US20050244869A1 - Modulation of transthyretin expression - Google Patents

Modulation of transthyretin expression Download PDF

Info

Publication number
US20050244869A1
US20050244869A1 US11/097,928 US9792805A US2005244869A1 US 20050244869 A1 US20050244869 A1 US 20050244869A1 US 9792805 A US9792805 A US 9792805A US 2005244869 A1 US2005244869 A1 US 2005244869A1
Authority
US
United States
Prior art keywords
oligonucleotide
transthyretin
rna
antisense compound
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/097,928
Inventor
Vickie Brown-Driver
Ravi Jain
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US55986304P priority Critical
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to US11/097,928 priority patent/US20050244869A1/en
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: JAIN, RAVI, BROWN-DRIVER, VICKIE L.
Publication of US20050244869A1 publication Critical patent/US20050244869A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/14Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
    • Y10T436/142222Hetero-O [e.g., ascorbic acid, etc.]
    • Y10T436/143333Saccharide [e.g., DNA, etc.]

Abstract

Compounds, compositions and methods are provided for modulating the expression of transthyretin. The compositions comprise oligonucleotides, targeted to nucleic acid encoding transthyretin. Methods of using these compounds for modulation of transthyretin expression and for diagnosis and treatment of diseases and conditions associated with expression of transthyretin are provided.

Description

    RELATED APPLICATIONS
  • This application claims the benefit of priority to U.S. provisional patent application Ser. No. 60/559,863, filed Apr. 5, 2004, which is incorporated herein by reference in its entirety.
  • INCORPORATION OF SEQUENCE LISTING
  • A computer-readable form of the sequence listing, on diskette, containing the file named RTS-0531US_Sequence_Listing.txt, which is 35,328 bytes (measured in MS-DOS) and was created on Mar. 31, 2005, is herein incorporated by reference.
  • FIELD OF THE INVENTION
  • The present invention provides compositions and methods for modulating the expression of transthyretin. In particular, this invention relates to antisense compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding transthyretin. Such compounds are shown herein to modulate the expression of transthyretin.
  • BACKGROUND OF THE INVENTION
  • Steroid hormones, thyroid hormones, retinoids, and vitamin D are small hydrophobic molecules that serve as important signaling molecules throughout the body. Although all of these molecules are insoluble in water, they are made soluble for transport in the bloodstream and other extracellular fluids by binding to specific carrier proteins, from which they dissociate before entering a target cell. One such carrier protein is transthyretin.
  • Transthyretin (also known as TTR; TTR, prealbumin; prealbumin, thyroxine; PALB; TBPA; HST2651; amyloidosis 1, included; dysprealbuminemic euthyroidal hyperthyroxinemia, included; hyperthytoxinemia, dysprealbuminemic, included; hyperthytoxinemia, dystransthyretinemic, included; amyloid polyneuropathy, multiple forms, included; senile systemic amyloidosis, included) is a homotetrameric transport protein found in the extracellular fluids of vertebrates (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300).
  • Transthyretin was first identified as the major thyroid hormone carrier in the cerebrospinal fluid (CSF) and in the serum (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300; Seibert, J. Biol. Chem, 1942, 143, 29-38). Transthyretin was cloned from adult human cDNA libraries and the gene was subsequently mapped to chromosome region 18q11.2-q12.1 (Mita et al., Biochem Biophys Res Commun, 1984, 124, 558-564; Sparkes et al., Hum Genet, 1987, 75, 151-154; Whitehead et al., Mol Biol Med, 1984, 2, 411-423).
  • The liver and the choroid plexus are the primary sites of transthyretin synthesis in humans (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300).
  • Transthyretin that is synthesized in the liver is secreted into the blood, whereas transthyretin originating in the choroid plexus is destined for the CSF. In the choroid plexus, transthyretin synthesis represents about 20% of total local protein synthesis and as much as 25% of the total CSF protein (Dickson et al., J Biol Chem, 1986, 261, 3475-3478). Transthyretin synthesis has also been identified in the yolk sac of developing rats (Soprano et al., Proc Natl Acad Sci USA, 1986, 83, 7330-7334); the retina, ciliar body and optic nerve regions of bovine and rat eyes (Martone et al., Biochem Biophys Res Commun, 1988, 151, 905-912; Ong et al., Biochemistry, 1994, 33, 1835-1842); human and porcine pancreatic islets (Jacobsson et al., J Histochem Cytochem, 1989, 37, 31-37) and, in minor amounts, in the stomach, heart, skeletal muscle, and spleen of rats (Soprano et al., J Biol Chem, 1985, 260, 11793-11798).
  • It is currently believed that transthyretin serves as a hormone reservoir. As demand for thyroid hormone increases, transthyretin increases the transport and release of hormone to targets such as brain, kidney, and cardiac tissues, thereby ensuring a uniform hormone distribution within the cells in each of these tissues (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300). Transthyretin transports the thyroid hormones triiodothyronine (T3) and thyroxine (T4) as well as the retinol/retinol-binding protein complex. A mouse strain deficient in transthyretin is viable and fertile, yet exhibits significantly depressed levels of serum retinol, retinol-binding protein, and thyroid hormone, confirming transthyretin's role in maintaining normal levels of these metabolites in circulating plasma (Episkopou et al., Proc Natl Acad Sci USA, 1993, 90, 2375-2379). In addition to serving as a transport protein, transthyretin has been reported to have a variety of other functions, including: inhibiting interleukin-1 production in monocytes and endothelial cells (Borish et al., Inflammation, 1992, 16, 471-484); involvement in the metabolism of the environmental pollutant polyhalogenated biphenyl(Brouwer and van den Berg, Toxicol Appl Pharmacol, 1986, 85, 301-312); and binding pterins (Emstrom et al., FEBS Lett, 1995, 360, 177-182). Furthermore, in recent years a link between transthyretin and lipoprotein biology has become increasingly apparent. A fraction of plasma transthyretin circulates in high density lipoproteins (HDL) through binding to apolipoprotein A-1 (Sousa et al., J Biol Chem, 2000, 275, 38176-38181), and transthyretin has been shown to proteolytically process apolipoprotein A-1 (Liz et al., J Biol Chem, 2004). Furthermore, transthyretin reabsorption by the kidneys is mediated by the lipoprotein receptor megalin (Sousa et al., J Biol Chem, 2000, 275, 38176-38181). This reabsorption serves as a means for preventing hormone loss in urine. Finally, the major site of degradation for both transthyretin and lipoproteins is the liver. There is considerable evidence that hepatic uptake of both transthyretin and lipoproteins is mediated by an as yet unidentified lipoprotein receptor, suggesting a shared degradation pathway (Sousa and Saraiva, J Biol Chem, 2001, 276, 14420-14425).
  • Transthyretin is associated with both local and systemic amyloidosis, a disorder characterized by extracellular systemic deposition of mutated or wild-type transthyretin as amyloid fibrils (Cornwell et al., Biochem Biophys Res Commun, 1988, 154, 648-653; Saraiva et al., J Clin Invest, 1984, 74, 104-119; Yazaki et al., Muscle Nerve, 2003, 28, 438-442), leading to organ dysfunction and death. Senile systemic amyloidosis is a sporadic disorder resulting from the extracellular deposition of wild-type transthyretin fibrils in cardiac and other tissues. Over 80 mutations in transthyretin are associated with familial amyloidotic polyneuropathy and cardiomyopathy. In most of these cases, inheritance is autosomal dominant (Reixach et al., Proc Natl Acad Sci USA, 2004, 101, 2817-2822). Jiang et al (Jiang et al., Proc Natl Acad Sci USA, 2001, 98, 14943-14948) demonstrated that the variant with a valine to isoleucine mutation at amino acid 122 (Val122Ile), which is among the most common amyloidogenic mutations worldwide, increases the velocity of rate-limiting tetramer dissociation, thereby resulting in accelerated amyloidogenesis. This finding suggests the possibility that treatments for transthyretin-related amyloidoses may include small molecules that stabilize the tetrameric form (Adamski-Wemer et al., J Med Chem, 2004, 47, 355-374; Altland and Winter, Neurogenetics, 1999, 2, 183-188). Small molecule stabilizers were also shown to be of use in preventing the formation of amyloid fibrils of the wildtype transthyretin (Reixach et al., Proc Natl Acad Sci USA, 2004, 101, 2817-2822). Other common transthyretin mutations associated with amyloidosis include Val30Met and Glu61 Lys. In vitro studies have shown success using ribozymes to specifically target and inhibit the expression of the Glu61Lys and Val30Met variants (Propsting et al., Biochem Biophys Res Commun, 1999, 260, 313-317; Tanaka et al., J Neurol Sci, 2001, 183, 79-84). Single-stranded oligonucleotides have been used both in vitro and in vivo to correct single-base mutation (Val30Met) in transthyretin to the wild-type form through targeted recombination (Nakamura et al., Gene Ther, 2004). The success of this therapy was limited, however, with gene conversion rates of 11% in vitro and 9% in vivo. These levels are not sufficient for suppression of the variant transthyretin in clinical terms (Nakamura et al., Gene Ther, 2004).
  • Thus liver transplantation is currently the only available therapy for familial amyloidotic polyneuropathy. However, this therapy is associated with several problems, and does not address conditions which are caused by transthyretin variant production in tissues other than liver (Yazaki et al., Muscle Nerve, 2003, 28, 438-442). Consequently, there remains an unmet need for agents capable of effectively modulating transthyretin expression (Nakamura et al., Gene Ther, 2004,; Tanaka et al., J Neurol Sci, 2001, 183, 79-84).
  • The PCT publication WO200259621 and the US pre-grant publication 20020160394 claim pharmaceutical compositions for treating obesity, comprising an antisense oligonucleotide that hybridizes to a polynucleotide encoding transthyretin and reduces expression of the polynucleotide. Also claimed is the use of said oligonucleotide in the manufacture of a medicament for treating obesity (Wu, 2002).
  • The U.S. Pat. No. 5,744,368 discloses a primer of 22 nucleotides in length targeted to Exon 4 of transthyretin (Goldgaber et al., 1998).
  • Antisense technology is an effective means of reducing the expression of specific gene products and therefore is uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of transthyretin expression. The present invention provides compositions and methods for modulating transthyretin expression.
  • SUMMARY OF THE INVENTION
  • The present invention is directed to antisense compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding transthyretin, and which modulate the expression of transthyretin. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of transthyretin and methods of modulating the expression of transthyretin in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of transthyretin are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
  • DETAILED DESCRIPTION OF THE INVENTION
  • A. Overview of the Invention
  • The present invention employs antisense compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding transthyretin. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding transthyretin. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding transthyretin” have been used for convenience to encompass DNA encoding transthyretin, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of transthyretin. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 90% sequence complementarity and even more preferably comprise at least 95% or at least 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some preferred embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. In some preferred embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
  • B. Compounds of the Invention
  • According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
  • One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
  • While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
  • The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620).
  • Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697).
  • The antisense compounds of the present invention also include modified compounds in which a different base is present at one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, modified compounds may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit expression of transthyretin mRNA.
  • In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • While oligonucleotides are a preferred form of the antisense compounds of this invention, the present invention comprehends other families of antisense compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
  • The antisense compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
  • In one preferred embodiment, the antisense compounds of the invention are 13 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 13 to 50 nucleobases in length, inclusive as detailed above.
  • In another preferred embodiment, the antisense compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15 to 30 nucleobases in length, inclusive as detailed above.
  • Particularly preferred compounds are oligonucleotides from about 13 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
  • Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.
  • Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). It is also understood that preferred antisense compounds may be represented by oligonucleotide sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred antisense compound, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases.
  • One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
  • C. Targets of the Invention
  • “Targeting” an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes transthyretin.
  • The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term “region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
  • Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding transthyretin, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. Consequently, the “start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
  • The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • Other target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA (or corresponding nucleotides on the gene). The 5′ cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5′ cap region.
  • Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
  • It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
  • Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA. One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also preferred target nucleic acids.
  • The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as “preferred target segments.” As used herein the term “preferred target segment” is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
  • While the specific sequences of certain preferred target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional preferred target segments may be identified by one having ordinary skill.
  • Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
  • Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). It is also understood that preferred antisense target segments may be represented by DNA or RNA sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred target segment, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases. One having skill in the art armed with the preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
  • Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • The oligomeric antisense compounds may also be targeted to regions of the target nucleobase sequence (e.g., such as those disclosed in Example 13) comprising nucleobases 1-80, 81-160, 161-240, 241-320, 321400, 401-480, 481-560, 561-640, 641-650, or any combination thereof.
  • Oligomeric compounds targeted to nucleobases 3880-3899 of SEQ ID NO: 11, or to nucleobases 6-25, 59-78, 91-119, 126-152, 170-189, 197-216, 217-236, 232-251, 250-269, 264-297, 323-361, 425-469, 460-532, 532-619 of SEQ ID NO: 4 are also suitable embodiments.
  • D. Screening and Target Validation
  • In a further embodiment, the “preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of transthyretin. “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding transthyretin and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding transthyretin with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding transthyretin. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding transthyretin, the modulator may then be employed in further investigative studies of the function of transthyretin, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
  • Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694-697).
  • The antisense compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between transthyretin and a disease state, phenotype, or condition. These methods include detecting or modulating transthyretin comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of transthyretin and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.
  • E. Kits, Research Reagents, Diagnostics, and Therapeutics
  • The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
  • For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
  • Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).
  • The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding transthyretin. For example, oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective transthyretin inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding transthyretin and in the amplification of said nucleic acid molecules for detection or for use in further studies of transthyretin. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding transthyretin can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of transthyretin in a sample may also be prepared.
  • The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of transthyretin is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a transthyretin inhibitor. The transthyretin inhibitors of the present invention effectively inhibit the activity of the transthyretin protein or inhibit the expression of the transthyretin protein. In one embodiment, the activity or expression of transthyretin in an animal is inhibited by about 10%. Preferably, the activity or expression of transthyretin in an animal is inhibited by about 30%. More preferably, the activity or expression of transthyretin in an animal is inhibited by 50% or more. Thus, the oligomeric antisense compounds modulate expression of transthyretin mRNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • For example, the reduction of the expression of transthyretin may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding transthyretin protein and/or the transthyretin protein itself.
  • The antisense compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
  • F. Modifications
  • As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base sometimes referred to as a “nucleobase” or simply a “base”. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • Modified Internucleoside Linkages (Backbones)
  • Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriaminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • Modified Sugar and Internucleoside Linkages—Mimetics
  • In other preferred antisense compounds, e.g., oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene (methylimino) or MMI backbone], —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH2—] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
  • Modified Sugars
  • Modified antisense compounds may also contain one or more substituted sugar moieties. Preferred are antisense compounds, preferably antisense oligonucleotides, comprising one of the following at the 2′ position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy(2′-O—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O—CH2—O—CH2—N(CH3)2, also described in examples hereinbelow.
  • Other preferred modifications include 2′-methoxy(2′-O—CH3), 2′-aminopropoxy(2′-OCH2CH2CH2NH2), 2′-allyl(2′-CH2—CH═CH2), 2′-O-allyl(2′-O—CH2—CH═CH2) and 2′-fluoro (2′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Antisense compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • A further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH2—)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • Natural and Modified Nucleobases
  • Antisense compounds may also include nucleobase (often referred to in the art as heterocyclic base or simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl(—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2 (3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2 (3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2 (3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
  • Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.
  • Conjugates
  • Another modification of the antisense compounds of the invention involves chemically linking to the antisense compound one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosure of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Antisense compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
  • Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
  • Chimeric Compounds
  • It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
  • The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. Chimeric antisense oligonucleotides are thus a form of antisense compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • G. Formulations
  • The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
  • The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Sodium salts have been shown to be suitable forms of oligonucleotide drugs.
  • The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
  • The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
  • Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • The pharmaceutical formulations and compositions of the present invention may also include surfactants. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
  • Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
  • Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. application Ser. No. 09/108,673 (filed Jul. 1, 1998), Ser. No. 09/315,298 (filed May 20, 1999) and Ser. No. 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.
  • Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • H. Dosing
  • The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or at desired intervals. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily.
  • While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • EXAMPLES Example 1 Synthesis of Nucleoside Phosphoramidites
  • Synthesis of nucleoside phorsphoramidates, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743, both of which are incorporated herein by reference.
  • Example 2 Oligonucleotide and Oligonucleoside Synthesis
  • The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • Oligonucleotides: Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
  • Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.
  • Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863. 3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050. Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878. Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively). 3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925. Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243. Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198. Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289. Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564. Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618. All patents and applications are incorporated herein by reference.
  • Example 3 RNA Synthesis
  • In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand., 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedron Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331).
  • RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid, or for diagnostic or therapeutic purposes.
  • Example 4 Synthesis of Chimeric Compounds
  • Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
  • [2′-O-Me]-[2′-deoxy]-[2′-O-Me]Chimeric Phosphorothioate Oligonucleotides
  • Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-3′-O-phosphoramidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • [2′-O-(2-Methoxyethyl)]-[2′-deoxy]-[2′-O-(methoxyethyl)]Chimeric Phosphorothioate Oligonucleotides—[2′-O-(2-methoxyethyl)]-[2′-deoxy]-[-2′-O-(methoxyethyl)]chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl)amidites for the 2′-O-methyl amidites.
  • [2′-O-(2-Methoxyethyl)Phosphodiester]-[2′-deoxy Phosphorothioate]-[2′-O-(2-Methoxyethyl) Phosphodiester]Chimeric Oligonucleotides—[2′-O-(2-methoxyethyl phosphodiester]-[2′-deoxy phosphorothioate]-[2′-O-(methoxyethyl)phosphodiester]chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl)amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
  • Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.
  • Example 5 Design and Screening of Duplexed Antisense Compounds Targeting Transthyretin
  • In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target transthyretin. The nucleobase sequence of the antisense strand of the duplex comprises at least an 8-nucleobase portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
  • For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine (dT) would have the following structure:
      cgagaggcggacgggaccgTT Antisense Strand
      |||||||||||||||||||
    TTgctctccgcctgccctggc Complement
  • In another embodiment, a duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG may be prepared with blunt ends (no single stranded overhang) as shown:
    cgagaggcggacgggaccg Antisense Strand
    |||||||||||||||||||
    gctctccgcctgccctggc Complement
  • The RNA duplex can be unimolecular or bimolecular; i.e, the two strands can be part of a single molecule or may be separate molecules.
  • RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15 uL of a 5× solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times. Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate transthyretin expression.
  • When cells reach 80% confluency, they are treated with duplexed antisense compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 containing 12 μg/mL LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
  • Example 6 Oligonucleotide Isolation
  • After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55° C. for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH4OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (+/−32 +/−48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Example 7 Oligonucleotide Synthesis—96 Well Plate Format
  • Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format using methods known to those skilled in the art.
  • Example 8 Oligonucleotide Analysis—96-Well Plate Format
  • The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy using methods known to those skilled in the art.
  • Example 9 Cell Culture and Oligonucleotide Treatment
  • The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. All cell types were cultured under standard conditions, using methods known to those skilled in the art.
  • T-24 cells: The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • A549 cells: The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.).
  • NHDF cells: Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville, Md.).
  • HEK cells: Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.).
  • HepG2 cells: The human hepatoblastoma cell line HepG2 was obtained from the American Type Culture Collection (Manassas, Va.). Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • Treatment with antisense compounds: When cells reached 65-75% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 100 μL OPTI-MEM™-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, Calif.) and then treated with 130 μL of OPTI-MEM™-1 containing 3.75 μg/mL LIPOFECTIN™ (Invitrogen Corporation, Carlsbad, Calif.) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37° C., the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.
  • The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are 2′-O-(2-methoxyethyl) gapmers (2′-O-(2-methoxyethyl) nucleotides shown in bold) with a phosphorothioate backbone. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a 2′-O-(2-methoxyethyl) gapmers (2′-O-(2-methoxyethyl) nucleotides shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
  • Example 10 Analysis of Oligonucleotide Inhibition of Transthyretin Expression
  • Antisense modulation of transthyretin expression can be assayed in a variety of ways known in the art. For example, transthyretin mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
  • Protein levels of transthyretin can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to transthyretin can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
  • Example 11 Design of Phenotypic Assays for the Use of Transthyretin Inhibitors
  • Phenotypic assays—Once transthyretin inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of transthyretin in health and disease. Phenotypic assay can be purchased from any one of several commercial vendors.
  • Example 12 RNA Isolation
  • Poly(A)+ mRNA isolation. Poly(A)+ mRNA was isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μL cold PBS. 60 μL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 μL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70° C., was added to each well, the plate was incubated on a 90° C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
  • Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions
  • Total RNA was isolated using an RNEASY 96™ kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures.
  • The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Example 13 Real-Time Quantitative PCR Analysis of Transthyretin mRNA Levels
  • Quantitation of transthyretin mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.
  • PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 μL PCR cocktail (2.5×PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).
  • Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • In this assay, 170 μL of RiboGreen™ working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 μL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.
  • Probes and primers to human transthyretin were designed to hybridize to a human transthyretin sequence, using published sequence information (GenBank accession number BC020791.1, incorporated herein as SEQ ID NO: 4). For human transthyretin the PCR primers were:
    • forward primer: CCCTGCTGAGCCCCTACTC (SEQ ID NO: 5)
    • reverse primer: TCCCTCATTCCTTGGGATTG (SEQ ID NO: 6) and the PCR probe was: FAM-ATTCCACCACGGCTGTCGTCA-TAMRA (SEQ ID NO: 7) where FAM is the fluorescent dye and TAMRA is the quencher dye. For human GAPDH the PCR primers were:
    • forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO: 8)
    • reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 9) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3′ (SEQ ID NO: 10) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
    Example 14 Northern Blot Analysis of Transthyretin mRNA Levels
  • Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL™ (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND™-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST “B” Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALNKER™ UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then probed using QUICKHYB™ hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.
  • To detect human transthyretin, a human transthyretin specific probe was prepared by PCR using the forward primer CCCTGCTGAGCCCCTACTC (SEQ ID NO: 5) and the reverse primer TCCCTCATTCCTTGGGATTG (SEQ ID NO: 6). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
  • Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER™ and IMAGEQUANT™ Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.
  • Example 15 Antisense Inhibition of Human Transthyretin Expression by Chimeric Phosphorothioate Oligonucleotides Having 2′-MOE Wings and a Deoxy Gap
  • In accordance with the present invention, a series of antisense compounds was designed to target different regions of the human transthyretin RNA, using published sequences (GenBank accession number BC020791.1, incorporated herein as SEQ ID NO: 4, and nucleotides 2009236 to 2017289 of the sequence with GenBank accession number NT010966.10, incorporated herein as SEQ ID NO: 11). The compounds are shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. All compounds in Table 1 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings”. The wings are composed of 2′-O-(2-methoxyethyl) nucleotides, also known as 2′-MOE nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on human transthyretin mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments in which HepG2 cells were treated with 50 nM of the antisense oligonucleotides of the present invention. The positive control ISIS 18078 (SEQ ID NO: 2) was used for this assay. If present, “N.D.” indicates “no data”.
    TABLE 1
    Inhibition of human transthyretin mRNA levels
    by chimeric phosphorothioate oligonucleotides
    having 2′-MOE wings and a deoxy gap
    TARGE SEQ
    T SEQ TARGE % ID
    ISIS # REGION ID NO T SITE SEQUENCE INHIB NO
    304237 Exon 1: 11 596 aaacactcaccgta 6 12
    Intron 1 gggcca
    junction
    304238 Intron 1: 11 1520 caccggtgccctgg 0 13
    Exon 2 gtgtag
    junction
    304239 Intron 2 11 1718 tgagcctctctcta 0 14
    ccaagt
    304240 Exon 3: 11 3880 gtatactcacctct 33 15
    Intron 3 gcatgc
    junction
    304241 Intron 3 11 4039 ttctcagagtgttg 0 16
    tgaatt
    304242 Intron 3 11 6252 actctgcataaata 0 17
    catttt
    304243 Intron 3 11 6967 tcttgttttgcaaa 0 18
    ttcacg
    304244 Intron 3 11 7192 tgaataccacctat 0 19
    gagaga
    304245 5′UTR 4 6 ctgccaagaatgag 33 20
    tggact
    304246 Start Codon 4 18 tgagaagccatcct 6 21
    gccaag
    304247 Start Codon 4 25 cagacgatgagaag 2 22
    ccatcc
    304248 Coding 4 30 aggagcagacgatg 10 23
    agaagc
    304249 Coding 4 59 acacaaataccagt 33 24
    ccagca
    304250 Coding 4 60 gacacaaataccag 0 25
    tccagc
    304251 Coding 4 66 gcctcagacacaaa 14 26
    taccag
    304252 Coding 4 75 gtagggccagcctc 3 27
    agacac
    304253 Coding 4 86 caccggtgcccgta 16 28
    gggcca
    304254 Coding 4 91 ggattcaccggtgc 32 29
    ccgtag
    304255 Coding 4 100 aggacacttggatt 47 30
    caccgg
    304256 Coding 4 105 atcagaggacactt 0 31
    ggattc
    304257 Coding 4 110 tgaccatcagagga 21 32
    cacttg
    304258 Coding 4 114 actttgaccatcag 16 33
    aggaca
    304259 Coding 4 126 acagcatctagaac 33 34
    tttgac
    304260 Coding 4 133 gcctcggacagcat 34 35
    ctagaa
    304261 Coding 4 146 tgatggcaggactg 16 36
    cctcgg
    304262 Coding 4 170 ttctgaacacatgc 41 37
    acggcc
    304263 Coding 4 185 tgtcatcagcagcc 8 38
    tttctg
    304264 Coding 4 197 atggctcccaggtg 34 39
    tcatca
    304265 Coding 4 203 aggcaaatggctcc 15 40
    caggtg
    304266 Coding 4 210 ttcccagaggcaaa 0 41
    tggctc
    304267 Coding 4 217 actggttttcccag 56 42
    aggcaa
    304268 Coding 4 222 gactcactggtttt 0 43
    cccaga
    304269 Coding 4 232 cagctctccagact 44 44
    cactgg
    304270 Coding 4 239 gcccatgcagctct 14 45
    ccagac
    304271 Coding 4 244 tgtgagcccatgca 3 46
    gctctc
    304272 Coding 4 250 ctcagttgtgagcc 36 47
    catgca
    304273 Coding 4 257 attcctcctcagtt 10 48
    gtgagc
    304274 Coding 4 264 tctacaaattcctc 34 49
    ctcagt
    304275 Coding 4 278 ctttgtatatccct 43 50
    tctaca
    304276 Coding 4 298 agatttggtgtcta 1 51
    tttcca
    304277 Coding 4 314 caagtgccttccag 14 52
    taagat
    304278 Coding 4 323 gggagatgccaagt 53 53
    gccttc
    304279 Coding 4 342 tctgcatgctcatg 42 54
    gaatgg
    304280 Coding 4 353 tgaataccacctct 7 55
    gcatgc
    304281 Coding 4 360 ttggctgtgaatac 5 56
    cacctc
    304282 Coding 4 369 ccggagtcgttggc 16 57
    tgtgaa
    304283 Coding 4 401 tcagcagggcggca 1 58
    atggtg
    304284 Coding 4 425 ccgtggtggaatag 63 59
    gagtag
    304285 Coding 4 427 agccgtggtggaat 53 60
    aggagt
    304286 Coding 4 431 cgacagccgtggtg 56 61
    gaatag
    304287 Coding 4 438 ttggtgacgacagc 92 62
    cgtggt
    304288 Coding 4 440 gattggtgacgaca 70 63
    gccgtg
    304289 Coding 4 442 gggattggtgacga 73 64
    cagccg
    304290 Coding 4 443 tgggattggtgacg 83 65
    acagcc
    304291 Coding 4 449 attccttgggattg 45 66
    gtgacg
    304292 Stop Codon 4 450 cattccttgggatt 27 67
    ggtgac
    304293 Stop Codon 4 451 tcattccttgggat 20 68
    tggtga
    304294 Stop Codon 4 460 agaagtccctcatt 37 69
    ccttgg
    304295 3′UTR 4 472 gtccactggaggag 47 70
    aagtcc
    304296 3′UTR 4 481 gtccttcaggtcca 86 71
    ctggag
    304297 3′UTR 4 489 catccctcgtcctt 76 72
    caggtc
    304298 3′UTR 4 501 tacatgaaatccca 52 73
    tccctc
    304299 3′UTR 4 507 cttggttacatgaa 78 74
    atccca
    304300 3′UTR 4 513 aatactcttggtta 52 75
    catgaa
    304301 3′UTR 4 526 ttagtaaaaatgga 20 76
    atactc
    304302 3′UTR 4 532 actgctttagtaaa 57 77
    aatgga
    304303 3′UTR 4 539 tgaaaacactgctt 54 78
    tagtaa
    304304 3′UTR 4 546 tatgaggtgaaaac 48 79
    actgct
    304305 3′UTR 4 551 tagcatatgaggtg 68 80
    aaaaca
    304306 3′UTR 4 559 ttctaacatagcat 72 81
    atgagg
    304307 3′UTR 4 564 tggacttctaacat 79 82
    agcata
    304308 3′UTR 4 572 tctctgcctggact 75 83
    tctaac
    304309 3′UTR 4 578 ttattgtctctgcc 83 84
    tggact
    304310 3′UTR 4 595 cctttcacaggaat 46 85
    gtttta
    304311 3′UTR 4 597 tgcctttcacagga 79 86
    atgttt
    304312 3′UTR 4 598 gtgcctttcacagg 80 87
    aatgtt
    304313 3′UTR 4 600 aagtgcctttcaca 68 88
    ggaatg
    304314 3′UTR 4 604 tgaaaagtgccttt 8 89
    cacagg
  • As shown in Table 1, SEQ ID NOs 15, 20, 24, 29, 30, 34, 35, 37, 39, 42, 44, 47, 49, 50, 53, 54, 59, 61, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 and 88 demonstrated at least 27% inhibition of human transthyretin expression in this assay and are therefore preferred. More preferred are SEQ ID NOs 84, 87, and 86. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 2. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 2 is the species in which each of the preferred target segments was found.
    TABLE 2
    Sequence and position of preferred target
    segments identified in transthyretin.
    REV
    TARGET COMP SEQ
    SITE SEQ ID TARGET OF SEQ ID
    ID NO SITE SEQUENCE ID ACTIVE IN NO
    220029 11 3880 gcatgcagaggtgagtatac 15 H. sapiens 90
    220034 4 6 agtccactcattcttggcag 20 H. sapiens 91
    220038 4 59 tgctggactggtatttgtgt 24 H. sapiens 92
    220043 4 91 ctacgggcaccggtgaatcc 29 H. sapiens 93
    220044 4 100 ccggtgaatccaagtgtcct 30 H. sapiens 94
    220048 4 126 gtcaaagttctagatgctgt 34 H. sapiens 95
    220049 4 133 ttctagatgctgtccgaggc 35 H. sapiens 96
    220051 4 170 ggccgtgcatgtgttcagaa 37 H. sapiens 97
    220053 4 197 tgatgacacctgggagccat 39 H. sapiens 98
    220056 4 217 ttgcctctgggaaaaccagt 42 H. sapiens 99
    220058 4 232 ccagtgagtctggagagctg 44 H. sapiens 100
    220061 4 250 tgcatgggctcacaactgag 47 H. sapiens 101
    220063 4 264 actgaggaggaatttgtaga 49 H. sapiens 102
    220064 4 278 tgtagaagggatatacaaag 50 H. sapiens 103
    220067 4 323 gaaggcacttggcatctccc 53 H. sapiens 104
    220068 4 342 ccattccatgagcatgcaga 54 H. sapiens 105
    220073 4 425 ctactcctattccaccacgg 59 H. sapiens 106
    220074 4 427 actcctattccaccacggct 60 H. sapiens 107
    220075 4 431 ctattccaccacggctgtcg 61 H. sapiens 108
    220076 4 438 accacggctgtcgtcaccaa 62 H. sapiens 109
    220077 4 440 cacggctgtcgtcaccaatc 63 H. sapiens 110
    220078 4 442 cggctgtcgtcaccaatccc 64 H. sapiens 111
    220079 4 443 ggctgtcgtcaccaatccca 65 H. sapiens 112
    220080 4 449 cgtcaccaatcccaaggaat 66 H. sapiens 113
    220081 4 450 gtcaccaatcccaaggaatg 67 H. sapiens 114
    220083 4 460 ccaaggaatgagggacttct 69 H. sapiens 115
    220084 4 472 ggacttctcctccagtggac 70 H. sapiens 116
    220085 4 481 ctccagtggacctgaaggac 71 H. sapiens 117
    220086 4 489 gacctgaaggacgagggatg 72 H. sapiens 118
    220087 4 501 gagggatgggatttcatgta 73 H. sapiens 119
    220088 4 507 tgggatttcatgtaaccaag 74 H. sapiens 120
    220089 4 513 ttcatgtaaccaagagtatt 75 H. sapiens 121
    220091 4 532 tccatttttactaaagcagt 77 H. sapiens 122
    220092 4 539 ttactaaagcagtgttttca 78 H. sapiens 123
    220093 4 546 agcagtgttttcacctcata 79 H. sapiens 124
    220094 4 551 tgttttcacctcatatgcta 80 H. sapiens 125
    220095 4 559 cctcatatgctatgttagaa 81 H. sapiens 126
    220096 4 564 tatgctatgttagaagtcca 82 H. sapiens 127
    220097 4 572 gttagaagtccaggcagaga 83 H. sapiens 128
    220098 4 578 agtccaggcagagacaataa 84 H. sapiens 129
    220099 4 595 taaaacattcctgtgaaagg 85 H. sapiens 130
    220100 4 597 aaacattcctgtgaaaggca 86 H. sapiens 131
    220101 4 598 aacattcctgtgaaaggcac 87 H. sapiens 132
    220102 4 600 cattcctgtgaaaggcactt 88 H. sapiens 133
  • As these “preferred target segments” have been found by experimentation to be open to, and accessible for, hybridization with the antisense compounds of the present invention, one of skill in the art will recognize or be able to ascertain, using no more than routine experimentation, further embodiments of the invention that encompass other compounds that specifically hybridize to these preferred target segments and consequently inhibit the expression of transthyretin.
  • According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
  • Example 16 Western Blot Analysis of Transthyretin Protein Levels
  • Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to transthyretin is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER™ (Molecular Dynamics, Sunnyvale Calif.).
  • All of the applications, patents and references cited are hereby incorporated herein by reference.
  • It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the present invention without departing from the spirit or scope of the invention. Thus it is intended that the present invention cover modifications and variations of thi invention. The invention is limited only by the claims below.

Claims (18)

1. An antisense compound 13 to 80 nucleobases in length targeted to a nucleic acid molecule encoding human transthyretin, wherein said compound inhibits the expression of human transthyretin mRNA by at least 10%.
2. The antisense compound of claim 1 comprising 13 to 50 nucleobases in length.
3. The antisense compound of claim 2 comprising 15 to 30 nucleobases in length.
4. The antisense compound of claim 1 comprising an oligonucleotide.
5. The antisense compound of claim 4 comprising a DNA oligonucleotide.
6. The antisense compound of claim 4 comprising an RNA oligonucleotide.
7. The antisense compound of claim 6 comprising a single-stranded RNA oligonucleotide.
8. The antisense compound of claim 4 comprising a chimeric oligonucleotide.
9. The antisense compound of claim 4 wherein at least a portion of said compound hybridizes with RNA to form an oligonucleotide-RNA duplex.
10. The antisense compound of claim 1 having at least one modified internucleoside linkage, sugar moiety, or nucleobase.
11. The antisense compound of claim 1 having at least one 2′-O-methoxyethyl sugar moiety.
12. The antisense compound of claim 1 having at least one phosphorothioate internucleoside linkage.
13. The antisense compound of claim 1 wherein at least one cytosine is a 5-methylcytosine.
14. A method of inhibiting the expression of human transthyretin in a cell or tissue comprising contacting said cell or tissue with the antisense compound of claim 1 so that expression of human transthyretin is inhibited.
15. A method of screening for a modulator of human transthyretin, the method comprising the steps of:
contacting a preferred target segment of a nucleic acid molecule encoding human transthyretin with one or more candidate modulators of human transthyretin, and
identifying one or more modulators of human transthyretin expression which modulate the expression of human transthyretin.
16. The method of claim 15 wherein the modulator of transthyretin expression comprises an oligonucleotide, an antisense oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, an RNA oligonucleotide having at least a portion of said RNA oligonucleotide capable of hybridizing with RNA to form an oligonucleotide-RNA duplex, or a chimeric oligonucleotide.
17. A diagnostic method for identifying a disease state comprising identifying the presence of human transthyretin in a sample using at least one of the primers comprising SEQ ID NOs 5 or 6, or the probe comprising SEQ ID NO: 7.
18. The antisense compound of claim 1, wherein said antisense compound has at least an 13 nucleobase portion of a sequence selected from the group consisting of SEQ ID NOs 15, 20, 24, 29, 30, 34, 35, 37, 39, 42, 44, 47, 49, 50, 53, 54, 59, 60, 61, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 and 88.
US11/097,928 2004-04-05 2005-04-01 Modulation of transthyretin expression Abandoned US20050244869A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US55986304P true 2004-04-05 2004-04-05
US11/097,928 US20050244869A1 (en) 2004-04-05 2005-04-01 Modulation of transthyretin expression

Applications Claiming Priority (16)

Application Number Priority Date Filing Date Title
US11/097,928 US20050244869A1 (en) 2004-04-05 2005-04-01 Modulation of transthyretin expression
US12/273,731 US8101743B2 (en) 2004-04-05 2008-11-19 Modulation of transthyretin expression
US13/357,481 US20120149109A1 (en) 2004-04-05 2012-01-24 Modulation of transthyretin expression
US14/614,647 US20150184157A1 (en) 2004-04-05 2015-02-05 Modulation of transthyretin expression
US15/092,476 US20160348100A1 (en) 2004-04-05 2016-04-06 Modulation of transthyretin expression
US15/803,484 US20180273949A1 (en) 2004-04-05 2017-11-03 Modulation of transthyretin expression
US15/898,073 US20180179532A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,128 US20180179535A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,153 US20180179537A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,058 US20180179529A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,111 US20180179533A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,057 US20180179528A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,061 US20180179530A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,117 US20180179534A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,142 US20180179536A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,070 US20180179531A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/273,731 Continuation US8101743B2 (en) 2004-04-05 2008-11-19 Modulation of transthyretin expression
US14/614,647 Continuation US20150184157A1 (en) 2004-04-05 2015-02-05 Modulation of transthyretin expression

Publications (1)

Publication Number Publication Date
US20050244869A1 true US20050244869A1 (en) 2005-11-03

Family

ID=35187558

Family Applications (16)

Application Number Title Priority Date Filing Date
US11/097,928 Abandoned US20050244869A1 (en) 2004-04-05 2005-04-01 Modulation of transthyretin expression
US12/273,731 Active US8101743B2 (en) 2004-04-05 2008-11-19 Modulation of transthyretin expression
US13/357,481 Abandoned US20120149109A1 (en) 2004-04-05 2012-01-24 Modulation of transthyretin expression
US14/614,647 Abandoned US20150184157A1 (en) 2004-04-05 2015-02-05 Modulation of transthyretin expression
US15/092,476 Abandoned US20160348100A1 (en) 2004-04-05 2016-04-06 Modulation of transthyretin expression
US15/803,484 Pending US20180273949A1 (en) 2004-04-05 2017-11-03 Modulation of transthyretin expression
US15/898,070 Pending US20180179531A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,058 Pending US20180179529A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,111 Pending US20180179533A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,073 Pending US20180179532A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,142 Pending US20180179536A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,057 Abandoned US20180179528A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,061 Pending US20180179530A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,128 Pending US20180179535A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,153 Abandoned US20180179537A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,117 Pending US20180179534A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression

Family Applications After (15)

Application Number Title Priority Date Filing Date
US12/273,731 Active US8101743B2 (en) 2004-04-05 2008-11-19 Modulation of transthyretin expression
US13/357,481 Abandoned US20120149109A1 (en) 2004-04-05 2012-01-24 Modulation of transthyretin expression
US14/614,647 Abandoned US20150184157A1 (en) 2004-04-05 2015-02-05 Modulation of transthyretin expression
US15/092,476 Abandoned US20160348100A1 (en) 2004-04-05 2016-04-06 Modulation of transthyretin expression
US15/803,484 Pending US20180273949A1 (en) 2004-04-05 2017-11-03 Modulation of transthyretin expression
US15/898,070 Pending US20180179531A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,058 Pending US20180179529A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,111 Pending US20180179533A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,073 Pending US20180179532A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,142 Pending US20180179536A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,057 Abandoned US20180179528A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,061 Pending US20180179530A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,128 Pending US20180179535A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,153 Abandoned US20180179537A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression
US15/898,117 Pending US20180179534A1 (en) 2004-04-05 2018-02-15 Modulation of transthyretin expression

Country Status (1)

Country Link
US (16) US20050244869A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010017509A1 (en) * 2008-08-07 2010-02-11 Isis Pharmaceuticals, Inc. Modulation of transthyretin expression for the treatment of cns related disorders
WO2011139917A1 (en) 2010-04-29 2011-11-10 Isis Pharmaceuticals, Inc. Modulation of transthyretin expression
US8741866B2 (en) 2008-10-20 2014-06-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of transthyretin
US9101643B2 (en) 2009-11-03 2015-08-11 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of transthyretin (TTR)
US9127276B2 (en) 2013-05-01 2015-09-08 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9399775B2 (en) 2011-11-18 2016-07-26 Alnylam Pharmaceuticals, Inc. RNAi agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases
US20160304870A1 (en) * 2013-12-06 2016-10-20 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of transthyretin (ttr) by double-stranded rna
AU2016203300B2 (en) * 2010-04-29 2017-04-13 Ionis Pharmaceuticals, Inc. Modulation of transthyretin expression
US10060921B2 (en) 2014-08-29 2018-08-28 Alnylam Pharmaceuticals, Inc. Methods of treating transthyretin (TTR) mediated amyloidosis
US10208307B2 (en) 2015-07-31 2019-02-19 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SG171914A1 (en) 2008-12-02 2011-07-28 Chiralgen Ltd Method for the synthesis of phosphorus atom modified nucleic acids
MX342945B (en) 2009-07-06 2016-10-18 Ontorii Inc * Novel nucleic acid prodrugs and methods use thereof.
EP2552456B1 (en) * 2010-03-29 2017-08-23 Alnylam Pharmaceuticals, Inc. Sirna therapy for transthyretin (ttr) related ocular amyloidosis
EP3248982A1 (en) 2011-07-19 2017-11-29 Wave Life Sciences Ltd. Thiosulfonate reagents for the synthesis of functionalized nucleic acids
CA2859581A1 (en) * 2011-12-16 2013-06-20 National University Corporation Tokyo Medical And Dental University Chimeric double-stranded nucleic acid
JP6246121B2 (en) 2012-07-13 2017-12-13 株式会社新日本科学 Chiral-nucleic acid adjuvants
KR101850319B1 (en) 2012-07-13 2018-04-20 웨이브 라이프 사이언시스 리미티드 Asymmetric auxiliary group
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
BR112015011112A2 (en) 2012-11-15 2018-11-06 Roche Innovation Ct Copenhagen As oligomeric compound, oligomer, pharmaceutical composition, use of the oligomeric compound, method of synthesis of an oligomeric compound and a method of treating a disease.
EP2951305B1 (en) 2013-01-30 2018-08-15 F.Hoffmann-La Roche Ag Lna oligonucleotide carbohydrate conjugates
JP2016514091A (en) 2013-02-08 2016-05-19 ミスフォールディング ダイアグノスティクス, インコーポレイテッド Transthyretin antibodies and uses thereof
WO2015108047A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
EP3095459A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
SG11201605782UA (en) 2014-01-16 2016-08-30 Wave Life Sciences Ltd Chiral design

Citations (97)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4426330A (en) * 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4667025A (en) * 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4752779A (en) * 1976-12-20 1988-06-21 The Marconi Company Limited Tracking radar systems
US4827941A (en) * 1987-12-23 1989-05-09 Advanced Cardiovascular Systems, Inc. Extendable guidewire for cardiovascular procedures
US4828979A (en) * 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) * 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4835205A (en) * 1988-01-11 1989-05-30 The Goodyear Tire & Rubber Company Copolyester adhesive containing hyroxymethyl benzoic acid
US4981957A (en) * 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US4994582A (en) * 1989-02-03 1991-02-19 Nippon Kayaku Kabushiki Kaisha Novel antibiotic NK130119
US5013556A (en) * 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5013830A (en) * 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5082830A (en) * 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5108921A (en) * 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US5109124A (en) * 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) * 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118800A (en) * 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5118802A (en) * 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5177198A (en) * 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5184444A (en) * 1991-08-09 1993-02-09 Aec-Able Engineering Co., Inc. Survivable deployable/retractable mast
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5194599A (en) * 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5214136A (en) * 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5292873A (en) * 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) * 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5378825A (en) * 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5386023A (en) * 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5391723A (en) * 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5393878A (en) * 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5395619A (en) * 1993-03-03 1995-03-07 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5405939A (en) * 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5414077A (en) * 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5414908A (en) * 1990-05-29 1995-05-16 Haines; Patrick R. Tie clip
US5416203A (en) * 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5415016A (en) * 1992-11-09 1995-05-16 Shima Seiki Manufacturing Limited Knitted fabric presser unit of flat knitting machine
US5417978A (en) * 1993-07-29 1995-05-23 Board Of Regents, The University Of Texas System Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use
US5485603A (en) * 1989-07-14 1996-01-16 U.S. Philips Corporation Pipeline system which pauses processing of already input data during dead time intervals at the system input
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5491133A (en) * 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5508270A (en) * 1993-03-06 1996-04-16 Ciba-Geigy Corporation Nucleoside phosphinate compounds and compositions
US5510475A (en) * 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512295A (en) * 1994-11-10 1996-04-30 The Board Of Trustees Of The Leland Stanford Junior University Synthetic liposomes for enhanced uptake and delivery
US5512667A (en) * 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5512439A (en) * 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5514785A (en) * 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) * 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5519126A (en) * 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5521291A (en) * 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5591584A (en) * 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5594722A (en) * 1992-12-16 1997-01-14 Fujitsu Limited Personal communication method and system
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5595086A (en) * 1994-08-02 1997-01-21 Aluminum Company Of America Apparatus for calibrating hollow nonsymmetrical multiplane extrusions and associated method
US5595756A (en) * 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
US5595726A (en) * 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5597696A (en) * 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599923A (en) * 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610300A (en) * 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5614617A (en) * 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) * 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5623070A (en) * 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5623065A (en) * 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5627053A (en) * 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5714331A (en) * 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) * 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5721218A (en) * 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5744368A (en) * 1993-11-04 1998-04-28 Research Foundation Of State University Of New York Methods for the detection of soluble amyloid β-protein (βAP) or soluble transthyretin (TTR)
US5750692A (en) * 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US6040179A (en) * 1999-06-25 2000-03-21 Isis Pharmaceuticals Inc. Antisense inhibition of G-alpha-i2 expression
US6369209B1 (en) * 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6383809B1 (en) * 2000-10-30 2002-05-07 Isis Pharmaceuticals, Inc. Antisense inhibition of cytohesin-1 expression
US20020058638A1 (en) * 1999-07-21 2002-05-16 Monia Brett P. Antisense inhibition of PTEN expression
US20030027780A1 (en) * 1999-02-23 2003-02-06 Hardee Gregory E. Multiparticulate formulation
US20040009946A1 (en) * 2002-05-23 2004-01-15 Ceptyr, Inc. Modulation of PTP1B expression and signal transduction by RNA interference
US20040018176A1 (en) * 2002-07-24 2004-01-29 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
US6877906B2 (en) * 2002-08-30 2005-04-12 Nippon Telegraph And Telephone Optical fiber cross-connect with a connection block, an alignment block and a handling device
US7250496B2 (en) * 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7696342B1 (en) * 2002-11-26 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US7696334B1 (en) * 2002-12-05 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable human herpesvirus 5 regulatory gene
US8090542B2 (en) * 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA

Family Cites Families (122)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4534899A (en) 1981-07-20 1985-08-13 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4824941A (en) * 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (en) 1985-01-08 1987-04-03 Pasteur Institut New nucleoside adenosine derivatives, their preparation and their biological applications
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5185444A (en) * 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
JPS638396A (en) 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd Poly-labeled oligonucleotide derivative
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
DE3851889T2 (en) 1987-06-24 1995-04-13 Florey Howard Inst Nucleoside derivatives.
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5457183A (en) 1989-03-06 1995-10-10 Board Of Regents, The University Of Texas System Hydroxylated texaphyrins
US5354844A (en) 1989-03-16 1994-10-11 Boehringer Ingelheim International Gmbh Protein-polycation conjugates
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5227170A (en) 1989-06-22 1993-07-13 Vestar, Inc. Encapsulation process
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5527528A (en) 1989-10-20 1996-06-18 Sequus Pharmaceuticals, Inc. Solid-tumor treatment method
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
CA2071510C (en) 1989-10-24 2004-07-06 Chris A. Buhr 2' modified oligonucleotides
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5580575A (en) 1989-12-22 1996-12-03 Imarx Pharmaceutical Corp. Therapeutic drug delivery systems
US5469854A (en) 1989-12-22 1995-11-28 Imarx Pharmaceutical Corp. Methods of preparing gas-filled liposomes
US5486603A (en) * 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5218105A (en) * 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
IL113519A (en) 1990-08-03 1997-11-20 Sterling Winthrop Inc Oligonucleoside sequences of from about 6 to about 200 bases having a three atom internucleoside linkage, their preparation and pharmaceutical compositions for inhibiting gene expression containing said oligonucleosides
US5223618A (en) * 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
JPH06505704A (en) * 1990-09-20 1994-06-30
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
JP3220180B2 (en) 1991-05-23 2001-10-22 三菱化学株式会社 The drug-containing protein-bound liposome
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
NZ244306A (en) 1991-09-30 1995-07-26 Boehringer Ingelheim Int Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
DE637965T1 (en) 1991-11-26 1995-12-14 Gilead Sciences Inc Increased formation of triple and double helices of oligomers having modified pyrimidines.
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (en) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5583020A (en) 1992-11-24 1996-12-10 Ribozyme Pharmaceuticals, Inc. Permeability enhancers for negatively charged polynucleotides
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
JP3351476B2 (en) 1993-01-22 2002-11-25 三菱化学株式会社 Phospholipid derivative and a liposome containing it
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
JPH08508492A (en) 1993-03-30 1996-09-10 スターリング ウィンスロップ インコーポレイティド Acyclic nucleoside analogues and oligonucleotide sequences comprising them
DE69407032T2 (en) 1993-03-31 1998-07-02 Sanofi Sa Oligonucleotides having amide linkages employ phosphoesterverkettungen
DE4311944A1 (en) 1993-04-10 1994-10-13 Degussa Coated sodium percarbonate particles, processes for their preparation and to detergents containing detergent and bleaching compositions
US5462854A (en) 1993-04-19 1995-10-31 Beckman Instruments, Inc. Inverse linkage oligonucleotides for chemical and enzymatic processes
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5534259A (en) 1993-07-08 1996-07-09 Liposome Technology, Inc. Polymer compound and coated particle composition
US5543158A (en) 1993-07-23 1996-08-06 Massachusetts Institute Of Technology Biodegradable injectable nanoparticles
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
KR100386337B1 (en) 1993-12-09 2004-03-24 토마스 제퍼슨 대학교 Compounds and a method for the specific mutation-sites in eukaryotic cells
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
DE69524269D1 (en) * 1994-01-28 2002-01-17 Matsushita Electric Ind Co Ltd Apparatus and method for decoding variable-length code
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
DE69834038D1 (en) * 1997-07-01 2006-05-18 Isis Pharmaceutical Inc Compositions and methods of administration of oligonucleotides via the esophagus
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US5951455A (en) * 1998-12-04 1999-09-14 Isis Pharmaceuticals, Inc. Antisense modulation of G-alpha-11 expression
US20040226056A1 (en) * 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US5998148A (en) * 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US6656730B1 (en) 1999-06-15 2003-12-02 Isis Pharmaceuticals, Inc. Oligonucleotides conjugated to protein-binding drugs
US20040002153A1 (en) * 1999-07-21 2004-01-01 Monia Brett P. Modulation of PTEN expression via oligomeric compounds
US6165728A (en) * 1999-11-19 2000-12-26 Isis Pharmaceuticals Inc. Antisense modulation of NCK-2 expression
US6287860B1 (en) 2000-01-20 2001-09-11 Isis Pharmaceuticals, Inc. Antisense inhibition of MEKK2 expression
WO2002081628A2 (en) * 2001-04-05 2002-10-17 Ribozyme Pharmaceuticals, Incorporated Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
WO2002059621A2 (en) 2001-01-24 2002-08-01 Bayer Corporation Regulation of transthyretin to treat obesity
US6468796B1 (en) 2001-04-27 2002-10-22 Isis Pharmaceuticals, Inc. Antisense modulation of bifunctional apoptosis regulator expression
US20040138163A1 (en) * 2002-05-29 2004-07-15 Mcswiggen James RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
AU2003213119A1 (en) 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF BCL2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20050058982A1 (en) * 2002-07-26 2005-03-17 Chiron Corporation Modified small interfering RNA molecules and methods of use
US7655785B1 (en) * 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
RU2678807C2 (en) * 2011-11-18 2019-02-01 Элнилэм Фармасьютикалз, Инк. Rnai agents, compositions and methods for use thereof for treating transthyretin (ttr) associated diseases

Patent Citations (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4752779A (en) * 1976-12-20 1988-06-21 The Marconi Company Limited Tracking radar systems
US4426330A (en) * 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4667025A (en) * 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4835263A (en) * 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) * 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5118800A (en) * 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) * 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US4828979A (en) * 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US5317098A (en) * 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5013830A (en) * 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5286717A (en) * 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5405939A (en) * 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5112963A (en) * 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5491133A (en) * 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US4827941A (en) * 1987-12-23 1989-05-09 Advanced Cardiovascular Systems, Inc. Extendable guidewire for cardiovascular procedures
US4835205A (en) * 1988-01-11 1989-05-30 The Goodyear Tire & Rubber Company Copolyester adhesive containing hyroxymethyl benzoic acid
US5082830A (en) * 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5519126A (en) * 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5109124A (en) * 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5194599A (en) * 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5512439A (en) * 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US4994582A (en) * 1989-02-03 1991-02-19 Nippon Kayaku Kabushiki Kaisha Novel antibiotic NK130119
US5599923A (en) * 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5108921A (en) * 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US5416016A (en) * 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5391723A (en) * 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5416203A (en) * 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5485603A (en) * 1989-07-14 1996-01-16 U.S. Philips Corporation Pipeline system which pauses processing of already input data during dead time intervals at the system input
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5013556A (en) * 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5721218A (en) * 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5292873A (en) * 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5177198A (en) * 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5750692A (en) * 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5414077A (en) * 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5214136A (en) * 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5514785A (en) * 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5414908A (en) * 1990-05-29 1995-05-16 Haines; Patrick R. Tie clip
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5623070A (en) * 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5378825A (en) * 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5614617A (en) * 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) * 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5386023A (en) * 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5623065A (en) * 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5512667A (en) * 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5510475A (en) * 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5714331A (en) * 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5184444A (en) * 1991-08-09 1993-02-09 Aec-Able Engineering Co., Inc. Survivable deployable/retractable mast
US5521291A (en) * 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
US5393878A (en) * 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5595726A (en) * 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5610300A (en) * 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5415016A (en) * 1992-11-09 1995-05-16 Shima Seiki Manufacturing Limited Knitted fabric presser unit of flat knitting machine
US5594722A (en) * 1992-12-16 1997-01-14 Fujitsu Limited Personal communication method and system
US5395619A (en) * 1993-03-03 1995-03-07 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
US5508270A (en) * 1993-03-06 1996-04-16 Ciba-Geigy Corporation Nucleoside phosphinate compounds and compositions
US5417978A (en) * 1993-07-29 1995-05-23 Board Of Regents, The University Of Texas System Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5744368A (en) * 1993-11-04 1998-04-28 Research Foundation Of State University Of New York Methods for the detection of soluble amyloid β-protein (βAP) or soluble transthyretin (TTR)
US5719262A (en) * 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5595756A (en) * 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
US5519134A (en) * 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5599928A (en) * 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) * 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5597696A (en) * 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5595086A (en) * 1994-08-02 1997-01-21 Aluminum Company Of America Apparatus for calibrating hollow nonsymmetrical multiplane extrusions and associated method
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5591584A (en) * 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5512295A (en) * 1994-11-10 1996-04-30 The Board Of Trustees Of The Leland Stanford Junior University Synthetic liposomes for enhanced uptake and delivery
US20030027780A1 (en) * 1999-02-23 2003-02-06 Hardee Gregory E. Multiparticulate formulation
US6369209B1 (en) * 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6040179A (en) * 1999-06-25 2000-03-21 Isis Pharmaceuticals Inc. Antisense inhibition of G-alpha-i2 expression
US20020058638A1 (en) * 1999-07-21 2002-05-16 Monia Brett P. Antisense inhibition of PTEN expression
US6383809B1 (en) * 2000-10-30 2002-05-07 Isis Pharmaceuticals, Inc. Antisense inhibition of cytohesin-1 expression
US20040009946A1 (en) * 2002-05-23 2004-01-15 Ceptyr, Inc. Modulation of PTP1B expression and signal transduction by RNA interference
US20040018176A1 (en) * 2002-07-24 2004-01-29 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
US6877906B2 (en) * 2002-08-30 2005-04-12 Nippon Telegraph And Telephone Optical fiber cross-connect with a connection block, an alignment block and a handling device
US7250496B2 (en) * 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US8090542B2 (en) * 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US7696342B1 (en) * 2002-11-26 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US7696334B1 (en) * 2002-12-05 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable human herpesvirus 5 regulatory gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Grünweller et al., Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2'-O-methyl RNA, phosphorothioates and small interfering RNA, 2003, Nucleic Acids Research, volume 31, pages 3185-3193. *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10233449B2 (en) 2002-11-14 2019-03-19 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9777270B2 (en) 2002-11-14 2017-10-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
WO2010017509A1 (en) * 2008-08-07 2010-02-11 Isis Pharmaceuticals, Inc. Modulation of transthyretin expression for the treatment of cns related disorders
EA029762B1 (en) * 2008-10-20 2018-05-31 Элнилэм Фармасьютикалз, Инк. Compositions and methods for inhibiting expression of transthyretin
US8741866B2 (en) 2008-10-20 2014-06-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of transthyretin
US9234196B2 (en) 2008-10-20 2016-01-12 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of transthyretin
US10240152B2 (en) 2008-10-20 2019-03-26 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of transthyretin
US9101643B2 (en) 2009-11-03 2015-08-11 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of transthyretin (TTR)
JP2013526860A (en) * 2010-04-29 2013-06-27 アイシス ファーマシューティカルズ, インコーポレーテッド Regulation of transthyretin expression
WO2011139917A1 (en) 2010-04-29 2011-11-10 Isis Pharmaceuticals, Inc. Modulation of transthyretin expression
CN103038345A (en) * 2010-04-29 2013-04-10 Isis制药公司 Modulation of transthyretin expression
US9061044B2 (en) 2010-04-29 2015-06-23 Isis Pharmaceuticals, Inc. Modulation of transthyretin expression
US8697860B1 (en) 2010-04-29 2014-04-15 Isis Pharmaceuticals, Inc. Diagnosis and treatment of disease
US9399774B2 (en) 2010-04-29 2016-07-26 Ionis Pharmaceuticals, Inc. Modulation of transthyretin expression
RU2592669C2 (en) * 2010-04-29 2016-07-27 Айсис Фармасьютикалс, Инк. Modulation of expression of transthyretin
KR101835386B1 (en) 2010-04-29 2018-03-08 아이오니스 파마수티컬즈, 인코포레이티드 Modulation of transthyretin expression
AU2016203300B2 (en) * 2010-04-29 2017-04-13 Ionis Pharmaceuticals, Inc. Modulation of transthyretin expression
US9399775B2 (en) 2011-11-18 2016-07-26 Alnylam Pharmaceuticals, Inc. RNAi agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases
US9145558B2 (en) 2013-05-01 2015-09-29 Isis Pharmaceuticals, Inc. Compositions and methods for modulating HBV expression
US9932580B2 (en) 2013-05-01 2018-04-03 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating HBV expression
US9181549B2 (en) 2013-05-01 2015-11-10 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9127276B2 (en) 2013-05-01 2015-09-08 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US10150965B2 (en) * 2013-12-06 2018-12-11 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of transthyretin (TTR) by double-stranded RNA
US20160304870A1 (en) * 2013-12-06 2016-10-20 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of transthyretin (ttr) by double-stranded rna
US10060921B2 (en) 2014-08-29 2018-08-28 Alnylam Pharmaceuticals, Inc. Methods of treating transthyretin (TTR) mediated amyloidosis
US10208307B2 (en) 2015-07-31 2019-02-19 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases

Also Published As

Publication number Publication date
US20120149109A1 (en) 2012-06-14
US20180273949A1 (en) 2018-09-27
US20180179528A1 (en) 2018-06-28
US20180179533A1 (en) 2018-06-28
US20180179535A1 (en) 2018-06-28
US20180179531A1 (en) 2018-06-28
US20180179536A1 (en) 2018-06-28
US20150184157A1 (en) 2015-07-02
US20160348100A1 (en) 2016-12-01
US20180179537A1 (en) 2018-06-28
US20180179534A1 (en) 2018-06-28
US20180179530A1 (en) 2018-06-28
US20180179532A1 (en) 2018-06-28
US20180179529A1 (en) 2018-06-28
US20090082300A1 (en) 2009-03-26
US8101743B2 (en) 2012-01-24

Similar Documents

Publication Publication Date Title
AU2007210038B2 (en) Compositions and their uses directed to huntingtin
EP1664271B1 (en) Modulation of diacylglycerol acyltransferase 2 expression
EP2441449B1 (en) Modulation of apolipoprotein C-III expression
US20040214325A1 (en) Antisense modulation of apolipoprotein B expression
US7229976B2 (en) Modulation of forkhead box O1A expression
US20050019915A1 (en) Antisense modulation of superoxide dismutase 1, soluble expression
JP4887140B2 (en) Regulation of C-reactive protein expression
US6906186B1 (en) Antisense modulation of polo-like kinase expression
US8765703B2 (en) Modification of MYD88 splicing using modified oligonucleotides
US8258105B2 (en) Antisense oligonucleotides optimized for kidney targeting
US20030224512A1 (en) Antisense modulation of beta-site APP-cleaving enzyme expression
US20040266714A1 (en) Modulation of glucagon receptor expression
US7745609B2 (en) Antisense modulation of CD40 expression
ES2652018T3 (en) Modulation of receptor expression of growth hormone and IGF-I
US6455308B1 (en) Antisense modulation of serum amyloid A4 expression
US7723508B2 (en) Modulation of apolipoprotein (A) expression
US7414033B2 (en) Modulation of diacylglycerol acyltransferase 1 expression
US8513400B2 (en) Modulation of HIF1α and HIF2α expression
US7718628B2 (en) Antisense modulation of kinesin-like 1 expression
US7468431B2 (en) Modulation of eIF4E-BP2 expression
AU6159899A (en) Antisense modulation of survivin expression
US7678895B2 (en) Antisense modulation of superoxide dismutase 1, soluble expression
US20040101857A1 (en) Modulation of cytokine-inducible kinase expression
US8101743B2 (en) Modulation of transthyretin expression
US20040014049A1 (en) Antisense modulation of protein kinase C-iota expression

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BROWN-DRIVER, VICKIE L.;JAIN, RAVI;REEL/FRAME:016319/0858;SIGNING DATES FROM 20050509 TO 20050512