US20040038360A1 - Ethanolaminephosphate cytidylyltransferase gene and promoter - Google Patents

Ethanolaminephosphate cytidylyltransferase gene and promoter Download PDF

Info

Publication number
US20040038360A1
US20040038360A1 US10/392,837 US39283703A US2004038360A1 US 20040038360 A1 US20040038360 A1 US 20040038360A1 US 39283703 A US39283703 A US 39283703A US 2004038360 A1 US2004038360 A1 US 2004038360A1
Authority
US
United States
Prior art keywords
gene
human
mouse
val
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/392,837
Inventor
Marica Bakovic
Arkadi Poloumienko
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Guelph
Original Assignee
University of Guelph
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Guelph filed Critical University of Guelph
Priority to US10/392,837 priority Critical patent/US20040038360A1/en
Assigned to UNIVERSITY OF GUELPH reassignment UNIVERSITY OF GUELPH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BAKOVIC, MARICA, POLOUMIENKO, ARKADI
Publication of US20040038360A1 publication Critical patent/US20040038360A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)

Definitions

  • the present invention relates generally to the fields of genes and promoters. More particularly, the present invention relates to an isolated gene and promoter of the enzyme ethanolaminephosphate cytidylyltransferase.
  • PE Phosphatidylethanolamine
  • inner-membrane proteins 1 or acts as a molecular chaperone and assists in proper protein folding (2).
  • PE also plays an important role in physiological processes such as blood coagulation, platelet activation, cell signalling, membrane fusion, cell cycle progression, cell division, and apoptosis (3-9). Transfer of PE from lipoproteins to platelets induces their activation (3) and PE induces high-affinity binding sites for factor VIII and stimulates its pro-coagulant activity (4).
  • PE is also involved in the thrombotic activity found in some cases of lupus where it further inhibits activated protein C (5).
  • PE is a direct precursor of other lipids and provides ethanolamine moiety for anandanide (a physiological ligand for the cannabioid receptors) and glycosylphospatidylinositol (GPI) membrane anchors for a diverse group of proteins known as proteoglycans.
  • anandanide a physiological ligand for the cannabioid receptors
  • GPI glycosylphospatidylinositol
  • Plasmalogens play a role in the prevention of oxidation of lipoproteins (16) and constitute a significant portion of total PE in many tissues (18,19).
  • plasmalogens play a role in the prevention of oxidation of lipoproteins (16) and constitute a significant portion of total PE in many tissues (18,19).
  • the principal biological function of plasmalogens is not firmly established and the understanding of the regulation of their production is surprisingly limited.
  • Their production is severely impaired in the peroxisomal disorders such as Zellweger syndrome, Refsum disease (11) and neurological disorders (21-23).
  • Glycosylated PE is abundant in lipoproteins of diabetics and has been implicated in the promotion of atherosclerosis in those individuals (24).
  • PE phosphatidylserine
  • PSD PS decarboxylase
  • PSS PS synthase
  • PC phosphatydylcholine
  • CDP-ethanolarnine pathway or Kenedy pathway synthesizes PE de novo from ethanolamine and diacylglycerols (DAGs).
  • the CDP-ethanolamine pathway includes three enzymatic steps consisting of the phosphorylation of ethanolamine (Etn), the formation of CDP-ethanolamine and pyrophosphate from phosphoethanolamine (P-Etn), and the final formation of PE from the transfer of phosphoethanolamine from CDP-ethanolamine (CDP-Etn) to diacylglycerol (DAG). These three steps are catalyzed by the enzymes ethanolamine kinase (EK), CTP:phosphoethanolamine cytidylyltransferase (ET), and ethanolaminephosphotransferase (EPT), respectively as shown in FIG. 1.
  • EK ethanolamine kinase
  • ET phosphoethanolamine cytidylyltransferase
  • EPT ethanolaminephosphotransferase
  • PPARs are activated by a diverse group of pharmacological ligands, the peroxisome proliferators (e.g., fibrates, troglitazone), which are well known drugs for regulating lipoprotein levels and very important for prevention of atherosclerosis.
  • the peroxisome proliferators e.g., fibrates, troglitazone
  • Ethanolamine kinase exists in several isoforms (20,25,26) having both EK and choline kinase (CK) activities.
  • the isolation of two rat cDNA clones for CK/EK has allowed for the characterization of two separate rat genes (27, 28) and two mouse gene products (29).
  • EPT is responsible for production of PE by transferring phosphoethanolamine from CDP-ethanolamine to DAG (30) and a separate enzyme, cholinephophotransferase (CPT), is responsible for this reaction in the CDP-choline pathway.
  • CPT and CPT are encoded by two separate genes (31,32).
  • the EPT gene was cloned by complementation of an EPT yeast mutant with a yeast genomic library (33). Subsequently, the human cDNA for EPT has been isolated (34). Interestingly, the human ethanolamine lipids (34).
  • CTP phosphoethanolamine cytidylyltransferase
  • ETP phosphoethanolamine cytidylyltransferase
  • CDP-ethanolamine pathway 35
  • rat ET protein Only rat ET protein has been successfully purified and its biochemical properties clearly established (36-38). The rat protein is considered soluble but could localize between the cisternae of the rough ER and the cytosolic space suggesting some associations with membranes (37).
  • rat ET only has activity towards ethanolaminephosphate and does not show any affinity for cholinephosphate (38).
  • ET and CTP phosphocholine cytidylyltransferase (CT) cDNAs are produced by two different genes (39, 40).
  • ET cDNAs from yeast, human, and rat have been functionally characterized and showed a high degree of homology between sequences (39-41). Neither the mouse ET cDNA nor any ET gene has yet been characterized.
  • ET protein possesses a recognition motif MIRNG and two catalytic domains with large internal repetitive sequences in its N-and C-terminal halves; both parts of the sequence contain the CTP-binding motif HXGH (41), which is conserved in the entire cytidylyltransferase superfamily (42).
  • CT does not contain the MIRNG motif, does not have two similar halves, and possesses only single HXGH motif (39, 40).
  • ET is a critical enzyme required for the de novo synthesis of PE
  • no gene has been characterized and little is known about the regulation of this enzyme's expression.
  • Recent evidence (43) indicates that rat ET mRNA and protein level increase during liver development; a higher change in mRNA than protein was visible, suggesting that combined transcriptional and translational events are may be involved in the regulation of ET activity. It would be advantageous to fully elucidate the regulation of the ET gene product.
  • ET phosphocholine cytidylyltransferase
  • PC phosphatidylcholine
  • PE plasmalogens which comprise a large portion of total cellular PE (50) and may play an important role in proper functioning of the brain and heart (51). It would be of great interest to fully understand the regulation of ET at the level of transcription. This information could be compared to the regulatory pathways of CT and other genes involved in lipid and cholesterol metabolism to establish the regulatory mechanisms for membrane biogenesis and lipid maintenance during normal development and in lipid-related pathological states.
  • the invention provides a gene encoding a protein having ethanolaminephosphate cytidylyltransferase activity consisting of a sequence selected from the group consisting of: (a) SEQ ID NO: 1; (b) a degenerate sequence of SEQ ID NO: 1 and (c) a sequence which hybridizes to the complement of SEQ ID NO: 1 under stringent conditions.
  • the gene may optionally be derived from human or mouse.
  • the invention provides a promoter of an ethanolaminephosphate cytidylyltransferase gene, said promoter consisting of a sequence selected from the group consisting of: (a) SEQ ID NO: 2; (b) a sequence according to SEQ ID NO: 2 having substitutions or deletions and maintaining promoter activity; and (c) a sequence which hybridizes to the complement of SEQ ID NO: 2 under stringent conditions.
  • the substitutions or deletions may render the promoter at least 90% identical to SEQ ID NO: 2, for example.
  • the gene and promoter according to the invention can be used to produce a transgenic mammal, for example a knock-out mouse.
  • the gene and promoter are useful in identifying, preventing, and treating diseases related to inappropriate phoshatidylethanolamine production.
  • the invention further provides a CTP:Ethanolaminephosphate Cytidylyltransferase (ECT) peptide having the sequence CTKAHHSSQEMSSEYRE according to SEQ ID NO: 53, and a CTP:Ethanolaminephosphate Cytidylyltransferase (ECT) specific antibody against this peptide.
  • ECT CTP:Ethanolaminephosphate Cytidylyltransferase
  • FIG. 1 shows a schematic representation of the three known biosynthetic pathways for phosphatidylethanolamine (PE) in mammalian cells.
  • FIG. 2 is a consensus alignment (SEQ ID NO: 3) of amino acid sequences of rat ET (rET) (SEQ ID NO: 4), human ET (hET) (SEQ ID NO: 5), and the mouse ET (mET) (SEQ ID NO: 6) proteins.
  • the alignment illustrates the ET consensus motifs MIRNG and HYGH, conserved in the entire cytidylyltransferase superfamily.
  • FIG. 3 is the structure and organization of the murine ET gene, as provided in SEQ ID NO: 1.
  • FIG. 4 illustrates the determination of transcription initiation site of human ET gene.
  • the 5′RACE strategy showing the location of human ET-specific primer binding sites is provided.
  • FIG. 5 shows results of the PCR reaction for the 5′RACE of human ET cDNA using the abridged anchor primer, AAP, and the gene specific reverse primer RP2AC.
  • FIG. 6 shows identification of positive clones for the 5′-end of human ET.
  • FIG. 7 shows alignment (SEQ ID NO: 7) of the positive clones for the 5′-end of human ET to the published human ET cDNA sequence.
  • the sequence of the gene specific primer sequence, I2RP is underlined.
  • the translational start codon of hET is in bold and underlined.
  • HET-C5.3, hET-C2.3 and HETC1.1 are represented as SEQ ID NO: 8-SEQ ID NO: 10, respectively.
  • FIG. 8 shows the 5′-flanking (regulatory, promoter) region of the human ET (corresponding to SEQ ID NO: 2) with consensus cis-elements for the regulatory transcription factors.
  • FIG. 9 shows the structure and organization of the mECT gene and differences in splicing between the mouse and human genes.
  • Part A is a schematic representation of the mECT gene deduced from the genomic clone BAC45A04
  • Part B is Schematic representation of hECT deduced from the alignment of human Chromosome 17 contingent NT — 010845 sequence and hECT cDNA GenBank NM — 002861.
  • FIG. 10 illustrates mapping the transcription start sites of the mouse and human ECT genes.
  • Part A represents the strategy of 5′-RACE: Mouse or human total RNA reverse transcription.
  • Part B represents 5′-end PCR products.
  • Part C shows the mECT and hECT 5′-untranslated regions and the positions of transcription start sites, corresponding to SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
  • FIG. 11 illustrates a strategy for determination of transcription termination site(s) of the mECT gene.
  • Part A shows a strategy of 3′-RACE: Mouse RNA reverse transcription.
  • Part B illustrates a nested PCR product of the 3′-amplification of mECT cDNA.
  • Part C shows a sequence of the 3′-untranslated region (3′-UTR) of the mECT transcript (SEQ ID NO: 13).
  • Part D depicts Comparison of transcription termination end products for the mouse and human ECT.
  • FIG. 12 shows tissue expression profiles and enzymatic activity of mECT.
  • Part A shows total RNA from various tissues.
  • Part B depicts the expression of hECT mRNA in various cell lines.
  • Part C illustrates mECT enzymatic activity in various tissues.
  • FIG. 13 illustrates transcriptional activity of the mECT promoter.
  • Part A shows mouse embryonic fibroblasts C3H10T1/2
  • Part B shows human breast cancer cells MCF-7.
  • FIG. 14 illustrates a multiple alignment of the amino acid sequence of rat, mouse, and human proteins (SEQ ID NO: 14-SEQ ID NO: 16, respectively), showing that protein structure is conserved among mouse, rat and human ECTs.
  • FIG. 15 compares 5′-regulatory promoter regions of the mouse (Part A) (SEQ ID NO: 17) and human (Part B) ECT (SEQ ID NO: 18) genes.
  • the two promoters show low sequence homology but high conservation of binding sites for transcription factors CAAT, Sp1 and NF 1.
  • Nucleotide +1 denotes the transcription start sites and is marked by an arrow.
  • FIG. 16 illustrates an HPLC chromatogram of ET peptide used for the production of ET antibody.
  • FIG. 17 illustrates titration curves of the immune antiserum isolated from rabbit #4649g relative to its preimmune serum (4649 pre).
  • FIG. 18 shows titration curves for the immune serum isolated from the immunized rabbit #4648g relative to its preimmune serum (4648 pre).
  • the isolated gene and promoter sequences are novel and do not match any other sequences in the mouse and human database.
  • the mouse gene sequence is unique and distinct from the human gene sequence.
  • the isolated gene and promoter have a number of applications within the biotechnology and pharmaceutical industries.
  • the invention establishes the isolation and functional characterization of the mouse (mECT) gene and its regulatory promoter.
  • the structures of both mouse and human ECT genes are established and transcription initiation and termination sites are identified.
  • the invention compares the regulation of the two genes and show that they produce two different transcripts as a result of differential splicing of exon 7 within the central region.
  • Mouse ECT is broadly expressed in mouse tissues but the high level of expression found in the kidney, liver, and lungs relative to other tissues is conserved between mice and humans.
  • the invention also relates to the cloning of a functional mECT promoter and compare its activity relative to the CTP:cholinephosphate cytidylyltransferase ⁇ (CCT ⁇ ) promoter.
  • FIG. 1 illustrates the biosynthetic pathways for phosphatidylethanolamine in eukaryotic cells.
  • PE is synthesized (i) de novo in the endoplasmic reticulum from ethanolamine (Etn) and DAG/alkylacylglycerols; in the Golgi/vacuole and mitochondria from the decarboxylation of PS (ii), and (iii) in the ER via a Ca2+-dependent base-exchange mechanism in which Etn replaces the head group of a pre-existing phospholipid, PC or PS.
  • CDP-ethanolamine pathway De novo synthesis via CDP-ethanolamine (CDP-Etn) pathway is an important route for PE biosynthesis in mammalian tissues and is essential for the production of PE plasmalogens.
  • PE phosphatidylethanolamine
  • PS phosphatidylserine
  • PC phosphatidylcholine
  • Etn ethanolamine
  • DAG diacylglycerol
  • EK ethanolamine kinase
  • ECT CTP:phosphoethanolamine cytidylyltransferase
  • EPT CDP-ethanolamine:1,2-diacylglycerol ethanolaminephosphotransferase
  • PSD phosphatidylserine decarboxylase
  • PSS base-exchange/phosphatidylserine synthase.
  • the invention is based on the screening of the mouse RP23 BAC (Bacterial Artificial Chromosome) library by using the 3′-end “overgo” cDNA sequence of the mouse ET. Thirteen positive mouse ET clones were identified. The BAC clones were reamplified with different primers, and after subcloning into a PCR vector and sequencing all positive clones were identified, the mouse ET gene was reconstructed. The BAC clones encoding the full-length mouse ET gene were isolated. The murine ET gene and the 5′ flanking (regulatory, promoter) region of the human ET gene were determined and are disclosed herein. The characterization of the overall structure for the murine and human ET genes as well as the localization of cis-DNA elements for transcription factors in the 5′flanking promoter region of the human gene are disclosed.
  • a gene according to the invention encoding a protein having ethanolaminephosphate cytidylyltransferase activity.
  • the gene consists of a sequence selected from the group consisting of: (a) SEQ ID NO: 1; (b) a degenerate sequence of SEQ ID NO: 1 and (c) a sequence which hybridizes to the complement of SEQ ID NO: 1 under stringent conditions.
  • a portion of such a gene capable of encoding a protein having ethanolaminephosphate citidylyltransferase activity also falls within the scope of the invention.
  • SEQ ID NO: 1 was isolated from mouse.
  • a promoter of an ethanolaminephosphate cytidylyltransferase gene according to the invention has a sequence selected from the group consisting of: (a) SEQ ID NO: 2; (b) a degenerate sequence of SEQ ID NO: 2 possessing promoter activity; and (c) a sequence which hybridizes to the complement of SEQ ID NO: 2 under stringent conditions.
  • a “degenerate sequence” it is meant a sequence in which a different codon is used to specify the insertion of the same amino acid in a peptide chain.
  • Degenerate sequence codons can easily be determined by those of skill in the art. Further, sequences specifying codons which indicate a conservative substitution of an amino acid into a sequence, which conservative substitution does not effect the resulting protein function also fall within the scope of the invention. The effect of such conservative substitutions can be determined according to functional tests.
  • stringent conditions it is meant hybridization conditions of temperature and concentration which ideally result in duplex DNA molecules formed only between strands in which the vast majority of nucleotide bases are paired.
  • An advantage of knowing the sequence of the isolated mouse ET gene according to the invention is that the genetic control of PE formation can be determined for effects on PE availability for membranes during cell growth, determination of the role of PE in performance of specialized functions such as blood clotting and in response to disease states such as cancer.
  • PE formation requires the action of the ET gene product.
  • the possession of the genomic sequence and the knowledge of the primary structure of this gene allows manipulation of the structure and function of this gene.
  • transgenic animals by either mutating the gene, increasing gene expression, or deleting all or a portion on the gene to produce a knock-out mouse strain. Further, a transgenic animal so formed could be cross-bred with other transgenic animals which also provide models of disease.
  • transgenic animals or “knocking-out” this gene it will be possible to define the molecular interactions regulating the production of this enzyme at the genetic level and its relationships with other lipid genes. This has applications for diagnosis, prevention and therapy of diseases related to inappropriate PE production, such as Zellweger's syndrome, or lipid-related diseases such as cardiovascular disease and obesity.
  • Transgenic animals containing the ET promoter fused to a reporter gene can be produced according to the invention.
  • a reporter gene e.g., green-fluorescent protein, luciferase
  • Such transgenic animals may include regulatory sequences or other mechanisms to allow for basal and tissue-specific transcription of this gene. This will allow analysis of the signalling pathways required for gene expression during normal cell growth and malignant transformations.
  • BAC bacterial artificial chromosome
  • CDP-etn CDP-ethanolamine
  • DAG diacylglycerol
  • DEPC diethyl pyrocarbonate
  • EK ethanolamine kinase
  • EPT ethanolaminephosphotransferase
  • Etn ethanolamine
  • PCR polymerase chain reaction
  • PtdCho phosphatidylcholine
  • PtdEtn phosphatidylethanolamine
  • PtdSer phosphatidylserine
  • ET CTP:ethanolaminephosphate cytidylyltransferase
  • RT-PCR reverse transcriptase-mediated PCR
  • RACE rapid amplification of cDNA ends
  • PC phosphatydylcholine
  • P-etn phosphoethanolamine
  • CT CTP:cholinephosphate cytidylyltransferase
  • PE ethanolamine
  • PCR products The cloning of PCR products was performed either by the TA cloning kit (Invitrogen, Mississauga, ON, Canada) or QIAGEN PCR cloning kit and the QIAPrepTM Spin Miniprep Kit was used for purification (Qiagen). All other reagents were obtained from Sigma (Oakville, ON, Canada) or Fisher Scientific (Nepean, ON, Canada).
  • Mouse Library Screening The mouse RPCI23 genomic library from C57BL/J6 female (Roswell Park Cancer Institute, Buffalo) was screened. An individual probe screening of seven filter sets was performed with an overgo-generated probe specifically designed from a mouse EST (GenBankTM: BC003473) and compared to human ET gene and marker (stSG12878) sequence of Chromosome 17 (GenBank: AC069004, BAC clone: RP11-498C9).
  • BAC and plasmid DNA preparation and analysis were isolated using either a Qiagen midi-prep kit (tip 100) or by standard methodology according to Sambrook and Russell (Molecular Cloning, a laboratory manual, 3rd Ed.). Plasmid DNA was isolated with a WizardTM miniprep kit, WizardTM maxiprep kit and/or by the ConcertTM miniprep kit. Screening and characterization of the genomic BAC (bacterial artificial chromosome) clones for the murine ET gene were performed by PCR and sequencing. PCR reactions were performed under the following conditions: the initial denaturation for 3 min at 94° C., plus 30 cycles of denaturation at 94° C. for 30 sec, annealing at 58° C.
  • PCR products were cloned into a PCR vector from the Qiagen PCR cloning kit and subsequently sequenced in both directions by using the vector specific primers and/or the ET specific primers.
  • RNA isolation and RT-PCR analysis RNA isolation and RT-PCR analysis.
  • Murine tissues (adipose, brain, kidney, liver, lung, spleen and testis) from p57/BL mice were snap-frozen in nitrogen and total RNA was isolated using TriazolTM reagent according to manufacturers instructions. RNA was evaluated by performing electrophoresis on 1% formaldehyde gels with ethidium bromide. Total RNA was reverse-transcribed using an 18-oligo-dT primer and SuperscriptTM II reverse transcriptase, as per manufacturers instructions. Briefly, 5 ⁇ g of total RNA was incubated at 70° C. for 10 min in the presence of 1 ⁇ l of primer (10 ⁇ M).
  • the transcriptional start site of human ET gene was determined by the 5′RACE methodology.
  • Total RNA from human hepatoma cells HepG2 (Geneka Biotechnology) was subjected to a reverse transcription using oligo(dT) primer and SuperscriptTM II reverse transcriptase (RT), following the manufacturers' instructions.
  • RT SuperscriptTM II reverse transcriptase
  • the newly synthesized cDNA was purified and tailed with a poly(dC) using reverse terminal deoxynucleotidyl transferase (rTdT).
  • the 5′-end tailed fragment of the human ET was then amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 ⁇ M dNTPs, 400 ⁇ M abridged anchor primer (annealing to the poly(dC) tail), 400 ⁇ M RP2AC gene specific reverse primer (Table 1), 8% glycerol (to increase primer binding specificity), 2.5 units Taq polymerase, and 10 ⁇ l tailed cDNA template, with a final volume of 50 ⁇ l.
  • This reaction was subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C. The reaction was terminated after a 10 min final extension at 72° C.
  • Nested PCR was performed using 3 ⁇ l of the above PCR mixture, amplified using the AAP primer and either I2RP or RP1AC gene specific reverse primer (Table 1) under the same conditions. Table 1 provides a list of human ET specific primers used in the 5′-RACE analysis (SEQ ID NO: 22 to SEQ ID NO: 28, respectively).
  • the 5′ sequence proximal to the transcriptional initiation site was obtained by using human ET specific primers for amplifying human genomic DNA isolated from MCF-7 human mammary carcinoma cell line and/or a BAC clone RP11498C9 (GenBankTM AC069004) obtained from The Sanger Sequencing Center, UK.
  • the sequence of the ET promoter region was evaluated using the TransfacTM transcription factor database located at http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html.
  • FIG. 3 shows the structure and organization of the murine ET gene. Schematic representation of both murine ET gene and cDNA are shown. Solid horizontal lines and solid boxes represent Introns and Exons, respectively. Numbers and sizes of exons (1-14) and introns (I-XIV) are also shown. The position and size of exons within the murine ET cDNA are indicated in the lower part of the FIG. 3.
  • the translational start site codon, ATG, encoding the protein is at the beginning of Exon 1 and the stop codon, TGA, is in Exon 14 at position 1257-1259.
  • the mid section displays the cloning strategy, the positions of primers and six overlapping clones used for the genomic sequence analysis.
  • the sequenced ET gene is 7,188 kb in length starting from the ATG translation start codon and ending at the TGA translation stop codon.
  • the gene is composed of 14 exons interrupted by 13 introns shown in FIG. 3 and Tables 2 and 4. The sizes of exons range from 44 (Exon 6) to 189 bp (Exon 3) and Exon 14 contains the TGA stop codon.
  • TABLE 4 The location and size of the non-coding, intervening sequence (introns) in the genomic clone BAC45A04 and the exon-intron boundaries within the murine ET gene. Intron No.
  • the human gene contains 15 exons and 14 introns: the sizes of exons are between 36 bp (Exon 13) and 958 bp (Exon 14) and the sizes of introns are between 128 (Intron 12) and 7944 (Intron 14) as shown in Table 5.
  • TABLE 5 Intron sizes of human ET and the exon-intron boundaries within this gene obtained from the GeneBank sequence contingent at Chromosome 17 NT_01045. 5′-Splice Intron Intron 3′-Splice Donor* No.
  • the invention also establishes the exon-intron boundaries of the mouse and human genes as shown in Table 4 and Table 5, respectively.
  • the boundary sequences at the 5′- and 3′-ends of all the mouse introns are GT and AG, respectively. These are consensus sequences for pre-mRNA splicing donor and acceptor sites.
  • FIG. 4 to FIG. 6 illustrate steps involved in the determination of transcription initiation site of human ET gene.
  • FIG. 4 shows 5′RACE strategy illustrating the location of human ET-specific primer binding sites.
  • the abridged anchor primer, AAP binds to the dCTP tail of the cDNA.
  • Gene specific reverse primers of human ET, I2RP, RP1AC, and RP2AC bind to the cDNA at positions +316/+333, +383/+404, and +544/+562, respectively. These positions correspond to the published sequence for the human ET cDNA (GenBankTM D84307).
  • FIG. 5 shows the results of the PCR reaction for the 5′ RACE of human ET cDNA using the abridged anchor primer, AAP, and the gene specific reverse primer RP2AC.
  • lane 1 represents a 100 bp ladder and the bright band corresponds to a 600 bp fragment.
  • FIG. 6 shows the results of one PCR screening of colonies containing the inserts from the nested PCR reaction. Only lane 3 holds the PCR product size of a length, of about 500 bp, that corresponds to the length of the 5′end of human ET including the 5′ and 3′ flanking regions that would be amplified from the pCR2.1 vector using pCR2.1 specific primers binding to 5′ and 3′ flanking regions of the insert area. Further screening yielded three colonies that contained inserts of a desired length. They were all further confirmed for the 5′-end of human ET by sequencing.
  • FIG. 7 represents the sequence alignment of three positive clones with the published sequence for the human ET cDNA (GenBankTM D84307).
  • the clones named hET-C5.3, C2.3, and C1.1, contained the sequence for human ET from positions +23/+333, +111/+333, and +109/+333, respectively.
  • Position +333 corresponds to the last nucleotide of the nested 12RP reverse primer.
  • Clone hET C5.3 having a 5′-end beginning at position +23 in comparison to the published human ET cDNA, represents one transcriptional start site of human ET.
  • the ATG translational start codon for the gene lies downstream of the start site, at position +67.
  • Clones hET C2.3 and C1.1 may represent a second transcription start site. There is an ATG codon at position +149 but it seems unlikely that it is in fact a true start site for human ET gene. A translational start at this position would not include the MIRNG motif conserved in all ET proteins, shown in FIG. 2. This suggests that the clone hET-C5.3 is representative of the 5′end of the human ET cDNA and is also representative of the true transcriptional start site of the human ET gene. This evidence also suggests that the promoter of the human ET gene lies just upstream, in the 5′ flanking sequence of the beginning of exon 1.
  • Human ET gene has been characterized using data obtained from the human genome project (BAC clone RP11498C9, GenBankTM AC069004, and human ET cDNA, GenBankTM NT — 010845, sequence alignments).
  • Human ET gene consists of 14 exons (total size ⁇ 20 Kb) the first 13 exons of which are separated by relatively small introns ( ⁇ 500 bp) as shown in Table 5. Intron 13 is comparatively larger than the rest ( ⁇ 12 kb, Table 4), separating exon 14 from the rest of the gene. From the results of 5′RACE according to the invention, the ATG start codon lies 45 bp downstream of the transcription start site.
  • the promoter region of human ET which lies immediately upstream of exon 1, is approximately 500 bp and has the sequence shown in SEQ ID NO: 2 and FIG. 8. Upstream of this region lies the coding sequence of another gene.
  • FIG. 8 shows 5′-flanking (regulatory, promoter) region of the human ET (SEQ ID NO: 2) with consensus cis-elements for the regulatory transcription factors.
  • italics is the exon 1 of human ET with an arrow pointing to the transcription start site determined by 5′RACE.
  • ATG translation start codon is underlined in certain boxes.
  • the transcription factor binding sites for the promoter region of the human ET were determined. This analysis led to the identification of multiple binding sites for several families of transcription factors, including the Sp family, the AP family, and the MyoD family. Eleven binding sites for the Sp-1 transcription factor were discovered according to the invention, which lie immediately upstream of the transcription start site in a very GC rich area in the sequence.
  • the Sp-1 family of transcription factors which binds GC boxes, can both initiate and regulate transcription, and offers both ubiquitous and regulated expression of human ET (53).
  • the Sp family of transcription factors play an important role in the expression of the CT gene (54).
  • a CAAT box is located approximately 100 bp from the transcriptional start site.
  • transcription factor binding sites may be utilized in tissue-specific expression of ET gene.
  • tissue-specific expression of ET gene The presence of several cis-elements for binding transacting factors and occurrence of a coding region for another gene upstream of SEQ ID NO: 2 indicates that the isolated DNA of SEQ ID NO: 2 is a promoter.
  • CTP ethanolaminephosphate cytidylyltransferase
  • ECT ethanolaminephosphate cytidylyltransferase
  • the spliced sequence encodes the peptide PPHPTPAGDTLSSEVSSQ, located immediately upstream of the second catalytic motif HIGH, and is entirely encoded by the mouse Exon 7.
  • the human gene is spliced differently from the mouse gene at its 3′-end, between Exons 13 and 14. This does not affect the size of the C-terminus but changes the amino acid composition.
  • Regulatory promoters in both the mouse and the human ECT genes lie immediately upstream of the first exon, within the 5′-flanking region, and have conserved initiation start sequence from ⁇ 3/+10 bp, as GGAG (+1) (C/T)CGCC(A/G)GGA (SEQ ID NO: 41). Both promoters are TATA-less but contain a conserved CAAT box at a matching distance ( ⁇ 85/ ⁇ 70 bp) from the transcription start site. The two promoters have low sequence similarities but share binding sites for transcription factors of the Sp1 and NF1 family.
  • Promoter-luciferase reporter analysis shows that the mouse ECT promoter is strong, cell-type specific, and similar in activity to the CTP: cholinephosphate cytidylyltransferase a promoter.
  • the mouse promoter contains multiple cis-acting elements for MyoD, Ap1, USF, CAAT/NFY and cEBP ⁇ transcription factors, suggesting complex regulation of ECT during tissue development, cell growth, and differentiation.
  • Murine Genomic Library Screening The mouse RPC123 genomic library from a C57BL/J6 female (Roswell Park Cancer Institute, Buffalo) was screened. An individual probe screening of seven filter sets was performed with an overgo-generated probe designed from a mouse EST cDNA (GenbankTM BC003473).
  • BAC DNA was isolated using the QiagenTM large construct kit. Plasmid DNA was isolated using either the QiaprepTM spin miniprep kit or the WizardTM maxiprep kit. Characterization of the mECT gene was accomplished using PCR and sequencing. The positions and the structure of the overlapping primer pairs used for determination of the mECT gene are shown in Table 6.
  • BAC45A04 DNA was performed under the following conditions: 3 min denaturation at 94° C., followed by 30 cycles of 94° C. for 30 sec, 58° C. for 30 sec, and 1 min at 72° C., and completed with a final extension of 8 min at 72° C.
  • the amplified fragments were cloned into the pDRIVE cloning vector supplied in the Qiagen PCR cloning kit and individual clones sequenced in both directions using vector-specific primers and/or mECT-specific primers.
  • RNA from mouse stem cells F9 was subjected to reverse transcription using the mECT-specific R7 primer (Table 6) and Superscript II reverse transcriptase.
  • Reverse transcribed cDNA was purified using the Qiagen PCR purification kit (Qiagen) and tailed with a poly(dC) tail in a reaction consisting of 10 mM Tris-HCl, 25 mM KCl, 1.5 mM MgCl2, 200 ⁇ M dCTP, and 1 ⁇ l reverse terminal deoxynucleotidyl transferase (rTdT). The tailing reaction was conducted for 10 min at 37° C.
  • the 5′-end tailed fragment of the mECT cDNA was amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 ⁇ M dNTPs, 400 ⁇ M abridged anchor primer (annealing to the poly(dC) tail), 400 ⁇ M antisense primer R5 (nested mECT primer shown in Table 6), and 2.5 U Taq polymerase.
  • This reaction consisted of the following: 2 min denaturation at 94° C., followed by 35 cycles of 94° C. for 30 sec, 55° C. for 30 sec, and 60 sec at 72° C., and completed with a final extension of 5 min at 72° C.
  • the resulting nested fragments were subcloned into the pDRIVE cloning vector and their identity was confirmed by sequencing.
  • RNA from human hepatoma cells HepG2 was subjected to reverse transcription using an oligo(dT) primer, the newly synthesized cDNA tailed with a poly(dC) using rTdT and the 5′-end tailed fragment amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 ⁇ M dNTPs, 400 ⁇ M abridged anchor primer (AAP), 400 ⁇ M RP2AC gene specific reverse primer (Table 7), 8% glycerol (to increase primer binding specificity), 2.5 units Taq polymerase, and 10 ⁇ l tailed cDNA template, with a final volume of 50 ⁇ l.
  • This reaction was subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C. The reaction was terminated after a 10 min final extension at 72° C.
  • Nested PCR was performed using 31 ⁇ l of the above PCR mixture, and amplified using the AAP and either I2RP or RP1AC gene specific reverse primer (Table 5) under the same conditions. hECT 5′-end products were cloned into the pCR2.1cloning vector (TA Cloning Kit, Invitrogen).
  • RNA from mouse cell line F9 was subjected to reverse transcription using the adapter primer (3′-AP) and Superscript II reverse transcriptase as mentioned above.
  • the 3′-end of mECT was amplified using PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl 2 , 200 ⁇ M dNTPs, 400 ⁇ M abridged universal anchor primer (AUAP) annealing to the 3′AP, 400 ⁇ M mECT sense primer F6 (Table 6), 8% glycerol, and 2.5 U Taq polymerase.
  • AUAP universal anchor primer
  • the reaction consisted of the following: 5 min denaturation at 94° C., followed by 35 cycles of 94° C. for 30 sec, 50° C. for 30 sec, and 72° C. for 90 sec, and completed with a final extension of 5 min at 72° C. An aliquot of the above reaction was subjected to nested PCR using the sense mECT primer F8 under the same conditions.
  • 3′-RACE of the hECT gene was performed as above except that hECT specific primers and total RNA from human HepG2 cells were used.
  • Primers used to amplify the 3′-end(s) were the AUAP and the 3′RACEFP3 gene-specific forward primer (Table 7).
  • the reactions were subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C.
  • the reactions were terminated after a 10 min final extension at 72° C.
  • Nested PCR was performed using the 3′-AP and 3′RACEFP4 gene specific forward primer (Table 7) under the same conditions.
  • RNA Isolation and RT-PCR Analysis Murine tissues (adipose, brain, heart, kidney spleen, muscle, lung and liver) from C57/BL mice were collected and snap-frozen in liquid nitrogen. Total RNA was isolated using TriazolTM reagent according to manufacturers′ instructions. RNA was evaluated by electrophoresis on 1% formaldehyde gels and visualizing by staining with ethidium bromide. Total RNA was reverse transcribed using a poly-dT primer and Superscript II reverse transcriptase. 5 ⁇ g total RNA was incubated for 10 min at 70° C. with 1 ⁇ l primer (10 ⁇ M).
  • PCR for 30 sec, and 30 sec at 72° C., and completed with a final extension of 5 min at 72° C.
  • the final components of the PCR were the following: 1 ⁇ PCR buffer, 1.7 mM MgCl 2 , 200 ⁇ M dNTPs, 300 nM primers, and 2.5 U Taq.
  • Mouse G3PDH was employed as a control using the sense primer TCCACCACCCTGTTGCTGTA (SEQ ID NO: 47) and antisense primer ACCACAGTCCATGCCATCAC (SEQ ID NO: 48) under the same conditions.
  • the reactions contained 10 mM MgCl 2 , 2 mM CTP, 20 mM Tris-HCl, 5 mM DTT, 1 mM phosphorylethanolamine and either 0.1 or 0.2 ⁇ Ci of [ 14 C]phosphorylethanolamine in a final volume of either 50 ⁇ l or 100 ⁇ l.
  • the reactions were incubated in a 37° C. water bath for 15 minutes, than transferred to a boiling water bath for 2 min to inactivate the enzyme. Unlabelled phosphorylethanolamine and CDP-ethanolamine (50 ⁇ g each) were added to each reaction as a standard and reactions were centrifuged for 2 min at 13000 ⁇ g to pellet the denatured protein.
  • CDP-ethanolamine was separated from phosphorylethanolamine by migration in methanol:0.5% NaCl:ammonia (50:50:5) on silica G plates (Analtech). The spots containing the CDP-ethanolamine were scraped and the activity of [ 14 C] was measured by liquid scintillation counting. Enzyme activity (nmol/min/mg protein) was derived from cpm data using a known amount of [ 14 C]phosphorylethanolamine as a standard.
  • the promoter region of mECT was amplified from the BAC45A04 clone using the sense primer ATAT GAGCTC GGGTATGCGGCACAGGGAGAATC (SacI site underlined) (SEQ ID NO: 49) and the antisense primer ATAT CTCGAG ACCGGAGGCCCCCCGCAAATCC (XhoI site underlined) (SEQ ID NO: 50) which would amplify the mECT promoter region from ⁇ 559 bp to +29 bp.
  • the PCR conditions were the following: 3 min denaturation at 94° C., followed by 35 cycles of 94° C.
  • the resulting fragment was gel-purified using the Qiagen gel-purification system, digested with SacI/XhoI and subcloned into the pGL3-basic luciferase reporter vector (Promega). Positive clones were confirmed by sequencing and used for further analysis.
  • C3H10-T1/2 murine fibroblasts were plated on 60 mm dishes at a confluency of 40% and incubated in DMEM supplemented with 10% fetal bovine serum and 1 mM sodium pyruvate for 24 hours at 37° C. with 10% CO 2 .
  • MCF-7 human breast cancer cells were incubated in Minimum Essential Medium (MEM, GibcoBRL) supplemented with 10% FBS and 1 mM sodium pyruvate under similar conditions.
  • MEM Minimum Essential Medium
  • the presence of putative regulatory elements and transcription factor binding sites within the 5′-flanking promoter region of the mouse and human ECT genes were determined using the TRANSFACTM transcription factor database (Research Group Bioinformatics/AG Bioinformatik) and other databases for eukaryotic promoters available from the NCBI.
  • the mouse ECT promoter/gene sequence is submitted to the GenBankTM database and has the accession number AY189524.
  • the HXGH is the CTP binding motif in all cytidylyltransferases with the ECT family specifically containing two such motifs.
  • the mECT cDNA clone shown in FIG. 2 was utilized for screening the C57BL/J6 murine genomic library, isolation of the mECT gene, and for the expression analysis of mECT mRNA in various tissues.
  • FIG. 9 shows the structure and organization of the mECT gene and differences in splicing between the mouse and human genes.
  • Part A Schematic representation of the mECT gene deduced from the genomic clone BAC45A04. Solid horizontal lines and solid boxes represent Introns and Exons, respectively. Numbers and sizes of Introns (I-XIII) and Exons (1-14) are also shown. The position and size of Exons within the mECT cDNA are indicated in the lower part of Part A. They are obtained by sequencing of the genomic BAC clone and sequence alignments with mECT cDNA.
  • the translation start site of the mECT (ATG) is at the beginning of Exon 1 and the stop codon (TAG) is in Exon 14 at position 1257.
  • the middle section in Part A displays the cloning strategy, the position of primers and the size of the overlapping clones used for the sequence analysis as summarized in Tables 6, 8 and 9.
  • the mouse Exon 7 that is spliced out of the human ECT gene is also shown.
  • Part B is a schematic representation of hECT deduced from the alignment of human Chromosome 17 contingent NT — 010845 sequence and hECT cDNA GenBank NM — 002861.
  • the translational start site of the hECT is at the beginning of Exon 1 and the stop codon (TAA) is in Exon 14 at position 1250.
  • the human gene is spliced between Exons 13 (35 bp) and Exon 14 (67 bp) and they together form a single Exon 14 (102 bp) in the mouse gene as indicated.
  • the hECT transcript is also missing the mouse Exon 7 between the Exons 6 and 7 as indicated.
  • the rest of the hECT exons are homologous to the mECT exons. Exon/intron boundaries and the sizes of Introns are shown in Table 10.
  • the gene structure shown in FIG. 9 (Part A) and Table 8 and Table 9 reveals that the mECT gene contains 14 coding regions (exons) interrupted by 13 intervening regions (introns).
  • the exons are small and range from 44 bp (Exon 6) to 161 bp (Exon 3). Sequencing of six overlapping regions showed that the introns were smaller than 2 kb allowing for the complete and accurate description of all introns present.
  • Intron sizes range from 103 bp (Intron XIII) to 1829 bp (Intron I), also shown in FIG. 9 (Part A) and Tables 8 and 9.
  • Exon-intron boundary sequences at the 5′- and 3′-ends of the mECT introns are entirely GT and AG, respectively, which agree with known consensus sequences for mRNA splice sites.
  • TABLE 8 Location and individual size of the protein coding sequence (exons) in the genomic clone BAC 45A04 that correspond to the mECT coding sequence Exon No.
  • FIG. 10 show a mapping of the transcription start sites of the mouse and human ECT genes.
  • AAP anchor primer
  • the transcription initiation site for mECT is 33 bp and for hECT 45 bp upstream of the ATG codon.
  • the ATG codon is shown in bold and capitalized.
  • FIG. 11 Determination of transcription termination site(s) of the mECT gene.
  • the mECT 3′-UTR region is 581 bp, starting from the first nucleotide after the stop codon TAG (in bold and capitalized) to the end of the polyadenylation site.
  • Polyadenylation signals (in bold) are 15 bp and 38 bp from the poly(A) tail.
  • D Comparison of transcription termination end products for the mouse and human ECT and the size of two mECT transcripts. The second mECT transcript with a polyadenilation signal 38 bp from poly(A) tail is also shown.
  • FIG. 12 Tissue expression profiles and enzymatic activity of mECT.
  • Part A Total RNA from various tissues was reverse transcribed and 100 ng cDNA amplified using mECT gene-specific primers. G3PDH (lower bands) was amplified from the same tissues and served as a control. Densitometric analyses (at the bottom) show the relative mECT mRNA expression in different tissues, with highest expression in the liver, adipose, lungs and kidneys and lowest expression in the skeletal muscle.
  • Part B The expression of hECT mRNA in various cell lines.
  • mECT Total mRNA from Kelly (neurons), THP-1 (monocytes), HepG2 (liver), DU145 (prostate), U937 (monocytes) and U937+phorbol ester (differentiated macrophages) was reverse transcribed and amplified by hECT specific primers using 200 ng cDNA. Human ⁇ -actin served as an internal control. Relative expression of hECT mRNA is shown at the bottom. hECT was highly expressed in HepG2, Kelly, and undifferentiated U937 cells. Part C. mECT enzymatic activity in various tissues.
  • mice tissue homogenates liver, heart, brain, adipose, muscle, lung, spleen, and kidney
  • 14 C-phosphoethanolamine 14 C-phosphoethanolamine
  • the results shown are means ⁇ S.D. from at least three measurements.
  • CAAAT-CAAT binding protein NF1-nuclear factor 1; Ap1-Ap4 associated proteins 1-4; c/EBP, CAAT enhancer binding protein; HNF hepatic nuclear factor; USF-upstream stimulatory factor; Sp1-stimulatory protein; GC-GC binding proteins;
  • the transcription start site GGAG(+1)C/TCGCCA/GGGA is conserved in the two genes and is shown in italics and underlined.
  • a CAAT box located at the matching distance ( ⁇ 85/ ⁇ 70 bp) from the transcription start site is conserved. The minus sign indicates the consensus sites in the opposite direction.
  • the mECT promoter sequence ⁇ 559/+29 is shown as in the luciferase reporters in FIG. 13.
  • the human promoter sequence further upstream at the 5-end ( ⁇ 348) contains the polyadenylation signal for another gene, SIRT7, and is not considered relevant for the regulation of ECT.
  • FIG. 13 illustrates the transcriptional activity of the mECT promoter.
  • Mouse embryonic fibroblasts C3H10T1/2 (Part A) and human breast cancer cells MCF-7 (Part B) were transiently transfected using DOTAP with 2.5 ⁇ g of reporter vector containing luciferase gene under the control of the mECT promoter and 0.5 ⁇ g of Renilla luciferase plasmid for control of transfection efficiency.
  • the luciferase reporters containing either mCCT promoter or Simian virus-40 (SV-40) promoter were used to evaluate the overall activity and the potency of the mECT promoter.
  • Transfected cells were harvested after 48 h and assayed for luciferase activity. Data shown are relative to the activities observed with the SV40 promoter. The measurements are performed in triplicates and the results are means ⁇ S.D. from three separate experiments.
  • mouse and human genes Comparison of the mouse and human genes and the alternative splicing. From the protein alignments shown in FIG. 14 we noticed that the mouse cDNA, although highly homologous to rat cDNA (97%), is longer than human cDNA by a 17-amino acid peptide (PPHPTPAGDTLSSEVSSQ) (SEQ ID NO: 51) within the central region, the position 180-199 amino acids immediately upstream of the second CTP binding motif HIGH. After deducing the structure of the mouse gene (FIG. 9 Part A) we were able to deduce that the mouse Exon 7 is entirely responsible for this peptide, suggesting a differential splicing mechanism between the mouse and human genes.
  • PPHPTPAGDTLSSEVSSQ 17-amino acid peptide
  • the first six human exons (Exons 1 to 6) maintain homology to the first six mouse exons, but the human Exons 7-12 correspond to mouse Exons 8 to 13 (compare FIG. 9 Parts A and B).
  • the human ECT gene is additionally spliced at its 3′-end, between the Exon 13 (35 bp) and Exon 14 (67 bp) (FIG. 9 PartB and Table 10). Those two human exons correspond to a single mouse Exon 14 (102 bp) and the mouse gene has no an intron present at that location (FIG. 9 Part A).
  • the entire 3′-UTR of the mouse transcript was found to be 605 bp and 581 bp from the first nucleotide after the stop codon to the end of the polyadenylation site.
  • a single polyadenylation site (AAUAA) was established 15 bp and 38 bp from the poly(A) tail so that at least two distinct mouse transcripts of 1852 and 1828 bp are possible.
  • 3′-untranslated region (3′UTR) of hECT was 644 bp from the stop codon TAA to the end of the polyadenylation site, producing a transcript of 1831 bp, only 25 bp less than the published cDNA, which is typical variation for transcripts utilizing single polyadenylation site.
  • Tissue distribution and enzymatic activity of mECT Tissue expression of mECT mRNA was determined using RT-PCR by amplifying the region spanning the last exon and part of the 3′-UTR of mECT, i.e., from 962 to 1285 bp, which does not distinguish the two ECT isoforms.
  • the housekeeping gene for G3PDH was employed as an internal control to correct for the variations in total mRNA used in each reaction.
  • Several tissues, including liver, heart, brain, adipose, skeletal muscle, lung, spleen and kidney were isolated from C57/BL/J6 mice and the mECT mRNA expression and enzyme activity analyzed. As shown in FIG.
  • Total mRNA from cell lines DU145 (prostate), THP-1 (monocytes), HepG2 (liver), U937 (monocytes), U937+TPA (differentiated to macrophages), and Kelly (neurons) were amplified and normalized with human ⁇ -actin as an internal control.
  • Conditions shown in FIG. 12 are in the linear range of mRNA concentration and number of PCR cycles (data not shown). Results show that, contrary to the mouse brain tissues (FIG. 12 Part A and human brain tissues, human neuronal cell line Kelly showed high expression of hECT mRNA (2.1-fold). Liver hepatoma cells HepG2 (1.87-fold) showed enhanced expression as was the case in normal liver (FIG. 12 Part A).
  • the expression pattern in blood cells was dependant on the type of cell transformation (THP-1 vs. U937 or 0.74: 1.8) and the stage of cell differentiation (undifferentiated U937 vs. phorbol ester differentiated U937, or 1.8: 0.85) (FIG. 12 Part B).
  • FIG. 12 Part C Cellular homogenates of several mouse tissues were also examined for the enzymatic activity of ECT (FIG. 12 Part C). The highest activity was observed in adipose tissue, spleen and kidneys (FIG. 12), corresponding to the high levels of expression of mRNAs in those tissues (FIG. 11 Part B). The activity detected in other tissues as the brain and skeletal muscle was significantly lower but coincided with their lower mRNA levels. The ECT enzymatic activity in the liver and lungs was slightly lower than anticipated from the mRNA abundance. Overall, the mECT mRNA expression in the ten tissues examined varied from 0.37 (skeletal muscle) to 1.5 (liver) or approximately 4-fold (FIG. 12 Part A).
  • the mECT promoter has a unique DNA sequence of low similarity to the human promoter and to existing eukaryotic promoters.
  • the regions around the transcription start sites do not contain the canonical TATA box commonly found in other promoters, but both mouse and human promoters contain a conserved CAAT box positioned at the matching distance ( ⁇ 85/ ⁇ 70 bp) from the transcription start sites.
  • the transcription start sites, GGAG(+1)C/TCGCCA/GGGA are highly conserved and although the rest of the sequence show low homology, a high conservation in the core consensuses for the transcription factors CAAT, Sp1 and NF1 were also detected. Based on the promoter structure and the widespread expression (FIG.
  • mECT and hECT could readily be considered housekeeping genes.
  • mECT is highly expressed in several tissues including adipocites, lungs, kidneys, and liver and is low in skeletal muscle and brain (FIG. 12).
  • hECT is downregulated during monocyte/macrophage differentiation by phorbol esters and by tumourogenesis (FIG. 12), all suggesting that ECT promoters could be tissue specific and subject to regulation under particular physiological conditions.
  • Transcription factors that could be involved in such regulation include Ap1/CREB and Ap2, hepatic and adipocite nuclear factor cEBP ⁇ , muscle differentiation factor MyoD, and the group of factors involved in growth and development such as CAAT-binding factors NFY and USF1/2, GC-binding Sp factors and NF1.
  • promoter activity of the mouse ECT gene was determined using luciferase reporter assays as shown in FIG. 13.
  • the luciferase reporter activity was measured in mouse fibroblasts C3H19T1/2 and human MCF-7 breast cancer cells.
  • the activity of the mECT promoter is similar to that of the Simian virus SV-40 promoter (pGL3-control) in MCF-7 cells and 13-fold higher in C3H10T1/2 cells, indicating that an active promoter has been isolated.
  • mECT promoter was also compared to the mCCT ⁇ promoter initially extensively characterized by the inventors, and by others.
  • the mECT and mCCT ⁇ promoters were 14-fold more active in the mouse C3H19T1/2 cells than in the human MCF-7 cells.
  • Relative luciferase activities for the mECT promoter increased from 0.9 ⁇ 0.1 in the human MCF-7 cells to 13.3 ⁇ 4 in the mouse C3H10T/1/2 cells and for the mCCT ⁇ promoter from 2.2 ⁇ 0.9 to 29 ⁇ 3.4 (FIG. 13).
  • the mECT promoter is a strong promoter that could drive a high expression of ECT in most tissues examined in FIG. 12 Part A and although not as strong as the mCCT ⁇ promoter could drive the expression of heterologous genes more that the viral promoter SV-40 (FIG. 13) and can replace the viral promoters in most of their applications.
  • This Example describes the first characterization of the genomic structure and function of mammalian genes for ECT.
  • the mECT gene contains 14 exons distributed among approximately 8.2 Kb and shows high similarity in both size and organization to the human gene. Both genes display a distinct pattern of exon/intron organization typically seen in genes that have undergone duplication events, as initially hypothesized from the structure of the hECT cDNA.
  • the first half of the mouse gene (six exons) is similar to the exons 8-14 distributed in the second half of the gene.
  • the two halves encode two separate catalytic domains, each having the cytydilyltransferase catalytic site HXGH, located at the beginning of Exon 2 (5 th to 8 th position) and at the start of Exon 9 (1 st to 4 th position).
  • the two catalytic domains are separated by an internal exon encoding a 17-aa peptide, the function of which is unknown but could be involved in protein folding and catalysis.
  • the human ECT gene is also organized into two halves except that the internal exon is specifically spliced producing a shorter transcript. Paradoxically, we noticed that the human gene still contains the same number of exons as the mouse gene even though the shorter transcript was produced. By aligning the human gene with the cDNA sequence we were able to demonstrate that the human gene is additionally spliced at its 3′-end producing the same number of exons as in the mouse gene. This additional splicing event occurs between the exons 13 and 14 and is not present in the mouse gene, suggesting that the human 3′-end region has probably evolved since the divergence of humans and mice.
  • the additional splicing does not affect the size of the human C-terminus but the amino acids differ significantly from the amino acids at the mouse ECT C-terminus.
  • the importance of those differences at the C-terminus is not obvious at present but could add to the structural divergence between the human and mouse ECT proteins already produced by alternative splicing of the internal exon. Whether the C-terminus in combination with the presence/absence of the central peptide has any functional significance, is not apparent at the present.
  • mice ESTs are predominantly of the ECTa type but some ECTb forms are also found (BQ890906, BU557590, BG862264, BF533931, BF234094).
  • human ESTs are predominantly of the ECTb type but unspliced ECTa transcripts are also present (BQ652247, BG760479, B1761073, BM927716).
  • Other species like chicken ( Gallus gallus ) produce the spliced ECT variant almost exclusively, while Lewin Cattle ( Bos taurus ) has both unspliced and spliced transcripts of similar frequency.
  • Lewin Cattle Bos taurus
  • the unspliced transcripts were detected in gonads, while other tissues predominantly contained the spliced isoform.
  • the human ECT gene is located at Chromosome 17q25.3, close to the marker RH44900 which has been assigned a position within the hECT 3′-UTR. Further downstream from the hECT gene is a mRNA of yet unidentified function, named LOC256933. Upstream from the hECT gene is SYRT7 or sirtuin silent mating type information regulation 2 homologue 7 ( S. cerevisiae ). SYRT7 is the last gene positioned at the longer arm of the chromosome 17, the closest to the chromosome end. This gene belongs to the sirtuin family of proteins and is homologous to the yeast Sir2 protein. The functions of SYRT7 have not yet been determined but studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity.
  • the mouse ECT gene is located at Chromosome 11, but because the mouse genome project has been completed only recently the precise location of the mECT gene remains uncertain.
  • the other already placed genes >240 and at least as many yet unplaced genes are from the human Chromosome 17, which suggests that the mouse Chromosome 11 has a broad region of conserved synteny with the human Chromosome 17.
  • the invention characterizes a BAC clone upstream from the mECT gene and found that it contains the mouse homologue of SYRT7 (data not shown) suggesting that the region surrounding the ECT gene is also preserved between the mouse and humans and likely similarly positioned at the very end of the long arm of Chromosome 11.
  • the ECT promoter structure suggests that ECT transcription is likely coordinated through a network of transcription factors of the Sp1/Kriippel-like family, CAAT/cEBP, NF1 and CAAT/NFY/UCF families and that the complexity of controls probably ensures adequate levels of ECT transcripts in response to metabolic requirements for PE, or other tissue- or cell-specific signals. Those factors have divergent binding and transactivation properties and their exact roles in phospholipid homeostasis are largely unknown.
  • the invention relates to knockout of the ECT gene.
  • ECT-specific polyclonal antibodies were produced by using an ECT unique peptide.
  • the ECT peptide was synthesized by means of the simultaneous multiple peptide synthesis using standard strategies. Coupling was performed using 3-6 equivalents Fmoc-aminoacid/HOBt/TBTU and 6-12 equivalents of N-methylmorpholine on the TentagelTM HL RAM resin (RAPP Polymere GmBH, Germany) loading as 0.38 mmol/g resin.
  • the amino acid protecting groups used are: Cys (Trt), Arg (Pbf), Ser(But), Thr (But), Tyr (But), Asp (Obut), Glu (Obut), Asn (Trt), Gln (Trt), Lys (Boc), His (Trt), Trp (Boc).
  • Peptides were deprotected and cleaved from the resin by trifluoroacetic acid (TFA)/thioanisole/thiocresol (95:2,5:2,5) in 3 h by adding 3% triisopropylsilane to the column, mixing for 10 min and adding 5% Me 3 SiCl for 1 hour.
  • the structure of the ECT peptide is CTKAHHSSQEMSSEYRE-amide (SEQ ID NO: 53).
  • the peptide is the same in human, mouse and rat ECT proteins.
  • An HPLC chromatogram for the ECT synthetic peptide is shown in FIG. 16.
  • the peptide mass was characterized by MALDI-TOF mass-spectrophotometry by means of a MALDI 2 DE Instrument, Shimadzu, Japan in linear mode. Calculated average Mw mass was the same as found Mw mass of 2010.
  • a typical peptide peak was shown in FIG. 16. It is obtained at the analytical column Phenomenex, 5 ⁇ m C18 300 ⁇ , with 5-80% gradient of solvent B in 30 min.
  • FIG. 16 illustrates an HPLC chromatogram of ET peptide used for the production of ET antibody.
  • Rabbit Immunization Protocol The immunization has been carried out according to standard protocols. Two rabbits, labelled #4648 and #4649 were immunized by the ECT-specific peptide conjugated to Limulus polyphemus hemocyanine.
  • Rabbit #4649g was immunized three times and bleed before (1.5 ml+0.02% thimertosal) and after the third immunization (total of 25 ml antiserum preserved by 0.02% thimerosal).
  • the rabbit was immunized once more and specific IgG (0.235 g/7 ml) isolated from 25 ml antiserum and stored in Tris-Glycine buffer pH 7.5, 250 mM NaCl, containing 0.02% thimerosal Rabbit #4648g was immunized six times and bleed before (1.5 ml+0.02% thimertosal) and after the third and sixth immnunization (total of 25 ml antiserum was isolated and preserved by 0.02% thimerosal). The rabbit was immunized once more (7 times in total) and specific IgG isolated from 25 ml antiserum and stored in Tris-Glycine buffer pH 7.5, 250 mM NaCl, containing 0.02% thimerosal.
  • the enzymatic reaction was stopped after 15 min by adding 100 ⁇ l/well of 0.5 M sulphuric acid and the absorption of a yellow solution measured in a 12-channel spectrophotometer at 450 nm (with reference wavelength 630 nm).
  • #4648g were 1:1000 and for #4649 1; 50000 (FIG. 17) and for #4648g were 1:1000 (FIG. 18).
  • the respective pre-immune serum titers were 1:100 for #4648 and 1:300 for #4649.
  • FIG. 17 illustrates titration curves of the immune antiserum isolated from rabbit #4649g relative to its preimmune serum (4649 pre).
  • FIG. 18 shows titration curves for the immune serum isolated from the immunized rabbit #4648g relative to its preimmune serum (4648 pre).
  • the columns were than connected to a photometer (Pharmacia LKB Uvicord SII; OD 280nm ) and a coupled printer (Pharnacia LKB Rec 102) and washed with TBS (50 mM Tris, 150 mM NaCl), pH 7,5, until the baseline of the elution-profile is reached.
  • TBS 50 mM Tris, 150 mM NaCl
  • the specific bounded IgG fraction is eluted with 0,2 M Glycin/HCl, pH 2,2, 250 mM NaCl.
  • the elution tubes containing a small amount of 1M Tris/HCl, pH 7,5 were used. If necessary the pH is adjusted to a pH of 7,2-7,4 with 1 M Tris/HCl, pH 7,5.
  • the antibody concentrations were calculated from OD275/280 ratio taking into account that 1 mg IgG/ml corresponds to 1,42 OD 275 or 1 mg IgG/ml corresponds to 1,35 OD 280

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a gene encoding a protein having ethanolaminephosphate cytidylyltransferase activity, and a promoter of an ethanolaminephosphate cytidylyltransferase gene. Nucleotide sequences according to SEQ ID NO: 1 and SEQ ID NO: 2 relate to the gene and the promoter, respectively. An antibody against mECT peptide (SEQ ID NO: 53) is also provided.

Description

  • This application is entitled to the benefit of and claims priority from U.S. patent application Ser. No. 10/101,957 entitled Ethanolaminephosphate Cytidylyltransferase Gene and Promoter, filed Mar. 21, 2002, the entirety of which is herein incorporated by reference.[0001]
    • FIELD OF THE INVENTION
  • The present invention relates generally to the fields of genes and promoters. More particularly, the present invention relates to an isolated gene and promoter of the enzyme ethanolaminephosphate cytidylyltransferase. [0002]
    • BACKGROUND OF THE INVENTION
  • Phosphatidylethanolamine (PE) is an abundant lipid in both eukaryotic and prokaryotic cells. PE is situated primarily on the inner leaflet of the cell membrane where it interacts with inner-membrane proteins (1) or acts as a molecular chaperone and assists in proper protein folding (2). PE also plays an important role in physiological processes such as blood coagulation, platelet activation, cell signalling, membrane fusion, cell cycle progression, cell division, and apoptosis (3-9). Transfer of PE from lipoproteins to platelets induces their activation (3) and PE induces high-affinity binding sites for factor VIII and stimulates its pro-coagulant activity (4). PE is also involved in the thrombotic activity found in some cases of lupus where it further inhibits activated protein C (5). PE is a direct precursor of other lipids and provides ethanolamine moiety for anandanide (a physiological ligand for the cannabioid receptors) and glycosylphospatidylinositol (GPI) membrane anchors for a diverse group of proteins known as proteoglycans. [0003]
  • The redistribution of PE in membranes plays a pivotal role during cytokinesis (7). Prior to late telophase, PE becomes exposed on the cell surface at the cleavage furrow, where it regulates the movement of the actin contractile ring and plasma membrane (7). Interestingly, the surface trapping of PE causes cell arrest (10), and the appearance of PE (together with PS) on the cell surface is an early hallmark of apoptosis (8). Products of PE metabolism, fatty acids, diacylglycerols and phosphatidic acid serve a critical role as second messengers in various signalling pathways and PE is an immediate donor of phosphoethanolamine residue linking glycosylphosphatydylinositol (GPI) anchor to proteins (11-14). There exist specialized forms of PE such as plasmalogens and derivatives such as natural cannabinoid anandamide and glycosylated PE (15-17). Plasmalogens play a role in the prevention of oxidation of lipoproteins (16) and constitute a significant portion of total PE in many tissues (18,19). However, despite their relative abundance, the principal biological function of plasmalogens is not firmly established and the understanding of the regulation of their production is surprisingly limited. Their production is severely impaired in the peroxisomal disorders such as Zellweger syndrome, Refsum disease (11) and neurological disorders (21-23). Glycosylated PE is abundant in lipoproteins of diabetics and has been implicated in the promotion of atherosclerosis in those individuals (24). [0004]
  • There are several pathways for the biosynthesis of PE, certain of which form PE from the alteration of other lipids. These include the decarboxylation of phosphatidylserine (PS) by a PS decarboxylase (PSD) and the base-exchange reaction with PS by a PS synthase (PSS) or phosphatydylcholine (PC). The third pathway, the CDP-ethanolarnine pathway or Kenedy pathway, synthesizes PE de novo from ethanolamine and diacylglycerols (DAGs). The CDP-ethanolamine pathway includes three enzymatic steps consisting of the phosphorylation of ethanolamine (Etn), the formation of CDP-ethanolamine and pyrophosphate from phosphoethanolamine (P-Etn), and the final formation of PE from the transfer of phosphoethanolamine from CDP-ethanolamine (CDP-Etn) to diacylglycerol (DAG). These three steps are catalyzed by the enzymes ethanolamine kinase (EK), CTP:phosphoethanolamine cytidylyltransferase (ET), and ethanolaminephosphotransferase (EPT), respectively as shown in FIG. 1. [0005]
  • Little is known about genomic regulation of the biosynthesis of phospholipids. Several control points for the regulation of PE biosynthesis have been suggested. The reaction catalyzed by CTP: ethanolaminephosphate cytidilyltransferase (ET) has been suggested as a major regulatory step in the PE biosynthetic pathway. Considerable effort has been focused on the regulation of genes that encode enzymes in the fatty acid and cholesterol synthesis pathways. Promoters of these genes contain sterol-regulatory elements and are regulated by cholesterol-responsive transcription factors, sterol regulatory element binding proteins (SREBPs). However, lipogenic enzymes are mainly regulated by dietary carbohydrates, and their promoters contain insulin-response elements. The role for SREBPs in the regulation of fatty acid genes has been ascribed as means for cholesterol regulation of membrane phospholipids, typified in phosphatydyl choline production but direct regulation with cholesterol has also been suggested. [0006]
  • Studies on the regulation of genes that encode phospholipid biosynthetic enzymes have lagged behind that of other classes of lipogenic genes, primarily because most phospholipid-biosynthetic enzymes are difficult to isolate owing to their association with membranes. No evidence for direct transcriptional control of phospholipid genes with cholesterol, fatty acids or carbohydrates has yet been produced, but it is possible that these factors may have influence. Future experimentation with a combination of different transgenic models may determine specific genetic links for carbohydrate, cholesterol and phospholipid metabolism. Furthermore, additional links with regulators of lipid metabolism, including the peroxisome proliferator activated receptors (PPARs) and lipoproteins may be found. PPARs are activated by a diverse group of pharmacological ligands, the peroxisome proliferators (e.g., fibrates, troglitazone), which are well known drugs for regulating lipoprotein levels and very important for prevention of atherosclerosis. [0007]
  • Ethanolamine kinase (EK) exists in several isoforms (20,25,26) having both EK and choline kinase (CK) activities. The isolation of two rat cDNA clones for CK/EK has allowed for the characterization of two separate rat genes (27, 28) and two mouse gene products (29). Unlike CK/EK, EPT is responsible for production of PE by transferring phosphoethanolamine from CDP-ethanolamine to DAG (30) and a separate enzyme, cholinephophotransferase (CPT), is responsible for this reaction in the CDP-choline pathway. EPT and CPT are encoded by two separate genes (31,32). The EPT gene was cloned by complementation of an EPT yeast mutant with a yeast genomic library (33). Subsequently, the human cDNA for EPT has been isolated (34). Interestingly, the human ethanolamine lipids (34). [0008]
  • CTP: phosphoethanolamine cytidylyltransferase (ET) is one of the most substrate-specific and the most regulatory enzyme in the CDP-ethanolamine pathway (35). Only rat ET protein has been successfully purified and its biochemical properties clearly established (36-38). The rat protein is considered soluble but could localize between the cisternae of the rough ER and the cytosolic space suggesting some associations with membranes (37). Unlike CK/EK and EPT, rat ET only has activity towards ethanolaminephosphate and does not show any affinity for cholinephosphate (38). These findings strongly agree with genetic evidence indicating that ET and CTP: phosphocholine cytidylyltransferase (CT) cDNAs are produced by two different genes (39, 40). ET cDNAs from yeast, human, and rat have been functionally characterized and showed a high degree of homology between sequences (39-41). Neither the mouse ET cDNA nor any ET gene has yet been characterized. [0009]
  • An EST (GenBank™ Accession No. BC003473) encoding 1855 bp of mRNA for the full-length mouse ET was identified, and is highly homologous to rat and human cDNAs, particularly in the proximity of the translation start codon ATG as shown in FIG. 2. Computer analysis suggests that ET protein possesses a recognition motif MIRNG and two catalytic domains with large internal repetitive sequences in its N-and C-terminal halves; both parts of the sequence contain the CTP-binding motif HXGH (41), which is conserved in the entire cytidylyltransferase superfamily (42). CT does not contain the MIRNG motif, does not have two similar halves, and possesses only single HXGH motif (39, 40). [0010]
  • Even though ET is a critical enzyme required for the de novo synthesis of PE, no gene has been characterized and little is known about the regulation of this enzyme's expression. Recent evidence (43) indicates that rat ET mRNA and protein level increase during liver development; a higher change in mRNA than protein was visible, suggesting that combined transcriptional and translational events are may be involved in the regulation of ET activity. It would be advantageous to fully elucidate the regulation of the ET gene product. [0011]
  • Little effort has been given towards the study of ET regulation at the genetic level. This is due to the fact that it was often assumed that ET is similar to CTP: phosphocholine cytidylyltransferase (CT), the major regulatory enzyme in the CDP-choline pathway for the biosynthesis of phosphatidylcholine (PC) (44-48). It was not until recently that it was speculated that ET was regulated in a different manner than CT (49) and that PE's importance may not lie in the fact that it only resides in cell membranes but rather that it can be found in other forms that could play vital roles in proper cell functioning. Further examples of this are PE plasmalogens, which comprise a large portion of total cellular PE (50) and may play an important role in proper functioning of the brain and heart (51). It would be of great interest to fully understand the regulation of ET at the level of transcription. This information could be compared to the regulatory pathways of CT and other genes involved in lipid and cholesterol metabolism to establish the regulatory mechanisms for membrane biogenesis and lipid maintenance during normal development and in lipid-related pathological states. [0012]
    • SUMMARY OF THE INVENTION
  • It is an object of the present invention to provide a nucleotide sequence of a murine ET gene. It is yet another object of the present invention to provide a promoter sequence of the human ET gene. Transcription initiation and termination sites are identified. [0013]
  • The invention provides a gene encoding a protein having ethanolaminephosphate cytidylyltransferase activity consisting of a sequence selected from the group consisting of: (a) SEQ ID NO: 1; (b) a degenerate sequence of SEQ ID NO: 1 and (c) a sequence which hybridizes to the complement of SEQ ID NO: 1 under stringent conditions. The gene may optionally be derived from human or mouse. [0014]
  • Further, the invention provides a promoter of an ethanolaminephosphate cytidylyltransferase gene, said promoter consisting of a sequence selected from the group consisting of: (a) SEQ ID NO: 2; (b) a sequence according to SEQ ID NO: 2 having substitutions or deletions and maintaining promoter activity; and (c) a sequence which hybridizes to the complement of SEQ ID NO: 2 under stringent conditions. The substitutions or deletions may render the promoter at least 90% identical to SEQ ID NO: 2, for example. [0015]
  • The gene and promoter according to the invention can be used to produce a transgenic mammal, for example a knock-out mouse. The gene and promoter are useful in identifying, preventing, and treating diseases related to inappropriate phoshatidylethanolamine production. [0016]
  • The invention further provides a CTP:Ethanolaminephosphate Cytidylyltransferase (ECT) peptide having the sequence CTKAHHSSQEMSSEYRE according to SEQ ID NO: 53, and a CTP:Ethanolaminephosphate Cytidylyltransferase (ECT) specific antibody against this peptide. [0017]
  • Other aspects and features of the present invention will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.[0018]
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • Embodiments of the present invention will now be described, by way of example only, with reference to the attached figures. [0019]
  • FIG. 1 shows a schematic representation of the three known biosynthetic pathways for phosphatidylethanolamine (PE) in mammalian cells. [0020]
  • FIG. 2 is a consensus alignment (SEQ ID NO: 3) of amino acid sequences of rat ET (rET) (SEQ ID NO: 4), human ET (hET) (SEQ ID NO: 5), and the mouse ET (mET) (SEQ ID NO: 6) proteins. The alignment illustrates the ET consensus motifs MIRNG and HYGH, conserved in the entire cytidylyltransferase superfamily. [0021]
  • FIG. 3 is the structure and organization of the murine ET gene, as provided in SEQ ID NO: 1. [0022]
  • FIG. 4 illustrates the determination of transcription initiation site of human ET gene. The 5′RACE strategy showing the location of human ET-specific primer binding sites is provided. [0023]
  • FIG. 5 shows results of the PCR reaction for the 5′RACE of human ET cDNA using the abridged anchor primer, AAP, and the gene specific reverse primer RP2AC. [0024]
  • FIG. 6 shows identification of positive clones for the 5′-end of human ET. [0025]
  • FIG. 7 shows alignment (SEQ ID NO: 7) of the positive clones for the 5′-end of human ET to the published human ET cDNA sequence. The sequence of the gene specific primer sequence, I2RP is underlined. The translational start codon of hET is in bold and underlined. HET-C5.3, hET-C2.3 and HETC1.1 are represented as SEQ ID NO: 8-SEQ ID NO: 10, respectively. [0026]
  • FIG. 8 shows the 5′-flanking (regulatory, promoter) region of the human ET (corresponding to SEQ ID NO: 2) with consensus cis-elements for the regulatory transcription factors. [0027]
  • FIG. 9 shows the structure and organization of the mECT gene and differences in splicing between the mouse and human genes. Part A is a schematic representation of the mECT gene deduced from the genomic clone BAC45A04, and Part B is Schematic representation of hECT deduced from the alignment of human Chromosome 17 contingent NT[0028] —010845 sequence and hECT cDNA GenBank NM—002861.
  • FIG. 10 illustrates mapping the transcription start sites of the mouse and human ECT genes. Part A represents the strategy of 5′-RACE: Mouse or human total RNA reverse transcription. Part B represents 5′-end PCR products. Part C shows the mECT and [0029] hECT 5′-untranslated regions and the positions of transcription start sites, corresponding to SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
  • FIG. 11 illustrates a strategy for determination of transcription termination site(s) of the mECT gene. Part A shows a strategy of 3′-RACE: Mouse RNA reverse transcription. Part B illustrates a nested PCR product of the 3′-amplification of mECT cDNA. Part C shows a sequence of the 3′-untranslated region (3′-UTR) of the mECT transcript (SEQ ID NO: 13). Part D depicts Comparison of transcription termination end products for the mouse and human ECT. [0030]
  • FIG. 12 shows tissue expression profiles and enzymatic activity of mECT. Part A shows total RNA from various tissues. Part B depicts the expression of hECT mRNA in various cell lines. Part C illustrates mECT enzymatic activity in various tissues. [0031]
  • FIG. 13 illustrates transcriptional activity of the mECT promoter. Part A shows mouse embryonic fibroblasts C3H10T1/2, and Part B shows human breast cancer cells MCF-7. [0032]
  • FIG. 14 illustrates a multiple alignment of the amino acid sequence of rat, mouse, and human proteins (SEQ ID NO: 14-SEQ ID NO: 16, respectively), showing that protein structure is conserved among mouse, rat and human ECTs. [0033]
  • FIG. 15 compares 5′-regulatory promoter regions of the mouse (Part A) (SEQ ID NO: 17) and human (Part B) ECT (SEQ ID NO: 18) genes. The two promoters show low sequence homology but high conservation of binding sites for transcription factors CAAT, Sp1 and [0034] NF 1. Nucleotide +1 denotes the transcription start sites and is marked by an arrow.
  • FIG. 16 illustrates an HPLC chromatogram of ET peptide used for the production of ET antibody. [0035]
  • FIG. 17 illustrates titration curves of the immune antiserum isolated from rabbit #4649g relative to its preimmune serum (4649 pre). [0036]
  • FIG. 18 shows titration curves for the immune serum isolated from the immunized [0037] rabbit #4648g relative to its preimmune serum (4648 pre).
    • DETAILED DESCRIPTION OF THE PREFERED EMBODIMENTS
  • This is the first characterization of the mouse and human CTP: phosphoethanolamine cytidylyltransferase genes. The isolated gene and promoter sequences are novel and do not match any other sequences in the mouse and human database. The mouse gene sequence is unique and distinct from the human gene sequence. The isolated gene and promoter have a number of applications within the biotechnology and pharmaceutical industries. The invention establishes the isolation and functional characterization of the mouse (mECT) gene and its regulatory promoter. The structures of both mouse and human ECT genes are established and transcription initiation and termination sites are identified. The invention compares the regulation of the two genes and show that they produce two different transcripts as a result of differential splicing of [0038] exon 7 within the central region. Mouse ECT is broadly expressed in mouse tissues but the high level of expression found in the kidney, liver, and lungs relative to other tissues is conserved between mice and humans. The invention also relates to the cloning of a functional mECT promoter and compare its activity relative to the CTP:cholinephosphate cytidylyltransferase α (CCT α) promoter.
  • FIG. 1 illustrates the biosynthetic pathways for phosphatidylethanolamine in eukaryotic cells. PE is synthesized (i) de novo in the endoplasmic reticulum from ethanolamine (Etn) and DAG/alkylacylglycerols; in the Golgi/vacuole and mitochondria from the decarboxylation of PS (ii), and (iii) in the ER via a Ca2+-dependent base-exchange mechanism in which Etn replaces the head group of a pre-existing phospholipid, PC or PS. De novo synthesis via CDP-ethanolamine (CDP-Etn) pathway is an important route for PE biosynthesis in mammalian tissues and is essential for the production of PE plasmalogens. PE, phosphatidylethanolamine; PS, phosphatidylserine; PC, phosphatidylcholine; Etn, ethanolamine; DAG, diacylglycerol; EK, ethanolamine kinase; ECT, CTP:phosphoethanolamine cytidylyltransferase; EPT, CDP-ethanolamine:1,2-diacylglycerol ethanolaminephosphotransferase; PSD, phosphatidylserine decarboxylase; PSS, base-exchange/phosphatidylserine synthase. [0039]
  • The invention is based on the screening of the mouse RP23 BAC (Bacterial Artificial Chromosome) library by using the 3′-end “overgo” cDNA sequence of the mouse ET. Thirteen positive mouse ET clones were identified. The BAC clones were reamplified with different primers, and after subcloning into a PCR vector and sequencing all positive clones were identified, the mouse ET gene was reconstructed. The BAC clones encoding the full-length mouse ET gene were isolated. The murine ET gene and the 5′ flanking (regulatory, promoter) region of the human ET gene were determined and are disclosed herein. The characterization of the overall structure for the murine and human ET genes as well as the localization of cis-DNA elements for transcription factors in the 5′flanking promoter region of the human gene are disclosed. [0040]
  • A gene according to the invention encoding a protein having ethanolaminephosphate cytidylyltransferase activity. The gene consists of a sequence selected from the group consisting of: (a) SEQ ID NO: 1; (b) a degenerate sequence of SEQ ID NO: 1 and (c) a sequence which hybridizes to the complement of SEQ ID NO: 1 under stringent conditions. A portion of such a gene capable of encoding a protein having ethanolaminephosphate citidylyltransferase activity also falls within the scope of the invention. In the examples put forth herein, SEQ ID NO: 1 was isolated from mouse. [0041]
  • A promoter of an ethanolaminephosphate cytidylyltransferase gene according to the invention has a sequence selected from the group consisting of: (a) SEQ ID NO: 2; (b) a degenerate sequence of SEQ ID NO: 2 possessing promoter activity; and (c) a sequence which hybridizes to the complement of SEQ ID NO: 2 under stringent conditions. [0042]
  • By a “degenerate sequence”, it is meant a sequence in which a different codon is used to specify the insertion of the same amino acid in a peptide chain. Degenerate sequence codons can easily be determined by those of skill in the art. Further, sequences specifying codons which indicate a conservative substitution of an amino acid into a sequence, which conservative substitution does not effect the resulting protein function also fall within the scope of the invention. The effect of such conservative substitutions can be determined according to functional tests. [0043]
  • By “stringent conditions”, it is meant hybridization conditions of temperature and concentration which ideally result in duplex DNA molecules formed only between strands in which the vast majority of nucleotide bases are paired. [0044]
  • An advantage of knowing the sequence of the isolated mouse ET gene according to the invention is that the genetic control of PE formation can be determined for effects on PE availability for membranes during cell growth, determination of the role of PE in performance of specialized functions such as blood clotting and in response to disease states such as cancer. PE formation requires the action of the ET gene product. The possession of the genomic sequence and the knowledge of the primary structure of this gene allows manipulation of the structure and function of this gene. By manipulation of the gene, it is possible to make transgenic animals by either mutating the gene, increasing gene expression, or deleting all or a portion on the gene to produce a knock-out mouse strain. Further, a transgenic animal so formed could be cross-bred with other transgenic animals which also provide models of disease. [0045]
  • By making transgenic animals or “knocking-out” this gene, it will be possible to define the molecular interactions regulating the production of this enzyme at the genetic level and its relationships with other lipid genes. This has applications for diagnosis, prevention and therapy of diseases related to inappropriate PE production, such as Zellweger's syndrome, or lipid-related diseases such as cardiovascular disease and obesity. [0046]
  • Transgenic animals containing the ET promoter fused to a reporter gene (e.g., green-fluorescent protein, luciferase) can be produced according to the invention. Such transgenic animals may include regulatory sequences or other mechanisms to allow for basal and tissue-specific transcription of this gene. This will allow analysis of the signalling pathways required for gene expression during normal cell growth and malignant transformations. [0047]
  • As used herein, the following abbreviations are defined as follows. BAC, bacterial artificial chromosome; CDP-etn: CDP-ethanolamine; DAG: diacylglycerol; DEPC, diethyl pyrocarbonate; EK: ethanolamine kinase; EPT: ethanolaminephosphotransferase; Etn: ethanolamine; PCR, polymerase chain reaction; PtdCho, phosphatidylcholine; PtdEtn, phosphatidylethanolamine; PtdSer, phosphatidylserine; ET, CTP:ethanolaminephosphate cytidylyltransferase; RT-PCR, reverse transcriptase-mediated PCR; RACE, rapid amplification of cDNA ends; PC, phosphatydylcholine; P-etn: phosphoethanolamine; CT, CTP:cholinephosphate cytidylyltransferase; PE, phosphatydylethanolamine; PS, phosphatydylserine; PSD: PS decarboxylase; PSS: PS synthase; DAG, diacylglycerol; PEtn, phosphoethanolamine; Etn, ethanolamine; CDP-Etn, cytidinediphosphate ethanolamine; EK, ethanolamine kinase; EPT, CDP-ethanolamine:1,2-diacylglycerol ethanolamine phosphotransferase; PSS, phosphatylylserine synthase; APC, activated protein C; ER, endoplasmic reticulum; 5′-UTR, 5′-untranslated region; and PCR, polymerase chain reaction. [0048]
    • EXAMPLES
  • The following material and methods were applied in illustrating the examples described below. [0049]
  • Materials. Restriction endonucleases, Taq DNA polymerase, dNTPs, PCR reagents, the Concert™ plasmid miniprep kit, Triazol™, 18-oligo-dT primers, Superscript™ II reverse transcriptase, and other molecular biology reagents were obtained from Life Technologies Inc. (Burlington, ON, Canada). Wizard™ miniprep kit or Wizard™ maxiprep kit were from Promega (Madison, Wis.) and the 5′RACE kit (version 2.0) from Gibco BRL. The cloning of PCR products was performed either by the TA cloning kit (Invitrogen, Mississauga, ON, Canada) or QIAGEN PCR cloning kit and the QIAPrep™ Spin Miniprep Kit was used for purification (Qiagen). All other reagents were obtained from Sigma (Oakville, ON, Canada) or Fisher Scientific (Nepean, ON, Canada). [0050]
  • Mouse Library Screening. The mouse RPCI23 genomic library from C57BL/J6 female (Roswell Park Cancer Institute, Buffalo) was screened. An individual probe screening of seven filter sets was performed with an overgo-generated probe specifically designed from a mouse EST (GenBank™: BC003473) and compared to human ET gene and marker (stSG12878) sequence of Chromosome 17 (GenBank: AC069004, BAC clone: RP11-498C9). An overgo that corresponded to the 3′-untranslated region of BC003473 at position 1342-1381 bp (5′-TGTCAGCTCACACAATTCCAAAGGAAACTGGCCTTGCTG-3′) (SEQ ID NO: 19) was used to design two complementary primers, BC003473-OVa: TGTCAGCTCACACAATTCCAAAGG (SEQ ID NO: 20) and BC003473-Ovb: TCAGCAAGGCCAGTTTCCTTTGGA (SEQ ID NO: 21), that act as primers for each other in a labelling reaction. After the second screen, 5 out of 12 BAC clones (Cloning vector pBACe3.6) were obtained corresponding to the sequence of the murine ET gene. The BAC45A04 clone from the RPCI23 genomic library was used for further analysis. [0051]
  • BAC and plasmid DNA preparation and analysis. BAC DNA was isolated using either a Qiagen midi-prep kit (tip 100) or by standard methodology according to Sambrook and Russell (Molecular Cloning, a laboratory manual, 3rd Ed.). Plasmid DNA was isolated with a Wizard™ miniprep kit, Wizard™ maxiprep kit and/or by the Concert™ miniprep kit. Screening and characterization of the genomic BAC (bacterial artificial chromosome) clones for the murine ET gene were performed by PCR and sequencing. PCR reactions were performed under the following conditions: the initial denaturation for 3 min at 94° C., plus 30 cycles of denaturation at 94° C. for 30 sec, annealing at 58° C. for 30 sec, and extension at 72° C. for 1 min, including a final extension at 72° C. for 8 min. The PCR products were cloned into a PCR vector from the Qiagen PCR cloning kit and subsequently sequenced in both directions by using the vector specific primers and/or the ET specific primers. [0052]
  • Primer Design and Sequencing. All primers for the mouse and human ET, except the abridged anchor primer AAP were synthesized by the Laboratory Services Division at the University of Guelph Molecular Supercenter. AAP was supplied in the 5′RACE kit. DNA sequencing was performed at the University of Guelph Molecular Supercenter. [0053]
  • RNA isolation and RT-PCR analysis. Murine tissues (adipose, brain, kidney, liver, lung, spleen and testis) from p57/BL mice were snap-frozen in nitrogen and total RNA was isolated using Triazol™ reagent according to manufacturers instructions. RNA was evaluated by performing electrophoresis on 1% formaldehyde gels with ethidium bromide. Total RNA was reverse-transcribed using an 18-oligo-dT primer and Superscript™ II reverse transcriptase, as per manufacturers instructions. Briefly, 5 μg of total RNA was incubated at 70° C. for 10 min in the presence of 1 μl of primer (10 μM). After a brief centrifugation, 4 μl of “first strand buffer”, 2 dithiothreitol (0.1 M) and 1 μl of dNTP mix (10 mM) were added and 42° C. for 2 min prior to addition of Superscript™ reverse transcriptase (1 μl) another incubation at 42° C. for 45 min. The reaction was terminated by incubation at 70° C. for 15 min. PCR was performed on the cDNA products by using primers specific for ET. The identity of the products was confirmed by sequencing. [0054]
  • Identification of the human ET transcriptional start site The transcriptional start site of human ET gene was determined by the 5′RACE methodology. Total RNA from human hepatoma cells HepG2 (Geneka Biotechnology) was subjected to a reverse transcription using oligo(dT) primer and Superscript™ II reverse transcriptase (RT), following the manufacturers' instructions. The newly synthesized cDNA was purified and tailed with a poly(dC) using reverse terminal deoxynucleotidyl transferase (rTdT). The 5′-end tailed fragment of the human ET was then amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 μM dNTPs, 400 μM abridged anchor primer (annealing to the poly(dC) tail), 400 μM RP2AC gene specific reverse primer (Table 1), 8% glycerol (to increase primer binding specificity), 2.5 units Taq polymerase, and 10 μl tailed cDNA template, with a final volume of 50 μl. This reaction was subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C. The reaction was terminated after a 10 min final extension at 72° C. Nested PCR was performed using 3 μl of the above PCR mixture, amplified using the AAP primer and either I2RP or RP1AC gene specific reverse primer (Table 1) under the same conditions. Table 1 provides a list of human ET specific primers used in the 5′-RACE analysis (SEQ ID NO: 22 to SEQ ID NO: 28, respectively). [0055]
    TABLE 1
    Human ET Specific Primers
    Primer Position
    Name Sequence (5′ to 3′) (on D84307)
    RP2AC TCTCCTGGCTGCTGTGATG +544 to +562
    RP1AC CCGTGAACACAGAAGTCACAGT +383 to +404
    I2RP CACCTCGTCCACCCA1TU +316 to +333
    AAP GGCCACGCGTCGACTAGT Poly(dC) tail
    ACGGGIIGGGIIGGGIIG
    PCR2.1FP CAGGAAACAGCTATGAC  ˜75 bp upstream of
    PCR insert
    PCR2.1RP TAATACGACTCACTATAGGG  ˜75 bp downstream 
    of PCR insert
  • Cloning of the Mouse ET Genomic Products and [0056] Human ET 5′-End Products: Subcloning of the BAC45A04 mouse genomic sequence was performed into a PCR cloning vector from Quiagen. Clones were tested for the presence of ET sequence and sequencing was performed on 6 overlapping mouse genomic regions using different sets of overlapping primers as shown in Table 2 and FIG. 3. Human ET 5′-end products of 5′-RACE were cloned into the pCR2.1cloning vector (TA Cloning Kit, Invitrogen). Screening of the inserts was determined by PCR of the miniprep DNA in order to determine sizes of the fragments inserted into the pCR2.1 vector. 3 μl of miniprep DNA template was amplified using the PCR protocol employed for 5′RACE except glycerol was not used in the reaction and the primer annealing step was conducted at 55° C. The authenticity of fragments of desired lengths were confirmed by sequencing, the result of which is illustrated in FIG. 7.
    TABLE 2
    Location and individual size of the protein coding sequence (exons)
    in the genomic clone BAC 45A04 that correspond to the murine ET
    coding sequence.
    Position
    Exon No. in cDNAa Exon Size Location in SEQ ID NO: 1d
    1  45b-133 5′ UTR + 88  1-89
    2 134-222 88 1918-2006
    3 223-384 189 2402-2565
    4 385-451 70 3456-3525
    5 452-536 84 4131-4217
    6 537-581 44 4433-4479
    7 582-635 53 4774-4828
    8 636-774 138 5255-5394
    9 775-857 82 5773-5856
    10 858-935 77 6151-6229
    11  936-1001 65 6443-6510
    12 1002-1067 65 6678-6745
    13 1068-1156 88 6892-6982
    14  1154-1259c 105 + 3′ UTR 7086-7188
  • Analysis of the ET Gene Regulatory Region. The 5′ sequence proximal to the transcriptional initiation site was obtained by using human ET specific primers for amplifying human genomic DNA isolated from MCF-7 human mammary carcinoma cell line and/or a BAC clone RP11498C9 (GenBank™ AC069004) obtained from The Sanger Sequencing Center, UK. The sequence of the ET promoter region (SEQ ID NO: 2) was evaluated using the Transfac™ transcription factor database located at http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html. [0057]
    • Example 1 Cloning and Exon-Intron Organization of the Murine ET Gene
  • FIG. 3 shows the structure and organization of the murine ET gene. Schematic representation of both murine ET gene and cDNA are shown. Solid horizontal lines and solid boxes represent Introns and Exons, respectively. Numbers and sizes of exons (1-14) and introns (I-XIV) are also shown. The position and size of exons within the murine ET cDNA are indicated in the lower part of the FIG. 3. The translational start site codon, ATG, encoding the protein is at the beginning of [0058] Exon 1 and the stop codon, TGA, is in Exon 14 at position 1257-1259. The mid section displays the cloning strategy, the positions of primers and six overlapping clones used for the genomic sequence analysis.
  • Several putative ET clones were isolated from the mouse BAC genomic library RPCI23 by using the “overgo” screening methodology. After performing a second screening with the 5′- and 3′-end specific primers shown in Table 3, one clone from the library, namely BAC45A04, that contained both 5′- and 3′-ends was identified, suggesting the presence of the entire ET gene in this clone. Further analysis of this clone was conducted by PCR amplification, subcloning, and sequencing by using gene-specific primers shown in Table 3 from six overlapping regions, as shown in FIG. 3 (SEQ ID NO: 29-SEQ ID NO: 40, respectively). The complete exon/intron structure of the mouse ET gene was successfully identified, as shown in FIG. 3, Table 2 and Table 4, and the sequence is shown as SEQ ID NO: 1. [0059]
    TABLE 3
    Sequences and positions of PCR primers
    used for identification and
    amplification of the murine ET genea.
    Position in Exon
    Primer
    5′-Sequence-3′ cDNA #
    Forward:
    F1 GGATTTGCGGGGGGCCTCCG 20-39 1
    F2 ACGGCAGGCACGGGCCATGGG 170-190 2
    F4 ACGCTGACAGTAGACGGCCG 393-412 4
    F6 GGAGATGTCCTCTGAGTACCG 536-556 6
    F8 TTCTGGGAAGGAGCCCCAGCC 710-730 8
    F11 ACCATACTCCGTGACAGCGG 962-981 11
    Reverse:
    R1 GTATGCACACCCACGATGAGG 217-197 2
    R3 CTCCCAGCCTGCTTCACTTCC 445-425 4
    R5 TTCCAAAACTGTCAGCATATTCC 579-557 6
    R7 GGCACCAGCCACATAGATGAC 761-741 8
    R10 ACCTTGAAGTGATTCAGGAGC 1003-983  11
    R13 GGTGGGCACAGGGCAAGGGC 1304-1285 14
  • The sequenced ET gene is 7,188 kb in length starting from the ATG translation start codon and ending at the TGA translation stop codon. The gene is composed of 14 exons interrupted by 13 introns shown in FIG. 3 and Tables 2 and 4. The sizes of exons range from 44 (Exon 6) to 189 bp (Exon 3) and [0060] Exon 14 contains the TGA stop codon.
    TABLE 4
    The location and size of the non-coding,
    intervening sequence (introns) in the genomic
    clone BAC45A04 and the exon-intron boundaries
    within the murine ET gene.
    Intron No.
    and
    5′-Splice Intron Size 3′-Splice Intron Positions
    Donora (bp) Acceptor SEQ ID NO: 1
    GGCTG/
    Figure US20040038360A1-20040226-P00801
    		 1 (1829)
    Figure US20040038360A1-20040226-P00817
    /CTATG    		   90-1917
    GGATG/
    Figure US20040038360A1-20040226-P00802
    		 2 (395)
    Figure US20040038360A1-20040226-P00818
    /AGGAG    		 2007 2402
    CGGCA/
    Figure US20040038360A1-20040226-P00803
    		 3 (891)
    Figure US20040038360A1-20040226-P00819
    /ATGAC    		 2565-3456
    TACAG/
    Figure US20040038360A1-20040226-P00804
    		 4 (608)
    Figure US20040038360A1-20040226-P00820
    /AGAGT    		 3523-4131
    GCCAG/
    Figure US20040038360A1-20040226-P00803
    		 5 (216)
    Figure US20040038360A1-20040226-P00821
    /GAGAT    		 4217-4433
    GAAAG/ GTGAG 6 (294)
    Figure US20040038360A1-20040226-P00822
    /CCCCC    		 4479-4773
    CCCAG/
    Figure US20040038360A1-20040226-P00805
    		 7 (427)
    Figure US20040038360A1-20040226-P00823
    /TGCCC    		 4828-5255
    GTTCC/ GTATC 8 (379)
    Figure US20040038360A1-20040226-P00824
    /ACATC    		 5394-577 
    ACCAG/
    Figure US20040038360A1-20040226-P00806
    		 9 (295)
    Figure US20040038360A1-20040226-P00818
    /GAAGT    		 5856-6151
    GCCGG/
    Figure US20040038360A1-20040226-P00802
    		 10 (214)
    Figure US20040038360A1-20040226-P00825
    /TATGT    		 6229-6443
    TCAAG/
    Figure US20040038360A1-20040226-P00803
    		 11 (168)
    Figure US20040038360A1-20040226-P00826
    /GTGGA    		 6510-6678
    ACCAG/
    Figure US20040038360A1-20040226-P00807
    		 12 (147)
    Figure US20040038360A1-20040226-P00826
    /GAGCC    		 6745-6893
    AACAG/
    Figure US20040038360A1-20040226-P00808
    		 13 (103)
    Figure US20040038360A1-20040226-P00820
    /GCTGG    		 6982-7085
  • Sequencing of six overlapping regions showed that the introns in the mouse gene were bellow 2 Kb, which allowed an accurate description of all introns present by using PCR amplification and sequencing. The introns range in size from 103 bp (the last intron, Intron XIII) to 1829 bp (the first intron, Intron I) as shown in FIG. 3 and Table 4. The organization of the mouse gene is different from that of the human ET gene as shown in Table 5. Information for the human Chromosome 17, Locus Link for human ET gene, changes frequently, and can be found at http://www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi?1=5833. The human gene contains 15 exons and 14 introns: the sizes of exons are between 36 bp (Exon 13) and 958 bp (Exon 14) and the sizes of introns are between 128 (Intron 12) and 7944 (Intron 14) as shown in Table 5. [0061]
    TABLE 5
    Intron sizes of human ET and the exon-intron
    boundaries within this gene obtained from the
    GeneBank sequence contingent at
    Chromosome 17 NT_01045.
    5′-Splice Intron Intron 3′-Splice
    Donor* No. Size (bp) Acceptor
    GGCTG/
    Figure US20040038360A1-20040226-P00803
    		 1  (835)
    Figure US20040038360A1-20040226-P00817
    /CTATG
    CGATG/
    Figure US20040038360A1-20040226-P00802
    		 2  (476)
    Figure US20040038360A1-20040226-P00818
    /AGGAG
    CGGCA/
    Figure US20040038360A1-20040226-P00803
    		 3  (240)
    Figure US20040038360A1-20040226-P00827
    /ATGAC
    TACAG/
    Figure US20040038360A1-20040226-P00803
    		 4  (709)
    Figure US20040038360A1-20040226-P00818
    /AGAAT
    GCCAG/
    Figure US20040038360A1-20040226-P00803
    		 5  (174)
    Figure US20040038360A1-20040226-P00821
    /GAGAT
    GCAAG/
    Figure US20040038360A1-20040226-P00803
    		 6  (655)
    Figure US20040038360A1-20040226-P00821
    /TGCCC
    GTTCC/
    Figure US20040038360A1-20040226-P00809
    		 7  (213)
    Figure US20040038360A1-20040226-P00821
    /ACATC
    ACCAG/
    Figure US20040038360A1-20040226-P00810
    		 8  (285)
    Figure US20040038360A1-20040226-P00825
    /GAGGT
    GCCGG/
    Figure US20040038360A1-20040226-P00803
    		 9  (364)
    Figure US20040038360A1-20040226-P00817
    /TACGT
    TCAAG/
    Figure US20040038360A1-20040226-P00803
    		 10  (222)
    Figure US20040038360A1-20040226-P00826
    /GTGGA
    ACCAG/
    Figure US20040038360A1-20040226-P00807
    		 11  (244)
    Figure US20040038360A1-20040226-P00828
    /GAGGC
    AGCTC/
    Figure US20040038360A1-20040226-P00811
    		 12  (128)
    Figure US20040038360A1-20040226-P00829
    /GGCGG
    AAGGC/
    Figure US20040038360A1-20040226-P00812
    		 13 (7944)
    Figure US20040038360A1-20040226-P00830
    /GCCTT
  • The invention also establishes the exon-intron boundaries of the mouse and human genes as shown in Table 4 and Table 5, respectively. The boundary sequences at the 5′- and 3′-ends of all the mouse introns are GT and AG, respectively. These are consensus sequences for pre-mRNA splicing donor and acceptor sites. [0062]
    • Example 2 Identification of Transcriptional Initiation Site for the Human ET Gene
  • FIG. 4 to FIG. 6 illustrate steps involved in the determination of transcription initiation site of human ET gene. [0063]
  • FIG. 4 [0064] shows 5′RACE strategy illustrating the location of human ET-specific primer binding sites. The abridged anchor primer, AAP, binds to the dCTP tail of the cDNA. Gene specific reverse primers of human ET, I2RP, RP1AC, and RP2AC, bind to the cDNA at positions +316/+333, +383/+404, and +544/+562, respectively. These positions correspond to the published sequence for the human ET cDNA (GenBank™ D84307).
  • FIG. 5 shows the results of the PCR reaction for the 5′ RACE of human ET cDNA using the abridged anchor primer, AAP, and the gene specific reverse primer RP2AC. The 5′-RACE analysis, using the AAP and RP2AC primers, produced one prominent band at ˜600 bp as shown in [0065] lane 2 of FIG. 5, which coincides with the binding site for the RP2AC primer on the published human ET cDNA sequence (GenBank™ D84307). In FIG. 5, lane 1 represents a 100 bp ladder and the bright band corresponds to a 600 bp fragment.
  • To confirm that the 5′-end for human ET is being amplified, two nested PCR reactions were utilized using one reaction with the RP1AC reverse primer, and the second reaction using the I2RP reverse primer. FIG. 6 shows the results of one PCR screening of colonies containing the inserts from the nested PCR reaction. [0066] Only lane 3 holds the PCR product size of a length, of about 500 bp, that corresponds to the length of the 5′end of human ET including the 5′ and 3′ flanking regions that would be amplified from the pCR2.1 vector using pCR2.1 specific primers binding to 5′ and 3′ flanking regions of the insert area. Further screening yielded three colonies that contained inserts of a desired length. They were all further confirmed for the 5′-end of human ET by sequencing.
  • FIG. 7 represents the sequence alignment of three positive clones with the published sequence for the human ET cDNA (GenBank™ D84307). The clones, named hET-C5.3, C2.3, and C1.1, contained the sequence for human ET from positions +23/+333, +111/+333, and +109/+333, respectively. Position +333 corresponds to the last nucleotide of the nested 12RP reverse primer. Clone hET C5.3, having a 5′-end beginning at position +23 in comparison to the published human ET cDNA, represents one transcriptional start site of human ET. The ATG translational start codon for the gene lies downstream of the start site, at position +67. Clones hET C2.3 and C1.1, whose 5′-ends begin at positions +109 and +111, respectively, may represent a second transcription start site. There is an ATG codon at position +149 but it seems unlikely that it is in fact a true start site for human ET gene. A translational start at this position would not include the MIRNG motif conserved in all ET proteins, shown in FIG. 2. This suggests that the clone hET-C5.3 is representative of the 5′end of the human ET cDNA and is also representative of the true transcriptional start site of the human ET gene. This evidence also suggests that the promoter of the human ET gene lies just upstream, in the 5′ flanking sequence of the beginning of [0067] exon 1.
    • Example 3 The 5′ Flanking Region of the Human ET Gene and the Overall Gene Structure
  • The structure for the human ET gene has been characterized using data obtained from the human genome project (BAC clone RP11498C9, GenBank™ AC069004, and human ET cDNA, GenBank™ NT[0068] —010845, sequence alignments). Human ET gene consists of 14 exons (total size ˜20 Kb) the first 13 exons of which are separated by relatively small introns (˜500 bp) as shown in Table 5. Intron 13 is comparatively larger than the rest (˜12 kb, Table 4), separating exon 14 from the rest of the gene. From the results of 5′RACE according to the invention, the ATG start codon lies 45 bp downstream of the transcription start site. The promoter region of human ET, which lies immediately upstream of exon 1, is approximately 500 bp and has the sequence shown in SEQ ID NO: 2 and FIG. 8. Upstream of this region lies the coding sequence of another gene.
  • FIG. 8 [0069] shows 5′-flanking (regulatory, promoter) region of the human ET (SEQ ID NO: 2) with consensus cis-elements for the regulatory transcription factors. In italics is the exon 1 of human ET with an arrow pointing to the transcription start site determined by 5′RACE. In bold and underlined is the ATG translation start codon. Underlined in certain boxes are the consensus binding sites for transcription factors Sp1, MyoD, Ap1, Ap4, AP2, NFkB, CAAT binding protein CBP, and NF1.
  • Using TRANSFEC™ transcription factor database, the transcription factor binding sites for the promoter region of the human ET were determined. This analysis led to the identification of multiple binding sites for several families of transcription factors, including the Sp family, the AP family, and the MyoD family. Eleven binding sites for the Sp-1 transcription factor were discovered according to the invention, which lie immediately upstream of the transcription start site in a very GC rich area in the sequence. The Sp-1 family of transcription factors, which binds GC boxes, can both initiate and regulate transcription, and offers both ubiquitous and regulated expression of human ET (53). The Sp family of transcription factors play an important role in the expression of the CT gene (54). A CAAT box is located approximately 100 bp from the transcriptional start site. Other transcription factor binding sites that have been identified may be utilized in tissue-specific expression of ET gene. The presence of several cis-elements for binding transacting factors and occurrence of a coding region for another gene upstream of SEQ ID NO: 2 indicates that the isolated DNA of SEQ ID NO: 2 is a promoter. [0070]
  • The isolation of the promoter region of human ET is important for the understanding of the regulation of human ET expression. The identification of this region promotes understanding of the coordination of expression of other lipogenic genes, whose regulation must be strictly regulated to ensure that phospholipid turnover is maintained. [0071]
    • Example 4 Structure, Expression, and Regulation of the Mouse CTP: Ethanolaminephosphate Cytidylyltransferase (mECT) Gene. Generation of Two Variants by Alternative Splicing
  • CTP: ethanolaminephosphate cytidylyltransferase (ECT) is an important regulatory enzyme in the Kennedy pathway for phosphatidylethanolamine biosynthesis. We cloned a mouse ECT gene from the C57BL/J6 genomic library and established the structural and functional relationship between the mouse and human genes. The two genes are similar in size and exon/intron organization, and have two conserved catalytic domains. An internal domain could, however, be alternatively spliced, producing two ECT transcripts: a longer, predominantly mouse form, ECTa, and a shorter, predominantly human form, ECTb. The spliced sequence encodes the peptide PPHPTPAGDTLSSEVSSQ, located immediately upstream of the second catalytic motif HIGH, and is entirely encoded by the [0072] mouse Exon 7. In addition, the human gene is spliced differently from the mouse gene at its 3′-end, between Exons 13 and 14. This does not affect the size of the C-terminus but changes the amino acid composition.
  • Regulatory promoters in both the mouse and the human ECT genes lie immediately upstream of the first exon, within the 5′-flanking region, and have conserved initiation start sequence from −3/+10 bp, as GGAG[0073] (+1) (C/T)CGCC(A/G)GGA (SEQ ID NO: 41). Both promoters are TATA-less but contain a conserved CAAT box at a matching distance (−85/−70 bp) from the transcription start site. The two promoters have low sequence similarities but share binding sites for transcription factors of the Sp1 and NF1 family. Promoter-luciferase reporter analysis shows that the mouse ECT promoter is strong, cell-type specific, and similar in activity to the CTP: cholinephosphate cytidylyltransferase a promoter. The mouse promoter contains multiple cis-acting elements for MyoD, Ap1, USF, CAAT/NFY and cEBPβ transcription factors, suggesting complex regulation of ECT during tissue development, cell growth, and differentiation.
  • Materials. Restriction endonucleases, Taq DNA polymerase, dNTPs, PCR reagents, Triazol™, 18-oligo-dT primers, Superscript™ II reverse transcriptase, and other molecular biology reagents were purchased from the Life Technologies Inc. (Burlington, ON, Canada). The dual luciferase reporter assay kit, Wizard™ maxiprep kit and large construct kit were obtained from Promega (Madison, Wis.). The 5′- and 3′-RACE kit (version 2.0) was purchased from Gibco BRL. The Qiaprep™ spin miniprep kit and the Qiagen PCR cloning kit were purchased from Qiagen. [0074] 14C-labeled phosphoethanolamine was obtained from American Radiolabeled Chemicals Inc. All other reagents were purchased from Fisher Scientific (Nepean, ON. Canada) or from Sigma (Oakville, ON. Canada).
  • Primer Design and Sequencing. All primers for the mouse and human ECT genes were synthesized at the Laboratory Services division of the University of Guelph Molecular Supercenter. The AAP and AP primers employed in 5′- and 3′-RACE were supplied in the RACE kit. DNA sequencing was performed at the University of Guelph Molecular Supercenter (Canada). [0075]
  • Murine Genomic Library Screening. The mouse RPC123 genomic library from a C57BL/J6 female (Roswell Park Cancer Institute, Buffalo) was screened. An individual probe screening of seven filter sets was performed with an overgo-generated probe designed from a mouse EST cDNA (Genbank™ BC003473). An “overgo” that corresponded to the 3′-untranslated region of BC003473 at position 1342-1381 bp (5′-TGTCAGCTCACACAATTCCAAAGGAAACTGGCCTTGCTG-3′) (SEQ ID NO: 19) was employed to design two complementary primers BC003473-OVa: TGTCAGCTCACACAATTCCAAAGG (SEQ ID NO: 20) and BC003473-OVb: TCAGCAAGGCCAGTTTCCTTTGGA (SEQ ID NO: 21), that act as primers for each other in a labeling reaction. Twelve positive clones were obtained by the first screening. After the second screening with two sets of the 5′-end and 3′-end mECT specific primers, 5 out 12 BAC clones (cloning vector pBACe3.6) corresponded to the full-length of the murine ECT gene. The positive clone BAC45A04 was used for further analysis. [0076]
  • DNA isolation and Determination of mECT Gene Structure. BAC DNA was isolated using the Qiagen™ large construct kit. Plasmid DNA was isolated using either the Qiaprep™ spin miniprep kit or the Wizard™ maxiprep kit. Characterization of the mECT gene was accomplished using PCR and sequencing. The positions and the structure of the overlapping primer pairs used for determination of the mECT gene are shown in Table 6. Using BAC45A04 DNA as a template, PCR was performed under the following conditions: 3 min denaturation at 94° C., followed by 30 cycles of 94° C. for 30 sec, 58° C. for 30 sec, and 1 min at 72° C., and completed with a final extension of 8 min at 72° C. The amplified fragments were cloned into the pDRIVE cloning vector supplied in the Qiagen PCR cloning kit and individual clones sequenced in both directions using vector-specific primers and/or mECT-specific primers. [0077]
    TABLE 6
    Sequences and positions of the PCR overlapping
    primers used for identification and
    amplification of the mECT genea
    Position in
    Primer 5′-Sequence-3′ cDNA Exon
    Forward:
    F1 GGATTTGCGGGGGGCCTCCG 20-39 1
    F2 ACGGCAGGCACGGGCCATGGG 170-190 2
    F4 ACGCTGACAGTAGACGGCCG 393-412 4
    F6 GGAGATGTCCTCTGAGTACCG 536-556 6
    F8 TTCTGGGAAGGAGCCCCAGCC 710-730 8
    F11 ACCATACTCCGTGACAGCGG 962-981 11
    Reverse:
    R1 GTATGCACACCCACGATGAGG 217-197 2
    R3 CTCCCAGCCTGCTTCACTTCC 445-425 4
    R5 TTCCAAAACTGTCAGCATATTCC 579-557 6
    R7 GGCACCAGCCACATAGATGAC 761-741 8
    R10 ACCTTGAAGTGATTCAGGAGC 1003-983  11
    R13 GGTGGGCACAGGGCAAGGGC 1304-1285 14
  • Identification of Transcription Start Site of the mECT. Total RNA from mouse stem cells F9 (Geneka) was subjected to reverse transcription using the mECT-specific R7 primer (Table 6) and Superscript II reverse transcriptase. Reverse transcribed cDNA was purified using the Qiagen PCR purification kit (Qiagen) and tailed with a poly(dC) tail in a reaction consisting of 10 mM Tris-HCl, 25 mM KCl, 1.5 mM MgCl2, 200 μM dCTP, and 1 μl reverse terminal deoxynucleotidyl transferase (rTdT). The tailing reaction was conducted for 10 min at 37° C. followed by a 10 min enzyine inactivation at 65° C. The 5′-end tailed fragment of the mECT cDNA was amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 μM dNTPs, 400 μM abridged anchor primer (annealing to the poly(dC) tail), 400 μM antisense primer R5 (nested mECT primer shown in Table 6), and 2.5 U Taq polymerase. This reaction consisted of the following: 2 min denaturation at 94° C., followed by 35 cycles of 94° C. for 30 sec, 55° C. for 30 sec, and 60 sec at 72° C., and completed with a final extension of 5 min at 72° C. The resulting nested fragments were subcloned into the pDRIVE cloning vector and their identity was confirmed by sequencing. [0078]
  • Identification of Transcription Start Site of the hECT. Total RNA from human hepatoma cells HepG2 (Geneka Biotechnology) was subjected to reverse transcription using an oligo(dT) primer, the newly synthesized cDNA tailed with a poly(dC) using rTdT and the 5′-end tailed fragment amplified by PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 200 μM dNTPs, 400 μM abridged anchor primer (AAP), 400 μM RP2AC gene specific reverse primer (Table 7), 8% glycerol (to increase primer binding specificity), 2.5 units Taq polymerase, and 10 μl tailed cDNA template, with a final volume of 50 μl. This reaction was subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C. The reaction was terminated after a 10 min final extension at 72° C. Nested PCR was performed using 31 μl of the above PCR mixture, and amplified using the AAP and either I2RP or RP1AC gene specific reverse primer (Table 5) under the same conditions. [0079] hECT 5′-end products were cloned into the pCR2.1cloning vector (TA Cloning Kit, Invitrogen). Screening of the inserts by PCR was performed on minipreps of selected clones to determine the fragment size. 3 μl of miniprep DNA template was amplified using the PCR protocol employed for 5′RACE except that glycerol was not used in the reaction and the annealing step was conducted at 55° C. The authenticity of the human ECT 5′-RACE fragments of desired lengths was confirmed by sequencing.
    TABLE 7
    Sequences and positions of the primers
    used for the 5′-RACE, 3′-RACE and characterization
    of the hECT gene*.
    Primer Name Sequence (5′ to 3′) Position
    RP2AC TCTCCTGGCTGCTGTGATG +544 to +562
    RP1AC CCGTGAACACAGAAGTCACAGT +383 to +404
    I2RP CACCTCGTCCACCCATTT +316 to +333
    AAP GGCCACGCGTCGACTAGT Poly(dC) tail
    ACGGGIIGGGIIGGGIIG
    PCR2.1FP CAGGAAACAGCTATGAC  ˜75 bp
    upstream of
    PCR insert
    PCR2.1RP TAATACGACTCACTATAGGG  ˜75 bp
    downstream of
    PCR insert
    3′-AP GGCCACGCGTCGACTAGTACTTTTTTTT To prime mRNA
    TTTTTTTTT
    AUAP GGCCACGCGTCGACTAC Binds to 3′-AP
    I1FP TGAGGGTGTGGTGCGAT  +134/+150 
    3′ RACEFP3 GGCATCTTCCGTCAGATTGA +1051/+1070
    3′ RACEFP4 CAGACCTCATCGTCCAGCGG +1091/+1110
  • Identification of Transcription Termination Sites of the mECT and hECTgenes. Total RNA from mouse cell line F9 was subjected to reverse transcription using the adapter primer (3′-AP) and Superscript II reverse transcriptase as mentioned above. The 3′-end of mECT was amplified using PCR: 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl[0080] 2, 200 μM dNTPs, 400 μM abridged universal anchor primer (AUAP) annealing to the 3′AP, 400 μM mECT sense primer F6 (Table 6), 8% glycerol, and 2.5 U Taq polymerase. The reaction consisted of the following: 5 min denaturation at 94° C., followed by 35 cycles of 94° C. for 30 sec, 50° C. for 30 sec, and 72° C. for 90 sec, and completed with a final extension of 5 min at 72° C. An aliquot of the above reaction was subjected to nested PCR using the sense mECT primer F8 under the same conditions.
  • 3′-RACE of the hECT gene was performed as above except that hECT specific primers and total RNA from human HepG2 cells were used. Primers used to amplify the 3′-end(s) were the AUAP and the 3′RACEFP3 gene-specific forward primer (Table 7). The reactions were subjected to a 3 min initial denaturation at 94° C., followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 50° C., and a 90 s primer extension at 72° C. The reactions were terminated after a 10 min final extension at 72° C. Nested PCR was performed using the 3′-AP and 3′RACEFP4 gene specific forward primer (Table 7) under the same conditions. [0081]
  • The resulting nested fragments of the mouse and [0082] human ECT 3′-ends were subcloned into the pDRIVE cloning vector and corresponding positive clones sequenced.
  • RNA Isolation and RT-PCR Analysis. Murine tissues (adipose, brain, heart, kidney spleen, muscle, lung and liver) from C57/BL mice were collected and snap-frozen in liquid nitrogen. Total RNA was isolated using Triazol™ reagent according to manufacturers′ instructions. RNA was evaluated by electrophoresis on 1% formaldehyde gels and visualizing by staining with ethidium bromide. Total RNA was reverse transcribed using a poly-dT primer and Superscript II reverse transcriptase. 5 μg total RNA was incubated for 10 min at 70° C. with 1 μl primer (10 μM). This was followed by the addition of 4 μl “first strand buffer”, 2μl dithiothreitol (0.1 M), and 1 μl dNTPs (10 mM). After 2 min incubation at 42° C., 1 μl Superscript II reverse transcriptase was added and further incubated at 42° C. for 1 hour. The reaction was then terminated by incubation at 70° C. for 15 min. PCR was performed on 100 ng cDNA using the sense primer, F11, and the antisense primer, R13 (see Table 6) under the following conditions: 3 min denaturation at 94° C., followed by 36 cycles of 94° C. for 20 sec, 58° C. for 30 sec, and 30 sec at 72° C., and completed with a final extension of 5 min at 72° C. The final components of the PCR were the following: 1×PCR buffer, 1.7 mM MgCl[0083] 2, 200 μM dNTPs, 300 nM primers, and 2.5 U Taq. Mouse G3PDH was employed as a control using the sense primer TCCACCACCCTGTTGCTGTA (SEQ ID NO: 47) and antisense primer ACCACAGTCCATGCCATCAC (SEQ ID NO: 48) under the same conditions.
  • Characterization of hECT mRNA Expression in Established Human Cell Lines. 5 μg total RNA from cell lines DU145 (prostate), THP-1(monocytes), HepG2 (liver), U937 (monocytes), U937+TPA (differentiated macrophages), and Kelly (neurons) (all from Geneka Biotechnology) were subjected to reverse transcription using poly(dT) and hECT than amplified from 300 ng cDNA using gene specific primers RP2AC and 11FP (Table 7) The conditions were the same as in 5′-RACE except glycerol was not used and only 30 cycles of amplification were needed. These conditions were shown to be in a linear range for the mRNA concentration and number of PCR cycles (data not shown). [0084]
  • Expression of human β-actin was also utilized as a control by amplification from 300 ng cDNA under similar conditions using actin-specific primers and the following cycling parameters: 3 min initial denaturation at 94° followed by 35 rounds of amplification each consisting of a 45 s denaturation at 94° C., a 30 s primer annealing step at 60° C., and a 90 s primer extension at 72° C. The reactions were terminated after a 10 min final extension at 72° C. The expression of mECT and hECT mRNAs relative to controls G3PDH and β-actin, respectively, was determined by densitometry using Scion Image software (Scion Inc). [0085]
  • Measurement of mECTEnzymatic Activity. Tissues dissected from a C57BL/J6 mouse were stored in liquid nitrogen for later use. Frozen tissues were thawed on ice and homogenized in buffer containing 10 mM Tris-HCl, pH 7.4; 1 mM EDTA; and 10 mM NaF using a PowerGen™ 125 homogenizer. Homogenates were twice flash frozen in liquid nitrogen and thawed on ice, then centrifuged for 2 min at 13000×g to pellet cellular debris. Enzymatic activity of mECT was assayed in either 20 μl or 40 μl of the soluble fraction as described by Bladergroen et al (30). The reactions contained 10 mM MgCl[0086] 2, 2 mM CTP, 20 mM Tris-HCl, 5 mM DTT, 1 mM phosphorylethanolamine and either 0.1 or 0.2 μCi of [14C]phosphorylethanolamine in a final volume of either 50 μl or 100 μl. The reactions were incubated in a 37° C. water bath for 15 minutes, than transferred to a boiling water bath for 2 min to inactivate the enzyme. Unlabelled phosphorylethanolamine and CDP-ethanolamine (50 μg each) were added to each reaction as a standard and reactions were centrifuged for 2 min at 13000×g to pellet the denatured protein. CDP-ethanolamine was separated from phosphorylethanolamine by migration in methanol:0.5% NaCl:ammonia (50:50:5) on silica G plates (Analtech). The spots containing the CDP-ethanolamine were scraped and the activity of [14C] was measured by liquid scintillation counting. Enzyme activity (nmol/min/mg protein) was derived from cpm data using a known amount of [14C]phosphorylethanolamine as a standard.
  • Isolation of the mECT Promoter and Construction of the mECT Promoter/Luciferase Reporters. The promoter region of mECT was amplified from the BAC45A04 clone using the sense primer ATAT[0087] GAGCTCGGGTATGCGGCACAGGGAGAATC (SacI site underlined) (SEQ ID NO: 49) and the antisense primer ATATCTCGAGACCGGAGGCCCCCCGCAAATCC (XhoI site underlined) (SEQ ID NO: 50) which would amplify the mECT promoter region from −559 bp to +29 bp. The PCR conditions were the following: 3 min denaturation at 94° C., followed by 35 cycles of 94° C. for 30 sec, 58° C. for 30 sec, and 45 sec at 72° C., and completed with a final extension of 8 min at 72° C. The resulting fragment was gel-purified using the Qiagen gel-purification system, digested with SacI/XhoI and subcloned into the pGL3-basic luciferase reporter vector (Promega). Positive clones were confirmed by sequencing and used for further analysis.
  • Tissue Culture, Transfections and Luciferase Reporter Assays. C3H10-T1/2 murine fibroblasts were plated on 60 mm dishes at a confluency of 40% and incubated in DMEM supplemented with 10% fetal bovine serum and 1 mM sodium pyruvate for 24 hours at 37° C. with 10% CO[0088] 2. MCF-7 human breast cancer cells were incubated in Minimum Essential Medium (MEM, GibcoBRL) supplemented with 10% FBS and 1 mM sodium pyruvate under similar conditions. The next day, the media were replaced with serum-free medium supplemented only with sodium pyruvate and each dish transfected with a mixture containing 2.5 μg promoter-luciferase constructs, 0.05 μg of pRL-CMV Renilla vector (Promega) as a transfection control, 250 μl serum-free DMEM, and 15 μg DOTAP (Avanti Polar Lipids). Cells were incubated in the transfection mixture for 5 h then replaced with serum-supplemented media and grown for 48 hours. After 48 h, cells were harvested, lysed in 400 μl Passive lysis buffer (Promega) and 10-25 μl of the cell lysate used for dual-luciferase assay according to the manufaciurer's instructions. Luciferase measurements were taken using the Turner Designs luminometer. Luciferase activity was normalized for transfection efficiency by using the ratio of the activities obtained with the mECT promoter luciferase constructs and the pRL-CMV construct carrying the cytomegalovirus promoter-luciferase fusion and/or normalized for the amount of total protein. Promoterless pGL3, basic (Promega) served as a negative control and the pGL3, control (carrying simian virus promoter SV40) as a positive control. Mouse ECT promoter-reporter (−559/+29 bp) activity was compared to the activity of the full-length CCTα promoter (LUC.C7, −1268/+38) that we previously fully characterized.
  • Computational and Statistical Analysis. Sequence alignments and homology searches were performed to characterize the parental genomic clone BAC45A04 using Ensembl Mouse Genome Browser (The Wellcome Trust Sanger Institute) and the MEGABLAST™ and BLAST2™ databases at the National Center for Biotechnology Information (NCBI). The protein structure of the rat, mouse, and human ECT was determined by the ClustalW™ algorithm at the European Bioinfornatics Institute (EMBL-EBI), and the mouse and human expression sequence tags (ESTs) were identified at the NCBI engines. The presence of putative regulatory elements and transcription factor binding sites within the 5′-flanking promoter region of the mouse and human ECT genes were determined using the TRANSFAC™ transcription factor database (Research Group Bioinformatics/AG Bioinformatik) and other databases for eukaryotic promoters available from the NCBI. The mouse ECT promoter/gene sequence is submitted to the GenBank™ database and has the accession number AY189524. [0089]
  • All measurements are expressed as means±S.D. Group means were compared by Student's t test after analysis of variance to determine the significance of difference between the individual means. Statistical significance was assumed atp<0.05. Densitometric analyses were performed by Scion Image data processing and acquisition software (Scion Inc). [0090]
  • Results. [0091]
  • Cloning strategy and characterization of the mECTgene. By performing a BLAST search of the mouse expressed sequence-tagged (ESTs) database we found multiple clones having considerable similarities to the rat (rECT) and human (hECT) cDNA. A clone (GenBank™ BC003473) containing the full-length mECT was confirmed by sequencing and chosen for further analysis. The deduced protein sequence demonstrates that the mouse clone contains both N- and C-terminal ends, including the ECT recognition motif MIRNG (amino acids 1-5), which is conserved in rECT and hECT, and two catalytic HXGH motifs (amino acids 35-38 and 226-229). The HXGH is the CTP binding motif in all cytidylyltransferases with the ECT family specifically containing two such motifs. The mECT cDNA clone shown in FIG. 2 was utilized for screening the C57BL/J6 murine genomic library, isolation of the mECT gene, and for the expression analysis of mECT mRNA in various tissues. [0092]
  • As evidenced by FIG. 14, protein structure is conserved among mouse, rat, and human ECTs. A multiple alignment of the amino acid sequence of the mouse (mECT, GenBank BC003473), rat (rECT, GenBank™ AF080568), and human (hECT, Genbank NM[0093] —002861) ECTs was made using the Clustal W. The N-terminus ECT recognition motif MIRNG and two putative CTP binding motifs, HYGH and HIGH, are indicated in bold. mECT protein is 97% identical to rECT protein. hECT lacks a 17-aa peptide at position 180 to 199 aa, immediately upstream of the second CTP binding motif HIGH. The consensus pattern is indicated at the bottom of the alignment. Stars depict identical amino acids, and differences are depicted in the order of increasing sequence conservation by the space, single dots and double dots, with the space representing the lowest sequence conservation.
  • FIG. 9 shows the structure and organization of the mECT gene and differences in splicing between the mouse and human genes. Part A. Schematic representation of the mECT gene deduced from the genomic clone BAC45A04. Solid horizontal lines and solid boxes represent Introns and Exons, respectively. Numbers and sizes of Introns (I-XIII) and Exons (1-14) are also shown. The position and size of Exons within the mECT cDNA are indicated in the lower part of Part A. They are obtained by sequencing of the genomic BAC clone and sequence alignments with mECT cDNA. The translation start site of the mECT (ATG) is at the beginning of [0094] Exon 1 and the stop codon (TAG) is in Exon 14 at position 1257. The middle section in Part A displays the cloning strategy, the position of primers and the size of the overlapping clones used for the sequence analysis as summarized in Tables 6, 8 and 9. The mouse Exon 7 that is spliced out of the human ECT gene is also shown. Part B is a schematic representation of hECT deduced from the alignment of human Chromosome 17 contingent NT—010845 sequence and hECT cDNA GenBank NM—002861. The translational start site of the hECT (ATG) is at the beginning of Exon 1 and the stop codon (TAA) is in Exon 14 at position 1250. The human gene is spliced between Exons 13 (35 bp) and Exon 14 (67 bp) and they together form a single Exon 14 (102 bp) in the mouse gene as indicated. The hECT transcript is also missing the mouse Exon 7 between the Exons 6 and 7 as indicated. The rest of the hECT exons are homologous to the mECT exons. Exon/intron boundaries and the sizes of Introns are shown in Table 10.
  • Thirteen putative mECT genomic clones were isolated from the BAC genomic library and after a second screening using 5′- and 3′-end specific probes (data not shown) six clones were identified containing the entire mECT gene. The structure of one clone, BAC45A04, was further analyzed by amplifying six overlapping regions spanning the entire gene utilizing the ‘overlapping oligo” strategy shown in FIG. 9 (Part A) and Table 6. The genomic sequencing and alignments with mECT cDNA enabled the determination of exon and intron sizes and the splice junctions. The mECT gene is 7,188 bp in length, starting from the ATG translation start codon (Exon 1) and ending at the TGA translation stop codon (Exon 14). The gene structure shown in FIG. 9 (Part A) and Table 8 and Table 9 reveals that the mECT gene contains 14 coding regions (exons) interrupted by 13 intervening regions (introns). The exons are small and range from 44 bp (Exon 6) to 161 bp (Exon 3). Sequencing of six overlapping regions showed that the introns were smaller than 2 kb allowing for the complete and accurate description of all introns present. Intron sizes range from 103 bp (Intron XIII) to 1829 bp (Intron I), also shown in FIG. 9 (Part A) and Tables 8 and 9. Exon-intron boundary sequences at the 5′- and 3′-ends of the mECT introns are entirely GT and AG, respectively, which agree with known consensus sequences for mRNA splice sites. [0095]
    TABLE 8
    Location and individual size of the protein coding sequence (exons)
    in the genomic clone BAC 45A04 that correspond to the mECT
    coding sequence
    Exon No. Position in CDNAa Exon Size Genomic location
    1  45b -133 88  1-89
    2 134-222 88 1918-2006
    3 223-384 161 2402-2563
    4 385-451 66 3456-3522
    5 452-536 84 4131-4215
    6 537-581 44 4433-4477
    7 582-635 53 4774-4827
    8 636-774 138 5255-5393
    9 775-857 82 5773-5855
    10 858-935 77 6151-6228
    11  936-1001 65 6443-6508
    12 1002-1067 65 6678-6743
    13 1068-1156 88 6892-6980
    14  1157-1259c 102 7086-7191
  • [0096]
    TABLE 9
    The location and size of the non-coding, intervening sequence
    (introns) in the genomic clone BAC45A04 and the exon-intron
    boundaries within the mECT gene.
    5′-Splice Intron Intron 3′-Splice
    Donora No. Size (bp) Acceptor Intron Positions
    GGCTG/
    Figure US20040038360A1-20040226-P00813
    		 1b (1829)
    Figure US20040038360A1-20040226-P00817
    /CTATG    		   90-1917
    GGATG/
    Figure US20040038360A1-20040226-P00802
    		 2  (395)
    Figure US20040038360A1-20040226-P00818
    /AGGAG    		 2007 2402
    CGGCA/
    Figure US20040038360A1-20040226-P00813
    		 3  (891)
    Figure US20040038360A1-20040226-P00819
    /ATGAC    		 2565-3456
    TACAG/
    Figure US20040038360A1-20040226-P00804
    		 4  (608)
    Figure US20040038360A1-20040226-P00820
    /AGAG*T    		 3523-4131
    GCCAG/
    Figure US20040038360A1-20040226-P00813
    		 5  (216)
    Figure US20040038360A1-20040226-P00821
    /GAGAT    		 4217-4433
    GAAAG/
    Figure US20040038360A1-20040226-P00813
    		 6c  (294)
    Figure US20040038360A1-20040226-P00822
    /CCCCC    		 4479-4773
    CCCAG/
    Figure US20040038360A1-20040226-P00805
    		 7d  (427)
    Figure US20040038360A1-20040226-P00831
    /TGCCC    		 4828-5255
    GTTCC/
    Figure US20040038360A1-20040226-P00809
    		 8  (379)
    Figure US20040038360A1-20040226-P00832
    /ACATC    		 5394-577 
    ACCAG/
    Figure US20040038360A1-20040226-P00814
    		 9  (295)
    Figure US20040038360A1-20040226-P00833
    /GAA*GT    		 5856-6151
    GCCGG/
    Figure US20040038360A1-20040226-P00815
    		 10  (214)
    Figure US20040038360A1-20040226-P00834
    /TAT*GT    		 6229-6443
    TCAAG/
    Figure US20040038360A1-20040226-P00813
    		 11  (168)
    Figure US20040038360A1-20040226-P00826
    /GTGGA    		 6510-6678
    ACCAG/
    Figure US20040038360A1-20040226-P00807
    		 12  (147)
    Figure US20040038360A1-20040226-P00835
    /GAGCC    		 6745-6893
    AACAG/
    Figure US20040038360A1-20040226-P00808
    		 13e  (103)
    Figure US20040038360A1-20040226-P00836
    /GCTG*G*    		 6982-7085
  • FIG. 10 show a mapping of the transcription start sites of the mouse and human ECT genes. A) Strategy of 5′-RACE: Mouse or human total RNA is reverse transcribed, tailed, and 5′-end of the mECT or hECT cDNA amplified using gene specific reverse primers and an anchor primer (AAP) (Tables 6 and 7). The position of nested primers used in the second round of amplification is shown as [0097] broken arrows. B) 5′-end PCR products obtained using mECT specific primer R5 or hECT specific primer RP2AC. C) The mECT and hECT 5′-untranslated regions and the positions of transcription start sites. The transcription initiation site for mECT is 33 bp and for hECT 45 bp upstream of the ATG codon. The ATG codon is shown in bold and capitalized.
  • FIG. 11. Determination of transcription termination site(s) of the mECT gene. A) Strategy of 3′-RACE: Mouse RNA is reverse transcribed using the anchor primer (AP) and the 3′ cDNA end amplified using gene specific forward primers F6 or F8 and the abridged universal anchor primer AUAP (Table 7). B) Nested PCR product of the 3′-amplification of mECT cDNA using the primer AUAP and the gene specific forward primer F8. [0098] Lane 1, DNA 100 bp ladder, lane 2, mECT 3′-end product of ˜1100 bp. C) Sequence of the 3′-untranslated region (3′-UTR) of the mECT transcript. The mECT 3′-UTR region is 581 bp, starting from the first nucleotide after the stop codon TAG (in bold and capitalized) to the end of the polyadenylation site. Polyadenylation signals (in bold) are 15 bp and 38 bp from the poly(A) tail. D. Comparison of transcription termination end products for the mouse and human ECT and the size of two mECT transcripts. The second mECT transcript with a polyadenilation signal 38 bp from poly(A) tail is also shown.
  • FIG. 12. Tissue expression profiles and enzymatic activity of mECT. Part A. Total RNA from various tissues was reverse transcribed and 100 ng cDNA amplified using mECT gene-specific primers. G3PDH (lower bands) was amplified from the same tissues and served as a control. Densitometric analyses (at the bottom) show the relative mECT mRNA expression in different tissues, with highest expression in the liver, adipose, lungs and kidneys and lowest expression in the skeletal muscle. Part B. The expression of hECT mRNA in various cell lines. Total mRNA from Kelly (neurons), THP-1 (monocytes), HepG2 (liver), DU145 (prostate), U937 (monocytes) and U937+phorbol ester (differentiated macrophages) was reverse transcribed and amplified by hECT specific primers using 200 ng cDNA. Human β-actin served as an internal control. Relative expression of hECT mRNA is shown at the bottom. hECT was highly expressed in HepG2, Kelly, and undifferentiated U937 cells. Part C. mECT enzymatic activity in various tissues. The mouse tissue homogenates (liver, heart, brain, adipose, muscle, lung, spleen, and kidney) were assayed for the mECT activity by using [0099] 14C-phosphoethanolamine as a substrate and determining the amount of 14C-CDP-phospboethanolamine formed from 25 μg of total tissue homogenates during 15 min reaction period. The results shown are means±S.D. from at least three measurements.
  • Comparison of 5′-regulatory promoter regions of the mouse (A) and human (B) ECT genes. The two promoters (see FIG. 15) show low sequence homology but high conservation of binding sites for transcription factors CAAT, Sp1 and NF1. [0100] Nucleotide +1 denotes the transcription start sites and is marked by an arrow. The core consensus sequence of specific transcription factors is in boldface type and the entire cis-elements are underlined. Only the most probable motifs are shown (core similarity 1 and matrix similarity >0.85). CAAAT-CAAT binding protein; NF1-nuclear factor 1; Ap1-Ap4 associated proteins 1-4; c/EBP, CAAT enhancer binding protein; HNF hepatic nuclear factor; USF-upstream stimulatory factor; Sp1-stimulatory protein; GC-GC binding proteins; The transcription start site GGAG(+1)C/TCGCCA/GGGA is conserved in the two genes and is shown in italics and underlined. A CAAT box located at the matching distance (−85/−70 bp) from the transcription start site is conserved. The minus sign indicates the consensus sites in the opposite direction. The mECT promoter sequence −559/+29 is shown as in the luciferase reporters in FIG. 13. The human promoter sequence further upstream at the 5-end (−348) contains the polyadenylation signal for another gene, SIRT7, and is not considered relevant for the regulation of ECT.
  • FIG. 13 illustrates the transcriptional activity of the mECT promoter. Mouse embryonic fibroblasts C3H10T1/2 (Part A) and human breast cancer cells MCF-7 (Part B) were transiently transfected using DOTAP with 2.5 μg of reporter vector containing luciferase gene under the control of the mECT promoter and 0.5 μg of Renilla luciferase plasmid for control of transfection efficiency. The luciferase reporters containing either mCCT promoter or Simian virus-40 (SV-40) promoter were used to evaluate the overall activity and the potency of the mECT promoter. Transfected cells were harvested after 48 h and assayed for luciferase activity. Data shown are relative to the activities observed with the SV40 promoter. The measurements are performed in triplicates and the results are means±S.D. from three separate experiments. [0101]
  • Comparison of the mouse and human genes and the alternative splicing. From the protein alignments shown in FIG. 14 we noticed that the mouse cDNA, although highly homologous to rat cDNA (97%), is longer than human cDNA by a 17-amino acid peptide (PPHPTPAGDTLSSEVSSQ) (SEQ ID NO: 51) within the central region, the position 180-199 amino acids immediately upstream of the second CTP binding motif HIGH. After deducing the structure of the mouse gene (FIG. 9 Part A) we were able to deduce that the [0102] mouse Exon 7 is entirely responsible for this peptide, suggesting a differential splicing mechanism between the mouse and human genes.
  • To further establish the relationship between the mouse and human ECT genes, and to find out whether the [0103] mouse Exon 7 sequence was present in the human genome, we characterized the structure of the human gene. The results are shown in FIG. 9 Part B and Table 10. The structure of the hECT gene was deduced by the alignment of human genomic contingent NT—010845 located at human Chromosome 17 with published hECT cDNA (GenBank NM—002861). We found that the Exon 7 sequence lacking in the human cDNA (FIG. 9 Part B) is present in the human genomic contingent NT—010845 (data not shown), supporting the notion that the mouse and human ECT genes were alternatively spliced at the same position. Because of such internal “exon skipping” in the human gene, the first six human exons (Exons 1 to 6) maintain homology to the first six mouse exons, but the human Exons 7-12 correspond to mouse Exons 8 to 13 (compare FIG. 9 Parts A and B). We establish that the two genes differ in their last exons as well. The human ECT gene is additionally spliced at its 3′-end, between the Exon 13 (35 bp) and Exon 14 (67 bp) (FIG. 9 PartB and Table 10). Those two human exons correspond to a single mouse Exon 14 (102 bp) and the mouse gene has no an intron present at that location (FIG. 9 Part A).
  • Taken together, we found that the hECT is lacking [0104] mouse Exon 7 and has an additional splice site between Exon 13 and Exon 14, which is responsible for the same total number of exons as in the mouse gene. Because the total size of the last two human exons, the Exons 13 and 14, is identical to the last mouse exon, Exon 14, the lengths of the protein C-termini are consequently not significantly altered in the two species. However, differences in the type of amino acids were apparent due to lower sequence conservation within the 3′-end regions (FIG. 14). Finally, the “exon skipping” within the human gene is entirely responsible for the production of the truncated ECT transcript, ECTb, missing the central region between the two conserved catalytic domains.
    TABLE 10
    Intron sizes of the hECT gene and the exon-intron
    boundaries within this gene obtained from the
    sequence contingent at Chromosome 17 (NT_01045)
    and hECT cDNA
    5′-Splice 3′-Splice
    Donor Intron Size (bp) Acceptor
    GGCTG/
    Figure US20040038360A1-20040226-P00803
    		 1a (835)
    Figure US20040038360A1-20040226-P00817
    /CTATG
    CGATG/
    Figure US20040038360A1-20040226-P00802
    		 2 (476)
    Figure US20040038360A1-20040226-P00818
    /AGGAG
    CGGCA/
    Figure US20040038360A1-20040226-P00803
    		 3 (240)
    Figure US20040038360A1-20040226-P00827
    /ATGAC
    TACAG/
    Figure US20040038360A1-20040226-P00803
    		 4 (709)
    Figure US20040038360A1-20040226-P00820
    /AGAAT
    GCCAG/
    Figure US20040038360A1-20040226-P00803
    		 5 (174)
    Figure US20040038360A1-20040226-P00821
    /GAGAT
    GCAAG/
    Figure US20040038360A1-20040226-P00803
    		 6b (655)
    Figure US20040038360A1-20040226-P00821
    /TGCCC
    GTTCC/
    Figure US20040038360A1-20040226-P00809
    		 7 (213)
    Figure US20040038360A1-20040226-P00821
    /ACATC
    ACCAG/
    Figure US20040038360A1-20040226-P00810
    		 8 (285)
    Figure US20040038360A1-20040226-P00825
    /GAGGT
    GCCGG/
    Figure US20040038360A1-20040226-P00803
    		 9 (364)
    Figure US20040038360A1-20040226-P00817
    /TACGT
    TCAAG/
    Figure US20040038360A1-20040226-P00803
    		 10 (222)
    Figure US20040038360A1-20040226-P00826
    /GTGGA
    ACCAG/
    Figure US20040038360A1-20040226-P00807
    		 11 (225)
    Figure US20040038360A1-20040226-P00820
    /GAGCC
    AAACA/
    Figure US20040038360A1-20040226-P00816
    		 12 (128)
    Figure US20040038360A1-20040226-P00828
    /GAGGC
    AGCTC/
    Figure US20040038360A1-20040226-P00811
    		 13c (198)
    Figure US20040038360A1-20040226-P00830
    /GCCTT
  • Identification of the Transcription Start Sites. The identification of transcription start sites was utilized as a prelude to localization and determination of mECT and hECT promoters. Depicted in FIG. 10, (Parts A and B) are the 5′-RACE strategies and resulting 5′-end products obtained from the mouse and human total mRNA. Subcloning and sequencing of the PCR products allowed for the isolation and identification of several clones slightly differing in size but those with the longest 5′-untranslated regions (5′-UTRs) were considered to contain the transcription start sites. Thus, the actual start site for the mECT gene was determined to be 32 bp and for the [0105] hECT gene 44 bp upstream of the ATG translation start codon, as shown in FIG. 10 Part C. The results show that the 5′-untranslated region is entirely situated in Exon 1, indicating that both genes are under control of a single promoter located immediately upstream within the 5′-flanking region. The sequence surrounding the start site including three additional upstream sequence 5′-GGAG(+1)C/TCGCCA/GGGA-3′ (SEQ ID NO: 52) (FIG. 10) are highly homologous between the mouse and human ECT genes also suggesting that proper transcription start sites were determined.
  • Identification of the Transcription Termination Sites and 3′-Untranslated Regions (3′-UTRs). It was also of importance to determine the 3′-UTR in both ECT genes and to establish the location and number of polyadenylation signals in the two genes. The 3′-UTRs were determined by amplifying the 3′-ends of total mouse and human mRNA. The 3′-RACE strategy and [0106] mECT 3′-end products are shown in FIG. 11, Parts A and B. The 3′-RACE results for the mouse and human transcripts are compared in FIG. 11 Part C. The entire 3′-UTR of the mouse transcript was found to be 605 bp and 581 bp from the first nucleotide after the stop codon to the end of the polyadenylation site. A single polyadenylation site (AAUAA) was established 15 bp and 38 bp from the poly(A) tail so that at least two distinct mouse transcripts of 1852 and 1828 bp are possible. 3′-untranslated region (3′UTR) of hECT was 644 bp from the stop codon TAA to the end of the polyadenylation site, producing a transcript of 1831 bp, only 25 bp less than the published cDNA, which is typical variation for transcripts utilizing single polyadenylation site. Further inspection of the 3-UTR sequences showed no additional polyadenylation signals. Furthermore, no consensus sequence motifs (AUUUA) implicated in mRNA instability were present, suggesting that both human and mouse ECT transcripts likely belong to the category of stable mRNAs. Mouse and human 3′-UTRs shows low sequence conservation, but the mouse and rat 5′-UTRs are highly homologous (data not shown). Altogether, we establish that both mouse and human genes utilize single polyadenylation signals producing similar size (˜1.8 kb) transcripts. The presence of longer transcripts is unlikely, supporting the previous Nothern blot analyses of the human and rat ECT when single ˜2 kb products were detected.
  • Tissue distribution and enzymatic activity of mECT. Tissue expression of mECT mRNA was determined using RT-PCR by amplifying the region spanning the last exon and part of the 3′-UTR of mECT, i.e., from 962 to 1285 bp, which does not distinguish the two ECT isoforms. The housekeeping gene for G3PDH was employed as an internal control to correct for the variations in total mRNA used in each reaction. Several tissues, including liver, heart, brain, adipose, skeletal muscle, lung, spleen and kidney were isolated from C57/BL/J6 mice and the mECT mRNA expression and enzyme activity analyzed. As shown in FIG. 12 Part A, similar expression of mECT mRNA, arbitrarily taken as 1-fold, was obtained in several tissues, including the adipose tissue and lungs, while in the liver (1.5-fold) and kidneys (1.3-fold) the mECT mRNA was the most abundant. The lowest expression of mECT mRNA was observed in skeletal muscle (0.48-fold) and brain (0.37-fold). [0107]
  • Distribution of ECT mRNA in human tissues was initially published and the human form of ECT had a similar pattern of expression, with the highest abundance in the liver, kidneys and lungs, lower expression in skeletal muscle, heart and brain, and no detectable expression in human placenta We further investigated the expression of hECT in several human cell lines (FIG. 12 Part B). A region (134 to 562 bp) contained within both the full-length and truncated hECT transcripts was amplified, for a better comparison with the previous data and with the mouse data in FIG. 12 Part A. Total mRNA from cell lines DU145 (prostate), THP-1 (monocytes), HepG2 (liver), U937 (monocytes), U937+TPA (differentiated to macrophages), and Kelly (neurons) were amplified and normalized with human β-actin as an internal control. Conditions shown in FIG. 12 are in the linear range of mRNA concentration and number of PCR cycles (data not shown). Results show that, contrary to the mouse brain tissues (FIG. 12 Part A and human brain tissues, human neuronal cell line Kelly showed high expression of hECT mRNA (2.1-fold). Liver hepatoma cells HepG2 (1.87-fold) showed enhanced expression as was the case in normal liver (FIG. 12 Part A). The expression pattern in blood cells was dependant on the type of cell transformation (THP-1 vs. U937 or 0.74: 1.8) and the stage of cell differentiation (undifferentiated U937 vs. phorbol ester differentiated U937, or 1.8: 0.85) (FIG. 12 Part B). [0108]
  • Cellular homogenates of several mouse tissues were also examined for the enzymatic activity of ECT (FIG. 12 Part C). The highest activity was observed in adipose tissue, spleen and kidneys (FIG. 12), corresponding to the high levels of expression of mRNAs in those tissues (FIG. 11 Part B). The activity detected in other tissues as the brain and skeletal muscle was significantly lower but coincided with their lower mRNA levels. The ECT enzymatic activity in the liver and lungs was slightly lower than anticipated from the mRNA abundance. Overall, the mECT mRNA expression in the ten tissues examined varied from 0.37 (skeletal muscle) to 1.5 (liver) or approximately 4-fold (FIG. 12 Part A). The high mRNA values agree with the high ECT activities in the adipose tissue, lungs, liver and kidneys (FIG. 12 Part C) but the change in the activity, from 4 nmol/min/mg in the muscle to 8 nmol/min/mg in adipocites (2-fold), is not as dramatic as changes in the mRNA levels (4-fold). Taken together, the expression and activity data show that, although ubiquitously expressed, ECT could have distinct, tissue-specific functions regulated by mechanisms at both transcriptional and post-transcriptional levels. [0109]
  • Analysis of the mouse and human ECT promoters. After performing 5′-RACE to determine the transcription start site, a fragment of 600 bp from the 5′-flanking region of the mouse gene was isolated, sequenced, and subcloned into the promoterless pGL3-basic luciferase reporter vector. In addition, computer searches were performed to characterize the parental mouse clone and the human 5′-flanking region for the presence of putative regulatory elements required for the promoter activity as shown in FIG. 15. Homologous ECT promoters from other species are not known, nor has the hECT promoter been initially characterised. Not surprisingly, the mECT promoter has a unique DNA sequence of low similarity to the human promoter and to existing eukaryotic promoters. The regions around the transcription start sites do not contain the canonical TATA box commonly found in other promoters, but both mouse and human promoters contain a conserved CAAT box positioned at the matching distance (−85/−70 bp) from the transcription start sites. Furthermore, the transcription start sites, GGAG(+1)C/TCGCCA/GGGA, are highly conserved and although the rest of the sequence show low homology, a high conservation in the core consensuses for the transcription factors CAAT, Sp1 and NF1 were also detected. Based on the promoter structure and the widespread expression (FIG. 12), mECT and hECT could readily be considered housekeeping genes. However, mECT is highly expressed in several tissues including adipocites, lungs, kidneys, and liver and is low in skeletal muscle and brain (FIG. 12). hECT is downregulated during monocyte/macrophage differentiation by phorbol esters and by tumourogenesis (FIG. 12), all suggesting that ECT promoters could be tissue specific and subject to regulation under particular physiological conditions. Transcription factors that could be involved in such regulation include Ap1/CREB and Ap2, hepatic and adipocite nuclear factor cEBPβ, muscle differentiation factor MyoD, and the group of factors involved in growth and development such as CAAT-binding factors NFY and USF1/2, GC-binding Sp factors and NF1. [0110]
  • Finally, promoter activity of the mouse ECT gene was determined using luciferase reporter assays as shown in FIG. 13. The luciferase reporter activity was measured in mouse fibroblasts C3H19T1/2 and human MCF-7 breast cancer cells. The activity of the mECT promoter is similar to that of the Simian virus SV-40 promoter (pGL3-control) in MCF-7 cells and 13-fold higher in C3H10T1/2 cells, indicating that an active promoter has been isolated. mECT promoter was also compared to the mCCTα promoter initially extensively characterized by the inventors, and by others. As expected from the fact that they are both mouse promoters, the mECT and mCCTα promoters were 14-fold more active in the mouse C3H19T1/2 cells than in the human MCF-7 cells. Relative luciferase activities for the mECT promoter increased from 0.9±0.1 in the human MCF-7 cells to 13.3±4 in the mouse C3H10T/1/2 cells and for the mCCTα promoter from 2.2±0.9 to 29±3.4 (FIG. 13). We conclude that the mECT promoter is a strong promoter that could drive a high expression of ECT in most tissues examined in FIG. 12 Part A and although not as strong as the mCCTα promoter could drive the expression of heterologous genes more that the viral promoter SV-40 (FIG. 13) and can replace the viral promoters in most of their applications. [0111]
    • Discussion
  • This Example describes the first characterization of the genomic structure and function of mammalian genes for ECT. We cloned the mouse ECT gene and demonstrate that alternative splicing of an internal exon results in the production of two ECT variants, the longer, predominantly mouse variant ECTa and shorter, predominantly human variant ECTb. We compare mouse and human genes and their promoters and reveal that the two genes are structurally conserved and similarly regulated. [0112]
  • The mECT gene contains 14 exons distributed among approximately 8.2 Kb and shows high similarity in both size and organization to the human gene. Both genes display a distinct pattern of exon/intron organization typically seen in genes that have undergone duplication events, as initially hypothesized from the structure of the hECT cDNA. The first half of the mouse gene (six exons) is similar to the exons 8-14 distributed in the second half of the gene. The two halves encode two separate catalytic domains, each having the cytydilyltransferase catalytic site HXGH, located at the beginning of Exon 2 (5[0113] th to 8th position) and at the start of Exon 9 (1st to 4th position). In the mECT gene, the two catalytic domains are separated by an internal exon encoding a 17-aa peptide, the function of which is unknown but could be involved in protein folding and catalysis.
  • The human ECT gene is also organized into two halves except that the internal exon is specifically spliced producing a shorter transcript. Paradoxically, we noticed that the human gene still contains the same number of exons as the mouse gene even though the shorter transcript was produced. By aligning the human gene with the cDNA sequence we were able to demonstrate that the human gene is additionally spliced at its 3′-end producing the same number of exons as in the mouse gene. This additional splicing event occurs between the [0114] exons 13 and 14 and is not present in the mouse gene, suggesting that the human 3′-end region has probably evolved since the divergence of humans and mice. The additional splicing does not affect the size of the human C-terminus but the amino acids differ significantly from the amino acids at the mouse ECT C-terminus. The importance of those differences at the C-terminus is not obvious at present but could add to the structural divergence between the human and mouse ECT proteins already produced by alternative splicing of the internal exon. Whether the C-terminus in combination with the presence/absence of the central peptide has any functional significance, is not apparent at the present.
  • The presence of different internal sequences between the rat and human ECT cDNAs, was initially attributed to interspecific variations. In the instant invention, only after determining the structure of the mouse ECT gene was it clear that the internal peptide sequence is encoded by a separate exon, which explained the production of different cDNAs in mouse/rat and humans by alternative splicing. Searches through ESTs databases supported the instant invention, and transcripts of both splice variants, the longer ECTa and the internally spliced ECTb, were detected in most species. The majority of mouse ESTs are predominantly of the ECTa type but some ECTb forms are also found (BQ890906, BU557590, BG862264, BF533931, BF234094). Conversely, human ESTs are predominantly of the ECTb type but unspliced ECTa transcripts are also present (BQ652247, BG760479, B1761073, BM927716). Other species, like chicken ([0115] Gallus gallus) produce the spliced ECT variant almost exclusively, while Lewin Cattle (Bos taurus) has both unspliced and spliced transcripts of similar frequency. Interestingly in tailbud Ciona intestinalis and fruit fly Drosophila melanogaster the unspliced transcripts were detected in gonads, while other tissues predominantly contained the spliced isoform.
  • What is the impact of generating two ECT transcripts across widely divergent species? Is it more to produce two enzymes of different activity during development and cell growth or is it a mechanism for controlling the subcellular localization of ECT, the mechanism commonly used with a number of other proteins. Further, the highly conserved splicing of ECT can be said to have a general cellular function, for example as an important molecular mechanism for the regulation of PE production under distinct metabolic conditions. [0116]
  • Recent completion of the human and mouse genome projects allowed the precise mapping of the two genes. The human ECT gene is located at Chromosome 17q25.3, close to the marker RH44900 which has been assigned a position within the [0117] hECT 3′-UTR. Further downstream from the hECT gene is a mRNA of yet unidentified function, named LOC256933. Upstream from the hECT gene is SYRT7 or sirtuin silent mating type information regulation 2 homologue 7 (S. cerevisiae). SYRT7 is the last gene positioned at the longer arm of the chromosome 17, the closest to the chromosome end. This gene belongs to the sirtuin family of proteins and is homologous to the yeast Sir2 protein. The functions of SYRT7 have not yet been determined but studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity.
  • The mouse ECT gene is located at [0118] Chromosome 11, but because the mouse genome project has been completed only recently the precise location of the mECT gene remains uncertain. The other already placed genes (>240) and at least as many yet unplaced genes are from the human Chromosome 17, which suggests that the mouse Chromosome 11 has a broad region of conserved synteny with the human Chromosome 17. The invention characterizes a BAC clone upstream from the mECT gene and found that it contains the mouse homologue of SYRT7 (data not shown) suggesting that the region surrounding the ECT gene is also preserved between the mouse and humans and likely similarly positioned at the very end of the long arm of Chromosome 11.
  • The resemblance in tissue expression profiles of the mouse ECT gene in FIG. 12 and human ECT gene suggest similar regulation of the two genes. We report here that transcription of both genes occurs under control of an inverted CAAT box located at the conserved distance, 70-80 bp upstream of the transcription start site and that both promoters share GC-rich regions commonly associated with widely expressed genes. Our data suggest that ECT gene could be tissue-specific and differently regulated during development, cell growth, and tumorogenesis. The ECT promoter structure suggests that ECT transcription is likely coordinated through a network of transcription factors of the Sp1/Kriippel-like family, CAAT/cEBP, NF1 and CAAT/NFY/UCF families and that the complexity of controls probably ensures adequate levels of ECT transcripts in response to metabolic requirements for PE, or other tissue- or cell-specific signals. Those factors have divergent binding and transactivation properties and their exact roles in phospholipid homeostasis are largely unknown. [0119]
  • In conclusion, we isolated mECT cDNA and genomic clones for mECT also containing 5′-regulatory promoter regions. We obtain new information on the structure and expression of the mouse and human ECT genes and reveal that the splicing of an internal exon generates two distinct ECT transcripts, which is evolutionary conserved. We have analysed human and mouse promoters and defined putative regulatory mechanisms for the basal and tissue-specific transcription of the mECT gene. These experiments are of critical importance for understanding the nuclear programs for this major regulatory gene in de novo biosynthesis of PE and its integration into complex regulation of lipogenic genes. [0120]
  • Further, the invention relates to knockout of the ECT gene. [0121]
    • Example 5 Production of the CTP:Ethanolaminephosphate Cytidylyltransferase (mECT) Specific Antibody
  • Peptide Synthesis. ECT-specific polyclonal antibodies were produced by using an ECT unique peptide. The ECT peptide was synthesized by means of the simultaneous multiple peptide synthesis using standard strategies. Coupling was performed using 3-6 equivalents Fmoc-aminoacid/HOBt/TBTU and 6-12 equivalents of N-methylmorpholine on the Tentagel™ HL RAM resin (RAPP Polymere GmBH, Germany) loading as 0.38 mmol/g resin. The amino acid protecting groups used are: Cys (Trt), Arg (Pbf), Ser(But), Thr (But), Tyr (But), Asp (Obut), Glu (Obut), Asn (Trt), Gln (Trt), Lys (Boc), His (Trt), Trp (Boc). Peptides were deprotected and cleaved from the resin by trifluoroacetic acid (TFA)/thioanisole/thiocresol (95:2,5:2,5) in 3 h by adding 3% triisopropylsilane to the column, mixing for 10 min and adding 5% Me[0122] 3SiCl for 1 hour.
  • Analytical analyses were performed by HPLC instrument Shimadzu LC-9A with photodiode array detector SPD-M6A. Analytical column was Jupiter, Phenomenex™, 5 [0123] μm C18 300 Å (250×4.6 mm) and solvent used were: A−0.05% TFA in water, solvent B=0.05% TFA in 80% CAN/water; flow: 1,0 ml/min and a linear gradient of 2.5% B/min and detection at 220 nm. Preparative analyses were performed at HPLC Shimatzu™ LC-8A with uv-vis detector SPD-6a, Phenomenex™, 10 μm, 300 Å (250×21,2 mm) column and solvent systems as described above with corresponding gradient in 30 min, flow 15 ml/min and detection at 220 nm.
  • The structure of the ECT peptide is CTKAHHSSQEMSSEYRE-amide (SEQ ID NO: 53). The peptide is the same in human, mouse and rat ECT proteins. An HPLC chromatogram for the ECT synthetic peptide is shown in FIG. 16. The peptide mass was characterized by MALDI-TOF mass-spectrophotometry by means of a [0124] MALDI 2 DE Instrument, Shimadzu, Japan in linear mode. Calculated average Mw mass was the same as found Mw mass of 2010. A typical peptide peak was shown in FIG. 16. It is obtained at the analytical column Phenomenex, 5 μm C18 300 Å, with 5-80% gradient of solvent B in 30 min.
  • FIG. 16 illustrates an HPLC chromatogram of ET peptide used for the production of ET antibody. [0125]
  • Rabbit Immunization Protocol. The immunization has been carried out according to standard protocols. Two rabbits, labelled #4648 and #4649 were immunized by the ECT-specific peptide conjugated to Limulus polyphemus hemocyanine. [0126]
  • Rabbit #4649g was immunized three times and bleed before (1.5 ml+0.02% thimertosal) and after the third immunization (total of 25 ml antiserum preserved by 0.02% thimerosal). The rabbit was immunized once more and specific IgG (0.235 g/7 ml) isolated from 25 ml antiserum and stored in Tris-Glycine buffer pH 7.5, 250 mM NaCl, containing 0.02% [0127] thimerosal Rabbit #4648g was immunized six times and bleed before (1.5 ml+0.02% thimertosal) and after the third and sixth immnunization (total of 25 ml antiserum was isolated and preserved by 0.02% thimerosal). The rabbit was immunized once more (7 times in total) and specific IgG isolated from 25 ml antiserum and stored in Tris-Glycine buffer pH 7.5, 250 mM NaCl, containing 0.02% thimerosal.
  • Titer Determination. Well-plates were covered overnight at 4° C. by 100 μl/well of antigen (10 μg ECT peptide-BSA-conjugate) in 0.05 M carbonate buffer, pH 9.5. Blocking was performed by rinsing the wells twice with phosphate-buffered saline (PBS) and by further incubation on a shaker with 200 μl PBS containing 1% fetal calf serum for 30 min at room temperature. After three washes by 300 μl of TBSTR (0.05% TritonX-100 in Tris-buffered saline) the antisera and pre-immune sera were added at different dilutions (100 μl/well) and incubated on a shaker for 1 hour at room temperature. TBS-TR was used as a blank. Dilutions for the pre-immune sera were 1/100, 1/300 and 1/900. Dilutions for the ET antisera were 1/100/1/300, 1/900, 1/2700, 1/8100, 1/24300, 1/72900, 1/218700 in TBSTR. The tests were performed for the antisera from both, #4648 and #4649 rabbits. [0128]
  • After 5×300 μl washes with TBST, species specific conjugate, 100 μl/well, of anti-rabbit-peroxidase conjugate, 1:15000 diluted in TBSTR, was added and incubated on a shaker for 1 hour at room temperature. After 5×300 μl more washes with TBSTR, the each well was given 100 μl of freshly prepared mixture of 0.05% hydrogen peroxide, 0.05 M sodium acetate, pH 4.5, 0.12 mg/ml tetramethyl benzidiene. The enzymatic reaction was stopped after 15 min by adding 100 μl/well of 0.5 M sulphuric acid and the absorption of a yellow solution measured in a 12-channel spectrophotometer at 450 nm (with reference wavelength 630 nm). Titers (the titer: serum dilution with A[0129] 450, serum=2 A450, Blank) for #4648g were 1:1000 and for #4649 1; 50000 (FIG. 17) and for #4648g were 1:1000 (FIG. 18). The respective pre-immune serum titers were 1:100 for #4648 and 1:300 for #4649.
  • FIG. 17 illustrates titration curves of the immune antiserum isolated from rabbit #4649g relative to its preimmune serum (4649 pre). FIG. 18 shows titration curves for the immune serum isolated from the immunized [0130] rabbit #4648g relative to its preimmune serum (4648 pre).
  • Purification of the ECT specific antibody by immunoaffinity chromatography. The antiserums tested above (#4648 and #4649, both ET specific IgGs) were loaded to the columns (Amersham Bioscience) containing the immobilized ET peptide antigen. Columns were washed first with TBS (50 mM Tris, 150 mM NaCl), [0131] pH 7,5, followed by TBS (20 mM Tris, 2 M NaCl), pH 7,5, and TBS (50 mM Tris, 150 mM NaCl). The columns were than connected to a photometer (Pharmacia LKB Uvicord SII; OD280nm) and a coupled printer (Pharnacia LKB Rec 102) and washed with TBS (50 mM Tris, 150 mM NaCl), pH 7,5, until the baseline of the elution-profile is reached. The specific bounded IgG fraction is eluted with 0,2 M Glycin/HCl, pH 2,2, 250 mM NaCl. For a fast neutralisation of the eluates the elution tubes containing a small amount of 1M Tris/HCl, pH 7,5 were used. If necessary the pH is adjusted to a pH of 7,2-7,4 with 1 M Tris/HCl, pH 7,5. The antibody concentrations were calculated from OD275/280 ratio taking into account that 1 mg IgG/ml corresponds to 1,42 OD275 or 1 mg IgG/ml corresponds to 1,35 OD280.
  • When the antibody concentration was lower than 100 μg/ml, either 10% BSA (final concentration: 0,2% BSA;) or 1,25 M Trehalose (final concentration: 250 mM) is added for stabilizing to the antibody solution. BSA disturbs the conjugation and coupling of the antibodies and to a microtiterplate. The antibody solution is stabilized with 0,02% Thimerosal or NaN[0132] 3 and stored at 4° C. ET specific IgGs were prepared from 25 ml antiserum and stored in Tris-glycine buffer pH 7.5+250 mM NaCl+0.02% thimerosal and at −20° C.
  • The above-described embodiments of the present invention are intended to be examples only. Alterations, modifications and variations may be effected to the particular embodiments by those of skill in the art without departing from the scope of the invention, which is defined solely by the claims appended hereto. [0133]
    • REFERENCES
  • 1. Bazzi, M. D., Youakim, M. A., and Nelsestuen, G. L. (1991) Biochemistry 31, 1125-1134. [0134]
  • 2. Bogdanov, M., Umeda, M., and Dowhan, W. (1999) J. Biol. Chem. 274, 12339-12345. [0135]
  • 3. Engelmann, B., Schaipp, B., Dobner, P., Stoechelhubert, M., Kogl, C., Siess, W., and Hermetter, A. (1998) J. Biol. Chem. 273, 27800-27808. [0136]
  • 4. Gilbert, G. E., and Arena, A. A. (2000) J. Biol. Chem. 270, 18500-18505. [0137]
  • 5. Smimov, M. D., Triplett, D. T., Comp, P. C., Esmon, N. L., and Esmon, C. T. (1995) J. Clin. Invest. 95, 309-316. [0138]
  • 6. Mileykovskaya, E., Sun, Q., Margolin, W., and Dowhan, W. (1998) J. Bacteriol. 180, 4252-4257. [0139]
  • 7. Emoto, K., Kobayashi, T., Yamaji, A., Aizawa, H., Yahara, I., Inoue, K., and Umeda, M. (1996) Proc. Natl. Acad. Sci. 93, 12867-12872. [0140]
  • 8. Emoto, K., Toyama-Sorimachi, N., Karasuyama, H., Inoue, K., and Umeda, M. (1997) Exp. Cell Res. 232, 430-434. [0141]
  • 9. Ellens, H., Siegel, D. P., Alford, D., Yeagle, P. L. Boni, L., Lis, L. J., Quinn, P. J., and Bentz, J. (1989) Biochem. 28, 3692-3703. [0142]
  • 10. Aoki, Y., Uenaka, T., Aoki, J., Umeda, M., and Inoue, K. (1994) J. Biochem. 116, 291-297. [0143]
  • 11. Menon K. A., and Stevens, I. V. (1992) J. Biol. Chem., 267, 15277-15280. [0144]
  • 12. Menon, K. A., Eppinger, M., Mayor, S., and Schwarz, T. R. (1993) EMBO J., 12, 1907-1914. [0145]
  • 13. Kamitani, T., Menon, K. A., Hallaq, Y., Waren, D, C., and Yeh, T. E. (1992) J. Biol. Chem., 267, 24611-24619. [0146]
  • 14. Hong, Y., Maeda, Y., Watanabe, R., Ohishi, K., Mishkind, M., Riezman, H., and Kinoshita, T. (1999) J. Biol. Chem., 274, 35099-35106. [0147]
  • 15. Van den Bosch, H., Schutgens, R. B. H., Wanders, R. J. A., and Tager, J. M. (1992) Annu. Rev. Biochem. 61, 157-197. [0148]
  • 16. Jira, W., and Spiteller, G. (1996) Chem. Phys. Lipids. 79, 95-100. [0149]
  • 17. Falbrook, A., Tur, 1-8. enne, S. D., Mamalias, N., Kish, S. J., and Ross, B. M. (1999) Brain Res. 834, 207-210. [0150]
  • 18. Xu, L., Byers, M. D., Palmer, C. St. B. F., Spence, W. M., and Cook, W. H. (1991) J. Biol. Chem., 266, 2143-2150. [0151]
  • 19. Snyder, F. (1985) In Biochemistry of Lipid and Membranes (Vance, D. E. and Vance, J. E. Eds.) pp 271-298, Benjamin Commings Publishing Co., Menlo Park, Calif. [0152]
  • 20. Porter, T. J., and Kent, C. (1990) J. Biol. Chem. 265, 414-422. [0153]
  • 21. Lee, T. C. (1998) Biochim. Biophys. Acta, 1394, 129-145. [0154]
  • 22. Datta, S. N., Golder, N. G, Wilson, N., and Hajra, K. A. (1984) New EngI. J. Med., 311, 1080-1083. [0155]
  • 23. Schrakamp, G., Schutgens, H. B. R, Wanders, A. J. R. Heymans, A. S. H., Tager, M. J. and Van den Bosch, H. (1985) Biochim. Biophys. Acta, 833, 170-174. [0156]
  • 24. Ravandi, A., Kuksis, A., and Shaikh, A. N. (1999) J. Biol. Chem., 274, 16494-16500. [0157]
  • 25. Ishidate, K., Iida, K., Tadokoro, K., and Nakazawa, Y. (1985) Biochim. Biophys. Acta. 833, 1-8. [0158]
  • 26. Tadokoro, K., Ishidate, K., and Nakazawa, Y. (1985) Biochim. Biophys. Acta. 835, 501-513. [0159]
  • 27. Uchida, T., and Yamashita, S. (1992) J. Bio. Chem. 267, 10156-10162. [0160]
  • 28. Aoyama, C., Nakashima, M., Matsui, M., and Ishidate, K. (1992) Biochim. Biophys. Acta. 1390, 1-7. [0161]
  • 29. Aoyama, C., Yamazaki, N., Terada, H., and Ishidate, K. (2000) J. Lipid Res. 41, 452-464. [0162]
  • 30. Vermeulen, P. S., Geelen, M. J. H., Tijburg, L. B. M., and van Golde, L. M. G. (1997) Advances in Lipobiology. 2, 287-322. [0163]
  • 31. Polokoff, M. A., Wing, D. C., and Raetz, C. R. H. (1981) J. Biol. Chem. 256, 7687-7690. [0164]
  • 32. Vance, J. E., and Vance, D. E. (1992) J. Biol. Chem. 263, 5898-5909. [0165]
  • 33. Hjelmstad, R. H., and Bell, R. M. (1991) J. Biol. Chem. 266, 5096-5103. [0166]
  • 34. Henneberry, A. L., and McMaster, C. R. (1999) Biochem. J. 339, 291-298. [0167]
  • 35. Tijburg, L. B. M., Houweling, M., Geelen, M. J. H., and van Golde, L. M. G. (1987) Biochim. Biophys. Acta. 922, 184-190. [0168]
  • 36. Vermeulen, P. S., Geelen, M. J. H., and van Golde, L. M. G. (1994) Biochim. Biophys. Acta. 1211, 343-349. [0169]
  • 37. Van Hellemond, J. J., Slot, J. W., Geelen, M. J., van Golde, L. M., and Vermeulen, P. S. (1994) J. Biol. Chem. 269, 15415-15418. [0170]
  • 38. Vermeulen, P. S., Tijburg, L. B. M., Geelen, M. J. H., and van Golde, L. M. G. (1993) J. Biol. Chem. 268, 7458-7464. [0171]
  • 39. Min-Seok, R., Kawamata, Y., Nakamura, H., Ohta, A., and Takagi, M. (1996) J. Biochem. 120, 1040-1047. [0172]
  • 40. Nakashima, A., Hosaka, K., and Nikawa, J. (1997) J. Biol. Chem. 272, 9567-9572. [0173]
  • 41. Bladergroen, B. A., Houweling, M., Geelen, M. J. H., and van Golde, L. M. G. (1999) Biochem. J. 343, 107-114. [0174]
  • 42. Bork, P., Holm, L., Koonin, E. V., and Sander, C. (1995) Proteins 22, 259-266. [0175]
  • 43. Bladergoen, B. A., Houweling, M., Geelen, M. J. H., and Van Golde, L. M. G. (1999) Biochem. J., 343, 107-114. [0176]
  • 44. Sugumoto, H., Bakovic, M., Yamashita, S., and Vance, D. E. (2001) J. Biol. Chem. 276, 12338-12344. [0177]
  • 45. Mallampalli, R. K., Ryan, A. J., Salome, R. G., and Jackowski, S. (2000) J. Biol. Chem. 275, 9699-9708. [0178]
  • 46. Lykidis, A., Baburina, I., and Jackowski, S. (1999) J. Biol. Chem. 274, 26992-27001. [0179]
  • 47. Lykidis, A., Murti, K. G., and Jackowski, S. (1998) J. Biol. Chem. 273, 14022-14029. [0180]
  • 48. Bladergroen, B. A., and van Golde, L. M. G. (1997)) Biochim. Biophys. Acta. 1348, 91-99. [0181]
  • 49. Kikuchi, K., Sakai, K., Suzuchi, T., and Takama, Z. (1999) Comp. Biochem. Physiol. 124B, 1-6. [0182]
  • 50. Xu, L., Byers, M. D., Palmer, C. St. B. F., Spence, W. M., and Cook, W. H. (1991) J. Biol. Chem. 266, 2143-2150. [0183]
  • 51. Lee, T. (1998) Biochim. Biophys. Acta. 1398, 129-145. [0184]
  • 52. Mount, S. M. (1982) Nucleic Acid Res., 10, 459-472. [0185]
  • 53. Lania, L., Majello, B., and DeLuca, P. (1997) Int. J. Biochem. Cell Biol. 29, 1313-1323. [0186]
  • 54. Bakovic, M., Waite, K. A., and Vance, D. E. (2000) J. Lipid Res. 41, 583-594. [0187]
  • 1 53 1 7188 DNA Mus musculus 1 atgatccgga acgggcacgg ggctgccagc gctgctgggc tgaagggtcc gggagatcag 60 cgcatcgtgc gggtgtggtg cgatggctgg tgagtggggc gacgagggga gggcggtcac 120 ctgggcgtca cgcaccggcc gttggcggaa ccggagtctt ccgaggccgc acgaggcaac 180 ctggcctccg gtcacttagg agtgtagcgt acagacacgg gtgcatcaga cggtgcgctc 240 cccgaaaacc ggaaatgcgg ctgtctgttc gccttgggca tttacccaaa ttacctgggc 300 tggaaggctg tgagcttctc tggcaaatca gcccgtgacg tctccaagaa agtcctggag 360 ctgtcaacaa gccgaagaga taagatgttg gcctttctat aacttaccat cttcagccct 420 tcgtcgtgcc tacccctggt ggatgagagg cattcggaat ggtcaccagg gctcctcagg 480 gcattcatgg cggaataggc tagactttgt gcgtttcttg tttgtctttg gttggttgct 540 gaggatggga accatagcct tgtgtgctat atatgtacag gcaagtgctc catcactgaa 600 ttacaacttc agtccccttc tgttcttttg cacctgagtc accagctttg acttcgtgtc 660 agtggactat gaccttggcc ccaccatggt gcctcaagcc cagatgcaga ctctgacctt 720 tgatctagcc ctgcctgtct agtgggcaca agggctgtcc tggaatttgc ccgttatcat 780 gtcccacctc ccaccccgtg cactgtggtg ttgacatgat gatagcccac tagggctcta 840 gaggaagcag agcagaacct atggcccagc actggcccat ggcaaagaat acaggtggtc 900 ccagggatat cccactggga tatcctcagt gtccagcata ttgctggctt ctgcatagct 960 tgaccttgac aaagtacttg tggccagacc tagatttgag gataaaagca ggtgacaggc 1020 acttgttctc tcagagagct aagccagccc tgggggtggg gaactgtcca cttgtgtcag 1080 ggtggaagta tctgctccca atgcaggact gatctcttgg ttccaagctt gagtgtggct 1140 tgttgatcca gggggactat tcttgtttag ggtgcaggag gttccatatt caaatcctag 1200 ataatctctt gtatcttgcg ggctgggagt gtagctagct cagctggtat tatgctggcc 1260 cagcatgcac aaggtcctac atttgttttg tagcacccaa cagttggctt tgggtgggaa 1320 tctcagcaga tggagtcaga agggttgaga gctgaaagtc gccgggcgtg gtggtataca 1380 cctttaatcc cagaatttgg gaggcagagg caggcagatt tctgagttca aggtcagcct 1440 ggtttacaaa gtaagttcca ggacagaaaa aaaagggtca agagttgaag gtcgtcctag 1500 gttttatagt gagtttgagg ccagcctggg ctacatgaga ccttattgtc ttaaaaaaaa 1560 aaaaaaagaa aaaaagaaaa aaagaaaaag atctgaagca gcttgaaatg cctgcccata 1620 gcaggaggca ccaacagggc aaaggcagtc taagacatgg gaaatggtta agcatctgcc 1680 agtgaacagc tgtcttggga gttcaccagc caggccttgt acctgaattt gccactcttg 1740 ctagacctgg cacccagtcc tgccctaggt ccagtactta gggtatggac aactgagaac 1800 cgacttctct gctgtaagcc caacaccggg atctgggcta ggagccctgg tgggggcctc 1860 tcagggagcc gtgctgcatc ccacacaaga ccctcagtct cctgtctgtc ctcacagcta 1920 tgacatggtg cattatggcc actccaacca gctacggcag gcacgggcca tgggggacta 1980 cctcatcgtg ggtgtgcata cggatggtaa ggtggggccc gatgtgccgg acagtccaat 2040 ggattaagcc tacagggcat ggggtggggc agaggggcgg gcagaatggt tccagcttcc 2100 ttccccagag cacagtggtg actcagggag cttagagagt aacatagcct ggtaccagct 2160 atagagagct gtggcaacac aggacagctg tattgtctgc ccctaccccg gttcttgaaa 2220 cagaagagac tgaaccctct tcttagttat ccagcagatg cccccgagca cacgccctgg 2280 ccaaaggaca atgctgttgg cacggggccc tgccttgtgg gcataccatt tgcacactgc 2340 agccttgcga cccagactcc tggacatcac ttaccttgtc ttgtcctttt ctctgtccct 2400 agaggagatt gccaagcata aggggccccc ggtgtttacc caggaggaga ggtacaagat 2460 ggtacaggcc atcaagtggg tggatgaggt ggtgcccgct gctccctacg tcaccaccct 2520 ggagacactg gacaagcaca actgtgactt ctctgttcac ggcagtgagt gggcagggtc 2580 tgaggtgggg gctgggcagt cagccctgct gacctagtca cagagacagt gggcttttca 2640 tcttggctca tcctatgcac atgcaaggaa gctctgggac catccccaga gcagtggcaa 2700 agggaaaggg gcccctgggg gctctcagtt aaaaatccct gtttatgcag gagagatggc 2760 tcagcagtta agagcactga tgttcttcca gaggtcctga gttcgattcc tagcaaccac 2820 atggtggctc acaaccatct gtaatggggc tccgatgcct tcttctggta tatctgaaga 2880 cagcaatggt gtacccacat acatgaaata aatgaattaa aaaaatctaa aaaaaaaaaa 2940 aaatttgccg ggcgtggtag cgcatggcac tcaggaggca gaggcaggcg gatttctgag 3000 ttcaaggaca gcctggtcta caaagtgagt tccaggacag ccagggctac acagagaaac 3060 cctgtctcaa aaacccaaaa aaaaaaagaa gaaaaaaaaa cccccaaaaa acaaaccctg 3120 tttatgagcc tagtgtgatg acacataact atcatcttag cattagtact gaggaggctg 3180 aaacgggaca ttaagtgttc tggattagct gggcggtggt ggtgcacgcc tttagttctg 3240 gcacttggga gacagaggca ggtggatttc tgagttcaag gccagcctgg tctataaata 3300 aagtaagttc cagaacagcc aaggttaatc agagaagcct tgttccaaaa agagttccag 3360 gtcaccctgg gatacatagc aagacatgcc ctgcccccct ctcaaaataa caacaaaaca 3420 ggaacaaatc cttttctgtg tgcgtgtcac ctctagatga catcacgctg acagtagacg 3480 gccgagacac ctatgaggaa gtgaagcagg ctgggaggta caggtaggtc cagggagtgg 3540 ggctcaagag gagaccccct gcctagctct ccttgttgct gtgttgacat acataccctg 3600 caaggcattt gggtcctcgg tcaggtgtgg aaagtgcagg acagcatgct ttgtgtgacc 3660 aaccccaggg cctctgcggt gctaccaggc atagctctgc cagatggcag cattctcgat 3720 catcaccgtt tgtaggacat ccttagactc gtagactcgg tagtctcagg tgcccctgga 3780 gagctgcctt tttattttaa ttaactgtaa tttaaagagc cagctgtggc cagtggttcc 3840 tatagggaca gagcagccag gaatgcatat cagggttgcc tgagtgtaat agaggccaga 3900 gggaacaacg ttggaatggg gggggccaga actggtatgt cctcaatgtg acctgcctac 3960 tccctggagt tacgttgtac agctgagtga gcccattgct cctgccccag tctggctttc 4020 tgttgtgggt gggtggtcct gggttagggt tgtgtccctc aggtggcttc tgcctatagc 4080 agagcctcag gattgtcctg gatgaaaacc tccaccttac ctctgtccca gagagtgcaa 4140 acgcacccag ggtgtgtcca ccacagacct cgtgggtcgc atgctgctgg tgaccaaggc 4200 ccatcacagc agccaggtga gtccaaacgg atggggtctg ggatacggtc cctgggctaa 4260 ggacacgggg gagggtgggt gcaggggggg gggtgcacca cctagccacc ctcaggttta 4320 tcccgtttct ctccctgacc aaccccttag tgggctccgg ggccatggcg tgctgggccc 4380 agggttggca gtcaggaggg caaggtccct tagtttcttg cccttgtgtg caggagatgt 4440 cctctgagta ccgggaatat gctgacagtt ttggaaaggt gagtacagcc tggctcgctg 4500 aggccactct ggaaatccag ttgacattcc cacccacccg ttaggcgtcc catggggaaa 4560 ggatggccca aagcttcagt gtctgccctc ctccctctct ttcccagtgc tgaccaggta 4620 ctgaccatca ggcttggcca gctagtggat gctgggaggg aggacaggca agaggtggcc 4680 agtcccagca gccacttctt ggaggaggag caaggactgc ccaccttaca ggtgggatct 4740 aaccaaatgg cctggccctc tctccctttg tagccccctc acccgacacc tgccggggac 4800 acactttcct cagaagtctc ctcccaggtg accagatggt gccctcaggg tgccgggtcc 4860 cccagagggc tgtgtctgct ggccactggg ctctgcgcct gctcctggtg gtgttgccag 4920 gcagagctgg tgttgactgc attatcttct gtggccaccg ggtggagcca cagtcctgct 4980 agctacagtg gtcctgcgtg gccttaccat ggtgtgtccc tgcccctgcc ccaagtgcct 5040 gcctggacac agcccccagc tgtgctgctg ggttattgac aggctggggt ttgggggagt 5100 ccagcctgta atgctctgtg caactcccat cacccacact tacgacaggg gcacagggag 5160 ccctgggccc agaagaatga ccaaggggag ggtactgggt gaggggcaca catagaggcc 5220 tctaccactg actggttcct tctcttgact aacagtgccc tggggggcag agcccctgga 5280 caggggtgtc ccagtttcta cagacatccc agaagatcat ccagtttgct tctgggaagg 5340 agccccagcc cggggagacg gtcatctatg tggctggtgc ctttgacctg ttccgtatcc 5400 tctgctgccc gaagtcatgc ctcagagtgg gacccatagc ctccaaggct ccagggttga 5460 gctgggttgt ggtgggtgcg gccttcacca gggagaatgg cacggggtcc cttgggtgcc 5520 cattgctgtt acctggcctg ctttcctcct ctccatccat ggggttgggg atggagcaca 5580 gggctctgcg tatccgaggc cagtgacctc ttgctgaact acaaccccaa gtcttgctct 5640 cttgagacag aattttcctg tgtagtccag gctgacctag aacttgcaat actcctgcct 5700 ccgccacgca agtgctgggt ttacaagaac accatgatac acagctagtt actgcttctt 5760 aatctggata tagacatcgg gcacgtggac ttcctacagg aggtgcacaa gctagccaag 5820 aggccctacg tcatcgccgg cctacacttt gaccaggtct ctgccctcct ccttgcttgc 5880 ttctcagcac cccgtcagct gatgggccat ggggtccctc aaggggcctt gctggggtca 5940 gtgttgggca caggtggcct ctgaaggact gaggaggctc caggtgcctg cgaaggcaag 6000 cttggctctc ttctggagtc caggacagcc ctgcctaggg tgttcctatg agagggggca 6060 cttttcccag cttctgccca cgacggccag ctgggaggga aggcaccatt catttgaggt 6120 cccccagctg agccaaactc actggcccta ggaagtaaac cggtacaagg gcaagaacta 6180 ccccatcatg aacctgcacg agcggactct cagtgtgctg gcctgccggg taagtgaact 6240 gggagtcagg gccgggcggc tgggccctac tgggtgcagt ttctttcccc tgctgaagga 6300 gtctgagggt cccctttgcc cactggccct ggccgtgtcg ccctgccctg ctggctcccc 6360 tggcctcctc tgccacgctc tagccctcta gctcgccagg gatgaggact gagtgaggtg 6420 cttcactggc tgtgtttccg cagtatgttt cagaagtggt gattggggca ccatactccg 6480 tgacagcgga gctcctgaat cacttcaagg tgaggcttcg ctcaaagttc tcctgagcag 6540 aacatgatgc taatcttcct agaggctctt gcctgcttca gcctgggcca gttttttggg 6600 gtttgggcta gccctaagtg gttgtcagtg gtggcatagc aactctgagg aagtctcctg 6660 accttgctcc ctttccaggt ggacctggtg tgtcacggga agacagagat tgtacccgac 6720 agggatgggt ctgaccccta ccaggtgggt tgcccggcgt gggctgcctc ggggaagtag 6780 gtgcaaccat ccttcctggt attggtctcc catgggtgga gggacagctg ggggtgtctc 6840 tgtggtcagg agacctctca tctcccactt ctcttcccat tgaggcctcc aggagcccaa 6900 gagaagaggc atcttctatc agattgacag tggcagtgac ctcactacag acctgattgt 6960 gcagaggatc atcaagaaca ggtgtgtctc ctcccctccc ctctgccacc ctccccccta 7020 ctgggttggc agtgggcaaa cccccagtat tggagagaac caacctacaa cccgtctggc 7080 cccaggctgg agtatgaagc acggaatcag aagaaagaag ccaaggaatt agcctttctg 7140 gaggccacga agcagcagga ggcgccgcct ggaggggaga ttgactag 7188 2 600 DNA Homo sapiens protein_bind (46)..(55) transcription factor AP4 binding site 2 ccccgagtgg tcggcccggg ctccccgggc tcaggtctgc cgcctggcag ctcggtcgtg 60 gcttaaaact cccttggttg gacaggggac aactgtagat tattgtgcca aaaaataaga 120 aaaaaaactc ccctggttgg gacagcgccc cgtggaggtt cccggaggtg gcggcggtgg 180 gacggtcccc acgccgcact gccccgccag ccgagcgcca ggtgtgggcg gtgcggagag 240 gccaggtgtg ggtcgggggg cggggctcgg aaagcgcggc acacgccatt ggctgtgcgt 300 ttggaggggg cgggactctg tcaggggctc acgccattgg ccgtgcgcgg aggtgcggtg 360 gggcgcggcc ttcggggggt ggggctcggg gcggagggcg ggaggcgggg cgggggaagc 420 gggggctggg ctcgggccga gcgccgaccc attggccgtg cgcagcgggt gaggcccgcg 480 tgacggccgc tgagcgtgcg ctggcggggc gggcggcggc gctcgga gtc gcc ggg 536 Val Ala Gly 1 agc tgc cag gct gct ccg cgc gcc gct gcg ggg cca tga tcc gga acg 584 Ser Cys Gln Ala Ala Pro Arg Ala Ala Ala Gly Pro Ser Gly Thr 5 10 15 ggc gcg ggg ctg cag g 600 Gly Ala Gly Leu Gln 20 3 125 PRT Artificial Sequence Consensus Sequence 3 Met Ile Arg Asn Gly His Gly Ala Ala Gly Ala Ala Gly Leu Lys Gly 1 5 10 15 Pro Gly Gly Gln Arg Val Arg Val Trp Cys Asp Gly Cys Tyr Asp Met 20 25 30 Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met Gly 35 40 45 Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys His 50 55 60 Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val Gln 65 70 75 80 Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val Thr 85 90 95 Thr Leu Glu Thr Leu Asp Asn Asp Val His Asn Asp Leu Thr Val Gly 100 105 110 Arg Asp Tyr Glu Glu Val Lys Gln Ala Gly Arg Glu Cys 115 120 125 4 130 PRT Rat misc_feature (107).. (118) Xaa=unknown or other at positions 107, 109 and 118 4 Met Ile Arg Asn Gly His Gly Ala Gly Gly Ala Ala Gly Leu Lys Gly 1 5 10 15 Pro Gly Gly Gln Arg Thr Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Met Thr Ser Arg Xaa Gln Xaa Met Ala Glu 100 105 110 Ile Pro Thr Arg Lys Xaa Ser Arg Leu Gly Gly Thr Glu Ser Ala Asn 115 120 125 Ala Pro 130 5 130 PRT Homo sapiens 5 Met Ile Arg Asn Gly Arg Gly Ala Ala Gly Gly Ala Glu Gln Pro Gly 1 5 10 15 Pro Gly Gly Arg Arg Ala Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Asp Lys Tyr Asn Cys Asp Phe Cys Val His 100 105 110 Gly Asn Asp Ile Thr Leu Thr Val Asp Gly Arg Asp Thr Tyr Glu Glu 115 120 125 Val Lys 130 6 130 PRT Mus musculus misc_feature (104)..(107) Xaa=unsure or other for positions 104 and 107 6 Met Ile Arg Asn Gly His Gly Ala Ala Ser Ala Ala Gly Leu Lys Gly 1 5 10 15 Pro Gly Asp Gln Arg Ile Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ser Asp Ala Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Asp Xaa His Asn Xaa Asp Trp Ser Val His 100 105 110 Cys Asn Asp Val Val Leu Thr Val Tyr Cys Arg Asp Ser Tyr Glu Glu 115 120 125 Val Lys 130 7 332 DNA Artificial Sequence Consensus sequence 7 attgcgggcg gcggcgttcg gagtcgccgg gagctgccag gctgtccgcg ccgccgctgc 60 ggggccatga tccggaacgg gcgcggggct gcaggcggcg cagagcagcc gggcccgggg 120 gcaggcgcgc cgtgagggtg tggtgcgatg gctgctatga catggtgcat tacggccact 180 ccaaccagct gcgccaggca cgggccatgg gtgactacct catcgtaggc gtgcacaccg 240 atgaggagat cgccaagcac aaggggcccc cggtgttcac tcaggaggag agatacaaga 300 tggtgcaggc catcaaatgg gtggacgagg tg 332 8 311 DNA Homo sapiens 8 gtcgccggga gctgccaggc tgtccgcgcc gccgctgcgg ggccatgatc cggaacgggc 60 gcggggctgc aggcggcgca gagcagccgg gcccgggggg caggcgcgcc gtgagggtgt 120 ggtgcgatgg ctgctatgac atggtgcatt acggccactc caaccagctg cgccaggcac 180 gggccatggg tgactacctc atcgtaggcg tgcacaccga tgaggagatc gccaagcaca 240 aggggccccc ggtgttcact caggaggaga gatacaagat ggtgcaggcc atcaaatggg 300 tggacgaggt g 311 9 223 DNA Homo sapiens 9 gggcccgggg ggcaggcgcg ccgtgagggt gtggtgcgat ggctgctatg acatggtgca 60 ttacggccac tccaaccagc tgcgccaggc acgggccatg ggtgactacc tcatcgtagg 120 cgtgcacacc gatgaggaga tcgccaagca caaggggccc ccggtgttca ctcaggagga 180 gagatacaag atggtgcagg ccatcaaatg ggtggacgag gtg 223 10 225 DNA Homo sapiens 10 ccgggcccgg ggggcaggcg cgccgtgagg gtgtggtgcg atggctgcta tgacatggtg 60 cattacggcc actccaacca gctgcgccag gcacgggcca tgggtgacta cctcatcgta 120 ggcgtgcaca ccgatgagga gatcgccaag cacaaggggc ccccggtgtt cactcaggag 180 gagagataca agatggtgca ggccatcaaa tgggtggacg aggtg 225 11 35 DNA Mus musculus 5′UTR (1)..(32) Region at 5′ end of mature transcript not translated 11 gccgccagga tttgcggggg gcctccggtg ccatg 35 12 47 DNA Homo sapiens 5′UTR (1)..(38) Region at 5′ end of mature transcript not translated 12 gtcgccggga gctgccaggc tgtccgcgcc gccgctgcgg ggccatg 47 13 586 DNA Mus musculus 3′UTR (6)..(586) Region at 3′ end of mature transcript not translated 13 actagcttca gacccggaga tgttgttcac gcccttgccc tgtgcccacc tcttctcttc 60 ctgcccggct ctgcttctgt gtcttgatgt cagctcacac aattccaaag gaaactggcc 120 ttgctgaggg tgctgcctgc ctgcgaggca cctgccttgc agcaggctct cagcccttcc 180 ctctgagctg ctcagagagg gtagctagcc caatgatgtg gcccgtggac aggataagca 240 gatgcacctg tgactgactg gaggcgtgtt gctgtgtatc ccgggcatcc atgggttcca 300 actgccactg ccccagtctt ggccagagat acccctcctg cctgactgga agctgcacat 360 ctgcccactg agctttggtg aaaggtccag aggctttggg gacctctgtt cctgggccac 420 cctgcccgtg ggcaccctct accttggggc acgttctagc accccattcc tgactcctgg 480 aagatgcact tgccccgaca gctgggcagc acggctgtcc tctgcagaga ctgcctggtc 540 ctcattgtac tttggtggct caactgaata aagccttgtg ggaagc 586 14 404 PRT Rat 14 Met Ile Arg Asn Gly His Gly Ala Gly Gly Ala Ala Gly Leu Lys Gly 1 5 10 15 Pro Gly Gly Gln Arg Thr Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Asp Lys His Asn Cys Asp Phe Cys Val His 100 105 110 Gly Asn Asp Ile Thr Leu Thr Val Asp Gly Arg Asp Thr Tyr Glu Glu 115 120 125 Val Lys Gln Ala Gly Arg Tyr Arg Glu Cys Lys Arg Thr Gln Gly Val 130 135 140 Ser Thr Thr Asp Leu Val Gly Arg Met Leu Leu Val Thr Lys Ala His 145 150 155 160 His Ser Ser Gln Glu Met Ser Ser Glu Tyr Arg Glu Tyr Ala Asp Ser 165 170 175 Phe Gly Lys Pro Pro His Pro Thr Pro Ala Gly Asp Thr Leu Ser Ser 180 185 190 Glu Val Ser Ser Gln Cys Pro Gly Gly Gln Ser Pro Trp Thr Gly Val 195 200 205 Ser Gln Phe Leu Gln Thr Ser Gln Lys Ile Ile Gln Phe Ala Ser Gly 210 215 220 Lys Glu Pro Gln Pro Gly Glu Thr Val Ile Tyr Val Ala Gly Ala Phe 225 230 235 240 Asp Leu Phe His Ile Gly His Val Asp Phe Leu Gln Glu Val His Lys 245 250 255 Leu Ala Lys Arg Pro Tyr Val Ile Ala Gly Leu His Phe Asp Gln Glu 260 265 270 Val Asn Arg Tyr Lys Gly Lys Asn Tyr Pro Ile Met Asn Leu His Glu 275 280 285 Arg Thr Leu Ser Val Leu Ala Cys Arg Tyr Val Ser Glu Val Val Ile 290 295 300 Gly Ala Pro Tyr Ser Val Thr Ala Glu Leu Leu Asn His Phe Lys Val 305 310 315 320 Asp Leu Val Cys His Gly Lys Thr Glu Ile Val Pro Asp Arg Asp Gly 325 330 335 Ser Asp Pro Tyr Glu Glu Pro Lys Arg Arg Gly Ile Phe Cys Gln Ile 340 345 350 Asp Ser Gly Ser Asp Leu Thr Thr Asp Leu Ile Val Gln Arg Ile Ile 355 360 365 Lys Asn Arg Leu Glu Tyr Glu Ala Arg Asn Gln Lys Lys Glu Ala Lys 370 375 380 Glu Leu Ala Phe Leu Glu Ala Leu Arg Gln Gln Glu Ala Gln Pro Arg 385 390 395 400 Gly Glu Thr Asp 15 404 PRT Mus musculus 15 Met Ile Arg Asn Gly His Gly Ala Ala Ser Ala Ala Gly Leu Lys Gly 1 5 10 15 Pro Gly Asp Gln Arg Ile Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Asp Lys His Asn Cys Asp Phe Ser Val His 100 105 110 Gly Asn Asp Ile Thr Leu Thr Val Asp Gly Arg Asp Thr Tyr Glu Glu 115 120 125 Val Lys Gln Ala Gly Arg Tyr Arg Glu Cys Lys Arg Thr Gln Gly Val 130 135 140 Ser Thr Thr Asp Leu Val Gly Arg Met Leu Leu Val Thr Lys Ala His 145 150 155 160 His Ser Ser Gln Glu Met Ser Ser Glu Tyr Arg Glu Tyr Ala Asp Ser 165 170 175 Phe Gly Lys Pro Pro His Pro Thr Pro Ala Gly Asp Thr Leu Ser Ser 180 185 190 Glu Val Ser Ser Gln Cys Pro Gly Gly Gln Ser Pro Trp Thr Gly Val 195 200 205 Ser Gln Phe Leu Gln Thr Ser Gln Lys Ile Ile Gln Phe Ala Ser Gly 210 215 220 Lys Glu Pro Gln Pro Gly Glu Thr Val Ile Tyr Val Ala Gly Ala Phe 225 230 235 240 Asp Leu Phe His Ile Gly His Val Asp Phe Leu Gln Glu Val His Lys 245 250 255 Leu Ala Lys Arg Pro Tyr Val Ile Ala Gly Leu His Phe Asp Gln Glu 260 265 270 Val Asn Arg Tyr Lys Gly Lys Asn Tyr Pro Ile Met Asn Leu His Glu 275 280 285 Arg Thr Leu Ser Val Leu Ala Cys Arg Tyr Val Ser Glu Val Val Ile 290 295 300 Gly Ala Pro Tyr Ser Val Thr Ala Glu Leu Leu Asn His Phe Lys Val 305 310 315 320 Asp Leu Val Cys His Gly Lys Thr Glu Ile Val Pro Asp Arg Asp Gly 325 330 335 Ser Asp Pro Tyr Gln Glu Pro Lys Arg Arg Gly Ile Phe Tyr Gln Ile 340 345 350 Asp Ser Gly Ser Asp Leu Thr Thr Asp Leu Ile Val Gln Arg Ile Ile 355 360 365 Lys Asn Arg Leu Glu Tyr Glu Ala Arg Asn Gln Lys Lys Glu Ala Lys 370 375 380 Glu Leu Ala Phe Leu Glu Ala Thr Lys Gln Gln Glu Ala Pro Pro Gly 385 390 395 400 Gly Glu Ile Asp 16 389 PRT Homo sapiens 16 Met Ile Arg Asn Gly Arg Gly Ala Ala Gly Gly Ala Glu Gln Pro Gly 1 5 10 15 Pro Gly Gly Arg Arg Ala Val Arg Val Trp Cys Asp Gly Cys Tyr Asp 20 25 30 Met Val His Tyr Gly His Ser Asn Gln Leu Arg Gln Ala Arg Ala Met 35 40 45 Gly Asp Tyr Leu Ile Val Gly Val His Thr Asp Glu Glu Ile Ala Lys 50 55 60 His Lys Gly Pro Pro Val Phe Thr Gln Glu Glu Arg Tyr Lys Met Val 65 70 75 80 Gln Ala Ile Lys Trp Val Asp Glu Val Val Pro Ala Ala Pro Tyr Val 85 90 95 Thr Thr Leu Glu Thr Leu Asp Lys Tyr Asn Cys Asp Phe Cys Val His 100 105 110 Gly Asn Asp Ile Thr Leu Thr Val Asp Gly Arg Asp Thr Tyr Glu Glu 115 120 125 Val Lys Gln Ala Gly Arg Tyr Arg Glu Cys Lys Arg Thr Gln Gly Val 130 135 140 Ser Thr Thr Asp Leu Val Gly Arg Met Leu Leu Val Thr Lys Ala His 145 150 155 160 His Ser Ser Gln Glu Met Ser Ser Glu Tyr Arg Glu Tyr Ala Asp Ser 165 170 175 Phe Gly Lys Cys Pro Gly Gly Arg Asn Pro Trp Thr Gly Val Ser Gln 180 185 190 Phe Leu Gln Thr Ser Gln Lys Ile Ile Gln Phe Ala Ser Gly Lys Glu 195 200 205 Pro Gln Pro Gly Glu Thr Val Ile Tyr Val Ala Gly Ala Phe Asp Leu 210 215 220 Phe His Ile Gly His Val Asp Phe Leu Glu Lys Val His Arg Leu Ala 225 230 235 240 Glu Arg Pro Tyr Ile Ile Ala Gly Leu His Phe Asp Gln Glu Val Asn 245 250 255 His Tyr Lys Gly Lys Asn Tyr Pro Ile Met Asn Leu His Glu Arg Thr 260 265 270 Leu Ser Val Leu Ala Cys Arg Tyr Val Ser Glu Val Val Ile Gly Ala 275 280 285 Pro Tyr Ala Val Thr Ala Glu Leu Leu Ser His Phe Lys Val Asp Leu 290 295 300 Val Cys His Gly Lys Thr Glu Ile Ile Pro Asp Arg Asp Gly Ser Asp 305 310 315 320 Pro Tyr Gln Glu Pro Lys Arg Arg Gly Ile Phe Arg Gln Ile Asp Ser 325 330 335 Gly Ser Asn Leu Thr Thr Asp Leu Ile Val Gln Arg Ile Ile Thr Asn 340 345 350 Arg Leu Glu Tyr Glu Ala Arg Asn Gln Lys Lys Glu Ala Lys Glu Leu 355 360 365 Ala Phe Leu Glu Ala Ala Arg Gln Gln Ala Ala Gln Pro Leu Gly Glu 370 375 380 Arg Asp Gly Asp Phe 385 17 587 DNA Mus musculus promoter (1)..(556) protein_bind (51)..(63) transcription factor HNF8 binding site 17 gggtatgcgg cacagggaga atctaactaa gcctccagtc tgagcaagtc ttattaaaca 60 tctctcaatt gctttggtgt cccgatgact gtcacacgca ccaccgaggt gcctgcatct 120 gagggcctgc atcgaggcgc ttttgaagaa cccagcccct gaaaatgctt ttggttggtt 180 ggtttttttg aaacagggtt tccgtgtgta gccctggctg tcctggaact cataagatcc 240 tcctgcctct gcctcccaag tgctgggatt aaaggggtcg ccaccactgc ccggctccta 300 agaatgctta aggcacgggg tgagctgcac gcacagttgt ggtgctaacc tgccccgttc 360 gtctgtggag aagtcaaatg ccaaagcccg ggcacctgca acacagacca ttggccgctc 420 gatctgggcg gaggggggtg tggcccggct gggggcgggg ccctggttgg cgcacgccat 480 tggctgcgcc aagcgggtga gatccgcgtg agcacgcgca agcgtagagg gcggggcgac 540 ggtactgtgt gtcgcgggag ccgccaggat tgcggggggc ctccggt 587 18 357 DNA Homo sapiens promoter (1)..(344) protein_bind (21)..(32) transcription fact Sp1(-)/NF1(-) binding site 18 gacggtcccc acgccgcact gccccgccag ccgagcgcca ggtgtgggcg gtgcggagag 60 gccaggtgtg ggtcgggggg cggggctcgg aaagcgcggc acacgccatt ggctgtgcgt 120 ttggaggggg cgggactctg tcaggggctc acgccattgg ccgtgcgcgg aggtgcggtg 180 gggcgcggcc ttcggggggt ggggctcggg gcggagggcg ggaggcgggg cgggggaagc 240 gggggctggg ctcgggccga gcgccgaccc attggccgtg cgcagcgggt gaggcccgcg 300 tgacggccgc tgagcgtgcg ctggcggggc gggcggcggc gctcggagtc gccggga 357 19 39 DNA Mus musculus 19 tgtcagctca cacaattcca aaggaaactg gccttgctg 39 20 24 DNA Artificial Sequence DNA sequence 20 tgtcagctca cacaattcca aagg 24 21 24 DNA Artificial Sequence DNA sequence 21 tcagcaaggc cagtttcctt tgga 24 22 19 DNA Artificial Sequence DNA sequence 22 tctcctggct gctgtgatg 19 23 22 DNA Artificial Sequence DNA sequence 23 ccgtgaacac agaagtcaca gt 22 24 18 DNA Artificial Sequence DNA sequence 24 cacctcgtcc acccattt 18 25 18 DNA Artificial Sequence DNA sequence 25 ggccacgcgt cgactagt 18 26 18 DNA Artificial Sequence DNA sequence 26 acgggnnggg nngggnng 18 27 17 DNA Artificial Sequence DNA sequence 27 caggaaacag ctatgac 17 28 20 DNA Artificial Sequence DNA sequence 28 taatacgact cactataggg 20 29 20 DNA Artificial Sequence DNA sequence 29 ggatttgcgg ggggcctccg 20 30 21 DNA Artificial Sequence DNA sequence 30 acggcaggca cgggccatgg g 21 31 20 DNA Artificial Sequence DNA sequence 31 acgctgacag tagacggccg 20 32 21 DNA Artificial Sequence DNA sequence 32 ggagatgtcc tctgagtacc g 21 33 21 DNA Artificial Sequence DNA sequence 33 ttctgggaag gagccccagc c 21 34 20 DNA Artificial Sequence DNA sequence 34 accatactcc gtgacagcgg 20 35 21 DNA Artificial Sequence DNA sequence 35 gtatgcacac ccacgatgag g 21 36 21 DNA Artificial Sequence DNA sequence 36 ctcccagcct gcttcacttc c 21 37 23 DNA Artificial Sequence DNA sequence 37 ttccaaaact gtcagcatat tcc 23 38 21 DNA Artificial Sequence DNA sequence 38 ggcaccagcc acatagatga c 21 39 21 DNA Artificial Sequence DNA sequence 39 accttgaagt gattcaggag c 21 40 20 DNA Artificial Sequence DNA sequence 40 ggtgggcaca gggcaagggc 20 41 13 DNA Homo sapiens 41 ggagycgccr gga 13 42 37 DNA Artificial Sequence DNA sequence 42 ggccacgcgt cgactagtac tttttttttt ttttttt 37 43 17 DNA Artificial Sequence DNA sequence 43 ggccacgcgt cgactac 17 44 17 DNA Artificial Sequence DNA sequence 44 tgagggtgtg gtgcgat 17 45 20 DNA Artificial Sequence DNA sequence 45 ggcatcttcc gtcagattga 20 46 20 DNA Artificial Sequence DNA sequence 46 cagacctcat cgtccagcgg 20 47 20 DNA Artificial Sequence DNA sequence 47 tccaccaccc tgttgctgta 20 48 20 DNA Artificial Sequence DNA sequence 48 accacagtcc atgccatcac 20 49 33 DNA Artificial Sequence DNA sequence 49 atatgagctc gggtatgcgg cacagggaga atc 33 50 32 DNA Artificial Sequence DNA sequence 50 atatctcgag accggaggcc ccccgcaaat cc 32 51 18 PRT Mus musculus 51 Pro Pro His Pro Thr Pro Ala Gly Asp Thr Leu Ser Ser Glu Val Ser 1 5 10 15 Ser Gln 52 13 DNA Artificial Sequence Consensus sequence 52 ggagycgccr gga 13 53 17 PRT Artificial Sequence Consensus sequence 53 Cys Thr Lys Ala His His Ser Ser Gln Glu Met Ser Ser Glu Tyr Arg 1 5 10 15 Glu

Claims (7)

1. A gene encoding a protein having ethanolarninephosphate cytidylyltransferase activity consisting of a sequence selected from the group consisting of:
(a) SEQ ID NO: 1;
(b) a degenerate sequence of SEQ ID NO: 1 and
(c) a sequence which hybridizes to the complement of SEQ ID NO: 1 under stringent conditions.
2. The gene according to claim 1 consisting of SEQ ID NO: 1.
3. The gene according to claim 1 derived from a human or a mouse.
4. A promoter of an ethanolaminephosphate cytidylyltransferase gene, said promoter consisting of a sequence selected from the group consisting of:
(a) SEQ ID NO: 2;
(b) a sequence having at least 90% identity to SEQ ID NO: 2 having substitutions or deletions and maintaining promoter activity; and
(c) a sequence which hybridizes to the complement of SEQ ID NO: 2 under stringent conditions.
5. The promoter according to claim 4 consisting of SEQ ID NO: 2.
6. A CTP:Ethanolaminephosphate Citidylyltransferase (ECT) peptide having the sequence CTKAHHSSQEMSSEYRE according to SEQ ID NO: 53.
7. A CTP:Ethanolaminephosphate Citidylyltransferase (ECT) specific antibody against the peptide of claim 6.
US10/392,837 2002-03-21 2003-03-21 Ethanolaminephosphate cytidylyltransferase gene and promoter Abandoned US20040038360A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/392,837 US20040038360A1 (en) 2002-03-21 2003-03-21 Ethanolaminephosphate cytidylyltransferase gene and promoter

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/101,957 US6777216B2 (en) 2002-03-21 2002-03-21 Ethanolaminephosphate cytidylytransferase gene and promoter
US10/392,837 US20040038360A1 (en) 2002-03-21 2003-03-21 Ethanolaminephosphate cytidylyltransferase gene and promoter

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/101,957 Continuation-In-Part US6777216B2 (en) 2002-03-21 2002-03-21 Ethanolaminephosphate cytidylytransferase gene and promoter

Publications (1)

Publication Number Publication Date
US20040038360A1 true US20040038360A1 (en) 2004-02-26

Family

ID=28673500

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/101,957 Expired - Fee Related US6777216B2 (en) 2002-03-21 2002-03-21 Ethanolaminephosphate cytidylytransferase gene and promoter
US10/392,837 Abandoned US20040038360A1 (en) 2002-03-21 2003-03-21 Ethanolaminephosphate cytidylyltransferase gene and promoter

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/101,957 Expired - Fee Related US6777216B2 (en) 2002-03-21 2002-03-21 Ethanolaminephosphate cytidylytransferase gene and promoter

Country Status (2)

Country Link
US (2) US6777216B2 (en)
CA (1) CA2421146A1 (en)

Also Published As

Publication number Publication date
CA2421146A1 (en) 2003-09-21
US6777216B2 (en) 2004-08-17
US20030194795A1 (en) 2003-10-16

Similar Documents

Publication Publication Date Title
Karim et al. Gene structure, expression and identification of a new CTP: phosphocholine cytidylyltransferase β isoform
US20070202107A1 (en) Novel kinases
JP2002522009A (en) STE-20-related protein kinase
JP4295386B2 (en) Highly active alkaline phosphatase
CA2300977A1 (en) Neutral sphingomyelinase
US8614300B2 (en) Nucleic acids encoding a mut-T domain-containing polypeptide
US6335435B1 (en) Human gene RecQ4 encoding helicase
US6482605B1 (en) Protein tyrosine phosphatase PTP20 and related products and methods
Baboval et al. Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse.
US6503700B1 (en) Mammalian CDP-diacylglycerol synthase
US20040038360A1 (en) Ethanolaminephosphate cytidylyltransferase gene and promoter
US6511825B1 (en) Cell signaling polypeptides and nucleic acids
US6797513B2 (en) Nucleic acid encoding CLK2 protein kinases
US6258547B1 (en) Nucleic acid encoding amp-activated protein kinase
US20040005688A1 (en) Isolated dishevelled associated kinases, polynucleotides encoding the kinases, and methods of use thereof
US7439061B2 (en) DNA encoding the novel mammalian protein, Ire1p
CA2167296C (en) Mammalian phospholipase a2 nucleotide sequences, low molecular weight amino acid sequences encoded thereby, antisense sequences and nucleotide sequences having internal ribosome binding sites
CA2410520A1 (en) Mutated eukariotic translation initiation factor 2 alpha kinase 3, eif2ak3, in patients with neonatal insulin-dependent diabetes and multiple epiphyseal dysplasia (wolcott-rallison syndrome)
US6255095B1 (en) Human diacylglycerol kinase iota
US20020147320A1 (en) Novel human kinase proteins and polynucleotides encoding the same
JP4660200B2 (en) Centrosome-binding proteins and their applications
JP3889863B2 (en) Glycosyltransferase gene
JP4169845B2 (en) Mouse secretory phospholipase A2
EP1491628A1 (en) Novel galactose transferases, peptides thereof and nucleic acid encoding the same
JP2005526516A (en) Mouse ortholog of deficient gene 1 in human schizophrenia

Legal Events

Date Code Title Description
AS Assignment

Owner name: UNIVERSITY OF GUELPH, CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BAKOVIC, MARICA;POLOUMIENKO, ARKADI;REEL/FRAME:014200/0551

Effective date: 20030421

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION