US20040177403A1 - Genes encoding protein participating in cytokinin synthesis - Google Patents

Genes encoding protein participating in cytokinin synthesis Download PDF

Info

Publication number
US20040177403A1
US20040177403A1 US10/471,040 US47104003A US2004177403A1 US 20040177403 A1 US20040177403 A1 US 20040177403A1 US 47104003 A US47104003 A US 47104003A US 2004177403 A1 US2004177403 A1 US 2004177403A1
Authority
US
United States
Prior art keywords
leu
ser
val
lys
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/471,040
Inventor
Tatsuo Kakimoto
Hitoshi Sakakibara
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nippon Paper Industries Co Ltd
Suntory Ltd
Original Assignee
Nippon Paper Industries Co Ltd
Suntory Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nippon Paper Industries Co Ltd, Suntory Ltd filed Critical Nippon Paper Industries Co Ltd
Assigned to SUNTORY LIMITED, NIPPON PAPER INDUSTRIES CO., LTD. reassignment SUNTORY LIMITED ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KAKIMOTO, TATSUO, SAKAKIBARA, HITOSHI
Publication of US20040177403A1 publication Critical patent/US20040177403A1/en
Priority to US11/398,550 priority Critical patent/US7807867B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8291—Hormone-influenced development
    • C12N15/8295—Cytokinins

Definitions

  • the present invention relates to a gene encoding a protein involved in cytokinin synthesis, a method of utilizing that gene, and a method for acquiring that gene.
  • Cytokinins are an important type of plant hormone. They have various effects including induction of cell division, formation of new buds, overcoming dormancy of axillary buds, prevention of aging and promotion of enlargement of fruit. Cytokinins have a structure in which a dimethylallyl group (isopentenyl group) bonds to a nitrogen atom at position 6 of adenine or adenosine, or has a structure in which the isopentenyl group is hydroxylated as their basic skeleton.
  • a dimethylallyl group isopentenyl group
  • cytokinin synthesis enzymes Some bacteria that are pathogenic to plants are known to have cytokinin synthesis enzymes and among these, the cytokinin synthases of IPT and TZS of Agrobacterium are known to have activity that transfers the dimethylallyl group of dimethylallyl pyrophosphoric acid (DMAPP) to the nitrogen atom at position 6 of adenosine monophosphate (AMP). This reaction is considered to be the most important step in cytokinin synthesis. However, cytokinin synthesis enzymes possessed by plants and the proteins that encode them have yet to be identified.
  • DMAPP dimethylallyl group of dimethylallyl pyrophosphoric acid
  • AMP adenosine monophosphate
  • an object of the present invention is to provide a gene that encodes an enzyme that catalyzes cytokinin synthesis, a protein encoded thereby, and its application.
  • an object of the present invention is to provide a method for identifying that gene.
  • the inventors of the present invention found a method for obtaining a novel gene that encodes an enzyme that catalyzes cytokinin synthesis from Arabidopsis thaliana , and obtained a novel gene that encodes an enzyme that catalyzes cytokinin synthesis.
  • the present invention provides a gene that encodes a protein involved in cytokinin synthesis. More specifically, the protein is a previously unreported enzyme in plants that catalyzes the reaction in which a side chain is introduced at position N6 of the adenine skeleton of cytokinins.
  • the present invention provides a gene that encodes a protein involved in cytokinin synthesis having the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14.
  • the present invention provides a gene that encodes a protein involved in cytokinin synthesis having a modified amino acid sequence resulting from the addition and/or deletion of one or a plurality of amino acids and/or substitution by other amino acids in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14.
  • the present invention provides a gene encoding a protein involved in cytokinin synthesis that hybridizes with a nucleic acid described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, and particularly DNA or a portion thereof, under stringent conditions.
  • the present invention also provides a vector that contains that gene.
  • the present invention provides a host that has been transformed by that vector.
  • This host may be a plant cell or a plant body.
  • the present invention is also able to provide a production method of a protein involved in cytokinin synthesis by culturing and cultivating the aforementioned host.
  • the present invention is able to provide a method for regulating the growth of a plant or plant cells by introducing the aforementioned gene into a plant or plant cells and expressing said gene.
  • various physiological actions in which cytokinins are involved such as promotion of the formation of adventitious buds, overcoming the dormancy of lateral buds, prevention of the aging of flowers and leaves and the ripening of fruit, improving the longevity of flowers, maintaining photosynthesis function, promoting the enlargement of fruit, prevention of dropping and control of flowering, can be regulated by expressing this gene.
  • FIG. 1 is a drawing showing the structure of plasmid pTK015.
  • FIG. 2 is a photograph of a plant body regenerated from Arabidopsis thaliana transformed by pHM4-AtIPT5.
  • the inventors of the present invention surmised that the reaction that catalyzes the introduction of an isopentenyl (dimethylallyl) side chain at the N6 position of the adenine skeleton is the rate-limiting step of cytokinin synthesis.
  • genes that are known to encode isopentenyl group transferases involved in cytokinin synthesis include the idt (gene4) gene encoded by T-DNA and the tzs gene present in the vir region of the Ti-plasmid of Agrobacterium tumefaciens , the Dtz gene present in several species of Pseudomonas, the ipt gene of Rhodococcus faciens , and the etz gene of Erwinia herbicola .
  • amino acid sequences of these gene products were first compared to find the amino acid residues preserved therein.
  • the resulting sequence was determined to be GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI] [VLI] xxDxxQx[57,60][VLI][VLI]xGG[ST].
  • x indicates an arbitrary amino acid
  • amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein
  • [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.
  • the genome sequence of Arabidopsis thaliana was searched using a TAIR Pattern Matching program to find the possible genes or estimated gene regions based on this amino acid sequence pattern.
  • the resulting eight genes consisted of AT4g24650 (number of the estimated gene region as determined by the Genome Project), T20010 — 210 (number of the estimated gene region as determined by the Genome Project), 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12 (number of the estimated gene region as determined by the Genome Project), MVI11.6 (number of the estimated gene region as determined by the Genome Project), T26J14.3 (number of the estimated gene region as determined by the Genome Project), F2J7.12 (number of the estimated gene region as determined by the Genome Project) and AF109376.
  • AF109376 an estimated gene, AF109376, has been cloned as the cDNA and annotated as being tRNA isopentenyl transferase mRNA.
  • T20010 — 210, MDB19.12, AT4g24650, MVI11.6, T26J14.3 and F2J7.12 have not being isolated as full length cDNA but estimated genes, and annotated to be likely tRNA isopentenyl transferases. 29375-30301 bp of T16G12 (accession number: AC0699089) genome clone is not even annotated.
  • the genes or estimated genes of AT4g24650, T20010 — 210, cDNA corresponding to 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12, MVI11.6, T26J14.3 and F2J7.12 are designated AtIPT4, AtIPT3, AtIPT5, AtIPT7, AtIPT8 and AtIPT6.
  • each of their nucleotide sequences are shown with SEQ ID NOs. 1, 3, 5, 7, 9, 11 and 13, and their corresponding amino acid sequences are indicated with SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14.
  • the calli of Arabidopsis thaliana normally form leaves and buds (to be referred to as shoots) when cytokinins are present in the medium, if cytokinins are not present, it does not form any shoots or even if they are formed, the frequency of formation is extremely low. Therefore, if callus efficiently forms shoots even in the absence of cytokinins when a gene has been introduced and expressed in the callus, the introduced gene can be considered to encode a cytokinin synthase or protein involved in cytokinin reactions.
  • the resulting gene can be confirmed to encode a cytokinin synthase or protein involved in cytokinin reactions.
  • plant cytokinin synthase was found to transfer the DMA group of DMAPP to ATP and ADP.
  • Examples of a gene of the present invention include that coding for the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14.
  • proteins having an amino acid sequence that has been modified by addition or deletion or a plurality of amino acids, and/or substitution by other amino acids are known to maintain activity similar to the original protein.
  • a modified gene that encodes a cytokinin synthase or protein involved in cytokinin synthesis activity and has an amino acid sequence that has been modified with respect to an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 by addition or deletion of one or a plurality of amino acids and/or substitution by other amino acids is also included in the present invention.
  • the degree of this modification is the degree which is possible by means that were commonly known technologies prior to filing of the present patent application, examples of which include site-specific mutagenesis, PCR method and so on.
  • the number of amino acids subject to modification while maintaining the activity of the cytokinin synthase or that relating to cytokinin synthesis is, for example 100 or less, for example 50 or less, preferably 25 or less, and for example 10 or less.
  • the present invention also provides a gene composed of DNA that encodes a cytokinin synthase or protein having activity involved in cytokinin synthesis, and which is capable of hybridizing with a nucleic acid having a nucleotide sequence described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, or portion thereof, under stringent conditions.
  • stringent conditions refer to hybridization conditions consisting of 5 ⁇ SSC and 50° C.
  • suitable hybridization temperature varies according to the particular nucleotide sequence and the length of that nucleotide sequence, hybridization can be carried out by suitable selecting the hybridization temperature.
  • a cDNA library, genomic DNA library and so forth prepared from a plant or microorganism, etc. having cytokinin synthase activity or activity involved in cytokinin synthesis can be used for the source of the gene subjected to the aforementioned hybridization, examples of which include plants such as Arabidopsis thaliana , corn, poplar, petunia, tobacco, rice, tomato and eucalyptus plants.
  • the nucleotide sequence of a gene encoding a cytokinin synthase or protein involved in cytokinin synthesis obtained in this manner has homology of 50% or more, 60% or more, preferably 70% or more or 80% or more, and for example 90% or more, with respect to a nucleotide sequence indicated in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13.
  • the subject gene encoding a protein having an amino acid sequence indicated in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 can be obtained from Arabidopsis thaliana in the form of cDNA or genomic DNA.
  • DNA encoding a protein having a modified amino acid sequence can be synthesized using commonly used site-specific mutagenesis or PCR method by using DNA having the inherent nucleotide sequence as a base.
  • a DNA fragment containing a desired modification can be obtained by obtaining a DNA fragment in which a modification is desired to be introduced by restriction enzyme treatment of the inherent cDNA or genomic DNA, and then performing site-specific mutagenesis or PCR method using this DNA as a template and a primer containing the desired mutation. Subsequently, this DNA fragment into which the mutation has been introduced should then be coupled with a DNA fragment that encodes another portion of the target protein.
  • DNA that encodes protein composed of a shortened amino acid sequence in order to obtain DNA that encodes protein composed of a shortened amino acid sequence, DNA that encodes an amino acid sequence longer than the target amino acid sequence, such as the entire amino acid sequence, should be digested by a desired restriction enzyme and, if the resulting DNA fragment does not encode the entire target amino acid sequence, a DNA fragment composed of the portion of the sequence that is lacking should be synthesized and then coupled to that fragment.
  • cytokinin synthase or a protein having activity involved in cytokinin synthesis can also be obtained by using antibody to a protein having an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14, and cytokinin synthase or protein having activity involved in cytokinin synthesis of other organisms can be cloned using antibody.
  • the present invention also relates to a recombinant vector, and particularly an expression vector, that contains the aforementioned gene, and to a host transformed by said vector.
  • Procaryotic organisms or eucaryotic organisms can be used as hosts.
  • Examples of prokaryotic organisms include bacteria such as Escherichia coli and other Escherichia species, Bacillus subtilis and other Bacillus species as well as other commonly used host microorganisms.
  • Examples of eucaryotic organisms include lower eucaryotic organisms such as eucaryotic microorganisms in the form of yeasts and molds.
  • yeasts include Saccharomyces cerevisiae and other Saccharomyces species
  • molds include Aspergillus oryzae, Aspergillus niger and other Aspergillus species as well as Penicillium species.
  • plant cells and animal cells may also be used as hosts, examples of which include cells systems of animals cells such as mouse, hamster, monkey or human cells, and more specifically, COS cells, Vero cells, CHO cells, L cells, C127 cells, BALB/c 3T3 cells and Sp-2/0 cells.
  • Examples of plant cells include tobacco and Arabidopsis cultured cells as well as cultured cells of poplar, eucalyptus and acacia species.
  • insect cells such as silkworm ( Bombyx mori ) cells or adult silkworms themselves can be used as hosts.
  • silkworm Bombyx mori
  • yoga Spodoptera frugiprd
  • cabbage looper Trichoplusiani
  • Plasmids, phages, phagemids and viruses can be used as expression vectors.
  • viruses such as Baculovirus (expression in insects) or Vaccinia virus (expression in animal cells)
  • Baculovirus expression in insects
  • Vaccinia virus expression in animal cells
  • Expression vectors of the present invention contain expression control regions such as promoters, terminators, replication origins and so forth depending on the type of host into which they are to be introduced.
  • promoters of bacterial expression vectors include lac promoter
  • yeast promoters include glyceraldehyde 3-phosphate dehydrogenase promoter, PHO5 promoter, adhi promoter and pqk promoter
  • mold promoters include amylase promoter and trpC promoter.
  • examples of insect promoters include Baculovirus polyhedron promoter, and examples of animal cell promoters include Simian Virus 40 early and late promoters, CMV promoter, HSV-TK promoter or SRa promoter.
  • examples of plant promoters include the 35S promoter of cauliflower mosaic virus and nopaline synthase promoter, while examples of inductive promoters include glutathione-S-transferase II gene promoter, hsp80 promoter and ribulose 2-phosphate carboxylase small subunit gene promoter.
  • preferable modes of the expression vector include, in addition to those described above, those containing enhancers, splicing signals, poly A addition signals or selection markers (for example, dihydrofolic acid reductase genes (methotrexate resistant) and neo genes (G418 resistant)). Furthermore, in the case of using an enhancer, SV40 enhancer, for example, is inserted upstream or downstream from the gene.
  • Host transformation by an expression vector can be carried out in accordance with ordinary methods well known among persons with ordinary skill in the art, and these methods are described in, for example, Current Protocols in Molecular Biology, John Wiley & Sons Publishing, 1995. Culturing of the transformant can also be carried out in accordance with ordinary methods. Purification of protein involved in cytokinin synthesis from the culture can be carried out in accordance with ordinary methods for isolating and purifying proteins, examples of which include ultrafiltration and various types of column chromatography such as chromatography using Sepharose.
  • CAA82744.1 the dimethylallyl transferase gene of Erwinia herbicola (Accession No. Z46375-2, Protein ID No. CAA86510.1) and the ⁇ -2-isopentenyl phosphate (IPP) transferase gene of Escherichia coli tRNA (Accession No. U14003-83, Protein ID No. AAA97067.1) using the amino acid sequence comparison software, Clustal V of Macvector 6.5.3, the preserved sequence of GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI][VLI]xxDxxQx[57,60][VLI] [VLI]xGG[ST] was found.
  • x indicates an arbitrary amino acid
  • amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein
  • [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.
  • pBI35T (WO 01/16332) was treated with EcoRI and HindIII to obtain a DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene. This was then treated with HindIII and EcoRI of pGPTV-KAN (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK015 (FIG. 1).
  • this DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene was then treated with HindIII and EcoRI of pGPTV-Bar (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK016.
  • DNA was amplified by incubating at 94° C. for 2 minutes followed by 40 cycles consisting of 15 seconds at 94° C., 30 seconds at 53° C. and 2 minutes and 40 seconds at 68° C. using the cDNA library of Arabidopsis thaliana for the template DNA of the PCR reaction, primer 398 (5′-TCCCCCGGGCGATGATGATGTTAAACCCTAGC-3′) (SEQ ID NO. 15) and primer 399 (5′-TCCCCCGGGTC AATTTACTTCTGCTTCTTGAACTTC) (SEQ ID NO.
  • AtIPT4 was amplified by incubating at 94° C. for 2 minutes followed by 42 cycles consisting of 15 seconds at 94° C., 20 seconds at 53° C. and 1 minute at 68° C. using the genomic DNA of Arabidopsis thaliana for the template of the PCR reaction, primer 421 (AAAATGAAGTGTAATGACAAAATGGTTGTG-3′) (SEQ ID NO. 17) and primer 407 (5′-GTCCAAACTAGTTAAGACTTAAAAATC-3′) (SEQ ID NO. 18) as primers and pfx DNA polymerase (Gibco BRL), followed by purification and cloning to the SmaI site of pTK015.
  • the cloned product in the sense direction downstream from the 35S promoter was designated as pTK015-AtIPT4.
  • DNA was amplified using genomic DNA of Arabidopsis thaliana for the template, primer 703 (5′-CACCAGCAAGTTTATATTGCAAAGCGT-3′) (SEQ ID NO. 19) and primer 705 (5′-GTTGTAACCACGTAAAAGATAAGGGTG-3′) (SEQ ID NO. 20) as primers and Herculase (trade name, Stratagene) as heat-resistant DNA synthase.
  • the PCR reaction was carried out for 1 minute at 92° C. followed by 35 cycles consisting of 30 seconds at 92° C., 30 seconds at 55° C. and 2 minutes and 30 seconds at 70° C.
  • pTK015 After digesting with SmaI and KpnI, the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen).
  • sequence of the multi-cloning site was altered by cloning primer 852 (5′-CTCGAGTTGGCGCGCCACCCGGGATTAATTAAGAC TAGTGGGTAC-3′) (SEQ ID NO. 27) and primer 853 (5′-CCCACTAGTCTTAATTAA TCCCGGGTGGCGCGCCAACTCGAG-3′) (SEQ ID NO. 28).
  • primer 852 and primer 853 are synthetic DNA having mutually complementary sequences
  • this procedure was carried out by incubating the three elements consisting of a fragment obtained by digesting pTK015 with SmaI and KpnI, primer 852 and primer 853 in the presence of ligase under ordinary conditions.
  • the plasmid produced in this manner was designated as pHM4.
  • the only difference between pHM4 and pTK015 is the sequence of the multi- -cloning site.
  • Those unique sites present in the multi-cloning site of pTK 015 consist of XbaI, XhoI, SmaI, PacI, SpeI, KpnI and SalI.
  • pHM4 pHM4
  • the terminals were blunted by incubating half the amount for 30 minutes at 70° C. in the presence of 200 ⁇ M deoxyATP, deoxyTTP, deoxyCTP, deoxyGTP and 1 unit of pfu DNA polymerase (Stratagene). After treating this for 1 hour at 37° C. with 20 units of calf intestine alkaline phosphatase (Takara), the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen). Here, the cloned DNA fragment that was amplified (for 35 cycles consisting of 20 seconds at 94° C., 30 seconds at 55° C.
  • a sequence containing the entire code region of SEQ ID NO. 6 starting 66 bps upstream from the translation starting point ATG described in SEQ ID NO. 5 was amplified by PCR using genomic DNA extracted from a Columbia wild strain (Takara Shuzo) as a template and using primer 856 (5′-CCGCTCGAGA TGAAGCCATGCATGACGGCTC-3′) (SEQ ID NO. 33) and primer 857 (5′-GGACTAGTCACCGGGAAATCGCCGCCA-3′) (SEQ ID NO. 34). These primers contain restriction enzyme sites and were treated with XhoI and SpeI following PCR. This DNA fragment was cloned to pHM4, a vector excessive expression in plants, and designated as pHM4-AtIPT5.
  • pTK015, pTK015-AF109376, pTK015-AtIPT4 and pTK016-AtIPT3 were inserted into the callus of Arabidopsis thaliana using Agrobacterium.
  • the method for inserting genes using Agrobacterium was in accordance with the method of Akama, et al. (Akama, K. et al., 1992 Plant Cell Rep., 12, 7-11).
  • the calli containing the inserted genes were cultured in two types of media consisting of cytokinin-free medium [GM medium (Akama, K.
  • cytokinin-containing medium cytokinin-free medium containing 0.5 ⁇ g/ml of trans-zeatin
  • calli transformed with pTK015-AtIPT4 formed shoots in both the cytokinin-free and cytokinin-containing medium.
  • calli transformed with pTK016-AtIPT3 similarly formed shoots in both the cytokinin-free and cytokinin-containing media.
  • calli of Arabidopsis thaliana respectively inserted with pHM4, pHM4-AtIPT1, pHM4-AtIPT8 and pHMR-AtIPT5 were cultured in cytokinin-free medium containing 0.2 ⁇ g/ml of indole acetate, 501g/ml of kanamycin and 100 ⁇ g/ml of claforan.
  • the procedure was the same as the example in which AtIPT4 was inserted into calli.
  • the calli containing pHM4 did not form shoots
  • the calli containing pHM4-AtIPT1, pHM4-AtIPT8 and pHM4-AtIPT5 formed shoot tissue.
  • AtIPT4 and AtIPT3 were suggested to have the ability to induce shoots and the ability to synthesis cytokinins.
  • AtIPT1 AtIPT5
  • AtIPT3 excessive expression of AtIPT1, AtIPT5 and AtIPT3 is capable of causing a cytokinin response.
  • pHM4-AtIPT5 was transformed in Arabidopsis thaliana using the vacuum infiltration Agrobacterium infection method (O. Araki, Shujunsha Publishing, Cell Engineering Supplement, Plant Cell Engineering Series 4, Experimental Protocols in Model Plants, p. 109-113).
  • the resulting seeds were cultivated in MS agar medium containing 50 ⁇ g/ml of kanamycin followed by selection of transformants.
  • the transformants were cultivated in vermiculite containing one-half the concentration of MS medium, an extremely large number of lateral buds were formed in several of the plants (causing the plants to appear bushy) (FIG. 2). This phenotype was not observed in pHM4 transformants cultivated as a control. As a result, it was determined that when AtIPT5 is expressed in excess, terminal bud dominance diminishes and lateral bud formation is promoted.
  • the code region was amplified by using the pTK015-AtIPT4 produced in Example 2 as a template, using primer 480 (5′-GGAATTCCATATGAAGTGTAATGACAAAATGGTTG ⁇ circumflex over ( ) ⁇ 3′) (SEQ ID NO. 21) and primer 481 (5′-GAAGATCTGTCCAAACTAGTTAAGACTTAAAAA TC-3′) (SEQ ID NO. 22) as primers, and using LA taq (Takara Shuzo). After purifying the amplified region, it was treated with NdeI and BglII followed by again purifying the DNA. This DNA fragment was cloned between the NdeI and BamHI sites of pET16b (Novagen) to produce pET16b-AtIPT4.
  • the coding region was amplified using pTK015-AF109376 as the template for the PCR reaction, using primer 550 (5′-GATCCCCGGCATATGATGATGTTAAACCCTAGC-18-3′) (SEQ ID NO. 23) and primer 551 (5′-ACGGTACCCATA TGTCAATTTACTTCTGCTTCTTGAAC-3′) (SEQ ID NO. 24) as primers, and using Herculase (Stratagene) as heat-resistant DNA polymerase. This was then treated with NdeI and cloned to the NdeI site of pET16b to produce pET16b-AF109376.
  • the coding region was amplified using genomic DNA of Arabidopsis thaliana as the template for the PCR reaction, using primer 741 (5′-TTATACATATGAAGCCATGCATGACGGCTCTAAG-3′) (SEQ ID NO. 25) and primer 742 (5′-CGGGATCCTCACCGGG AAATCGCCGCCA-3′) (SEQ ID NO. 26) as primers, and using LA taq (Takara Shuzo) as heat-resistant enzyme. Following purification, the DNA was treated with NdeI and BamHI and cloned between the NdeI and BamHI sites of pET15b (Novagen) to produce pET15b-AtIPT5.
  • AtIPT1, AtIPT4, AtIPT8 and AtIPT6 form a single subgroup, while AtIPT3, AtIPT5 and AtIPT7 form a different subgroup.
  • Enzyme activity in E. coli was measured from each for a single gene.
  • coli were then centrifuged for 10 minutes at 300000 g followed by recovery of the supernatants. 10 ⁇ l of these supernatants were mixed with Buffer A containing 60 ⁇ M DMAPP, 5 ⁇ M [3H]AMP (722 GBq/mmol) and 10 mM MgCl 2 followed by incubation for 30 minutes at 25° C. Subsequently, 50 mM of Tris-HCl (pH 9) was added to this reaction liquid followed by the addition of calf intestine alkaline phosphatase to a concentration of 2 units/30 ⁇ l and incubating for 30 minutes at 37° C. to carry out a dephosphatization reaction.
  • Buffer A containing 60 ⁇ M DMAPP, 5 ⁇ M [3H]AMP (722 GBq/mmol) and 10 mM MgCl 2 followed by incubation for 30 minutes at 25° C.
  • 50 mM of Tris-HCl (pH 9) was added to this reaction liquid followed by
  • AtIPT4 was cloned in pET32b (Novagen) and an extract was prepared from E. coli in the same manner as Example 3, Part (ii). This was designated as Sample A.
  • 400 ⁇ l of Ni-NTA agarose suspension (containing 110 ⁇ l of Ni-NTA agarose as precipitate, 30 mM NaH 2 PO 4 (pH 8), 15 mM indazole, 0.9 M NaCl, 7.5 mM ⁇ -mercaptoethanol, 0.5 mM PMSF and 30 ⁇ g/ml of leupeptin) were added to 800 ⁇ l of Sample A. This suspension was designated as Sample B.
  • Sample B was then centrifuged to separate into supernatant (Sample C) and precipitate.
  • Washing liquid consisting of 20 mM NaH 2 PO 4 (pH 8), 10 mM indazole, 0.3 M NaCl, 5 mM ⁇ -mercaptoethanol, 0.5 mM PMSF and 10 ⁇ g/ml of leupeptin
  • Sample D 50 ⁇ l of Sample D were then mixed with 50 ⁇ l of 2 ⁇ reaction liquid (25 mM Tris-HCl (pH 7.5), 75 mM KCl, 10 mM MgCl 2 , 10 ⁇ g/ml of leupeptin, 1 mM PMSF and 66 ⁇ M DMAPP) containing one of the nucleotides of ATP, ADP or AMP or adenosine or adenine at 0.25 ⁇ M, which were labeled with 3 H, and allowed to react for 30 minutes at 23° C.
  • 2 ⁇ reaction liquid 25 mM Tris-HCl (pH 7.5), 75 mM KCl, 10 mM MgCl 2 , 10 ⁇ g/ml of leupeptin, 1 mM PMSF and 66 ⁇ M DMAPP
  • AtIPT1 also encoded protein having activity that transfers a dimethylallyl group to ATP and ADP.
  • the aforementioned Sample D was mixed with an equal volume of 2 ⁇ reaction liquid (containing 1 mM ATP and 1 mM DMAPP) and allowed to react for 1 hour at 25° C. After centrifuging, the supernatant was divided into two equal portions, and one of the portions was treated with calf intestine alkaline phosphatase in the same manner as previously described. After diluting each portion with 3 volumes of acetone and holding for 30 minutes at ⁇ 80° C., they were centrifuged for 30 minutes at 17,000 ⁇ g to remove the protein. After drying the supernatant to a solid under reduced pressure, it was dissolved in methanol.
  • 2 ⁇ reaction liquid containing 1 mM ATP and 1 mM DMAPP
  • a portion of the dried supernatant was fractionated with the Chemocobond ODS-W column (Chemco). Elution was carried out using a linear concentration gradient by first eluting for 15 minutes with 20 mM KH 2 PO 4 followed by 30 minutes with an 80% aqueous acetonitrile solution containing K 2 HPO 4 ranging from 20 mM to 4 mM.
  • the sample not treated with calf intestine alkaline phosphatase exhibited two main peaks in Chemocobond ODS-W column chromatography. The retention time of the peak that eluted first coincided with the retention time of ATP.
  • the retention time of the peak (Peak A) that eluted later did not coincide with any of the retention times of ATP, adenosine or isopentenyl adenosine.
  • the sample treated with calf intestine alkaline phosphatase also exhibited two main peaks in Chemocobond ODS-W column chromatography.
  • the retention time of the peak that eluted first coincided with the retention time of adenosine, while the retention time of the peak that eluted later (Peak B) coincided with that of isopentenyl adenosine.
  • Peak A After drying the fractions of Peaks A and B, they were dissolved in ethanol and analyzed by fast atom bombardment mass spectrometry (JMS-SX102 or JEOL Mstation, JOEL Datum Ltd.). As a result, a signal originating in the compound of Peak A was unable to be obtained, because of inhibition of ionization by the triphosphate group. Signals originating in the compound of Peak B were observed at m/z values of 336 and 204, with the former corresponding to isopentenyl adenosine, and the latter corresponding to a decomposition product of isopentenyl adenosine. On the basis of the above, Peak A was thought to be isopentenyl ATP (also referred to as iPTP), which is a compound resulting from the phosphatization of isopentenyl adenosine.
  • iPTP isopentenyl ATP
  • ATP can be efficiently used as a substrate of cytokinin synthesis, these genes are expected to function more effectively in plants than cytokinin synthesis genes originating in bacteria using AMP as substrate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A gene is provided that encodes an amino acid sequence indicated in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 originating in, for example, Arabidopsis thaliana.

Description

    FIELD OF THE INVENTION
  • The present invention relates to a gene encoding a protein involved in cytokinin synthesis, a method of utilizing that gene, and a method for acquiring that gene. [0001]
    • BACKGROUND ART
  • Cytokinins are an important type of plant hormone. They have various effects including induction of cell division, formation of new buds, overcoming dormancy of axillary buds, prevention of aging and promotion of enlargement of fruit. Cytokinins have a structure in which a dimethylallyl group (isopentenyl group) bonds to a nitrogen atom at position 6 of adenine or adenosine, or has a structure in which the isopentenyl group is hydroxylated as their basic skeleton. Some bacteria that are pathogenic to plants are known to have cytokinin synthesis enzymes and among these, the cytokinin synthases of IPT and TZS of Agrobacterium are known to have activity that transfers the dimethylallyl group of dimethylallyl pyrophosphoric acid (DMAPP) to the nitrogen atom at position 6 of adenosine monophosphate (AMP). This reaction is considered to be the most important step in cytokinin synthesis. However, cytokinin synthesis enzymes possessed by plants and the proteins that encode them have yet to be identified. [0002]
    • DISCLOSURE OF THE INVENTION
  • Therefore, an object of the present invention is to provide a gene that encodes an enzyme that catalyzes cytokinin synthesis, a protein encoded thereby, and its application. In addition, an object of the present invention is to provide a method for identifying that gene. [0003]
  • The inventors of the present invention found a method for obtaining a novel gene that encodes an enzyme that catalyzes cytokinin synthesis from [0004] Arabidopsis thaliana, and obtained a novel gene that encodes an enzyme that catalyzes cytokinin synthesis.
  • Thus, the present invention provides a gene that encodes a protein involved in cytokinin synthesis. More specifically, the protein is a previously unreported enzyme in plants that catalyzes the reaction in which a side chain is introduced at position N6 of the adenine skeleton of cytokinins. [0005]
  • More specifically, the present invention provides a gene that encodes a protein involved in cytokinin synthesis having the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. In addition, the present invention provides a gene that encodes a protein involved in cytokinin synthesis having a modified amino acid sequence resulting from the addition and/or deletion of one or a plurality of amino acids and/or substitution by other amino acids in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. Moreover, the present invention provides a gene encoding a protein involved in cytokinin synthesis that hybridizes with a nucleic acid described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, and particularly DNA or a portion thereof, under stringent conditions. [0006]
  • The present invention also provides a vector that contains that gene. [0007]
  • Moreover, the present invention provides a host that has been transformed by that vector. This host may be a plant cell or a plant body. [0008]
  • The present invention is also able to provide a production method of a protein involved in cytokinin synthesis by culturing and cultivating the aforementioned host. [0009]
  • In addition, the present invention is able to provide a method for regulating the growth of a plant or plant cells by introducing the aforementioned gene into a plant or plant cells and expressing said gene. Namely, various physiological actions in which cytokinins are involved, such as promotion of the formation of adventitious buds, overcoming the dormancy of lateral buds, prevention of the aging of flowers and leaves and the ripening of fruit, improving the longevity of flowers, maintaining photosynthesis function, promoting the enlargement of fruit, prevention of dropping and control of flowering, can be regulated by expressing this gene.[0010]
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a drawing showing the structure of plasmid pTK015. [0011]
  • FIG. 2 is a photograph of a plant body regenerated from [0012] Arabidopsis thaliana transformed by pHM4-AtIPT5.
    • DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The inventors of the present invention surmised that the reaction that catalyzes the introduction of an isopentenyl (dimethylallyl) side chain at the N6 position of the adenine skeleton is the rate-limiting step of cytokinin synthesis. Examples of genes that are known to encode isopentenyl group transferases involved in cytokinin synthesis include the idt (gene4) gene encoded by T-DNA and the tzs gene present in the vir region of the Ti-plasmid of [0013] Agrobacterium tumefaciens, the Dtz gene present in several species of Pseudomonas, the ipt gene of Rhodococcus faciens, and the etz gene of Erwinia herbicola. Among these, the gene products of the tzs and ipt genes of Agrobacterium, the etz gene of Pseudomonas and the ipt gene of Rhodococcus have been demonstrated to have DMAPP:AMP dimethylallyl transferase activity in vitro. In addition to these, many living organisms have enzymes that transfer an isopentenyl group from DMAPP to rRNA. If plant cytokinins are assumed to be synthesized by isopentenylation of the adenine skeleton, then there is the possibility that enzymes that catalyze this reaction may have amino acids in common with the isopentenyl group transferases mentioned above. Therefore, the amino acid sequences of these gene products were first compared to find the amino acid residues preserved therein. The resulting sequence was determined to be GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI] [VLI] xxDxxQx[57,60][VLI][VLI]xGG[ST]. Here, x indicates an arbitrary amino acid, amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein, and [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.
  • The genome sequence of [0014] Arabidopsis thaliana was searched using a TAIR Pattern Matching program to find the possible genes or estimated gene regions based on this amino acid sequence pattern. The resulting eight genes consisted of AT4g24650 (number of the estimated gene region as determined by the Genome Project), T20010—210 (number of the estimated gene region as determined by the Genome Project), 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12 (number of the estimated gene region as determined by the Genome Project), MVI11.6 (number of the estimated gene region as determined by the Genome Project), T26J14.3 (number of the estimated gene region as determined by the Genome Project), F2J7.12 (number of the estimated gene region as determined by the Genome Project) and AF109376.
  • Among these eight genes, an estimated gene, AF109376, has been cloned as the cDNA and annotated as being tRNA isopentenyl transferase mRNA. Among the seven remaining genes, T20010[0015] —210, MDB19.12, AT4g24650, MVI11.6, T26J14.3 and F2J7.12 have not being isolated as full length cDNA but estimated genes, and annotated to be likely tRNA isopentenyl transferases. 29375-30301 bp of T16G12 (accession number: AC0699089) genome clone is not even annotated.
  • The genes or estimated genes of AT4g24650, T20010[0016] —210, cDNA corresponding to 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12, MVI11.6, T26J14.3 and F2J7.12 are designated AtIPT4, AtIPT3, AtIPT5, AtIPT7, AtIPT8 and AtIPT6. In addition, each of their nucleotide sequences are shown with SEQ ID NOs. 1, 3, 5, 7, 9, 11 and 13, and their corresponding amino acid sequences are indicated with SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14.
  • Although the calli of [0017] Arabidopsis thaliana normally form leaves and buds (to be referred to as shoots) when cytokinins are present in the medium, if cytokinins are not present, it does not form any shoots or even if they are formed, the frequency of formation is extremely low. Therefore, if callus efficiently forms shoots even in the absence of cytokinins when a gene has been introduced and expressed in the callus, the introduced gene can be considered to encode a cytokinin synthase or protein involved in cytokinin reactions.
  • Alternatively, by expressing the resulting gene using a gene expression system such as [0018] E. coli or yeast and then measuring the enzyme activity, the resulting gene can be confirmed to encode a cytokinin synthase or protein involved in cytokinin reactions.
  • On the basis of the above, in the present invention, a gene that encodes a cytokinin synthase or protein involved in cytokinin synthesis of plant origin was isolated and identified for the first time. [0019]
  • In addition, in the present invention, plant cytokinin synthase was found to transfer the DMA group of DMAPP to ATP and ADP. [0020]
  • Examples of a gene of the present invention include that coding for the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. However, proteins having an amino acid sequence that has been modified by addition or deletion or a plurality of amino acids, and/or substitution by other amino acids are known to maintain activity similar to the original protein. Thus, a modified gene that encodes a cytokinin synthase or protein involved in cytokinin synthesis activity and has an amino acid sequence that has been modified with respect to an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 by addition or deletion of one or a plurality of amino acids and/or substitution by other amino acids, is also included in the present invention. [0021]
  • Here, the degree of this modification is the degree which is possible by means that were commonly known technologies prior to filing of the present patent application, examples of which include site-specific mutagenesis, PCR method and so on. The number of amino acids subject to modification while maintaining the activity of the cytokinin synthase or that relating to cytokinin synthesis is, for example 100 or less, for example 50 or less, preferably 25 or less, and for example 10 or less. [0022]
  • In addition, the present invention also provides a gene composed of DNA that encodes a cytokinin synthase or protein having activity involved in cytokinin synthesis, and which is capable of hybridizing with a nucleic acid having a nucleotide sequence described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, or portion thereof, under stringent conditions. Here, stringent conditions refer to hybridization conditions consisting of 5×SSC and 50° C. Furthermore, as the suitable hybridization temperature varies according to the particular nucleotide sequence and the length of that nucleotide sequence, hybridization can be carried out by suitable selecting the hybridization temperature. [0023]
  • A cDNA library, genomic DNA library and so forth prepared from a plant or microorganism, etc. having cytokinin synthase activity or activity involved in cytokinin synthesis can be used for the source of the gene subjected to the aforementioned hybridization, examples of which include plants such as [0024] Arabidopsis thaliana, corn, poplar, petunia, tobacco, rice, tomato and eucalyptus plants.
  • The nucleotide sequence of a gene encoding a cytokinin synthase or protein involved in cytokinin synthesis obtained in this manner has homology of 50% or more, 60% or more, preferably 70% or more or 80% or more, and for example 90% or more, with respect to a nucleotide sequence indicated in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13. [0025]
  • As will be concretely indicated in the examples, the subject gene encoding a protein having an amino acid sequence indicated in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 can be obtained from [0026] Arabidopsis thaliana in the form of cDNA or genomic DNA.
  • In addition, DNA encoding a protein having a modified amino acid sequence can be synthesized using commonly used site-specific mutagenesis or PCR method by using DNA having the inherent nucleotide sequence as a base. For example, a DNA fragment containing a desired modification can be obtained by obtaining a DNA fragment in which a modification is desired to be introduced by restriction enzyme treatment of the inherent cDNA or genomic DNA, and then performing site-specific mutagenesis or PCR method using this DNA as a template and a primer containing the desired mutation. Subsequently, this DNA fragment into which the mutation has been introduced should then be coupled with a DNA fragment that encodes another portion of the target protein. [0027]
  • Alternatively, in order to obtain DNA that encodes protein composed of a shortened amino acid sequence, DNA that encodes an amino acid sequence longer than the target amino acid sequence, such as the entire amino acid sequence, should be digested by a desired restriction enzyme and, if the resulting DNA fragment does not encode the entire target amino acid sequence, a DNA fragment composed of the portion of the sequence that is lacking should be synthesized and then coupled to that fragment. [0028]
  • Alternatively, cytokinin synthase or a protein having activity involved in cytokinin synthesis can also be obtained by using antibody to a protein having an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14, and cytokinin synthase or protein having activity involved in cytokinin synthesis of other organisms can be cloned using antibody. [0029]
  • Thus, the present invention also relates to a recombinant vector, and particularly an expression vector, that contains the aforementioned gene, and to a host transformed by said vector. Procaryotic organisms or eucaryotic organisms can be used as hosts. Examples of prokaryotic organisms include bacteria such as [0030] Escherichia coli and other Escherichia species, Bacillus subtilis and other Bacillus species as well as other commonly used host microorganisms.
  • Examples of eucaryotic organisms include lower eucaryotic organisms such as eucaryotic microorganisms in the form of yeasts and molds. Examples of yeasts include [0031] Saccharomyces cerevisiae and other Saccharomyces species, while examples of molds include Aspergillus oryzae, Aspergillus niger and other Aspergillus species as well as Penicillium species. Moreover, plant cells and animal cells may also be used as hosts, examples of which include cells systems of animals cells such as mouse, hamster, monkey or human cells, and more specifically, COS cells, Vero cells, CHO cells, L cells, C127 cells, BALB/c 3T3 cells and Sp-2/0 cells. Examples of plant cells include tobacco and Arabidopsis cultured cells as well as cultured cells of poplar, eucalyptus and acacia species.
  • Moreover, insect cells such as silkworm ([0032] Bombyx mori) cells or adult silkworms themselves can be used as hosts. In addition, yoga (Spodoptera frugiprd) or cabbage looper (Trichoplusiani) cells can also be used.
  • Plasmids, phages, phagemids and viruses (such as Baculovirus (expression in insects) or Vaccinia virus (expression in animal cells)) can be used as expression vectors. [0033]
  • Expression vectors of the present invention contain expression control regions such as promoters, terminators, replication origins and so forth depending on the type of host into which they are to be introduced. Examples of promoters of bacterial expression vectors include lac promoter, examples of yeast promoters include glyceraldehyde 3-phosphate dehydrogenase promoter, PHO5 promoter, adhi promoter and pqk promoter, and examples of mold promoters include amylase promoter and trpC promoter. [0034]
  • In addition, examples of insect promoters include Baculovirus polyhedron promoter, and examples of animal cell promoters include Simian Virus 40 early and late promoters, CMV promoter, HSV-TK promoter or SRa promoter. Examples of plant promoters include the 35S promoter of cauliflower mosaic virus and nopaline synthase promoter, while examples of inductive promoters include glutathione-S-transferase II gene promoter, hsp80 promoter and ribulose 2-phosphate carboxylase small subunit gene promoter. [0035]
  • In addition, preferable modes of the expression vector include, in addition to those described above, those containing enhancers, splicing signals, poly A addition signals or selection markers (for example, dihydrofolic acid reductase genes (methotrexate resistant) and neo genes (G418 resistant)). Furthermore, in the case of using an enhancer, SV40 enhancer, for example, is inserted upstream or downstream from the gene. [0036]
  • Host transformation by an expression vector can be carried out in accordance with ordinary methods well known among persons with ordinary skill in the art, and these methods are described in, for example, Current Protocols in Molecular Biology, John Wiley & Sons Publishing, 1995. Culturing of the transformant can also be carried out in accordance with ordinary methods. Purification of protein involved in cytokinin synthesis from the culture can be carried out in accordance with ordinary methods for isolating and purifying proteins, examples of which include ultrafiltration and various types of column chromatography such as chromatography using Sepharose. [0037]
  • On the basis of the current level of technology, adventitious bud formation can be promoted even in plants such as roses, for which individual regeneration is difficult even by artificial regulation using plant hormones externally added to the medium, by inserting and expressing this gene in a plant by coupling this cDNA or gene under the control of a composite or inductive promoter with a system that uses Agrobacterium or a system that uses a particle gun or electroporation and so forth. Moreover, the various physiological actions exhibited by cytokinins in plants, such as lateral bud elongation, prevention of aging, flowering time, promotion of fruit enlargement and prevention of fruit dropping, can be regulated by controlling the expression of a gene that encodes a protein involved in cytokinin synthesis. [0038]
  • The following provides a detailed description of the present invention according to examples. Unless stated otherwise, molecular biological techniques are in accordance with Molecular Cloning (Sambrook, et al., 1989). [0039]
    • EXAMPLE 1 Search for and Isolation of Genes Encoding Proteins Involved in Cytokinin Synthesis
  • As a result of analyzing the amino acid sequences of the gene products of the tzs gene of [0040] Agrobacterium tumefaciens (Accession No. X03933-1, Protein ID No. CAA27572.1), the ipt gene of Agrobacterium tumefaciens (Accession No. AB025109-1, Protein ID No. BAA76344.1), the ptz gene of Pseudomonas syringae (Accession No. X03679-1, Protein ID No. CAA27315.1), the ipt gene of Rhodococcus faciens (Accession No. Z29635-4, Protein ID No. CAA82744.1), the dimethylallyl transferase gene of Erwinia herbicola (Accession No. Z46375-2, Protein ID No. CAA86510.1) and the δ-2-isopentenyl phosphate (IPP) transferase gene of Escherichia coli tRNA (Accession No. U14003-83, Protein ID No. AAA97067.1) using the amino acid sequence comparison software, Clustal V of Macvector 6.5.3, the preserved sequence of GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI][VLI]xxDxxQx[57,60][VLI] [VLI]xGG[ST] was found. Here, x indicates an arbitrary amino acid, amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein, and [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.
  • Next, in order to isolate those genes or estimated gene regions considered to have this preserved amino acid sequence pattern, a search was made of the genomic database of [0041] Arabidopsis thaliana using the TAIR Pattern Matching Program. As a result, eight genes consisting of the estimated gene region numbers as designated by the National Genome Project of AT4g24650, T20010—210, MDB19.12, MVI11.6, T26J14.3, F2J7.12, AF109376 and the 29375-30301 bp region of the T16G12 genome clone (Accession No. AC068809) were determined to have the aforementioned preserved amino acid sequence pattern.
  • Among these eight genes, cDNA has previously been cloned for AF109376 only, and is annotated as tRNA isopentenyl transferase mRNA. However, since the total length cDNA of AT4g24650, T20010[0042] —210, MDB19.12, MVI11.6, T26J14.3 and F2J7.12 have not been isolated, they are annotated as probably being tRNA isopentenyl transferases. With respect to the 29375-30301 bp region of the genome clone of T16G12 (Accession No. AC068809), there are even no annotations regarding its estimated function. Namely, the functions of these eight genes are only estimated on the basis of computer analyses, while there have been no experimental analyses whatsoever, and their functions were not known. In addition, their enzyme activity has also not been measured, and their substrates have not been identified.
  • The nucleotide sequences of AT4g24650 (AtIPT4), T20010[0043] —210 (AtIPT3), the cDNA corresponding to the 29375-30301 bp region of the genome clone of T16G12 (Accession No. AC068809) (AtIPT5), MDB19.12 (AtIPT7), MVI11.6 (AtIPT8), T26J14.3 (AtIPT1) and F2J7.12 (AtIPT6) are shown in SEQ ID NOs. 1, 3, 5, 7, 9, 11 and 13.
  • In addition, a molecular phylogenetic tree was produced with the Clustal W Program (http://www.ddbj.nig.ac.jp/E-mail/clustalw-e.html, Thompson, et al., 1994, Nucl. Acids Res., 22, 4673-4680), including each of the amino acids encoded by them (SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14) and homologous amino acid sequences obtained as a result of searching DNA databases (such as the DNA Databank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp). As a result, the sequence indicated with SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14 were demonstrated to form a family with eucaryotic or bacterial DMAPP:tRNA isopentenyl transferase or isopentenyl transferase involved in cytokinin synthesis of plant pathogens such as Agrobacterium that form gall. Moreover, the amino acid sequences indicated in SEQ ID NOs. 2, 10, 12 and 14 formed a single subgroup. Those genes that were related to this subgroup consisted of AAL83819 (DDBJ accession no.) of petunia origin and BAB86364 (DDBJ accession no.) of rice origin. In addition, the amino acid sequences indicated in SEQ ID NOs. 4, 6 and 8 also formed a single subgroup, and AW720363 (DDBJ accession no.) of bird's-foot trefoil [0044] Lotus japonicus origin was positioned in this subgroup.
    • EXAMPLE 2 Excessive Expression in Plants of Genes Encoding Proteins Involved in Cytokinin Synthesis
  • i) Production of Gene Insertion Vector for Plants [0045]
  • pBI35T (WO 01/16332) was treated with EcoRI and HindIII to obtain a DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene. This was then treated with HindIII and EcoRI of pGPTV-KAN (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK015 (FIG. 1). Similarly, this DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene was then treated with HindIII and EcoRI of pGPTV-Bar (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK016. [0046]
  • For the predicted open reading frame of AF109376, DNA was amplified by incubating at 94° C. for 2 minutes followed by 40 cycles consisting of 15 seconds at 94° C., 30 seconds at 53° C. and 2 minutes and 40 seconds at 68° C. using the cDNA library of [0047] Arabidopsis thaliana for the template DNA of the PCR reaction, primer 398 (5′-TCCCCCGGGCGATGATGATGTTAAACCCTAGC-3′) (SEQ ID NO. 15) and primer 399 (5′-TCCCCCGGGTC AATTTACTTCTGCTTCTTGAACTTC) (SEQ ID NO. 16) as primers and pfx DNA polymerase (Gibco BRL), and purifying the amplified DNA followed by treatment with SmaI and repeated purification of the DNA. This was then cloned to the SmaI site of pTK015, after which the cloned product in the sense direction downstream from the 35S RNA gene promoter (35S promoter) of cauliflower mosaic virus was selected and designated as pTK015-AF109376.
  • AtIPT4 was amplified by incubating at 94° C. for 2 minutes followed by 42 cycles consisting of 15 seconds at 94° C., 20 seconds at 53° C. and 1 minute at 68° C. using the genomic DNA of [0048] Arabidopsis thaliana for the template of the PCR reaction, primer 421 (AAAATGAAGTGTAATGACAAAATGGTTGTG-3′) (SEQ ID NO. 17) and primer 407 (5′-GTCCAAACTAGTTAAGACTTAAAAATC-3′) (SEQ ID NO. 18) as primers and pfx DNA polymerase (Gibco BRL), followed by purification and cloning to the SmaI site of pTK015. The cloned product in the sense direction downstream from the 35S promoter was designated as pTK015-AtIPT4.
  • For AtIPT3, DNA was amplified using genomic DNA of [0049] Arabidopsis thaliana for the template, primer 703 (5′-CACCAGCAAGTTTATATTGCAAAGCGT-3′) (SEQ ID NO. 19) and primer 705 (5′-GTTGTAACCACGTAAAAGATAAGGGTG-3′) (SEQ ID NO. 20) as primers and Herculase (trade name, Stratagene) as heat-resistant DNA synthase. The PCR reaction was carried out for 1 minute at 92° C. followed by 35 cycles consisting of 30 seconds at 92° C., 30 seconds at 55° C. and 2 minutes and 30 seconds at 70° C. Following purification of this product, it was cloned at the blunt terminal to the SmaI site of pTK016, and the cloned product of AtIPT3 in the sense direction downstream from the 35S promoter was selected and designated as pTK016-AtIPT3.
  • For pTK015, after digesting with SmaI and KpnI, the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen). Here, the sequence of the multi-cloning site was altered by cloning primer 852 (5′-CTCGAGTTGGCGCGCCACCCGGGATTAATTAAGAC TAGTGGGTAC-3′) (SEQ ID NO. 27) and primer 853 (5′-CCCACTAGTCTTAATTAA TCCCGGGTGGCGCGCCAACTCGAG-3′) (SEQ ID NO. 28). Here, since primer 852 and primer 853 are synthetic DNA having mutually complementary sequences, this procedure was carried out by incubating the three elements consisting of a fragment obtained by digesting pTK015 with SmaI and KpnI, primer 852 and primer 853 in the presence of ligase under ordinary conditions. The plasmid produced in this manner was designated as pHM4. The only difference between pHM4 and pTK015 is the sequence of the multi-[0050] -cloning site. Those unique sites present in the multi-cloning site of pTK015 consist of XbaI, XhoI, SmaI, PacI, SpeI, KpnI and SalI.
  • 4 μg of pHM4 were digested with 20 units of BamHI. The terminals were blunted by incubating half the amount for 30 minutes at 70° C. in the presence of 200 μM deoxyATP, deoxyTTP, deoxyCTP, deoxyGTP and 1 unit of pfu DNA polymerase (Stratagene). After treating this for 1 hour at 37° C. with 20 units of calf intestine alkaline phosphatase (Takara), the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen). Here, the cloned DNA fragment that was amplified (for 35 cycles consisting of 20 seconds at 94° C., 30 seconds at 55° C. and 1 minute at 72° C.) from genomic DNA of [0051] Arabidopsis thaliana using Herculase heat-resistant DNA polymerase (Stratagene), primer 918 (5′-ATG ACA GAA CTC AAC TTC CAC CT-3′) (SEQ ID NO. 29) and primer 879 (5′-CAAAAAAAAGATCTAATTTTGCACCAAATGCCGCTT-31) (SEQ ID NO. 30) was cloned and designated as pHM4-AtIPT1.
  • A cloned DNA fragment amplified from the genomic DNA of [0052] Arabidopsis thaliana using primer 533 (5′-ATTATGCAAAATCTTACG TCCACATTCGTC-3′) (SEQ ID NO. 31) and primer 881 (5′-ACAGGATCCTCACACTTTGTCTTTCACCAAG-31) (SEQ ID NO. 32) was cloned in the same manner as the production of pHM4-AtIPT1 and designated as pHM4-AtIPT8.
  • A sequence containing the entire code region of SEQ ID NO. 6 starting 66 bps upstream from the translation starting point ATG described in SEQ ID NO. 5 was amplified by PCR using genomic DNA extracted from a Columbia wild strain (Takara Shuzo) as a template and using primer 856 (5′-CCGCTCGAGA TGAAGCCATGCATGACGGCTC-3′) (SEQ ID NO. 33) and primer 857 (5′-GGACTAGTCACCGGGAAATCGCCGCCA-3′) (SEQ ID NO. 34). These primers contain restriction enzyme sites and were treated with XhoI and SpeI following PCR. This DNA fragment was cloned to pHM4, a vector excessive expression in plants, and designated as pHM4-AtIPT5. [0053]
  • ii) Gene Insertion into Plants [0054]
  • pTK015, pTK015-AF109376, pTK015-AtIPT4 and pTK016-AtIPT3 were inserted into the callus of [0055] Arabidopsis thaliana using Agrobacterium. The method for inserting genes using Agrobacterium was in accordance with the method of Akama, et al. (Akama, K. et al., 1992 Plant Cell Rep., 12, 7-11). The calli containing the inserted genes were cultured in two types of media consisting of cytokinin-free medium [GM medium (Akama, K. et al., 1992 Plant Cell Rep., 12, 7-11) containing 50 μg/ml of kanamycin sulfate, 100 μg/ml of cefotaxime, 100 μg/ml of vancomycin and 0.3 μg/ml of indole acetate] and cytokinin-containing medium (cytokinin-free medium containing 0.5 μg/ml of trans-zeatin). When observed two weeks later, neither the calli transformed with pTK015 or calli transformed with pTK015-AF109376 formed shoots in the cytokinin-free medium, and only formed shoots in the cytokinin-containing medium. In contrast, the calli transformed with pTK015-AtIPT4 formed shoots in both the cytokinin-free and cytokinin-containing medium. In addition, calli transformed with pTK016-AtIPT3 similarly formed shoots in both the cytokinin-free and cytokinin-containing media.
  • In addition, calli of [0056] Arabidopsis thaliana respectively inserted with pHM4, pHM4-AtIPT1, pHM4-AtIPT8 and pHMR-AtIPT5 were cultured in cytokinin-free medium containing 0.2 μg/ml of indole acetate, 501g/ml of kanamycin and 100 μg/ml of claforan. The procedure was the same as the example in which AtIPT4 was inserted into calli. Although the calli containing pHM4 did not form shoots, the calli containing pHM4-AtIPT1, pHM4-AtIPT8 and pHM4-AtIPT5 formed shoot tissue.
  • On the basis of these findings, AtIPT4 and AtIPT3 were suggested to have the ability to induce shoots and the ability to synthesis cytokinins. [0057]
  • In addition, it was also indicated that excessive expression of AtIPT1, AtIPT5 and AtIPT3 is capable of causing a cytokinin response. [0058]
  • iii) Excessive Expression of pHM4-AtIPT5 in Plants [0059]
  • pHM4-AtIPT5 was transformed in [0060] Arabidopsis thaliana using the vacuum infiltration Agrobacterium infection method (O. Araki, Shujunsha Publishing, Cell Engineering Supplement, Plant Cell Engineering Series 4, Experimental Protocols in Model Plants, p. 109-113). The resulting seeds were cultivated in MS agar medium containing 50 μg/ml of kanamycin followed by selection of transformants. When the transformants were cultivated in vermiculite containing one-half the concentration of MS medium, an extremely large number of lateral buds were formed in several of the plants (causing the plants to appear bushy) (FIG. 2). This phenotype was not observed in pHM4 transformants cultivated as a control. As a result, it was determined that when AtIPT5 is expressed in excess, terminal bud dominance diminishes and lateral bud formation is promoted.
    • EXAMPLE 3 Measurement of Enzyme Activity of Proteins Involved in Cytokinin Synthesis
  • i) Plasmid Production for Measuring Enzyme Activity [0061]
  • The code region was amplified by using the pTK015-AtIPT4 produced in Example 2 as a template, using primer 480 (5′-GGAATTCCATATGAAGTGTAATGACAAAATGGTTG{circumflex over ( )}3′) (SEQ ID NO. 21) and primer 481 (5′-GAAGATCTGTCCAAACTAGTTAAGACTTAAAAA TC-3′) (SEQ ID NO. 22) as primers, and using LA taq (Takara Shuzo). After purifying the amplified region, it was treated with NdeI and BglII followed by again purifying the DNA. This DNA fragment was cloned between the NdeI and BamHI sites of pET16b (Novagen) to produce pET16b-AtIPT4. [0062]
  • In addition, the coding region was amplified using pTK015-AF109376 as the template for the PCR reaction, using primer 550 (5′-GATCCCCGGCATATGATGATGTTAAACCCTAGC-18-3′) (SEQ ID NO. 23) and primer 551 (5′-ACGGTACCCATA TGTCAATTTACTTCTGCTTCTTGAAC-3′) (SEQ ID NO. 24) as primers, and using Herculase (Stratagene) as heat-resistant DNA polymerase. This was then treated with NdeI and cloned to the NdeI site of pET16b to produce pET16b-AF109376. [0063]
  • Moreover, the coding region was amplified using genomic DNA of [0064] Arabidopsis thaliana as the template for the PCR reaction, using primer 741 (5′-TTATACATATGAAGCCATGCATGACGGCTCTAAG-3′) (SEQ ID NO. 25) and primer 742 (5′-CGGGATCCTCACCGGG AAATCGCCGCCA-3′) (SEQ ID NO. 26) as primers, and using LA taq (Takara Shuzo) as heat-resistant enzyme. Following purification, the DNA was treated with NdeI and BamHI and cloned between the NdeI and BamHI sites of pET15b (Novagen) to produce pET15b-AtIPT5.
  • ii) Measurement of Enzyme Activity of [0065] E. Coli Extract As was previously described, AtIPT1, AtIPT4, AtIPT8 and AtIPT6 form a single subgroup, while AtIPT3, AtIPT5 and AtIPT7 form a different subgroup. Enzyme activity in E. coli was measured from each for a single gene.
  • After culturing [0066] E. coli strain AD494(DE3)pLysS containing pET16b-AtIPT4, pET16b-AF109376 or pET15b-AtIPT5 for 12 hours at 20° C. in the presence of 1 mM IPTG, the microorganisms were collected by centrifugation, and after adding Buffer A (25 mM Tris-HCl, 50 mM KCl, 5 mM β-mercaptoethanol, 1 mM PMSF and 20 μg/ml of leupeptin) to an OD600 of 100, the E. coli were disrupted by freezing and thawing. The disrupted E. coli were then centrifuged for 10 minutes at 300000 g followed by recovery of the supernatants. 10 μl of these supernatants were mixed with Buffer A containing 60 μM DMAPP, 5 μM [3H]AMP (722 GBq/mmol) and 10 mM MgCl2 followed by incubation for 30 minutes at 25° C. Subsequently, 50 mM of Tris-HCl (pH 9) was added to this reaction liquid followed by the addition of calf intestine alkaline phosphatase to a concentration of 2 units/30 μl and incubating for 30 minutes at 37° C. to carry out a dephosphatization reaction. As a result of developing the reaction liquid by C18 reversed-phase thin layer chromatography (mobile phase: 50% methanol) and detecting the reaction products by autoradiography, formation of isopentenyl adenosine was confirmed in the reaction liquids containing extracts of E. coli having pET16b-AtIPT4 and pET15b-AtIPT5. However, formation activity of isopentenyl adenosine was not observed in the extract of E. coli containing pET16b-AF109376.
  • iii) Measurement of Enzyme Activity of Purified Proteins [0067]
  • Similar to Example 3, Part (i), AtIPT4 was cloned in pET32b (Novagen) and an extract was prepared from [0068] E. coli in the same manner as Example 3, Part (ii). This was designated as Sample A. 400 μl of Ni-NTA agarose suspension (containing 110 μl of Ni-NTA agarose as precipitate, 30 mM NaH2PO4 (pH 8), 15 mM indazole, 0.9 M NaCl, 7.5 mM β-mercaptoethanol, 0.5 mM PMSF and 30 μg/ml of leupeptin) were added to 800 μl of Sample A. This suspension was designated as Sample B. Sample B was then centrifuged to separate into supernatant (Sample C) and precipitate. Washing liquid (consisting of 20 mM NaH2PO4 (pH 8), 10 mM indazole, 0.3 M NaCl, 5 mM β-mercaptoethanol, 0.5 mM PMSF and 10 μg/ml of leupeptin) was added to the precipitate, and the Ni-NTA agarose was washed four times using a procedure in which the precipitate was recovered by centrifugation. This Ni-NTA agarose was then suspended in 500 μl of washing liquid and designated as Sample D. 50 μl of Sample D were then mixed with 50 μl of 2× reaction liquid (25 mM Tris-HCl (pH 7.5), 75 mM KCl, 10 mM MgCl2, 10 μg/ml of leupeptin, 1 mM PMSF and 66 μM DMAPP) containing one of the nucleotides of ATP, ADP or AMP or adenosine or adenine at 0.25 μM, which were labeled with 3H, and allowed to react for 30 minutes at 23° C. After adding 700 μl of ethyl acetate to this reaction liquid followed by stirring and centrifuging, 550 μl of the ethyl acetate layer were recovered followed by the addition of 500 μl of distilled water. After stirring and centrifugal separation, 350 μl of the ethyl acetate layer were recovered followed again by the addition of 500 μl of distilled water. After again stirring and separating by centrifugation, 0.5 ml of ACSII (Pharmacia) were added to 50 μl of the ethyl acetate layer followed by measurement of radioactivity with a liquid scintillation counter. As a result, the dimethylallyl group of DMAPP was found to have efficiently transferred to ATP and ADP. Thus, it was shown that the AtIPT4 product has activity that transfers a dimethylallyl group to ATP and ADP.
  • When the Km for ATP was measured in the presence of 0.4 mM DMAPP using purified recombinant AtIPT4 protein (2 ng/ml), the resulting value was comparable to the Km of 11.1 μM (Morris, et al., Aust. J. Plant Physiol., 20, 621-637, 1993) of tzs for AMP. In addition, when the Km for DMAPP was measured in the presence of 200 μM ATP, the value was 6.5 μM. [0069]
  • Similarly, AtIPT1 also encoded protein having activity that transfers a dimethylallyl group to ATP and ADP. [0070]
  • iv) Identification of Reaction Products [0071]
  • The aforementioned Sample D was mixed with an equal volume of 2× reaction liquid (containing 1 mM ATP and 1 mM DMAPP) and allowed to react for 1 hour at 25° C. After centrifuging, the supernatant was divided into two equal portions, and one of the portions was treated with calf intestine alkaline phosphatase in the same manner as previously described. After diluting each portion with 3 volumes of acetone and holding for 30 minutes at −80° C., they were centrifuged for 30 minutes at 17,000×g to remove the protein. After drying the supernatant to a solid under reduced pressure, it was dissolved in methanol. A portion of the dried supernatant was fractionated with the Chemocobond ODS-W column (Chemco). Elution was carried out using a linear concentration gradient by first eluting for 15 minutes with 20 mM KH[0072] 2PO4 followed by 30 minutes with an 80% aqueous acetonitrile solution containing K2HPO4 ranging from 20 mM to 4 mM. The sample not treated with calf intestine alkaline phosphatase exhibited two main peaks in Chemocobond ODS-W column chromatography. The retention time of the peak that eluted first coincided with the retention time of ATP. The retention time of the peak (Peak A) that eluted later did not coincide with any of the retention times of ATP, adenosine or isopentenyl adenosine. The sample treated with calf intestine alkaline phosphatase also exhibited two main peaks in Chemocobond ODS-W column chromatography. The retention time of the peak that eluted first coincided with the retention time of adenosine, while the retention time of the peak that eluted later (Peak B) coincided with that of isopentenyl adenosine.
  • After drying the fractions of Peaks A and B, they were dissolved in ethanol and analyzed by fast atom bombardment mass spectrometry (JMS-SX102 or JEOL Mstation, JOEL Datum Ltd.). As a result, a signal originating in the compound of Peak A was unable to be obtained, because of inhibition of ionization by the triphosphate group. Signals originating in the compound of Peak B were observed at m/z values of 336 and 204, with the former corresponding to isopentenyl adenosine, and the latter corresponding to a decomposition product of isopentenyl adenosine. On the basis of the above, Peak A was thought to be isopentenyl ATP (also referred to as iPTP), which is a compound resulting from the phosphatization of isopentenyl adenosine. [0073]
  • When the genes indicated with SEQ ID NOs. 2 and 6 were expressed in [0074] E. coli, both exhibited cytokinin synthesis activity. In addition, a cytokinin response was evoked in the case of excessive expression in plants of enzymes of the genes indicated in SEQ ID NOs. 2, 4, 6, 10 and 12. In addition, SEQ ID NOs. 2, 10, 12 and 14 or SEQ ID NOs. 4, 6 and 8 were clearly shown to be extremely closely related in terms of their respective molecular systems. Thus, each of these are considered to be cytokinin synthesis enzymes. Thus, it was possible to control cell division, differentiation, axillary bud length, regulation of nutrient distribution, inhibition of aging, reproductive growth and seed growth by controlling the expression of the genes of the present invention and their analogous genes. In addition, since they are plant genes, the appearance of toxicity and so forth of proteins expressed in plants into which these genes have been inserted is unlikely.
  • Since ATP can be efficiently used as a substrate of cytokinin synthesis, these genes are expected to function more effectively in plants than cytokinin synthesis genes originating in bacteria using AMP as substrate. [0075]
  • 0
    SEQUENCE LISTING
    <160> NUMBER OF SEQ ID NOS: 34
    <210> SEQ ID NO 1
    <211> LENGTH: 957
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT4)
    <400> SEQUENCE: 1
    atg aag tgt aat gac aaa atg gtt gtg atc atg ggt gcc acc ggt tct 48
    Met Lys Cys Asn Asp Lys Met Val Val Ile Met Gly Ala Thr Gly Ser
    1 5 10 15
    ggc aag tca tca ctc tct gtt gat ctc gct tta cat ttt aaa gcc gag 96
    Gly Lys Ser Ser Leu Ser Val Asp Leu Ala Leu His Phe Lys Ala Glu
    20 25 30
    atc atc aac tct gac aaa atg cag ttc tac gat ggc ttg aag atc acc 144
    Ile Ile Asn Ser Asp Lys Met Gln Phe Tyr Asp Gly Leu Lys Ile Thr
    35 40 45
    acg aat caa tcg acc att gaa gat cga cgt gga gtg cca cat cac ctt 192
    Thr Asn Gln Ser Thr Ile Glu Asp Arg Arg Gly Val Pro His His Leu
    50 55 60
    ctc ggt gaa cta aac ccg gag gct gga gaa gtc aca gcg gca gaa ttt 240
    Leu Gly Glu Leu Asn Pro Glu Ala Gly Glu Val Thr Ala Ala Glu Phe
    65 70 75 80
    cgc gtt atg gcg gct gaa gcc atc tcc gag att act caa cgt aaa aag 288
    Arg Val Met Ala Ala Glu Ala Ile Ser Glu Ile Thr Gln Arg Lys Lys
    85 90 95
    ctc cca atc ctt gcc ggt gga tcc aac tca tac att cat gct ctc ctt 336
    Leu Pro Ile Leu Ala Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu
    100 105 110
    gca aaa tct tat gac cct gaa aac tat ccg ttt tct gat cac aag ggc 384
    Ala Lys Ser Tyr Asp Pro Glu Asn Tyr Pro Phe Ser Asp His Lys Gly
    115 120 125
    tca atc tgc tcc gag ttg aaa tat gat tgt tgt ttc att tgg ata gat 432
    Ser Ile Cys Ser Glu Leu Lys Tyr Asp Cys Cys Phe Ile Trp Ile Asp
    130 135 140
    gtg gat cag tct gtg tta ttc gag tat ctt tct tta cgt ttg gat ctt 480
    Val Asp Gln Ser Val Leu Phe Glu Tyr Leu Ser Leu Arg Leu Asp Leu
    145 150 155 160
    atg atg aag tca ggt atg ttc gag gag atc gct gag ttc cac cgc tct 528
    Met Met Lys Ser Gly Met Phe Glu Glu Ile Ala Glu Phe His Arg Ser
    165 170 175
    aag aag gcc ccg aaa gag cca ttg ggg ata tgg aag gct ata gga gtg 576
    Lys Lys Ala Pro Lys Glu Pro Leu Gly Ile Trp Lys Ala Ile Gly Val
    180 185 190
    caa gag ttt gat gac tac ctc aaa atg tac aag tgg gac aat gac atg 624
    Gln Glu Phe Asp Asp Tyr Leu Lys Met Tyr Lys Trp Asp Asn Asp Met
    195 200 205
    gat aaa tgg gac cct atg aga aag gag gct tat gag aag gcg gtg aga 672
    Asp Lys Trp Asp Pro Met Arg Lys Glu Ala Tyr Glu Lys Ala Val Arg
    210 215 220
    gcc atc aaa gaa aac aca ttt cag ctc aca aag gat caa atc acg aag 720
    Ala Ile Lys Glu Asn Thr Phe Gln Leu Thr Lys Asp Gln Ile Thr Lys
    225 230 235 240
    atc aac aag ctg aga aat gcc ggg tgg gac ata aag aag gtg gat gct 768
    Ile Asn Lys Leu Arg Asn Ala Gly Trp Asp Ile Lys Lys Val Asp Ala
    245 250 255
    aca gca tcg ttt cga gag gca att agg gca gcc aag gaa ggc gaa ggt 816
    Thr Ala Ser Phe Arg Glu Ala Ile Arg Ala Ala Lys Glu Gly Glu Gly
    260 265 270
    gta gcc gag atg cag aga aag ata tgg aac aag gaa gtg ttg gaa ccg 864
    Val Ala Glu Met Gln Arg Lys Ile Trp Asn Lys Glu Val Leu Glu Pro
    275 280 285
    tgt gtg aag att gtc agg agc cac ttg gac caa ccg atc aac tat tat 912
    Cys Val Lys Ile Val Arg Ser His Leu Asp Gln Pro Ile Asn Tyr Tyr
    290 295 300
    tat tat tac ttt tat tta cta aaa aga ttt tta agt ctt aac tag 957
    Tyr Tyr Tyr Phe Tyr Leu Leu Lys Arg Phe Leu Ser Leu Asn
    305 310 315
    <210> SEQ ID NO 2
    <211> LENGTH: 318
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT4)
    <400> SEQUENCE: 2
    Met Lys Cys Asn Asp Lys Met Val Val Ile Met Gly Ala Thr Gly Ser
    1 5 10 15
    Gly Lys Ser Ser Leu Ser Val Asp Leu Ala Leu His Phe Lys Ala Glu
    20 25 30
    Ile Ile Asn Ser Asp Lys Met Gln Phe Tyr Asp Gly Leu Lys Ile Thr
    35 40 45
    Thr Asn Gln Ser Thr Ile Glu Asp Arg Arg Gly Val Pro His His Leu
    50 55 60
    Leu Gly Glu Leu Asn Pro Glu Ala Gly Glu Val Thr Ala Ala Glu Phe
    65 70 75 80
    Arg Val Met Ala Ala Glu Ala Ile Ser Glu Ile Thr Gln Arg Lys Lys
    85 90 95
    Leu Pro Ile Leu Ala Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu
    100 105 110
    Ala Lys Ser Tyr Asp Pro Glu Asn Tyr Pro Phe Ser Asp His Lys Gly
    115 120 125
    Ser Ile Cys Ser Glu Leu Lys Tyr Asp Cys Cys Phe Ile Trp Ile Asp
    130 135 140
    Val Asp Gln Ser Val Leu Phe Glu Tyr Leu Ser Leu Arg Leu Asp Leu
    145 150 155 160
    Met Met Lys Ser Gly Met Phe Glu Glu Ile Ala Glu Phe His Arg Ser
    165 170 175
    Lys Lys Ala Pro Lys Glu Pro Leu Gly Ile Trp Lys Ala Ile Gly Val
    180 185 190
    Gln Glu Phe Asp Asp Tyr Leu Lys Met Tyr Lys Trp Asp Asn Asp Met
    195 200 205
    Asp Lys Trp Asp Pro Met Arg Lys Glu Ala Tyr Glu Lys Ala Val Arg
    210 215 220
    Ala Ile Lys Glu Asn Thr Phe Gln Leu Thr Lys Asp Gln Ile Thr Lys
    225 230 235 240
    Ile Asn Lys Leu Arg Asn Ala Gly Trp Asp Ile Lys Lys Val Asp Ala
    245 250 255
    Thr Ala Ser Phe Arg Glu Ala Ile Arg Ala Ala Lys Glu Gly Glu Gly
    260 265 270
    Val Ala Glu Met Gln Arg Lys Ile Trp Asn Lys Glu Val Leu Glu Pro
    275 280 285
    Cys Val Lys Ile Val Arg Ser His Leu Asp Gln Pro Ile Asn Tyr Tyr
    290 295 300
    Tyr Tyr Tyr Phe Tyr Leu Leu Lys Arg Phe Leu Ser Leu Asn
    305 310 315
    <210> SEQ ID NO 3
    <211> LENGTH: 1011
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT3)
    <400> SEQUENCE: 3
    atg atc atg aag ata tct atg gct atg tgc aaa caa cca ttg cct cct 48
    Met Ile Met Lys Ile Ser Met Ala Met Cys Lys Gln Pro Leu Pro Pro
    1 5 10 15
    tcg ccg act tta gac ttc cct cca gcg aga ttt ggt ccc aat atg cta 96
    Ser Pro Thr Leu Asp Phe Pro Pro Ala Arg Phe Gly Pro Asn Met Leu
    20 25 30
    act cta aac cca tac ggt cca aag gac aaa gtt gtg gtc atc atg ggt 144
    Thr Leu Asn Pro Tyr Gly Pro Lys Asp Lys Val Val Val Ile Met Gly
    35 40 45
    gct acc ggg aca ggc aag tca cga ctc tcc gtg gat ata gcc aca cgt 192
    Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp Ile Ala Thr Arg
    50 55 60
    ttt cgg gct gag atc ata aac tca gac aag ata caa gtc cac caa ggt 240
    Phe Arg Ala Glu Ile Ile Asn Ser Asp Lys Ile Gln Val His Gln Gly
    65 70 75 80
    cta gac att gta acc aac aag atc acg agc gag gag agc tgc ggg gta 288
    Leu Asp Ile Val Thr Asn Lys Ile Thr Ser Glu Glu Ser Cys Gly Val
    85 90 95
    ccg cac cat ctc ctc ggc gtc ttg ccg cct gaa gcc gac tta acc gcc 336
    Pro His His Leu Leu Gly Val Leu Pro Pro Glu Ala Asp Leu Thr Ala
    100 105 110
    gcg aat tac tgt cac atg gcg aat ctc tcc att gaa tcc gtc cta aac 384
    Ala Asn Tyr Cys His Met Ala Asn Leu Ser Ile Glu Ser Val Leu Asn
    115 120 125
    cgt gga aag ctt cca atc atc gtt gga ggt tcc aac tct tac gtg gag 432
    Arg Gly Lys Leu Pro Ile Ile Val Gly Gly Ser Asn Ser Tyr Val Glu
    130 135 140
    gct cta gtg gat gac aaa gaa aac aag ttc agg tcg aga tac gac tgt 480
    Ala Leu Val Asp Asp Lys Glu Asn Lys Phe Arg Ser Arg Tyr Asp Cys
    145 150 155 160
    tgt ttt cta tgg gtg gac gtg gca ctt ccc gtt ttg cac ggg ttc gtg 528
    Cys Phe Leu Trp Val Asp Val Ala Leu Pro Val Leu His Gly Phe Val
    165 170 175
    tct gag aga gtt gac aag atg gtg gag agt gga atg gtt gag gaa gtc 576
    Ser Glu Arg Val Asp Lys Met Val Glu Ser Gly Met Val Glu Glu Val
    180 185 190
    aga gaa ttt ttc gac ttt tcg aac tct gat tac tca aga ggg atc aag 624
    Arg Glu Phe Phe Asp Phe Ser Asn Ser Asp Tyr Ser Arg Gly Ile Lys
    195 200 205
    aaa gca atc gga ttt ccg gag ttt gac agg ttt ttc agg aac gag cag 672
    Lys Ala Ile Gly Phe Pro Glu Phe Asp Arg Phe Phe Arg Asn Glu Gln
    210 215 220
    ttc ttg aat gtg gaa gac aga gaa gaa ctg tta agt aaa gtg ttg gaa 720
    Phe Leu Asn Val Glu Asp Arg Glu Glu Leu Leu Ser Lys Val Leu Glu
    225 230 235 240
    gaa ata aag agg aat aca ttt gag tta gct tgt agg cag aga gaa aag 768
    Glu Ile Lys Arg Asn Thr Phe Glu Leu Ala Cys Arg Gln Arg Glu Lys
    245 250 255
    atc gaa cgg ttg aga aaa gtg aag aag tgg tct att cag aga gtg gat 816
    Ile Glu Arg Leu Arg Lys Val Lys Lys Trp Ser Ile Gln Arg Val Asp
    260 265 270
    gcg act cca gtc ttt aca aag cga agg tcc aag atg gat gct aac gtg 864
    Ala Thr Pro Val Phe Thr Lys Arg Arg Ser Lys Met Asp Ala Asn Val
    275 280 285
    gcc tgg gag agg ctc gtg gct gga cca agc aca gat act gtg tcg cgg 912
    Ala Trp Glu Arg Leu Val Ala Gly Pro Ser Thr Asp Thr Val Ser Arg
    290 295 300
    ttt ctg ctg gac att gcc agc cga cga ccg ctc gtg gaa gct tca aca 960
    Phe Leu Leu Asp Ile Ala Ser Arg Arg Pro Leu Val Glu Ala Ser Thr
    305 310 315 320
    gcg gtt gcg gcc gcc atg gaa cgc gag ttg tcg cgg tgt cta gtg gcg 1008
    Ala Val Ala Ala Ala Met Glu Arg Glu Leu Ser Arg Cys Leu Val Ala
    325 330 335
    tga 1011
    <210> SEQ ID NO 4
    <211> LENGTH: 336
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT3)
    <400> SEQUENCE: 4
    Met Ile Met Lys Ile Ser Met Ala Met Cys Lys Gln Pro Leu Pro Pro
    1 5 10 15
    Ser Pro Thr Leu Asp Phe Pro Pro Ala Arg Phe Gly Pro Asn Met Leu
    20 25 30
    Thr Leu Asn Pro Tyr Gly Pro Lys Asp Lys Val Val Val Ile Met Gly
    35 40 45
    Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp Ile Ala Thr Arg
    50 55 60
    Phe Arg Ala Glu Ile Ile Asn Ser Asp Lys Ile Gln Val His Gln Gly
    65 70 75 80
    Leu Asp Ile Val Thr Asn Lys Ile Thr Ser Glu Glu Ser Cys Gly Val
    85 90 95
    Pro His His Leu Leu Gly Val Leu Pro Pro Glu Ala Asp Leu Thr Ala
    100 105 110
    Ala Asn Tyr Cys His Met Ala Asn Leu Ser Ile Glu Ser Val Leu Asn
    115 120 125
    Arg Gly Lys Leu Pro Ile Ile Val Gly Gly Ser Asn Ser Tyr Val Glu
    130 135 140
    Ala Leu Val Asp Asp Lys Glu Asn Lys Phe Arg Ser Arg Tyr Asp Cys
    145 150 155 160
    Cys Phe Leu Trp Val Asp Val Ala Leu Pro Val Leu His Gly Phe Val
    165 170 175
    Ser Glu Arg Val Asp Lys Met Val Glu Ser Gly Met Val Glu Glu Val
    180 185 190
    Arg Glu Phe Phe Asp Phe Ser Asn Ser Asp Tyr Ser Arg Gly Ile Lys
    195 200 205
    Lys Ala Ile Gly Phe Pro Glu Phe Asp Arg Phe Phe Arg Asn Glu Gln
    210 215 220
    Phe Leu Asn Val Glu Asp Arg Glu Glu Leu Leu Ser Lys Val Leu Glu
    225 230 235 240
    Glu Ile Lys Arg Asn Thr Phe Glu Leu Ala Cys Arg Gln Arg Glu Lys
    245 250 255
    Ile Glu Arg Leu Arg Lys Val Lys Lys Trp Ser Ile Gln Arg Val Asp
    260 265 270
    Ala Thr Pro Val Phe Thr Lys Arg Arg Ser Lys Met Asp Ala Asn Val
    275 280 285
    Ala Trp Glu Arg Leu Val Ala Gly Pro Ser Thr Asp Thr Val Ser Arg
    290 295 300
    Phe Leu Leu Asp Ile Ala Ser Arg Arg Pro Leu Val Glu Ala Ser Thr
    305 310 315 320
    Ala Val Ala Ala Ala Met Glu Arg Glu Leu Ser Arg Cys Leu Val Ala
    325 330 335
    <210> SEQ ID NO 5
    <211> LENGTH: 990
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT5)
    <400> SEQUENCE: 5
    atg aag cca tgc atg acg gct cta aga caa gtg att caa cca ttg tcg 48
    Met Lys Pro Cys Met Thr Ala Leu Arg Gln Val Ile Gln Pro Leu Ser
    1 5 10 15
    ttg aac ttc caa gga aac atg gtg gac gtt ccg ttt ttc cgg cga aaa 96
    Leu Asn Phe Gln Gly Asn Met Val Asp Val Pro Phe Phe Arg Arg Lys
    20 25 30
    gac aag gtt gtt ttc gtc atg gga gcc acc gga acc ggc aaa tct cgt 144
    Asp Lys Val Val Phe Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg
    35 40 45
    cta gcc att gac cta gcc act cgt ttt ccg gcg gag att gta aac tcc 192
    Leu Ala Ile Asp Leu Ala Thr Arg Phe Pro Ala Glu Ile Val Asn Ser
    50 55 60
    gac aag atc cag gtc tat aaa ggt cta gac att gtg act aac aaa gtc 240
    Asp Lys Ile Gln Val Tyr Lys Gly Leu Asp Ile Val Thr Asn Lys Val
    65 70 75 80
    act cct gag gaa agc ctt ggc gtt cct cac cac ctt ctc ggc acc gtc 288
    Thr Pro Glu Glu Ser Leu Gly Val Pro His His Leu Leu Gly Thr Val
    85 90 95
    cac gac act tac gaa gat ttc acg gcg gag gat ttt cag cgt gaa gca 336
    His Asp Thr Tyr Glu Asp Phe Thr Ala Glu Asp Phe Gln Arg Glu Ala
    100 105 110
    atc agg gcc gtc gag tca atc gtc cag aga gac cgt gtc ccg atc ata 384
    Ile Arg Ala Val Glu Ser Ile Val Gln Arg Asp Arg Val Pro Ile Ile
    115 120 125
    gcc ggt ggt tcc aat tct tac atc gag gct ctg gtc aac gat tgc gtt 432
    Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn Asp Cys Val
    130 135 140
    gac ttc cgg tta agg tat aat tgt tgc ttc ttg tgg gtc gac gtc tct 480
    Asp Phe Arg Leu Arg Tyr Asn Cys Cys Phe Leu Trp Val Asp Val Ser
    145 150 155 160
    aga ccg gtt tta cac tcg ttt gtc tcg gag cga gtt gat aag atg gtt 528
    Arg Pro Val Leu His Ser Phe Val Ser Glu Arg Val Asp Lys Met Val
    165 170 175
    gat atg ggt ctc gtc gac gag gtt cgc cgc atc ttc gat ccg tct tcg 576
    Asp Met Gly Leu Val Asp Glu Val Arg Arg Ile Phe Asp Pro Ser Ser
    180 185 190
    tcg gat tac tcc gct gga att cgc cga gcc att gga gtt cca gag ctc 624
    Ser Asp Tyr Ser Ala Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Leu
    195 200 205
    gac gaa ttt ctc cgt tcg gag atg cgg aat tat ccg gcg gag acg acg 672
    Asp Glu Phe Leu Arg Ser Glu Met Arg Asn Tyr Pro Ala Glu Thr Thr
    210 215 220
    gag aga ctt ctt gaa acg gcg atc gag aag att aaa gag aac act tgt 720
    Glu Arg Leu Leu Glu Thr Ala Ile Glu Lys Ile Lys Glu Asn Thr Cys
    225 230 235 240
    ttg ctt gcg tgt aga caa ttg cag aag att caa agg ctt tac aag cag 768
    Leu Leu Ala Cys Arg Gln Leu Gln Lys Ile Gln Arg Leu Tyr Lys Gln
    245 250 255
    tgg aag tgg aac atg cac cgt gtc gac gcg acg gag gtt ttt ctc cga 816
    Trp Lys Trp Asn Met His Arg Val Asp Ala Thr Glu Val Phe Leu Arg
    260 265 270
    cga gga gaa gaa gct gat gag gct tgg gat aac tca gtg gct cat ccg 864
    Arg Gly Glu Glu Ala Asp Glu Ala Trp Asp Asn Ser Val Ala His Pro
    275 280 285
    agc gca ctc gcc gtc gaa aag ttc ctt agt tac agc gat gac cac cat 912
    Ser Ala Leu Ala Val Glu Lys Phe Leu Ser Tyr Ser Asp Asp His His
    290 295 300
    ttg gaa ggc gcc aat att ctc cta ccg gag atc tct gcc gtt ccg cct 960
    Leu Glu Gly Ala Asn Ile Leu Leu Pro Glu Ile Ser Ala Val Pro Pro
    305 310 315 320
    ctt cca gcc gcc gtg gcg gcg att tcc cgg 990
    Leu Pro Ala Ala Val Ala Ala Ile Ser Arg
    325 330
    <210> SEQ ID NO 6
    <211> LENGTH: 330
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT5)
    <400> SEQUENCE: 6
    Met Lys Pro Cys Met Thr Ala Leu Arg Gln Val Ile Gln Pro Leu Ser
    1 5 10 15
    Leu Asn Phe Gln Gly Asn Met Val Asp Val Pro Phe Phe Arg Arg Lys
    20 25 30
    Asp Lys Val Val Phe Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg
    35 40 45
    Leu Ala Ile Asp Leu Ala Thr Arg Phe Pro Ala Glu Ile Val Asn Ser
    50 55 60
    Asp Lys Ile Gln Val Tyr Lys Gly Leu Asp Ile Val Thr Asn Lys Val
    65 70 75 80
    Thr Pro Glu Glu Ser Leu Gly Val Pro His His Leu Leu Gly Thr Val
    85 90 95
    His Asp Thr Tyr Glu Asp Phe Thr Ala Glu Asp Phe Gln Arg Glu Ala
    100 105 110
    Ile Arg Ala Val Glu Ser Ile Val Gln Arg Asp Arg Val Pro Ile Ile
    115 120 125
    Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn Asp Cys Val
    130 135 140
    Asp Phe Arg Leu Arg Tyr Asn Cys Cys Phe Leu Trp Val Asp Val Ser
    145 150 155 160
    Arg Pro Val Leu His Ser Phe Val Ser Glu Arg Val Asp Lys Met Val
    165 170 175
    Asp Met Gly Leu Val Asp Glu Val Arg Arg Ile Phe Asp Pro Ser Ser
    180 185 190
    Ser Asp Tyr Ser Ala Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Leu
    195 200 205
    Asp Glu Phe Leu Arg Ser Glu Met Arg Asn Tyr Pro Ala Glu Thr Thr
    210 215 220
    Glu Arg Leu Leu Glu Thr Ala Ile Glu Lys Ile Lys Glu Asn Thr Cys
    225 230 235 240
    Leu Leu Ala Cys Arg Gln Leu Gln Lys Ile Gln Arg Leu Tyr Lys Gln
    245 250 255
    Trp Lys Trp Asn Met His Arg Val Asp Ala Thr Glu Val Phe Leu Arg
    260 265 270
    Arg Gly Glu Glu Ala Asp Glu Ala Trp Asp Asn Ser Val Ala His Pro
    275 280 285
    Ser Ala Leu Ala Val Glu Lys Phe Leu Ser Tyr Ser Asp Asp His His
    290 295 300
    Leu Glu Gly Ala Asn Ile Leu Leu Pro Glu Ile Ser Ala Val Pro Pro
    305 310 315 320
    Leu Pro Ala Ala Val Ala Ala Ile Ser Arg
    325 330
    <210> SEQ ID NO 7
    <211> LENGTH: 990
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT7)
    <400> SEQUENCE: 7
    atg aag ttc tca atc tca tca ctg aag cag gta caa cca atc ttg tgc 48
    Met Lys Phe Ser Ile Ser Ser Leu Lys Gln Val Gln Pro Ile Leu Cys
    1 5 10 15
    ttc aag aac aag cta tct aag gtc aac gtc aac tct ttt ctc cat ccc 96
    Phe Lys Asn Lys Leu Ser Lys Val Asn Val Asn Ser Phe Leu His Pro
    20 25 30
    aaa gaa aaa gtc atc ttt gtg atg gga gct acc gga tcg ggt aag tct 144
    Lys Glu Lys Val Ile Phe Val Met Gly Ala Thr Gly Ser Gly Lys Ser
    35 40 45
    cgt ctc gcc atc gac cta gca act cgt ttt caa gga gag atc ata aac 192
    Arg Leu Ala Ile Asp Leu Ala Thr Arg Phe Gln Gly Glu Ile Ile Asn
    50 55 60
    tcc gac aag att caa ctt tac aag ggc cta gac gtc cta aca aac aaa 240
    Ser Asp Lys Ile Gln Leu Tyr Lys Gly Leu Asp Val Leu Thr Asn Lys
    65 70 75 80
    gtc acc cct aaa gaa tgc cga ggc gtg cct cac cac ttg ctt gga gta 288
    Val Thr Pro Lys Glu Cys Arg Gly Val Pro His His Leu Leu Gly Val
    85 90 95
    ttc gac tcc gaa gcc gga aac cta acg gcc acc cag tat agc cgc ctt 336
    Phe Asp Ser Glu Ala Gly Asn Leu Thr Ala Thr Gln Tyr Ser Arg Leu
    100 105 110
    gcg tca caa gca atc tcg aaa ctc tca gcg aac aac aag ctt ccc ata 384
    Ala Ser Gln Ala Ile Ser Lys Leu Ser Ala Asn Asn Lys Leu Pro Ile
    115 120 125
    gta gcc ggt gga tca aac tct tac atc gaa gca ctt gtt aat cat tcc 432
    Val Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn His Ser
    130 135 140
    tcg ggg ttt tta tta aac aac tac gat tgt tgt ttc att tgg gtc gac 480
    Ser Gly Phe Leu Leu Asn Asn Tyr Asp Cys Cys Phe Ile Trp Val Asp
    145 150 155 160
    gtt tcc tta ccc gta ctt aac tcc ttt gtc tca aaa cgt gtc gac cgc 528
    Val Ser Leu Pro Val Leu Asn Ser Phe Val Ser Lys Arg Val Asp Arg
    165 170 175
    atg atg gaa gca gga tta ctc gaa gaa gta aga gaa gtg ttc aat cca 576
    Met Met Glu Ala Gly Leu Leu Glu Glu Val Arg Glu Val Phe Asn Pro
    180 185 190
    aaa gcg aat tac tcc gta ggg ata cga cga gct atc gga gtc ccc gag 624
    Lys Ala Asn Tyr Ser Val Gly Ile Arg Arg Ala Ile Gly Val Pro Glu
    195 200 205
    ctc cat gaa tat tta cgt aac gaa tct cta gtg gac cgt gcc aca aaa 672
    Leu His Glu Tyr Leu Arg Asn Glu Ser Leu Val Asp Arg Ala Thr Lys
    210 215 220
    agt aaa atg ctt gac gta gcc gtt aaa aat atc aaa aag aac act gag 720
    Ser Lys Met Leu Asp Val Ala Val Lys Asn Ile Lys Lys Asn Thr Glu
    225 230 235 240
    att tta gct tgt cga cag tta aaa aag att caa cgg ctt cac aag aag 768
    Ile Leu Ala Cys Arg Gln Leu Lys Lys Ile Gln Arg Leu His Lys Lys
    245 250 255
    tgg aag atg tct atg cat cgt gtt gac gcc act gag gtg ttc ttg aaa 816
    Trp Lys Met Ser Met His Arg Val Asp Ala Thr Glu Val Phe Leu Lys
    260 265 270
    cgc aac gta gaa gaa caa gac gag gct tgg gag aat ctt gta gcg aga 864
    Arg Asn Val Glu Glu Gln Asp Glu Ala Trp Glu Asn Leu Val Ala Arg
    275 280 285
    cca agc gag aga atc gtc gat aag ttt tat aat aat aat aac caa ctg 912
    Pro Ser Glu Arg Ile Val Asp Lys Phe Tyr Asn Asn Asn Asn Gln Leu
    290 295 300
    aaa aat gat gat gtt gag cac tgt ttg gcg gca tct tac ggc gga gga 960
    Lys Asn Asp Asp Val Glu His Cys Leu Ala Ala Ser Tyr Gly Gly Gly
    305 310 315 320
    agt gga agt aga gcc cac aat atg ata tga 990
    Ser Gly Ser Arg Ala His Asn Met Ile
    325
    <210> SEQ ID NO 8
    <211> LENGTH: 329
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT7)
    <400> SEQUENCE: 8
    Met Lys Phe Ser Ile Ser Ser Leu Lys Gln Val Gln Pro Ile Leu Cys
    1 5 10 15
    Phe Lys Asn Lys Leu Ser Lys Val Asn Val Asn Ser Phe Leu His Pro
    20 25 30
    Lys Glu Lys Val Ile Phe Val Met Gly Ala Thr Gly Ser Gly Lys Ser
    35 40 45
    Arg Leu Ala Ile Asp Leu Ala Thr Arg Phe Gln Gly Glu Ile Ile Asn
    50 55 60
    Ser Asp Lys Ile Gln Leu Tyr Lys Gly Leu Asp Val Leu Thr Asn Lys
    65 70 75 80
    Val Thr Pro Lys Glu Cys Arg Gly Val Pro His His Leu Leu Gly Val
    85 90 95
    Phe Asp Ser Glu Ala Gly Asn Leu Thr Ala Thr Gln Tyr Ser Arg Leu
    100 105 110
    Ala Ser Gln Ala Ile Ser Lys Leu Ser Ala Asn Asn Lys Leu Pro Ile
    115 120 125
    Val Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn His Ser
    130 135 140
    Ser Gly Phe Leu Leu Asn Asn Tyr Asp Cys Cys Phe Ile Trp Val Asp
    145 150 155 160
    Val Ser Leu Pro Val Leu Asn Ser Phe Val Ser Lys Arg Val Asp Arg
    165 170 175
    Met Met Glu Ala Gly Leu Leu Glu Glu Val Arg Glu Val Phe Asn Pro
    180 185 190
    Lys Ala Asn Tyr Ser Val Gly Ile Arg Arg Ala Ile Gly Val Pro Glu
    195 200 205
    Leu His Glu Tyr Leu Arg Asn Glu Ser Leu Val Asp Arg Ala Thr Lys
    210 215 220
    Ser Lys Met Leu Asp Val Ala Val Lys Asn Ile Lys Lys Asn Thr Glu
    225 230 235 240
    Ile Leu Ala Cys Arg Gln Leu Lys Lys Ile Gln Arg Leu His Lys Lys
    245 250 255
    Trp Lys Met Ser Met His Arg Val Asp Ala Thr Glu Val Phe Leu Lys
    260 265 270
    Arg Asn Val Glu Glu Gln Asp Glu Ala Trp Glu Asn Leu Val Ala Arg
    275 280 285
    Pro Ser Glu Arg Ile Val Asp Lys Phe Tyr Asn Asn Asn Asn Gln Leu
    290 295 300
    Lys Asn Asp Asp Val Glu His Cys Leu Ala Ala Ser Tyr Gly Gly Gly
    305 310 315 320
    Ser Gly Ser Arg Ala His Asn Met Ile
    325
    <210> SEQ ID NO 9
    <211> LENGTH: 993
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT8)
    <400> SEQUENCE: 9
    atg caa aat ctt acg tcc aca ttc gtc tct cct tcc atg atc ccg atc 48
    Met Gln Asn Leu Thr Ser Thr Phe Val Ser Pro Ser Met Ile Pro Ile
    1 5 10 15
    act tct ccg cgg ctg cga ctg cca cca cca cga tca gta gtt ccc atg 96
    Thr Ser Pro Arg Leu Arg Leu Pro Pro Pro Arg Ser Val Val Pro Met
    20 25 30
    act acc gtt tgc atg gaa caa tca tac aag caa aaa gtg gtt gtg atc 144
    Thr Thr Val Cys Met Glu Gln Ser Tyr Lys Gln Lys Val Val Val Ile
    35 40 45
    atg gga gcc acc gga tca ggc aag tca tgc ctc tca atc gat cta gca 192
    Met Gly Ala Thr Gly Ser Gly Lys Ser Cys Leu Ser Ile Asp Leu Ala
    50 55 60
    act cgt ttc tct ggc gag atc gtc aat tcc gac aag att caa ttc tac 240
    Thr Arg Phe Ser Gly Glu Ile Val Asn Ser Asp Lys Ile Gln Phe Tyr
    65 70 75 80
    gat gga ttg aag gtc act acg aat caa atg agc atc ctt gag aga tgt 288
    Asp Gly Leu Lys Val Thr Thr Asn Gln Met Ser Ile Leu Glu Arg Cys
    85 90 95
    gga gtc cct cac cat ctc ctt ggt gag ctc cct ccg gat gat agc gaa 336
    Gly Val Pro His His Leu Leu Gly Glu Leu Pro Pro Asp Asp Ser Glu
    100 105 110
    cta act acc tcc gaa ttc cgc tct ttg gcg tcg cgg tcc atc tcc gag 384
    Leu Thr Thr Ser Glu Phe Arg Ser Leu Ala Ser Arg Ser Ile Ser Glu
    115 120 125
    att act gct cgt gga aac ctc ccg att ata gct ggt gga tca aac tcc 432
    Ile Thr Ala Arg Gly Asn Leu Pro Ile Ile Ala Gly Gly Ser Asn Ser
    130 135 140
    ttc att cat gct ctc ctt gtc gac cgt ttt gac ccc aaa acc tat cca 480
    Phe Ile His Ala Leu Leu Val Asp Arg Phe Asp Pro Lys Thr Tyr Pro
    145 150 155 160
    ttc tct tct gag aca tcc atc tct tcc ggc ttg agg tac gag tgt tgc 528
    Phe Ser Ser Glu Thr Ser Ile Ser Ser Gly Leu Arg Tyr Glu Cys Cys
    165 170 175
    ttc ctt tgg gtg gat gtc tca gtg tcg gtc ctg ttc gag tac ctc tcg 576
    Phe Leu Trp Val Asp Val Ser Val Ser Val Leu Phe Glu Tyr Leu Ser
    180 185 190
    aaa cgt gtc gac cag atg atg gag tca ggg atg ttc gag gag cta gcc 624
    Lys Arg Val Asp Gln Met Met Glu Ser Gly Met Phe Glu Glu Leu Ala
    195 200 205
    ggt ttc tac gac ccg aga tat tcc ggg tcc gca atc cga gcc cac ggg 672
    Gly Phe Tyr Asp Pro Arg Tyr Ser Gly Ser Ala Ile Arg Ala His Gly
    210 215 220
    att cac aag acc ata gga ata ccc gag ttc gac cgg tac ttc agc tta 720
    Ile His Lys Thr Ile Gly Ile Pro Glu Phe Asp Arg Tyr Phe Ser Leu
    225 230 235 240
    tac ccg cct gag aga aag cag aag atg tcc gaa tgg gac caa gca aga 768
    Tyr Pro Pro Glu Arg Lys Gln Lys Met Ser Glu Trp Asp Gln Ala Arg
    245 250 255
    aag ggg gcg tat gac gaa gct gtc caa gag atc aaa gag aac aca tgg 816
    Lys Gly Ala Tyr Asp Glu Ala Val Gln Glu Ile Lys Glu Asn Thr Trp
    260 265 270
    agg ctt gcg aag aag cag att gag agg atc atg aag ctg aaa agc agc 864
    Arg Leu Ala Lys Lys Gln Ile Glu Arg Ile Met Lys Leu Lys Ser Ser
    275 280 285
    gga tgg gac att cag agg ttg gac gct acg ccg tca ttt gga aga tcg 912
    Gly Trp Asp Ile Gln Arg Leu Asp Ala Thr Pro Ser Phe Gly Arg Ser
    290 295 300
    tca aga gag att tgg gac aat act gtt ttg gat gaa agc atc aag gtt 960
    Ser Arg Glu Ile Trp Asp Asn Thr Val Leu Asp Glu Ser Ile Lys Val
    305 310 315 320
    gtg aaa cgc ttc ttg gtg aaa gac aaa gtg tga 993
    Val Lys Arg Phe Leu Val Lys Asp Lys Val
    325 330
    <210> SEQ ID NO 10
    <211> LENGTH: 330
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT8)
    <400> SEQUENCE: 10
    Met Gln Asn Leu Thr Ser Thr Phe Val Ser Pro Ser Met Ile Pro Ile
    1 5 10 15
    Thr Ser Pro Arg Leu Arg Leu Pro Pro Pro Arg Ser Val Val Pro Met
    20 25 30
    Thr Thr Val Cys Met Glu Gln Ser Tyr Lys Gln Lys Val Val Val Ile
    35 40 45
    Met Gly Ala Thr Gly Ser Gly Lys Ser Cys Leu Ser Ile Asp Leu Ala
    50 55 60
    Thr Arg Phe Ser Gly Glu Ile Val Asn Ser Asp Lys Ile Gln Phe Tyr
    65 70 75 80
    Asp Gly Leu Lys Val Thr Thr Asn Gln Met Ser Ile Leu Glu Arg Cys
    85 90 95
    Gly Val Pro His His Leu Leu Gly Glu Leu Pro Pro Asp Asp Ser Glu
    100 105 110
    Leu Thr Thr Ser Glu Phe Arg Ser Leu Ala Ser Arg Ser Ile Ser Glu
    115 120 125
    Ile Thr Ala Arg Gly Asn Leu Pro Ile Ile Ala Gly Gly Ser Asn Ser
    130 135 140
    Phe Ile His Ala Leu Leu Val Asp Arg Phe Asp Pro Lys Thr Tyr Pro
    145 150 155 160
    Phe Ser Ser Glu Thr Ser Ile Ser Ser Gly Leu Arg Tyr Glu Cys Cys
    165 170 175
    Phe Leu Trp Val Asp Val Ser Val Ser Val Leu Phe Glu Tyr Leu Ser
    180 185 190
    Lys Arg Val Asp Gln Met Met Glu Ser Gly Met Phe Glu Glu Leu Ala
    195 200 205
    Gly Phe Tyr Asp Pro Arg Tyr Ser Gly Ser Ala Ile Arg Ala His Gly
    210 215 220
    Ile His Lys Thr Ile Gly Ile Pro Glu Phe Asp Arg Tyr Phe Ser Leu
    225 230 235 240
    Tyr Pro Pro Glu Arg Lys Gln Lys Met Ser Glu Trp Asp Gln Ala Arg
    245 250 255
    Lys Gly Ala Tyr Asp Glu Ala Val Gln Glu Ile Lys Glu Asn Thr Trp
    260 265 270
    Arg Leu Ala Lys Lys Gln Ile Glu Arg Ile Met Lys Leu Lys Ser Ser
    275 280 285
    Gly Trp Asp Ile Gln Arg Leu Asp Ala Thr Pro Ser Phe Gly Arg Ser
    290 295 300
    Ser Arg Glu Ile Trp Asp Asn Thr Val Leu Asp Glu Ser Ile Lys Val
    305 310 315 320
    Val Lys Arg Phe Leu Val Lys Asp Lys Val
    325 330
    <210> SEQ ID NO 11
    <211> LENGTH: 1071
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT1)
    <400> SEQUENCE: 11
    atg aca gaa ctc aac ttc cac ctc ctc cca ata atc tcc gat cgc ttc 48
    Met Thr Glu Leu Asn Phe His Leu Leu Pro Ile Ile Ser Asp Arg Phe
    1 5 10 15
    acg acg acg acg aca aca tca ccg tcg ttc tcg tca cat tct tct tct 96
    Thr Thr Thr Thr Thr Thr Ser Pro Ser Phe Ser Ser His Ser Ser Ser
    20 25 30
    tct tct tct ctt ctc tct ttc acc aaa cga aga cga aaa cac caa cct 144
    Ser Ser Ser Leu Leu Ser Phe Thr Lys Arg Arg Arg Lys His Gln Pro
    35 40 45
    tta gta tca tcc ata cgc atg gaa cag tca cgg tca cgg aat cgg aaa 192
    Leu Val Ser Ser Ile Arg Met Glu Gln Ser Arg Ser Arg Asn Arg Lys
    50 55 60
    gac aaa gtc gtc gtc att tta gga gca acc ggc gcc gga aaa tca aga 240
    Asp Lys Val Val Val Ile Leu Gly Ala Thr Gly Ala Gly Lys Ser Arg
    65 70 75 80
    ctt tcc gtc gat ctc gct act cgt ttc cct tca gag atc ata aac tcc 288
    Leu Ser Val Asp Leu Ala Thr Arg Phe Pro Ser Glu Ile Ile Asn Ser
    85 90 95
    gat aaa atc caa gtc tac gaa gga tta gag atc aca acg aat cag att 336
    Asp Lys Ile Gln Val Tyr Glu Gly Leu Glu Ile Thr Thr Asn Gln Ile
    100 105 110
    acg tta caa gac cgt cgc ggc gtt cct cac cat ctc ctc ggc gtc atc 384
    Thr Leu Gln Asp Arg Arg Gly Val Pro His His Leu Leu Gly Val Ile
    115 120 125
    aac ccc gaa cac ggc gaa cta acc gcc gga gag ttt cgc tcc gcc gct 432
    Asn Pro Glu His Gly Glu Leu Thr Ala Gly Glu Phe Arg Ser Ala Ala
    130 135 140
    tca aac gtc gtc aaa gag ata act tct cgt caa aag gtt ccg att atc 480
    Ser Asn Val Val Lys Glu Ile Thr Ser Arg Gln Lys Val Pro Ile Ile
    145 150 155 160
    gcc ggt gga tct aac tct ttc gtc cac gca ctc tta gct caa cga ttc 528
    Ala Gly Gly Ser Asn Ser Phe Val His Ala Leu Leu Ala Gln Arg Phe
    165 170 175
    gac cca aag ttc gat cct ttt tca tcc ggg tcg tgt tta atc agc tcc 576
    Asp Pro Lys Phe Asp Pro Phe Ser Ser Gly Ser Cys Leu Ile Ser Ser
    180 185 190
    gat ttg cgt tac gag tgt tgt ttc atc tgg gtc gat gta tcg gag act 624
    Asp Leu Arg Tyr Glu Cys Cys Phe Ile Trp Val Asp Val Ser Glu Thr
    195 200 205
    gtt ctc tac gag tat ctt ctc aga aga gtc gac gaa atg atg gat tca 672
    Val Leu Tyr Glu Tyr Leu Leu Arg Arg Val Asp Glu Met Met Asp Ser
    210 215 220
    ggt atg ttc gaa gag ctg tct aga ttc tac gac ccg gtt aaa tcc ggt 720
    Gly Met Phe Glu Glu Leu Ser Arg Phe Tyr Asp Pro Val Lys Ser Gly
    225 230 235 240
    tta gaa acc cgg ttt ggg att agg aaa gct ata ggt gta ccg gag ttt 768
    Leu Glu Thr Arg Phe Gly Ile Arg Lys Ala Ile Gly Val Pro Glu Phe
    245 250 255
    gac ggt tac ttc aaa gag tat cca ccg gag aag aag atg ata aag tgg 816
    Asp Gly Tyr Phe Lys Glu Tyr Pro Pro Glu Lys Lys Met Ile Lys Trp
    260 265 270
    gac gct tta aga aaa gcg gcg tac gat aag gcg gtt gat gat atc aaa 864
    Asp Ala Leu Arg Lys Ala Ala Tyr Asp Lys Ala Val Asp Asp Ile Lys
    275 280 285
    agg aac acg tgg acg tta gcg aag aga caa gtg aag aag att gag atg 912
    Arg Asn Thr Trp Thr Leu Ala Lys Arg Gln Val Lys Lys Ile Glu Met
    290 295 300
    cta aaa gac gct ggt tgg gaa ata gaa aga gtt gat gca acg gcg tcg 960
    Leu Lys Asp Ala Gly Trp Glu Ile Glu Arg Val Asp Ala Thr Ala Ser
    305 310 315 320
    ttt aaa gca gtg atg atg aag agt tcg tcg gag aag aag tgg aga gag 1008
    Phe Lys Ala Val Met Met Lys Ser Ser Ser Glu Lys Lys Trp Arg Glu
    325 330 335
    aat tgg gaa gag caa gtg ttg gag cca agc gta aag att gtg aag cgg 1056
    Asn Trp Glu Glu Gln Val Leu Glu Pro Ser Val Lys Ile Val Lys Arg
    340 345 350
    cat ttg gtg caa aat 1071
    His Leu Val Gln Asn
    355
    <210> SEQ ID NO 12
    <211> LENGTH: 357
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT1)
    <400> SEQUENCE: 12
    Met Thr Glu Leu Asn Phe His Leu Leu Pro Ile Ile Ser Asp Arg Phe
    1 5 10 15
    Thr Thr Thr Thr Thr Thr Ser Pro Ser Phe Ser Ser His Ser Ser Ser
    20 25 30
    Ser Ser Ser Leu Leu Ser Phe Thr Lys Arg Arg Arg Lys His Gln Pro
    35 40 45
    Leu Val Ser Ser Ile Arg Met Glu Gln Ser Arg Ser Arg Asn Arg Lys
    50 55 60
    Asp Lys Val Val Val Ile Leu Gly Ala Thr Gly Ala Gly Lys Ser Arg
    65 70 75 80
    Leu Ser Val Asp Leu Ala Thr Arg Phe Pro Ser Glu Ile Ile Asn Ser
    85 90 95
    Asp Lys Ile Gln Val Tyr Glu Gly Leu Glu Ile Thr Thr Asn Gln Ile
    100 105 110
    Thr Leu Gln Asp Arg Arg Gly Val Pro His His Leu Leu Gly Val Ile
    115 120 125
    Asn Pro Glu His Gly Glu Leu Thr Ala Gly Glu Phe Arg Ser Ala Ala
    130 135 140
    Ser Asn Val Val Lys Glu Ile Thr Ser Arg Gln Lys Val Pro Ile Ile
    145 150 155 160
    Ala Gly Gly Ser Asn Ser Phe Val His Ala Leu Leu Ala Gln Arg Phe
    165 170 175
    Asp Pro Lys Phe Asp Pro Phe Ser Ser Gly Ser Cys Leu Ile Ser Ser
    180 185 190
    Asp Leu Arg Tyr Glu Cys Cys Phe Ile Trp Val Asp Val Ser Glu Thr
    195 200 205
    Val Leu Tyr Glu Tyr Leu Leu Arg Arg Val Asp Glu Met Met Asp Ser
    210 215 220
    Gly Met Phe Glu Glu Leu Ser Arg Phe Tyr Asp Pro Val Lys Ser Gly
    225 230 235 240
    Leu Glu Thr Arg Phe Gly Ile Arg Lys Ala Ile Gly Val Pro Glu Phe
    245 250 255
    Asp Gly Tyr Phe Lys Glu Tyr Pro Pro Glu Lys Lys Met Ile Lys Trp
    260 265 270
    Asp Ala Leu Arg Lys Ala Ala Tyr Asp Lys Ala Val Asp Asp Ile Lys
    275 280 285
    Arg Asn Thr Trp Thr Leu Ala Lys Arg Gln Val Lys Lys Ile Glu Met
    290 295 300
    Leu Lys Asp Ala Gly Trp Glu Ile Glu Arg Val Asp Ala Thr Ala Ser
    305 310 315 320
    Phe Lys Ala Val Met Met Lys Ser Ser Ser Glu Lys Lys Trp Arg Glu
    325 330 335
    Asn Trp Glu Glu Gln Val Leu Glu Pro Ser Val Lys Ile Val Lys Arg
    340 345 350
    His Leu Val Gln Asn
    355
    <210> SEQ ID NO 13
    <211> LENGTH: 1029
    <212> TYPE: DNA
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Nucleotide sequence of DNA encoding cytokinin
    synthase-like protein (AtIPT6)
    <400> SEQUENCE: 13
    atg caa caa ctc atg acc ttg tta tca cca cca ctc tct cat tct tct 48
    Met Gln Gln Leu Met Thr Leu Leu Ser Pro Pro Leu Ser His Ser Ser
    1 5 10 15
    ctc ctt ccc acc gtc act acc aaa ttc ggg tca cca cga tta gtc act 96
    Leu Leu Pro Thr Val Thr Thr Lys Phe Gly Ser Pro Arg Leu Val Thr
    20 25 30
    acg tgc atg ggc cat gca ggg cgt aaa aat atc aag gat aag gtg gtt 144
    Thr Cys Met Gly His Ala Gly Arg Lys Asn Ile Lys Asp Lys Val Val
    35 40 45
    ctc atc aca ggt aca aca ggc aca ggc aag tca cgc ctc tca gtc gat 192
    Leu Ile Thr Gly Thr Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp
    50 55 60
    ctt gcc acc cgt ttt ttt ccc gcc gag atc ata aac tcg gac aaa atg 240
    Leu Ala Thr Arg Phe Phe Pro Ala Glu Ile Ile Asn Ser Asp Lys Met
    65 70 75 80
    caa atc tac aag gga ttc gag att gtc aca aat cta atc cca ctg cat 288
    Gln Ile Tyr Lys Gly Phe Glu Ile Val Thr Asn Leu Ile Pro Leu His
    85 90 95
    gag caa gga gga gtc ccg cac cat ctt cta ggt cag ttc cac cca caa 336
    Glu Gln Gly Gly Val Pro His His Leu Leu Gly Gln Phe His Pro Gln
    100 105 110
    gac ggt gaa ctc acc cct gca gag ttc cgt tct ttg gcg aca ctg tcc 384
    Asp Gly Glu Leu Thr Pro Ala Glu Phe Arg Ser Leu Ala Thr Leu Ser
    115 120 125
    atc tct aaa cta att tct agc aag aaa ctc ccg att gta gtt ggt gga 432
    Ile Ser Lys Leu Ile Ser Ser Lys Lys Leu Pro Ile Val Val Gly Gly
    130 135 140
    tcc aac tcc ttc aat cac gct cta ctc gcc gag cgt ttt gac ccg gat 480
    Ser Asn Ser Phe Asn His Ala Leu Leu Ala Glu Arg Phe Asp Pro Asp
    145 150 155 160
    att gat cca ttc tct ccc gga tcg agt ctt tca acg atc tgc tct gac 528
    Ile Asp Pro Phe Ser Pro Gly Ser Ser Leu Ser Thr Ile Cys Ser Asp
    165 170 175
    cta agg tac aaa tgt tgc atc tta tgg gtt gat gtt tta gag ccg gtt 576
    Leu Arg Tyr Lys Cys Cys Ile Leu Trp Val Asp Val Leu Glu Pro Val
    180 185 190
    ctg ttc caa cac ttg tgc aat cgt gtc gac caa atg atc gag tcg gga 624
    Leu Phe Gln His Leu Cys Asn Arg Val Asp Gln Met Ile Glu Ser Gly
    195 200 205
    ttg gtc gag cag ctt gcc gaa ttg tac gac cct gtt gta gat tcg ggt 672
    Leu Val Glu Gln Leu Ala Glu Leu Tyr Asp Pro Val Val Asp Ser Gly
    210 215 220
    cga cga cta ggg gtt cgg aag acg ata gga gta gag gag ttc gac cga 720
    Arg Arg Leu Gly Val Arg Lys Thr Ile Gly Val Glu Glu Phe Asp Arg
    225 230 235 240
    tac ttt aga gta tac cct aag gag atg gac aag gga att tgg gac tta 768
    Tyr Phe Arg Val Tyr Pro Lys Glu Met Asp Lys Gly Ile Trp Asp Leu
    245 250 255
    gcg aga aag gcg gcg tac gag gag aca gtg aag ggg atg aaa gag agg 816
    Ala Arg Lys Ala Ala Tyr Glu Glu Thr Val Lys Gly Met Lys Glu Arg
    260 265 270
    aca tgt cgg ttg gtg aag aag cag aaa gag aag atc atg aag ctg ata 864
    Thr Cys Arg Leu Val Lys Lys Gln Lys Glu Lys Ile Met Lys Leu Ile
    275 280 285
    aga ggt ggt tgg gag att aag agg ctt gac gct acg gcg gca att atg 912
    Arg Gly Gly Trp Glu Ile Lys Arg Leu Asp Ala Thr Ala Ala Ile Met
    290 295 300
    gct gag ctg aat caa agt acg gca aag gga gaa gga aag aat ggg aga 960
    Ala Glu Leu Asn Gln Ser Thr Ala Lys Gly Glu Gly Lys Asn Gly Arg
    305 310 315 320
    gag att tgg gaa aaa cac att gtg gat gaa agt gtc gag att gtc aag 1008
    Glu Ile Trp Glu Lys His Ile Val Asp Glu Ser Val Glu Ile Val Lys
    325 330 335
    aag ttt ttg ttg gaa gtt tag 1029
    Lys Phe Leu Leu Glu Val
    340
    <210> SEQ ID NO 14
    <211> LENGTH: 342
    <212> TYPE: PRT
    <213> ORGANISM: Arabidopsis thaliana
    <223> OTHER INFORMATION: Amino acid sequence of cytokinin synthase-like
    protein (AtIPT6)
    <400> SEQUENCE: 14
    Met Gln Gln Leu Met Thr Leu Leu Ser Pro Pro Leu Ser His Ser Ser
    1 5 10 15
    Leu Leu Pro Thr Val Thr Thr Lys Phe Gly Ser Pro Arg Leu Val Thr
    20 25 30
    Thr Cys Met Gly His Ala Gly Arg Lys Asn Ile Lys Asp Lys Val Val
    35 40 45
    Leu Ile Thr Gly Thr Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp
    50 55 60
    Leu Ala Thr Arg Phe Phe Pro Ala Glu Ile Ile Asn Ser Asp Lys Met
    65 70 75 80
    Gln Ile Tyr Lys Gly Phe Glu Ile Val Thr Asn Leu Ile Pro Leu His
    85 90 95
    Glu Gln Gly Gly Val Pro His His Leu Leu Gly Gln Phe His Pro Gln
    100 105 110
    Asp Gly Glu Leu Thr Pro Ala Glu Phe Arg Ser Leu Ala Thr Leu Ser
    115 120 125
    Ile Ser Lys Leu Ile Ser Ser Lys Lys Leu Pro Ile Val Val Gly Gly
    130 135 140
    Ser Asn Ser Phe Asn His Ala Leu Leu Ala Glu Arg Phe Asp Pro Asp
    145 150 155 160
    Ile Asp Pro Phe Ser Pro Gly Ser Ser Leu Ser Thr Ile Cys Ser Asp
    165 170 175
    Leu Arg Tyr Lys Cys Cys Ile Leu Trp Val Asp Val Leu Glu Pro Val
    180 185 190
    Leu Phe Gln His Leu Cys Asn Arg Val Asp Gln Met Ile Glu Ser Gly
    195 200 205
    Leu Val Glu Gln Leu Ala Glu Leu Tyr Asp Pro Val Val Asp Ser Gly
    210 215 220
    Arg Arg Leu Gly Val Arg Lys Thr Ile Gly Val Glu Glu Phe Asp Arg
    225 230 235 240
    Tyr Phe Arg Val Tyr Pro Lys Glu Met Asp Lys Gly Ile Trp Asp Leu
    245 250 255
    Ala Arg Lys Ala Ala Tyr Glu Glu Thr Val Lys Gly Met Lys Glu Arg
    260 265 270
    Thr Cys Arg Leu Val Lys Lys Gln Lys Glu Lys Ile Met Lys Leu Ile
    275 280 285
    Arg Gly Gly Trp Glu Ile Lys Arg Leu Asp Ala Thr Ala Ala Ile Met
    290 295 300
    Ala Glu Leu Asn Gln Ser Thr Ala Lys Gly Glu Gly Lys Asn Gly Arg
    305 310 315 320
    Glu Ile Trp Glu Lys His Ile Val Asp Glu Ser Val Glu Ile Val Lys
    325 330 335
    Lys Phe Leu Leu Glu Val
    340
    <210> SEQ ID NO 15
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 398
    <400> SEQUENCE: 15
    tcccccgggc gatgatgatg ttaaacccta gc 32
    <210> SEQ ID NO 16
    <211> LENGTH: 36
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 399
    <400> SEQUENCE: 16
    tcccccgggt caatttactt ctgcttcttg aacttc 36
    <210> SEQ ID NO 17
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 421
    <400> SEQUENCE: 17
    aaaatgaagt gtaatgacaa aatggttgtg 30
    <210> SEQ ID NO 18
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 407
    <400> SEQUENCE: 18
    gtccaaacta gttaagactt aaaaatc 27
    <210> SEQ ID NO 19
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 703
    <400> SEQUENCE: 19
    caccagcaag tttatattgc aaagcgt 27
    <210> SEQ ID NO 20
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 705
    <400> SEQUENCE: 20
    gttgtaacca cgtaaaagat aagggtg 27
    <210> SEQ ID NO 21
    <211> LENGTH: 35
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 480
    <400> SEQUENCE: 21
    ggaattccat atgaagtgta atgacaaaat ggttg 35
    <210> SEQ ID NO 22
    <211> LENGTH: 35
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 481
    <400> SEQUENCE: 22
    gaagatctgt ccaaactagt taagacttaa aaatc 35
    <210> SEQ ID NO 23
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 550
    <400> SEQUENCE: 23
    gatccccggc atatgatgat gttaaaccct agc 33
    <210> SEQ ID NO 24
    <211> LENGTH: 38
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 551
    <400> SEQUENCE: 24
    acggtaccca tatgtcaatt tacttctgct tcttgaac 38
    <210> SEQ ID NO 25
    <211> LENGTH: 34
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 741
    <400> SEQUENCE: 25
    ttatacatat gaagccatgc atgacggctc taag 34
    <210> SEQ ID NO 26
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 742
    <400> SEQUENCE: 26
    cgggatcctc accgggaaat cgccgcca 28
    <210> SEQ ID NO 27
    <211> LENGTH: 46
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 852
    <400> SEQUENCE: 27
    ctcgagttgg cgcgccaccc gggattaatt aagactagtg gggtac 46
    <210> SEQ ID NO 28
    <211> LENGTH: 42
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 853
    <400> SEQUENCE: 28
    cccactagtc ttaattaatc ccgggtggcg cgccaactcg ag 42
    <210> SEQ ID NO 29
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 918
    <400> SEQUENCE: 29
    atgacagaac tcaacttcca cct 23
    <210> SEQ ID NO 30
    <211> LENGTH: 36
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 879
    <400> SEQUENCE: 30
    caaaaaaaag atctaatttt gcaccaaatg ccgctt 36
    <210> SEQ ID NO 31
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 533
    <400> SEQUENCE: 31
    attatgcaaa atcttacgtc cacattcgtc 30
    <210> SEQ ID NO 32
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 881
    <400> SEQUENCE: 32
    acaggatcct cacactttgt ctttcaccaa g 31
    <210> SEQ ID NO 33
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 856
    <400> SEQUENCE: 33
    ccgctcgaga tgaagccatg catgacggct c 31
    <210> SEQ ID NO 34
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <221> NAME/KEY:
    <222> LOCATION:
    <223> OTHER INFORMATION: Primer 857
    <400> SEQUENCE: 34
    ggactagtca ccgggaaatc gccgcca 27

Claims (14)

1. A gene encoding a protein having cytokinin synthesis activity and an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14.
2. A gene encoding a protein having cytokinin synthesis activity and which has a modified amino acid sequence resulting from the addition and/or deletion of one or a plurality of amino acids and/or substitution by other amino acids in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14.
3. A gene encoding a protein having cytokinin synthesis activity and which hybridizes with a nucleic acid or portion thereof having a nucleotide sequence described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13 under stringent conditions.
4. A protein encoded by a gene according to any of claims 1 through 3.
5. A vector comprising a gene according to any of claims 1 through 3.
6. A host transformed by a vector according to claim 5.
7. A host according to claim 6, wherein the transformed host is a plant or plant cells.
8. A production method of cytokinin synthase comprising: culturing or growing the host according to claim 6 or 7, and harvesting the cytokinin synthase from said host.
9. A plant or plant cells into which the gene according to any of claims 1 through 3 has been inserted.
10. A method for regulating the growth of a plant or plant cells by inserting a gene according to any of claims 1 through 3 into a plant or plant cells and expressing said gene.
11. A method for inducing adventitious bud formation by a plant or plant cells by inserting a gene according to any of claims 1 through 3 into a plant or plant cells, and expressing said gene.
12. A method for searching for a plant gene that encodes an isopentenyl group transferase based on homology with the amino acid sequence GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI][VLI]xxDxxQx[57,60][VLI] [VLI]xGG[ST] (where, x indicates an arbitrary amino acid residue, amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein, and [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b).
13. A method according to claim 12, wherein the plant gene that encodes an isopentenyl group transferase is a gene originating in Arabidopsis thaliana.
14. A method according to claim 12 or claim 13, wherein the plant gene that encodes an isopentenyl group transferase is a gene that encodes cytokinin synthase.
US10/471,040 2001-03-12 2002-03-12 Genes encoding protein participating in cytokinin synthesis Abandoned US20040177403A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/398,550 US7807867B2 (en) 2001-03-12 2006-04-06 Gene encoding protein involved in cytokinin synthesis

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2001-69489 2001-03-12
JP2001069489 2001-03-12
PCT/JP2002/002315 WO2002072818A1 (en) 2001-03-12 2002-03-12 Genes encoding proteins participating in cytokinin synthesis

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/398,550 Division US7807867B2 (en) 2001-03-12 2006-04-06 Gene encoding protein involved in cytokinin synthesis

Publications (1)

Publication Number Publication Date
US20040177403A1 true US20040177403A1 (en) 2004-09-09

Family

ID=18927516

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/471,040 Abandoned US20040177403A1 (en) 2001-03-12 2002-03-12 Genes encoding protein participating in cytokinin synthesis
US11/398,550 Expired - Fee Related US7807867B2 (en) 2001-03-12 2006-04-06 Gene encoding protein involved in cytokinin synthesis

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/398,550 Expired - Fee Related US7807867B2 (en) 2001-03-12 2006-04-06 Gene encoding protein involved in cytokinin synthesis

Country Status (10)

Country Link
US (2) US20040177403A1 (en)
EP (1) EP1384776B1 (en)
JP (1) JP4334228B2 (en)
CN (1) CN1496401B (en)
AT (1) ATE441708T1 (en)
AU (1) AU2002237573B2 (en)
CA (1) CA2441791A1 (en)
DE (1) DE60233563D1 (en)
NZ (1) NZ528152A (en)
WO (1) WO2002072818A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050164370A1 (en) * 2003-10-10 2005-07-28 Sumitomo Chemical Company, Limited Transformed cell co-expressing cytokinin receptor and cytokinin biosynthesis enzyme

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060064786A1 (en) * 2004-09-17 2006-03-23 Pioneer Hi-Bred International, Inc. Isopentenyl transferase sequences and methods of use
AU2007211057A1 (en) 2006-02-01 2007-08-09 Pioneer Hi-Bred International, Inc. Soybean isopentenyl transferase genes and methods of use
JPWO2008029942A1 (en) 2006-09-04 2010-01-21 独立行政法人理化学研究所 Utilization of active cytokinin synthase gene
DE112008001730T5 (en) * 2007-06-29 2010-06-02 Basf Plant Science Gmbh Plants with improved yield-related traits and methods for their production
WO2015101709A1 (en) * 2013-12-30 2015-07-09 Stora Enso Oyj A method for improving stem volume growth and biomass production in trees

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5689042A (en) * 1995-03-29 1997-11-18 Wisconsin Alumni Research Foundation Transgenic plants with altered senescence characteristics

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2253956C (en) * 1996-05-09 2007-10-02 Nippon Paper Industries Co., Ltd. Vector for introducing a gene into a plant from which a selectable marker gene can be optionally removed
EP1033405A3 (en) * 1999-02-25 2001-08-01 Ceres Incorporated Sequence-determined DNA fragments and corresponding polypeptides encoded thereby

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5689042A (en) * 1995-03-29 1997-11-18 Wisconsin Alumni Research Foundation Transgenic plants with altered senescence characteristics

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050164370A1 (en) * 2003-10-10 2005-07-28 Sumitomo Chemical Company, Limited Transformed cell co-expressing cytokinin receptor and cytokinin biosynthesis enzyme

Also Published As

Publication number Publication date
US20060236431A1 (en) 2006-10-19
EP1384776B1 (en) 2009-09-02
EP1384776A1 (en) 2004-01-28
CN1496401A (en) 2004-05-12
CA2441791A1 (en) 2002-09-19
US7807867B2 (en) 2010-10-05
JPWO2002072818A1 (en) 2004-07-02
AU2002237573B2 (en) 2008-02-28
ATE441708T1 (en) 2009-09-15
JP4334228B2 (en) 2009-09-30
EP1384776A4 (en) 2004-12-22
DE60233563D1 (en) 2009-10-15
WO2002072818A1 (en) 2002-09-19
CN1496401B (en) 2010-05-26
NZ528152A (en) 2008-06-30

Similar Documents

Publication Publication Date Title
US6444875B1 (en) Imidazolinone resistant AHAS mutants
US20020094557A1 (en) Synthases
CN101421295A (en) Genes for enhancing nitrogen utilization efficiency in crop plants
US7807867B2 (en) Gene encoding protein involved in cytokinin synthesis
Matsuoka et al. Control of plant growth and development by overexpressing MAP3K17, an ABA-inducible MAP3K, in Arabidopsis
US10550409B2 (en) Drimenol synthases III
US20030172405A1 (en) Rice-origin gibberellin 3beta-hydroxylase genes and utilization thereof
WO2000047747A2 (en) Maize glutathione-s-transferase enzymes
JP4334584B2 (en) Genes encoding proteins involved in cytokinin synthesis
WO2008029942A1 (en) Use of activated cytokinin-biosynthesizing enzyme gene
KR100510430B1 (en) Novel polypeptide having function of 7-keto-8-aminopelargonic acid synthase of plant and method for inducing growth inhibition and lethality by suppressing expression of the polypeptide
US6930227B1 (en) Camellia sinensis gene encoding a caffeine synthesis associated n-methyl transferase with 7-methylxanthine n3 methyl transferase, theobromine n1 methyl transferase, and paraxanthine n3 methyl transferase activities and use thereof
WO2001018191A2 (en) Polynucleotides and polypeptides of the phosphoenolpyruvate carboxylase kinase (pepc kinase) family and their variants
AU782201B2 (en) Gene coding for protein involved in cytokinin signal transduction
US20030167513A1 (en) Selection and use of isopropylmalate synthase (IPMS) mutants desensitized in L-leucine negative feedback control
CN109897860B (en) Wheat UDP-glucosyltransferase TaUGT6 and application thereof
JP3522042B2 (en) Phosphate transporter gene promoter
AU6023000A (en) Homeobox gene encoding a protein involved in differentiation
CN117568395A (en) OsPCRKs gene and application thereof in regulating resistance of rice to rice blast
de Oliveira c19) United States c12) Patent Application Publication

Legal Events

Date Code Title Description
AS Assignment

Owner name: NIPPON PAPER INDUSTRIES CO., LTD., JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KAKIMOTO, TATSUO;SAKAKIBARA, HITOSHI;REEL/FRAME:015003/0221

Effective date: 20030825

Owner name: SUNTORY LIMITED, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KAKIMOTO, TATSUO;SAKAKIBARA, HITOSHI;REEL/FRAME:015003/0221

Effective date: 20030825

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION