WO2001018191A2 - Polynucleotides and polypeptides of the phosphoenolpyruvate carboxylase kinase (pepc kinase) family and their variants - Google Patents

Abstract

The present invention relates to polynucleotides and polypeptides of the phosphoenolpyruvate carboxylase kinase (PEPc kinase) family, as well as their variants. The invention further relates to the use of the polynucleotides of the phosphoenolpyruvate carboxylase kinase family for production of transgenic plants.

Description

PLANT GENE The present invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their variants, agonists and antagonists thereof, and their uses. In particular, the invention relates to polynucleotides and polypeptides of the phosphoenolpyruvate carboxylase kinase (PEPc kinase) family, as well as their variants, hereinafter referred to as "PEPc kinase", "PEPc kinase polynucleotide (s) " and "PEPc kinase polypeptide (s) " as the case can be.

In CAM, C₃ and C₄ plants, PEPc kinase regulates the activity of phosphoenolpyruvate carboxylase by reversible phosphorylation (Carter et al., 1991; Jiao et al. , 1991; McNaughton et al.; 1991). Phosphoenolpyruvate carboxylase (EC4.1.1.31, PEPc) catalyses the fixation of C0₂ (as HC0₃ ^") to yield oxaloacetate. In plants that exhibit Crassulacean acid metabolism (CAM) or C₄ metabolism, PEP carboxylase catalyses the primary fixation step in atmospheric C0₂ assimilation, while in C₃ plants it plays an anaplerotic role (Andreo et al . , 1987; O'Leary, 1982). It also plays a specialised role in the provision of malate in legume root nodules and stomatal guard cells. In the characteristic diurnal pattern of CAM, flux through PEP carboxylase at night leads to the formation of malic acid, which is stored in the vacuole. During the following day, malate released from the vacuole is decarboxylated, and the resulting C0₂ is fixed in the Calvin cycle (Osmond and Holtu , 1981) . Some CAM plants exhibit circadian rhythms of C0₂ metabolism that arise through circadian control of the flux through PEP carboxylase (Wilkins, 1992) .

Higher plant PEP carboxylase is an allosteric enzyme, activated by glucose-6-phosphate and inhibited by malate (Andreo et al . , 1987). Reversible phosphorylation by PEPc kinase reduces the sensitivity of PEP carboxylase to inhibition by malate; it becomes phosphorylated, and more active in vivo, in the dark in CAM leaf tissue, but becomes phosphorylated in response to illumination in C₄ and C₃ leaf tissue (Duff and Chollet, 1995; Jiao and Chollet, 1988; Nim o et al . , 1984, 1987; Smith et al . , 1996). It also becomes phosphorylated in response to photosynthate in legume root nodules and to fusicoccin in guard cells (Zhang et al., 1995; Du et al., 1997). In the CAM plant Bryophyllum (Kalanchoe) fedtschenkox , the activity of PEPc kinase exhibits a circadian rhythm which correlates with that of the phosphorylation state of PEP carboxylase and contributes to the circadian rhythms of C0₂ metabolism (Carter et al . , 1991). The circadian disappearance of PEPc kinase activity can be delayed by low, and accelerated by high, temperature treatments, respectively (Carter et al . , 1995) . In C₄ and C₃ plants, PEPc kinase activity increases upon illumination; this increase is blocked by inhibitors of photosynthetic electron transport and is reversed in darkness (Bakrim et al . , 1992; Duff and Chollet, 1995; Echevarria et al . , 1990; McNaughton et al . , 1991; Smith et al . , 1996). The regulation of PEP carboxylase by reversible phosphorylation in higher plants shows one particularly noteworthy feature. No evidence has been obtained to indicate that the PEPc kinase activity responsible for in vivo phosphorylation of PEPc is regulated either directly by a second messenger or by a phosphorylation cascade.

Instead, experiments involving the use of protein and RNA synthesis inhibitors have shown that kinase activity is regulated in a process that involves protein synthesis/degradation (Carter et al . , 1991; Duff and

Chollet, 1995; Jiao et al . , 1991; Nimmo, 1993; Smith et al . , 1996). Moreover, there have been no reports of the isolation of antibodies to the enzyme, nor has its gene been cloned. It has therefore not been possible to ascertain whether the component which must be synthesized for kinase activity to appear is the kinase protein itself or another component that activates the kinase.

It is thus one of the main objectives of the present invention to identify and isolate DNA molecules encoding a phosphoenolpyruvate carboxylase kinase (hereinafter referred to a PEPc kinase) enzyme from a plant source.

Accordingly, the present invention provides an isolated DNA molecule encoding a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme or fragments thereof from a plant source.

PEPc kinase catalyses the transfer of the γ-phosphate group of ATP to a highly conserved serine residue of PEPc, close to the N-terminal end of the protein, in the sequence SIDAQ (see Vidal & Chollet, 1997 for an alignment of the region around the phosphorylation site of PEP carboxylase of different plant species) .

For the purposes of the description "nucleotide sequence" will be referred to as DNA unless there is different indication but is understood to be non-limiting and may include RNA, cDNA etc.

The present invention further provides an isolated DNA molecule encoding a protein from a plant, such as from the division spermataphyta, for example gymnosperms and angiosperms such as a dicotyledones and monocotyledones, for example from the family Crassulaceae, such as Kalanchoe fedtschenkoi , from the family of Brassicaceae, such as Brassica napus and Arabidopsis thaliana, from the family of Musaceae, such as banana, from the family of Solanaceae, such as tomato, from the family of Poaceae, such as rice, from the family of Malvaceae, such as cotton, from C₄ plants (e.g. maize, sugarcane, sorghum, etc), CAM plants (e.g. pineapple, etc) , C₃ plants including tuberous crops (e.g. potato, yam, sweet potato, etc) , cereals (e.g. wheat, oats, barley, etc) , legumes (e.g. soybean, etc) , oilseeds (e.g. sunflower, etc.), harvested products (e.g. grape, soft fruits such as raspberries, lettuce, onion, celery, tea, etc.), flax, ornamental tubers (e.g. Dahlia, etc), bulbs (e.g. Daffodil, Narcissus, Amaryllis, etc), having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity. The complete genomic and cDNA sequences encoding PEPc kinase isolated from a Kalanchoe species and an Arabidopsis species are shown in Figures 1, 2, 5, 6, 24 and 25. Partial and full sequences encoding PEPc kinase isolated from a banana, tomato, cotton and rice plant, a Brassica species and soybean are shown in Figures 8, 10, 12, 14, 16, 30, 32 and 34.

In particular, the invention provides isolated DNA molecules comprising the coding sequences for PEPc kinase enzymes from a plant, such as from the division spermataphyta, for example gymnosperms and angiosperms such as dicotyledones and monocotyledones , for example from the family Crassulaceae, such as Kalanchoe fedtschenkoi , from the family of Brassicaceae, such as Brassica napus and Arabidopsis thaliana , from the family of Musaceae, such as banana, from the family of Solanaceae, such as tomato, from the family of Poaceae, such as rice, from the family of Malvaceae, such as cotton, from C₄ plants (e.g. maize, sugarcane, sorghum, etc) CAM plants (e.g. pineapple, etc) C₃ plants including tuberous crops (e.g. potato, yam, sweet potato, etc) , cereals (e.g. wheat, oats, barley, etc) , legumes (e.g. soybean), oilseeds (e.g. sunflower, etc.), harvested products (e.g. grape, soft fruits such as raspberries, lettuce, onion, celery, tea, etc) , flax, ornamental tubers (e.g. Dahlia, etc), bulbs (e.g. Daffodil, Narcissus, Amaryllis, etc) . The complete deduced amino acid sequences for PEPc kinase from a Kalanchoe species and an Arabidopsis species are shown in Figures 4, 7 and 26. Partial and full deduced amino acid sequences for PEPc kinase from a banana, tomato, cotton and rice plant, a Brassica species and soybean are shown in Figures 9, 11, 13, 15, 17, 31, 33 and 35.

Sequence comparisons between the sequences of the present invention and sequences deposited in databases such as GENBANK and EMBL have been carried out. As a result, a full-length genomic sequence has been identified in Genbank and the Arabidopsis Biological Resource Centre as having homology with the present sequences and in particular the sequence of the PEPc kinase of A. Thaliana . However, it was noted that the genomic sequence had an incorrect annotation as a result of the presence of one intron being overlooked.

Using the information provided by the present invention, the DNA coding sequence for a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme from any plant source may now be obtained using standard methods, for example, by employing consensus oligonucleotides and PCR. Furthermore, any promoter (s) associated with the PEPc kinase gene may also be identified using the information provided by the present invention.

The invention still further provides a nucleotide sequence which is similar to the disclosed DNA sequences. By "similar" is meant a sequence which is capable of hybridising to a sequence which is complementary to the inventive nucleotide sequence. When the similar sequence and inventive sequence are double stranded the nucleic acid constituting the similar sequence preferably has a T_m within 20°C of that of the inventive sequence. In the case that the similar and inventive sequences are mixed together and denatured simultaneously, the Tm values of the sequences are preferably within 10°C of each other. More preferably hybridization may be performed under stringent conditions, with either the similar or inventive DNA preferably being supported. Thus for example either a denatured similar or inventive sequence is preferably first bound to a support and hybridization may be effected for a specified period of time at a temperature of between 50 and 70°C in double strength SSC (2xNaCl 17.5g/l and sodium citrate (SC) at 8.8g/l) buffered saline containing 0.1% sodium dodecyl sulphate (SDS) followed by rinsing of the support at the same temperature but with a buffer having a reduced SSC concentration. Depending upon the degree of stringency required, and thus the degree of similarity of the sequences, such reduced concentration buffers are typically single strength SSC containing 0.1%SDS, half strength SSC containing 0.1%SDS and one tenth strength SSC containing 0.1%SDS. Sequences having the greatest degree of similarity are those the hybridization of which is least affected by washing in buffers of reduced concentration. It is most preferred that the similar and inventive sequences are so similar that the hybridization between them is substantially unaffected by washing or incubation at high stringency, for example, in one tenth strength sodium citrate buffer containing 0.1% SDS. Therefore, the invention still further provides a nucleotide sequence which is complementary to one which hybridizes under stringent conditions with the above disclosed nucleotide sequences. The present invention therefore provides nucleotide sequences which are 70%, 80%, 90%, 95% or 98% similar with the disclosed sequences.

As is well known in the art, the degeneracy of the genetic code permits substitution of bases in a codon resulting in a different codon which is still capable of coding for the same amino acid, eg. the codon for amino acid glutamic acid is both GAT and GAA. Consequently, it is clear that for the expression of polypeptides with the amino acid sequences shown in Figures 4, 7, 9, 11, 13, 15 17, 26, 31, 33 and 35, or fragments thereof, use can be made of derivative nucleic acid sequences with such an alternative codon composition different from the nucleic acid sequences shown in Figures 2, 6, 8,10, 12, 14, 16, 24, 30, 32 and 34.

For recombinant production of the enzyme in a host organism, the plant PEPc kinase coding sequence may be inserted into an expression cassette to form a DNA construct designed for a chosen host and introduced into the host where it is recombinantly produced. The choice of specific regulatory sequences such as promoter, signal sequence, 5' and 3¹ untranslated sequences, enhancer and terminator appropriate for the chosen host is within the level of skill of the routine worker in the art. The resultant molecule, containing the individual elements linked in proper reading frame, may be introduced into the chosen cell, using techniques well known to those in the art, such as electroporation, biolistic introduction, Ti plasmid introduction etc. Suitable expression cassettes and vectors and methods for recombinant production of proteins are well known for host organisms such as E. coli (see, e.g. Studier and Moffatt, J. Mol . Biol . 189: 113 (1986); Brosius, DNA 8: 759 (1989)), yeast (see, e.g., Schneider and Guarente, Meth, Enzymol . 194: 373 (1991)) and insect cells (see, e.g., Luckow and Summers, Bio/Technol . 6: 47 (1988)).

Examples of promoters suitable for use in DNA constructs of the present invention include viral, fungal, bacterial, animal and plant derived promoters capable of functioning in plant cells. The promoter may be selected from so-called constitutive promoters or inducible promoters.

Examples of suitable inducible or developmentally regulated promoters include the napin storage protein gene (induced during seed development) , the malate synthase gene (induced during seedling germination) , the small subunit RUBISCO gene (induced in photosynthetic tissue in response to light) , the patatin gene highly expressed in potato tubers, the cauliflower mosaic virus 35S (CaMV 35S) and 19S (CaMV 19S) promoters, the nopaline synthase promoter, octopine synthase promoter, heat shock 80 (hsp 80) promoter and the like. Alternatively, the promoter could be selected to express the DNA constitutively. Generally, in 01/18191

10 plants and plant cells of the invention inducible or developmentally regulated promoters are preferred.

A terminator is contemplated as a DNA sequence at the end of a transcriptional unit which signals termination of transcription. These elements are 3 '-non-translated sequences containing polyadenylation signals which act to cause the addition of polyadenylate sequences to the 3 ' end of primary transcripts. Sequences mentioned above may be isolated for example from fungi, bacteria, animals or plants.

Examples of terminators particularly suitable for use in nucleotide sequences and DNA constructs of the invention include the nopaline synthase polyadenylation signal of Agrobacterium tumefaciens, the 35S polyadenylation signal of CaMV, octopine synthase polyadenylation signal, the zein polyadenylation signal from Zea mays, and those found in plasmids such as pBluescript (Stratagene, La Jolla, CA) , pFLAG (International Biotechnologies, Inc., New Haven, CT) , pTricHis (Invitrogen, La Jolla, CA) , and baculovirus expression vectors, e.g., those derived from the genome of Autographica californica nuclear polyhedrosis virus (AcMNPV) . A preferred baculovirus/insect system is pV111392/Sf21 cells (Invitrogen, La Jolla, CA) .

Therefore, the invention further provides an expression cassette comprising a promoter operably linked to a DNA molecule encoding PEPc kinase or functionally active variant thereof from a plant, preferably from a dicotyledonous or a monocotyledonous plant, more preferably from an Arabidopsis species, C₄ plants (e.g. maize, sugarcane, sorghum) CAM plants (e.g. pineapple, Kalanchoe fedtschenkoi ) C₃ plants including tuberous crops (e.g. potato, yam, sweet potato) , cereals (e.g. wheat, rice, oats, barley), legumes (e.g. soybean), oilseeds (e.g. Brassica napus, sunflower etc.), harvested products (e.g. tomato, grape, banana, soft fruits such as raspberries, lettuce, onion, celery, tea, etc.), cotton, flax, ornamental tubers (e.g. Dahlia) , bulbs (e.g. Daffodil, Narcissus, Amaryllis) , etc. having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity.

In a yet further aspect the present invention provides a nucleotide sequence comprising a transcriptional regulatory sequence, a sequence under the transcriptional control thereof which encodes an RNA sequence characterised in that the RNA sequence is anti-sense to an mRNA which codes for PEPc kinase enzyme.

The nucleotide sequence encoding the antisense RNA molecule can be of any length provided that the antisense RNA molecule transcribable therefrom is sufficiently long so as to be able to form a complex with a sense mRNA molecule encoding for PEPc kinase enzyme. Thus, without the intention of being bound by theory it is thought that the antisense RNA molecule complexes with the mRNA for the protein or proteins and prevents or substantially inhibits the synthesis of a functional PEPc kinase enzyme. As a consequence of the interference by the antisense RNA, enzyme activity of PEPc kinase is decreased or substantially eliminated.

The DNA encoding the antisense RNA can be from about 20 nucleotides in length up to the length of the relevant mRNA produced by the cell. Preferably, the length of the DNA encoding the antisense RNA will be from 50 to 1500 nucleotides in length. The preferred source of antisense RNA transcribed from DNA constructs of the present invention is DNA showing substantial identity or similarity to the genes or fragments of PEPc kinase enzyme in plants. Transcriptional initiation sequences are commonly located upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Examples of such transcriptional initiation sequences (also known as protomers) are hereinbefore described.

It will be appreciated that the promoter employed should give rise to the transcription of a sufficient amount of the antisense RNA molecule at a rate sufficient to cause an inhibition of PEPc kinase activity in plant cells. The required amount of antisense RNA to be transcribed may vary from plant to plant.

DNA constructs and nucleotide sequences of the invention may be used to transform cells of both monocotyledonous and dictoyledonous plants in various ways known in the art. For example, particle bombardment of embryogenic callus is the method of choice for production of transgenic monocotyledonous plants [Vasil (1994) Plant Mol . Biol . 25, 925-937]. In many cases transformed plant cells may be cultured to regenerate whole plants which can subsequently reproduce to give successive generations of genetically modified plants.

The invention also provides a biological vector comprising a DNA construct according to the present invention. The biological vector may be a virus or bacterium, such as Agrobacterium tumefaciens , for example, and the construct advantageously further encodes a marker protein, such as one having herbicide resistance, or anti- bacterial properties.

A further aspect of the invention is a recombinant biological vector comprising the said construct wherein said vector is capable of transforming a host cell. Also comprised is a host cell stably transformed with the said vector wherein said host cell is preferably a cell selected from the group consisting of a bacterial cell, a yeast cell, and an insect cell and is further capable of expressing the DNA molecule according to the invention.

The invention still further provides eukaryotic cells, such as plant cells (including protoplasts) for example, containing the said nucleotide sequence, DNA construct or vector.

The invention still further provides plant cell with gene "knockouts" wherein the gene encoding PEPc kinase has been mutated or removed to eliminate expression.

The invention still further provides transgenic plants comprising such plant cells, the progency of such plants which contain the sequence stably incorporated and 14 hereditable in a Mendelian manner, and/or the seeds of such plants or such progeny. Such plants include C₄ plants (e.g. maize, sugarcane, sorghum) ; CAM plants (e.g. pineapple,

Kalanchoe fedtschenkoi) ; C₃ plants including tuberous crops (e-g« potato, yam, sweet potato), cereals (e.g. wheat, rice, oats, barley) , legumes (e.g. soybean) , oilseeds (e.g.

Brassica napus , sunflower etc.), harvested products (e.g. tomato, grape, banana, soft fruits such as raspberries, lettuce, onion, celery, tea, etc.), cotton, flax, ornamental tubers (e.g. Dahlia) , bulbs (e.g. Daffodil,

Narcissus, Amaryllis) , etc.

Manipulation of the expression of PEPc kinase in transgenic plants (either up or down, depending on the application) may result in altered sugar, storage carbohydrate, lipid and/or protein content of leaves, fruits, seeds, tubers and other organs in a wide range of species as a result of altered partitioning of carbon/nitrogen. Some specific examples are given below: altered relative levels of protein and lipids in oil seeds (e.g. Brassica napus, sunflower); increased starch production in tuberous crops (e.g. potato, yam, sweet potato) ; altered starch and protein content of wheat, rice, maize, oat, barley and other cereal seeds; altered storage carbohydrate levels in ornamental tubers (e.g. Dahlia) and bulbs (e.g. Daffodil ; Narcissus,

Amaryllis etc) . This may improve both propagation and flower production; increased fibre synthesis in e.g. cotton and flax; increased synthesis of flavonoids and other phenylpropanoids in a wide range of plants. This may (a) give increased protection against abiotic stresses (including via oxidative stress) and UV-damage; (b) give improved defence against a range of pathogens; (c) provide improved nutritional qualities of harvested products (e.g. in tomato fruits, soft fruits such as raspberries, lettuce, onion, celery, etc) since flavonoids have been reported to reduce the risk of e.g. heart disease and certain cancers in humans; increased lignin production through increased flux through the phenylpropanoid pathway in woody species (trees, etc) ; more intense pigmentation of some flowers and other pigmented organs (e.g. in red lettuce) as a result of altered anthocyanin production; improved wine quality as a result of altered synthesis of sugars and tannins in grapes; improved tea quality as a result of altered tannin synthesis; increased C fixation in CAM plants may improve yield and sugar content of e.g. pineapples; improved ripening and altered carbohydrate content of certain fruits (e.g. banana) ; enhanced nitrogen fixation in legumes; increased photosynthesis in C4 plants (e.g. maize, sugarcane etc) ; 16 increased tolerance of drought, cold and other osmotic stresses through increased accumulation of proline in a wide range of species; increased drought tolerance through altered stomatal opening; increased tolerance of metals through enhanced exudation of organic acids; altered flowering time in species in which relative sugar levels are part of the stimulus to flower; and use of the PEPc kinase gene promoter from Kalanchoe or other CAM plants to confer circadian regulation on heterologous coding sequences in transgenic plants.

The invention still further provides the use of the sequence according to the invention, whether "naked" or present in a DNA construct or biological vector - in the production of eukaryotic cells, particularly plant cells having a modified PEPc kinase activity.

Plant PEPc kinase coding sequences may be isolated according to well known techniques based on their sequence homology to the Kalanchoe fedtschenkoi (Figures 1 and 2) ,

Arabidopsis thaliana (Figures 5, 6, 24 and 25) , banana

(Figure 8) , tomato (Figures 10 and 30) , cotton (Figure 12) , rice (Figure 14) , Brassica napus (Figure 16) or soybean

(Figures 32 and 34) coding sequences disclosed herein. In these techniques all or part of the known PEPc kinase coding sequence is used as a probe which selectively hybridizes to other PEPc kinase coding sequences present in a population of cloned genomic DNA fragments or cDNA 17 fragments (i.e. genomic or cDNA libraries) from a chosen organism. Such techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, e.g. Sambrook et al . , "Molecular Cloning", eds., Cold Spring Harbor Laboratory Press. (1989)) and amplification by PCR using oligonucleotide primers corresponding to sequence domains conserved among known PEPc kinase amino acid sequences (see, e.g. Innis et al . , "PCR Protocols, a Guide to Methods and Applications", pub. by Academic Press (1990)). These methods are particularly well suited to the isolation of PEPc kinase coding sequences from organisms closely related to the organism for which the probe sequence is derived. Thus, application of these methods using at least a partial sequence of the Kalanchoe fedtschenkoi , Arabidopsis , banana, tomato, cotton, rice, Brassica napus and/or soybean PEPc kinase coding sequences as a probe would be expected to be particularly well suited for the isolation of PEPc kinase coding sequences from other plant species. Further studies have in fact revealed the presence of a second PEPc kinase gene in Arabidopsis thaliana, tomato, soybean, barley, Medicago truncabula, Lotus japonicus, wheat, cotton and pine.

Therefore, a further embodiment of the invention is a method of isolating a polynucleotide fragment, said polynucleotide fragment comprising a sequence at having at least 70%, 80%, 90%, 95% or 98% sequence similarity with the disclosed sequences comprising (a) preparing a nucleotide probe capable of specifically hybridizing to a plant phosphoenolpyruvate carboxylase kinase (PEPc kinase) gene or mRNA, wherein said probe comprises a contiguous portion of the coding sequence for a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme from a plant at least 10 nucleotides in length;

(b) probing for other PEPc kinase coding sequences in populations of genomic DNA fragments or cDNA fragments from a chosen organism using the nucleotide probe prepared according to step (a) ; and

(c) isolating a polynucleotide fragment comprising a portion encoding a protein having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity.

The isolated plant PEPc kinase sequences taught by the present invention may be manipulated according to standard genetic engineering techniques to suit any desired purpose.

For example, the entire PEPc kinase coding sequence or portions thereof may be used as probes capable of specifically hybridizing to coding sequences and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among PEPc kinase coding sequences and are at least 10 nucleotides in length, preferably at least 20 nucleotides in length, and most preferably at least 50 nucleotides in length. Such probes may be used to amplify and/or analyse

PEPc kinase coding sequences from a chosen organism via the well known process of polymerase chain reaction (PCR) .

This technique may be useful to isolate additional PEPc kinase coding sequences from a desired organism as hereinbefore described or as a diagnostic assay to determine the presence of PEPc kinase coding sequences in a organism. Hybridisation probes may also be used to quantitate levels of PEPc kinase mRNA in a plant using standard techniques such as Northern blot analysis. This technique may be useful as a diagnostic assay to detect altered levels of PEPc kinase expression that may be associated with particular conditions such as nutrient status, abiotic stresses, pathogen attack, nodulation, etc.

Therefore, the invention further provides methods for detecting the presence and form of the PEPc kinase gene and quantitating levels of PEPc kinase transcripts in an organism. These methods may be used to diagnose conditions, such as those described previously, which are associated with an altered form of the PEPc kinase enzyme or altered levels of expression of the PEPc kinase enzyme.

Furthermore, the present invention provides probes capable of specifically hybridizing to a plant phosphoenolpyruvate carboxylase kinase (PEPc kinase) gene or mRNA, wherein said probe comprises a contiguous portion of the coding sequence for an phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme from a plant at least 10 nucleotides in length. PEPc kinase specific hybridization probes may also be used to map the location of the native PEPc kinase gene(s) in the genome of a chosen plant using standard techniques based on the selective hybridization of the probe to 20 genomic PEPc kinase sequences. These techniques include, but are not limited to, identification of DNA polymorphisms identified or contained within the PEPc kinase probe sequence, and use of such polymorphisms to follow segregation of the PEPc kinase gene relative to other markers of known map position in a mapping population derived from self fertilization of a hybrid of two polymorphic parental lines (see e.g. Helentjaris et al . ,

Plant Mol . Biol . 5: 109 (1985); Sommer et al . Biotechniques 12:82 (1992); D'Ovidio et al . , Plant Mol . Biol . 15: 169 (1990)). While any plant PEPc kinase sequence is contemplated to be useful as a probe for mapping PEPc kinase genes, preferred probes are those PEPc kinase sequences from plant species more closely related to the chosen plant species, and most preferred probes are those PEPc kinase sequences from the chosen plant species. Mapping of PEPc kinase genes in this manner is contemplated to be particularly useful for breeding purposes. For instance, by knowing the genetic map position of a mutant PEPc kinase gene which could confer properties as described previously, flanking DNA markers can be identified from a reference genetic map (see, e.g., Helentjaris, Trends Genet . 3: 217 (1987)). During introgression of the mutant PEPc kinase gene trait into a new breeding line, these markers can then be used to monitor the extent of PEPc kinase-linked flanking chromosomal DNA still present in the recurrent parent after each round of back-crossing. 21 Recombinantly produced plant PEPc kinase enzyme may be useful for a variety of purposes. For example, it may be used to supply PEPc kinase enzymatic activity in vitro to manipulate the activity of PEP carboxylase in order to alter levels of sugar, storage, carbohydrate, lipid and/or protein content of leaves, fruits, seeds, tubers and other organs in a wider range of species as a result of altered partitioning of carbon/nitrogen.

Recombinantly produced plant PEPc kinase enzyme can be isolated and purified using a variety of standard techniques. The actual techniques which may be used will vary depending upon the host organism used, whether the

PEPc kinase enzyme is designed for secretion, and other such factors familiar to the skilled artisan (see, e.g. chapter 16 of Ausubel, F. et al . , "Current Protocols in

Molecular Biology", pub. By John Wiley & Sons, Inc. (1994) .

Therefore, the present invention provides a polypeptide comprising a phosphoenolpyruvate carboxylase kinase enzyme. The present invention further provides the recombinant production of the PEPc kinase enzyme.

It will be understood that for particular PEPc kinase polypeptides embraced herein, variations (natural or otherwise) can exist. These variations may be demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. All such derivatives are included within the scope of this invention provided that the derivatives are physiologically active 22 (ie. display PEPc kinase activity as defined herein) . For example, for the purpose of the present invention conservative replacements may be made between amino acids, within the following groups: (I) alanine, serine and threonine;

(II) glutamic acid and aspartic acid;

(III) arginine and lysine;

(IV) asparagine and glutamine;

(V) isoleucine, leucine and valine; (VI) p enylalanine, tyrosine and tryptophan;

The invention also relates to a method of producing a protein having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity in a host organism comprising

(a) inserting a DNA sequence encoding a protein having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity into a host cell;

(b) growing the said transformed host cell in a suitable culture medium;

(c) expressing said DNA sequence to produce said protein; and

(d) isolating the protein product either from the transformed host cell or the culture medium or both and purifying it.

The cloning and expression of a recombinant PEPc kinase polynucleotide fragment also facilitates in producing anti-PEPc kinase antibodies and fragments thereof

(particularly monoclonal antibodies) and evaluation of in vitro and in vivo biological activity of recombinant PEPc kinase polypeptides. The antibodies may be employed in diagnostic tests for native PEPc kinase polypeptides.

These and other aspects of the present invention shall now be described, by way of example only, and with reference to the accompanying Figures and Examples, which show:

Figure 1 illustrates a genomic sequence encoding a

PEPc kinase polypeptide from Kalanchoe fedtschenkoi .

Primer sequences are double underlined, start and stop codons are in bold and intron sequences are single underlined;

Figure 2 illustrates a cDNA sequence encoding a PEPc kinase polypeptide from Kalanchoe fedtschenkoi . Primer sequences are double underlined and start and stop codons are in bold;

Figure 3 illustrates a nucleotide sequence for a 3 ' - non-translatable probe used to probe Northern blots of Kal anchoe fedtschenkoi RNA from different tissues/conditions; Figure 4 illustrates an amino acid sequence deduced from the cDNA sequence given in Figure 2 ;

Figure 5 illustrates a first full length genomic sequence of Arabidopsis thaliana (bases 50102 to 51681 of BAC F22013) identified in Genbank as accession number AC003981; Figure 6 illustrates a first cDNA sequence encoding a first PEPc kinase polypeptide from Arabidopsis thaliana . Primers are double underlined and start and stop codons are in bold; Figure 7 illustrates an amino acid sequence deduced from the cDNA sequence given in Figure 6;

Figure 8 illustrates a nucleotide sequence encoding part of a PEPc kinase polypeptide from banana;

Figure 9 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 8;

Figure 10 illustrates a nucleotide sequence encoding part of a PEPc kinase polypeptide from tomato;

Figure 11 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 10; Figure 12 illustrates a nucleotide sequence encoding part of a PEPc kinase polypeptide from cotton;

Figure 13 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 12 ;

Figure 14 illustrates a nucleotide sequence encoding part of a PEPc kinase polypeptide from rice;

Figure 15 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 14 ;

Figure 16 illustrates a nucleotide sequence encoding part of a PEPc kinase polypeptide from Brassica napus ; Figure 17 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 16; Figure 18 is a comparison of the amino acid sequence of gene F22013.13 deduced from the genomic sequence in Genbank accession number AC003981 as illustrated in Figure 5 (top line) with the amino acid sequence of Arabidopsis thaliana PEPc kinase deduced from the cDNA sequence (bottom line) as illustrated in Figure 6;

Figure 19 illustrates phosphorimages of ³⁵S[Met]- labelled translation products from in vitro translations of RNA samples, separated on 10% (A-C) and 12.5% (D) SDS polyacrylamide gels. The lower panels show the ³²P-labelled PEP carboxylase in assays of PEPc kinase activity in these translation products. a: lane 1, no RNA; lane 2, transcribed RNA (0.5 μg) from the original plasmid library; lane 3, total RNA from K. Fedtschenkoi (5.0 μg) isolated in the middle of the dark period. b: lanes 1 - 3, transcribed RNA (0.5 μg) from three different pools after three rounds of screening; lane 4, no RNA; lane 5, total RNA from K. fedtschenkoi (5.0 μg) isolated in the middle of the dark period. c: lanes 1 - 2, transcribed RNA (0.5 μg) from two different colonies isolated from the K. fedtschenkoi cDNA library that contain unidentified protein kinase genes unrelated to PEPc kinase; lane 3, no RNA; lane 4, total RNA from K. fedtschenkoi (5.0 μg) isolated in the middle of the dark period. 26 d: lane 1, transcribed RNA (0.5 μg) from an EST clone encoding A. thaliana PEPc kinase; lane 2, transcribed RNA

(0.5 μg) from the K. fedtschenkoi PEPc kinase clone; lane

3, no RNA; lane 4, total RNA from K. fedtschenkoi (5.0 μg) isolated in the middle of the dark period;

Figure 20 illustrates peptide mapping of phosphorylation sites in PEPc kinase. PEP carboxylase (1.0 μg samples) was phosphorylated using highly purified PEPc kinase from K. fedtschenkoi or the translation products from transcribed RNA (0.5 μg) of the K. fedtschenkoi and A. thaliana PEPc kinase clones and isolated on an 8% SDS polyacrylamide gel stained with Coomassie blue. Gel chips containing the major PEP carboxylase band were excised and run on a 12.5% gel, with or without digestion with 40 ng protease from Staphylococcus aureus V8. The gel was stained with silver, scanned, dried and phosphorimaged. a: silver-stained gel, b: phosphorimage

Lanes 1 - 3 undigested, lanes 4 - 6 digested with protease. Lanes 1 and 4 : phosphorylation by the transcribed and translated product of the A. thaliana PEPc kinase clone. Lanes 2 and 5: phosphorylation by the transcribed and translated product of the K. fedtschenkoi PEPc kinase clone. Lanes 3 and 6: phosphorylation by purified PEPc kinase; Figure 21 illustrates the complete sequence of the PEPc kinases of Kalanchoe fedtschenkoi and Arabidopsis thaliana aligned with the sequences of the catalytic domains of CDPK5 (calcium dependent protein kinase) from Arabidopsis thaliana , rat Ca⁺/calmodulin-dependent protein kinase II subunit, and rat phosphorylase b kinase y subunit. Residues identical in all sequences are indicated by a #. Residues whose codons are interrupted or separated by introns are underlined. Intron positions were taken from Genbank accession number 3080406, Nishioka et al , (1996) FEBS Lett . 396, 333-336 and Cawley et al . (1993) J. Biol . Chem . 268, 1194 - 1200 respectively. The asterisk marks the position of the phosphorylation site in the activation loop of protein kinases; Figure 22 illustrates the expression of Kalanchoe f dtschenkoi PEPc kinase a and b, diurnal control; c, circadian control. a, phosphorimage showing Northern analysis of leaf RNA samples throughout the normal diurnal cycle, photoperiod 08.00 - 16.00; the numbers below the phosphorimage show the relative intensities of the bands; b, the quantitative date from a are shown with the amounts of PEPc kinase mRNA and activity taken from earlier work under identical conditions; c, Northern analysis of RNA samples from leaves kept in constant conditions (continuous darkness, C0₂-free air at 15°C); Figure 23 illustrates a phylogenetic analysis of PEPc kinase and other protein kinases. Sequences of catalytic domains were aligned and the tree was constructed using Clustal X (Thompson, J.D. et al (1997) The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nuc. Acids Res. 25, 4876-4882) with N = 1000. The tree was displayed using TreeView (Page, R.D.M. (1996) TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358) . Human cyclic AMP-dependent protein kinase (PKA) and protein kinase C (PKC) , members of the AGC family of protein kinases, were defined as the outgroup (labelled A) . The other protein kinases are all members of the calcium/calmodulin-regulated protein kinase (CaMK) family. The animal CaMK sequences are those of rat phosphorylase b kinase and mouse Ca2+/calmodulin dependent protein kinase II (labelled B) . The plant calcium-dependent protein kinase (CDPK) sequences are from Arabidopsis thaliana (At) , Zea mays (Zm) , Mesembryanthemum crystallinum (Mc) and Nicotiana tabacum (Nt) (labelled C) . The PEPc kinase sequences are those given in this specification (Bn = Brassica napus, Kf = Kalanchoe fedtschenkoi) (labelled D) .

Figure 24 illustrates a cDNA sequence encoding a second PEPc kinase polypeptide from Arabidopsis thaliana ; Figure 25 illustrates a second genomic sequence of Arabidopsis thaliana . Initiation and termination codons are in bold and the intron is underlined;

Figure 26 illustrates an amino acid sequence deduced from the cDNA sequence given in Figure 24;

Figure 27 is a comparison of the deduced amino acid sequences of Arabidopsis thaliana PEPc kinase II (top) and I (bottom) .

Figure 28 illustrates RT-PCR studies of the expression of PEPcK I and II. Total RNA was obtained from tissues, reverse transcribed to cDNA and amplified with the following primers:

PEPcK I (forward) GTTTTACGGCGAGACAG and (reverse) ACAACTCTGCTTTCTCACATC, PEPcK II (forward) GGTTATCAGAATCAGAATCC and (reverse) CGTAGTTGTGTGTTTCAGCA, actin (forward) GTTGGGATGAACCAGAAGGA and (reverse) CTTACAATTTCCCGCTCTGC. R = rosette, C = cauline; Figure 29 illustrates the effect of light on expression of PEPc kinase I in rosette leaves. Total RNA was isolated from rosette leaves in light or darkness. The primers used for amplification of cDNA were as in Figure 27. The band resulting from amplification of genomic DNA by the PEPc kinase I primers is indicated;

Figure 30 illustrates a nucleotide sequence of the insert in tomato EST AW033195; Figure 31 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 29;

Figure 32 illustrates a nucleotide sequence of the insert in soybean EST AII736847; Figure 33 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 31;

Figure 34 illustrates a nucleotide sequence of the inert in soybean EST AW099717;

Figure 35 illustrates an amino acid sequence deduced from the nucleotide sequence given in Figure 33;

Figure 36 illustrates expression of K. fedtschenkoi PEPc kinase in Arabidopsis thaliana . The Figure shows RT- PCR products obtained as described in the text from three individuals (A,B,C) of each of four lines (FLS1-4) , and from Kalanchoe leaves harvested at 12:00 (noon) and 00:00 (midnight) ; and

Figure 37 illustrates the phenotype of homozygous lines overexpressing the PEPc kinase gene.

Examples

RNA Isolation and Hybridization Analysis

Frozen leaf samples were ground in liquid nitrogen using a pestle and mortar and total RNA was extracted from the frozen powder (Hartwell et al., 1996). 10 μg of total RNA was fractionated in 1.4% agarose-formaldehyde gels and blotted onto a nylon membrane (Hybond-N; Araersham, E.K.), using standard procedures (Sambrode et al. , 1989). Radiolabelled DNA probes were prepared with an appropriate 31 deoxynucleotide triphosphate, using the Rediprime system (Amersham) . Both full-length K. fedtschenkoi PEPc kinase cDNA and part of the K. fedtschenkoi 3 • -non-translated sequence were used as probes. Hybridization analysis was conducted as described previously (Jackson et al., 1995). Radiolabelled blots were routinely visualized and quantified using a phosphorimager.

Isolation of the PEPc kinase gene A cDNA library was prepared in UniZAP XR (Stratagene) using poly (A)⁺ RNA isolated from mature K. fedtschenkoi leaves sampled in the middle of the dark period, when PEPc kinase translatable mRNA is at its maximum. After mass excision of an aliquot of the amplified library that represented approximately ten times the size of the primary library, the resulting phagemids were transformed into Escherichia coli XLOLR cells and plasmids were isolated with a Maxiprep kit (Promega) . To screen this library, a sample was linearised with Xho 1 and inserts were transcribed from the T3 promoter using the T3 mMessage mMachine kit (Ambion) . Transcribed RNA (0.5 μg) was translated and the PEPc kinase activity of the translation products was assessed. This confirmed that the plasmid library contained a PEPc kinase insert (Figure 19) . The plasmid library was transformed into electrocompetent E. coli XLI-Blue MRF^' using standard protocols. The transformants were plated on 10 plates at a density of 550000 cfu per plate. The cells on each plate were eluted off into 10 ml of LB broth and plasmids were isolated with a Miniprep kit (Qiagen) . Each of the 10 pools was screened as above. The plasmid pool whose translation product contained the most PEPc kinase activity was selected and subjected to a further four rounds of sub-division and screening. From a final pool of 600, individual colonies were picked and grown up and the plasmids were isolated. These were screened by PCR using primers designed against domains VI and VII of protein kinases. Individual plasmids which gave a PCR product of the expected size were linearised and transcribed, and the translation products were assayed for PEPc kinase activity (Figure 19) .

PCR conditions PCR amplifications were carried out with the following protocol :

95°C for 2 min then 30 repeats of

50°C for 30 sec 72°C for 80 sec

95°C for 30 sec then

50°C for 30 sec

72°C for 5 min Partial PEPc kinase genomic sequences were obtained by PCR from genomic DNA using the following primers: Sense 1 TGCGAGGAGATCGGCCGKG Sense 2 TTCGCYTGCAARWCSATCG Antisense 1 ACCTCCGGCGCCACGTARTAC where K = G/T, Y = C/T, R = A/G, W = A/T, S = C/G. These primers anneal to the underlined sections of the Arabidopsis and Kalanchoe sequences. The tomato, banana, cotton and rice PCR products were obtained with sense 1 and antisense 1 primers; the Brassica napus PCR product was obtained with sense 2 and antisense 1 primers.

Purification of PEPc kinase

PEPc kinase was purified from mature K . fedtschenkoi leaves harvested in the middle of the dark phase. Leaves

(250 g) were homogenised for 4 x 15 s in 250 ml of 100 mM

Tris/HCl pH 8.0, 2 mM EDTA, 2% polyethylene glycol 20000,

0.05% 2-mercaptoethanol, 1 mM benzamidine HCl, protease inhibitors (leupetin, chymostatin and antipain, each at 1 μg/ l) , 12.5 g of insoluble polyvinylpyrrolidone, 12.5 g sodium bicarbonate and 1 ml octanol. The homogenate was filtered through muslin and centrifuged for 30 min at 12000 x g. 1.0 M Na₂HP0₄ was added to the supernatant (200 ml/L) , the pH was adjusted to 8.5-8.8 and 4 M CaCl₂ was added (20 ml/L) . The mixture was stirred for 1 h and centrifuged for

10 min at 12000 x g. The pH of the supernatant was adjusted to 7.5 by addition of HCl. Proteins that precipitated between 30 and 42% saturation with ammonium 34 sulphate were collected and dissolved in Buffer A (50 mM Tris/HCl pH 7.5, 0.1 mM EDTA, 1 mM benzamidine HCl, 1 mM dithiothreitol) containing protease inhibitors as above. The material was loaded onto a column (7.5 ml) of Phenyl Sepharose equilibrated in Buffer A. The column was washed with Buffer A containing 30% ethylene glycol, and PEPc kinase was eluted with Buffer A containing 60% ethylene glycol. The eluate was diluted 3-fold with Buffer A and loaded onto a column (4 ml) of hydroxyapatite equilibrated in Buffer A. The column was washed with Buffer A containing 10 mM sodium phosphate, and PEPc kinase was eluted with Buffer A containing 50 mM sodium phosphate. The eluate was desalted into Buffer A on a column of Sephadex G25, then loaded onto a column of blue dextran- agarose (Sigma) equilibrated in Buffer A. PEPc kinase was eluted with Buffer A containing 1 M KC1 and concentrated over a Centricon 30 filter (Amicon) . It was then run on a Superose 12 column equilibrated in Buffer A containing 50 mM KC1 and 0.015% Brij . Protease inhibitors (as above) were added to the pooled column fractions after each step. The results suggest that PEPc kinase comprises less than 1 in 10^s of soluble leaf protein. PEPc kinase was assayed as described by Carter et al. (1991) .

Results

Using an assay for kinase translatable mRNA (Hartwell et al., 1996), the abundance of PEPc kinase clones in pools of a cDNA library was assessed by transcription, translation and assay of PEPc kinase activity in vitro (Figure 1) . Successively more enriched pools were isolated and, in the final step, individual clones that encode protein kinases (as judged by PCR with conserved kinase primers) were tested. One colony which encoded a protein with very high PEPc kinase activity was identified (Figure 19) ; the activity of this protein was independent of Ca²⁺ (not shown) . Two other clones encoding protein kinases unrelated to PEPc kinase were isolated from the same library and the transcription/translation products from these clones did not phosphorylate PEP carboxylase (Figure 19) . It has already been shown by peptide mapping that purified PEPc kinase phosphorylates the same site on PEP carboxylase that is phosphorylated in vivo (Carter et al., 1991) ; here it is also shown that the same site is phosphorylated by the transcription/translation product of the putative PEPc kinase clone (Figure 20) . The identity of the clone has been confirmed by its diurnal and circadian expression pattern (see below) . The deduced amino acid sequence of K. fedtschenkoi

PEPc kinase is shown in Figure 21. The protein comprises 274 amino acids with a predicted Mr of 30695. Its sequence is most closely related to those of the catalytic domains of the CaMK group of protein kinases (Hanks & Hunter, 1995) , which comprise kinases regulated by Ca²⁺/calmodulin and close relatives. Amongst this group, higher plants contain a family of CDPKs which contain a protein kinase domain fused to an autoinhibitory region and a calmodulin- 36 like domain (Harper et al. , 1991; Hrabak et al., 1996).

PEPc kinase shows up to 40% identity and 60% similarity with the catalytic domains of this family (Harper et al.;

Hrabak et al., 1996), but it does not contain the auto- inhibitory region and EF hands of the calcium-dependent protein kinase family. Database searches revealed the presence of a sequence very similar to that of K. fedtschenkoi PEPc kinase in A. thaliana genomic DNA (gene

13 on BAC F22013) . A full-length EST corresponding to this putative A. thaliana PEPc kinase gene was identified; the GenBank accession number of the EST is T46119, and the Aradiposis Biological Resource Center stock number for the clone is 135K3T7. Sequencing of this clone showed that the Genbank annotation for F22013.13 is incorrect. There is an intron from base 50934 to base 51105 inclusive, and the coding sequence extends to stop codon at bases 51153 - 51155. The open reading frame encodes a 284 residue protein of predicted M_r 31832 that is highly related to CDPKs but lacks an auto inhibitory region and EF hands (Figure 21) .

Its identity was confirmed by showing that the product of in vitro transcription and translation of the EST clone has very high PEPc kinase activity (Figure 19) , and phosphorylated K. fedtschenkoi PEP carboxylase at the same site as is phosphorylated by purified PEPc kinase (Figure 20) . Thus PEPc kinase is a unique member of the CaMK subgroup of protein kinases (Hanks & Hunter, 1995) , whose activity is not regulated by Ca²⁺ ions. The two PEPc kinase sequences are compared to sequences of the catalytic domains of representative members of the CaMK family in Figure 21. Members of the protein kinase superfamily contain a catalytic domain of some 260 residues (Hanks and Hunter, 1995) . The PEPc kinases are apparently the smallest protein kinases yet described, comprising this catalytic domain with minimal additions; for example, the K. fedtschenkoi PEPc kinase is some 20 residues shorter than members of the cdc2 family (294 - 298 residues) . Many protein kinases are activated by phosphorylation of one or more residues in a segment known as the "activation loop" (Johnson et al . , 1996). In these cases, introduction of a phosphate group in this region leads to ionic interactions that are important for activity (Johnson et al . , 1996). Like PEPc kinase, the catalytic subunit of phosphorylase b kinase is a member of the CaMK sub-group of protein kinases that is constitutively active. In this enzyme, the phosphorylation site in the activation loop is replaced by a negatively charged residue, E182. The two PEPc kinases contain a conserved glycine residue in this position

(marked with an asterisk in Figure 21) . Hence its sequence indicated that PEPc kinase is constitutively active, not activated by phosphorylation. This is confirmed by the high activity of the protein expressed by transcription/translation in vitro (Figure 19) . Many protein kinases are complexed with targeting or regulatory subunits. However, gel filtration on a calibrated Superose 12 column showed that the native M_r of PEPc kinase is 34,000 38

(not illustrated) , suggesting that it exists as a monomer devoid of additional subunits. Hence both the size and the sequence of PEPc kinase is consistent with the view that it is regulated by protein synthesis rather than by a second messenger, by phosphorylation or by interaction with a regulatory or targeting protein.

The control of PEPc kinase was therefore examined.

Southern blotting with homologous probes suggested that only one kinase gene is present in both K. fedtschenkoi and A. thaliana (not shown) . Northern analysis showed that the level of K. fedtschenkoi PEPc kinase transcripts varied over the diurnal cycle exactly as does the level of PEPc kinase translatable mRNA (Figure 22) . The kinase transcript level clearly controls both PEPc kinase activity and the phosphorylation state of PEPc. Moreover, PEPc kinase transcript levels showed a circadian oscillation in detached leaves kept in constant environmental conditions (Figure 22) . These data not only confirm that PEPc kinase is regulated at the transcript level but also show that the PEPc kinase gene is controlled developmentally and can be regarded as a circadian clock-controlled gene.

Higher plants contain a family of genes encoding CDPKs, for example at least 15 in A. thaliana . The gene products differ in their expression, substrate specificity and response to Ca²⁺, but at least some have a broad substrate specificity (Lee & Harmon, 1998) . PEPc kinase is related to this family but it has several unusual and related properties. First, it lacks any regulatory domain at all, and the activity of the PEPc kinase protein may well be essentially unregulated. Secondly, it is regulated directly at the level of expression, both developmentally and in response to a circadian oscillator. Thirdly, it is noteworthy that PEPc kinase is very specific, and seems to recognise elements of the three-dimensional structure of PEPc rather than a short linear sequence of amino acids (Li et al. , 1997) . This high specificity may be important in preventing the phosphorylation of other proteins by an essentially unregulated protein kinase.

Identification of further PEPc kinases

PEPc kinase was described above and in Hartwell et al . (1999) as highly related to plant calcium-dependent protein kinases (CDPKs) but lacking an auto inhibitory region and EF hands. The accuracy of this description is confimed by the recent report that the PEPc kinase of Mesembryanthemum crystallinum is also highly related to CDPKs but lacks an auto inhibitory region and EF hands (Taybi et al . , 2000). Additional PEPc kinase genes have been identified in a range of higher plants. The PEPc kinase of Arabidopsis thaliana referred to above and in Hartwell et al . (1999) is now termed PEPc kinase I . Arabidopsis thaliana contains a second PEPc kinase gene termed PEPc kinase II. The cDNA and genomic sequences of PEPc kinase II from Arabidopsis thaliana ecotype Landsberg erecta are shown in Figures 24 and 25. The deduced amino acid sequence is shown in Figure 26. The corresponding genomic sequence from Arabidopsis 40 thaliana ecotype Columbia is gene T27C4.19 on BAC T27C4 (GenBank accession number AC022287) . However the annotation of this BAC sequence (as at 17/08/2000) is incorrect. There is an intron from base 67176 to base 67249 and the stop codon is bases 67291-67293.

The Arabidopsis thaliana PEPc kinases I and II are 65% identical (see Figure 27) and differ in their tissue expression patterns. The promoters of the two genes which are given in GenBank accession numbers AC003981 for kinase I and AC022287 for kinase II. Gene-specific primers were used in RT-PCR amplifications. Since these span the intron in each gene, amplification of contaminating genomic DNA gives a slightly larger fragment than amplification of cDNA. As shown in Figure 28, PEPc kinase I is most heavily expressed in rosette leaves, and is also expressed in roots and flowers. Actin was used as a control. PEPc kinase II is most heavily expressed in flowers and roots; its expression in rosette leaves is barely detectable. In rosette leaves PEPc kinase I is more highly expressed in the light than the dark, particularly in young tissue (Figure 29) .

Tomato also contains two distinct PEPc kinase genes. We now define the partial sequence reported in Figures 10 and 11 as PEPc kinase I. This is equivalent to the following EST sequences: AW933544, AI774158, BE459112, BE431605 and AW033195. We have determined the full sequence of the insert in AW033195 and reported this as GenBank submission AF203481; the nucleotide and deduced 41 amino acid sequences are shown in Figures 30 and 31. The very minor differences in nucleotide sequence between Figure 30 and Figure 10 are likely due to cultivar differences. A second PEPc kinase gene is represented by the following ESTs: AW442172, AW738217 and AW441584. We define this gene as PEPc kinase II. The EST AW223421 may also be a transcript from this gene; however this sequence contains an insertion relative to authentic PEPcKs and may represent a cloning artefact. Given the sources of the libraries from which the ESTs were obtained, expression of PEPc kinase I has been observed in immature green fruit, mature green fruit, breaker fruit, leaves and callus. Expression of PEPc kinase II has been observed in ripe red fruit and flower buds. Soybean (Glycine max) contains two distinct PEPc kinase genes with a third possible variant. We define the ESTs AI736847, AW620843 and AW100476 as PEPc kinase I. We have determined the nucleotide sequence of the partial- length clone EST AI736847, shown in Figure 32 The deduced amino acid sequence is shown in Figure 33. PEPc kinase II is represented by the following ESTs: AW755870, AW756453, AW756033 and AW278795. The minor differences in nucleotide sequence between AW278795 and AW755870, AW756453 and AW756033 are likely due to cultivar differences. A further soybean EST representing a PEPc kinase sequence is AW099717. This is most similar to PEPc kinase II but has several differences at the amino acid sequence level and so may represent a third PEPc kinase from soybean. We have determined the nucleotide sequence of AW099717, shown in Figure 34 The deduced amino acid sequence is shown in Figure 35 Given the sources of the libraries from which the ESTs were obtained, expression of PEPc kinase I has been observed in apical shoot tips from 9-10 day old etiolated seedlings, seedling roots and immature flowers. Expression of PEPc kinase II has been observed in somatic embryos and immature seed coats. AW099717 was expressed in apical shoot tips from 9-10 day old etiolated seedlings. Further PEPc kinases have been identified in other EST collections. BE413415 and BE231198 represent one PEPc kinase in barley. BE454588 is very similar but includes an insertion which may be a cloning artefact; alternatively this may represent another PEPc kinase gene. AW688391 and AW574075 represent one PEPc kinase from Medicago truncatula . AW719293, AW720549 and AV425263 represent one PEPc kinase from Lotus japonicuε . BE517315, BE053633 and AW056630 represent PEPc kinases from wheat, cotton and pine respectively. Collectively, these data indicate that many plants contain two or more PEPc kinase genes, which may be expressed in different tissues. Thus the metabolic effects of the use of PEPc kinase antisense constructs is expected to be tissue-specific. Example: Overexpression of PEPc kinase in Arabidopsis thaliana

We have generated transgenic Arabidopsis thaliana plants which over-express the PEPc kinase cDNA from Kalanchoe fedtschenkoi . The over-expressing lines were generated using the full-length cDNA for PEPc kinase from Kalanchoe fedtschenkoi . The coding sequence from this cDNA (from nucleotide 19-849 of GenBank accession AF162660) was cloned using PCR-aided cloning (primers forward: 5 * aagcttctagacatgtctgaggcattgagcag3 ' and reverse: 5 •tggattgagctctgggatcagaaattagtgtc3 • ) into the plant binary vector pBI121 (Clontech) at the Xbal/Sacl sites downstream of the cauliflower mosaic virus 35S promoter, yielding the construct pFLSKAL. The pBI121 vector possesses the NPTII gene for kanamycin selection and the T-DNA left and right borders to direct stable integration of the DNA cloned between the borders into plant genomic DNA following Agr.roJacteriujn-mediated transformation. The construct pFLSKAL was transformed into Agrobacterium tumefaciens (strain GV3101) and then used to transform Arabidopsis thaliana (col-0 ecotype) using the in planta vacuum infiltration method (Bechtold et al . , 1993). Primary transformants (to) were selected by plating sterile seed from the vacuum infiltrated plants on 1/2 MS-agar plates containing 50 g/ml kanamycin. Dark green seedlings were rescued onto soil and grown on and allowed to self and set seed (tl) . The tl seed were again subjected to kanamycin selection as were the t2 to generate t3 seed. The t3 seed 44 were again subjected to kanamycin selection and seed showing a 100% dark-green phenotype on kanamycin-selection were assumed to be homozygous lines. These plants were selected for further analysis. The overexpression of Kalanchoe PEPc kinase was confirmed for all 4 transgenic lines of Arabidopsis using RT-PCR with primers specific to the Kalanchoe PEPc kinase sequence (the same primers used in the PCR based cloning of Kalanchoe PEPc kinase into pBI121 - see above for sequences) . These primers do not hybridise to the endogenous Arabidopsis PEPc kinase I and II transcripts. Figure 35 shows that three individual plants (A, B and C) from all 4 transgenic lines (FLS1-4) are expressing a very high level of the Kalanchoe PEPc kinase transcript driven by the 35S promoter. As a positive control two samples of Kalanchoe RNA were amplified in the same experiment, one from the middle of the day (12.00) and one from the middle of the night (00.00). The Arabidopsis over-expressing lines possess a much higher level of Kalanchoe PEPc kinase transcript than is detected in a Kalanchoe leaf in the middle of the night (00.00 h - peak expression for Kalanchoe) .

Examples of the phenotypes of a selection of t3 seedlings are shown in Figure 37. As can be seen, these plants develop normal healthy cotyledons following germination but then fail to develop healthy primary and secondary leaves. Instead, these leaves are severely malformed and lacking in chlorophyll. However, after about two weeks in this state the plants develop secondary meristems which produce normal healthy leaves and the plants then grow like wild type and set seed efficiently. The fully expanded rosette leaves have yellow, necrotic lesions on their margins and sometimes show signs of curling. In all other visible phenotypes the overexpressing lines are like the wild type.

This demonstrates that PEPc kinase expression can be manipulated in transgenic plants and that this can have an effect on the phenotype of the plants.

REFERENCES Andreo, C.S., Gonzalez, D.H. and Iglesias, A.A. (1987) Higher plant phosphoenolpyruvate carboxylase. FEBS Lett . 213, 1-8. Bakrim, N. , Echevarria, C. , Cretin, C. , Arriodupont,

M. , Pierre, J.N., Vidal, J. , Chollet, R. , and Gadal, P. (1992) Regulatory phosphorylation of Sorghum leaf phosphoenolpyruvate carboxylase. Identification of the protein-serine kinase and some elements of the signal- transduction cascade. Eur. J. Biochem . 204, 821-830.

Bechtold, N. , Ellis, J. , and Pelletier, G. (1993) In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. Comptes Rendus de l'Academie des Sciences Serie III, Sciences de la Vie-Life Sciences. 316: 1194-1199.

Carter, P.J. , Nimmo, H.G., Fewson, CA. & Wilkins, M.B. (1991) Circadian rhythms in the activity of a plant protein kinase, EMBO J. 10, 2063-2068.

Carter, P. J. , Wilkins, M.B., Nimmo, H.G. and Fewson, CA. (1995) Effects of temperature on the activity of phosphoenolpyruvate carboxylase and on the control of C0₂ fixation in Bryophyllum fedtschenkoi Planta , 196, 375-380.

Du, Z., Aghoram, K. & Outlaw, W.H. (1997) In vivo phosphorylation of phosphoenolpyruvate carboxylase in guard cells of Vicia faba L. Is enhanced by fusicoccin and suppressed by abscisic acid. Arch Biochem. Biophys, 337,

345-350. 47 Duff, S.M.G. and Chollet, R. (1995) In vivo regulation of wheat-leaf phosphoenolpyruvate carboxylase by reversible phosphorylation. Plant Physiol . 107, 775-782.

Echevarria, C, Vidal, J. , Jiao, J. And Chollet, R. (1990) Reversible light activation of the phosphoenolpyruvate carboxylase protein-serine kinase in maize leaves. FEBS Lett . 275, 25-28.

Hanks, S.K. & Hunter, T. (1995) The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9, 576-596 .

Harper, J.F., Sussman, M.R., Schaller, G.E., Putnam- Evans, C, Charbonneau, H. & Harmon, A.C. (1991) A calcium-dependent protein kinase with a regulatory domain similar to calmodulin. Science 252, 951-954. Hartwell, J. , Gill, A., Nimmo, G. A., Wilkins, M. B. ,

Jenkins, G. I. and Nimmo, H. G. (1999) Phosphoenolpyruvate carboxylase kinase is a novel protein kinase regulated at the level of expression. Plant J. 20, 333-342.

Hartwell, J. , Smith, L.H., Wilkins, M.B., Jenkins, G.I. & Nimmo, H.G. (1996) Higher plant phosphoenolpyruvate carboxylase kinase is regulated at the level of translatable mRNA in response to light or a circadian rhythm. Plant J. 10, 1071-1078.

Hrabak, E.M. , Dickmann, L.J. , Satterlee, J.S. & Sussman, M.R. (1996) Characterisation of eight new members of the calmodulin-like domain protein kinase gene family from Arabidopsis thaliana . Plant Mol . Biol . 31, 405-412. Hudspeth, R.L. , Glackin, A. , Bonner, J. & Grula, J.W. (1986) Genomic and cDNA clones for maize phosphoenolpyruvate carboxylase and pyruvate, orthophosphate dikinase: expression of different gene family members in leaves and roots. Proc. Natl . Acad. Sci . USA 83, 2884-2888.

Jackson, J.A. , Fuglevand, G. , Brown, B.A. , Shaw, M.J

& Jenkins, G.I. (1995) Isolation of Arabidopsis mutants altered in the light-regulation of chalcone synthase gene expression using a transgenic screening approach. Plant J.

8, 369-380.

Jiao, J. and Chollet, R. (1988) Light/dark regulation of maize leaf phosphoenolpyruvate carboxylase by in vivo phosphorylation. Arch . Biochem, Biophys . 261, 409-417. Jiao, J.A. , Echevarria, C, Vidal, J. & Chollet, R.

(1991) Protein turnover as a component in the light/dark regulation of phosphoenolpyruvate carboxylase protein- serine kinase activity in C₄ plants. Proc . Natl .Acad . Sci . USA 88, 2172-2715. Johnson, L.N., Noble, M.E.M. & Owen, D.J. (1996)

Active and inactive protein kinases: structural basis for regulation. Cell 85, 149-158.

Langdale, J.A. , Rothermel, B.A. & Nelson, T. (1988) Cellular pattern of photosynthetic gene expression in developing maize levels. Genes & Development 2, 106-115. 49 Lee, J-Y, Yoo, B-C & Harmon, A.C (1998) Kinetic and calcium-binding properties of three calcium-dependent protein kinase isoenzymes from soybean. Biochemistry 37, 6801-6809. Li, B., Pacquit, V, Jiao, J-A. , Duff, S.M.G.,

Maralihalli, G.B., Sarath, G. , Condon, S.C, Vidal, J. & Chollet, R. (1997) Structural requirements for phosphorylation of C₄-leaf phosphoenolpyruvate carboxylase by its highly regulated protein-serine kinase. A comparative study with synthetic-peptide substrates and mutant target proteins. Aust . J. Plant Physiol . 24, 443- 449.

McNaughton, G.A.L., MacKintosh, C, Fewson, CA. , Wilkins, M.B. and Nimmo, H.G. (1991) Illumination increases the phosphorylation state of maize leaf phosphoenolpyruvate carboxylase by causing an increase in the activity of a protein kinase. Biochim . Biophys . Acta, 1093, 189-195.

Nimmo, H.G. (1993) The regulation of phosphoenolpyruvate carboxylase by reversible phosphorylation. In Post-Translational Modifications in Plants (Battey, N.H. , Dickinson, H.G. and Hetherington, A.M. eds) . Society for Experimental Biology Seminar Series No. 53. Cambridge: Cambridge University Press, pp. 161- 170. 50

Nimmo, G.A. , McNaughton, G.A.L., Fewson, CA. ,

Wilkins, M.B and Nimmo, H.G. (1987) Changes in the kinetic properties and phosphorylation state of phosphoenolpyruate carboxylase in Zea mays leaves in response to light and dark. FEBS Lett . 213, 18-22.

Nimmo, G.A. , Nimmo, H.G., Fewson, CA. and Wilkins,

M.B. (1984) Diurnal changes in the properties of phosphoenolpyruvate carboxylase in Bryophyllum leaves: a possible covalent modification. FEBS Lett . 178, 199-203. O'Leary, M.H. (1982) Phosphoenolpyruvate carboxylase: an enzymologist ' s view. Ann . Rev. Plant Phyε . 33, 297-315.

Osmond, C.B. and Holtum, J.A.M. (1981) Crassulacean acid metabolism. In the Biochemistry of Plants, Volume 8

(Hatch, M.D. and Boardman, N.A. eds) . New York: Academic Press, pp. 283-370.

Sambrook, J. , Fritsch, E.F. & Maniatis, T. Molecular cloning: a laboratory manual (Cold Spring Harbor, NY: Cold

Spring Harbor Laboratory) (1989) .

Smith, L.H., Lillo, C, Nimmo, H.G. and Wilkins, M.B. (1996) Light regulation of PEPCase in barley mesophyll protoplasts is modulated by protein synthesis and calcium and not necessarily correlated with PEPCase kinase activity. Planta , 200, 174-180.

Taybi, T., Patil, S., Chollet, R. and Cushman, J. C (2000) A minimal serine/threonine protein kinase circadianly regulates phosphoenolpyruvate carboxylase activity in Crassulacean acid metabolism-induced leaves of the common ice plant. Plant Physiol . 123, 1471-1481 51

Vidal, J. & Chollet., R. (1997) Regulatory phosphorylation of C₄ PEP carboxylase. Trends in Plant Science 2, 230-237.

Wilkins, M.B. (1992) Circadian rhythms - their origin and control. New Phytol . 121, 347-375.

Zhang, X.-Q., Li, B. & Chollet, R. (1995) In vivo regulatory phosphorylation of soybean nodule phosphoenolpyruvate carboxylase. Plant Physiol. 108, 1561- 1568.

Claims

C AIMS 1. An isolated DNA molecule encoding a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme or fragments thereof from a plant source.

2. A DNA molecule according to claim 1 wherein the molecule encodes a protein from a plant from the division spermataphyta.

3. A DNA molecule according to claim 2 wherein said molecule encodes a protein from a dicotyledonous or monocotyledonous plant.

4. A DNA molecule according to claim 3 wherein said plant is from a family selected from the group consisting of Brassicaceae, Musaceae, Solanaceae, Poaceae and Malvaceae.

5. A DNA molecule according to claim 3 wherein the plant is selected from the group consisting of C₄ plants, CAM plants and C₃ plants.

6. A DNA molecule according to any preceding claim, wherein said DNA molecule comprises a sequence substantially as shown in Figures 1, 2, 5, 6, 8, 10, 12, 14, 16, 24, 25, 30, 32 and 34, or a fragment thereof.

7. A DNA molecule according to any preceding claim, wherein said DNA molecule comprises the coding sequence for PEPc kinase enzyme.

8. A polypeptide comprising a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme from a plant source, or functional fragment thereof.

9. A polypeptide according to claim 8 wherein the PEPc kinase enzyme is from a plant from the division spermataphyta .

10. A polypeptide according to claim 9 wherein said PEPc kinase enzyme is from a dicotyledenous or monocotyledonous plant.

11. A polypeptide according to claim 10 wherein said PEPc kinase enzyme is from a family selected from the group consisting of Brassicaceae, Musaceae, Solanaceae, Poaceae and Malvaceae.

12. A polypeptide according to claim 10 wherein said PEPc kinase enzyme is selected from the group consisting of C₄ plants, CAM plants and C₃ plants.

13. A polypeptide according to any one of claims 8 to 12 wherein said PEPc kinase enzyme comprises a sequence selected substantially as shown in Figures 4, 7, 9, 11, 13, 15, 17, 26, 31, 33 and 35, or a fragment thereof.

14. A nucleotide sequence comprising a transcriptional regulatory sequence and a sequence under the transcriptional control thereof which encodes an RNA sequence characterised in that the RNA sequence is anti- sense to a mRNA which codes for PEPc kinase enzyme.

15. A nucleotide sequence according to claim 14 wherein said RNA sequence which is anti-sense to a mRNA which codes for PEPc kinase is 50-1500 nucleotides in length.

16. An expression cassette comprising a promoter operably linked to a DNA molecule encoding a PEPc kinase or functionally active variant thereof from a plant.

17. An expression cassette according to claim 16 wherein said plant is selected from the group consisting of

Brassicaceae, Musaceae, Solanaceae, Poaceae and Malvaceae.

18. An expression cassette according to claim 17 wherein said plant is selected from the group consisting of C₄ plants, CAM plants and C₃ plants.

19. An expression cassette according to any of claims

16 to 18 wherein said DNA molecule comprises a sequence substantially as shown in Figures 1, 2, 5, 6, 8, 10, 12, 14, 16, 24, 25, 30, 32 and 34, or a fragment thereof.

20. A biological vector comprising a DNA construct, said DNA construct comprising a nucleotide sequence which encodes PEPc kinase from plants.

21. A biological vector according to claim 20 wherein said vector is Agrobacterium tumefaciens .

22. A transgenic plant wherein the cells of said plant are stably transformed with the DNA molecule of claims 1 to 7, the expression cassette of claims 16 to 19, or the biological vector of claim 20.

23. A transgenic plant according to claim 22 wherein said plant is selected from the group consisting of Brassicaceae, Musaceae, Solanaceae, Poaceae and Malvaceae.

24. A transgenic plant according to claims 22 or 23 wherein the expression of PEPc kinase in said transgenic plant results in altered levels of lipid in at least a portion of the cells of said transgenic plant, or seeds produced thereof.

25. Use of an isolated DNA molecule which encodes a phosphoenolpyruvate carboxylase kinase (PEPc kinase) enzyme or fragment thereof from a plant source for the production of transgenic plants.

26. Use of a DNA molecule according to claim 25 wherein said plant is from a family selected from the group consisting of Brassicaceae, Musaceae, Solanaceae, Poaceae and Malvaceae.

27. Use of a DNA molecule according to claim 26 wherein the plant is selected from the group consisting of

C₄ plants, CAM plants and C₃ plants.

28. Use of a DNA molecule according to any of claims 25 to 27, wherein said DNA molecule comprises a sequence substantially as shown in Figures 1, 2, 5, 6, 8, 10, 12, 14, 16, 24, 25, 30, 32 and 34, or a fragment thereof.

29. A method of producing a protein having phosphoenolpyruvate carboxylase kinase activity in a host organism, said method comprising

(a) inserting a DNA sequence encoding a protein having phosphoenolpyruvate carboxylase kinase (PEPc kinase) activity into a host cell;

(b) growing the said transformed host cell in a suitable culture medium; (c) expressing said DNA sequence to produce said protein; and

(d) isolating the protein product either from the transformed host cell or the culture medium or both and purifying it.

30. A polynucleotide probe comprising at least 10 contiguous bases, from the sequences shown in Figures 1, 2, 5, 6, 8, 10, 12, 14, 16, 24, 25, 30, 32 or 34.

31. Use of an antibody raised to plant PEPc kinase for detecting the presence of said PEPc kinase in a sample.

32. Use of an antibody according to claim 31, wherein said antibody is raised to a polypeptide as claimed in any of claims 8 to 13.