US20100216138A1 - Method for dna breakpoint analysis - Google Patents
Method for dna breakpoint analysis Download PDFInfo
- Publication number
- US20100216138A1 US20100216138A1 US12/599,953 US59995308A US2010216138A1 US 20100216138 A1 US20100216138 A1 US 20100216138A1 US 59995308 A US59995308 A US 59995308A US 2010216138 A1 US2010216138 A1 US 2010216138A1
- Authority
- US
- United States
- Prior art keywords
- primers
- seq
- primer
- gene
- breakpoint
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Definitions
- the present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the breakpoint position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene breakpoint associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition.
- Chromosomal translocations bring the previously unlinked segments of the genome together by virtue of the exchange of parts between non-homologous chromosomes. Although some translocations are not associated with a new phenotype, others may result in disease due to the modulation of protein expression or the synthesis of a new fusion protein.
- translocations There are two main types of chromosomal translocations which occur, these being reciprocal translocations (also known as non-Robertsonian) and Robertsonian translocations. Further, translocations can be balanced (in an even exchange of material with no genetic information extra or missing) or unbalanced (where the exchange of chromosome material is unequal resulting in extra or missing genes).
- Reciprocal (non-Robertsonian) translocations usually result in an exchange of material between non-homologous chromosomes and are found in about 1 in 600 newborns. Such translocations are usually harmless and may be found through prenatal diagnosis. However, carriers of balanced reciprocal translocations exhibit an increased risk of creating gametes with unbalanced chromosome translocations thereby leading to miscarriages or children with abnormalities.
- Robertsonian translocations involve two acrocentric chromosomes that fuse near the centromere region with loss of the short arms. The resulting karyotype has only 45 chromosomes since two chromosomes have fused together. Robertsonian translocations have been observed involving all combinations of acrocentric chromosomes. The most common translocation involves chromosomes 13 and 14 and is seen in about 1 in 1300 persons. Like other translocations, carriers of Robertsonian translocations are phenotypically normal, but exhibit a risk of unbalanced gametes which lead to miscarriages or abnormal offspring. For example, carriers of Robertsonian translocations involving chromosome 21 exhibit a higher probability of having a child with Down syndrome.
- the shorthand t(A;B)(p1;q2) is used to denote a translocation between chromosome A and chromosome B.
- the information in the second set of parentheses when given, gives a precise location within the chromosome for chromosomes A and B respectively—with p indicating the short arm of the chromosome, q indicating the long arm, and the numbers of p and q refers to regions, bands and sub-bands seen when staining the chromosomes under microscope.
- chronic myelogenous leukemia is an example of a neoplastic condition which is caused by a chromosomal translocation.
- a chromosomal translocation unlike many neoplastic conditions, its treatment prospects are quite good if it can be effectively diagnosed and monitored.
- translocation involves the reciprocal fusion of small pieces from the long arms of chromosome 9 and 22.
- the altered chromosome 22 is known as the Philadelphia chromosome (abbreviated as Ph1).
- Ph1 Philadelphia chromosome
- the BCR-ABL fusion gene encodes a phosphoprotein (p210) that functions as a dysregulated protein tyrosine kinase and predisposes the cell to become neoplastic.
- chromosomal translocations such as those observed in chronic myelogenic leukemia
- PCR PCR technique
- the PCR technique can also be used for sensitive detection and monitoring of treatment. Monitoring to determine the effect of treatment has become increasingly important for diseases such as chronic myeloid leukemia and acute promyelocytic leukemia as increasingly effective treatment has been developed.
- the starting material for the PCR is RNA.
- the translocation breakpoint is within the introns of the respective genes and, as a consequence, RNA splicing removes the sequence of RNA transcribed by introns and results in only one or a very limited number of final mRNA products being produced, despite the very large number of different translocations which are present in the patient population.
- RNA is a difficult molecule to work with due to its inherent susceptibility to degradation.
- DNA is a more stable molecule.
- the initial identification and characterisation of the breakpoint in the context of DNA is much more difficult since cluster regions of chromosomal fusion sites often span large introns of several tens of thousands of nucleotides. These sizes are too large for direct coverage by a single PCR reaction. There therefore exists an ongoing need to develop means for routinely conducting breakpoint analyses on DNA samples.
- the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source. Further, as used herein the singular forms of “a”, “and” and “the” include plural referents unless the context clearly dictates otherwise.
- nucleotide sequence information prepared using the programme PatentIn Version 3.1, presented herein after the bibliography.
- Each nucleotide sequence is identified in the sequence listing by the numeric indicator ⁇ 210 > followed by the sequence identifier (eg. ⁇ 210 > 1 , ⁇ 210 > 2 , etc).
- the length, type of sequence (DNA, etc) and source organism for each sequence is indicated by information provided in the numeric indicator fields ⁇ 211 >, ⁇ 212 > and ⁇ 213 >, respectively.
- Nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2, etc.).
- sequence identifier referred to in the specification correlates to the information provided in numeric indicator field ⁇ 400 > in the sequence listing, which is followed by the sequence identifier (eg. ⁇ 400 > 1 , ⁇ 400 > 2 , etc). That is SEQ ID NO:1 as detailed in the specification correlates to the sequence indicated as ⁇ 400 > 1 in the sequence listing
- One aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising: contacting a DNA sample with:
- FIG. 1 is a schematic representation of the strategy for amplification of the breakpoint region in the first round PCR.
- the forward primers for gene A and the reverse primers for gene B are preferably used in pools rather than individually. Only primer pairs which closely straddle the breakpoint will produce efficient amplification. The tags and tag primers are not shown.
- the strategy for the second round PCR is the same although the forward and reverse primers are just internal to their corresponding primers in the first round.
- gene A is the BCR gene and gene B is the ABL gene.
- Primer binding sites are staggered so that the maximum amplicon size does not exceed 1 kilobase.
- FIG. 2 is a schematic representation of a protocol for isolation of the BCR-ABL translocation breakpoint in chronic myeloid leukemia.
- FIG. 3 is an image of the results of electrophoresis showing amplified material from study of one patient.
- NFA was the pool of 6 forward BCR primers and NFA13 and NFA14 were 2 pools each containing 12 reverse ABL primers.
- NFA 13/14 was a pool containing the 24 ABL primers belonging to pools 13 and 14.
- FIG. 4 is a representation of the sequences of the breakpoints in 4 patients with chronic myeloid leukemia.
- the numbers on the left are the Genbank base numbers for the BCR and ABL genes.
- FIG. 5 shows the site of the DNA breakpoints in the ABL and BCR genes in the 27 patients with breakpoints isolated and identified.
- Blue regions in the ABL gene represent the exons 1a, 1b and E2.
- Red regions in the BCR gene represent exons 13, 14 and 15.
- the DNA-based PCR used patient-specific primers synthesised using knowledge of the breakpoint sequence in the patient being studied, the RNA-based PCR was the conventional approach using reverse transcription followed by PCR using generic primers. Black symbols show MRD detected by both techniques, red symbols show disease detected only by DNA-PCR and blue symbols show disease not detected. DNA-based PCR appears to be approximately 2 orders of magnitude more sensitive than RNA-based PCR.
- FIG. 7 is an illustration of the isolation of the PML-RAR ⁇ breakpoint from a sample from the one patient with acute promyelocytic leukemia
- the present invention is predicated, in part, on the determination that gene translocation breakpoints can be routinely and easily identified, via DNA analysis, by sequentially performing two PCR reactions which use multiple primers directed to the genes flanking the breakpoint which are themselves tagged at their 5′ end with a DNA region suitable for use as a primer hybridisation site.
- the simultaneous use of multiple primers facilitates the performance of a short PCR, rather than the long PCRs which have been performed to date.
- amplification of a DNA molecule spanning the breakpoint region can be achieved in a manner which enables the identification and isolation of a smaller amplification product than has been enabled to date in terms of the analysis of genomic DNA.
- the method of the present invention therefore provides a simple yet accurate means of identifying and analysing a gene breakpoint using DNA. To this end, it would be appreciated that although the method of the present invention is exemplified by reference to chronic myelogenic leukemia, this method can be applied to any situation in which a gene breakpoint is sought to be identified via a DNA sample.
- the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
- step (i)(a) where one primer is used in step (i)(a), it is preferable that two or more primers are used in step (i)(b). The converse applies where one primer is used in step (i)(b). Similarly, in another preferred embodiment, where one primer is used in step (iii)(a), it is preferable that two or more primers are used in step (iii)(b). The converse applies where one primer is used in step (iii)(b).
- Reference to the “flanking genes” 5′ and 3′ to the breakpoint should be understood as a reference to the genes or gene fragments on either side of the breakpoint.
- any reference to “gene” or “gene fragment” herein, to the extent that it is not specified, is a reference to the sense strand of double stranded DNA.
- Reference to the forward primer being directed to the antisense strand of the flanking gene 5′ to the breakpoint therefore indicates that the forward primer bears the same DNA sequence as a region of the sense strand 5′ to the breakpoint and therefore will bind to and amplify the antisense strand corresponding to that region.
- references to “gene” should be understood as a reference to a DNA molecule which codes for a protein product, whether that be a full protein or a protein fragment.
- the gene will include both intron and exon regions.
- the DNA of interest is cDNA, such as might occur if the DNA of interest is vector DNA, there may not exist intron regions. Such DNA may nevertheless include 5′ or 3′ untranslated regions.
- reference to “gene” herein should be understood to encompass any form of DNA which codes for a protein or protein fragment including, for example, genomic DNA and cDNA.
- Reference to a gene “breakpoint” should be understood as a reference to the point at which a fragment of one gene recombines with another gene or fragment thereof. That is, there has occurred a recombination of two genes such that either one or both genes have become linked at a point within one or both of the genes rather than the beginning or end of one gene being linked to the beginning or end of the other gene. That is, at least one of the subject genes has been cleaved and has recombined with all or part of another gene.
- the recombination of the two non-homologous gene regions may occur by any method including but not limited to chromosomal gene translocations or in vitro homologous recombinations (such as may occur where a DNA segment is being inserted into a vector or an artificial chromosome or where a vector portion thereof chromosomally integrates in a host cell).
- the subject gene breakpoint is a chromosomal gene translocation breakpoint.
- chromosomal gene translocations are known to occur and, in some cases, lead to the onset of disease states. Since a gene translocation between two genes will not necessarily result in the breakpoint occurring at precisely the same nucleotide position on the two genes each time the translocation event occurs, it is not possible to assume that the breakpoint position in one patient, such as the Philadelphia chromosome breakpoint in one CML patient, will be the same in another patient.
- the method of the present invention enables the simple yet accurate determination of a gene breakpoint using DNA.
- the present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising: (i) contacting a genomic DNA sample with:
- DNA should be understood as a reference to deoxyribonucleic acid or derivative or analogue thereof. In this regard, it should be understood to encompass all forms of DNA, including cDNA and genomic DNA.
- the nucleic acid molecules of the present invention may be of any origin including naturally occurring (such as would be derived from a biological sample), recombinantly produced or synthetically produced.
- references to “derivatives” should be understood to include reference to fragments, homologs or orthologs of said DNA from natural, synthetic or recombinant sources. “Functional derivatives” should be understood as derivatives which exhibit any one or more of the functional activities of DNA. The derivatives of said DNA sequences include fragments having particular regions of the DNA molecule fused to other proteinaceous or non-proteinaceous molecules. “Analogs” contemplated herein include, but are not limited to, modifications to the nucleotide or nucleic acid molecule such as modifications to its chemical makeup or overall conformation.
- nucleotides or nucleic acid molecules interact with other nucleotides or nucleic acid molecules such as at the level of backbone formation or complementary base pair hybridisation.
- biotinylation or other form of labelling of a nucleotide or nucleic acid molecules is an example of a “functional derivative” as herein defined.
- the method of the present invention is predicated on the use of multiple oligonucleotide primers to facilitate the multiplexed amplification of a DNA sample of interest.
- the DNA sample of interest is a hybrid gene which comprises a portion of one gene (gene A) which is located 5′ to the translocation breakpoint and a second gene (gene B) which is located 3′ to the translocation breakpoint.
- gene A is BCR and gene B is ABL.
- the identification of the existence and nature of a gene translocation breakpoint is achieved by using two or more forward primers directed to gene A and two or more reverse primers directed towards gene B.
- the primers directed to gene A are designed to hybridise at intervals along gene A and the primers directed to gene B are similarly designed to hybridise at intervals along gene B.
- the primers which will amplify the hybrid gene are the upstream primers which hybridise to that portion of gene A which lies 5′ to the breakpoint and the downstream primers which hybridise to that portion of gene B which lies 3′ to the breakpoint. Furthermore, since small amplicons are amplified more efficiently than larger amplicons, there will occur selection for amplification directed by the primer pair which hybridises closest to the breakpoint.
- each second round primer corresponds to an individual first-round primer but hybridises internal to it with regard to the breakpoint, there will be further selection for amplification by the pair of the second round primers which bound the breakpoint.
- the second round of PCR amplification provides additional specificity for amplification of the breakpoint region. Following the second round PCR, successful amplification of the sequence surrounding the breakpoint will be evident as a band of amplified material on electrophoresis.
- the forward and reverse primers selected for the first round amplification are directed to amplifying from the 5′ and 3′ end regions, respectively, of the gene fragments flanking the breakpoint.
- the second round primers are then directed to internal regions of the gene fragments flanking the breakpoint, that is, the regions which are closer to the breakpoint than the regions targeted by the first round primers.
- the second round “internal primers” is a reference to a population of primers of which at least one primer, but preferably all the primers, are designed to amplify the subject DNA from a point which, when considered in the context of the translocated gene itself (rather than the antisense strand or the amplification product), is 3′ of the most 3′ of the forward primers used in the first round amplification and 5′ of the most 5′ of the reverse primers used in the first round amplification.
- amplification of DNA spanning the breakpoint region can be achieved without the requirement to perform long PCRs or to generate very long and cumbersome amplification products.
- a “primer” or an “oligonucleotide primer” should be understood as a reference to any molecule comprising a sequence of nucleotides, or functional derivatives or analogues thereof, the function of which includes hybridisation to a region of a nucleic acid molecule of interest (the DNA of interest also being referred to as a “target DNA”) and the amplification of the DNA sequence 5′ to that region.
- the primer may comprise non-nucleic acid components.
- the primer may also comprise a non-nucleic acid tag such as a fluorescent or enzymatic tag or some other non-nucleic acid component which facilitates the use of the molecule as a probe or which otherwise facilitates its detection or immobilisation.
- the primer may also comprise additional nucleic acid components, such as the oligonucleotide tag which is discussed in more detail hereinafter.
- the primer may be a protein nucleic acid which comprises a peptide backbone exhibiting nucleic acid side chains. preferably, said oligonucleotide primer is a DNA primer.
- forward primer should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest by hybridising to the antisense strand of the target DNA.
- reverse primer should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest and in the PCR by hybridising to the sense strand of the target DNA.
- primers suitable for use in the present invention would be well known to those of skill in the art.
- the subject primer is 4 to 60 nucleotides in length, in another embodiment 10 to 50 in length, in yet another embodiment 15 to 45 in length, in still another embodiment 20 to 40 in length, in yet another embodiment 25 to 35 in length.
- primer is about 26, 27, 28, 29, 30, 31, 32, 33 or 34 nucleotides in length.
- the primers are designed in one embodiment to have a T M of 65 to 70° C. This enables the PCR to use a high annealing temperature, which minimises non-specific annealing and amplification.
- Each forward or reverse primer for the second round PCR is designed to hybridise to a sequence which is close, either downstream for the forward primer or upstream for the reverse primer, to the hybridisation sequence for its corresponding forward or reverse first-round primer. Designing the corresponding primers to hybridise to closely adjoining sequences minimises the probability that the translocation breakpoint will involve or occur between the hybridisation sequences. Even if this does occur, the sequence surrounding the translation breakpoint can still be amplified by the immediately upstream or downstream, as the case may be, primer pair.
- primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase.
- This strategy is in contrast to the strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction.
- the advantages of the strategy of the present invention are that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
- the number of primers which are used in the method of the invention this can be determined by the person of skill in the art.
- the variables which require consideration are the size of the gene region which is being targeted and the distance between the sequences to which the primers hybridise.
- the primers can be designed to hybridise at intervals of approximately 500 bases.
- CML nearly all BCR translocations involve one of two regions, each of approximately 3 kb in length. In this case, 12 outer forward primers and 12 corresponding inner primers may be used.
- the ABL gene is larger, approximately 140 kb in length, and up to 280 outer reverse primers and 280 inner reverse primers may be used. In one particular embodiment, a combination of 6 forward primers and 24 reverse primers is used and in another embodiment a combination of 6 forward primers and 140 reverse primers.
- the primer number which is selected to be used will depend on the genes involved in the translocation and thus may vary from translocation to translocation and will involve consideration of the competing issues of the number of PCR reactions which are required to be performed versus the probability of generating non-specific products during a PCR reaction. As would be understood by the person of skill in the art, a large number of primers in each individual PCR reaction decreases the number of PCR reactions but increases the probability of non-specific amplification reactions.
- the method of the present invention is performed using at least three primers, in another embodiment at least four primers.
- said invention is performed using 6-10 primers, 6-15 primers, 6-20 primers, 6-25 primers or 6-30 primers.
- a method of identifying a gene breakpoint comprising: (i) contacting a DNA sample with
- the primers which are used in the method of the present invention are of a relatively low individual concentration due to the starting primer pool comprising multiple individual primers. This reduces the risk of inducing inhibition of PCR. In order to facilitate a successful amplification result, it is therefore necessary to enable the generation of sufficient amplicons for detection and isolation. In one aspect of the present invention, this can be facilitated by tagging the primers with an oligonucleotide which can be used as a primer hybridisation site. In addition to the primers directed towards genes A and B, each PCR reaction may therefore also contain concentrations of two oligonucleotides which are directed to the tag, as a primer hybridisation site.
- oligonucleotide sequences act as primers and enable efficient secondary amplification of the amplicons generated by the initial hybridisation and extension of the primers directed towards genes A and B.
- the primer which is directed to the tag exhibits a T M of 65° C.-70° C. in order to minimise non-specific amplification.
- these primers are directed towards overcoming the potential problem posed by the low concentrations of the primers directed towards A and B.
- the oligonucleotide tags provide an additional use when they are present in the final PCR round, since the tag primers can also be used for sequencing. Accordingly, although the tag is suitable for use as a site for primer hybridisation, it should be understood that the subject tag may also be useful for other purposes, such as a probe binding site in the context of Southern gel analysis or to enable isolation of the primer or the amplicon extended therefrom. To this end, the tag may comprise a non-nucleic acid component, such as a protein molecule or biotin which would enable isolation, for example by affinity chromatography, streptavidin binding or visualisation.
- a non-nucleic acid component such as a protein molecule or biotin which would enable isolation, for example by affinity chromatography, streptavidin binding or visualisation.
- the primers are linked to the oligonucleotide tag at their 5′ end.
- Reference to “oligonucleotide tag” should therefore be understood as a reference to a nucleotide sequence of less than 50 nucleotides which is linked to the 5′ end of the forward and reverse primers of the present invention. In one embodiment, the tag is 25-30 bases in length.
- the oligonucleotide tags herein described may also comprise non-nucleic acid components such as isolation or visualisation tags eg. biotin, enzymatic labels, fluorescent labels and the like. This enables quick and simple isolation or visualisation of the tagged primers or amplicons via non-molecular methods.
- these regions correspond to various types of interactions.
- interaction should be understood as a reference to any form of interaction such as hybridisation between complementary nucleotide base pairs or some other form of interaction such as the formation of bonds between any nucleic or non-nucleic acid portion of the primer molecule or tag molecule with any other nucleic acid or non-nucleic acid molecule, such as the target molecule, a visualisation means, an isolation means or the like.
- This type of interaction may occur via the formation of bonds such as, but not limited to, covalent bonds, hydrogen bonds, van der Wals forces or any other mechanism of interaction.
- said interaction is hybridisation between complementary nucleotide base pairs.
- the target DNA is rendered partially or fully single stranded for a time and under conditions sufficient for hybridisation with the primer to occur.
- an oligonucleotide tag which can itself function as a primer hybridisation site can assist in facilitating the convenient and specific amplification of the amplicon generated by the forward and reverse primers of the present invention. Accordingly, this overcomes somewhat the amplification limitation which is inherent where a relatively low starting concentration of the forward and reverse primers is used. Where the starting concentration of forward and reverse primers is sufficiently high, it may not be necessary to use a tag.
- the DNA sample of interest is contacted with both the forward and reverse primers of the present invention and primers directed to the oligonucleotide tags of the forward and reverse primers such that the amplification reaction of step (ii) proceeds in the context of all these primers.
- the method can be adapted to perform the tag primer based amplification step after the completion of the gene primer based amplification.
- the DNA sequence of the tags may be the same or different. With respect to a first round amplification, the tags may be the same if the purpose is to amplify the initial amplification product. However, if one wishes to selectively enrich for amplicons containing the sequence of one of the flanking genes, the primer directed to the tag region of the primer of the gene of interest (eg. gene A) should differ to the primer directed to the tag region of the primer of the other gene (eg. gene B). In another example, in terms of a second or subsequent round of amplification, the tags which are used for sequencing would be required to be different to prevent the simultaneous sequencing of both strands.
- the present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising: (i) contacting a DNA sample with:
- oligonucleotide primers and tags of the present invention should not be limited to the specific structure exemplified herein (being a linear, single-stranded molecule) but may extend to any suitable structural configuration which achieves the functional objectives detailed herein.
- Facilitating the interaction of the nucleic acid primer with the target DNA may be performed by any suitable method. Those methods will be known to those skilled in the art.
- said amplification is polymerase chain reaction, NASBA or strand displacement amplification. Most preferably, said amplification is polymerase chain reaction.
- a 20 minute hybridisation provides good amplification in the first round PCR.
- references to a “sample” should be understood as a reference to either a biological or a non-biological sample.
- non-biological samples includes, for example, the nucleic acid products of synthetically produced nucleic acid populations.
- Reference to a “biological sample” should be understood as a reference to any sample of biological material derived from an animal, plant or microorganism (including cultures of microorganisms) such as, but not limited to, cellular material, blood, mucus, faeces, urine, tissue biopsy specimens, fluid which has been introduced into the body of an animal and subsequently removed (such as, for example, the saline solution extracted from the lung following lung lavage or the solution retrieved from an enema wash), plant material or plant propagation material such as seeds or flowers or a microorganism colony.
- the biological sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing.
- a biopsy sample may require homogenisation prior to testing or it may require sectioning for in situ testing.
- a reagent such as a buffer
- the biological sample may be directly tested or else all or some of the nucleic acid material present in the biological sample may be isolated prior to testing. It is within the scope of the present invention for the target nucleic acid molecule to be pre-treated prior to testing, for example inactivation of live virus or being run on a gel. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
- Reference to “contacting” the sample with the primer should be understood as a reference to facilitating the mixing of the primer with the sample such that interaction (for example, hybridisation) can occur. Means of achieving this objective would be well known to those of skill in the art.
- a neoplastic condition is the subject of analysis. If the neoplastic condition is a lymphoid leukemia, a blood sample, lymph fluid sample or bone marrow aspirate would likely provide a suitable testing sample. Where the neoplastic condition is a lymphoma, a lymph node biopsy or a blood or marrow sample would likely provide a suitable source of tissue for testing.
- mammal to the extent that it is used herein includes humans, primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. kangaroos, deer, foxes).
- livestock animals e.g. horses, cattle, sheep, pigs, donkeys
- laboratory test animals e.g. mice, rats, rabbits, guinea pigs
- companion animals eg. dogs, cats
- captive wild animals eg. kangaroos, deer, foxes.
- the method of the present invention is performed as a sequential two step amplification using multiple second round primers each of which is directed to a gene region which is either 3′ (for the forward primers) or 5′ (for the reverse primers) to that which is targeted by the corresponding first round primers.
- second round primers each of which is directed to a gene region which is either 3′ (for the forward primers) or 5′ (for the reverse primers) to that which is targeted by the corresponding first round primers.
- This situation may arise when the sequence around the breakpoint is amplified very efficiently and there is very little non-specific amplification such that a clearly defined band of amplification product is observed on electrophoresis of the product of the first round amplification or if the subsequent selection step is very efficient.
- a sequential two step amplification process would be used in order to minimise non-specific amplification and to generate a relatively short amplification product which spans the breakpoint region.
- the amplification product would be less than 1.5 kb, less than 1 kb, less than 0.8 kb or less than 0.5 kb.
- the method of the invention may be adapted to incorporate third or fourth round amplification steps in order to further minimise non-specific amplification. This can be an issue owing to the number of primers present in the multiplexed reaction and to the fact that one of the genes participating in the translocation often contains multiple repetitive sequences such as Alu. Nevertheless, it is expected that the need for further rounds of amplification would be unlikely.
- the method of the present invention has been designed such that the amplification steps can be sequentially performed directly on the amplification product of a previous amplification, this should not be understood as a limitation in terms of whether any additional steps are sought to be incorporated by the skilled person, such as enrichment/selection steps. For example, one may seek to select for the desired amplicons after the first round amplification and to thereafter conduct the second round amplification on their material alone. Methods which one could utilise to select or enrich include:
- the primers and reaction conditions are designed so that primer hybridisation and extension of the forward and reverse primers occur at or close to the maximum efficiency so that the number of amplicons approximately doubles with each cycle resulting in efficient exponential amplification.
- Bottleneck PCR is predicated on the use of forward and reverse primer sets where the primers of one set have been designed or are otherwise used under conditions wherein they do not hybridise and extend efficiently. Accordingly, although the efficient primer set will amplify normally, the inefficient set will not. As a consequence, when a sequence of interest is amplified, the number of amplicon strands is significantly less than that which would occur in a classical PCR.
- Efficient amplification only commences once amplicons have been generated which incorporate, at one end, the tag region of the inefficient primer. At this point, the primers directed to the tag regions effect a normal amplification rate. A “bottleneck” is therefore effectively created in terms of the generation of transcripts from the inefficient primer set.
- a more severe bottleneck is usefully created where the inefficient primers are directed to commonly repeated sequences, such as an alu sequence. Amplification of unwanted product may result if such binding sites are closely apposed and if the inefficient primers can act as forward primers and reverse primers.
- amplification is initially extremely inefficient and there is a severe bottleneck. Efficient amplification only commences once amplicon strands have been generated which comprise the tag region of the inefficient primer at one end and its complement at the other. After any given number of cycles, the number of such amplicons is, however, substantially less than that which occurs during amplification of the sequence of interest. The amount of unwanted product at the end of the amplification reaction is correspondingly reduced.
- Hybridisation and extension of an inefficient primer which has correctly hybridised to the sequence of interest followed in a subsequent cycle by hybridisation and extension of an efficient primer to the previously synthesised amplicon generates a template to which the tag primer can efficiently hybridise and extend. Since such molecules together with their complements provide upstream and downstream binding sites, each for an efficient primer (the tag primer and one member of the efficient set), succeeding cycles of amplification from such templates are both efficient and exponential. The result is that, after an initial lag or “bottleneck”, the overall rate of amplification speeds up in later cycles so that a near doubling of amplicon number with each cycle results. However, the net result is that there is negative selection against amplification of undesired amplicons as compared to amplicons of the sequence of interest, owing to the bottleneck at each end for the former and only at one end for the latter.
- the amplicons spanning the breakpoint region can be analysed.
- the subject amplicon is isolated by excision of a gel band containing that amplicon and sequenced in order to characterise the breakpoint region.
- a band excised from a gel it may be necessary to further amplify the DNA contained therein in order to provide sufficient material for sequencing.
- the oligonucleotide tags hereinbefore described provide a suitable primer hybridisation site to facilitate further amplification of the isolated amplicons.
- the method of the present invention provides a simple and routine means of identifying and characterising any breakpoint region, such as the nature, accuracy and stability of a site directed insertion of a gene into a chromosome or vector (this being important in the context of gene therapy), but in particular the chromosomal gene translocation breakpoints that are characteristic of many diseases.
- breakpoint region such as the nature, accuracy and stability of a site directed insertion of a gene into a chromosome or vector (this being important in the context of gene therapy), but in particular the chromosomal gene translocation breakpoints that are characteristic of many diseases. Examples of such translocations and diseases include, but are not limited to:
- primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase.
- This strategy may be contrasted to the prior art strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction.
- One of the advantages of the strategy of the present invention is that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
- the present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising: (i) contacting a DNA sample with:
- a method of monitoring a disease condition in a mammal which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method hereinbefore defined.
- Methods of screening for the subject breakpoint would be well known to those skilled in the art and include any suitable probe-based screening technique, such as PCR based methods.
- probe-based screening technique such as PCR based methods.
- said gene breakpoint is a chromosomal gene translocation breakpoint such as:
- Still another aspect of the present invention is directed to a DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method hereinbefore defined.
- Forward primer pool—FA contains 7 forward BCR primers BCRF1-BCRF7 each with same 5′ tag sequence (A), Total 50 ng (7.14 ng each)
- Reverse primer pool—R3/4 Pieris of 24 oligonucleotide reverse ABL primers, each with same 5′ tag sequence (C), Total 50 ng (2.08 ng each)
- Forward and reverse tag sequence primers (A,C) —25 ng of each
- Forward primer pool NFA (Contains 7 forward internal BCR primers BFN1-BFN7 each with same 5′ tag sequence (B), Total 50 ng (7.14 ng each)
- Reverse primer pool R3/4 (Pool of 24 oligonucleotide reverse internal ABL primers, each with same 5′ tag sequence (D), Total 50 ng (2.08 ng each)
- Forward and reverse tags B,D—25 ng of each
- a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers
- 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
- the ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence.
- the ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
- Example 2 The BCR and ABL primers used in Example 1 are shown in Example 2.
- the second round primers were internal to the first round primers and were used either for a second round together with internal ABL primers or for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
- the protocol that was used was to set up 6 PCRs, each containing a different BCR primer and all 282 ABL primers
- Amplified patient DNA was electrophoresed on a 2% agarose gel.
- P is patient DNA
- N is the normal DNA
- W is the water control.
- the patient DNA was amplified using multiple RAR ⁇ primers and a single PML primer
- the second round primers were internal to the first round primers and were used for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
- Various combinations of the forward and reverse primers can be used. 2 exemplary protocols were either to set up 6 PCRs, each containing a different PML primer and all 34 RARalpha primers, or to set up 1 PCR which contained all 6 forward and all 34 reverse primers.
- a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers
- 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
- the ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence.
- the ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
- Example 2 The BCR and ABL primers used in Example 1 are shown in Example 2.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the break-point position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene break-point associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.
Description
- The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the breakpoint position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene breakpoint associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.
- The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
- Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
- Chromosomal translocations bring the previously unlinked segments of the genome together by virtue of the exchange of parts between non-homologous chromosomes. Although some translocations are not associated with a new phenotype, others may result in disease due to the modulation of protein expression or the synthesis of a new fusion protein.
- There are two main types of chromosomal translocations which occur, these being reciprocal translocations (also known as non-Robertsonian) and Robertsonian translocations. Further, translocations can be balanced (in an even exchange of material with no genetic information extra or missing) or unbalanced (where the exchange of chromosome material is unequal resulting in extra or missing genes).
- Reciprocal (non-Robertsonian) translocations usually result in an exchange of material between non-homologous chromosomes and are found in about 1 in 600 newborns. Such translocations are usually harmless and may be found through prenatal diagnosis. However, carriers of balanced reciprocal translocations exhibit an increased risk of creating gametes with unbalanced chromosome translocations thereby leading to miscarriages or children with abnormalities.
- Robertsonian translocations involve two acrocentric chromosomes that fuse near the centromere region with loss of the short arms. The resulting karyotype has only 45 chromosomes since two chromosomes have fused together. Robertsonian translocations have been observed involving all combinations of acrocentric chromosomes. The most common translocation involves
chromosomes 13 and 14 and is seen in about 1 in 1300 persons. Like other translocations, carriers of Robertsonian translocations are phenotypically normal, but exhibit a risk of unbalanced gametes which lead to miscarriages or abnormal offspring. For example, carriers of Robertsonian translocations involving chromosome 21 exhibit a higher probability of having a child with Down syndrome. - Diseases which may result from the occurrence of a translocation include:
-
- Cancer—several forms of cancer are caused by translocations; this mainly having been described in leukemia (eg. acute myelogenous leukemia and chronic myelogenous leukemia).
- (ii) Infertility—this can occur where one of the would-be parents carries a balanced translocation, where the parent is asymptomatic but conceived foetuses are not viable.
- (iii) Down syndrome—in some cases this is caused by a Robertsonian translocation of about a third of chromosome 21 onto
chromosome 14.
Specific examples of chromosomal translocations and the disease with which they are associated include: - t(2;5)(p23;q35)—anaplastic large cell lymphoma
- t(8;14) —Burkitt's lymphoma (c-myc)
- t(9;22)(q34;q11)—Philadelphia chromosome, CML, ALL
- t(11;14)—Mantle cell lymphoma (Bcl-1)
- t(11;22)(q24;q11.2-12)—Ewing's sarcoma
- t(14;18)(q32;q21)—follicular lymphoma (Bcl-2)
- t(17;22)—dermatofibrosarcoma protuberans
- t(15;17)—acute promyelocytic leukemia (pml and retinoic acid receptor genes)
- t(1;12)(q21;p13)—acute myelogenous leukemia
- t(9;12)(p24;p13)—CML, ALL (TEL-JAK2)
- t(X;18)(p11.2;q11.2)—Synovial sarcoma
- t(1;11)(q42.1;q14.3)—Schizophrenia
- t(1;19)—acute pre-B cell leukemia (PBX-1 and E2A genes).
- The shorthand t(A;B)(p1;q2) is used to denote a translocation between chromosome A and chromosome B. The information in the second set of parentheses, when given, gives a precise location within the chromosome for chromosomes A and B respectively—with p indicating the short arm of the chromosome, q indicating the long arm, and the numbers of p and q refers to regions, bands and sub-bands seen when staining the chromosomes under microscope.
- As detailed above, chronic myelogenous leukemia is an example of a neoplastic condition which is caused by a chromosomal translocation. However, unlike many neoplastic conditions, its treatment prospects are quite good if it can be effectively diagnosed and monitored.
- In virtually all cases of chronic myelogenous leukemia, a specific translocation is seen. This translocation involves the reciprocal fusion of small pieces from the long arms of chromosome 9 and 22. The altered chromosome 22 is known as the Philadelphia chromosome (abbreviated as Ph1). When the breakpoint of the Ph1 chromosome was sequenced, it was found that the translocation creates a fusion gene by bringing together sequences from the c-ABL proto-oncogene and another BCR (breakpoint cluster region). The BCR-ABL fusion gene encodes a phosphoprotein (p210) that functions as a dysregulated protein tyrosine kinase and predisposes the cell to become neoplastic. This hypothesis is supported by finding that expression of p210 results in transformation of a variety of hematopoietic cell lines in vitro and that mice transgenic for the human BCR-ABL gene develop a number of hematologic malignancies. Another well studied example of a translocation generating cancer is seen in Burkitt's lymphoma. In some cases of this B cell tumor, a translocation is seen involving chromosome 8 and one of three other chromosomes (2, 14 or 22). In these cases, a fusion protein is not produced. Rather, the c-myc proto-oncogene on chromosome 8 is brought under transcriptional control of an immunoglobulin gene promoter. In B cells, immunoglobulin promoters are transcriptionally quite active, resulting in over expression of c-myc, which is known from several other systems to exhibit monogenic properties. Accordingly, this translocation results in aberrant high expression of an oncogenic protein.
- The classical method of diagnosing chromosomal translocations, such as those observed in chronic myelogenic leukemia, is by karyotyping. For many translocations, however, it is now possible to detect the translocation by PCR, using primers which span the breakpoint. In some cases, the PCR technique can also be used for sensitive detection and monitoring of treatment. Monitoring to determine the effect of treatment has become increasingly important for diseases such as chronic myeloid leukemia and acute promyelocytic leukemia as increasingly effective treatment has been developed. For monitoring in these 2 diseases, the starting material for the PCR is RNA. The translocation breakpoint is within the introns of the respective genes and, as a consequence, RNA splicing removes the sequence of RNA transcribed by introns and results in only one or a very limited number of final mRNA products being produced, despite the very large number of different translocations which are present in the patient population.
- However, the use of RNA as the starting material to detect and quantify the translocation by PCR suffers the disadvantage that RNA is a difficult molecule to work with due to its inherent susceptibility to degradation. DNA is a more stable molecule. However, the initial identification and characterisation of the breakpoint in the context of DNA is much more difficult since cluster regions of chromosomal fusion sites often span large introns of several tens of thousands of nucleotides. These sizes are too large for direct coverage by a single PCR reaction. There therefore exists an ongoing need to develop means for routinely conducting breakpoint analyses on DNA samples.
- In work leading up to the present invention, a novel multiplex amplification reaction has been developed which enables the localisation and analysis of a breakpoint in a DNA sample. Despite the precise position of the breakpoint being unknown, the method of the present invention nevertheless enables diagnosis of the existence of the breakpoint in a DNA sample and the isolation and analysis of the breakpoint region using a relatively modest and simple multiplex amplification reaction. The design of this amplification reaction results in the advantage that generation of long PCR products is not required. Still further, the optional incorporation of a primer hybridisation tag region at the 5′ end of the amplification primers enables the rapid generation of large copy numbers of the amplicons generated using these primers and therefore facilitates the isolation and analysis of the amplicons.
- Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
- As used herein, the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source. Further, as used herein the singular forms of “a”, “and” and “the” include plural referents unless the context clearly dictates otherwise.
- Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
- The subject specification contains nucleotide sequence information prepared using the programme PatentIn Version 3.1, presented herein after the bibliography. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (eg. <210>1, <210>2, etc). The length, type of sequence (DNA, etc) and source organism for each sequence is indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2, etc.). The sequence identifier referred to in the specification correlates to the information provided in numeric indicator field <400> in the sequence listing, which is followed by the sequence identifier (eg. <400>1, <400>2, etc). That is SEQ ID NO:1 as detailed in the specification correlates to the sequence indicated as <400>1 in the sequence listing
- One aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
contacting a DNA sample with: -
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
The present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising:
(i) contacting a genomic DNA sample with: - (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
There is therefore preferably provided a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with - (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
The present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: - (a) one to thirty forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
According to this preferred embodiment there is provided a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: - (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
The present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: - (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) isolating and sequencing said amplified DNA.
-
FIG. 1 is a schematic representation of the strategy for amplification of the breakpoint region in the first round PCR. The forward primers for gene A and the reverse primers for gene B are preferably used in pools rather than individually. Only primer pairs which closely straddle the breakpoint will produce efficient amplification. The tags and tag primers are not shown. The strategy for the second round PCR is the same although the forward and reverse primers are just internal to their corresponding primers in the first round. In the case of chronic myeloid leukemia, gene A is the BCR gene and gene B is the ABL gene. Primer binding sites are staggered so that the maximum amplicon size does not exceed 1 kilobase. -
FIG. 2 is a schematic representation of a protocol for isolation of the BCR-ABL translocation breakpoint in chronic myeloid leukemia. -
FIG. 3 is an image of the results of electrophoresis showing amplified material from study of one patient. NFA was the pool of 6 forward BCR primers and NFA13 and NFA14 were 2 pools each containing 12 reverse ABL primers. NFA 13/14 was a pool containing the 24 ABL primers belonging topools 13 and 14. -
FIG. 4 is a representation of the sequences of the breakpoints in 4 patients with chronic myeloid leukemia. The numbers on the left are the Genbank base numbers for the BCR and ABL genes. -
FIG. 5 shows the site of the DNA breakpoints in the ABL and BCR genes in the 27 patients with breakpoints isolated and identified. Blue regions in the ABL gene represent the exons 1a, 1b and E2. Red regions in the BCR gene representexons 13, 14 and 15. - Samples from 29 CML patients have been studied using the invention. In 27 of these patients the breakpoint sequences have been isolated and detailed sequencing information obtained. For one patient it has not been possible to amplify the BCR/ABL breakpoint. For the remaining patient a suspected breakpoint has been amplified. Sequence information shows the BCR gene at the 5′ end and ABL sequence at the 3′ end, however this breakpoint has not been confirmed with primers made specifically for the suspected regions.
-
FIG. 6 is a comparison of DNA-based and RNA-based quantification of minimal residual disease (MRD) in samples of blood from 16 patients with CML. ND=not detected. Y-axis shows the number of leukemic cells as a proportion of total cells. The DNA-based PCR used patient-specific primers synthesised using knowledge of the breakpoint sequence in the patient being studied, the RNA-based PCR was the conventional approach using reverse transcription followed by PCR using generic primers. Black symbols show MRD detected by both techniques, red symbols show disease detected only by DNA-PCR and blue symbols show disease not detected. DNA-based PCR appears to be approximately 2 orders of magnitude more sensitive than RNA-based PCR. -
FIG. 7 is an illustration of the isolation of the PML-RARα breakpoint from a sample from the one patient with acute promyelocytic leukemia - The present invention is predicated, in part, on the determination that gene translocation breakpoints can be routinely and easily identified, via DNA analysis, by sequentially performing two PCR reactions which use multiple primers directed to the genes flanking the breakpoint which are themselves tagged at their 5′ end with a DNA region suitable for use as a primer hybridisation site. The simultaneous use of multiple primers facilitates the performance of a short PCR, rather than the long PCRs which have been performed to date. By sequentially performing a second PCR using primers directed to gene regions internal to those used in the first reaction, amplification of a DNA molecule spanning the breakpoint region can be achieved in a manner which enables the identification and isolation of a smaller amplification product than has been enabled to date in terms of the analysis of genomic DNA. By incorporating unique tag regions which can themselves be targeted by a primer, amplification of the initial amplicon can be rapidly achieved, thereby overcoming any disadvantage associated with the use of a low concentration of starting primer directed to the genes flanking the breakpoint. The method of the present invention therefore provides a simple yet accurate means of identifying and analysing a gene breakpoint using DNA. To this end, it would be appreciated that although the method of the present invention is exemplified by reference to chronic myelogenic leukemia, this method can be applied to any situation in which a gene breakpoint is sought to be identified via a DNA sample.
- Accordingly, in one aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
- (i) contacting a DNA sample with:
-
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
- It should be understood that in a preferred embodiment of the present invention, where one primer is used in step (i)(a), it is preferable that two or more primers are used in step (i)(b). The converse applies where one primer is used in step (i)(b). Similarly, in another preferred embodiment, where one primer is used in step (iii)(a), it is preferable that two or more primers are used in step (iii)(b). The converse applies where one primer is used in step (iii)(b). Reference to the “flanking genes” 5′ and 3′ to the breakpoint should be understood as a reference to the genes or gene fragments on either side of the breakpoint. In terms of the 5′ and 3′ nomenclature which is utilised in the context of these genes/gene fragments, this should be understood as a reference to the 5′→3′ orientation of the sense strand of double stranded DNA from which the DNA of interest derives. Accordingly, reference to “the flanking
gene 5′ to the breakpoint” should be understood as a reference to the sense strand of double stranded DNA. To this end, any reference to “gene” or “gene fragment” herein, to the extent that it is not specified, is a reference to the sense strand of double stranded DNA. Reference to the forward primer being directed to the antisense strand of the flankinggene 5′ to the breakpoint therefore indicates that the forward primer bears the same DNA sequence as a region of thesense strand 5′ to the breakpoint and therefore will bind to and amplify the antisense strand corresponding to that region. - Reference to “gene” should be understood as a reference to a DNA molecule which codes for a protein product, whether that be a full protein or a protein fragment. In terms of chromosomal DNA, the gene will include both intron and exon regions. However, to the extent that the DNA of interest is cDNA, such as might occur if the DNA of interest is vector DNA, there may not exist intron regions. Such DNA may nevertheless include 5′ or 3′ untranslated regions. Accordingly, reference to “gene” herein should be understood to encompass any form of DNA which codes for a protein or protein fragment including, for example, genomic DNA and cDNA.
- Reference to a gene “breakpoint” should be understood as a reference to the point at which a fragment of one gene recombines with another gene or fragment thereof. That is, there has occurred a recombination of two genes such that either one or both genes have become linked at a point within one or both of the genes rather than the beginning or end of one gene being linked to the beginning or end of the other gene. That is, at least one of the subject genes has been cleaved and has recombined with all or part of another gene. The recombination of the two non-homologous gene regions may occur by any method including but not limited to chromosomal gene translocations or in vitro homologous recombinations (such as may occur where a DNA segment is being inserted into a vector or an artificial chromosome or where a vector portion thereof chromosomally integrates in a host cell).
- Preferably, the subject gene breakpoint is a chromosomal gene translocation breakpoint. As detailed hereinbefore, chromosomal gene translocations are known to occur and, in some cases, lead to the onset of disease states. Since a gene translocation between two genes will not necessarily result in the breakpoint occurring at precisely the same nucleotide position on the two genes each time the translocation event occurs, it is not possible to assume that the breakpoint position in one patient, such as the Philadelphia chromosome breakpoint in one CML patient, will be the same in another patient. The method of the present invention enables the simple yet accurate determination of a gene breakpoint using DNA.
- The present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising:
(i) contacting a genomic DNA sample with: -
- (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
- Reference to “DNA” should be understood as a reference to deoxyribonucleic acid or derivative or analogue thereof. In this regard, it should be understood to encompass all forms of DNA, including cDNA and genomic DNA. The nucleic acid molecules of the present invention may be of any origin including naturally occurring (such as would be derived from a biological sample), recombinantly produced or synthetically produced.
- Reference to “derivatives” should be understood to include reference to fragments, homologs or orthologs of said DNA from natural, synthetic or recombinant sources. “Functional derivatives” should be understood as derivatives which exhibit any one or more of the functional activities of DNA. The derivatives of said DNA sequences include fragments having particular regions of the DNA molecule fused to other proteinaceous or non-proteinaceous molecules. “Analogs” contemplated herein include, but are not limited to, modifications to the nucleotide or nucleic acid molecule such as modifications to its chemical makeup or overall conformation. This includes, for example, modification to the manner in which nucleotides or nucleic acid molecules interact with other nucleotides or nucleic acid molecules such as at the level of backbone formation or complementary base pair hybridisation. The biotinylation or other form of labelling of a nucleotide or nucleic acid molecules is an example of a “functional derivative” as herein defined.
- As detailed hereinbefore, the method of the present invention is predicated on the use of multiple oligonucleotide primers to facilitate the multiplexed amplification of a DNA sample of interest. In one embodiment of the present invention, the DNA sample of interest is a hybrid gene which comprises a portion of one gene (gene A) which is located 5′ to the translocation breakpoint and a second gene (gene B) which is located 3′ to the translocation breakpoint. In a particular embodiment, gene A is BCR and gene B is ABL. The identification of the existence and nature of a gene translocation breakpoint is achieved by using two or more forward primers directed to gene A and two or more reverse primers directed towards gene B. The primers directed to gene A are designed to hybridise at intervals along gene A and the primers directed to gene B are similarly designed to hybridise at intervals along gene B. In the first round PCR, the primers which will amplify the hybrid gene are the upstream primers which hybridise to that portion of gene A which lies 5′ to the breakpoint and the downstream primers which hybridise to that portion of gene B which lies 3′ to the breakpoint. Furthermore, since small amplicons are amplified more efficiently than larger amplicons, there will occur selection for amplification directed by the primer pair which hybridises closest to the breakpoint. The same principle holds for the second round primers and, since in one embodiment each second round primer corresponds to an individual first-round primer but hybridises internal to it with regard to the breakpoint, there will be further selection for amplification by the pair of the second round primers which bound the breakpoint. Without limiting the present invention in any way, the second round of PCR amplification provides additional specificity for amplification of the breakpoint region. Following the second round PCR, successful amplification of the sequence surrounding the breakpoint will be evident as a band of amplified material on electrophoresis.
- Since it is not known precisely where the breakpoint lies, it is possible that one or more of the internal primers may not hybridise to their target region sequence due to this sequence having been effectively spliced out during the translocation event. However, in one embodiment, the forward and reverse primers selected for the first round amplification are directed to amplifying from the 5′ and 3′ end regions, respectively, of the gene fragments flanking the breakpoint. The second round primers are then directed to internal regions of the gene fragments flanking the breakpoint, that is, the regions which are closer to the breakpoint than the regions targeted by the first round primers. Again, it would be appreciated that since the precise location of the breakpoint is not known, one or more of these forward and/or reverse primers may not hybridise to the DNA sample due to their target region sequence having been spliced out. In terms of the second round “internal primers”, it should be understood that this is a reference to a population of primers of which at least one primer, but preferably all the primers, are designed to amplify the subject DNA from a point which, when considered in the context of the translocated gene itself (rather than the antisense strand or the amplification product), is 3′ of the most 3′ of the forward primers used in the first round amplification and 5′ of the most 5′ of the reverse primers used in the first round amplification. By using the approach of a two step amplification using progressively more internally localised primers, amplification of DNA spanning the breakpoint region can be achieved without the requirement to perform long PCRs or to generate very long and cumbersome amplification products.
- Reference to a “primer” or an “oligonucleotide primer” should be understood as a reference to any molecule comprising a sequence of nucleotides, or functional derivatives or analogues thereof, the function of which includes hybridisation to a region of a nucleic acid molecule of interest (the DNA of interest also being referred to as a “target DNA”) and the amplification of the
DNA sequence 5′ to that region. It should be understood that the primer may comprise non-nucleic acid components. For example, the primer may also comprise a non-nucleic acid tag such as a fluorescent or enzymatic tag or some other non-nucleic acid component which facilitates the use of the molecule as a probe or which otherwise facilitates its detection or immobilisation. The primer may also comprise additional nucleic acid components, such as the oligonucleotide tag which is discussed in more detail hereinafter. In another example, the primer may be a protein nucleic acid which comprises a peptide backbone exhibiting nucleic acid side chains. preferably, said oligonucleotide primer is a DNA primer. - Reference to “forward primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest by hybridising to the antisense strand of the target DNA.
- Reference to “reverse primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest and in the PCR by hybridising to the sense strand of the target DNA.
- The design and synthesis of primers suitable for use in the present invention would be well known to those of skill in the art. In one embodiment, the subject primer is 4 to 60 nucleotides in length, in another embodiment 10 to 50 in length, in yet another embodiment 15 to 45 in length, in still another embodiment 20 to 40 in length, in yet another embodiment 25 to 35 in length. In yet still another embodiment, primer is about 26, 27, 28, 29, 30, 31, 32, 33 or 34 nucleotides in length. Without limiting the invention in any way, the primers are designed in one embodiment to have a TM of 65 to 70° C. This enables the PCR to use a high annealing temperature, which minimises non-specific annealing and amplification. Each forward or reverse primer for the second round PCR is designed to hybridise to a sequence which is close, either downstream for the forward primer or upstream for the reverse primer, to the hybridisation sequence for its corresponding forward or reverse first-round primer. Designing the corresponding primers to hybridise to closely adjoining sequences minimises the probability that the translocation breakpoint will involve or occur between the hybridisation sequences. even if this does occur, the sequence surrounding the translation breakpoint can still be amplified by the immediately upstream or downstream, as the case may be, primer pair.
- In the exemplified embodiment described herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy is in contrast to the strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. The advantages of the strategy of the present invention are that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
- In terms of the number of primers which are used in the method of the invention, this can be determined by the person of skill in the art. With regard to the total number of primers, the variables which require consideration are the size of the gene region which is being targeted and the distance between the sequences to which the primers hybridise. In order to amplify PCR fragments which are no larger than about 1 kb, the primers can be designed to hybridise at intervals of approximately 500 bases. With regard to CML, nearly all BCR translocations involve one of two regions, each of approximately 3 kb in length. In this case, 12 outer forward primers and 12 corresponding inner primers may be used. The ABL gene, however, is larger, approximately 140 kb in length, and up to 280 outer reverse primers and 280 inner reverse primers may be used. In one particular embodiment, a combination of 6 forward primers and 24 reverse primers is used and in another embodiment a combination of 6 forward primers and 140 reverse primers. The primer number which is selected to be used will depend on the genes involved in the translocation and thus may vary from translocation to translocation and will involve consideration of the competing issues of the number of PCR reactions which are required to be performed versus the probability of generating non-specific products during a PCR reaction. As would be understood by the person of skill in the art, a large number of primers in each individual PCR reaction decreases the number of PCR reactions but increases the probability of non-specific amplification reactions.
- In one embodiment, the method of the present invention is performed using at least three primers, in another embodiment at least four primers. In yet another embodiment said invention is performed using 6-10 primers, 6-15 primers, 6-20 primers, 6-25 primers or 6-30 primers. In still another embodiment there is used 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 primers.
- There is therefore preferably provided a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with -
- (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
preferably, said gene breakpoint is a gene translocation breakpoint and still more preferably a chromosomal gene translocation breakpoint.
- The primers which are used in the method of the present invention are of a relatively low individual concentration due to the starting primer pool comprising multiple individual primers. This reduces the risk of inducing inhibition of PCR. In order to facilitate a successful amplification result, it is therefore necessary to enable the generation of sufficient amplicons for detection and isolation. In one aspect of the present invention, this can be facilitated by tagging the primers with an oligonucleotide which can be used as a primer hybridisation site. In addition to the primers directed towards genes A and B, each PCR reaction may therefore also contain concentrations of two oligonucleotides which are directed to the tag, as a primer hybridisation site. These oligonucleotide sequences act as primers and enable efficient secondary amplification of the amplicons generated by the initial hybridisation and extension of the primers directed towards genes A and B. In one embodiment, the primer which is directed to the tag exhibits a TM of 65° C.-70° C. in order to minimise non-specific amplification. Thus these primers are directed towards overcoming the potential problem posed by the low concentrations of the primers directed towards A and B. Nevertheless, in some situations it may not be necessary to use one or both tag primers. For example, when there are only six forward primers for the BCR gene each primer may be at a concentration which is sufficient for relatively efficient amplification. Still further, it should be appreciated that the oligonucleotide tags provide an additional use when they are present in the final PCR round, since the tag primers can also be used for sequencing. Accordingly, although the tag is suitable for use as a site for primer hybridisation, it should be understood that the subject tag may also be useful for other purposes, such as a probe binding site in the context of Southern gel analysis or to enable isolation of the primer or the amplicon extended therefrom. To this end, the tag may comprise a non-nucleic acid component, such as a protein molecule or biotin which would enable isolation, for example by affinity chromatography, streptavidin binding or visualisation.
- In order to ensure that these tags do not interfere with the extension of the primer, the primers are linked to the oligonucleotide tag at their 5′ end. Reference to “oligonucleotide tag” should therefore be understood as a reference to a nucleotide sequence of less than 50 nucleotides which is linked to the 5′ end of the forward and reverse primers of the present invention. In one embodiment, the tag is 25-30 bases in length. It should also be understood that consistently with the definitions provided in relation to the forward and reverse primers, the oligonucleotide tags herein described may also comprise non-nucleic acid components such as isolation or visualisation tags eg. biotin, enzymatic labels, fluorescent labels and the like. This enables quick and simple isolation or visualisation of the tagged primers or amplicons via non-molecular methods.
- That the oligonucleotide tag is “operably linked” to the primer should be understood as a reference to those regions being linked such that the functional objectives of the tagged primer, as detailed hereinbefore, can be achieved. In terms of the means by which these regions are linked and, further, the means by which the subject oligonucleotide primer binds to its target DNA region, these correspond to various types of interactions. In this regard, reference to “interaction” should be understood as a reference to any form of interaction such as hybridisation between complementary nucleotide base pairs or some other form of interaction such as the formation of bonds between any nucleic or non-nucleic acid portion of the primer molecule or tag molecule with any other nucleic acid or non-nucleic acid molecule, such as the target molecule, a visualisation means, an isolation means or the like. This type of interaction may occur via the formation of bonds such as, but not limited to, covalent bonds, hydrogen bonds, van der Wals forces or any other mechanism of interaction. preferably, to the extent that the interaction occurs between the primer and a region of the target DNA, said interaction is hybridisation between complementary nucleotide base pairs. In order to facilitate this interaction, it is preferable that the target DNA is rendered partially or fully single stranded for a time and under conditions sufficient for hybridisation with the primer to occur.
- Without limiting the present invention to any one theory or mode of action, the inclusion of an oligonucleotide tag which can itself function as a primer hybridisation site can assist in facilitating the convenient and specific amplification of the amplicon generated by the forward and reverse primers of the present invention. Accordingly, this overcomes somewhat the amplification limitation which is inherent where a relatively low starting concentration of the forward and reverse primers is used. Where the starting concentration of forward and reverse primers is sufficiently high, it may not be necessary to use a tag. Accordingly, in a preferred embodiment, the DNA sample of interest is contacted with both the forward and reverse primers of the present invention and primers directed to the oligonucleotide tags of the forward and reverse primers such that the amplification reaction of step (ii) proceeds in the context of all these primers. It should be understood, however, that although it is preferred that amplification based on both the gene primers and the tag primers is performed simultaneously, the method can be adapted to perform the tag primer based amplification step after the completion of the gene primer based amplification.
- The DNA sequence of the tags may be the same or different. With respect to a first round amplification, the tags may be the same if the purpose is to amplify the initial amplification product. However, if one wishes to selectively enrich for amplicons containing the sequence of one of the flanking genes, the primer directed to the tag region of the primer of the gene of interest (eg. gene A) should differ to the primer directed to the tag region of the primer of the other gene (eg. gene B). In another example, in terms of a second or subsequent round of amplification, the tags which are used for sequencing would be required to be different to prevent the simultaneous sequencing of both strands.
- The present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: -
- (a) one to thirty forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
preferably said gene translocation breakpoint is a chromosomal gene translocation breakpoint.
- It should be understood that the oligonucleotide primers and tags of the present invention should not be limited to the specific structure exemplified herein (being a linear, single-stranded molecule) but may extend to any suitable structural configuration which achieves the functional objectives detailed herein. For example, it may be desirable that all or part of the oligonucleotide is double stranded, comprises a looped region (such as a hairpin bend) or takes the form of an open circle confirmation, that is, where the nucleotide primer is substantially circular in shape but its terminal regions do not connect.
- Facilitating the interaction of the nucleic acid primer with the target DNA may be performed by any suitable method. Those methods will be known to those skilled in the art.
- Methods for achieving primer directed amplification are also very well known to those of skill in the art. In a preferred method, said amplification is polymerase chain reaction, NASBA or strand displacement amplification. Most preferably, said amplification is polymerase chain reaction. To this end, in one embodiment of the invention, a 20 minute hybridisation provides good amplification in the first round PCR.
- Reference to a “sample” should be understood as a reference to either a biological or a non-biological sample. Examples of non-biological samples includes, for example, the nucleic acid products of synthetically produced nucleic acid populations. Reference to a “biological sample” should be understood as a reference to any sample of biological material derived from an animal, plant or microorganism (including cultures of microorganisms) such as, but not limited to, cellular material, blood, mucus, faeces, urine, tissue biopsy specimens, fluid which has been introduced into the body of an animal and subsequently removed (such as, for example, the saline solution extracted from the lung following lung lavage or the solution retrieved from an enema wash), plant material or plant propagation material such as seeds or flowers or a microorganism colony. The biological sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing. For example, a biopsy sample may require homogenisation prior to testing or it may require sectioning for in situ testing. Further, to the extent that the biological sample is not in liquid form, (if such form is required for testing) it may require the addition of a reagent, such as a buffer, to mobilise the sample.
- To the extent that the target DNA is present in a biological sample, the biological sample may be directly tested or else all or some of the nucleic acid material present in the biological sample may be isolated prior to testing. It is within the scope of the present invention for the target nucleic acid molecule to be pre-treated prior to testing, for example inactivation of live virus or being run on a gel. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
- Reference to “contacting” the sample with the primer should be understood as a reference to facilitating the mixing of the primer with the sample such that interaction (for example, hybridisation) can occur. Means of achieving this objective would be well known to those of skill in the art.
- The choice of what type of sample is most suitable for testing in accordance with the method disclosed herein will be dependent on the nature of the situation, such as the nature of the condition being monitored. For example, in a preferred embodiment a neoplastic condition is the subject of analysis. If the neoplastic condition is a lymphoid leukemia, a blood sample, lymph fluid sample or bone marrow aspirate would likely provide a suitable testing sample. Where the neoplastic condition is a lymphoma, a lymph node biopsy or a blood or marrow sample would likely provide a suitable source of tissue for testing. Consideration would also be required as to whether one is monitoring the original source of the neoplastic cells or whether the presence of metastases or other forms of spreading of the neoplasia from the point of origin is to be monitored. In this regard, it may be desirable to harvest and test a number of different samples from any one mammal. Choosing an appropriate sample for any given detection scenario would fall within the skills of the person of ordinary skill in the art.
- The term “mammal” to the extent that it is used herein includes humans, primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. kangaroos, deer, foxes). preferably, the mammal is a human or a laboratory test animal. Even more preferably the mammal is a human.
- As detailed hereinbefore, in one embodiment the method of the present invention is performed as a sequential two step amplification using multiple second round primers each of which is directed to a gene region which is either 3′ (for the forward primers) or 5′ (for the reverse primers) to that which is targeted by the corresponding first round primers. The person of skill in the art would appreciate that in some cases it may not be necessary to conduct a second round amplification. The necessity to perform a second round amplification may also be obviated if a selective or enrichment step as described below is performed. This situation may arise when the sequence around the breakpoint is amplified very efficiently and there is very little non-specific amplification such that a clearly defined band of amplification product is observed on electrophoresis of the product of the first round amplification or if the subsequent selection step is very efficient. In general, however, it is expected that a sequential two step amplification process would be used in order to minimise non-specific amplification and to generate a relatively short amplification product which spans the breakpoint region. In general, it is expected that the amplification product would be less than 1.5 kb, less than 1 kb, less than 0.8 kb or less than 0.5 kb. It should be understood that depending on the size of the genes which have been translocated, the method of the invention may be adapted to incorporate third or fourth round amplification steps in order to further minimise non-specific amplification. This can be an issue owing to the number of primers present in the multiplexed reaction and to the fact that one of the genes participating in the translocation often contains multiple repetitive sequences such as Alu. Nevertheless, it is expected that the need for further rounds of amplification would be unlikely.
- Although the method of the present invention has been designed such that the amplification steps can be sequentially performed directly on the amplification product of a previous amplification, this should not be understood as a limitation in terms of whether any additional steps are sought to be incorporated by the skilled person, such as enrichment/selection steps. For example, one may seek to select for the desired amplicons after the first round amplification and to thereafter conduct the second round amplification on their material alone. Methods which one could utilise to select or enrich include:
- a selection step based on the unique oligonucleotide tags which are linked to the primers. Accordingly, since the tags themselves are also amplified and therefore form part of the amplicon, they could be used as a probe site to enable isolation of amplicons which are the result of both forward and reverse primer amplification and therefore should span the breakpoint. Alternatively, biotinylation of one of the tags provides means of identifying and isolating amplicons which have resulted from extension by either the forward or reverse primers. For example, by flooding the amplification product with biotinylated primer, the primer can act as a probe to identify the amplicons of interest and the biotinylation can provide a basis for isolating those amplicons. By ensuring that each of the primer groups of the present invention comprises a unique tag, it is possible to select out, with significant particularity, only specific amplicons of interest. In particular, the skilled person would seek to exclude amplicons which have been amplified by a forward primer but which have not then been amplified by a reverse primer, thereby indicating that the subject amplicon possibly does not extend across the breakpoint. By selecting out the amplicons which are most likely spanning the breakpoint, a subsequent round of amplification is more specifically targeted and less likely to generate unwanted amplicons as a result of either inherent cross-hybridisation of primers or the amplification of amplicons which do not flank both sides of the breakpoint.
- (ii) One may seek to run the products on a gel and excise out only certain bands or regions which are likely to be relevant and thereafter subject these to a further amplification step. When a band is present on the gel after the second round amplification, if there are any problems in sequencing an attempt can be made to clean it up by cutting the product out of the gel and performing a series of PCR reactions using individual primers and/or smaller pools of primers. For example, one might use individual forward BCR primers and pools containing only 12 reverse ABL primers.
- (iii) one may expose the amplified products to one or more rounds of bottleneck PCR in order to provide negative selection against non-specific amplified products.
- Without limiting the application of the present invention to any one theory or mode of action, in a classical PCR, the primers and reaction conditions are designed so that primer hybridisation and extension of the forward and reverse primers occur at or close to the maximum efficiency so that the number of amplicons approximately doubles with each cycle resulting in efficient exponential amplification. Bottleneck PCR, however, is predicated on the use of forward and reverse primer sets where the primers of one set have been designed or are otherwise used under conditions wherein they do not hybridise and extend efficiently. Accordingly, although the efficient primer set will amplify normally, the inefficient set will not. As a consequence, when a sequence of interest is amplified, the number of amplicon strands is significantly less than that which would occur in a classical PCR. Efficient amplification only commences once amplicons have been generated which incorporate, at one end, the tag region of the inefficient primer. At this point, the primers directed to the tag regions effect a normal amplification rate. A “bottleneck” is therefore effectively created in terms of the generation of transcripts from the inefficient primer set.
- A more severe bottleneck is usefully created where the inefficient primers are directed to commonly repeated sequences, such as an alu sequence. Amplification of unwanted product may result if such binding sites are closely apposed and if the inefficient primers can act as forward primers and reverse primers. However, owing to both primers being inefficient, amplification is initially extremely inefficient and there is a severe bottleneck. Efficient amplification only commences once amplicon strands have been generated which comprise the tag region of the inefficient primer at one end and its complement at the other. After any given number of cycles, the number of such amplicons is, however, substantially less than that which occurs during amplification of the sequence of interest. The amount of unwanted product at the end of the amplification reaction is correspondingly reduced.
- Hybridisation and extension of an inefficient primer which has correctly hybridised to the sequence of interest followed in a subsequent cycle by hybridisation and extension of an efficient primer to the previously synthesised amplicon generates a template to which the tag primer can efficiently hybridise and extend. Since such molecules together with their complements provide upstream and downstream binding sites, each for an efficient primer (the tag primer and one member of the efficient set), succeeding cycles of amplification from such templates are both efficient and exponential. The result is that, after an initial lag or “bottleneck”, the overall rate of amplification speeds up in later cycles so that a near doubling of amplicon number with each cycle results. However, the net result is that there is negative selection against amplification of undesired amplicons as compared to amplicons of the sequence of interest, owing to the bottleneck at each end for the former and only at one end for the latter.
- Accordingly, if the same number of commencing target sequences is considered and comparison to the amplification produced by classical PCR is made, application of the bottleneck PCR will produce a lesser increase in the number of amplicons of the sequence of interest and an even lesser increase in the number of amplicons of unwanted sequences. Although amplification of both wanted and unwanted products occurs, there is relative enrichment of the sequence of interest relative to the unwanted sequences. There is an inverse relationship between absolute amplification and enrichment since decreasing the efficiency of the inefficient primer set produces increased enrichment at the expense of lesser amplification.
- Once the amplification rounds have been completed, the amplicons spanning the breakpoint region can be analysed. In a preferred embodiment, the subject amplicon is isolated by excision of a gel band containing that amplicon and sequenced in order to characterise the breakpoint region. To the extent that a band excised from a gel is to be analysed, it may be necessary to further amplify the DNA contained therein in order to provide sufficient material for sequencing. The oligonucleotide tags hereinbefore described provide a suitable primer hybridisation site to facilitate further amplification of the isolated amplicons.
- As detailed hereinbefore, the method of the present invention provides a simple and routine means of identifying and characterising any breakpoint region, such as the nature, accuracy and stability of a site directed insertion of a gene into a chromosome or vector (this being important in the context of gene therapy), but in particular the chromosomal gene translocation breakpoints that are characteristic of many diseases. Examples of such translocations and diseases include, but are not limited to:
-
- t(2;5)(p23;q35)—anaplastic large cell lymphoma
- t(8;14) —Burkitt's lymphoma (c-myc)
- t(9;22)(q34;q11)—Philadelphia chromosome, CML, ALL (BCR-ABL recombination)
- t(11;14)—Mantle cell lymphoma (Bcl-1)
- t(11;22)(q24;q11.2-12)—Ewing's sarcoma
- t(14;18)(q32;q21)—follicular lymphoma (Bcl-2)
- t(17;22)—dermatofibrosarcoma protuberans
- t(15;17)—acute promyelocytic leukemia (pml and retinoic acid receptor genes)
- t(1;12)(q21;p13)—acute myelogenous leukemia
- t(9;12)(p24;p13)—CML, ALL (TEL-JAK2)
- t(X;18)(p11.2;q11.2)—Synovial sarcoma
- t(1;11)(q42.1;q14.3)—Schizophrenia
- t(1;19)—acute pre-B cell leukemia (PBX-1 and E2A genes).
preferably, said chromosomal gene translocation is a BCR-ABL translocation or a PML-RARalpha translocation.
According to this preferred embodiment there is provided a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: - (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with: - (a) one or more forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
- (b) one or more reverse primers directed to ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
preferably, said amplification steps are performed using 1-30 forward primers and 24-300 reverse primers.
- In terms of the embodiment of the invention exemplified herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy may be contrasted to the prior art strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. One of the advantages of the strategy of the present invention is that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
- The present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with: -
- (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
- (c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) contacting the amplicon generated in step (ii) with: - (a) one to thirty forward primers directed to a DNA region of BCR or fragment thereof, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (b) twenty-four to four hundred reverse primers directed to a DNA region of ABL or fragment thereof, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
- (c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
- (d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
- wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii);
(v) isolating and sequencing said amplified DNA.
More preferably, said DNA sequence is a blood derived sample.
The method of the present invention has broad application including, but not limited to:
- (i) enabling the design and generation of patient specific probes which can be used for the ongoing monitoring of a patient who is diagnosed with a disease condition characterised by chromosomal gene translocation. Results obtained by this means for chronic myeloid leukemia are shown in
FIG. 6 . - (ii) the analysis and monitoring of in vitro and in vivo gene transfection systems which are directed to integrating a gene or other DNA region into a chromosome, vector, plasmid, artificial chromosome or the like. Where the general site at which recombination should occur is known, the present invention can be applied to determine the specific point and nature of the integration (i.e. the breakpoint). It can also be used to monitor the ongoing stability of the genetic recombination event by virtue of enabling the generation of specific primers.
- Accordingly, in yet another aspect there is provided a method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method hereinbefore defined.
- Methods of screening for the subject breakpoint would be well known to those skilled in the art and include any suitable probe-based screening technique, such as PCR based methods. By virtue of the identification of the breakpoint region in accordance with the method of the invention, one can design an appropriate probe set to specifically amplify the subject breakpoint.
- In one embodiment, said gene breakpoint is a chromosomal gene translocation breakpoint such as:
-
- t(2;5)(p23;q35)
- t(8;14)
- t(9;22)(q34;q11)
- t(11;14)
- t(11;22)(q24;q11.2-12)
- t(14;18)(q32;q21)
- t(17;22)
- t(15;17)
- t(1;12)(q21;p13)
- t(9;12)(p24;p13)
- t(X;18)(p11.2;q11.2)
- t(1;11)(q42.1;q14.3)
- t(1;19).
In another embodiment, said condition is: - anaplastic large cell lymphoma
- Burkitt's lymphoma
- CML, ALL
- Mantle cell lymphoma
- Ewing's sarcoma
- follicular lymphoma
- dermatofibrosarcoma protuberans
- acute promyelocytic leukemia
- acute myelogenous leukemia
- Synovial sarcoma
- Schizophrenia; or
- acute pre-B cell leukemia.
- Still another aspect of the present invention is directed to a DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method hereinbefore defined.
- The present invention is now described by reference to the following non-limiting examples and figures.
- Genomic DNA extracted by Qiagen Flexigene kit
- 1st Round PCR (50 ng genomic DNA)—all reactions performed in duplicate
- Forward primer pool—FA (Contains 7 forward BCR primers BCRF1-BCRF7 each with same 5′ tag sequence (A),
Total 50 ng (7.14 ng each)
Reverse primer pool—R3/4 (Pool of 24 oligonucleotide reverse ABL primers, each with same 5′ tag sequence (C),Total 50 ng (2.08 ng each)
Forward and reverse tag sequence primers (A,C) —25 ng of each - 1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM each), 0.4 ul Platinum Taq (2 U)
- 95/4 min
- (97° C./1 min, 65° C./20 min, 72° C./1 min)×5
- (96° C./30 sec, 65° C./20 min, 72° C./1 min)×5
- (92° C./30 sec, 65° C./20 min, 72° C./1 min)×10
- 2nd Round PCR (1st round reaction diluted 1/200 in sterile water)
- Forward primer pool—NFA (Contains 7 forward internal BCR primers BFN1-BFN7 each with same 5′ tag sequence (B),
Total 50 ng (7.14 ng each)
Reverse primer pool—RN3/4 (Pool of 24 oligonucleotide reverse internal ABL primers, each with same 5′ tag sequence (D),Total 50 ng (2.08 ng each)
Forward and reverse tags (B,D)—25 ng of each - 1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
- 95/4 min
- (94° C./30 sec, 65° C./10 min, 72° C./1 min) x10
- (94° C./30 sec, 65° C./5 min, 72° C./1 min) x15
-
- PCR products (7 ul) resolved on 1.5% (v/v) agarose gel at 120 volts
Identification of BCR/ABL Breakpoint fromPatient 1 - PCR products resolved on 1.5% (v/v) agarose gel at 120 volt Band excised and purified via Flexigene kit
- Reamplification of Bands by PCR (1/1000 Dilution of Purified Product)
Forward primer—Tag B (25 ng)
Reverse primer—TagD (25 ng)
PCR conditions
- PCR products (7 ul) resolved on 1.5% (v/v) agarose gel at 120 volts
- 1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
- 95/4 min
- (94° C./30 sec, 65° C./30 sec, 72° C./30 sec)×35
-
- PCR Product Sequenced with TagB primer (Flinders Sequencing Facility)
-
-
- PCR performed on gDNA (50 ng) across breakpoint
Patient 1 gDNA vs 10× Normal gDNA (several primer combinations)
Forward primer—BCR (patient specific) (25 ng)
Reverse primer—ABL (patient specific) (25 ng)
- PCR performed on gDNA (50 ng) across breakpoint
- 1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
- 95/4 min
- (97° C./1 min, 65° C./30 sec, 72° C./30 sec)×5
- (96° C./30 sec, 65° C./30 sec, 72° C./30 sec)×5
- (92° C./30 sec, 65° C./30 sec, 72° C./30 sec)×25
-
- PCR products resolved on 3% (v/v) agarose gel at 120 volt
- Band excised and purified via Qiagen minElute kit
- Products sequenced with 5′ BCR specific primer to confirm BCR/ABL breakpoint (Flinders sequencing facility).
- Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
- If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
- The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
-
- design using standard criteria
- pairing with each BCR primer and testing by electronic PCR for amplification off the BCR template. Primers that fail this criterion are discarded.
- incorporation in a pool of 12 or 24 ABL primers, pairing the pool with each BCR primer, and testing by experimental PCR using a BCR template which has been previously produced by PCR amplification. Any pool that that produces amplification and thus fails this test is further analysed by testing each of the individual ABL primers to determine which is responsible for amplification. When identified, this primer is discarded.
- The BCR and ABL primers used in Example 1 are shown in Example 2.
-
-
1st Rd BCRF1-FT0 cttctccctgacatccgtgg BCRF2-FT0 (−5) acacagcatacgctatgcacatgtg BCRF3-FT0 gaggttgttcagatgaccacgg BCRF4-FT1 (−10) cagctactggagctgtcagaacag BCRF5-FT0 tgggcctccctgcatcc BCRF6-FT0 tccccctgcaccccacg 2nd Rd BCRF1-FT1 tgacatccgtggagctgcagatgc BCRF2-FT1 acatgtgtccacacacaccccacc BCRF3-FT1 accacgggacacctttgaccctgg BCRF4-FT1 (−4) ctggagctgtcagaacagtgaagg BCRF5-FT1 tccctgcatccctgcatctcctcc BCRF6-FT1 cccacgacttctccagcactgagc - The second round primers were internal to the first round primers and were used either for a second round together with internal ABL primers or for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
- Various combinations of the forward and reverse primers can be used. In one embodiment, the protocol that was used was to set up 6 PCRs, each containing a different BCR primer and all 282 ABL primers
- 282 Reverse ABL Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer
-
Tag A gcaacactgtgacgtactggagg R1 gtctatctaaaattcacaaggaatgc R2 aggcaaagtaaaatccaagcaccc R3 cactcctgcactccagcctgg R4 caaccaccaaagtgcttttcctgg R5 atatggcatctgtaaatattaccacc R6 tgcctcggcctcccaaagtgc R7 agccaccacacccagccagg R8 aataactgttttctccccccaaaac R9 tgttttacaaaaatggggccatacc R10 acttaagcaaattctttcataaaaaggg R11 ctttcaattgttgtaccaactctcc R12 acctcctgcatctctccttttgc R13 aaataaagttttgagaaccataagtgg R14 caccatcacagctcactgcagc R15 aacctctttgagaatcggatagcc R16 aaataaagtacatacctccaattttgc R17 gacacattcctatgggtttaattcc R18 tgtaaaatatggtttcagaagggagg R19 gcaggtggataacgaggtcagg R20 ccagccaagaatttcaaagattagc R21 gaagggagatgacaaagggaacg R22 gcagaagaactgcttgaacctgg R23 gtggtcccagctactcgagagg R24 ccctcagcaaaactaactgaaaagg R25 tagaaaccaagatatctagaattccc R26 ccacgcccggcggaataaatgc R27 acaaaaaaagaggcaaaaactgagag R28 ctgggcgcagtggctcatgcc R29 tggctgtgaggctgagaactgc R30 ctgggcgacagagtgagactcc R31 aagtctggctgggcgcagtgg R32 aatggacaaaagaggtgaactggc R33 gatagagtgaaaacgcacaatggc R34 aattaaacagctaggtcaatatgagg R35 ggtctccactatcaagggacaag R36 aagcagctgttagtcatttccagg R37 aggcatcctcagattatggctcc R38 cctgagtaacactgagaccctgc R39 aacactcaagctgtcaagagacac R40 attcaggccaggcgcagtggc R41 taaatcgtaaaactgccacaaagc R42 cagaggagtaggagaaggaaaagg R43 ggtagctatctaccaagtagaatcc R44 atcagattggaaaaagtcccaaagc R45 ctcctgaaaagcacctactcagc R46 ctccttaaacctgaggtactggg R47 ttttctcctaatagaccaccattcc R48 ctgctgtattaccatcactcatgtc R49 ctggccaacatagtgaaaccacg R50 atttgaataggggttaaagtatcattg R51 cacttcagtggaagttggcatgc R52 gtttttcttcgaagtgataaacatacg R53 gctccttagtctatgtacctgtgg R54 tactctggcatggtaactggtgc R55 acaaaggactaggtctgtggagc R56 ccaagtttaccaaattaccaaagttacc R57 tgagccgatatcacgccactgc R58 tcccaataaaggttttggcccagg R59 ctgggtagcaaattagggaacagg R60 ctggccagaaaagacagttttatcc R61 ggttcccaggaagggataacacc R62 tcactccaggaggttccatttcc R63 aggcttggaaataagcagcagtgg R64 attcatacaatggaatactactcagc R65 taagtgatcctcccacctcaacc R66 tataagaggaagactggggctgg R67 tcatacttatgcaggttataggagg R68 caagatcacgccactgcactcc R69 aaaataaatagctggtgctcaagatc R70 caccagcctcattcaacagatgg R71 caatgcagcctcaacctcctgg R72 gttaggtcaggtgctcatgtctg R73 aagtttcaaaaggacatgtacaaaatg R74 tcctgaagaggctgcagcttcc R75 ctggtgcacattcccaagtgtgc R76 catgttggccatgttcttctgagg R77 ctcagcctcccgagtagctgg R78 aaagacatttaagaggagatgaggc R79 tgctgggattacaggcgtgagc R80 tgtgacttccatccgcagctcc R81 gacacttttgtggagctttcatgg R82 catgtgagggggcacgtcttgc R83 tcttctctatgagaaaagtggttgc R84 tggcaaaatgctatcgagctgcc R85 tatgaacacagccggcctcagg R86 gaggttgcagtgagctgagatcg R87 gtcaagcacccagtccgatacc R88 atctgggcttggtggcgcacg R89 gttaagcgggtcccacatcagc R90 cagccagtttcagtagaaagatgc R91 gacccaagcataaggggactagc R92 cccaaaaagtttacaagagaaattttc R93 cgcctgtagtcccagctactcg R94 cgcgtgatgcggaaaagaaatcc R95 tctactatgaaccctccttcagac R96 gtgctgggattacaggtgtgagc R97 ttatccaaatgtcccagggcagg R98 ctgccagcactgctcgccagc R99 gctactgcaggcagtgccttcc R100 catccaagcccaaggtgtcagg R101 tgtttgcatgtaatttcaggaagcc R102 gatccgtcactgttaacactcagg R103 ctcacagtcacaagctcctgagc R104 gagatgatgctggggtcacagg R105 ttagaagaatgggatcgcaaagg R106 cggtattcaaatatgaggtcaggc R107 gtaaatcctgctgccagtcttcc R108 acagggtcagacagagccttgg R109 agttattgatctaactatacaacaagc R110 aaagactaggggccggggacg R111 ctggtagaaataaagacaacaaagcc R112 gtgccaagtaattaaaagtttgaaacc R113 ggcttttgaagggagcaccacc R114 gaaggataaatacctatgatactttcc R115 ggcagggaaatactgtgcttcaag R116 gtggtgaaattccacctcagtacc R117 tcccaaagtgctgggattacagg R118 gaaattagcaaacaatgccaagacg R119 taagtattggaccgggaaggagg R120 ctatcattttgctcaaagtgtagcc R121 atttcacaaactacagaggccagg R122 tagacttctgtctctctatgctgc R123 tgagtgagctgccatgtgatacc R124 acttcacaccagcctgtccacc R125 taactcatatcctcagagagaccc R126 agaggttcctcgattcccctgc R127 gtgtcagcgtcccaacacaaagc R128 gaaagtggatgggcaagcattgc R129 gtgatcacctcacagctgcagg R130 gtttgtttagtcaaggcatttcacc R131 cctcagcctccagagtagctgg R132 taaaagaaaactcctccttcctgg R133 aatgtgctatgtctttaaatccatgg R134 agctggcaaatctggtaatataaaag R135 gcttgaacctggaaggtggagg R136 gcaggcatgctaagaccttcagc R137 cagctccatgaataactccacagg R138 gcttgaacccaggaggcagagg R139 atcgaagatgccactgcaagagg R140 ccaaccacacttcaggggatacc R141 cacgccagtccactgatactcac R142 gggtttcaccatgttggccagg R143 cccaacaaaggctctggcctgg R144 atgacagcagaggagcttcatcc R145 gcaggctacgagtaaaaggatgg R146 cgggtaaaatcttgcctccttcc R147 aaacttaaaccaatggtggatgtgg R148 agagactgaggaactgttccagc R149 gaaacggtcttggatcactgatcc R150 tgcgcatgatatcttgtttcaggg R151 ggcctccgtttaaactgttgtgc R152 gaatgctggcccgacacagtgg R153 tcttggtatagaaaagccagctgg R154 gcaaaagcccaagagcccctgg R155 ttctcccaaaatgagccccaagg R156 gtggtgacgtaaacaaaaggtacc R157 gcaaattccatgtgaatcttattggc R158 cctgatctatggaacagtggtgg R159 gttacaaacgttgcagtttgcaacg R160 gaaccccgtcaacagtgatcacc R161 acaggacctcaaggcaaggagc R162 catacctaaaatagaaatgtctatccc R163 gagttgcatatatgttttataaatccc R164 tgagcccacatccataaagttagc R165 accgcaacctttgccgcctgg R166 taaatattttgtatggagtcaccacc R167 aaagccaggagaaaaagttatgagg R168 tcccaaagtcccaggattacagg R169 tcactatggagcatctccgatgg R170 agttccctggaagtctccgagg R171 aaaataatcacccagcccacatcc R172 acaaaactacagacacagaaagtgg R173 tttgggaggctgaggtaggtgg R174 aaagacagtgaaacatctataaggg R175 cattttgggagaccagggcagg R176 gcatgggacagacacaaagcagc R177 gaataacaaagagagccggctgg R178 taaaccttttattgaaaattgtcaaatgg R179 cgcctcagcctcccaaagtgc R180 tacattagttttataggtccagtagg R181 gaaggtttattcatattaaaatgtgcc R182 ctggcttctgtggtttgagttgg R183 acagacctacctcctaaggatgg R184 gctagcttttgtgtgtaagaatggg R185 ggcctactcacacaatagaatacc R186 gcaccattgcactccagcctgg R187 gaaattaggataaaggttgtcacagc R188 cagaagtgttcaaggtgaaactgtc R189 ctgaatcatgaaatgttctactctgc R190 tgtcaacttgactgggccatacg R191 ctcccgtatagttgggattatagg R192 gcttggagttccttgaaattcttgg R193 cctggtggctccagttttctacc R194 aactcctgacctcatgatccacc R195 gctgggattacaggcatgagcc R196 ttctcctttatccttggtgacattc R197 tcccaaagtgctgggattacagg R198 gtcataagtcagggaccatctgc R199 ctgtttcattgatttccagactggc R200 gcaatctcggctcactgcaagc R201 gaagaagtgactatatcagatctgg R202 ttcaccatgttggccaggctgg R203 catcactgaagatgacaactgagc R204 gtccagcctgggcgatagagc R205 gaggaaagtctttgaagaggaacc R206 ggtacactcaccagcagttttgc R207 gagcaactggtgtgaatacatatgg R208 caatacctggcaccacatacacc R209 gggactacaggcatgtgccacc R210 cggtggctcacgcgtgtaatcc R211 caactgttaaatctctcatggaaacc R212 gacaaaggattagaaatgcaccc R213 ggaaatgttctaaaactggattgtgg R214 aataataatagccaggtgtggtagc R215 ctggaacactcacacattgctgg R216 ctgggtgacagagcgagactcc R217 cccaaatcatccccgtgaaacatgc R218 gaccctgcaatcccaacactgg R219 ctctcaggccttcaaactacacc R220 caggaaagggctcgctcagtgg R221 atctgcaaaagcagcagagcagg R222 gtacccatgacagacaagttttagg R223 cttatcccctactgtctcctttgg R224 ggatggtctcgatctcctgacc R225 aggttagagaccttcctctaatgc R226 agctgggattacaggtgcctgc R227 gctgaggcaggttggggctgc R228 acatttaacgtctcctaacttctcc R229 gtgctgcgattacaggtgtgagc R230 tatgacagcagtattatactatcacc R231 ctggggaccaaatctgaactgcc R232 gtagctattgttatttccaaaagagg R233 gcttgggaccccaggacaagg R234 cctggccaacatggggaaatcc R235 aattgcttgaacctgggaggtgg R236 gcctaagacccaaaagctattagc R237 catattaaagggccatattcaaattgg R238 ggatgtaaccagtgtatatcacagg R239 ggaagtttagtccacatcttctagc R240 gcacccacaggacaaccacacg R241 gggacgcgcctgttaacaaagg R242 gggctgggggccacgctcc R243 cgcaaaagtgaagccctcctgg R244 gaaatcctacttgatctaaagtgagc R245 tttgagcaacttggaaaaaataagcg R246 ttcccaaaagacaaatagcacttcc R247 ccattttgaaaatcacagtgaattcc R248 gaaaagaaaaccctgaattcaaaagg R249 tgctgaaaagaagcatttaaaagtgg R250 ctcttaccagtttcagagctttcc R251 ttttcagccaaaaatcaaggacagg R252 cttgagcccaggagtttgagacc R253 cgcctgtagtaccctctactagg R254 ggtaaagaaagaaggatttgaaaacc R255 taagagtaatgaggttaaagtttatgc R256 catttttattgtcacaggccatttgc R257 gccacgccttctcttctgccacc R258 tgcctctcctgactgcactgtg R259 ccatgctctaccacgcccttgg R260 cattcaggctggagtgcggtgg R261 cttaaaaattgtctggctaagacattg R262 ttgctcttgttgcccgggttgg R263 gagcttagaggaaaagtattatttcc R264 tggtgctgtgccagacgctgg R265 cagatctttttggctattgtcttgg R266 gaaggaaagggcctcccactgc R267 catgaaaaagcatgctggggagg R268 caaacataaaaaagctttaatagaagcc R269 tcccaactatgaaaaaatagaagacg R270 cacaaattagccgggcatggtgg R271 cttcctttactgagtctttctaaagc R272 tgtcctttgaaatgtaggtatgtgg R273 ggatcttgcaatactgacatctcc R274 atttgaaaagaactgaaggatctacc R275 gtgagctgagatctcgtctctgc R276 tttgtctgaaacagattctaaaagttgg R277 gcaggtgcctgtagtcccagc R278 gtttgagcttctaaaattcatggattc R279 gtggtaggtcaaaccgcaattcc R280 accaaatcagacatatcagctttgg R281 cacagaacggatcctcaataaagg R282 gttaactcctcccttctctttatgg
282 Reverse ABL Primers Used for the Second PCR Round and the Tag Sequence which was on the 5′ End of Each Primer -
2nd Round Tag D gtgttcagagagcttgatttccagg RN1 cccacttgatttttcccacatgg RN2 atttatttagatgaagtgaatattttcc RN3 atttagtttgtttaactgtgagtgc RN4 gtacagaagtgcttgatgcatacc RN5 aggcagataaaaattctccattagc RN6 acaagcacgagccacagcacc RN7 cgctcttgttgcccaggctgg RN8 cccaaaacagactttctagataacc RN9 ttcaaattgctttttttctactcacc RN10 gatctgaaaaaagtgacaggttgg RN11 cactgaaatttgaaaggaacatatgg RN12 tctggtgcagtggcctctagg RN13 accataagtggttttacctgatgg RN14 cccaggcgcaggtgattctcc RN15 ggtggctcacgcctgaaatcc RN16 cacagtccacgtgccacaatcc RN17 aatcatgttaacacatccctctcc RN18 gaagagagtgttgaaaggttaagc RN19 cgagaccatactggctaagatgg RN20 attagccacacaataaatgttctgg RN21 tttgaaaagcgttgcaatatgatgc RN22 ggttgcagtgagccgagatcg RN23 ggtgggaggactgcctgagc RN24 aacagagagaaaaaacacaaattacc RN25 gatatctagaattcccaaatacttgg RN26 gtgatagaattaaaggaaaaaataaacg RN27 attgttccttttctaaatattctacc RN28 cagcactttgggaggctgagg RN29 cacagaggtttcacagtgctgg RN30 aacttctgcttctgtccataatgc RN31 gcctgtaatcccagcactttgg RN32 gccagtaaacatatgaaaaggtgc RN33 aattatgtaaataaagagtgaaaagg RN34 cccctacacagaaaaaacaattcc RN35 tgagtgtcaaagaaaaatacaattgg RN36 atacacagagaaaatgagtccacc RN37 aacactccccttctctgtttagc RN38 gatattctttgcaacctaggatgc RN39 ctctaaaactaatcagcaatgtaacc RN40 cacctgtaatcccagcactttgg RN41 cgtaaaactgccacaaagcttgtagg RN42 gtggcagaggtgcaagcaagc RN43 acagaaatgacaaacgcatgtacc RN44 acactctcttagctaggctttgg RN45 gagcttggaatagggcagttcc RN46 ctgggttctttaaacatgtccagg RN47 tcaagaaaggacactgcagtggc RN48 catgcacacaaactatctcattcc RN49 tagccgggcatggtggcacg RN50 atcatgctgattgaatttcaaatagc RN51 ttggcatgcagggcagtgacc RN52 ggtggtgagataataacacctgc RN53 ttgctatataataatcatttgtgatcc RN54 cggtaactgttactctgggatgg RN55 aggctaggttcccttctcttcc RN56 gtagtgcctagcacagagaaagc RN57 ctagcctgggcaacaagagcg RN58 tctctctcctctctgggatcag RN59 gtttgaatatttgtatgcagcaagc RN60 tagaacaaattctggcttataaaagc RN61 ccactctacctttattccttgcc RN62 agaccagaatatgcaagcagagg RN63 ggacgttttgctggtgtctgcg RN64 aaggaacaaactgttgtcacatgc RN65 atgtagctgggactacaggtgc RN66 ggctcatgcctgtaatcccagc RN67 atgaggttttcacacaaaaagatgc RN68 tgggcgacagagcaagactcc RN69 aaatgtccctaaaagtgatcaacagc RN70 cagactcagttttacctcatcagc RN71 agtgatctttcctctttaacctcc RN72 ccagctattcaggaggccaagg RN73 cttaaacattatgacactgtcttgc RN74 ccaggtctatgaggccgttcc RN75 tccaaagcatccctacattatacc RN76 acatacatacatgcagtgactagc RN77 tacaggtgccagccaccatgc RN78 gcctgtaatcccagcactctgg RN79 gacagagtcccactcttgttgc RN80 gtgccttccaaagcagtgtagg RN81 tatcttactgggtatgtataatgcc RN82 caaaggaaatacgtcctaccagg RN83 ccttttctcacagacatgcttcc RN84 taaacacagtgagcagaatccc RN85 ataaagcaaacttctaaaagggtcc RN86 accactacactccagcctggg RN87 gatacctgggtcagagtaagtgc RN88 tgtaatctcagctacttgggagg RN89 gtgtcgtcttctcttcctctacg RN90 ctggctagtatgaggttggtgc RN91 ggactagccacatttcaaccagg RN92 gcagtatactgagaatttagtttcc RN93 gaggctgaggcaggagaatgg RN94 cattgtttgatgaaggtcaacagc RN95 cagacaagagtggctacggcag RN96 acgcccagccagattattcagg RN97 ggaaccagaaagaagtgcaaagg RN98 tgagccatcttggaggcaggc RN99 caggaccttcctacaaacctcc RN100 aacacaacatatctgaccttacgc RN101 gccttagaagtccagaggaaagc RN102 tgacgtacccagtagaccttcc RN103 ctctgcaagcctgggaaacagg RN104 gccttgtccccaagtcctaagg RN105 gcaaagggactcctggaattcc RN106 gctcctgcctgtaatcccagc RN107 gaaggaaacagaaaaagcagaggc RN108 cttactaccgttcttcttcactgg RN109 actattctgtttctttaggtttactgc RN110 cggtggctcacacctgtaatcc RN111 agccagagttctgtgctctagg RN112 taatttgcatttcgtgccgctcc RN113 cacttttaatacagatcccaatagg RN114 atgtattttttcttttcctgtcaagc RN115 aaatgttaacattattctccctaagg RN116 catatgcccagatcccgtctcc RN117 acaggtgtgagccgctgcacc RN118 gccaagacgtttacagttttggc RN119 aggaaacttctgaggatgatggg RN120 gctttatagggcagtctgaattcc RN121 ttagaataaaagttatctcgggagg RN122 taatttcttcagctttatccctcag RN123 cacatgactaattctctattcattcc RN124 aaagacctcaagaaaagagtcacc RN125 gacccataaagattatatgcccag RN126 aaagtactaatgcagtgtgtcagc RN127 gaggttcctcgattcccctgc RN128 ggagagcagaggaattcacagg RN129 agtaattagaaactgattctaagacg RN130 cataccattgccaatccagttcc RN131 attacgggtgcctgccactgc RN132 cagccaggcagaggagagagg RN133 ttttcattccaagtttctgtttggg RN134 tttcaaataggaatttggataatccc RN135 taagccgagatcacaccactgc RN136 ccttcagcgcattatatcttggc RN137 ccatctaatccatcttaaattcacc RN138 gagtggagactgcgccactgc RN139 aatcatgtgccaattaaaccatggc RN140 cccagggaccagaccagacc RN141 ctcactcaccagtgaaaatcagc RN142 ggttgctctcgaactcctgacc RN143 gttcccccagctcctttctgc RN144 agaaagatgtagaagggtccagc RN145 gggaaaaggtgtattatgcaagcg RN146 ctctctcagacctaatgcaaaagc RN147 aactatacatacagtatttgtattagc RN148 aaattaatgcaatccatgatccagg RN149 ctttctccactctaagagaaccc RN150 ttttggtgtgttcatattggctgc RN151 gcttccacaaatgacagacaaagg RN152 ggctcatgcttgtaatcccagc RN153 catatgaattgttgttcctttgtagg RN154 cactggtacaagtccaagagtcc RN155 gaccctgtgtctacttcctggg RN156 tatttgaactatctcttgaaatgtcc RN157 ctgattaaaaagtattacccttggc RN158 tttgaaactgcactcaataacttgg RN159 agtaatgtgtcatgatccaatggc RN160 gaaagcatttcccaatgtctcacc RN161 caatggacaaaaggcccaactgc RN162 tccagctctggcttttttgttaag RN163 acggagtctcactccgtgacc RN164 ctatgtcatagtcaagagactttgc RN165 gttcaagcgattctcctgtctcg RN166 ccacctaatacttaaatacggaagc RN167 acaacaaacttaatagtgaagtg RN168 ttacaggcgtgagtcaccatgc RN169 aacacctccaagaggccaaacg RN170 tactattggcaaatttcaattatatgg RN171 agcccacatcctaaaattcaataag RN172 gaaagtggataagtgtttgtctgg RN173 ggccaggcattcaagaccagc RN174 agccaacaacaaaaagacacaacc RN175 ttgagcccaggagttcaagacc RN176 cagactaaagatctcagagagaaac RN177 cgcttgtaatcccagcacttgg RN178 aaaagtgaaatcagaatttgtttcc RN179 caggcgtgagcaactgtgtcc RN180 ggtccagtaggatctcgtttgc RN181 actttgaaaatgttgttatagctggg RN182 ttccctgcatctaagtcttctcc RN183 agatatctaccattgaagagtttgc RN184 agtcttcacttcactttgttgtcc RN185 ccatgcaggtatgaaatataaaagc RN186 tgggtgacagagtgagactcc RN187 acagcaataccgggttaacatgc RN188 tttatgtaaaagatgaatgcgaggc RN189 ctactctgctactgggaacagg RN190 caaacgttagtctggcaaaatgcg RN191 tgcacgctaccacacccagc RN192 aattcttggatctgtgtgtttactgc RN193 taccagttatcattctctttctgc RN194 atccacccacctcggcctcc RN195 cactctgcctggcccttaatgg RN196 atagtttgtttaatatgccactaagg RN197 gcgtgagccaccgcacctgg RN198 ctccatcacacaaattttatgtggc RN199 agacggagtctcgttctgtcgc RN200 tcccaggttcaagccattctcc RN201 tattttgagagtctcactctgtcg RN202 gtctcgaactcctgacctcagg RN203 aaggaggtgaagagtgaactacg RN204 gtctcaggttttggacttacttgg RN205 tttacagatcttaaatgcattaggac RN206 gtacactgaacaaaggagacagg RN207 ctggtagtaatgcaaaatagcacc RN208 catttaatgtgaaatgaattataagcc RN209 gagacagggtttcactatgttgg RN210 ccagcactttggaaggctgagg RN211 gaaaccaagtatcatggtaaattgc RN212 cagtgagggctgctcagttcc RN213 gccaggtgcggtggctcacg RN214 catgcctgtaatcccagctacc RN215 atgtaaatggtacagtcactttagg RN216 cccacaatacagagaactcttacc RN217 tgaaacatgcagcccagtgtcc RN218 tgttttttctcctgccttcaatcc RN219 gctttcctgggtctccatctgg RN220 gcagccgcttgaaaacaaaacagc RN221 gatcacgttacatttgggggtgg RN222 taggctgaaaaactaaaatttgttgc RN223 ctcctttgggctcctttagtcc RN224 gcctcggcctcccaaagtgc RN225 aatgcctagagagatttggcagg RN226 gagatggggtttcactatgttgg RN227 tgtgatcttgccactgcactcc RN228 acttctcctccatttgtttcttcg RN229 cgtgcccgggctcagttctac RN230 ccaaaacaataaaatcacaatttggg RN231 ctgaactgccttagagtaaatccg RN232 atttctgtatcaggtctgtgttcc RN233 ggctgaccccttcactgtttcc RN234 caaaaattagccaggcatggtgg RN235 gcagtgagcagtgatcgcacc RN236 aaagactgtgaactaacttgtttgc RN237′1 tgccaagaattacacattattaggc RN238 ggccaggatgtcattaactttcc RN239 gtaagagctgacgtgtattgtgc RN240 cccggtgaggccgcacatcc RN241 cctgcgccttaaccccctcc RN242 cggcgcctaggggccatcg RN243 acttaaggaaacgaacatgacacc RN244 gagaccgagtcttgctgtgtcg RN245 gtattaattgaagatgatttggaatgc RN246 tctttaaaagactatcgctgaggc RN247 aaaagagacatcagtagagcatcc RN248 gttcatgttttctttgacgtctcc RN249 tttcgaaagttcaggctgagtgc RN250 gaccctcaaaacaatcctctaagg RN251 caaaacacacttagaaacaaactgc RN252 gcctgggcgacatagtgagacc RN253 ggcaggagaatggcgtgaacc RN254 tttgctcgttgcccaggctgg RN255 gcaacttaatgtgatagaataatagc RN256 cctccccttctgctgccagc RN257 ccacaacaatgtaaactcctctgg RN258 tactctccctagagttcgttccc RN259 gggtccccctttggccattcc RN260 gatcttggctcacttcaacctcc RN261 aggggaaatatttaaaccttgg RN262 aatgcaatggtgcatttacagagg RN263 tcattttatctatttctacatggtcc RN264 ggaagggaaatgcccatgaacc RN265 agtgaacattttctgcagcctcc RN266 caacaggacgtcaggcgatcc RN267 ccttcaggctgtcctgaaaagg RN268 agtctcactccatcgcccagg RN269 actgtgaacagtagttaactcagg RN270 gcatgcctgtaatccaagctgc RN271 gaaacaattctcttttcacacttgc RN272 ggctcatgcctgttatcccagc RN273 agaagaagcttagtcatatgtttgg RN274 cagatgcttgagccaaacaaatgg RN275 ctggcagacagagtgagactcc RN276 aatgtgtgaatattattcattacaggg RN277 gcaggagaattgcttgaacctgg RN278 ctttagtcaaattaaaacagtctatcc RN279 gatttctatctcctgcaaccacc RN280 ttcttgtgtaactactaaaaatctcc RN281 aaagggtcttcataaggctaatgg RN282 ctcttaaggattatttatatgaagacc - Amplified patient DNA was electrophoresed on a 2% agarose gel. P is patient DNA, N is the normal DNA and W is the water control. The patient DNA was amplified using multiple RARα primers and a single PML primer
-
- a) Amplified patient DNA electrophoresed on a 2% agarose gel, P is patient DNA, N is the normal DNA and W is the water control. The patient DNA was amplified for one round using an RARα primer and a PML primer designed using the breakpoint sequence.
- b) The sequence chromatogram obtained from the patient DNA. The breakpoint between PML and RARα is shown.
- Two patients have been studied and the breakpoint has been isolated and sequenced in both. The primers used are shown in Example 4.
-
-
1st Rd PML F1-FT1 caggaggagccccagagc PML F2-FT1 tcctggggatggttggatgc PML F3-FT1 tgaccccacagagtttacacagc PML F4-FT1 agtcagggcaggctctgcc PML F5-FT1 tattttggccccatccagaaagc PML F6-FT1 cacccagagtacagctttgttcc 2nd Rd PML F1-FT2 gaggagccccagagcctgc PML F2-FT2 tggggatggttggatgcttacc PML F3-FT2 cccacagagtttacacagcttgc PML F4-FT2 caggctctgcccactcacc PML F5-FT2 ccatccagaaagcccaaagcc PML F6-FT2 ccagagtacagctttgttcctcattc - The second round primers were internal to the first round primers and were used for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
- Various combinations of the forward and reverse primers can be used. 2 exemplary protocols were either to set up 6 PCRs, each containing a different PML primer and all 34 RARalpha primers, or to set up 1 PCR which contained all 6 forward and all 34 reverse primers.
- 34 Reverse RARalpha Reverse Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer
-
Tag R1 gcagtacaaacaacgcacagcg RAR1 ctgccaccctccacagtccc RAR2 gccaagaccatgcatgcg RAR3 cccagggacaaagagactccc RAR4 caggaagcagacagtcttctagttcc RAR5 tgcctgtaatcccaacactttgg RAR6 tccctctggccaggatggg RAR7 atggggaatgggagtaggaagc RAR8 cagatcagttctcccctccagc RAR9 acaaaaaagaaacatgctcagagagg RAR10 tggtggcatgcatctgtagtcc RAR11 aggtgctctatagatgttagcatccc RAR12 ccaggacaggatggagatctgg RAR13 agggaacctgtgcattatccttgc RAR14 cagaagtcttgctttaaggaggagg RAR15 gggtacgtgaaactcaccaagg RAR16 cagagtgtggcaagcaaggg RAR17 aacattttaaaggtacaaataacgtggg RAR18 tagggagcaacagccattaagc RAR19 ggtgcactgtccagctctgg RAR20 actctcgctgaactcgcctgg RAR21 ctcggtctctggtggtacgc RAR22 gcaagaggtccgagctggg RAR23 ggaagaagtgaaacaagagatgaagg RAR24 cccagagaacaaaccggattagg RAR25 cccttcaaccttctccaatctgc RAR26 cccatgtccagtggtttaggg RAR27 gagattggtgggagacagatgg RAR28 cttctcagctcaaagttccagcg RAR29 gaatgggagagatgaccagagg RAR30 aagggcaagggggtatgtgg RAR31 ggaaggaagcatgggaacacc RAR32 ccatcaatgctctgtctgtctgg RAR33 gtgccgtgactgtgcttgg RAR34 acatcccattgacctcatcaagc - Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
- If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
- The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
-
- design using standard criteria
- pairing with each BCR primer and testing by electronic PCR for amplification off the BCR template. Primers that fail this criterion are discarded.
- incorporation in a pool of 12 or 24 ABL primers, pairing the pool with each BCR primer, and testing by experimental PCR using a BCR template which has been previously produced by PCR amplification. Any pool that that produces amplification and thus fails this test is further analysed by testing each of the individual ABL primers to determine which is responsible for amplification. When identified, this primer is discarded.
- The BCR and ABL primers used in Example 1 are shown in Example 2.
- Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
-
TABLE 1 Sequence Identifier Sequence SEQ ID NO: 001 gtgggcccccccgtttccgtgtacagggcacctgca gggagggcaggcagctagcctgaaggctgatccccc cttcctgttagcacttttgatgggactagtggactt tggttcagaaggaagagctatgcttgttagggcctc ttgtctcctcccaggagtggacaaggtgggttagga gcagtttctccctgagtggctgc SEQ ID NO: 002 caccacgtctggctaatttttgtatttttagtagag atggggtttcaacatgttagccaggctggtctcgaa ctcctgacctcaggtgatccacccgcctgggccctc caaagtgctgggattacaggcaggagccactgtgcc cggcctgacctcatatttgaataccgagttttagtt ctggaggagctgcaggttttatgaaaagggaacaca tttgattcctcagagcagccacaggccagctctctg aagtaaagtgcacgtgtgcatgtgtgtgcacactca cacacacgtacacacacattcacaaataactgtgcc cggcctgacctcatatttgaataccgagttttagtt ctggaggagctgcagg SEQ ID NO: 003 tttgggaggctgaggcaggtggatcgcttgagctca ggagttggagaccagcctgaccaacatggtgaaacc ctgtgtctactaaaaatacaaagattagccgggcta ggcagtgggcacctgtaatcacaactgcttgggagg ctgagggaagagaatcgcttgaacccaggaggcgga ggttgcagtgagccgagcttgtgccactgcattcca gcctgggcgacagag SEQ ID NO: 004 ggtctcactctgttgaactcctggtggcctcaaggg atcctcctacctcggcctcacaaagtattggaatta caggtgtgagtcactgcagctggccttcacttatca ctgtgaggagtaaacagctgcatggtgggcttaatg ccatctaacacgagtgactccatgttcagacagtag gatcacaaatgattattatatagcaatgaatggcca caggtacatagactaaggagccacatccctgct SEQ ID NO: 005 cctccagctacctgccagccggcacttttggtcaag ctgttttgcattcactgttgcacatatgctcagtca cacacacagcatacgctatgcacatgtgtccacaca caccccacccacatcccacatcaccccgaccccctc tgctgtccttggaaccttattacacttcgagtcact ggtttgcctgtattgtgaaaccagctggatcc SEQ ID NO: 006 ttatttataacaacattttcagcgtggcaactgcag tttcagaatggtggaattataccagtcagagagaga tgcaaatgatttaaaataggaagaaagcaggtgtct ggcccagaggaccagattaagaagaccccatgagag ttacaatagttagtgaaaatggtgcttctgcaaacc tcatgtctacagaagctggt SEQ ID NO: 007 tgcaccttcataacataatctttctcctgggcccct gtctctggctgcctcataaacgctggtgtttccctc gtgggcctccctgcatccctgcatctcctcccgggt cctgtctgtgagcaatacagcgtgacaccctacgct gccccgtggtcccgggcttgtctctccttgcctccc tgttacctttctttctatctcttccttgccccg SEQ ID NO: 008 gtgagctccgcctcctgtcagatcagtggcggcatt agtttctcataggagcatgaaatctattgtgaacag tacatgcgatggatccaggttgcgtgctcctagtga gaatctaatgcctgaggatctctcattgtctcttat cactcccagataggactgtctagttgcaggaaaaca agctcagggctcccactgattctacattacagtggg ttgtataattattatatattacaatgtaataataa SEQ ID NO: 009 ggagtctgaggaggggaaggaggcaaggttggctcg gatcccagccagtaagtctgggtgtgg SEQ ID NO: 010 cttctccctgacatccgtgg SEQ ID NO: 011 acacagcatacgctatgcacatgtg SEQ ID NO: 012 gaggttgttcagatgaccacgg SEQ ID NO: 013 cagctactggagctgtcagaacag SEQ ID NO: 014 tgggcctccctgcatcc SEQ ID NO: 015 tccccctgcaccccacg SEQ ID NO: 016 tgacatccgtggagctgcagatgc SEQ ID NO: 017 acatgtgtccacacacaccccacc SEQ ID NO: 018 accacgggacacctttgaccctgg SEQ ID NO: 019 ctggagctgtcagaacagtgaagg SEQ ID NO: 020 tccctgcatccctgcatctcctcc SEQ ID NO: 021 cccacgacttctccagcactgagc SEQ ID NO: 022 gcaacactgtgacgtactggagg SEQ ID NO: 023 gtctatctaaaattcacaaggaatgc SEQ ID NO: 024 aggcaaagtaaaatccaagcaccc SEQ ID NO: 025 cactcctgcactccagcctgg SEQ ID NO: 026 caaccaccaaagtgcttttcctgg SEQ ID NO: 027 atatggcatctgtaaatattaccacc SEQ ID NO: 028 tgcctcggcctcccaaagtgc SEQ ID NO: 029 agccaccacacccagccagg SEQ ID NO: 030 aataactgttttctccccccaaaac SEQ ID NO: 031 tgttttacaaaaatggggccatacc SEQ ID NO: 032 acttaagcaaattctttcataaaaaggg SEQ ID NO: 033 ctttcaattgttgtaccaactctcc SEQ ID NO: 034 acctcctgcatctctccttttgc SEQ ID NO: 035 aaataaagttttgagaaccataagtgg SEQ ID NO: 036 caccatcacagctcactgcagc SEQ ID NO: 037 aacctctttgagaatcggatagcc SEQ ID NO: 038 aaataaagtacatacctccaattttgc SEQ ID NO: 039 gacacattcctatgggtttaattcc SEQ ID NO: 040 tgtaaaatatggtttcagaagggagg SEQ ID NO: 041 gcaggtggataacgaggtcagg SEQ ID NO: 042 ccagccaagaatttcaaagattagc SEQ ID NO: 043 gaagggagatgacaaagggaacg SEQ ID NO: 044 gcagaagaactgcttgaacctgg SEQ ID NO: 045 gtggtcccagctactcgagagg SEQ ID NO: 046 ccctcagcaaaactaactgaaaagg SEQ ID NO: 047 tagaaaccaagatatctagaattccc SEQ ID NO: 048 ccacgcccggcggaataaatgc SEQ ID NO: 049 acaaaaaaagaggcaaaaactgagag SEQ ID NO: 050 ctgggcgcagtggctcatgcc SEQ ID NO: 051 tggctgtgaggctgagaactgc SEQ ID NO: 052 ctgggcgacagagtgagactcc SEQ ID NO: 053 aagtctggctgggcgcagtgg SEQ ID NO: 054 aatggacaaaagaggtgaactggc SEQ ID NO: 055 gatagagtgaaaacgcacaatggc SEQ ID NO: 056 aattaaacagctaggtcaatatgagg SEQ ID NO: 057 ggtctccactatcaagggacaag SEQ ID NO: 058 aagcagctgttagtcatttccagg SEQ ID NO: 059 aggcatcctcagattatggctcc SEQ ID NO: 060 cctgagtaacactgagaccctgc SEQ ID NO: 061 aacactcaagctgtcaagagacac SEQ ID NO: 062 attcaggccaggcgcagtggc SEQ ID NO: 063 taaatcgtaaaactgccacaaagc SEQ ID NO: 064 cagaggagtaggagaaggaaaagg SEQ ID NO: 065 ggtagctatctaccaagtagaatcc SEQ ID NO: 066 atcagattggaaaaagtcccaaagc SEQ ID NO: 067 ctcctgaaaagcacctactcagc SEQ ID NO: 068 ctccttaaacctgaggtactggg SEQ ID NO: 069 ttttctcctaatagaccaccattcc SEQ ID NO: 070 ctgctgtattaccatcactcatgtc SEQ ID NO: 071 ctggccaacatagtgaaaccacg SEQ ID NO: 072 atttgaataggggttaaagtatcattg SEQ ID NO: 073 cacttcagtggaagttggcatgc SEQ ID NO: 074 gtttttcttcgaagtgataaacatacg SEQ ID NO: 075 gctccttagtctatgtacctgtgg SEQ ID NO: 076 tactctggcatggtaactggtgc SEQ ID NO: 077 acaaaggactaggtctgtggagc SEQ ID NO: 078 ccaagtttaccaaattaccaaagttacc SEQ ID NO: 079 tgagccgatatcacgccactgc SEQ ID NO: 080 tcccaataaaggttttggcccagg SEQ ID NO: 081 ctgggtagcaaattagggaacagg SEQ ID NO: 082 ctggccagaaaagacagttttatcc SEQ ID NO: 083 ggttcccaggaagggataacacc SEQ ID NO: 084 tcactccaggaggttccatttcc SEQ ID NO: 085 aggcttggaaataagcagcagtgg SEQ ID NO: 086 attcatacaatggaatactactcagc SEQ ID NO: 087 taagtgatcctcccacctcaacc SEQ ID NO: 088 tataagaggaagactggggctgg SEQ ID NO: 089 tcatacttatgcaggttataggagg SEQ ID NO: 090 caagatcacgccactgcactcc SEQ ID NO: 091 aaaataaatagctggtgctcaagatc SEQ ID NO: 092 caccagcctcattcaacagatgg SEQ ID NO: 093 caatgcagcctcaacctcctgg SEQ ID NO: 094 gttaggtcaggtgctcatgtctg SEQ ID NO: 095 aagtttcaaaaggacatgtacaaaatg SEQ ID NO: 096 tcctgaagaggctgcagcttcc SEQ ID NO: 097 ctggtgcacattcccaagtgtgc SEQ ID NO: 098 catgttggccatgttcttctgagg SEQ ID NO: 099 ctcagcctcccgagtagctgg SEQ ID NO: 100 aaagacatttaagaggagatgaggc SEQ ID NO: 101 tgctgggattacaggcgtgagc SEQ ID NO: 102 tgtgacttccatccgcagctcc SEQ ID NO: 103 gacacttttgtggagctttcatgg SEQ ID NO: 104 catgtgagggggcacgtcttgc SEQ ID NO: 105 tcttctctatgagaaaagtggttgc SEQ ID NO: 106 tggcaaaatgctatcgagctgcc SEQ ID NO: 107 tatgaacacagccggcctcagg SEQ ID NO: 108 gaggttgcagtgagctgagatcg SEQ ID NO: 109 gtcaagcacccagtccgatacc SEQ ID NO: 110 atctgggcttggtggcgcacg SEQ ID NO: 111 gttaagcgggtcccacatcagc SEQ ID NO: 112 cagccagtttcagtagaaagatgc SEQ ID NO: 113 gacccaagcataaggggactagc SEQ ID NO: 114 cccaaaaagtttacaagagaaattttc SEQ ID NO: 115 cgcctgtagtcccagctactcg SEQ ID NO: 116 cgcgtgatgcggaaaagaaatcc SEQ ID NO: 117 tctactatgaaccctccttcagac SEQ ID NO: 118 gtgctgggattacaggtgtgagc SEQ ID NO: 119 ttatccaaatgtcccagggcagg SEQ ID NO: 120 ctgccagcactgctcgccagc SEQ ID NO: 121 gctactgcaggcagtgccttcc SEQ ID NO: 122 catccaagcccaaggtgtcagg SEQ ID NO: 123 tgtttgcatgtaatttcaggaagcc SEQ ID NO: 124 gatccgtcactgttaacactcagg SEQ ID NO: 125 ctcacagtcacaagctcctgagc SEQ ID NO: 126 gagatgatgctggggtcacagg SEQ ID NO: 127 ttagaagaatgggatcgcaaagg SEQ ID NO: 128 cggtattcaaatatgaggtcaggc SEQ ID NO: 129 gtaaatcctgctgccagtcttcc SEQ ID NO: 130 acagggtcagacagagccttgg SEQ ID NO: 131 agttattgatctaactatacaacaagc SEQ ID NO: 132 aaagactaggggccggggacg SEQ ID NO: 133 ctggtagaaataaagacaacaaagcc SEQ ID NO: 134 gtgccaagtaattaaaagtttgaaacc SEQ ID NO: 135 ggcttttgaagggagcaccacc SEQ ID NO: 136 gaaggataaatacctatgatactttcc SEQ ID NO: 137 ggcagggaaatactgtgcttcaag SEQ ID NO: 138 gtggtgaaattccacctcagtacc SEQ ID NO: 139 tcccaaagtgctgggattacagg SEQ ID NO: 140 gaaattagcaaacaatgccaagacg SEQ ID NO: 141 taagtattggaccgggaaggagg SEQ ID NO: 142 ctatcattttgctcaaagtgtagcc SEQ ID NO: 143 atttcacaaactacagaggccagg SEQ ID NO: 144 tagacttctgtctctctatgctgc SEQ ID NO: 145 tgagtgagctgccatgtgatacc SEQ ID NO: 146 acttcacaccagcctgtccacc SEQ ID NO: 147 taactcatatcctcagagagaccc SEQ ID NO: 148 agaggttcctcgattcccctgc SEQ ID NO: 149 gtgtcagcgtcccaacacaaagc SEQ ID NO: 150 gaaagtggatgggcaagcattgc SEQ ID NO: 151 gtgatcacctcacagctgcagg SEQ ID NO: 152 gtttgtttagtcaaggcatttcacc SEQ ID NO: 153 cctcagcctccagagtagctgg SEQ ID NO: 154 taaaagaaaactcctccttcctgg SEQ ID NO: 155 aatgtgctatgtctttaaatccatgg SEQ ID NO: 156 agctggcaaatctggtaatataaaag SEQ ID NO: 157 gcttgaacctggaaggtggagg SEQ ID NO: 158 gcaggcatgctaagaccttcagc SEQ ID NO: 159 cagctccatgaataactccacagg SEQ ID NO: 160 gcttgaacccaggaggcagagg SEQ ID NO: 161 atcgaagatgccactgcaagagg SEQ ID NO: 162 ccaaccacacttcaggggatacc SEQ ID NO: 163 cacgccagtccactgatactcac SEQ ID NO: 164 gggtttcaccatgttggccagg SEQ ID NO: 165 cccaacaaaggctctggcctgg SEQ ID NO: 166 atgacagcagaggagcttcatcc SEQ ID NO: 167 gcaggctacgagtaaaaggatgg SEQ ID NO: 168 cgggtaaaatcttgcctccttcc SEQ ID NO: 169 aaacttaaaccaatggtggatgtgg SEQ ID NO: 170 agagactgaggaactgttccagc SEQ ID NO: 171 gaaacggtcttggatcactgatcc SEQ ID NO: 172 tgcgcatgatatcttgtttcaggg SEQ ID NO: 173 ggcctccgtttaaactgttgtgc SEQ ID NO: 174 gaatgctggcccgacacagtgg SEQ ID NO: 175 tcttggtatagaaaagccagctgg SEQ ID NO: 176 gcaaaagcccaagagcccctgg SEQ ID NO: 177 ttctcccaaaatgagccccaagg SEQ ID NO: 178 gtggtgacgtaaacaaaaggtacc SEQ ID NO: 179 gcaaattccatgtgaatcttattggc SEQ ID NO: 180 cctgatctatggaacagtggtgg SEQ ID NO: 181 gttacaaacgttgcagtttgcaacg SEQ ID NO: 182 gaaccccgtcaacagtgatcacc SEQ ID NO: 183 acaggacctcaaggcaaggagc SEQ ID NO: 184 catacctaaaatagaaatgtctatccc SEQ ID NO: 185 gagttgcatatatgttttataaatccc SEQ ID NO: 186 tgagcccacatccataaagttagc SEQ ID NO: 187 accgcaacctttgccgcctgg SEQ ID NO: 188 taaatattttgtatggagtcaccacc SEQ ID NO: 189 aaagccaggagaaaaagttatgagg SEQ ID NO: 190 tcccaaagtcccaggattacagg SEQ ID NO: 191 tcactatggagcatctccgatgg SEQ ID NO: 192 agttccctggaagtctccgagg SEQ ID NO: 193 aaaataatcacccagcccacatcc SEQ ID NO: 194 acaaaactacagacacagaaagtgg SEQ ID NO: 195 tttgggaggctgaggtaggtgg SEQ ID NO: 196 aaagacagtgaaacatctataaggg SEQ ID NO: 197 cattttgggagaccagggcagg SEQ ID NO: 198 gcatgggacagacacaaagcagc SEQ ID NO: 199 gaataacaaagagagccggctgg SEQ ID NO: 200 taaaccttttattgaaaattgtcaaatgg SEQ ID NO: 201 cgcctcagcctcccaaagtgc SEQ ID NO: 202 tacattagttttataggtccagtagg SEQ ID NO: 203 gaaggtttattcatattaaaatgtgcc SEQ ID NO: 204 ctggcttctgtggtttgagttgg SEQ ID NO: 205 acagacctacctcctaaggatgg SEQ ID NO: 206 gctagcttttgtgtgtaagaatggg SEQ ID NO: 207 ggcctactcacacaatagaatacc SEQ ID NO: 208 gcaccattgcactccagcctgg SEQ ID NO: 209 gaaattaggataaaggttgtcacagc SEQ ID NO: 210 cagaagtgttcaaggtgaaactgtc SEQ ID NO: 211 ctgaatcatgaaatgttctactctgc SEQ ID NO: 212 tgtcaacttgactgggccatacg SEQ ID NO: 213 ctcccgtatagttgggattatagg SEQ ID NO: 214 gcttggagttccttgaaattcttgg SEQ ID NO: 215 cctggtggctccagttttctacc SEQ ID NO: 216 aactcctgacctcatgatccacc SEQ ID NO: 217 gctgggattacaggcatgagcc SEQ ID NO: 218 ttctcctttatccttggtgacattc SEQ ID NO: 219 tcccaaagtgctgggattacagg SEQ ID NO: 220 gtcataagtcagggaccatctgc SEQ ID NO: 221 ctgtttcattgatttccagactggc SEQ ID NO: 222 gcaatctcggctcactgcaagc SEQ ID NO: 223 gaagaagtgactatatcagatctgg SEQ ID NO: 224 ttcaccatgttggccaggctgg SEQ ID NO: 225 catcactgaagatgacaactgagc SEQ ID NO: 226 gtccagcctgggcgatagagc SEQ ID NO: 227 gaggaaagtctttgaagaggaacc SEQ ID NO: 228 ggtacactcaccagcagttttgc SEQ ID NO: 229 gagcaactggtgtgaatacatatgg SEQ ID NO: 230 caatacctggcaccacatacacc SEQ ID NO: 231 gggactacaggcatgtgccacc SEQ ID NO: 232 cggtggctcacgcgtgtaatcc SEQ ID NO: 233 caactgttaaatctctcatggaaacc SEQ ID NO: 234 gacaaaggattagaaatgcaccc SEQ ID NO: 235 ggaaatgttctaaaactggattgtgg SEQ ID NO: 236 aataataatagccaggtgtggtagc SEQ ID NO: 237 ctggaacactcacacattgctgg SEQ ID NO: 238 ctgggtgacagagcgagactcc SEQ ID NO: 239 cccaaatcatccccgtgaaacatgc SEQ ID NO: 240 gaccctgcaatcccaacactgg SEQ ID NO: 241 ctctcaggccttcaaactacacc SEQ ID NO: 242 caggaaagggctcgctcagtgg SEQ ID NO: 243 atctgcaaaagcagcagagcagg SEQ ID NO: 244 gtacccatgacagacaagttttagg SEQ ID NO: 245 cttatcccctactgtctcctttgg SEQ ID NO: 246 ggatggtctcgatctcctgacc SEQ ID NO: 247 aggttagagaccttcctctaatgc SEQ ID NO: 248 agctgggattacaggtgcctgc SEQ ID NO: 249 gctgaggcaggttggggctgc SEQ ID NO: 250 acatttaacgtctcctaacttctcc SEQ ID NO: 251 gtgctgcgattacaggtgtgagc SEQ ID NO: 252 tatgacagcagtattatactatcacc SEQ ID NO: 253 ctggggaccaaatctgaactgcc SEQ ID NO: 254 gtagctattgttatttccaaaagagg SEQ ID NO: 255 gcttgggaccccaggacaagg SEQ ID NO: 256 cctggccaacatggggaaatcc SEQ ID NO: 257 aattgcttgaacctgggaggtgg SEQ ID NO: 258 gcctaagacccaaaagctattagc SEQ ID NO: 259 catattaaagggccatattcaaattgg SEQ ID NO: 260 ggatgtaaccagtgtatatcacagg SEQ ID NO: 261 ggaagtttagtccacatcttctagc SEQ ID NO: 262 gcacccacaggacaaccacacg SEQ ID NO: 263 gggacgcgcctgttaacaaagg SEQ ID NO: 264 gggctgggggccacgctcc SEQ ID NO: 265 cgcaaaagtgaagccctcctgg SEQ ID NO: 266 gaaatcctacttgatctaaagtgagc SEQ ID NO: 267 tttgagcaacttggaaaaaataagcg SEQ ID NO: 268 ttcccaaaagacaaatagcacttcc SEQ ID NO: 269 ccattttgaaaatcacagtgaattcc SEQ ID NO: 270 gaaaagaaaaccctgaattcaaaagg SEQ ID NO: 271 tgctgaaaagaagcatttaaaagtgg SEQ ID NO: 272 ctcttaccagtttcagagctttcc SEQ ID NO: 273 ttttcagccaaaaatcaaggacagg SEQ ID NO: 274 cttgagcccaggagtttgagacc SEQ ID NO: 275 cgcctgtagtaccctctactagg SEQ ID NO: 276 ggtaaagaaagaaggatttgaaaacc SEQ ID NO: 277 taagagtaatgaggttaaagtttatgc SEQ ID NO: 278 catttttattgtcacaggccatttgc SEQ ID NO: 279 gccacgccttctcttctgccacc SEQ ID NO: 280 tgcctctcctgactgcactgtg SEQ ID NO: 281 ccatgctctaccacgcccttgg SEQ ID NO: 282 cattcaggctggagtgcggtgg SEQ ID NO: 283 cttaaaaattgtctggctaagacattg SEQ ID NO: 284 ttgctcttgttgcccgggttgg SEQ ID NO: 285 gagcttagaggaaaagtattatttcc SEQ ID NO: 286 tggtgctgtgccagacgctgg SEQ ID NO: 287 cagatctttttggctattgtcttgg SEQ ID NO: 288 gaaggaaagggcctcccactgc SEQ ID NO: 289 catgaaaaagcatgctggggagg SEQ ID NO: 290 caaacataaaaaagctttaatagaagcc SEQ ID NO: 291 tcccaactatgaaaaaatagaagacg SEQ ID NO: 292 cacaaattagccgggcatggtgg SEQ ID NO: 293 cttcctttactgagtctttctaaagc SEQ ID NO: 294 tgtcctttgaaatgtaggtatgtgg SEQ ID NO: 295 ggatcttgcaatactgacatctcc SEQ ID NO: 296 atttgaaaagaactgaaggatctacc SEQ ID NO: 297 gtgagctgagatctcgtctctgc SEQ ID NO: 298 tttgtctgaaacagattctaaaagttgg SEQ ID NO: 299 gcaggtgcctgtagtcccagc SEQ ID NO: 300 gtttgagcttctaaaattcatggattc SEQ ID NO: 301 gtggtaggtcaaaccgcaattcc SEQ ID NO: 302 accaaatcagacatatcagctttgg SEQ ID NO: 303 cacagaacggatcctcaataaagg SEQ ID NO: 304 gttaactcctcccttctctttatgg SEQ ID NO: 305 gtgttcagagagcttgatttccagg SEQ ID NO: 306 cccacttgatttttcccacatgg SEQ ID NO: 307 atttatttagatgaagtgaatattttcc SEQ ID NO: 308 atttagtttgtttaactgtgagtgc SEQ ID NO: 309 gtacagaagtgcttgatgcatacc SEQ ID NO: 310 aggcagataaaaattctccattagc SEQ ID NO: 311 acaagcacgagccacagcacc SEQ ID NO: 312 cgctcttgttgcccaggctgg SEQ ID NO: 313 cccaaaacagactttctagataacc SEQ ID NO: 314 ttcaaattgctttttttctactcacc SEQ ID NO: 315 gatctgaaaaaagtgacaggttgg SEQ ID NO: 316 cactgaaatttgaaaggaacatatgg SEQ ID NO: 317 tctggtgcagtggcctctagg SEQ ID NO: 318 accataagtggttttacctgatgg SEQ ID NO: 319 cccaggcgcaggtgattctcc SEQ ID NO: 320 ggtggctcacgcctgaaatcc SEQ ID NO: 321 cacagtccacgtgccacaatcc SEQ ID NO: 322 aatcatgttaacacatccctctcc SEQ ID NO: 323 gaagagagtgttgaaaggttaagc SEQ ID NO: 324 cgagaccatactggctaagatgg SEQ ID NO: 325 attagccacacaataaatgttctgg SEQ ID NO: 326 tttgaaaagcgttgcaatatgatgc SEQ ID NO: 327 ggttgcagtgagccgagatcg SEQ ID NO: 328 ggtgggaggactgcctgagc SEQ ID NO: 329 aacagagagaaaaaacacaaattacc SEQ ID NO: 330 gatatctagaattcccaaatacttgg SEQ ID NO: 331 gtgatagaattaaaggaaaaaataaacg SEQ ID NO: 332 attgttccttttctaaatattctacc SEQ ID NO: 333 cagcactttgggaggctgagg SEQ ID NO: 334 cacagaggtttcacagtgctgg SEQ ID NO: 335 aacttctgcttctgtccataatgc SEQ ID NO: 336 gcctgtaatcccagcactttgg SEQ ID NO: 337 gccagtaaacatatgaaaaggtgc SEQ ID NO: 338 aattatgtaaataaagagtgaaaagg SEQ ID NO: 339 cccctacacagaaaaaacaattcc SEQ ID NO: 340 tgagtgtcaaagaaaaatacaattgg SEQ ID NO: 341 atacacagagaaaatgagtccacc SEQ ID NO: 342 aacactccccttctctgtttagc SEQ ID NO: 343 gatattctttgcaacctaggatgc SEQ ID NO: 344 ctctaaaactaatcagcaatgtaacc SEQ ID NO: 345 cacctgtaatcccagcactttgg SEQ ID NO: 346 cgtaaaactgccacaaagcttgtagg SEQ ID NO: 347 gtggcagaggtgcaagcaagc SEQ ID NO: 348 acagaaatgacaaacgcatgtacc SEQ ID NO: 349 acactctcttagctaggctttgg SEQ ID NO: 350 gagcttggaatagggcagttcc SEQ ID NO: 351 ctgggttctttaaacatgtccagg SEQ ID NO: 352 tcaagaaaggacactgcagtggc SEQ ID NO: 353 catgcacacaaactatctcattcc SEQ ID NO: 354 tagccgggcatggtggcacg SEQ ID NO: 355 atcatgctgattgaatttcaaatagc SEQ ID NO: 356 ttggcatgcagggcagtgacc SEQ ID NO: 357 ggtggtgagataataacacctgc SEQ ID NO: 358 ttgctatataataatcatttgtgatcc SEQ ID NO: 359 cggtaactgttactctgggatgg SEQ ID NO: 360 aggctaggttcccttctcttcc SEQ ID NO: 361 gtagtgcctagcacagagaaagc SEQ ID NO: 362 ctagcctgggcaacaagagcg SEQ ID NO: 363 tctctctcctctctgggatcag SEQ ID NO: 364 gtttgaatatttgtatgcagcaagc SEQ ID NO: 365 tagaacaaattctggcttataaaagc SEQ ID NO: 366 ccactctacctttattccttgcc SEQ ID NO: 367 agaccagaatatgcaagcagagg SEQ ID NO: 368 ggacgttttgctggtgtctgcg SEQ ID NO: 369 aaggaacaaactgttgtcacatgc SEQ ID NO: 370 atgtagctgggactacaggtgc SEQ ID NO: 371 ggctcatgcctgtaatcccagc SEQ ID NO: 372 atgaggttttcacacaaaaagatgc SEQ ID NO: 373 tgggcgacagagcaagactcc SEQ ID NO: 374 aaatgtccctaaaagtgatcaacagc SEQ ID NO: 375 cagactcagttttacctcatcagc SEQ ID NO: 376 agtgatctttcctctttaacctcc SEQ ID NO: 377 ccagctattcaggaggccaagg SEQ ID NO: 378 cttaaacattatgacactgtcttgc SEQ ID NO: 379 ccaggtctatgaggccgttcc SEQ ID NO: 380 tccaaagcatccctacattatacc SEQ ID NO: 381 acatacatacatgcagtgactagc SEQ ID NO: 382 tacaggtgccagccaccatgc SEQ ID NO: 383 gcctgtaatcccagcactctgg SEQ ID NO: 384 gacagagtcccactcttgttgc SEQ ID NO: 385 gtgccttccaaagcagtgtagg SEQ ID NO: 386 tatcttactgggtatgtataatgcc SEQ ID NO: 387 caaaggaaatacgtcctaccagg SEQ ID NO: 388 ccttttctcacagacatgcttcc SEQ ID NO: 389 taaacacagtgagcagaatccc SEQ ID NO: 390 ataaagcaaacttctaaaagggtcc SEQ ID NO: 391 accactacactccagcctggg SEQ ID NO: 392 gatacctgggtcagagtaagtgc SEQ ID NO: 393 tgtaatctcagctacttgggagg SEQ ID NO: 394 gtgtcgtcttctcttcctctacg SEQ ID NO: 395 ctggctagtatgaggttggtgc SEQ ID NO: 396 ggactagccacatttcaaccagg SEQ ID NO: 397 gcagtatactgagaatttagtttcc SEQ ID NO: 398 gaggctgaggcaggagaatgg SEQ ID NO: 399 cattgtttgatgaaggtcaacagc SEQ ID NO: 400 cagacaagagtggctacggcag SEQ ID NO: 401 acgcccagccagattattcagg SEQ ID NO: 402 ggaaccagaaagaagtgcaaagg SEQ ID NO: 403 tgagccatcttggaggcaggc SEQ ID NO: 404 caggaccttcctacaaacctcc SEQ ID NO: 405 aacacaacatatctgaccttacgc SEQ ID NO: 406 gccttagaagtccagaggaaagc SEQ ID NO: 407 tgacgtacccagtagaccttcc SEQ ID NO: 408 ctctgcaagcctgggaaacagg SEQ ID NO: 409 gccttgtccccaagtcctaagg SEQ ID NO: 410 gcaaagggactcctggaattcc SEQ ID NO: 411 gctcctgcctgtaatcccagc SEQ ID NO: 412 gaaggaaacagaaaaagcagaggc SEQ ID NO: 413 cttactaccgttcttcttcactgg SEQ ID NO: 414 actattctgtttctttaggtttactgc SEQ ID NO: 415 cggtggctcacacctgtaatcc SEQ ID NO: 416 agccagagttctgtgctctagg SEQ ID NO: 417 taatttgcatttcgtgccgctcc SEQ ID NO: 418 cacttttaatacagatcccaatagg SEQ ID NO: 419 atgtattttttcttttcctgtcaagc SEQ ID NO: 420 aaatgttaacattattctccctaagg SEQ ID NO: 421 catatgcccagatcccgtctcc SEQ ID NO: 422 acaggtgtgagccgctgcacc SEQ ID NO: 423 gccaagacgtttacagttttggc SEQ ID NO: 424 aggaaacttctgaggatgatggg SEQ ID NO: 425 gctttatagggcagtctgaattcc SEQ ID NO: 426 ttagaataaaagttatctcgggagg SEQ ID NO: 427 taatttcttcagctttatccctcag SEQ ID NO: 428 cacatgactaattctctattcattcc SEQ ID NO: 429 aaagacctcaagaaaagagtcacc SEQ ID NO: 430 gacccataaagattatatgcccag SEQ ID NO: 431 aaagtactaatgcagtgtgtcagc SEQ ID NO: 432 gaggttcctcgattcccctgc SEQ ID NO: 433 ggagagcagaggaattcacagg SEQ ID NO: 434 agtaattagaaactgattctaagacg SEQ ID NO: 435 cataccattgccaatccagttcc SEQ ID NO: 436 attacgggtgcctgccactgc SEQ ID NO: 437 cagccaggcagaggagagagg SEQ ID NO: 438 ttttcattccaagtttctgtttggg SEQ ID NO: 439 tttcaaataggaatttggataatccc SEQ ID NO: 440 taagccgagatcacaccactgc SEQ ID NO: 441 ccttcagcgcattatatcttggc SEQ ID NO: 442 ccatctaatccatcttaaattcacc SEQ ID NO: 443 gagtggagactgcgccactgc SEQ ID NO: 444 aatcatgtgccaattaaaccatggc SEQ ID NO: 445 cccagggaccagaccagacc SEQ ID NO: 446 ctcactcaccagtgaaaatcagc SEQ ID NO: 447 ggttgctctcgaactcctgacc SEQ ID NO: 448 gttcccccagctcctttctgc SEQ ID NO: 449 agaaagatgtagaagggtccagc SEQ ID NO: 450 gggaaaaggtgtattatgcaagcg SEQ ID NO: 451 ctctctcagacctaatgcaaaagc SEQ ID NO: 452 aactatacatacagtatttgtattagc SEQ ID NO: 453 aaattaatgcaatccatgatccagg SEQ ID NO: 454 ctttctccactctaagagaaccc SEQ ID NO: 455 ttttggtgtgttcatattggctgc SEQ ID NO: 456 gcttccacaaatgacagacaaagg SEQ ID NO: 457 ggctcatgcttgtaatcccagc SEQ ID NO: 458 catatgaattgttgttcctttgtagg SEQ ID NO: 459 cactggtacaagtccaagagtcc SEQ ID NO: 460 gaccctgtgtctacttcctggg SEQ ID NO: 461 tatttgaactatctcttgaaatgtcc SEQ ID NO: 462 ctgattaaaaagtattacccttggc SEQ ID NO: 463 tttgaaactgcactcaataacttgg SEQ ID NO: 464 agtaatgtgtcatgatccaatggc SEQ ID NO: 465 gaaagcatttcccaatgtctcacc SEQ ID NO: 466 caatggacaaaaggcccaactgc SEQ ID NO: 467 tccagctctggcttttttgttaag SEQ ID NO: 468 acggagtctcactccgtgacc SEQ ID NO: 469 ctatgtcatagtcaagagactttgc SEQ ID NO: 470 gttcaagcgattctcctgtctcg SEQ ID NO: 471 ccacctaatacttaaatacggaagc SEQ ID NO: 472 atattcaacaaacttaatagtgaagtg SEQ ID NO: 473 ttacaggcgtgagtcaccatgc SEQ ID NO: 474 aacacctccaagaggccaaacg SEQ ID NO: 475 tactattggcaaatttcaattatatgg SEQ ID NO: 476 agcccacatcctaaaattcaataag SEQ ID NO: 477 gaaagtggataagtgtttgtctgg SEQ ID NO: 478 ggccaggcattcaagaccagc SEQ ID NO: 479 agccaacaacaaaaagacacaacc SEQ ID NO: 480 ttgagcccaggagttcaagacc SEQ ID NO: 481 cagactaaagatctcagagagaaac SEQ ID NO: 482 cgcttgtaatcccagcacttgg SEQ ID NO: 483 aaaagtgaaatcagaatttgtttcc SEQ ID NO: 484 caggcgtgagcaactgtgtcc SEQ ID NO: 485 ggtccagtaggatctcgtttgc SEQ ID NO: 486 actttgaaaatgttgttatagctggg SEQ ID NO: 487 ttccctgcatctaagtcttctcc SEQ ID NO: 488 agatatctaccattgaagagtttgc SEQ ID NO: 489 agtcttcacttcactttgttgtcc SEQ ID NO: 490 ccatgcaggtatgaaatataaaagc SEQ ID NO: 491 tgggtgacagagtgagactcc SEQ ID NO: 492 acagcaataccgggttaacatgc SEQ ID NO: 493 tttatgtaaaagatgaatgcgaggc SEQ ID NO: 494 ctactctgctactgggaacagg SEQ ID NO: 495 caaacgttagtctggcaaaatgcg SEQ ID NO: 496 tgcacgctaccacacccagc SEQ ID NO: 497 aattcttggatctgtgtgtttactgc SEQ ID NO: 498 taccagttatcattctctttctgc SEQ ID NO: 499 atccacccacctcggcctcc SEQ ID NO: 500 cactctgcctggcccttaatgg SEQ ID NO: 501 atagtttgtttaatatgccactaagg SEQ ID NO: 502 gcgtgagccaccgcacctgg SEQ ID NO: 503 ctccatcacacaaattttatgtggc SEQ ID NO: 504 agacggagtctcgttctgtcgc SEQ ID NO: 505 tcccaggttcaagccattctcc SEQ ID NO: 506 tattttgagagtctcactctgtcg SEQ ID NO: 507 gtctcgaactcctgacctcagg SEQ ID NO: 508 aaggaggtgaagagtgaactacg SEQ ID NO: 509 gtctcaggttttggacttacttgg SEQ ID NO: 510 tttacagatcttaaatgcattaggac SEQ ID NO: 511 gtacactgaacaaaggagacagg SEQ ID NO: 512 ctggtagtaatgcaaaatagcacc SEQ ID NO: 513 catttaatgtgaaatgaattataagcc SEQ ID NO: 514 gagacagggtttcactatgttgg SEQ ID NO: 515 ccagcactttggaaggctgagg SEQ ID NO: 516 gaaaccaagtatcatggtaaattgc SEQ ID NO: 517 cagtgagggctgctcagttcc SEQ ID NO: 518 gccaggtgcggtggctcacg SEQ ID NO: 519 catgcctgtaatcccagctacc SEQ ID NO: 520 atgtaaatggtacagtcactttagg SEQ ID NO: 521 cccacaatacagagaactcttacc SEQ ID NO: 522 tgaaacatgcagcccagtgtcc SEQ ID NO: 523 tgttttttctcctgccttcaatcc SEQ ID NO: 524 gctttcctgggtctccatctgg SEQ ID NO: 525 gcagccgcttgaaaacaaaacagc SEQ ID NO: 526 gatcacgttacatttgggggtgg SEQ ID NO: 527 taggctgaaaaactaaaatttgttgc SEQ ID NO: 528 ctcctttgggctcctttagtcc SEQ ID NO: 529 gcctcggcctcccaaagtgc SEQ ID NO: 530 aatgcctagagagatttggcagg SEQ ID NO: 531 gagatggggtttcactatgttgg SEQ ID NO: 532 tgtgatcttgccactgcactcc SEQ ID NO: 533 acttctcctccatttgtttcttcg SEQ ID NO: 534 cgtgcccgggctcagttctac SEQ ID NO: 535 ccaaaacaataaaatcacaatttggg SEQ ID NO: 536 ctgaactgccttagagtaaatccg SEQ ID NO: 537 atttctgtatcaggtctgtgttcc SEQ ID NO: 538 ggctgaccccttcactgtttcc SEQ ID NO: 539 caaaaattagccaggcatggtgg SEQ ID NO: 540 gcagtgagcagtgatcgcacc SEQ ID NO: 541 aaagactgtgaactaacttgtttgc SEQ ID NO: 542 tgccaagaattacacattattaggc SEQ ID NO: 543 ggccaggatgtcattaactttcc SEQ ID NO: 544 gtaagagctgacgtgtattgtgc SEQ ID NO: 545 cccggtgaggccgcacatcc SEQ ID NO: 546 cctgcgccttaaccccctcc SEQ ID NO: 547 cggcgcctaggggccatcg SEQ ID NO: 548 acttaaggaaacgaacatgacacc SEQ ID NO: 549 gagaccgagtcttgctgtgtcg SEQ ID NO: 550 gtattaattgaagatgatttggaatgc SEQ ID NO: 551 tctttaaaagactatcgctgaggc SEQ ID NO: 552 aaaagagacatcagtagagcatcc SEQ ID NO: 553 gttcatgttttctttgacgtctcc SEQ ID NO: 554 tttcgaaagttcaggctgagtgc SEQ ID NO: 555 gaccctcaaaacaatcctctaagg SEQ ID NO: 556 caaaacacacttagaaacaaactgc SEQ ID NO: 557 gcctgggcgacatagtgagacc SEQ ID NO: 558 ggcaggagaatggcgtgaacc SEQ ID NO: 559 tttgctcgttgcccaggctgg SEQ ID NO: 560 gcaacttaatgtgatagaataatagc SEQ ID NO: 561 cctccccttctgctgccagc SEQ ID NO: 562 ccacaacaatgtaaactcctctgg SEQ ID NO: 563 tactctccctagagttcgttccc SEQ ID NO: 564 gggtccccctttggccattcc SEQ ID NO: 565 gatcttggctcacttcaacctcc SEQ ID NO: 566 aggggaaatatttaaaccttgg SEQ ID NO: 567 aatgcaatggtgcatttacagagg SEQ ID NO: 568 tcattttatctatttctacatggtcc SEQ ID NO: 569 ggaagggaaatgcccatgaacc SEQ ID NO: 570 agtgaacattttctgcagcctcc SEQ ID NO: 571 caacaggacgtcaggcgatcc SEQ ID NO: 572 ccttcaggctgtcctgaaaagg SEQ ID NO: 573 agtctcactccatcgcccagg SEQ ID NO: 574 actgtgaacagtagttaactcagg SEQ ID NO: 575 gcatgcctgtaatccaagctgc SEQ ID NO: 576 gaaacaattctcttttcacacttgc SEQ ID NO: 577 ggctcatgcctgttatcccagc SEQ ID NO: 578 agaagaagcttagtcatatgtttgg SEQ ID NO: 579 cagatgcttgagccaaacaaatgg SEQ ID NO: 580 ctggcagacagagtgagactcc SEQ ID NO: 581 aatgtgtgaatattattcattacaggg SEQ ID NO: 582 gcaggagaattgcttgaacctgg SEQ ID NO: 583 ctttagtcaaattaaaacagtctatcc SEQ ID NO: 584 gatttctatctcctgcaaccacc SEQ ID NO: 585 ttcttgtgtaactactaaaaatctcc SEQ ID NO: 586 aaagggtcttcataaggctaatgg SEQ ID NO: 587 ctcttaaggattatttatatgaagacc SEQ ID NO: 588 caggaggagccccagagc SEQ ID NO: 589 tcctggggatggttggatgc SEQ ID NO: 590 tgaccccacagagtttacacagc SEQ ID NO: 591 agtcagggcaggctctgcc SEQ ID NO: 592 tattttggccccatccagaaagc SEQ ID NO: 593 cacccagagtacagctttgttcc SEQ ID NO: 594 gaggagccccagagcctgc SEQ ID NO: 595 tggggatggttggatgcttacc SEQ ID NO: 596 cccacagagtttacacagcttgc SEQ ID NO: 597 caggctctgcccactcacc SEQ ID NO: 598 ccatccagaaagcccaaagcc SEQ ID NO: 599 ccagagtacagctttgttcctcattc SEQ ID NO: 600 gcagtacaaacaacgcacagcg SEQ ID NO: 601 ctgccaccctccacagtccc SEQ ID NO: 602 gccaagaccatgcatgcg SEQ ID NO: 603 cccagggacaaagagactccc SEQ ID NO: 604 caggaagcagacagtcttctagttcc SEQ ID NO: 605 tgcctgtaatcccaacactttgg SEQ ID NO: 606 tccctctggccaggatggg SEQ ID NO: 607 atggggaatgggagtaggaagc SEQ ID NO: 608 cagatcagttctcccctccagc SEQ ID NO: 609 acaaaaaagaaacatgctcagagagg SEQ ID NO: 610 tggtggcatgcatctgtagtcc SEQ ID NO: 611 aggtgctctatagatgttagcatccc SEQ ID NO: 612 ccaggacaggatggagatctgg SEQ ID NO: 613 agggaacctgtgcattatccttgc SEQ ID NO: 614 cagaagtcttgctttaaggaggagg SEQ ID NO: 615 gggtacgtgaaactcaccaagg SEQ ID NO: 616 cagagtgtggcaagcaaggg SEQ ID NO: 617 aacattttaaaggtacaaataacgtggg SEQ ID NO: 618 tagggagcaacagccattaagc SEQ ID NO: 619 ggtgcactgtccagctctgg SEQ ID NO: 620 actctcgctgaactcgcctgg SEQ ID NO: 621 ctcggtctctggtggtacgc SEQ ID NO: 622 gcaagaggtccgagctggg SEQ ID NO: 623 ggaagaagtgaaacaagagatgaagg SEQ ID NO: 624 cccagagaacaaaccggattagg SEQ ID NO: 625 cccttcaaccttctccaatctgc SEQ ID NO: 626 cccatgtccagtggtttaggg SEQ ID NO: 627 gagattggtgggagacagatgg SEQ ID NO: 628 cttctcagctcaaagttccagcg SEQ ID NO: 629 gaatgggagagatgaccagagg SEQ ID NO: 630 aagggcaagggggtatgtgg SEQ ID NO: 631 ggaaggaagcatgggaacacc SEQ ID NO: 632 ccatcaatgctctgtctgtctgg SEQ ID NO: 633 gtgccgtgactgtgcttgg SEQ ID NO: 634 acatcccattgacctcatcaagc
Claims (49)
1. A method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag,
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i); and
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. A method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:
(a) one or more forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
(d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
(d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii); and
(v) analysing said amplified DNA.
29. The method according to claim 1 , wherein at least one set of said forward and reverse primers are linked to an oligonucleotide tag.
30. The method according to claim 1 , wherein one primer is used in step (i)(a) and two or more primers are used in step (i)(b).
31. The method according to claim 1 , wherein one primer is used in step (i)(b) and two or more primers are used in step (i)(a).
32. The method according to claim 1 , wherein step (iii) is performed and one primer is used in step (iii)(a) and two or more primers are used in step (πi)(b).
33. The method according to claim 1 , wherein step (iii) is performed and one primer is used in step (iii)(b) and two or more primers are used in step (iii)(a).
34. The method according to claim 1 , wherein said gene breakpoint is a gene translocation breakpoint or a homologous recombination point.
35. The method according to claim 34 , wherein said gene translocation breakpoint is a chromosomal gene translocation breakpoint.
36. The method according to claim 35 , wherein said gene translocation breakpoint is selected from the group consisting of:
(i) BCR-ABL translocation,
(ii) PML-RARα translocation,
(iii) t(2;5)(p23;q35) translocation,
(iv) t(8; 14) translocation,
(v) t(9;22)(q34;q11) translocation,
(vi) t(11; 14) translocation,
(vii) t(11;22)(q24;q11.2-12) translocation,
(viii) t(14;18)(q32;q21) translocation,
(ix) t(17;22) translocation,
(x) t(15; 17) translocation,
(xi) t(1; 12)(q21;p 13) translocation,
(xii) t(9; 12)(p24;p 13) translocation,
(xiii) t(X;18)(p1 1.2;q1 1.2) translocation,
(xiv) t(1;1 I)(q42.1;q14.3) translocation, and
(xv) t(1; 19) translocation.
37. The method according to claim 1 , wherein 1-30 primers are used in step (i)(a) and 24-400 primers are used in step (i)(b).
38. The method according to claim 37 , wherein step (iii) is performed and 1-30 primers are used in step (iii)(a) and 24-400 primers are used in step (iii)(b).
39. The method according to claim 1 , wherein only steps (i), (ii) and (v) are performed.
40. The method according to claim 39 , wherein steps (iii) and (iv) are additionally performed.
41. The method according to claim 39 , wherein said amplified DNA of step (ii) is subjected to a further step of amplification, selection or enrichment.
42. The method according to claim 41 , wherein said amplification is bottleneck PCR.
43. The method according to claim 40 , wherein said amplified DNA of step (iv) is subjected to a further step of amplification, selection or enrichment.
44. The method according to claim 43 , wherein said amplification is bottleneck PCR.
45. The method according to claim 1 , wherein said gene breakpoint is a chromosomal BCR-ABL translocation and:
(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:10-15; and
(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:23-304 and are linked to the oligonucleotide tag defined by SEQ ID NO:22
and wherein if step (iii) is performed then:
(a) the forward primers of step (iii)(a) correspond to SEQ ID NOs: 16-21; and
(b) the reverse primers of step (iii)(b) corresponds to SEQ ID NOs:306-587 and are linked to the oligonucleotide tag defined by SEQ ID NO:305.
46. The method according to claim 1 , wherein said gene breakpoint is a chromosomal PML-RARalpha translocation and:
(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:588-593; and
(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:601-634 and are linked to the oligonucleotide tag defined by SEQ ID NO: 22
and wherein step (ii) is followed by bottleneck PCR which is performed using primers corresponding to SEQ ID NOs: 594-599.
47. A method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method of claim 1 .
48. The method according to claim 47 , wherein said condition is:
anaplastic large cell lymphoma,
Burkitt's lymphoma,
CML, ALL,
Mantle cell lymphoma,
Ewing's sarcoma,
follicular lymphoma,
dermatofibrosarcoma protuberans,
acute promyelocy e leukemia,
acute myelogenous leukemia,
Synovial sarcoma,
Schizophrenia; or
acute pre-B cell leukemia.
49. A DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method of claim 1 .
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/599,953 US20100216138A1 (en) | 2007-06-01 | 2008-05-30 | Method for dna breakpoint analysis |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US94141907P | 2007-06-01 | 2007-06-01 | |
US12/599,953 US20100216138A1 (en) | 2007-06-01 | 2008-05-30 | Method for dna breakpoint analysis |
PCT/AU2008/000779 WO2008144841A1 (en) | 2007-06-01 | 2008-05-30 | A method for dna breakpoint analysis |
Publications (1)
Publication Number | Publication Date |
---|---|
US20100216138A1 true US20100216138A1 (en) | 2010-08-26 |
Family
ID=40074473
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/599,953 Abandoned US20100216138A1 (en) | 2007-06-01 | 2008-05-30 | Method for dna breakpoint analysis |
US12/130,049 Expired - Fee Related US9145587B2 (en) | 2007-06-01 | 2008-05-30 | Method for DNA breakpoint analysis |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/130,049 Expired - Fee Related US9145587B2 (en) | 2007-06-01 | 2008-05-30 | Method for DNA breakpoint analysis |
Country Status (6)
Country | Link |
---|---|
US (2) | US20100216138A1 (en) |
EP (1) | EP2150628B1 (en) |
JP (2) | JP5730568B2 (en) |
CN (1) | CN101835900B (en) |
AU (1) | AU2008255569A1 (en) |
WO (1) | WO2008144841A1 (en) |
Families Citing this family (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101483576B1 (en) * | 2011-10-31 | 2015-01-21 | 아크레이 가부시키가이샤 | Method for measuring abundance of genes |
US9121051B2 (en) | 2011-10-31 | 2015-09-01 | Arkray, Inc. | Method of determining the abundance of a target nucleotide sequence of a gene of interest |
WO2014055920A1 (en) * | 2012-10-05 | 2014-04-10 | The Regents Of The University Of California | Targeted detection of recurrent genomic rearrangements |
US10131954B2 (en) * | 2014-03-31 | 2018-11-20 | University Of Cincinnati | Methods for detection and quantification of EGFRvIII in the peripheral blood of GBM patients |
EP3271849B1 (en) * | 2015-03-17 | 2021-09-08 | Bio-Rad Laboratories, Inc. | Detection of genome editing |
EP3359695B1 (en) * | 2015-10-10 | 2020-04-15 | Guardant Health, Inc. | Methods and applications of gene fusion detection in cell-free dna analysis |
GB201709675D0 (en) | 2017-06-16 | 2017-08-02 | Inivata Ltd | Method for detecting genomic rearrangements |
CN107385065B (en) * | 2017-08-16 | 2020-07-28 | 北京东方亚美基因科技研究院有限公司 | Method for amplifying nucleic acid and use thereof |
CA3107376A1 (en) | 2018-08-08 | 2020-02-13 | Inivata Ltd. | Method of sequencing using variable replicate multiplex pcr |
EP4219763A3 (en) * | 2018-12-12 | 2023-08-16 | Inivata Ltd. | Method for quantifying gene fusion dna |
EP4127225A1 (en) * | 2020-04-03 | 2023-02-08 | F. Hoffmann-La Roche AG | A method of detecting structural rearrangements in a genome |
EP4291679A1 (en) * | 2021-02-12 | 2023-12-20 | Guardant Health, Inc. | Methods and compositions for detecting nucleic acid variants |
CN114807302B (en) * | 2021-10-14 | 2024-07-02 | 深圳联合医学科技有限公司 | Amplicon library construction method and kit for thalassemia mutant and deletion type gene detection |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6355422B1 (en) * | 1998-06-24 | 2002-03-12 | City Of Hope | Single tube PCR assay for detection of chromosomal mutations: application to the inversion hotspot in the factor VIII gene including optional use of subcycling PCR |
Family Cites Families (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP4468488B2 (en) * | 1996-05-29 | 2010-05-26 | コーネル・リサーチ・ファンデーション・インコーポレイテッド | Detection of nucleic acid sequence differences using combined ligase detection and polymerase chain reaction |
AU2002366179A1 (en) * | 2001-11-20 | 2003-06-10 | The Regents Of The University Of California | Early leukemia diagnostics using microsphere arrays |
EP2418287B1 (en) | 2002-10-11 | 2013-09-18 | Erasmus Universiteit Rotterdam | Nucleic acid amplification primers for PCR-based clonality studies of the TCR-beta gene |
US20070059700A1 (en) * | 2003-05-09 | 2007-03-15 | Shengce Tao | Methods and compositions for optimizing multiplex pcr primers |
US7851148B2 (en) | 2003-10-13 | 2010-12-14 | Qiagen Gmbh | Method and kit for primer based multiplex amplification of nucleic acids employing primer binding tags |
CN1280422C (en) * | 2004-08-26 | 2006-10-18 | 北京博奥生物芯片有限责任公司 | Asymmetrical PCR amplification method, dedicated primer and use thereof |
JP2006075126A (en) | 2004-09-13 | 2006-03-23 | National Institute Of Advanced Industrial & Technology | Method for detecting monobasic mutation and probe for detection |
JP2006174806A (en) | 2004-12-24 | 2006-07-06 | Institute Of Physical & Chemical Research | Method for labeling nucleic acid amplified product |
US20100086918A1 (en) * | 2006-07-31 | 2010-04-08 | The Regents Of The University Of California | Methods for High Sensitivity Detection of Genetic Polymorphisms |
-
2008
- 2008-05-30 US US12/599,953 patent/US20100216138A1/en not_active Abandoned
- 2008-05-30 US US12/130,049 patent/US9145587B2/en not_active Expired - Fee Related
- 2008-05-30 AU AU2008255569A patent/AU2008255569A1/en not_active Abandoned
- 2008-05-30 WO PCT/AU2008/000779 patent/WO2008144841A1/en active Application Filing
- 2008-05-30 JP JP2010509632A patent/JP5730568B2/en not_active Expired - Fee Related
- 2008-05-30 CN CN200880018488.3A patent/CN101835900B/en not_active Expired - Fee Related
- 2008-05-30 EP EP08756871.3A patent/EP2150628B1/en not_active Not-in-force
-
2014
- 2014-10-09 JP JP2014208155A patent/JP2015012873A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6355422B1 (en) * | 1998-06-24 | 2002-03-12 | City Of Hope | Single tube PCR assay for detection of chromosomal mutations: application to the inversion hotspot in the factor VIII gene including optional use of subcycling PCR |
Also Published As
Publication number | Publication date |
---|---|
JP2015012873A (en) | 2015-01-22 |
US20090202999A1 (en) | 2009-08-13 |
CN101835900A (en) | 2010-09-15 |
AU2008255569A1 (en) | 2008-12-04 |
EP2150628B1 (en) | 2013-12-11 |
CN101835900B (en) | 2015-04-15 |
JP2010528592A (en) | 2010-08-26 |
WO2008144841A1 (en) | 2008-12-04 |
EP2150628A4 (en) | 2010-09-29 |
US9145587B2 (en) | 2015-09-29 |
JP5730568B2 (en) | 2015-06-10 |
EP2150628A1 (en) | 2010-02-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9145587B2 (en) | Method for DNA breakpoint analysis | |
US20230193381A1 (en) | Compositions and methods for accurately identifying mutations | |
Edger et al. | Subgenome dominance in an interspecific hybrid, synthetic allopolyploid, and a 140-year-old naturally established neo-allopolyploid monkeyflower | |
Kozlowski et al. | New applications and developments in the use of multiplex ligation‐dependent probe amplification | |
EP1633884B1 (en) | Identification of clonal cells by repeats in (eg.) t-cell receptor v/d/j genes | |
JP6082141B2 (en) | Classification of DNA samples | |
WO2017084624A1 (en) | Method for simultaneously completing gene locus, chromosome and linkage analysis | |
López-Girona et al. | CRISPR-Cas9 enrichment and long read sequencing for fine mapping in plants | |
An et al. | Draft genome of Dugesia japonica provides insights into conserved regulatory elements of the brain restriction gene nou-darake in planarians | |
Moler et al. | Population epigenomics: advancing understanding of phenotypic plasticity, acclimation, adaptation and diseases | |
Currier et al. | Spectratype/immunoscope analysis of the expressed TCR repertoire | |
CN104152447B (en) | A kind of SNP marker and HRM methods carry out Carnis Sus domestica DNA source tracing methods | |
Shay et al. | Fine-mapping and construction of a bovine contig spanning the ovine callipyge locus | |
AU2019453690B2 (en) | Method for preparing nested multiplex PCR high-throughput sequencing library and kit | |
US20230055466A1 (en) | A method of nucleic acid sequence analysis | |
Benamozig et al. | A detection method for the capture of genomic signatures: From disease diagnosis to genome editing | |
Key | Molecular genetics, recombinant DNA, & genomic technology | |
US20220403447A1 (en) | Sample preparation and sequencing analysis for repeat expansion disorders and short read deficient targets | |
US12077814B2 (en) | Method for low frequency somatic cell mutation identification and quantification | |
Liu | Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome | |
Chang et al. | Human hair follicles as a peripheral source of tyrosine hydroxylase and aromatic L-amino acid decarboxylase mRNA | |
Shandil | Methods for analysis of sex-specific methylation in the CpG island of ALS-linked gene UBQLN2 | |
Fransen et al. | Reference standards for the development and analytical validation of a next-generation lung cancer liquid biopsy assay | |
Wilkins | Identifying and rectifying aberrant RNA metabolism in amyotrophic lateral sclerosis | |
Van Cauwenbergh et al. | Genetic testing techniques |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: MONOQUANT PTY LTD, AUSTRALIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MORLEY, ALEXANDER ALAN;REEL/FRAME:024131/0973 Effective date: 20091126 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |