagc

SEQ ID NO: 343	gatattctttgcaacctaggatgc

SEQ ID NO: 344	ctctaaaactaatcagcaatgtaacc

SEQ ID NO: 345	cacctgtaatcccagcactttgg

SEQ ID NO: 346	cgtaaaactgccacaaagcttgtagg

SEQ ID NO: 347	gtggcagaggtgcaagcaagc

SEQ ID NO: 348	acagaaatgacaaacgcatgtacc

SEQ ID NO: 349	acactctcttagctaggctttgg

SEQ ID NO: 350	gagcttggaatagggcagttcc

SEQ ID NO: 351	ctgggttctttaaacatgtccagg

SEQ ID NO: 352	tcaagaaaggacactgcagtggc

SEQ ID NO: 353	catgcacacaaactatctcattcc

SEQ ID NO: 354	tagccgggcatggtggcacg

SEQ ID NO: 355	atcatgctgattgaatttcaaatagc

SEQ ID NO: 356	ttggcatgcagggcagtgacc

SEQ ID NO: 357	ggtggtgagataataacacctgc

SEQ ID NO: 358	ttgctatataataatcatttgtgatcc

SEQ ID NO: 359	cggtaactgttactctgggatgg

SEQ ID NO: 360	aggctaggttcccttctcttcc

SEQ ID NO: 361	gtagtgcctagcacagagaaagc

SEQ ID NO: 362	ctagcctgggcaacaagagcg

SEQ ID NO: 363	tctctctcctctctgggatcag

SEQ ID NO: 364	gtttgaatatttgtatgcagcaagc

SEQ ID NO: 365	tagaacaaattctggcttataaaagc

SEQ ID NO: 366	ccactctacctttattccttgcc

SEQ ID NO: 367	agaccagaatatgcaagcagagg

SEQ ID NO: 368	ggacgttttgctggtgtctgcg

SEQ ID NO: 369	aaggaacaaactgttgtcacatgc

SEQ ID NO: 370	atgtagctgggactacaggtgc

SEQ ID NO: 371	ggctcatgcctgtaatcccagc

SEQ ID NO: 372	atgaggttttcacacaaaaagatgc

SEQ ID NO: 373	tgggcgacagagcaagactcc

SEQ ID NO: 374	aaatgtccctaaaagtgatcaacagc

SEQ ID NO: 375	cagactcagttttacctcatcagc

SEQ ID NO: 376	agtgatctttcctctttaacctcc

SEQ ID NO: 377	ccagctattcaggaggccaagg

SEQ ID NO: 378	cttaaacattatgacactgtcttgc

SEQ ID NO: 379	ccaggtctatgaggccgttcc

SEQ ID NO: 380	tccaaagcatccctacattatacc

SEQ ID NO: 381	acatacatacatgcagtgactagc

SEQ ID NO: 382	tacaggtgccagccaccatgc

SEQ ID NO: 383	gcctgtaatcccagcactctgg

SEQ ID NO: 384	gacagagtcccactcttgttgc

SEQ ID NO: 385	gtgccttccaaagcagtgtagg

SEQ ID NO: 386	tatcttactgggtatgtataatgcc

SEQ ID NO: 387	caaaggaaatacgtcctaccagg

SEQ ID NO: 388	ccttttctcacagacatgcttcc

SEQ ID NO: 389	taaacacagtgagcagaatccc

SEQ ID NO: 390	ataaagcaaacttctaaaagggtcc

SEQ ID NO: 391	accactacactccagcctggg

SEQ ID NO: 392	gatacctgggtcagagtaagtgc

SEQ ID NO: 393	tgtaatctcagctacttgggagg

SEQ ID NO: 394	gtgtcgtcttctcttcctctacg

SEQ ID NO: 395	ctggctagtatgaggttggtgc

SEQ ID NO: 396	ggactagccacatttcaaccagg

SEQ ID NO: 397	gcagtatactgagaatttagtttcc

SEQ ID NO: 398	gaggctgaggcaggagaatgg

SEQ ID NO: 399	cattgtttgatgaaggtcaacagc

SEQ ID NO: 400	cagacaagagtggctacggcag

SEQ ID NO: 401	acgcccagccagattattcagg

SEQ ID NO: 402	ggaaccagaaagaagtgcaaagg

SEQ ID NO: 403	tgagccatcttggaggcaggc

SEQ ID NO: 404	caggaccttcctacaaacctcc

SEQ ID NO: 405	aacacaacatatctgaccttacgc

SEQ ID NO: 406	gccttagaagtccagaggaaagc

SEQ ID NO: 407	tgacgtacccagtagaccttcc

SEQ ID NO: 408	ctctgcaagcctgggaaacagg

SEQ ID NO: 409	gccttgtccccaagtcctaagg

SEQ ID NO: 410	gcaaagggactcctggaattcc

SEQ ID NO: 411	gctcctgcctgtaatcccagc

SEQ ID NO: 412	gaaggaaacagaaaaagcagaggc

SEQ ID NO: 413	cttactaccgttcttcttcactgg

SEQ ID NO: 414	actattctgtttctttaggtttactgc

SEQ ID NO: 415	cggtggctcacacctgtaatcc

SEQ ID NO: 416	agccagagttctgtgctctagg

SEQ ID NO: 417	taatttgcatttcgtgccgctcc

SEQ ID NO: 418	cacttttaatacagatcccaatagg

SEQ ID NO: 419	atgtattttttcttttcctgtcaagc

SEQ ID NO: 420	aaatgttaacattattctccctaagg

SEQ ID NO: 421	catatgcccagatcccgtctcc

SEQ ID NO: 422	acaggtgtgagccgctgcacc

SEQ ID NO: 423	gccaagacgtttacagttttggc

SEQ ID NO: 424	aggaaacttctgaggatgatggg

SEQ ID NO: 425	gctttatagggcagtctgaattcc

SEQ ID NO: 426	ttagaataaaagttatctcgggagg

SEQ ID NO: 427	taatttcttcagctttatccctcag

SEQ ID NO: 428	cacatgactaattctctattcattcc

SEQ ID NO: 429	aaagacctcaagaaaagagtcacc

SEQ ID NO: 430	gacccataaagattatatgcccag

SEQ ID NO: 431	aaagtactaatgcagtgtgtcagc

SEQ ID NO: 432	gaggttcctcgattcccctgc

SEQ ID NO: 433	ggagagcagaggaattcacagg

SEQ ID NO: 434	agtaattagaaactgattctaagacg

SEQ ID NO: 435	cataccattgccaatccagttcc

SEQ ID NO: 436	attacgggtgcctgccactgc

SEQ ID NO: 437	cagccaggcagaggagagagg

SEQ ID NO: 438	ttttcattccaagtttctgtttggg

SEQ ID NO: 439	tttcaaataggaatttggataatccc

SEQ ID NO: 440	taagccgagatcacaccactgc

SEQ ID NO: 441	ccttcagcgcattatatcttggc

SEQ ID NO: 442	ccatctaatccatcttaaattcacc

SEQ ID NO: 443	gagtggagactgcgccactgc

SEQ ID NO: 444	aatcatgtgccaattaaaccatggc

SEQ ID NO: 445	cccagggaccagaccagacc

SEQ ID NO: 446	ctcactcaccagtgaaaatcagc

SEQ ID NO: 447	ggttgctctcgaactcctgacc

SEQ ID NO: 448	gttcccccagctcctttctgc

SEQ ID NO: 449	agaaagatgtagaagggtccagc

SEQ ID NO: 450	gggaaaaggtgtattatgcaagcg

SEQ ID NO: 451	ctctctcagacctaatgcaaaagc

SEQ ID NO: 452	aactatacatacagtatttgtattagc

SEQ ID NO: 453	aaattaatgcaatccatgatccagg

SEQ ID NO: 454	ctttctccactctaagagaaccc

SEQ ID NO: 455	ttttggtgtgttcatattggctgc

SEQ ID NO: 456	gcttccacaaatgacagacaaagg

SEQ ID NO: 457	ggctcatgcttgtaatcccagc

SEQ ID NO: 458	catatgaattgttgttcctttgtagg

SEQ ID NO: 459	cactggtacaagtccaagagtcc

SEQ ID NO: 460	gaccctgtgtctacttcctggg

SEQ ID NO: 461	tatttgaactatctcttgaaatgtcc

SEQ ID NO: 462	ctgattaaaaagtattacccttggc

SEQ ID NO: 463	tttgaaactgcactcaataacttgg

SEQ ID NO: 464	agtaatgtgtcatgatccaatggc

SEQ ID NO: 465	gaaagcatttcccaatgtctcacc

SEQ ID NO: 466	caatggacaaaaggcccaactgc

SEQ ID NO: 467	tccagctctggcttttttgttaag

SEQ ID NO: 468	acggagtctcactccgtgacc

SEQ ID NO: 469	ctatgtcatagtcaagagactttgc

SEQ ID NO: 470	gttcaagcgattctcctgtctcg

SEQ ID NO: 471	ccacctaatacttaaatacggaagc

SEQ ID NO: 472	atattcaacaaacttaatagtgaagtg

SEQ ID NO: 473	ttacaggcgtgagtcaccatgc

SEQ ID NO: 474	aacacctccaagaggccaaacg

SEQ ID NO: 475	tactattggcaaatttcaattatatgg

SEQ ID NO: 476	agcccacatcctaaaattcaataag

SEQ ID NO: 477	gaaagtggataagtgtttgtctgg

SEQ ID NO: 478	ggccaggcattcaagaccagc

SEQ ID NO: 479	agccaacaacaaaaagacacaacc

SEQ ID NO: 480	ttgagcccaggagttcaagacc

SEQ ID NO: 481	cagactaaagatctcagagagaaac

SEQ ID NO: 482	cgcttgtaatcccagcacttgg

SEQ ID NO: 483	aaaagtgaaatcagaatttgtttcc

SEQ ID NO: 484	caggcgtgagcaactgtgtcc

SEQ ID NO: 485	ggtccagtaggatctcgtttgc

SEQ ID NO: 486	actttgaaaatgttgttatagctggg

SEQ ID NO: 487	ttccctgcatctaagtcttctcc

SEQ ID NO: 488	agatatctaccattgaagagtttgc

SEQ ID NO: 489	agtcttcacttcactttgttgtcc

SEQ ID NO: 490	ccatgcaggtatgaaatataaaagc

SEQ ID NO: 491	tgggtgacagagtgagactcc

SEQ ID NO: 492	acagcaataccgggttaacatgc

SEQ ID NO: 493	tttatgtaaaagatgaatgcgaggc

SEQ ID NO: 494	ctactctgctactgggaacagg

SEQ ID NO: 495	caaacgttagtctggcaaaatgcg

SEQ ID NO: 496	tgcacgctaccacacccagc

SEQ ID NO: 497	aattcttggatctgtgtgtttactgc

SEQ ID NO: 498	taccagttatcattctctttctgc

SEQ ID NO: 499	atccacccacctcggcctcc

SEQ ID NO: 500	cactctgcctggcccttaatgg

SEQ ID NO: 501	atagtttgtttaatatgccactaagg

SEQ ID NO: 502	gcgtgagccaccgcacctgg

SEQ ID NO: 503	ctccatcacacaaattttatgtggc

SEQ ID NO: 504	agacggagtctcgttctgtcgc

SEQ ID NO: 505	tcccaggttcaagccattctcc

SEQ ID NO: 506	tattttgagagtctcactctgtcg

SEQ ID NO: 507	gtctcgaactcctgacctcagg

SEQ ID NO: 508	aaggaggtgaagagtgaactacg

SEQ ID NO: 509	gtctcaggttttggacttacttgg

SEQ ID NO: 510	tttacagatcttaaatgcattaggac

SEQ ID NO: 511	gtacactgaacaaaggagacagg

SEQ ID NO: 512	ctggtagtaatgcaaaatagcacc

SEQ ID NO: 513	catttaatgtgaaatgaattataagcc

SEQ ID NO: 514	gagacagggtttcactatgttgg

SEQ ID NO: 515	ccagcactttggaaggctgagg

SEQ ID NO: 516	gaaaccaagtatcatggtaaattgc

SEQ ID NO: 517	cagtgagggctgctcagttcc

SEQ ID NO: 518	gccaggtgcggtggctcacg

SEQ ID NO: 519	catgcctgtaatcccagctacc

SEQ ID NO: 520	atgtaaatggtacagtcactttagg

SEQ ID NO: 521	cccacaatacagagaactcttacc

SEQ ID NO: 522	tgaaacatgcagcccagtgtcc

SEQ ID NO: 523	tgttttttctcctgccttcaatcc

SEQ ID NO: 524	gctttcctgggtctccatctgg

SEQ ID NO: 525	gcagccgcttgaaaacaaaacagc

SEQ ID NO: 526	gatcacgttacatttgggggtgg

SEQ ID NO: 527	taggctgaaaaactaaaatttgttgc

SEQ ID NO: 528	ctcctttgggctcctttagtcc

SEQ ID NO: 529	gcctcggcctcccaaagtgc

SEQ ID NO: 530	aatgcctagagagatttggcagg

SEQ ID NO: 531	gagatggggtttcactatgttgg

SEQ ID NO: 532	tgtgatcttgccactgcactcc

SEQ ID NO: 533	acttctcctccatttgtttcttcg

SEQ ID NO: 534	cgtgcccgggctcagttctac

SEQ ID NO: 535	ccaaaacaataaaatcacaatttggg

SEQ ID NO: 536	ctgaactgccttagagtaaatccg

SEQ ID NO: 537	atttctgtatcaggtctgtgttcc

SEQ ID NO: 538	ggctgaccccttcactgtttcc

SEQ ID NO: 539	caaaaattagccaggcatggtgg

SEQ ID NO: 540	gcagtgagcagtgatcgcacc

SEQ ID NO: 541	aaagactgtgaactaacttgtttgc

SEQ ID NO: 542	tgccaagaattacacattattaggc

SEQ ID NO: 543	ggccaggatgtcattaactttcc

SEQ ID NO: 544	gtaagagctgacgtgtattgtgc

SEQ ID NO: 545	cccggtgaggccgcacatcc

SEQ ID NO: 546	cctgcgccttaaccccctcc

SEQ ID NO: 547	cggcgcctaggggccatcg

SEQ ID NO: 548	acttaaggaaacgaacatgacacc

SEQ ID NO: 549	gagaccgagtcttgctgtgtcg

SEQ ID NO: 550	gtattaattgaagatgatttggaatgc

SEQ ID NO: 551	tctttaaaagactatcgctgaggc

SEQ ID NO: 552	aaaagagacatcagtagagcatcc

SEQ ID NO: 553	gttcatgttttctttgacgtctcc

SEQ ID NO: 554	tttcgaaagttcaggctgagtgc

SEQ ID NO: 555	gaccctcaaaacaatcctctaagg

SEQ ID NO: 556	caaaacacacttagaaacaaactgc

SEQ ID NO: 557	gcctgggcgacatagtgagacc

SEQ ID NO: 558	ggcaggagaatggcgtgaacc

SEQ ID NO: 559	tttgctcgttgcccaggctgg

SEQ ID NO: 560	gcaacttaatgtgatagaataatagc

SEQ ID NO: 561	cctccccttctgctgccagc

SEQ ID NO: 562	ccacaacaatgtaaactcctctgg

SEQ ID NO: 563	tactctccctagagttcgttccc

SEQ ID NO: 564	gggtccccctttggccattcc

SEQ ID NO: 565	gatcttggctcacttcaacctcc

SEQ ID NO: 566	aggggaaatatttaaaccttgg

SEQ ID NO: 567	aatgcaatggtgcatttacagagg

SEQ ID NO: 568	tcattttatctatttctacatggtcc

SEQ ID NO: 569	ggaagggaaatgcccatgaacc

SEQ ID NO: 570	agtgaacattttctgcagcctcc

SEQ ID NO: 571	caacaggacgtcaggcgatcc

SEQ ID NO: 572	ccttcaggctgtcctgaaaagg

SEQ ID NO: 573	agtctcactccatcgcccagg

SEQ ID NO: 574	actgtgaacagtagttaactcagg

SEQ ID NO: 575	gcatgcctgtaatccaagctgc

SEQ ID NO: 576	gaaacaattctcttttcacacttgc

SEQ ID NO: 577	ggctcatgcctgttatcccagc

SEQ ID NO: 578	agaagaagcttagtcatatgtttgg

SEQ ID NO: 579	cagatgcttgagccaaacaaatgg

SEQ ID NO: 580	ctggcagacagagtgagactcc

SEQ ID NO: 581	aatgtgtgaatattattcattacaggg

SEQ ID NO: 582	gcaggagaattgcttgaacctgg

SEQ ID NO: 583	ctttagtcaaattaaaacagtctatcc

SEQ ID NO: 584	gatttctatctcctgcaaccacc

SEQ ID NO: 585	ttcttgtgtaactactaaaaatctcc

SEQ ID NO: 586	aaagggtcttcataaggctaatgg

SEQ ID NO: 587	ctcttaaggattatttatatgaagacc

SEQ ID NO: 588	caggaggagccccagagc

SEQ ID NO: 589	tcctggggatggttggatgc

SEQ ID NO: 590	tgaccccacagagtttacacagc

SEQ ID NO: 591	agtcagggcaggctctgcc

SEQ ID NO: 592	tattttggccccatccagaaagc

SEQ ID NO: 593	cacccagagtacagctttgttcc

SEQ ID NO: 594	gaggagccccagagcctgc

SEQ ID NO: 595	tggggatggttggatgcttacc

SEQ ID NO: 596	cccacagagtttacacagcttgc

SEQ ID NO: 597	caggctctgcccactcacc

SEQ ID NO: 598	ccatccagaaagcccaaagcc

SEQ ID NO: 599	ccagagtacagctttgttcctcattc

SEQ ID NO: 600	gcagtacaaacaacgcacagcg

SEQ ID NO: 601	ctgccaccctccacagtccc

SEQ ID NO: 602	gccaagaccatgcatgcg

SEQ ID NO: 603	cccagggacaaagagactccc

SEQ ID NO: 604	caggaagcagacagtcttctagttcc

SEQ ID NO: 605	tgcctgtaatcccaacactttgg

SEQ ID NO: 606	tccctctggccaggatggg

SEQ ID NO: 607	atggggaatgggagtaggaagc

SEQ ID NO: 608	cagatcagttctcccctccagc

SEQ ID NO: 609	acaaaaaagaaacatgctcagagagg

SEQ ID NO: 610	tggtggcatgcatctgtagtcc

SEQ ID NO: 611	aggtgctctatagatgttagcatccc

SEQ ID NO: 612	ccaggacaggatggagatctgg

SEQ ID NO: 613	agggaacctgtgcattatccttgc

SEQ ID NO: 614	cagaagtcttgctttaaggaggagg

SEQ ID NO: 615	gggtacgtgaaactcaccaagg

SEQ ID NO: 616	cagagtgtggcaagcaaggg

SEQ ID NO: 617	aacattttaaaggtacaaataacgtggg

SEQ ID NO: 618	tagggagcaacagccattaagc

SEQ ID NO: 619	ggtgcactgtccagctctgg

SEQ ID NO: 620	actctcgctgaactcgcctgg

SEQ ID NO: 621	ctcggtctctggtggtacgc

SEQ ID NO: 622	gcaagaggtccgagctggg

SEQ ID NO: 623	ggaagaagtgaaacaagagatgaagg

SEQ ID NO: 624	cccagagaacaaaccggattagg

SEQ ID NO: 625	cccttcaaccttctccaatctgc

SEQ ID NO: 626	cccatgtccagtggtttaggg

SEQ ID NO: 627	gagattggtgggagacagatgg

SEQ ID NO: 628	cttctcagctcaaagttccagcg

SEQ ID NO: 629	gaatgggagagatgaccagagg

SEQ ID NO: 630	aagggcaagggggtatgtgg

SEQ ID NO: 631	ggaaggaagcatgggaacacc

SEQ ID NO: 632	ccatcaatgctctgtctgtctgg

SEQ ID NO: 633	gtgccgtgactgtgcttgg

SEQ ID NO: 634	acatcccattgacctcatcaagc

Claims

1. A method of identifying a gene breakpoint, said method comprising:

(i) contacting a DNA sample with:

(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and

(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;

wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;

(ii) amplifying the DNA sample of step (i);

(iii) optionally contacting the amplicon generated in step (ii) with:

(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and

(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag,

wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i); and

(iv) amplifying the DNA sample of step (iii);

(v) analysing said amplified DNA.

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. (canceled)

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. (canceled)

26. (canceled)

27. (canceled)

28. A method of identifying a gene translocation breakpoint, said method comprising:

(i) contacting a DNA sample with:

(a) one or more forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;

(c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and

(d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);

(ii) amplifying the DNA sample of step (i);

(iii) optionally contacting the amplicon generated in step (ii) with:

(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;

(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;

(c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and

(d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);

wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);

(iv) amplifying the DNA sample of step (iii); and

(v) analysing said amplified DNA.

29. The method according to claim 1, wherein at least one set of said forward and reverse primers are linked to an oligonucleotide tag.

30. The method according to claim 1, wherein one primer is used in step (i)(a) and two or more primers are used in step (i)(b).

31. The method according to claim 1, wherein one primer is used in step (i)(b) and two or more primers are used in step (i)(a).

32. The method according to claim 1, wherein step (iii) is performed and one primer is used in step (iii)(a) and two or more primers are used in step (πi)(b).

33. The method according to claim 1, wherein step (iii) is performed and one primer is used in step (iii)(b) and two or more primers are used in step (iii)(a).

34. The method according to claim 1, wherein said gene breakpoint is a gene translocation breakpoint or a homologous recombination point.

35. The method according to claim 34, wherein said gene translocation breakpoint is a chromosomal gene translocation breakpoint.

36. The method according to claim 35, wherein said gene translocation breakpoint is selected from the group consisting of:

(i) BCR-ABL translocation,

(ii) PML-RARα translocation,

(iii) t(2;5)(p23;q35) translocation,

(iv) t(8; 14) translocation,

(v) t(9;22)(q34;q11) translocation,

(vi) t(11; 14) translocation,

(vii) t(11;22)(q24;q11.2-12) translocation,

(viii) t(14;18)(q32;q21) translocation,

(ix) t(17;22) translocation,

(x) t(15; 17) translocation,

(xi) t(1; 12)(q21;p 13) translocation,

(xii) t(9; 12)(p24;p 13) translocation,

(xiii) t(X;18)(p1 1.2;q1 1.2) translocation,

(xiv) t(1;1 I)(q42.1;q14.3) translocation, and

(xv) t(1; 19) translocation.

37. The method according to claim 1, wherein 1-30 primers are used in step (i)(a) and 24-400 primers are used in step (i)(b).

38. The method according to claim 37, wherein step (iii) is performed and 1-30 primers are used in step (iii)(a) and 24-400 primers are used in step (iii)(b).

39. The method according to claim 1, wherein only steps (i), (ii) and (v) are performed.

40. The method according to claim 39, wherein steps (iii) and (iv) are additionally performed.

41. The method according to claim 39, wherein said amplified DNA of step (ii) is subjected to a further step of amplification, selection or enrichment.

42. The method according to claim 41, wherein said amplification is bottleneck PCR.

43. The method according to claim 40, wherein said amplified DNA of step (iv) is subjected to a further step of amplification, selection or enrichment.

44. The method according to claim 43, wherein said amplification is bottleneck PCR.

45. The method according to claim 1, wherein said gene breakpoint is a chromosomal BCR-ABL translocation and:

(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:10-15; and

(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:23-304 and are linked to the oligonucleotide tag defined by SEQ ID NO:22

and wherein if step (iii) is performed then:

(a) the forward primers of step (iii)(a) correspond to SEQ ID NOs: 16-21; and

(b) the reverse primers of step (iii)(b) corresponds to SEQ ID NOs:306-587 and are linked to the oligonucleotide tag defined by SEQ ID NO:305.

46. The method according to claim 1, wherein said gene breakpoint is a chromosomal PML-RARalpha translocation and:

(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:588-593; and

(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:601-634 and are linked to the oligonucleotide tag defined by SEQ ID NO: 22

and wherein step (ii) is followed by bottleneck PCR which is performed using primers corresponding to SEQ ID NOs: 594-599.

47. A method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method of claim 1.

48. The method according to claim 47, wherein said condition is:

anaplastic large cell lymphoma,

Burkitt's lymphoma,

CML, ALL,

Mantle cell lymphoma,

Ewing's sarcoma,

follicular lymphoma,

dermatofibrosarcoma protuberans,

acute promyelocy e leukemia,

acute myelogenous leukemia,

Synovial sarcoma,

Schizophrenia; or

acute pre-B cell leukemia.

49. A DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method of claim 1.