US20060069051A1 - AChE antisense oligonucleotide as an anti-inflammatory agent - Google Patents

AChE antisense oligonucleotide as an anti-inflammatory agent Download PDF

Info

Publication number
US20060069051A1
US20060069051A1 US11/187,719 US18771905A US2006069051A1 US 20060069051 A1 US20060069051 A1 US 20060069051A1 US 18771905 A US18771905 A US 18771905A US 2006069051 A1 US2006069051 A1 US 2006069051A1
Authority
US
United States
Prior art keywords
ache
inhibitor
seq
expression
treatment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/187,719
Other languages
English (en)
Inventor
Hermona Soreq
Amir Dori
Itzhak Wirguin
Gal Ifergane
Raz Yirmiya
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ben Gurion University of the Negev Research and Development Authority Ltd
Mor Research Applications Ltd
Yissum Research Development Co of Hebrew University of Jerusalem
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of US20060069051A1 publication Critical patent/US20060069051A1/en
Assigned to BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DEVELOPMENT AUTHORITY, MOR RESEARCH APPLICATIONS LTD. reassignment BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DEVELOPMENT AUTHORITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DORI, AMIR, IFERGANE, GAL, WIRGUIN, ITZHAK
Assigned to YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HERBREW UNIVERSITY OF JERUSALEM reassignment YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HERBREW UNIVERSITY OF JERUSALEM ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: YIRMIYA, RAZ, SOREQ, HERMONA
Assigned to MOR RESEARCH APPLICATIONS LTD., BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DEVELOPMENT AUTHORITY reassignment MOR RESEARCH APPLICATIONS LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DORI, AMIR, IFERGANE, GAL, WIRGUIN, ITZHAK
Priority to US11/788,321 priority Critical patent/US20090005331A1/en
Assigned to YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM reassignment YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: YIRMIYA, RAZ, SOREQ, HERMONA
Priority to US13/351,171 priority patent/US20130018081A1/en
Priority to US13/899,922 priority patent/US8722876B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A61P29/02—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] without antiinflammatory effect
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

Definitions

  • the present invention relates to the field of anti-inflammatory agents. More specifically, the present invention provides a novel use for an antisense oligonucleotide targeted to the coding domain of the acetylcholinesterase (AChE) nucleotide sequence, as an anti-inflammatory agent.
  • AChE acetylcholinesterase
  • Inflammation plays a crucial role in defense against pathogen invaders as well as in healing and recovery processes following various types of injury.
  • the magnitude and duration of inflammatory responses have to be tightly regulated, because excessive inflammatory reactions can be detrimental, leading to autoimmune diseases, neurodegeneration, sepsis, trauma and other pathological conditions.
  • regulation of inflammatory reactions is mediated both by immune responses (particularly the secretion of anti-inflammatory cytokines) and by neuroendocrine factors, particularly the activation of the pituitary-adrenal axis and the secretion of glucocorticoids.
  • neural mechanisms are also involved in limiting inflammatory responses.
  • cholinergic neurons inhibit acute inflammation, providing a rapid, localized, and adaptive anti-inflammatory reflex system (Tracy, 2002).
  • ACh acetylcholine
  • IL-1 ⁇ interleukin-1 ⁇
  • IL-6 and IL-18 IL-6 and IL-18
  • IL-10 anti-inflammatory cytokine IL-10
  • IL-1 causes AChE over-production both in PC12 cells and in the rat cortex [Li, Y. et al., (2000) J. Neurosci. 20, 149-155], suggesting a closed loop whereby ACh suppresses IL-1, ablating the induction of AChE production.
  • Allostatic breakdown of this intricately controlled pathway may occur under various stressors, including glycinergic (strychnine) or cholinergic agents (succinylcholine), or under myasthenic crisis or post-anesthesia effects [Becker, C. M. et al., (1992) Neuron 8, 283-289; Millard, C. B. & Broomfield, C. A. (1995) J. Neurochem. 64, 1909-1918; Subramony, S. H. et al. (1986) Muscle Nerve 9, 64-68; Krasowski, M. D. et al. (1997) Can. J. Anaesth. 44, 525-534].
  • glycinergic trychnine
  • cholinergic agents succinylcholine
  • a parallel stress response involves down-regulation of choline acetyltransferase (ChAT) [Kaufer, D. et al., (1998) Nature 393, 373-377] and the genomically linked vesicular acetylcholine transporter (VAChT) [Weihe, E. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 3547-3552], together limiting the production and vesicle packaging of acetylcholine while expediting its degradation. This yields down-regulation of the cholinergic hyperexcitation that is associated with many stresses.
  • ChAT choline acetyltransferase
  • VAChT genomically linked vesicular acetylcholine transporter
  • this stress response is associated with hypersensitivity to both agonists and antagonists of cholinergic neurotransmission [Meshorer, E. et al. (2002) Science 295, 508-512] and abnormal locomotor activities that can be ablated under antisense destruction of AChE-R mRNA [Cohen, O. et al. (2002) Mol. Psychiatry 7, 874-885]. Finely-tuned control over AChE-R levels thus emerged as a key component of stress management by spinal cord motoneurons. AChE-R over-expression, which suppresses ACh levels, further lead to increased IL-1 production. Should this be the case, antisense suppression of AChE-R production [Brenner, T. et al. (2003) Faseb J. 17(2), 214-22] would increase ACh levels and reduce the levels of pro-inflammatory cytokines in CNS neurons.
  • Endotoxin administration induces fever, malaise and increased production and secretion of cytokines, particularly TNF- ⁇ , IL-6, IL-1 and IL-1ra and cortisol [for review see Burrell R. (1994) Circ. Shock 43:137-53], as well as proteases [Fahmi H. and Chaby R. (1994) Immunol. Invest. 23:243-58].
  • cytokines particularly TNF- ⁇ , IL-6, IL-1 and IL-1ra and cortisol
  • proteases Flahmi H. and Chaby R. (1994) Immunol. Invest. 23:243-58.
  • endotoxin-induced cytokine secretion is correlated with impairments in verbal and non-verbal declarative memory functions [Reichenberg A. et al., (2001) Arch. Gen. Psychiatry 58:445-52].
  • cholinergic processes are relevant to endotoxin responses because in the central nervous system (CNS), cholinergic responses are notably involved in several important aspects of cognitive functioning, including attention, learning and memory [for reviews see Levin E. D. and Simon B. B. (1998) Psychopharmacology ( Berl ) 138:217-30; Segal M. and Auerbach J. M. (1997) Life Sci. 60:1085-91].
  • endotoxin decreases brain choline acetyltransferase activity [Willard L. B. et al. (1999) Neuroscience 88:193-200], similar to the effects of psychological stress [Kaufer (1998) id ibid.].
  • endogenous or exogenous acetylcholine attenuates the release of pro-inflammatory cytokines from endotoxin-stimulated human macrophages [Borovikova (2000) id ibid.; Bernik (2002) id ibid.; Tracey (2001) id ibid.].
  • the ACh hydrolyzing enzyme acetylcholinesterase (AChE) was considered as potentially being of particular relevance to these processes because AChE controls ACh levels and since AChE inhibitors improve cognitive functions in both clinical and experimental paradigms [Palmer A. M. (2002) Trends Pharmacol. Sci. 23:426-33; Weinstock M.
  • AChE over-expression is triggered by acute and chronic stressful insults [Meshorer (2002) id ibid.] and induces progressive memory impairments, as was demonstrated in transgenic mice [Beeri R. et al. (1995) Curr. Biol. 5:1063-71].
  • mice that overexpress both AChE-S and AChE-R present progressive dendritic and spine loss [Beeri R. et al. (1997) J. Neurochem. 69:2441-51], as well as altered anxiety responses [Erb C. et al. (2001) J. Neurochem. 77:638-46]. Furthermore, these mice display early-onset deficits in social recognition and exaggerated responsiveness to stressful insults. These can be briefly ameliorated by conventional anticholinesterase treatment or for longer periods by an antisense oligonucleotide capable of specifically inducing the destruction of AChE-R mRNA [Cohen (2002) id ibid.], suggesting that AChE-R is the primary cause. Thus, AChE-R production may lead to both positive and negative effects on cognition.
  • AChE-R Stressful insults induce AChE-R production in the periphery as well (e.g., in the small intestines), and failure to induce this production, in response to aversive stimuli, results in hypersensitivity to relatively mild stressors [Shapira M. et al. (2000) Hum. Mol. Genet. 9:1273-1281]. This observation raised the possibility that peripheral AChE modulations may serve as a surrogate marker of endotoxin-induced changes in cognition as well. However, in plasma, proteolytic cleavage of AChE-R leads to the appearance in the serum of a short immunopositive C-terminal peptide which facilitates the hematopoietic stress responses [Grisaru, D. et al.
  • Peripheral neurophaties are caused by altered function and structure of peripheral motor, sensory or autonomic neurons.
  • the main causes of neuropathy are entrapment (compression), diabetes and other systemic diseases, inherited disorders, inflammatory demyelinating, ischemic, metabolic, and paraneoplastic conditions, nutritional deficiency states, and toxin-induced derangement.
  • GBS Guillain-Barré syndrome
  • GBS is an acute inflammatory polyneuropathy. It is the most common cause of acute flaccid paralysis worldwide, with an annual incidence of 0.75 to 2 in 100,000 in the general population. GBS is suspected when a patient presents with progressive motor weakness and loss of deep tendon reflexes (areflexia). Other clinical features include sensory symptoms, cranial nerve involvement, autonomic dysfunction causing pulse and blood pressure changes, and respiratory failure, which is a major cause of morbidity and mortality [Asbury and Cornblath, (1990) Ann. Neurol. 27: Suppl. S21-24]. The onset of symptoms can either be acute or sub-acute, but improvement is gradual, initiating after a plateau phase of several weeks, reaching clinical recovery by 6-7 months [Group, T.I.G.
  • CSF cerebrospinal fluid
  • Segmental demyelination termed acute inflammatory demyelinating polyradiculoneuropathy (AIDP) is the most common type of Guillain-Barré syndrome, apparently mediated by lymphocytic and macrophage infiltration of the peripheral nerves [Griffin J. et al., (1995) Brain 118: (Pt. 3), 577-595; Honavar M. et al., (1991) Brain 114: (Pt. 3), 1245-1269; Rees (1995) id ibid.] Demyelination is demonstrated by electrophysiological reduction of nerve conduction velocity, and subsequent remyelination is associated with recovery.
  • the electrophysiological features in these cases are reduced compound muscle action potential (CMAP) amplitude, and additionally, reduced sensory nerve action potentials in AMSAN, but preserved conduction velocity, indicating axonal dysfunction without demyelination.
  • CMAP compound muscle action potential
  • AMSAN reduced sensory nerve action potentials in AMSAN
  • conduction velocity indicating axonal dysfunction without demyelination.
  • Both axonal neuropathies are characterized by rapidly progressive weakness, often with respiratory failure, but although AMAN patients usually exhibit good recovery [McKhann (1993) id ibid.], the recovery of AMSAN patients is generally slow and incomplete, considered to be the most severe form of GBS (Brown and Feasby (1984) Brain 107: (Pt. 1) 219-239].
  • Axonal degeneration types of GBS are often preceded by infection with Campylobacter jejuni (Cj), which is associated with a slow recovery, and severe residual disability [Rees (1995) id ibid.].
  • Cj Campylobacter jejuni
  • LPS lipopolysaccharides
  • LPS LPS-stimulated human macrophages
  • AChE is therefore considered as potentially being of particular relevance to these processes because AChE controls ACh levels.
  • Acute and chronic stressful insults trigger transcriptional activation of AChE gene expression, which leads to accumulation of the normally rare, AChE-R splice variant [Soreq (2001) id ibid.].
  • the AChE-R excess reduces the stress-induced cholinergic hyperexcitation in the CNS [Kaufer (1998) id ibid.].
  • the present inventors have previously found that antisense oligonucleotides against the common coding region of AChE are useful for suppressing AChE-R production [see WO 98/26062].
  • the inventors have shown the use of an antisense oligonucleotide against the AChE sequence for the treatment of myasthenia gravis [WO 03/002739 and U.S. 2003-0216344].
  • the present invention provides a novel use for an antisense oligonucleotide directed against the AChE mRNA sequence, as a new anti-inflammatory agent, and particularly for the treatment of subjects afflicted with inflammation associated neuropathies such as the Guillain-Barré Syndrome.
  • the present invention refers to a method of treatment of conditions triggering an inflammatory response in a mammalian subject in need, comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same.
  • said conditions are selected from any one of stress, bacterial infection, drugs, irradiation, exposure to AChE inhibitors, stroke, auto-immune diseases, multiple chemical sensitivity and any cumulative age-dependent damages.
  • the present invention provides a method for the treatment and/or prevention of inflammation in the joints, central nervous system, gastrointestinal tract, endocardium, pericardium, lung, eyes, skin and urogenital system in a mammalian subject in need, comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same.
  • the present invention provides a method for suppressing the release of pro-inflammatory cytokines, comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same, to a subject in need.
  • said pro-inflammatory cytokine is selected from the group consisting of IL-1 ⁇ , TNF ⁇ , IL-6, IL-8, IL-12 and IL-18, and the release of said cytokine is triggered by one of stress, bacterial infection, drugs, irradiation, exposure to AChE inhibitors, stroke, auto-immune diseases, multiple chemical sensitivity, and any cumulative age-dependent damages.
  • the present invention provides a method for treating fever, comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same, to a subject in need.
  • the present invention also provides a method for the treatment of inflammation-associated neuropathies, comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same, to a subject in need.
  • a therapeutic effective amount of an inhibitor of AChE expression or a pharmaceutical composition comprising the same, to a subject in need.
  • an inflammation-associated neuropathy is the Guillain-Barré Syndrome.
  • said inhibitor of AChE expression is one of an AChE-specific ribozyme, an RNA sequence used for RNA interference of the AChE gene, and an antisense oligonucleotide directed against AChE.
  • said inhibitor of AChE expression is a nuclease resistant antisense nucleotide directed against AChE, or functional analogs, derivatives or fragments thereof.
  • said inhibitor of AChE expression is an antisense oligonucleotide directed against AChE, having the sequence as denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, as follows: 5′-CTGCCACGTTCTCCTGCACC-3′; (SEQ ID NO:1) 5′-CTGCAATATTTTCTTGCACC-3′; (SEQ ID NO:2) and 5′-CTGCCACGTTCTCCTGCA*C*C*-3′, (SEQ ID NO:7) wherein the three 3′ terminal residues are modified with 2-O-methyl groups (*), or functional analogs, derivatives or fragments thereof.
  • said mammalian subject is a human
  • said inhibitor of AChE expression is an antisense oligonucleotide directed against AChE, as denoted by the sequence selected from SEQ ID NO:1 and SEQ ID NO:7, or functional analogs, derivatives or fragments thereof.
  • said antisense oligonucleotide or composition comprising the same is for daily use by a subject in need, and said therapeutic effective amount is a dosage of active ingredient between about 0.001 ⁇ g/g and about 50 ⁇ g/g.
  • said dosage of active ingredient is between about 0.01 and about 5.0 ⁇ g/g. More preferably, said dosage of active ingredient is between about 0.15 and about 0.50 ⁇ g/g.
  • FIG. 1A - 1 F Reduced VAChT accumulation in cholinergic terminals and partition cells of treated monkeys.
  • FIG. 1B Average value of volume and average number per cell of labeled terminals, including all motoneurons detected in a section.
  • FIG. 1C Population distribution of volume and average number per cell of labeled terminals, including all motoneurons detected in a section.
  • FIG. 1D Average values of FIGS. 1B, 1C analyses ( ⁇ Standard Evaluation of the Mean, SEM). Significant reductions are marked by asterisks (p ⁇ 0.01, Student's t test).
  • FIG. 1E Immunolabeling with anti-ChAT antibody in partition cells from na ⁇ ve spinal cord, localized in close proximity to the central canal (arrows). Hematoxylin was used for background staining.
  • FIG. 1F Higher magnification of ChAT positive partition cells in na ⁇ ve monkeys (1) or following oral (p.o.) administration of 150 ⁇ g/kg/day (2) or 500 ⁇ g/kg/day (3) and i.v. administration of 500 ⁇ g/kg/day hEN101 (4). Note dose-independent handling—induced reductions in both terminals volume and density.
  • n. na ⁇ ve
  • Term. terminal
  • vol. volume
  • Part. Ce. Partition cell
  • Cent. Can. Central canal.
  • FIG. 2A - 2 J Selective ACHE-R mRNA suppression by hEN101 in monkey spinal cord neurons.
  • FIG. 2A Scheme of the human ACHE gene coding exons and two of its alternative transcripts, the synaptic AChE-S(S) and the stress-associated AChE-R(R) mRNA.
  • the S transcript includes exons 2, 3, 4 and 6, whereas the R transcript contains exons 2, 3, 4, 5 and pseudointron 4′.
  • FIG. 2B Sampling site on the dissected monkey lumbar spinal cord is indicated by an arrow.
  • FIG. 2C - 2 J Tissue sections from lumbar spinal cords were prepared following 7-day treatment with the noted doses of hEN101 by p.o. or i.v. administration. Shown is in situ hybridization used to compare neuronal labeling pattern with the noted probes. Nuclei were visualized by DAPI staining (white). There was no difference between tested sections in total cell numbers and/or general histology. Note that AChE-S mRNA labeling displayed significant changes following treatment only in neuronal process sections ( 2 F, 2 H and 2 J as compared to 2 D), whereas neuronal AChE-R mRNA labeling was notably reduced in cell bodies.
  • FIG. 2C No treatment, staining specific for AChE-R mRNA.
  • FIG. 2D No treatment, staining specific for AChE-S mRNA.
  • FIG. 2E Treatment with 150 ⁇ g/kg/day of EN101, p.o., staining specific for AChE-R mRNA.
  • FIG. 2F Treatment with 150 ⁇ g/kg/day of EN101, p.o., staining specific for AChE-S mRNA.
  • FIG. 2G Treatment with 500 ⁇ g/kg/day of EN101, p.o., staining specific for AChE-R mRNA.
  • FIG. 2H Treatment with 500 ⁇ g/kg/day of EN101, p.o., staining specific for AChE-S mRNA.
  • FIG. 2I Treatment with 500 ⁇ g/kg/day of EN101, i.v., staining specific for AChE-R mRNA.
  • FIG. 2J Treatment with 500 ⁇ g/kg/day of EN101, i.v., staining specific for AChE-S mRNA.
  • FIG. 3A - 3 C Cell size-dependent efficacy of neuronal AChE-R mRNA suppression.
  • FIG. 3A Scheme of the lumbar spinal cord and its three compartments: the ventral and dorsal horns separated by the intermediate zone and the central canal.
  • FIG. 3C Shown are fractions of AChE-R positive neurons from the three size groups under the different treatment regimens. Insets: representative neurons from the different size groups, taken from the p.o. 150 ⁇ g/kg/day regimen. Columns show average AChE-R positive cells in each size group ⁇ SEM representing repeated analyses of the entire lumbar spinal cord gray matter in multiple sections. Stars note significant differences (p ⁇ 0.05, Wilcoxon test).
  • Cent. Can. central canal
  • D. h. dorsal horn
  • I. z. Intermediate zone
  • V. h. ventral horn
  • pos. ce. positive cells
  • si. gr. size group
  • Ce. Bo. Diam. cell body diameter.
  • FIG. 4A - 4 C Suppression of stress-induced neuronal pro-inflammatory cytokines under antisense intervention with AChE-R expression.
  • FIG. 4C Fractions of IL-6 positive spinal cord neurons were evaluated essentially as under 4 A. Note decreases in both IL-1 ⁇ and IL-6 in spinal cord neurons of monkeys treated with 500 ⁇ g/kg/day EN101.
  • FIG. 5A - 5 D Changes over time in the human plasma levels of AChE activity and in AChE-R cleavage.
  • FIG. 5A Hydrolytic activities. Shown are plasma AChE activities (mean ⁇ SEM) for ten volunteers injected twice, with endotoxin or saline (placebo) at the noted intervals after injection. Pre-injection (baseline) AChE level was considered as 100% for each individual. Asterisks denote statistical difference (p ⁇ 0.05).
  • FIG. 5B Immunoblot. Shown are consecutive results for one individual. Plasma samples underwent electrophoresis by SDS-PAGE, and the blot immunoreacted with anti-AChE-R antibodies. Note the 6.5 kDa AChE-R cleavage product. Left lanes indicate the response to a placebo injection; right lanes demonstrate elevated AChE-R cleavage in response to endotoxin.
  • FIG. 5C Densitometric intensities. Shown are average values (mean ⁇ SEM) of the rapidly migrating AChE-R cleavage product in plasma of the endotoxin and placebo treated individuals as % of baseline (described in A).
  • FIG. 6 Mass spectroscopy of gel-eluted band.
  • FIG. 7A - 7 C AChE-R is expressed in human vascular endothelial cells from various tissues.
  • FIG. 7A AChE-R mRNA. Shown are the results of in situ hybridization using a 5′-biotinylated cRNA probe selective for the AChE-R mRNA variant on sections of human vascular endothelial cells affected by an inflammatory process (skin hypersensitivity vasculitis; labeling is seen as pink color, red arrow).
  • FIG. 7B AChE-R protein. Shown is an immunomicrograph of human kidney vascular endothelial cells from a patient with vasculitis, labeled with antibodies targeted at the AChE-R C-terminal peptide (red arrow).
  • FIG. 7C Image analysis. Shown are average AChE-R mRNA and AChE-R protein labeling intensities (black and white columns, respectively), in kidney, skin and muscle vascular endothelial cells (mean values ⁇ SEM) as the percentage of red pixels, falling within a defined intensity range.
  • prot. protein
  • int. intensity
  • k. rej. kidney rejection
  • k. vas. kidney vasculitis
  • nonspec. non-specific
  • n. end. normal endothelium
  • m. muscle
  • hyp. vasc. hypersensitivity vasculitis.
  • FIG. 8A - 8 C Bidirectional associations between AChE-R cleavage and the changes in cortisol and cytokines.
  • FIG. 8A cortisol.
  • FIG. 8B TNF- ⁇ .
  • FIG. 8C IL-6.
  • r correlation coefficient
  • t time after injection
  • Plac. placebo
  • end. endotoxin
  • H. p. inj. hours post-injection
  • cleav. prod. cleavage product.
  • FIG. 9 Endotoxin impairs declarative memory. Shown are average ⁇ SEM values for the performance in the immediate story recall test of the endotoxin and placebo treated individuals at the noted time following treatment as well as the associations of the changes in these values at 9 hr post-injection with the changes in AChE-R cleavage (b) and AChE activity (c).
  • FIG. 10 Endotoxin-induced improvement in working memory.
  • r correlation coefficient
  • t time after injection
  • S.b. Span backward
  • plac. placebo
  • endot. endotoxin
  • H.p.inj. hours post-injection
  • cleav. prod. cleavage product
  • act. activity.
  • FIG. 11A - 11 C Scheme-Endotoxin induces interrelated cytokine-cholinergic effects on memory.
  • FIG. 11A At 1 hr post-treatment: Endotoxin induces the release of cytokines, cortisol and proteases. Cytokines elevation associates with impaired declarative memory, which is a medial temporal lobe-associated phenomenon. Cortisol induces AChE-R production, which elevates the immunopositive AChE-R amounts in plasma. Vesicular ACh is released into the synaptic cleft, where it affects neuronal electrophysiology and may improve working memory, which is a neocortex-associated property. In the periphery, ACh begins to suppress cytokines production in macrophages (circular arrow).
  • FIG. 11B At 3 hr post-treatment: Proteases release a C-terminal fragment of 36 amino acids in length from AChE-R and initiate further destruction, followed by decreases in AChE activity. Endotoxin is already gone, and ACh effectively suppresses cytokines production; Increased ACh levels (reflecting enhanced secretion and the decrease in AChE's hydrolytic activity) are probably associated with activated working memory, whereas the elevation in AChE-R cleavage product is associated with a lower working memory improvement.
  • FIG. 11C At 9 hr Post-treatment: Cortisol is gone as well. However, the persistent, although slow decrease in AChE activity is associated both with the impaired declarative memory and, probably through ACh increases, with the activated working memory. The steady increase in AChE-R cleavage product is now associated both with a greater impairment in declarative memory and with lower improvement in working memory.
  • FIG. 12A - 12 B Transgenic mice display higher body temperature than wild-type mice.
  • FIG. 12A Graph showing the temperature of each mouse over time, squares represent transgenic mice, circles, control.
  • FIG. 12B Graph showing the average temperature of each group (transgenic or control) over time, diamonds represent transgenic mice, squares, control.
  • An. T. Anal temperature
  • Aver. An. T. Average Anal temperature
  • T. p. anest. time post-anesthesia.
  • FIG. 13A - 13 C Effects of Tacrine on LPS-induced IL-1 secretion in the hippocampus and IL-1 and TNF- ⁇ secretion in the serum.
  • FIG. 13A Graph showing the levels of IL-1 ⁇ in the hippocampus.
  • FIG. 13B Graph showing the levels of IL-1 ⁇ in the serum.
  • FIG. 13C Graph showing the levels of TNF- ⁇ in the serum.
  • prot. protein
  • ser. serum
  • sal. saline
  • FIG. 14A - 14 C Effects of Rivastigmine on LPS-induced IL-1 secretion in the hippocampus and IL-1 and TNF- ⁇ secretion in the serum.
  • FIG. 14A Graph showing the levels of IL-1 ⁇ in the hippocampus.
  • FIG. 14B Graph showing the levels of IL-1 ⁇ in the serum.
  • FIG. 14C Graph showing the levels of TNF- ⁇ in the serum.
  • prot. protein
  • ser. serum
  • sal. saline
  • FIG. 15A - 15 H Effects of surgery stress on emotional and cognitive parameters.
  • FIG. 15A Graph showing the effect of surgery stress on anxiety.
  • FIG. 15B Graph showing the effect of surgery stress on depression.
  • FIG. 15C Graph showing the effect of surgery stress on fatigue.
  • FIG. 15D Graph showing the effect of surgery stress on pain.
  • FIG. 15E Graph showing the effect of surgery stress on word list recall.
  • FIG. 15F Graph showing the effect of surgery stress on word list recognition.
  • FIG. 15G Graph showing the effect of surgery stress on story recall.
  • FIG. 15H Graph showing the effect of surgery stress on figure recall.
  • FIG. 16A - 16 C Effect of surgery stress on cytokine levels.
  • FIG. 16A Graph showing the effect of surgery stress on IL-1 and IL-6 levels.
  • FIG. 16B Correlation between IL-1 and depression.
  • FIG. 16C Correlation between cytokines and cognitive parameters.
  • FIG. 17A - 17 C Reduction of AChE gene expression upon EN301 treatment.
  • FIG. 17A Analysis of RT-PCR reaction (AChE exon 2 product after 31 PCR cycles). From left to right: lane 1, marker; lanes 2-8, samples from EN301-treated mice; lanes 9-14, samples from PBS-treated mice.
  • FIG. 17B Histogram representing quantitative analysis of the results obtained in the PCR reaction using primers targeting the common sequence in exon 2 of murine AChE cDNA.
  • FIG. 17C Histogram representing quantitative analysis of the results obtained in the PCR reaction using primers targeting the sequence in exon 6 unique to the AChE-S variant.
  • FIG. 18A - 18 C Schematic representation of injections and conduction tracings in the GBS model
  • FIG. 18A Systemic exposure was provided by intra-peritoneal (i.p.) injection (systemic injection). Intra-neural (i.n.) injections were to the sciatic nerve at the mid thigh level.
  • FIG. 18B Compound muscle action potential is recorded from the intrinsic foot muscles following proximal stimulation of the sciatic nerve at the sciatic notch and distal stimulation of the peroneal and posterior tibial nerves at the ankle.
  • FIG. 18C Proximal to distal amplitudes ratio (PDR) of less than 0.5 indicates conduction block.
  • inj. injection; red., reduced; norm., normal; prox. stim., proximal stimulation; dist. stim., distal stimulation; rec. si., recording site.
  • FIG. 19A - 19 D Histograms representing average proximal to distal amplitude ratio (PDR) in selected experiments.
  • i.n. intra-neural; i.p., intra-peritoneal; LPS, lipopolysaccharide; EN101 or AS, antisense oligonucleotide; SM, splenocyte medium; BMM, bone marrow macrophage; ARP, AChE-readthrough peptide; ASP, AChE-synaptic peptide; n., none; sal., saline; inj., injection; PID2, second post-injection day; I.N.Inj., intra-neural injection; LPS-R, lipopolysaccharide-reactive.
  • FIG. 20 Immunoblot signal for PKC ⁇ II.
  • PKC ⁇ II is increased following intra-neural injection (i.n.) of LPS-reactive splenocyte medium in two nerves (RM, lanes 3, 4) compared to two nerves injected with non-reacted splenocyte medium (NM, lanes 1, 2). This increase is attenuated in two nerves by concomitant i.n. injection of antisense EN101 (RM+EN101, lanes 5, 6).
  • Antisense oligonucleotide A nucleotide comprising essentially a reverse complementary sequence to a sequence of AChE mRNA.
  • the nucleotide is preferably an oligodeoxynucleotide, but also ribonucleotides or nucleotide analogues, or mixtures thereof, are contemplated by the invention.
  • the antisense oligonucleotide may be modified in order to enhance the nuclease resistance thereof, to improve its membrane crossing capability, or both.
  • the antisense oligonucleotide may be linear, or may comprise a secondary structure. It may also comprise enzymatic activity, such as ribozyme activity.
  • hEN101 SEQ ID NO:1
  • hEN101 a 2′-oxymethylated antisense oligonucleotide inducing AChE-R mRNA destruction.
  • hEN101 prevented the stress-induced increases in plasma AChE activities and selectively suppressed neuronal AChE-R mRNA and interleukins-1 ⁇ and -6 levels in a dose- and cell size-dependent manner.
  • VAChT and ChAT levels were reduced dose-independently in all of the handling-stressed monkeys, demonstrating distinct regulation for the corresponding genes.
  • the present invention refers to the use of an inhibitor of AChE expression, as an anti-inflammatory agent.
  • the present invention provides methods of treatment and/or prevention of conditions selected from the group consisting of: conditions triggering an inflammatory response, inflammation, release of pro-inflammatory cytokines, fever, and inflammation-associated neuropathies, particularly GBS, said method comprising administering a therapeutic effective amount of an inhibitor of AChE expression, or a pharmaceutical composition comprising the same, to a subject in need.
  • an inhibitor of AChE expression is any agent which is capable of blocking or hindering the expression of the AChE gene, particularly by interacting with its mRNA.
  • said inhibitor may be an AChE-specific ribozyme, a double-stranded nucleotide sequence used for RNA interference of the AChE gene, or an antisense oligonucleotide directed against AChE.
  • Antisense nucleotides are preferably nuclease resistant.
  • said inhibitor of AChE expression selectively inhibits the AChE-R mRNA, consequently selectively inhibiting the expression of the AChE-R isoform.
  • any agent capable of inhibiting the soluble AChE-R isoform may also be an anti-inflammatory agent. Therefore, a putative molecule that could block AChE-R expression and/or function would be an anti-inflammatory agent.
  • AChE-S mRNA appeared in processes of many more spinal cord neurons than AChE-R mRNA, creating a pattern reminiscent of VAChT labeling in the rat spinal cord ventral horn [Weihe et al. (1996) id ibid.].
  • hEN101 treatment was highly efficient with neuronal AChE-R mRNA and much less effective with AChE-S mRNA.
  • the reduced intensity of neuronal AChE-S mRNA labeling likely reflected limited reduction in neuronal AChE-S mRNA levels as well.
  • AChE-S mRNA in processes was reduced, suggesting common tendency for reduced dendrite translocation of the rodent and primate AChE-S mRNA transcript under stress [Meshorer et al. (2002) id ibid.]. This difference further strengthened the notion that the na ⁇ ve monkey was indeed under no stress, an important fact in a study with strictly limited number of animals.
  • the reduced AChE-S mRNA in neuronal processes of the treated monkeys may be treatment- and/or drug-induced. Following 7 days treatment, a shift from the primary AChE-S mRNA transcript to the stress-induced antisense-suppressible AChE-R mRNA may be visualized in the neuronal processes ( FIG. 2A-2J ).
  • said inhibitor of AChE expression is an antisense oligonucleotide directed against AChE, having any one of the following sequences: 5′ CTGCCACGTTCTCCTGCACC 3′; (SEQ ID NO:1) and 5′ CTGCCACGTTCTCCTGCA*C*C* 3′, (SEQ ID NO:7) wherein the three 3′ terminal residues are modified with 2-O-methyl groups (*).
  • the antisense oligonucleotides denoted by SEQ ID NO:1 or SEQ ID NO:7 are also referred to herein as EN101, or hEN101.
  • hEN101 is also commercially known as MonarsenTM.
  • the antisense oligonucleotides directed against AChE have been described in the past by the present inventors [WO 03/002739], and were shown to have a potent effect in the treatment of the neuromuscular pathology myasthenia gravis [applicant's co-pending U.S. 2003-0216344].
  • the antisense oligonucleotide directed against AChE was able to reduce the release of IL-1 ⁇ , which is a pro-inflammatory cytokine.
  • Example 1 AChE-R mRNA levels in motoneurons were minimally affected, However, elimination of AChE-R production in spinal cord smaller neurons potentially increased ACh signaling within the treated tissue, in spite of the stress-induced reduction in VAChT and ChAT [Kaufer et al. (1998) id ibid.]. This attributes to AChE-R the primary role of regulating ACh levels in the CNS. Findings of others show large variability in the electrophysiological activity patterns of spinal cord interneurons [Perlmutter (1996) id ibid.] as well as pre-movement instructed delay activity in them [Prut and Fetz (1999) id ibid.].
  • AChE-R expression in small cholinergic neurons may thus contribute to the control of motoneuron activities (e.g. motor reflexes).
  • C-terminal structures, which affect the cholinergic input to motoneurons, were considered to originate in proximity to the motoneurons themselves [Hellstrom (1999) id ibid.]. This study attributes this origin to AChE mRNA positive interneurons and small cholinergic neurons located in the ventral horn and intermediate zone of the lumbar spinal cord.
  • antisense oligonucleotides directed against AChE have also been described, and potentially have the same anti-inflammatory effect as hEN101, as demonstrated in Example 16 for mEN101.
  • antisense oligonucleotides derived from the mouse and the rat AChE homologous sequences which have the following sequences: mEN101 5′-CTGCAATATTTTCTTGCACC-3′ (SEQ ID NO:2) [Grifman and Soreq (1997) Antisense Nucleic Acid Drug Dev. 7(4):351-9] Also referred herein as EN301.
  • rEN101 5′-CTGCCATATTTTCTTGTACC-3′ (SEQ ID NO:3) [Brenner (2003) id ibid.]
  • hEN103 5′-GGGAGAGGAGGAGGAAGAGG-3′ (SEQ ID NO:4) [Grisaru, D. et al. (1999) Mol. Cell Biol. 19(1):788-95]
  • Example 16 demonstrates how administration of mEN101 (EN301) was able to reduce the levels of ACHE-R in the brain. This could be done directly, upon crossing the blood-brain-barrier, or indirectly, by reducing the levels of peripheral AChE, increasing the levels of ACh, which would then suppress the production of pro-inflammatory cytokines by macrophages.
  • the present invention provides the use of an inhibitor of AChE as defined herein, as a suppressor of pro-inflammatory cytokines release.
  • Known pro-inflammatory cytokines are IL-1 ⁇ , TNF ⁇ , IL-6, IL-8, IL-12 and IL-18, amongst others.
  • IL-1 ⁇ is the pro-inflammatory cytokine to be suppressed by the method of the invention upon administration of an antisense oligonucleotide denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, or a composition comprising thereof, to a subject in need.
  • an antisense oligonucleotide denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, or a composition comprising thereof, to a subject in need.
  • Pro-inflammatory cytokine release may be triggered by factors of acquired, chemical or genetic origin. Amongst others, these may be stress, bacterial infection, drugs, irradiation, exposure to AChE inhibitors, stroke, auto-immune diseases, multiple chemical sensitivity, or any cumulative age-dependent damages.
  • Known conditions which trigger pro-inflammatory cytokine release are: bacterial infection, drugs, irradiation, exposure to AChE inhibitors, stroke, auto-immune diseases, multiple chemical sensitivity, or any cumulative age-dependent damages.
  • Stress-induced spinal IL-1 ⁇ over-production and spinal IL-1 ⁇ suppression following AS-ON inhibition of AChE-R support the notion of cholinergic regulation of anti-inflammatory response in the CNS.
  • Stressed” neurons produce high levels of AChE-R, reducing ACh and allowing uninterrupted production of IL-1 ⁇ in CNS neurons that do not express IL-1 ⁇ under normal conditions.
  • Antisense suppression of the stress-induced AChE-R would increase ACh levels, which can then suppress IL-1 ⁇ production in CNS neurons.
  • Such cholinergic regulation of inflammatory response within the CNS may explain both the increase of pro-inflammatory cytokines under cholinergic imbalance (e.g.
  • the inhibition of IL-1 ⁇ release by the antisense oligonucleotide herein described might result in cartilage regeneration.
  • the invention also provides the use of an inhibitor of AChE expression, as defined herein, as an inducer of cartilage regeneration.
  • the antisense oligodeoxynucleotides used as anti-inflammatory agents in the present invention are preferably nuclease resistant. There are a number of modifications that impart nuclease resistance to a given oligonucleotide. Reference is made to WO 98/26062, which publication discloses that oligonucleotides may be made nuclease resistant e.g., by replacing phosphodiester internucleotide bonds with phosphorothioate bonds, replacing the 2′-hydroxy group of one or more nucleotides by 2′-O-methyl groups, or adding a nucleotide sequence capable of forming a loop structure under physiological conditions to the 3′ end of the antisense oligonucleotide sequence.
  • An example for a loop forming structure is the sequence 5′-CGCGAAGCG-3′, which may be added to the 3′ end of a given antisense oligonucleotide to impart nuclease resistance thereon.
  • Phosphorothioate-modified oligonucleotides are generally regarded as safe and free of side effects.
  • the antisense oligonucleotides of the present invention have been found to be effective as partially phosphorothioates and yet more effective as partially 2′-O-methyl protected oligonucleotides.
  • WO 98/26062 teaches that AChE antisense oligonucleotides containing three phosphorothioate bonds out of about twenty internucleotide bonds are generally safe to use in concentrations of between about 1 and 10 ⁇ M. However, for long-term applications, oligonucleotides that do not release toxic groups when degraded may be preferred.
  • the inhibitor of AChE as defined above may also be used as an anti-pyretic.
  • the antisense oligonucleotides denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, or compositions comprising thereof may be used in the method of the invention for treating fever, or lowering body temperature, in a subject in need.
  • transgenic mice with host AChE-R elevation show inherently higher body temperature as compared to strain, gender and age-matched controls. Furthermore, their body temperature remains higher also under anesthesia, demonstrating impaired regulation and tentative association of AChE-R with pyrogenic responses. Thus, inhibitors of AChE-R expression would also have an effect in lowering the elevated body temperature that is characteristic of inflammatory reactions.
  • Normal body temperature varies by person, age, activity, and time of day.
  • the average normal body temperature is 37° C. (98.6° F.).
  • An at least half-degree elevation of the average temperature may already be considered as fever.
  • Fever or elevated body temperature
  • causes including: viral and bacterial infections, colds or flu-like illnesses, sore throats and strep throat, ear infections, viral gastroenteritis or bacterial gastroenteritis, acute bronchitis, infectious mononucleosis, urinary tract infections, upper respiratory infections (such as tonsillitis, pharyngitis or laryngitis), medications (such as antibiotics, antihistamines, barbiturates, and drugs for high blood pressure), occasionally, more serious problems like pneumonia, appendicitis, tuberculosis, and meningitis, collagen vascular disease, rheumatoid diseases, and autoimmune disorders, juvenile rheumatoid arthritis, lupus erythematosus, periarteritis nodosa, AIDS and HIV infection, inflammatory bowel disease, regional enteritis, ulcerative colitis, cancer, leukemia, neuroblastoma, Hodgkin's disease and non-
  • the dosage of the antisense oligodeoxynucleotide is about 0.001 to 50 ⁇ g oligonucleotide per gram of body weight of the treated mammalian subject, and it is for daily use.
  • the dosage is about 0.01 to about 5.0 ⁇ g/g. More preferably, the dosage is between about 0.05 to about 0.7 ⁇ g/g.
  • the optimal dose range is between 50-500 ⁇ g/kg of body weight of the treated subject, for rats, monkeys and most importantly humans.
  • This dosage refers to the antisense oligonucleotide administered per se, or in solution, in a pharmaceutical composition.
  • the present invention also provides a pharmaceutical composition for the treatment of conditions triggering an inflammatory response in a mammalian subject in need, preferably a human, comprising as active agent the above-defined inhibitor of AChE expression.
  • the composition further comprises pharmaceutically acceptable additives, carriers and/or diluents.
  • said inhibitor of AChE expression is an antisense oligonucleotide directed against AChE, and has the sequence as denoted by any one of SEQ ID NO:1 and SEQ ID NO:7.
  • said antisense nucleotide has the sequence as denoted by any one of SEQ ID NO:2 and SEQ ID NO:3.
  • the present invention provides a pharmaceutical composition for the treatment and/or prevention of inflammation in the joints, central nervous system, gastrointestinal tract, endocardium, pericardium, lung, eyes, skin and urogenital system in a mammalian subject in need, comprising as active agent the inhibitor of AChE expression as defined above, optionally further comprising pharmaceutically acceptable additives, carriers and/or diluents.
  • said inhibitor of AChE expression is an antisense oligonucleotide.
  • said antisense nucleotide has the sequence as denoted by any one of SEQ ID NO:1 and SEQ ID NO:7.
  • said antisense nucleotide has the sequence as denoted by any one of SEQ ID NO:2 and SEQ ID NO:3.
  • the inhibitor of AChE expression is to be used in the preparation of the pharmaceutical composition comprising the same.
  • compositions are for use by injection, topical administration, or oral uptake.
  • the present invention also provides the use of the antisense oligonucleotides described herein, and preferably the use of the antisense oligonucleotides denoted by SEQ ID NO:1 and SEQ ID NO:7, in the preparation of a pharmaceutical composition for the treatment or prevention of conditions triggering an inflammatory response in a subject in need.
  • said conditions are selected from the group comprised of inflammation in the joints, central nervous system, gastrointestinal tract, endocardium, pericardium, lung, eyes, skin, urogenital system, fever, the release of pro-inflammatory cytokines, stroke, brain and peripheral nerve trauma, neurodegenerative diseases (e.g. vascular dementia), closed head injury, memory impairment, and inflammation-associated neuropathies (e.g. Guillain-Barré syndrome).
  • composition of the invention may comprise as active agent a combination of at least two antisense oligonucleotides as defined in the invention, or functional analogs, derivatives or fragments thereof.
  • analogs and derivatives is meant the “fragments”, “variants”, “analogs” or “derivatives” of said nucleic acid molecule.
  • a “fragment” of a molecule such as any of the oligonucleotide sequences of the present invention, is meant to refer to any nucleotide subset of the molecule.
  • a “variant” of such molecule is meant to refer a naturally occurring molecule substantially similar to either the entire molecule or a fragment thereof.
  • An “analog” of a molecule can be without limitation a paralogous or orthologous molecule, e.g. a homologous molecule from the same species or from different species, respectively.
  • Preferred modes of administration of the inhibitor of AChE expression or pharmaceutical compositions comprising the same are by subcutaneous, intraperitoneal, intravenous, intramuscular or systemic injection.
  • the pharmaceutical composition described herein generally comprises a buffering agent, an agent which adjusts the osmolarity thereof, and optionally, one or more carriers, excipients and/or additives as known in the art, e.g., for the purposes of adding flavors, colors, lubrication, or the like to the pharmaceutical composition.
  • a preferred buffering agent is Tris, consisting of 10 mM Tris, pH 7.5-8.0, which solution is also adjusted for osmolarity.
  • the antisense oligonucleotides are suspended is sterile distilled water or in sterile saline.
  • Other carriers may include starch and derivatives thereof, cellulose and derivatives thereof, e.g., microcrystalline cellulose, xantham gum, and the like.
  • Lubricants may include hydrogenated castor oil and the like.
  • Topical administration of pharmaceutical compositions may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions described herein include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
  • compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. Such compositions may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • compositions may be formulated and used as foams.
  • Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
  • the pharmaceutical composition of the invention is for daily use by a subject in need of such treatment, at a dosage of active ingredient between about 0.001 ⁇ g/g and about 50 ⁇ g/g.
  • the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.01 to about 5.0 ⁇ g/g.
  • said dosage of active ingredient is of between about 0.05 to about 0.70 ⁇ g/g, and even most preferably, the dosage is from 0.15 to 0.50 ⁇ g/g of body weight of the subject in need.
  • the antisense agent targeted toward the human ACHE sequence appeared effective in Cynomolgus monkeys at the same nanomolar dose as that of the corresponding agents in mice [Cohen et al. (2002) id ibid.] and rats Brenner et al. (2003) id ibid.].
  • Long-term AChE-R overproduction is associated with impaired locomotion control that is susceptible to improvement under antisense suppression of AChE-R production [Shohami (2000) id ibid.].
  • the present invention teaches methods of treatment of conditions wherein lowering the amounts of circulating AChE-R may be therapeutic and even preventive.
  • said conditions may be summarized as conditions triggering an inflammatory response, inflammation of any kind, and in particular inflammation-associated neuropathies, such as Guillain-Barré syndrome.
  • the method comprises administering a therapeutically effective amount of an inhibitor of AChE expression or a composition comprising the same to a mammalian subject in need, preferably a human.
  • said inhibitor of AChE expression to be used in the methods of the invention is an antisense oligonucleotide, which, more preferably has the sequence as denoted by any one of SEQ ID NO:1 and SEQ ID NO:7.
  • Said therapeutic effective amount, or dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved.
  • Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 , found to be effective in in vitro as well as in in vivo.
  • the variant specificity, low dose and long duration efficacy of the antisense agents may be clear advantages over conservative drugs, both for interfering with acute stress-induced symptoms and inflammatory response, and hence for prevention of neurodeterioration.
  • These considerations may be relevant to various disease conditions, including amyotrophic lateral sclerosis [Shaw, P. J. & Eggett, C. J. (2000) J. Neurol. 247 Suppl 1: I17-27], myasthenic syndromes [Becker et al. (1992) id ibid.], muscular dystrophy [Cifuentes-Diaz, C. et al. (2001) J. Cell Biol. 152: 1107-1114], spinal muscular atrophy [Sendtner, M.
  • the methods described herein also include combination therapy, where the inhibitor of AChE expression or the composition comprising thereof are administered in combination with other drugs, in accordance with the condition of the subject to be treated.
  • FIG. 11 presents a scheme summarizing the kinetic follow-up for the different parameters that were measured and the postulated associations between them, predicting potentially causal relationships between the induction of cytokines, hormone secretion, AChE modulations and the resultant memory changes.
  • the endotoxin-induced impairment in declarative memory was highest and correlated positively with cytokine secretion, whereas the improvement in working memory became prominent at 3 hr post-treatment and showed no correlation with cytokine secretion.
  • both types of memory changes were significantly correlated with AChE-R cleavage, although cholinergic control over working memory seemed to begin earlier than for declarative memory (3 hr vs. 9 hr post-injection, FIG. 11B and FIG. 11C , respectively).
  • Test substance Human (h) HPLC-purified, GLP grade EN101 (purity 95% as verified by capillary electrophoresis) was purchased from Avecia Biotechnology (Milford, Mass.).
  • the primary hEN101 sequence 5′CTGCCACGTTCTCCTGCA*C*C*3′ (SEQ ID NO:1), is complementary to the coding sequence of human AChE mRNA (GeneBank Accession No. NM 000665, nucleotide positions 733-752) within exon 2, common to all three AChE variants [Soreq, H. & Zakut, H. (1993) Human cholinesterases and anticholinesterases , Academic Press, INC. San Diego; Ben Aziz-Aloya, R.
  • hEN101 stability Stability of freeze-dried hEN101 was tested by HPLC during storage at ⁇ 20 ⁇ 5° C., 4° C. and 25 ⁇ 2° C. (60 ⁇ 5% relative humidity) in the dark. Three samples from each storage condition were collected after 3, 6 and 9 months and their stability analyzed by HPLC. hEN101 was found to be stable for at least 6 months at ⁇ 20° C. under these storage conditions.
  • hEN101 administration Three pairs of 1.5 to 2.5 Kg cynomolgus monkeys, 1 male and 1 female, were administered hEN101 for 7 days: 150 ⁇ g/kg daily per os (p.o.) by oral gavage (15 ⁇ g/ml in 0.9% saline) or 500 ⁇ g/kg daily (p.o., 50 ⁇ g/ml in saline) or by intravenous (i.v.) injection (100 ⁇ g/ml in saline). Plasma samples were removed at the noted hours following the second day of treatment and kept at ⁇ 20° C. until use. Following 1 week of daily treatment, animals were euthanized and lumbar spinal cord preparations were paraffin-embedded by standard procedures. One male na ⁇ ve monkey served as control.
  • Toxicology Potential toxicity of hEN101 was tested at Huntingdon before, during and following treatment. Among the parameters noted were body weight, food consumption, general locomotor behavior, electrocardiography and blood pressure, blood count, prothrombin time and standard blood chemistry (Hitachi 917 Clinical Chemistry Analyzer). Post-mortem observation included organ weights and scanning of hematoxylin and eosin-stained sections of brain, heart, kidneys, liver, lungs, spinal cord and stomach.
  • In situ hybridization Tissues were fixed in 4% paraformaldehyde and cut into 7 ⁇ m paraffin-embedded sections. Lumbar spinal cord sections were deparaffinized, rehydrated using serial ethanol dilutions and permeabilized with proteinase K (10 ⁇ g/ml, 10 min at 37° C.). Slides were exposed to 5′ biotinylated, fully 2′-oxymethylated AChE-R or AChE-S-specific 50-mer cRNA probes complementary to human ACHE pseudointron 4 or exon 6, respectively (Microsynth, Belgach, Switzerland). The following probes were employed:
  • human AChE-R probe (nucleotide positions 88-38 in GenBank Accession No. S 71129; SEQ ID NO:5): 5′-CUAGGGGGAGAAGAGAGGGGUUACACUGGCGGGCUCCCACUCCCCUCC UC-3′;
  • human AChE-S probe (nucleotide positions 2071-2022 in GenBank Accession No. NM 000665; SEQ ID NO:6): 5′-CCGGGGGACGUCGGGGUGGGGUGGGGAUGGGCAGAGUCUGGGGCUC GUCU-3′.
  • Hybridization was performed overnight at 52° C. in hybridization mixture containing 10 ⁇ g/ml probe, 50 ⁇ g/ml yeast tRNA, 50 ⁇ g/ml heparin and 50% formamide in 375 mM Na chloride, 37.5 mM Na citrate, pH 4.5. Slides were washed to remove unhybridized probe, blocked with 1% skim milk containing 0.01% Tween-20 and 2 mM levamisol, an alkaline phosphatase inhibitor used to suppress non-specific staining and incubated with streptavidin-alkaline phosphatase (Amersham Pharmacia, Little Chalfont Bucks, UK). Fast RedTM substrate (Roche Diagnostics, Mannheim, Germany) was used for detection.
  • Immunohistochemistry Re-hydrated spinal cord sections were subjected to heat-induced antigen retrieval by microwave treatment in 0.01 M citrate buffer, pH 6.0. Non-specific binding was blocked by 4% naive goat or donkey serum in PBS with 0.3% Triton X-100 and 0.05% Tween20TM. Slides were incubated with primary antibodies diluted in the same buffer (1 h, room temp., overnight, 4° C.). Sections were rinsed and incubated with biotin-conjugated secondary antibody, diluted (1:200) in the same blocking buffer (3 h, room temp.). The primary antibodies included rabbit polyclonal anti-VAChT (1:100, Sigma, St.
  • Biotinylated secondary antibodies were donkey anti-rabbit (Chemicon) and donkey anti-goat (Jackson ImmunoResearch Laboratories, West Grove, Pa.), both used at 1:200 dilutions. Detection was with Fast RedTM substrate for anti-VAChT and ChAT antibodies and with Vectastain ABC peroxidase kit (Vector Laboratories, Burlingame, Calif.) for the anti-IL-1 ⁇ antibody.
  • Confocal microscopy was carried out using a Bio-Rad MRC 1024 confocal scanhead (Hemel Hempsted, Hertfordshire, U.K.) coupled to an inverted Zeiss Axiovert 135 microscope (Oberkochen, Germany) equipped with a Plan Apochromat 40 ⁇ 1.3 immersion objective. Fast Red was excited at 488 nm and emission was measured through a 580df32 interference filter (580 ⁇ 16 nm). Immunolabeled sections were scanned every 0.5 ⁇ m and projections analyzed using the Image Pro Plus 4.0 (Media Cybernetics, Silver Spring, Md.) software.
  • Cholinesterase activity measurements Plasma samples were subjected to cholinesterase catalytic activity measurements [Ellman, G. L. et al. (1961) Biochem. Pharmacol. 7, 88-99] adapted to a multi-well plate reader. Acetylthiocholine (ATCh) hydrolysis rates were measured following prior incubation for 30 min with 5 ⁇ 10 ⁇ 5 M of the specific butyrylcholinesterase (BuChE) inhibitor tetraisopropylpyrophosphoramide, iso-OMPA. Total plasma cholinesterase activities were measured in the absence of inhibitors.
  • Subjects of the memory study Ten male subjects participated in the study, which was approved by an independent ethics committee. Subjects recruitment as well as physical and psychiatric screening, were described in detail elsewhere [Reichenberg A. et al. (2001) id ibid.]. The current study involved a subset of the subjects included in the previous project, with serum AChE and working memory tests added. Interviews by experienced psychiatrists excluded the presence and the history of any axis I psychiatric disorder according to the DSM-IV [American Psychiatric Association (1994) Diagnostic and statistical manual for mental disorders, 4th ed. Washington D.C.]. Only subjects who successfully passed the screening procedure, and signed an informed consent form, were considered eligible to participate. Comprehensive assessment was performed, and involved each subject going through a number of physical and neuropsychological tests in a clinical research unit using a balanced, randomized, double-blind, cross-over design.
  • Procedure for the memory tests All technical equipment, including the blood sampling device, was housed in a room adjacent to the sound-shielded experimental room. Every subject passed two 10 days apart testing sessions and spent the night before each experimental session in the research unit. A battery of neuropsychological tests, assessing memory, learning, and attention was given for adaptation upon their first arrival in the evening, minimizing subsequent practice effects [McCaffrey, R. J. and Lynch, J. K. (1992) Neuropsychol. Rev. 3:235-48]. Alternate versions of these tests were used in the experimental testing sessions.
  • an intravenous cannula was inserted into an antecubital forearm vein for intermittent blood sampling and intravenous (i.v.) injection of endotoxin (0.8 ng Salmonella abortus equi endotoxin per Kg body weight) in one session or the same volume of 0.9% NaCl (saline) solution on the other occasion (placebo).
  • endotoxin 0.8 ng Salmonella abortus equi endotoxin per Kg body weight
  • saline 0.9% NaCl
  • Salmonella abortus equi endotoxin Prepared for use in humans, this endotoxin was available as a sterile solution free of proteins and nucleic acids. The endotoxin preparation employed has proven to be safe in various studies of other groups [Burrell R. (1994) id ibid.] and in studies at the Max Planck Institute of Psychiatry, including more than 100 subjects since 1991 [Pollmacher T. et al., (1996) J. Infect. Dis. 174:1040-5].
  • Plasma levels of AChE and its degradation product, cytokines and cortisol Blood was collected in tubes containing Na-EDTA and aprotinin and was immediately centrifuged. Plasma was aliquoted and frozen to ⁇ 80° C.
  • AChE catalytic activity was measured as the capacity for acetylthiocholine (ATCh) hydrolysis in the presence of 1 ⁇ 10 ⁇ 5 M tetraisopropylpyrophosphoramidate (iso-OMPA), a selective inhibitor of serum butyrylcholinesterase, BChE [Soreq H. and Glick D. (2000): Novel roles for cholinesterases in stress and inhibitor responses.
  • Giacobini E In: Giacobini E.
  • AChE-R mRNA and its protein product in vascular endothelial cells Fluorescent in situ hybridization and immunohistochemistry of AChE-R mRNA and AChE-R protein were performed and quantified as reported [Cohen (2002) id ibid.; Perry, C. et al. (2002) Oncogene 21:8428-8441] using paraffin-embedded tissue sections from surgically-removed biopsies of patients with or without clinical inflammation due to non-specific kidney vasculitis or following kidney rejection.
  • MALDI-TOF-MS analysis of immunolabeled proteins Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) was employed in an attempt to identify the protein and peptide bands labeled by anti-AChE-R antibodies in blotted membranes. Proteolytic degradation of the gel-eluted peptide was performed using the endoprotease LysC from Achromobacterlyticus (Wako Chemicals, Inc., USA) at a substrate to enzyme ratio of 200:1. Digestion was carried out overnight in 0.05M Tris HCl, pH 9.0, in the presence of 4M urea, at 30° C.
  • Subjects were requested to repeat lists of digits with increased number of digits every two lists either in the correct order of presentation (forward condition—assessment of span), or in a reversed order (backward condition—assessment of working memory). The number of lists correctly repeated was counted. Attention was assessed using the Ruff 2&7 cancellation test [Ruff R. M. and Allen C. C. (1996): Ruff 2&7 Selective Attention Test: Professional Manual . Psychological Assessment Resources Inc., Lutz, Fla.]: Subjects were instructed to mark either the digit 2 or the digit 7, which are randomly placed either between letters or between digits. The numbers of correct responses in a 5 minute trial were counted.
  • Linear rank Wilcoxon test for two related samples was used for the analysis of AChE-R- and IL-1 ⁇ -positive fractions of analyzed neurons, measured on at least 4 sections from each group. Differences were considered significant when a p value of ⁇ 0.05 or less was obtained using the SAS 8.0 software. Student's t test was used for analyzing the numbers and volume of VAChT-containing terminals in spinal cord sections.
  • the cells were suspended in RPMI-1640 medium containing antibiotics and glutamine. Following centrifugation, the pellet was resuspended in RPMI, layered on Histopaque and centrifuged again. The lymphocyte fraction was collected, washed and supplemented with fetal calf serum and diluted to a concentration of 1.4 ⁇ 10 7 cells/ml. Splenocytes reacted with LPS additionally contained 0.5 ⁇ g/ml Cj-LPS. Following incubation for 48 hour at 37° C. with 5% CO2, the cell suspension was centrifuged and supernatant medium collected and stored at ⁇ 20° C. until use.
  • Bone-marrow derived macrophages Rat femur marrow content was obtained as described elsewhere [Apte, R. N., and Keisari, Y. (1987) Immunobiology 175: 470-481], dispersed into RPMI 1640 medium, washed, supplemented with serum and L-cell conditioned medium as a source of a colony stimulating factor and cultured at 37° C. 5% CO 2 . After 7 days a macrophage monolayer was harvested.
  • Intraneural injection Female 8-week-old Lewis rats were anesthetized by intraperitoneal injection of 10% solution of chloralhydrate (0.3-1 ml). The sciatic nerves exposed at the mid-thigh through a skin incision from the sciatic notch to the popliteal fossa. Tested mediums or solutions, 10 ⁇ l each, were intraneurally injected to separate sciatic nerves, via hand held Hamilton microsyringe with a 301 ⁇ 2 gauge needle under a dissection microscope.
  • Tissue preparations For western blot analysis, 7 ⁇ m of the sciatic nerve including the injection site were removed under general anesthesia as described, quickly frozen in liquid nitrogen, and stored at ⁇ 70° C. For morphological analysis, the nerve segments were immersed in 4% paraformaldehyde in PBS (48 hrs, 4° C.), embedded in paraffin and sectioned at 8 ⁇ m in the axial or longitudinal planes.
  • Cy3- or biotin-conjugated secondary IgG reacted with avidin-bound peroxidase-complex will be applied for detection of primary antibodies by confocal or light microscopy following peroxidase reaction, respectively. Selected sections will be counterstained with Gill-2 hematoxyllin.
  • Acetylthiocholine hydrolysis will be measured spectrophotometrically as described [Kaufer (1998) id ibid.], using Iso-OMPA (tetraisopropylpyrophosphoramide) to block butyrylcholinesterase activity (5-10-5 M).
  • Iso-OMPA tetraisopropylpyrophosphoramide
  • VAChT was predictably concentrated in cholinergic (C) terminals surrounding motoneurons [Weihe (1996) id ibid.], where it loads neural vesicles with ACh.
  • VACh-T-labeled C-terminals were significantly smaller ( ⁇ 60 ⁇ m 3 ) under p.o. administration of 150 ⁇ g/kg/day as compared to control sections ( FIGS. 1B and 1C , p ⁇ 0.01, Student's t test), perhaps reflecting changes in VAChT translocation into vesicles and/or VAChT stability.
  • VAChT production is largely co-regulated with that of ChAT [Usdin, T. B. et al. (1995) Trends Neurosci. 18, 218-224], since both are produced from one gene complex (the so called “cholinergic locus”) [Erickson, J. D. et al. (1996) Prog. Brain Res. 109, 69-82].
  • ChAT staining of C-terminals on motoneurons indeed presented similar changes to those observed for VAChT staining (data not shown).
  • Lumbar spinal cord sections from hEN101-treated monkeys regardless of the dose or mode of administration, revealed conspicuously decreased staining intensity of ChAT-positive partition cells ( FIG. 1E ), again indicating handling stress-related suppression of ACh production and slowdown of vesicle recycling.
  • Cholinesterase activities were measured in plasma samples taken during the second day of hEN101 administration.
  • ATCh hydrolysis in plasma is largely due to serum BuChE, the primary serum cholinesterase encoded by a non-homologous mRNA which remained generally unchanged.
  • plasma also includes a minor, but significant AChE activity [Zakut, H. et al. (1998) Cancer 61, 727-737], measurable following pre-incubation in the presence of 5 ⁇ 10 ⁇ 5 M of the BuChE-specific inhibitor, iso-OMPA.
  • AChE activity increased, as compared with the values before treatment (pre-dose), within the 5 hr following the stressful oral gavage administration of 150 ⁇ g/kg EN101 (Table 1), potentially reflecting increased production under handling.
  • Total ChE activity 0 100 ⁇ 1 100 ⁇ 2 100 ⁇ 1 (% of pre-treatment 2 ) 3 92 ⁇ 9 105 ⁇ 1 89 ⁇ 2 6 102 ⁇ 3 96 ⁇ 2 94 ⁇ 1 12 98 ⁇ 2 96 ⁇ 1 93 ⁇ 1
  • AChE activity 0 100 ⁇ 4 100 ⁇ 6 100 ⁇ 4 (% of pre-treatment 3 ) 3 117 ⁇ 2 114 ⁇ 6 105 ⁇ 4 6 135 ⁇ 1 100 ⁇ 5 89 ⁇ 5 12 123 ⁇ 3 112 ⁇ 4 94 ⁇ 3 1 Percent changes in the ATCh hydrolysis rates in plasma samples from monkeys treated twice on 2 consecutive days with the noted amounts and administration routes of hEN101.
  • hydrolysis rates reflect activity of the abundant cholinesterase in plasma, BChE.
  • AChE specific activity measured in the presence of 5 ⁇ 10 ⁇ 5 M of the specific BChE inhibitor, iso-OMPA. Values represent average ⁇ SEM from six measurements in plasma samples derived from 2 monkeys. Mean AChE and BChE absolute activity.
  • FIG. 2A Paraffin-embedded sections of lumbar spinal cord from Cynomolgus monkeys treated for 7 days once daily with hEN101 were subjected to high resolution fluorescent in situ hybridization (FISH).
  • FISH fluorescent in situ hybridization
  • FIG. 2B-2C Variant-specific FISH probes revealed AChE-S more than AChE-R mRNA labeling in numerous punctuate areas and longitudinal threads, possibly cross-sections and longitudinal sections through neuronal processes.
  • FIG. 2B-2C This difference, albeit statistically non-significant was compatible with previous observations demonstrating AChE-S, but not AChE-R mRNA in murine neuronal processes under normal conditions [Meshorer (2002) id ibid.].
  • FIGS. 2G and 2I as compared with the lower dose, FIG. 2E .
  • AChE-S mRNA-labeled neurons displayed limited EN101-induced suppression ( FIG. 2H, 2J as compared to 2 D), with reduced process labeling ( FIGS. 2F, 2H and 2 J).
  • Positron Emission Tomography (PET) imaging studies in Rhesus monkeys demonstrated for 2′-O-methylated oligonucleotides limited, yet relatively efficient penetrance to the brain as compared with phosphorothioate agents [Tavitian et al. (1998) id ibid.].
  • medium-sized neurons (20-40 ⁇ m, about 60%, dispersed throughout the spinal cord, mainly in the ventral horn and intermediate zone
  • small neurons 10-20 ⁇ m, 5-20%, located primarily in the dorsal horn).
  • Endotoxin administration produced a time-dependent decrease in plasma AChE activity, measured by quantifying the rate of ATCh hydrolysis in the presence of the butyrylcholinesterase (BChE) inhibitor iso-OMPA.
  • BChE butyrylcholinesterase
  • Saline administration caused no change in AChE activity, excluding the possibilities that it was induced by the injection stress or by circadian influences. The decline in hydrolytic activity could potentially reflect losses in the AChE protein.
  • AChE-R cleavage product larger plasma samples (180 ⁇ g/lane) were resolved by electrophoresis. Protein bands that co-migrated with the bands labeled with anti AChE-R antibodies were cut out of the gel and subjected to MALDI-TOF-MS analyses. The elution product of the larger band was identified as being mainly composed of serum albumin (molecular weight, 69367), compatible with the assumption that AChE-R is only a minor component in this size fraction of human serum proteins. The shorter peptide eluted from the excised band, however, revealed a single peak with a molecular mass of 3613-3615. FIG.
  • FIG. 7A, 7B Quantification of signal intensities revealed considerable similarities between AChE-R mRNA and AChE-R protein levels in patients with or without inflammatory vasculitis, so that tissues with less pronounced mRNA labeling also displayed fainter protein labeling ( FIG. 7C ).
  • vascular endothelial cells which also harbor non-neuronal nicotinic acetylcholine receptors [Heeschen et al., (2002) J. Clin. Invest. 110:527-36] as a probable site of continuous plasma AChE-R production.
  • F(2,16) 41.2, 10.6, 10.5, 3.2, respectively, all p ⁇ 0.05, by H-F].
  • Fever is one of the consequences of higher levels of circulating pro-inflammatory cytokines.
  • human synaptic AChE hAChE-S
  • murine AChE-R a transgenic FVB/N hAChE-S and mAChE-R overexpressing females, 3-5 months old, had their temperature measured between 5 and 55 minutes after anesthesia, which was administered in order to induce a change in body temperature. As shown in the graph ( FIG.
  • LPS induced a significant increase in the hippocampal and serum IL-1 ⁇ , which was significantly attenuated in tacrine-treated mice.
  • tacrine produced a small and non-significant attenuation of LPS-induced TNF- ⁇ secretion in the serum.
  • Two types of stressful situations were investigated in the same subjects: Psychological stress—while waiting for a surgery (i.e., in the morning of the surgery day), and surgical stress—in the day after surgery.
  • EN301 corresponds to mEN101, defined herein as SEQ ID NO:2. This antisense oligonucleotide is targeted to a sequence within exon 2 of mouse AChE exon 2 sequence.
  • EN301 was produced by Microsynth, Switzerland, at relatively large quantities for animal tests. The treatment persisted for 3 consecutive days, and the mice were sacrificed on day 4. Brain was collected, flash frozen in liquid nitrogen and stored at ⁇ 70° C.
  • the goal of the present experiment was to test for reduction in AChE gene expression under EN301 treatment, while ensuring that AChE-S mRNA levels are maintained reflecting sustained cholinergic neurotransmission.
  • the ratio between AChE-S:common (S/Com) transcripts showed that in the EN301-treated brain, the S/Com ratio is significantly increased (from 0.65 to 0.98).
  • RT-PCR data cannot be used as such for comparing the absolute quantities of the analyzed transcripts, because different primer pairs may function with different efficacies.
  • these two tests point at the same direction (namely, that AChE-R but not AChE-S mRNA was reduced in the EN301-treated brains and that the relative concentration of AChE-S mRNA increased, albeit insignificantly, under treatment) supports the notion that this agent affects brain gene expression as well.
  • EN301 treatment causes selective destruction of AChE-R mRNA in the EN301 treated brains while maintaining essentially unmodified AChE-S levels.
  • EN301 does not necessarily have to cross the blood-brain barrier. Rather, by reducing the levels of peripheral AChE it would increase acetylcholine levels, suppressing the production by macrophages of pro-inflammatory cytokines e.g. IL-1 [Wang, H. et al. (2003) Nature 421, 384-8]. Because IL-1 promotes AChE gene expression [Li et al. (2000) J. Neurosci.
  • Intra-neural injection into a rat peripheral nerve is often used to study Guillain-Barré Syndrome GBS, testing the pathogenesis of the disease following nerve sheath impairment, i.e., examining the effect of intra-neural invasion of reactive soluble factors, and not the nerve sheath disruption per se.
  • serum obtained from GBS patients was reported to cause demyelination and conduction blocks [Harrison B. et al., (1984) Ann. Neurol. 15: 163-170; Saida T. et al. (1982) Ann. Neurol. 11: 69-75], which are not elicited by intra-neural injection of anti-GM1 IgG or IgM [Harvey G. et al. (1995) Muscle Nerve 18: 388-394].
  • KLH keyhole limpet hemocyanin
  • CMAP Compound muscle action potential
  • Conduction blocks did not develop in rats which were systemically exposed to Cj-LPS without an intraneural injection, and neither in rats which were injected intraneurally directly with the Cj-LPS itself Conduction blocks developed in 3 out of 10 intraneurally injected rats which were not exposed to Cj-LPS and in none of the animals which were intraneurally injected 8 days after Cj-LPS exposure. The differences between the test and control groups were statistically significant (P ⁇ 0.01). Morphological analysis of the injected nerves revealed no morphological abnormalities (i.e. demyelination, axonal degeneration or inflammatory changes) on days 3 and 9 following i.n. injection, in either group. The fact that direct Cj-LPS i.n.
  • splenocytes from KLH pre-sensitized rats were exposed to Cj-LPS in a cell suspension for 48 hours.
  • the medium of splenocytes which reacted with LPS in vitro was then injected intraneurally to the sciatic nerve of rats.
  • This reactive medium was cell-free and devoid of IgG or IgM, and did not elicit any electrophysiological effect within 10 minutes following injection, indicating that it did not contain neuroinhibitory or toxic substances reminiscent of curare or tetrodotoxine which typically block ion channels within minutes. Nevertheless, one to 4 days following i.n.
  • CMAP stimulated proximal to the injection site was reduced in more than 70% of nerves, indicating a conduction block.
  • Normal splenocyte medium (not reacted with LPS) induced a conduction block in only 6.2% of nerves which was significantly different (p ⁇ 0.01).
  • Conduction block duration was 1.44 ⁇ 1.02 days with resolution in 70% of the nerves.
  • morphological analysis demonstrated no demyelination, axonal degeneration or inflammatory abnormalities, indicating that the electrophysiological pathology was not due to gross neural deformity, or myelin sheath and axonal degeneration.
  • the inventors tested the participation of AChE-R in the sequence of events that follow exposure to LPS and lead to conduction abnormalities in the GBS model described above. Indeed, systemic (i.p.) treatment with EN101 (0.5 mg/kg) prevented formation of conduction blocks when applied with Cj-LPS parallel to i.n. saline injection. Treatment with EN101 significantly improved PDR (proximal to distal amplitude ratio, p ⁇ 0.01), which became similar to non-i.n. injected controls (p 0.45; FIG. 19A ). Furthermore, addition of EN101 (20 pmole) to i.n.
  • AChE-R plays a key role in induction of functional nerve conduction blocks following immune activation by LPS exposure or i.n. invasion of macrophages, as evidenced in GBS, and strongly suggest that ARP is the active modulator in these processes. Nevertheless, AChE-R induction is not restricted to reaction to the Campylobacter type of LPS. Furthermore, the formation of nerve conduction block by direct i.n. injection of ARP indicates that AChE-R and ARP may affect nerve conduction in response to various inflammatory responses, where nerve sheath/blood nerve barrier is injured or disrupted, as exemplified in GBS. Hence, EN101 treatment to treat nerve conduction pathology is applicable for conditions that similarly induce AChE-R when concurrent nerve sheath disruption is present.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Rheumatology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Pain & Pain Management (AREA)
  • Biochemistry (AREA)
  • Cardiology (AREA)
  • Oncology (AREA)
  • Psychiatry (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Communicable Diseases (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US11/187,719 2003-10-26 2005-07-21 AChE antisense oligonucleotide as an anti-inflammatory agent Abandoned US20060069051A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US11/788,321 US20090005331A1 (en) 2003-10-26 2007-04-18 AChE antisense oligonucleotide as an anti-inflammatory agent
US13/351,171 US20130018081A1 (en) 2003-10-26 2012-01-16 AChE ANTISENSE OLIGONUCLEOTIDE AS AN ANTI-INFLAMMATORY AGENT
US13/899,922 US8722876B2 (en) 2003-10-26 2013-05-22 Antisense oligonucleotides against AChE in the treatment of gastrointestinal inflammation disorders

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
IL158600A IL158600A (en) 2003-10-26 2003-10-26 Dioxysoligonucleotide Antisense Against Acetylcholinesterase as an Anti-Inflammatory Agent
IL158600 2003-10-26
PCT/IL2004/000978 WO2005039480A2 (en) 2003-10-26 2004-10-26 AChE ANTISENSE DEOXYOLIGONUCLEOTIDE AS AN ANTI-INFLAMMATORY AGENT

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2004/000978 Continuation-In-Part WO2005039480A2 (en) 2003-10-26 2004-10-26 AChE ANTISENSE DEOXYOLIGONUCLEOTIDE AS AN ANTI-INFLAMMATORY AGENT

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/788,321 Continuation US20090005331A1 (en) 2003-10-26 2007-04-18 AChE antisense oligonucleotide as an anti-inflammatory agent

Publications (1)

Publication Number Publication Date
US20060069051A1 true US20060069051A1 (en) 2006-03-30

Family

ID=34044237

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/187,719 Abandoned US20060069051A1 (en) 2003-10-26 2005-07-21 AChE antisense oligonucleotide as an anti-inflammatory agent
US11/788,321 Abandoned US20090005331A1 (en) 2003-10-26 2007-04-18 AChE antisense oligonucleotide as an anti-inflammatory agent
US13/899,922 Expired - Fee Related US8722876B2 (en) 2003-10-26 2013-05-22 Antisense oligonucleotides against AChE in the treatment of gastrointestinal inflammation disorders

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/788,321 Abandoned US20090005331A1 (en) 2003-10-26 2007-04-18 AChE antisense oligonucleotide as an anti-inflammatory agent
US13/899,922 Expired - Fee Related US8722876B2 (en) 2003-10-26 2013-05-22 Antisense oligonucleotides against AChE in the treatment of gastrointestinal inflammation disorders

Country Status (6)

Country Link
US (3) US20060069051A1 (enExample)
EP (2) EP1682072A4 (enExample)
JP (1) JP4753088B2 (enExample)
CA (1) CA2543305A1 (enExample)
IL (1) IL158600A (enExample)
WO (1) WO2005039480A2 (enExample)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090275634A1 (en) * 2006-04-10 2009-11-05 Amarin Corporation Plc Antisense oligonucleotides against acetylcholinesterase for treating inflammatory diseases
US20110136897A1 (en) * 2008-08-14 2011-06-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Toll-like receptor 9 agonists for the treatment of anxiety-related disorders and inflammatory disorders
US9056088B2 (en) 2009-04-29 2015-06-16 Amarin Pharmaceuticals Ireland Limited Pharmaceutical compositions comprising fatty acids
US9060982B2 (en) 2009-04-29 2015-06-23 Amarin Pharmaceuticals Ireland Limited Stable pharmaceutical composition and methods of using same
US9283201B2 (en) 2013-03-14 2016-03-15 Amarin Pharmaceuticals Ireland Limited Compositions and methods for treating or preventing obesity in a subject in need thereof
US9814733B2 (en) 2012-12-31 2017-11-14 A,arin Pharmaceuticals Ireland Limited Compositions comprising EPA and obeticholic acid and methods of use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220102008A1 (en) * 2020-09-30 2022-03-31 Genentech, Inc. Methods and systems for placebo response modeling

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891725A (en) * 1992-04-15 1999-04-06 Yissum Research Development Co. Of The Hebrew Univ. Of Jerusalem Synthetic antisense oligodeoxynucleotides and pharmaceutical compositions containing them
US20030216344A1 (en) * 2001-05-24 2003-11-20 Hermona Soreq Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6495579B1 (en) * 1996-12-02 2002-12-17 Angiotech Pharmaceuticals, Inc. Method for treating multiple sclerosis
AU727611B2 (en) * 1996-12-12 2000-12-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Synthetic antisense oligodeoxynucleotides and pharmaceutical compositions containing them
AU8742198A (en) * 1997-08-15 1999-03-08 Shire International Licensing B.V. Use of cholinesterase inhibitor for treating diseases associated with pro teolytic enzyme activity
EP2007399A2 (en) * 2006-04-10 2008-12-31 Ester Neurosciences Ltd. Antisense oligonucleotides against acetylcholinesterase for treating inflammatory diseases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891725A (en) * 1992-04-15 1999-04-06 Yissum Research Development Co. Of The Hebrew Univ. Of Jerusalem Synthetic antisense oligodeoxynucleotides and pharmaceutical compositions containing them
US20030216344A1 (en) * 2001-05-24 2003-11-20 Hermona Soreq Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof
US7074915B2 (en) * 2001-05-24 2006-07-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090275634A1 (en) * 2006-04-10 2009-11-05 Amarin Corporation Plc Antisense oligonucleotides against acetylcholinesterase for treating inflammatory diseases
US20120196920A1 (en) * 2006-04-10 2012-08-02 Amarin Pharma, Inc. Antisense oligonucleotides against acetylcholinesterase for treating inflammatory diseases
US20110136897A1 (en) * 2008-08-14 2011-06-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Toll-like receptor 9 agonists for the treatment of anxiety-related disorders and inflammatory disorders
US9056088B2 (en) 2009-04-29 2015-06-16 Amarin Pharmaceuticals Ireland Limited Pharmaceutical compositions comprising fatty acids
US9060982B2 (en) 2009-04-29 2015-06-23 Amarin Pharmaceuticals Ireland Limited Stable pharmaceutical composition and methods of using same
US9060983B2 (en) 2009-04-29 2015-06-23 Amarin Pharmaceuticals Ireland Limited Stable pharmaceutical composition and methods of using same
US9072715B2 (en) 2009-04-29 2015-07-07 Amarin Pharmaceuticals Ireland Limited Stable pharmaceutical composition and methods of using same
US11033523B2 (en) 2009-04-29 2021-06-15 Amarin Pharmaceuticals Ireland Limited Pharmaceutical compositions comprising EPA and a cardiovascular agent and methods of using the same
US9814733B2 (en) 2012-12-31 2017-11-14 A,arin Pharmaceuticals Ireland Limited Compositions comprising EPA and obeticholic acid and methods of use thereof
US9283201B2 (en) 2013-03-14 2016-03-15 Amarin Pharmaceuticals Ireland Limited Compositions and methods for treating or preventing obesity in a subject in need thereof

Also Published As

Publication number Publication date
IL158600A0 (en) 2004-05-12
WO2005039480A3 (en) 2006-08-03
WO2005039480A8 (en) 2006-06-15
EP1682072A4 (en) 2010-10-13
CA2543305A1 (en) 2005-05-06
IL158600A (en) 2015-07-30
US20130310441A1 (en) 2013-11-21
JP2007509186A (ja) 2007-04-12
EP1682072A2 (en) 2006-07-26
US20090005331A1 (en) 2009-01-01
US8722876B2 (en) 2014-05-13
JP4753088B2 (ja) 2011-08-17
WO2005039480A2 (en) 2005-05-06
EP2599489A1 (en) 2013-06-05

Similar Documents

Publication Publication Date Title
US8722876B2 (en) Antisense oligonucleotides against AChE in the treatment of gastrointestinal inflammation disorders
Fattori et al. The specialised pro‐resolving lipid mediator maresin 1 reduces inflammatory pain with a long‐lasting analgesic effect
Franceschi et al. The continuum of aging and age-related diseases: common mechanisms but different rates
Henry et al. Inhibition of miR-155 limits neuroinflammation and improves functional recovery after experimental traumatic brain injury in mice
Mietto et al. Neurotrauma and inflammation: CNS and PNS responses
KR102021688B1 (ko) 아포지방단백질 ｃｉｉｉ （ａｐｏｃｉｉｉ） 발현의 조정
JP4316373B2 (ja) ヒトのアセチルコリンエステラーゼ（ａｃｈｅ）に対するアンチセンスオリゴヌクレオチド及びその使用
De Sarno et al. Lithium prevents and ameliorates experimental autoimmune encephalomyelitis
Liu et al. Neuroprotection and its molecular mechanism following spinal cord injury☆
Cohen et al. Endotoxin-induced changes in human working and declarative memory associate with cleavage of plasma “readthrough” acetylcholinesterase
RU2661781C2 (ru) Модулирование экспрессии аполипопротеина с-iii (аросiii) у людей с дефицитом липопротеинлипазы (lpld)
Xu et al. Subicular Caspase‐1 Contributes to Pharmacoresistance in Temporal Lobe Epilepsy
Mietto et al. Lack of galectin‐3 speeds W allerian degeneration by altering TLR and pro‐inflammatory cytokine expressions in injured sciatic nerve
Lu et al. miR-204 ameliorates osteoarthritis pain by inhibiting SP1-LRP1 signaling and blocking neuro-cartilage interaction
Tuxworth et al. Attenuating the DNA damage response to double-strand breaks restores function in models of CNS neurodegeneration
Hoshino et al. Histone deacetylase activity is retained in primary neurons expressing mutant huntingtin protein
Kharouf et al. The hyperpolarization‐activated cyclic nucleotide‐gated 4 channel as a potential anti‐seizure drug target
WO2020214993A1 (en) 25-hydroxycholesterol (25hc), cryab aggregation inhibitor, is a novel senolytic
Xie et al. Astrocyte‐derived exosomes contribute to pathologies of neuromyelitis optica spectrum disorder in rodent model
Butler-Ryan et al. The functions of repressor element 1-silencing transcription factor in models of epileptogenesis and post-ischemia
Chan et al. Methylprednisolone induces reversible clinical and pathological remission and loss of lymphocyte reactivity to myelin oligodendrocyte glycoprotein in experimental autoimmune encephalomyelitis
CN108853505A (zh) 钾离子通道抑制剂治疗抑郁症的用途和药物组合物
US20130018081A1 (en) AChE ANTISENSE OLIGONUCLEOTIDE AS AN ANTI-INFLAMMATORY AGENT
JP4427639B2 (ja) 合成アンチセンスオリゴデオキシヌクレオチド類およびそれらを含む医薬組成物
EP3038617A1 (en) Method for treating amyotrophic lateral sclerosis by inhibition of cxcr4/cxcl12 signaling

Legal Events

Date Code Title Description
AS Assignment

Owner name: BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DORI, AMIR;WIRGUIN, ITZHAK;IFERGANE, GAL;REEL/FRAME:019278/0749;SIGNING DATES FROM 20051101 TO 20051102

Owner name: MOR RESEARCH APPLICATIONS LTD., ISRAEL

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DORI, AMIR;WIRGUIN, ITZHAK;IFERGANE, GAL;REEL/FRAME:019278/0749;SIGNING DATES FROM 20051101 TO 20051102

AS Assignment

Owner name: MOR RESEARCH APPLICATIONS LTD., ISRAEL

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DORI, AMIR;WIRGUIN, ITZHAK;IFERGANE, GAL;REEL/FRAME:018871/0849;SIGNING DATES FROM 20051101 TO 20051102

Owner name: BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DORI, AMIR;WIRGUIN, ITZHAK;IFERGANE, GAL;REEL/FRAME:018871/0849;SIGNING DATES FROM 20051101 TO 20051102

Owner name: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HERBREW

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SOREQ, HERMONA;YIRMIYA, RAZ;REEL/FRAME:018872/0048;SIGNING DATES FROM 20060511 TO 20061207

AS Assignment

Owner name: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SOREQ, HERMONA;YIRMIYA, RAZ;REEL/FRAME:019272/0094;SIGNING DATES FROM 20060511 TO 20061207

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION