US20030082813A1 - Promotion of somatic embryogenesis in plants by wuschel gene expression - Google Patents

Promotion of somatic embryogenesis in plants by wuschel gene expression Download PDF

Info

Publication number
US20030082813A1
US20030082813A1 US09/984,274 US98427401A US2003082813A1 US 20030082813 A1 US20030082813 A1 US 20030082813A1 US 98427401 A US98427401 A US 98427401A US 2003082813 A1 US2003082813 A1 US 2003082813A1
Authority
US
United States
Prior art keywords
promoter
plant
tissue
inducible
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/984,274
Other languages
English (en)
Inventor
Jianru Zuo
Qi-Wen Niu
Giovanna Frugis
Nam-Hai Chua
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rockefeller University
Original Assignee
Rockefeller University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rockefeller University filed Critical Rockefeller University
Priority to US09/984,274 priority Critical patent/US20030082813A1/en
Assigned to ROCKEFELLER UNIVERSITY, THE reassignment ROCKEFELLER UNIVERSITY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHUA, NAM-HAI, NIU, QI-WEN, ZUO, JIANRU, FRUGIS, GIOVANNA
Priority to PCT/US2002/034534 priority patent/WO2003037072A2/fr
Priority to MXPA04004003A priority patent/MXPA04004003A/es
Priority to DE60219673T priority patent/DE60219673T2/de
Priority to CA2464147A priority patent/CA2464147C/fr
Priority to EP02776339A priority patent/EP1451301B1/fr
Priority to AT07075071T priority patent/ATE452966T1/de
Priority to DE60234877T priority patent/DE60234877D1/de
Priority to AU2002342173A priority patent/AU2002342173B2/en
Priority to EP07075071A priority patent/EP1785481B1/fr
Priority to AT02776339T priority patent/ATE360060T1/de
Priority to ES02776339T priority patent/ES2286290T3/es
Priority to CA2821597A priority patent/CA2821597C/fr
Publication of US20030082813A1 publication Critical patent/US20030082813A1/en
Priority to US10/956,120 priority patent/US7700829B2/en
Priority to AU2007201633A priority patent/AU2007201633B2/en
Priority to US12/722,981 priority patent/US7816580B2/en
Priority to US12/888,636 priority patent/US7977534B2/en
Priority to US13/164,904 priority patent/US8101821B2/en
Priority to US13/347,839 priority patent/US8431773B2/en
Priority to US13/856,623 priority patent/US8581037B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A01H4/005—Methods for micropropagation; Vegetative plant propagation using cell or tissue culture techniques
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • Somatic embryogenesis is a unique pathway for asexual propagation or somatic cloning in plants.
  • the developmental process of somatic embryogenesis shares considerable similarity with that of zygotic embryogenesis (Zimmerman, 1993; Mordhorst et al., 1997) and this is likely due to the conservation in the underpinning cellular and molecular mechanisms between the two processes. Therefore, somatic embryogenesis provides an attractive model system for studying zygotic embryogenesis, particularly because zygotic embryos are encased by maternal tissues and difficult to access by biochemical and molecular tools. Moreover, in biotechnological applications, most economically important crop as well as non-crop plants are regenerated via somatic embryogenesis.
  • somatic embryogenesis In contrast to organogenesis, which requires a high cytokinin to auxin ratio (Skoog and Miller, 1957; Sugiyama, 1999; Sugiyama, 2000), somatic embryogenesis does not require any external cytokinins, but rather is dependent on high concentrations of 2,4-D (Zimmerman, 1993; Mordhorst et al., 1997; Sugiyama, 2000), a synthetic chemical that has long been used as a functional analog of auxin. It is generally believed that somatic embryogenesis is mediated by a signaling cascade triggered by external auxin or 2,4-D (Zimmerman, 1993; Mordhorst et al., 1997; Schmidt et al., 1997). However, very little is known about the signal transduction pathway, particularly the molecular mechanism involved in the transition of a vegetative cell to an embryogenic competent cell.
  • Leafy cotyledon 1 (LEC1) gene encoding a subunit of the HAP heterotrimeric transcription factor complex (HAP3), has been proposed as a key regulator for embryonic identity (Lotan et al., 1998). Mutations in the LEC1 locus result in defective embryo maturation as well as the conversion of cotyledons into true-leaf-like structures (Lotan et al., 1998; Meinke, 1992; Meinke et al., 1994). Constitutive overexpression of LEC1 leads to severely abnormal plant growth and development with occasional formation of somatic embryo-like structures (Lotan et al., 1998). The developmental fate of these embryo-like structures, however, remained unknown due to the lethality of LEC1 overexpression.
  • HAP3 HAP heterotrimeric transcription factor complex
  • One aspect of the present invention is a method to promote somatic embryogenesis from a tissue or organ of a plant, said method comprising overexpressing a Wuschel gene in said tissue or organ.
  • a second aspect of the invention is a method to generate somatic plant embryos wherein said method comprises overexpressing a Wuschel gene in a tissue or organ of a plant.
  • Another aspect of the invention is a method for generating shoots from a tissue or organ of a plant, said method comprising overexpressing a Wuschel gene in said tissue or organ.
  • Yet another aspect of the invention is a method of selecting plants transformed with a vector comprising a silent selectable marker wherein the marker is a Wuschel gene.
  • Another object of the invention is a method of producing an apomictic plant line.
  • Another object of the invention is a method of producing haploid plants.
  • FIG. 1 is a schematic diagram of the XVE activation tagging vector pER16.
  • FIGS. 2 A-F illustrate the pga6 gain-of-function mutant phenotype.
  • Root explants derived from pga6 seedlings were cultured on the non-inductive SCM (SCM minus 17- ⁇ -estradiol) for 20 days (FIG. 2A); or on the inductive SCM for 10 days (FIG. 2B), 20 days (FIG. 2C), or 30 days (FIG. 2D).
  • FIG. 2E shows an enlarged view of a germinating somatic embryo isolated from the explant shown in (FIG. 2D).
  • FIG. 2F shows a germinating seedling derived from a somatic embryo grown on MS medium (45 days). Scale bar, 100 ⁇ m for FIGS. 2A and 2E; 1 mm, for FIGS. 2B, 2C, 2 D and 2 F.
  • FIGS. 3 A-D are electron microscopic analyses showing somatic embryogenesis in pga6 mutant explants (culturing conditions were identical to those shown in FIGS. 2 A-F).
  • FIG. 3A shows a pre-embryo stage before the first embryonic cell division (arrows) and a two-cell stage after the first asymmetric division with a smaller apical cell (A) and a larger basal (B) cell.
  • FIG. 3B shows embryos at the globular (G) and the early heart (H) stages.
  • FIG. 3C shows a germinating embryo.
  • C cotyledon
  • H hypocotyl.
  • FIG. 3D shows an abnormal somatic embryo with three cotyledons (C) anchored on the hypocotyl (H). Scale bar, 10 ⁇ m for FIG. 3A; 100 ⁇ m for FIGS. 3 B-D.
  • FIGS. 4 A-H illustrate phytohormone-independent somatic embryo formation caused by the pga6 gain-of-function mutation.
  • FIG. 4A is an overview of pga6 mutant seedlings germinated and grown on MS medium (first seedling from the left) or the inductive MS medium (MST: 5 ⁇ M 17- ⁇ -estradiol) for 7 days.
  • FIGS. 4 B-D show pga6 seedlings that were cultured on the inductive MS medium for 10 days (FIG. 4B), 14 days (FIG. 4C) or 30 days (FIG. 4D).
  • FIGS. 4A is an overview of pga6 mutant seedlings germinated and grown on MS medium (first seedling from the left) or the inductive MS medium (MST: 5 ⁇ M 17- ⁇ -estradiol) for 7 days.
  • FIGS. 4 B-D show pga6 seedlings that were cultured on the inductive MS medium for 10 days (FIG. 4B), 14
  • FIG. 4 E-F show seven-day-old pga6 seedlings germinated and grown on MS medium which were transferred onto an inductive MS medium and cultured for 5 (FIG. 4E) or 10 (FIG. 4F) days.
  • FIG. 4G shows pga6 root explants which were cultured on the inductive MS medium for 20 days.
  • FIG. 4H is an enlarged view of FIG. 4G. Scale bar, 1 mm.
  • FIGS. 5 A-D show that the pga6 phenotype is due to the inducer-dependent overexpression of WUS.
  • FIG. 5A is a schematic diagram illustrating the insertion site of the T-DNA upstream of the WUS gene (not shown to scale). Arrows indicate the directions of transcription.
  • FIG. 5B shows pga6 seeds (T2, homozygous) which were germinated and grown on MS medium supplemented with various concentrations of the inducer as indicated. Ten-day old seedlings are shown. The scale bar represents 1 mm.
  • FIG. 5C shows the expression of PGA6/WUS induced by different concentrations of the inducer.
  • FIG. 5D shows ethidium bromide staining of the gel as a control for RNA loading and transfer.
  • FIGS. 6 A-H are photographs showing that 35S- or XVE-controlled overexpression of WUS cDNA phenocopies the pga6 phenotype.
  • FIG. 6A shows embryogenic callus and
  • FIG. 6B shows somatic embryo formation from root tips of XVE-WUS cDNA T2 seedlings grown for 15 days in A medium supplemented with 17- ⁇ -estradiol (10 ⁇ M).
  • FIGS. 6 C-H show 15 day-old T1 35S:: WUS seedling phenotypes.
  • FIG. 6C shows the tips of the roots are enlarged and show an embryo-like structure.
  • FIG. 6D shows the adventitious root tip.
  • FIG. 6A shows embryogenic callus
  • FIG. 6B shows somatic embryo formation from root tips of XVE-WUS cDNA T2 seedlings grown for 15 days in A medium supplemented with 17- ⁇ -estradiol (10 ⁇ M).
  • FIGS. 6 C-H show 15 day-old
  • FIG. 6E shows that WUS overexpression induces both organogenesis and embryogenesis from the root.
  • FIG. 6F shows detail of early embryo structure formation.
  • FIG. 6G shows the shoot apical meristem is dramatically altered and, besides forming lateral organs with altered shaped, givers rise to adventitious shoots and somatic embryos.
  • FIG. 6H shows the entire shoot apical meristem expands and lateral organs transform into meristematic tissues. Scale bar is 1 mm.
  • FIGS. 7 A-C are Northern blots of RNA from root explants prepared from pga6 seedlings cultured on the screening medium (SCM) for different times as indicated. On day 28, when somatic embryos were apparent, cultures were transferred onto a freshly-prepared SCM or control medium (SCM without the inducer) and incubated for an additional day (28+1) or two days (28+2). Five micrograms of total RNA, prepared from the frozen materials, were analyzed by Northern blotting using WUS (FIG. 7A) and LEC1 (FIG. 7B) cDNA as probes. The blot was rehybridized with an actin cDNA probe (FIG. 7C) to ensure that equal amounts of RNA were loaded.
  • SCM screening medium
  • FIGS. 8 A-B illustrate formation of somatic embryos from isolated zygotic embryos of PGA6 transgenic plants grown in the presence (FIG. 8A) or absence (FIG. 8B) of an inducer of PGA6.
  • PGA6 Plant Growth Activator 6
  • PGA6 plays a critical regulatory role during embryogenesis, likely involved in maintaining embryonic cell identity.
  • Molecular and genetic analyses indicate that pga6 is a gain-of-function allele of the previously characterized wus loss-of-function mutation (Mayer et al., 1998).
  • WUS is capable of promoting vegetative-to-embryonic transition and eventually somatic embryo formation uncovers an additional critical function of this homeodomain protein during embryogenesis.
  • the highly restrictive expression of WUS hallmarks the putative embryonic organizing center which, in turn, may give rise to stem cells during embryogenesis and later development. Therefore, WUS is involved in promoting and maintaining the identity of embryonic cells from which stem cells are derived. Because WUS-expressing cells have not been morphologically and functionally characterized, it remains of interest to determine whether this cluster of cells indeed represents a functional organizing center similar to Spemann's organizer discovered nearly 80 years ago in Xenopus embryos (Spemann and Mangold, 1924).
  • LEC1 transcript was barely detectable in the organizing center or the WUS expressing domain, albeit LEC1 was found to express throughout embryogenesis as well as in seeds (Lotan et al., 1998). Consistent with these observations, somatic embryo expression of LEC1, presumably resembling that in zygotic embryos, was found to be promptly repressed by the WUS activity. In addition, the LEC1 function appeared to require unidentified embryo- and or seed-specific cofactors, since inducible overexpression of LEC1 by the XVE system (Zuo, et al., 2000b) during post-germination stages did not result in any detectable phenotype.
  • WUS appears to be a key player in promoting embryonic potential as its activity does not appear to require any developmentally specific factors under our tested conditions.
  • LEC2 encodes a transcription factor containing a B3 domain unique to several other plant transcription factors including ABI3/NVP1 and FUS3.
  • ABI3/NVP1 and FUS3 Overexpression of LEC2 leads to formation of somatic embryos as well as the formation of callus, cotyledon-like and leaf-like structures, a phenotype similar to that of pga6 mutant, suggesting that LEC2 might be functionally close to WUS. It will be interesting to determine if the LEC2 activity is also dependent on embryo- and/or seed-specific cofactors as in the case for LEC1.
  • Leafy cotyledon 1 causes severe developmental abnormality and growth arrest, a phenotype similar to that of the pga6 mutant (Lotan et al., 1998). Formation of somatic embryos is occasionally observed in the Lec1 overexpression plants (Lotan et al., 1998), but these embryos never germinate or develop into normal adult plants.
  • the finding that the pga6 gain-of-function mutation or overexpression of WUS results in hormone-independent somatic embryo formation at a high frequency will have significant impact on plant biotechnology, and provides a convenient and attractive model system for many aspects of plant biological research.
  • embryogenesis is induced in haploid cells, such as pollen cells, to produce haploid plants.
  • This can be achieved by stably transforming a plant cell or tissue with a WUS gene under the control of a tissue specific promoter that is active in a haploid cell or tissue, and expressing the WUS gene therein, or by introducing the WUS gene into a plant tissue or cell under the control of an inducible promoter and applying the inducer to cause expression of the WUS gene therein.
  • the WUS gene is under the control of a promoter that is both haploid-tissue specific and inducible.
  • a promoter is used that is both inducible and tissue-specific, giving greater control over the process.
  • a WUS gene linked to an inducible pollen-specific promoter is used to induce somatic embryogenesis in pollen cells.
  • haploid tissue or cell results in the formation of haploid somatic embryos, which can be grown into haploid plants using standard techniques.
  • a preferred method comprises exposing excised transgenic tissue containing the haploid cells (e.g., pollen or ovules) to the inducer specific for the inducible promoter for a time sufficient to induce the formation of a somatic embryo, withdrawing the inducer, and growing the somatic embryo into a transgenic haploid plant in the absence of the inducer.
  • excised transgenic tissue containing the haploid cells e.g., pollen or ovules
  • Diploidization of the haploid plants to form dihaploids will significantly expedite the process of obtaining homozygous plants as compared to a method of conventional genetic segregation.
  • This technology will not only be beneficial for breeding purposes but also for basic research such as studies of mutagenesis and other genetic studies, because dihaploids are truly homozygous down to the DNA level, containing two identical copies of each gene.
  • WUS genes will be useful for inducing apomixis into plants. Apomixis and methods of conferring apomixis into plants are discussed in several patents (see, e.g., U.S. Pat. Nos. 5,710,367; 5,811,636; 6,028,185; 6,229,064; and 6,239,327 as well as WO 00/24914 which are incorporated herein by reference). Reproduction in plants is ordinarily classified as sexual or asexual. The term apomixis is generally accepted as the replacement of sexual reproduction by various forms of asexual reproduction (Rieger et al., IN Glossary of Genetics and Cytogenetics, Springer-Verlag, New York, N.Y., 1976).
  • apomixis is a genetically controlled method of reproduction in plants where the embryo is formed without union of an egg and a sperm.
  • apomictic reproduction There are three basic types of apomictic reproduction: 1) apospory-embryo develops from a chromosomally unreduced egg in an embryo sac derived from a somatic cell in the nucellus, 2) diplospory-embryo develops from an unreduced egg in an embryo sac derived from the megaspore mother cell, and 3) adventitious embryony-embryo develops directly from a somatic cell.
  • apomixis In most forms of apomixis, pseudogamy or fertilization of the polar nuclei to produce endosperm is necessary for seed viability. These types of apomixis have economic potential because they can cause any genotype, regardless of how heterozygous, to breed true. It is a reproductive process that bypasses female meiosis and syngamy to produce embryos genetically identical to the maternal parent. With apomictic reproduction, progeny of specially adaptive or hybrid genotypes would maintain their genetic fidelity throughout repeated life cycles. In addition to fixing hybrid vigor, apomixis can make possible commercial hybrid production in crops where efficient male sterility or fertility restoration systems for producing hybrids are not known or developed. Apomixis can make hybrid development more efficient. It also simplifies hybrid production and increases genetic diversity in plant species with good male sterility.
  • Agrobacteria ABI cells carrying pER16 were used to transform Arabidopsis (the Wassilewskija ecotype) root explants. Infected root explants were cultured on the screening medium (SCM; 1 ⁇ MS salts, 1% sucrose, 0.5 g/L MES (2-[N-morpholino]ethanesulfonic acid), 0.15 mg/L IAA (indole acetic acid), 5 ⁇ M 17- ⁇ -estradiol, 50 mg/L kanamycin, 100 mg/L carbenicillin and 0.2% phytagel, pH 5.7) at 22° C. under a 16-hour white light/8-hour dark cycle.
  • SCM screening medium
  • Putative pga mutants which appeared as rapidly growing green-yellowish or green cell clumps or calli upon culturing on the SCM for 10-15 days, were transferred onto a non-inductive shoot induction medium (SIM; for green calli; 1 ⁇ MS salts, 1% sucrose, 0.5 g/L MES, 1 mg/L 2-IP (N 6 , ⁇ 2 -isopentenyladenine), 0.15 mg/L IAA, 50 mg/L kanamycin, 100 mg/L carbenicillin and 0.2% phytagel, pH 5.7) to recover mutant shoots.
  • SIM non-inductive shoot induction medium
  • the green-yellowish calli were transferred onto the callus induction medium (CIM; 1 ⁇ B5 salts (Sigma), 2% glucose, 0.5 g/L MES, 0.5 mg/L 2,4-D, 0.05 mg/L kinetin, 50 mg/L kanamycin, 100 mg/L carbenicillin and 0.2% phytagel, pH 5.7).
  • CIM callus induction medium
  • the amplified calli were then transferred onto a SIM to regenerate shoots. Regenerated shoots, usually formed after culturing on the SIM for 2-3 weeks, were then transferred to a root induction medium (RIM; identical to SIM but without 2-IP) to promote root formation.
  • RIM root induction medium
  • pga mutant plantlets including pga6, were able to set seeds after transferring to soil, a portion of roots were excised and placed on the CIM to reinduce callus formation, followed by repeating the above-described screening procedure to confirm the inducer-dependentpga phenotype.
  • the pga6 mutant was backcrossed with wild-type (Wassilewskija) plants twice for further genetic and phenotypic analyses.
  • the XVE inducible expression vector pER10 is identical to pER8 (Zuo et al., 2000a) except that the hygromycin selectable marker of pER8 was replaced with a kanamycin selectable marker.
  • pER10 was digested with SpeI and Asp718I followed by Klenow enzyme fill-in reaction and religation.
  • the resulting pER16 vector lacked the rbcsS3A polyA addition sequence of the O LeXA-46::T 3A expression cassette (see FIG. 1 of Zuo et al. (2000a)).
  • pER16 is shown in FIG. 1. Only the region between the Right Border (RB) and Left Border (LB) is shown (not to scale).
  • Two transcription units and the O LexA -46 promoter are located between the RB and LB.
  • the G10-90 promoter (Ishige et al., 1999) drives the XVE fusion gene terminated by the rbcs E9 polyA addition sequence.
  • the second transcription unit consists of the Nopaline Synthase (NOS) gene promoter, the coding sequence of the Neomycin Phosphotransferase II (NPT II) gene and the NOS polyadenylation sequence.
  • NOS Nopaline Synthase
  • the O LexA -46 promoter consists of 8 copies of the LexA operator sequence fused to the -46 CaMV35S promoter. Upon integration into the plant genome, the O LexA -46 promoter can activate the transcription of sequences fused downstream from the promoter in a 17- ⁇ -estradiol-dependent fashion.
  • the WUS cDNA was amplified from flower cDNA by polymerase chain reaction (PCR), using the primers WusUp (5′ CTTATTTACCGTTAACTTGTGAACA 3′) (SEQ ID NO:1) and WusLow (5′ CACATAACGAGAGATAACTAGTTAAC 3′) (SEQ ID NO:2).
  • Genomic DNA Southern and RNA Northern blotting analyses were carried out as previously described (Zuo et al., 2000a; Zuo et al., 2001).
  • Explants derived from Arabidopsis vegetative tissues are known to be incapable of forming somatic embryos or embryogenic calli promoted by external plant hormones.
  • external hormones alone were incapable of activating key regulators of Arabidopsis necessary for vegetative-to-embryogenic transition.
  • gain-of-function mutations in these regulatory genes may activate the vegetative-to-embryonic transition.
  • gain-of-function mutations may also cause severe defects during subsequent plant growth and development. Therefore, if the expression of the mutated gene and/or the biological activity of related gene products is not appropriately controlled, it will be difficult to maintain the identified mutations.
  • the pga6 mutant was initially identified by its ability to form embryogenic calli on SCM.
  • the embryogenic calli were transferred onto a shoot induction medium containing both auxin and cytokinin but without the chemical inducer 17- ⁇ -estradiol.
  • shoots were regenerated from the isolated calli.
  • Explants derived from different organs of the regenerated shoots were cultured on SCM as described before; a portion of the excised explants was cultured in SCM without the inducer to serve as controls. After culturing for 7-10 days, only slowly growing calli were occasionally observed in the absence of inducer (FIG. 2A).
  • the inducer-dependent somatic embryo formation was reproducibly observed in pga6 explants prepared from different organs/tissues of previously uninduced T1 plants. Similar to that observed in the T0 explants, the highest frequency of somatic embryo formation was observed from root explants, followed by leaf petioles, stems and leaves. Isolated zygotic embryos had a frequency similar to that of root explants.
  • LEC1 Overexpression of LEC1 leads to abnormal plant growth and development as well as the occasional formation of embryo-like structures (Lotan et al., 1998). The LEC1 gain-of-function phenotype, however, appeared to be strictly restricted to developmental stages prior to germination. After seedling germination, overexpression of LEC1, controlled by the XVE inducible expression system (Zuo et al., 2000a), did not produce any apparent abnormality in plant growth and development, although the LEC1 transgene was highly responsive to the inducer during post-germination stages.
  • the same transgenic line showed a strong phenotype if germinated directly in the presence of the inducer and the LEC1 transgene was highly responsive to the inducer during post-germination stages.
  • PGA6 is Identical to the Homeodomain Protein WUS
  • the pga6 mutant genome appears to contain a single transgenic locus.
  • molecular analysis indicated the presence of the O LexA -46 promoter in two independent loci.
  • One O LexA -46 promoter was found to fuse to the WUS gene in chromosome II (Mayer et al., 1998), approximately 1 kilobase-pair (Kb) upstream from the putative translation initiation codon (FIG. 5A).
  • the second O LexA -46 promoter fused immediately upstream of the putative translation initiation codon of an open reading frame (ORF) in chromosome V, encoding a putative basic-helix-loop-helix type transcription factor (deigned ORF1).
  • ORF open reading frame
  • cDNA fragments containing both WUS and the putative ORF1 were cloned into an XVE vector, and the resulting constructs were used to transform wild-type plants (Bechtold et al., 1993). Explants derived from XVE-ORF1 T1 transgenic plants did not show any apparent inducer-dependent phenotype.
  • ORF1 expression did not appear to be up-regulated by the chemical inducer in pga6 plants, presumably due to the instability of the ORF1 transcript lacking the entire 5′-untranslated region (UTR).
  • all pga6 mutant phenotypes as described before were observed in the XVE-WUS T2 transgenic plants (FIGS. 6A and 6B) in an inducer dependent manner (see Example 11 for details).
  • FIG. 5C shows expression of PGA6/WUS induced by different concentrations of the inducer.
  • Ten-day-old pga6 seedlings germinated and grown on the MS medium were transferred to an MS medium containing various concentrations of 17- ⁇ -estradiol as indicated and cultured for an additional 16 hours before total RNA extraction.
  • Five ⁇ g total RNA were used for Northern blot analysis using a WUS cDNA fragment as a probe.
  • pga6 plants also showed various penetrations of the mutant phenotype in an inducer concentration-dependent fashion (FIG. 5B), thus providing a series of conditional mutant alleles for further functional studies.
  • the WUS promoter presumably remains functional in the mutant genome, leading to no apparent loss-of-function phenotype for the mutation. Nevertheless, the WUS gene was strongly inducible, giving rise to two transcripts, approximately 1.3 and 2.3 Kb (FIG. 5C). The shorter transcript was presumably generated from the native transcription initiation site of the WUS gene, in which case the LexA operator sequence might serve as an enhancer to the WUS promoter. On the other hand, the longer transcript might represent transcription from the O LexA -46 promoter. This suggests that the O LexA -46 sequence can serve as a functional promoter, as well as a transcriptional enhancer for activation tagging.
  • the LEC1 gene normally expressed only in embryos and seeds (Lotan et al., 1998), was highly expressed in 20-30-day-old explants, a stage when somatic embryos and derived seedlings were generated.
  • FIG. 7B shows LEC1 expression from 14 days until 28 days when pga6-dependent somatic embryogenesis takes places. LEC1 expression, however, was dramatically decreased upon reactivation of WUS expression (FIG. 7B). No alteration of LEC1 expression was detected when the explants/calli were transferred onto the control medium for an additional two days, suggesting that the LEC1 repression was a specific response to the 17- ⁇ -estradiol induced WUS expression.
  • LEC1 expression in pga6 explants was not a direct response to WUS overexpression but rather a consequence of the pga6 somatic embryo development.
  • a developmental path redefined by WUS overexpression leads to the repression of LEC1, a gene presumably involved in embryo maturation.
  • somatic embryos Although we were able to generate somatic embryos from various pga6 tissues/organs in the absence of any external hormone, the frequency of somatic embryo formation appears to be lower compared to that observed in our original screening conditions, under which a 2,4-D pretreatment was included.
  • pga6 root explants were cultured on MS medium with 0.5 mg/L 2,4-D for 5 days prior to being transferred to an MS medium with or without 10 ⁇ M 17- ⁇ -estradiol. No somatic embryo formation was observed in the medium without the inducer, whereas numerous somatic embryos were generated after 2-3 weeks culturing in the presence of the inducer. As shown above (see Example 7 and FIGS.
  • the XVE vector pER10 is identical to pER 8 except that the hygromycin resistance marker is replaced with a kanamycin-resistance marker (Zuo et al., 2000(a)).
  • Full length WUS cDNA was placed under the control of the XVE system in pER10.
  • Stem segments derived from the pER10-WUS transgenic plants were pre-cultured on the MS medium with 0.5 mg/L 2,4-D for 5 days and then transferred to an MS medium with or without 10 ⁇ M 17- ⁇ -estradiol. No somatic embryo was observed in medium in the absence of the inducer, whereas with the inducer, many somatic embryos were generated after 2-3 weeks of culture.
  • the G10-90 promoter in the XVE vector can be replaced with a tissue-specific promoter (e.g. a pollen-, root- stem- or leaf-specific promoter).
  • tissue-specific promoter e.g. a pollen-, root- stem- or leaf-specific promoter.
  • tissue specific promoters are well known to those of skill in the art. Because expression of a transgene is activated by the chimeric XVE gene which is controlled by a tissue-specific promoter in this Example, the O lexA -46 promoter controlling the WUS transgene is therefore tissue-specific in an inducer-dependent manner. This means that WUS will be induced only in the presence of an inducer and only in the specific tissue corresponding to the tissue specific promoter. Appropriate tissues or cell types, can then be collected from the transgenic plants and used for induction of somatic embryos as described in Examples 10 and 11.
  • progeny plants generated from pollen-derived somatic embryos should be haploid instead of diploid (see, e.g., Twell et al., 1989 and Twell et al., 1990 for pollen specific promoters).
  • a transgenic plant having in its genome a Wuschel (WUS) gene under the control of an inducible, pollen-specific promoter would not normally express the gene.
  • Pollen from such a plant can be cultured in the presence of the inducer until somatic embryogenesis occurs, after which the inducer is removed and the haploid embryos are permitted to develop into haploid clones according to standard techniques.
  • the pER10-WUS vector can be used directly for transformation of explants without the use of an antibiotic resistance marker. Somatic embryos that formed in the presence of an inducer but in the absence of cytokinin should be transformants, because under such conditions non-transformants will be incapable of forming somatic embryos nor shoots due to the lack of induced WUS gene expression. Upon inducer removal, the embryos and shoots will develop into normal and fertile plants.
  • the vector can include any gene or genes which are desired to be present in the transformed plants and these can be under the control of a desired promoter. The plants selected as a result of selecting for inducible WUS expression-dependent somatic embryos or shoots will contain the desired gene or genes.
  • the WUS transgene can be placed into a vector comprising a means of removing the WUS transgene as well as other portions of the vector which are no longer desired, e.g., using the XVE-Cre/lox system (Zuo et al., 2001).
  • a vector comprising a means of removing the WUS transgene as well as other portions of the vector which are no longer desired, e.g., using the XVE-Cre/lox system (Zuo et al., 2001).
  • Zygote embryos at late heart stage were isolated from young siliques of PGA6 plants and transferred to either non-inductive medium (MICK: MS salts, 30 g/L sucrose, 0.15 mg/L IAA, 100 mg/L carbenicillin, 50 mg/L kanamycin, and 0.25% phytagel, pH 5.7) or inductive medium (MICK plus 10.0 ⁇ M 17- ⁇ -estradiol).
  • MICK MS salts, 30 g/L sucrose, 0.15 mg/L IAA, 100 mg/L carbenicillin, 50 mg/L kanamycin, and 0.25% phytagel, pH 5.7
  • inductive medium MICK plus 10.0 ⁇ M 17- ⁇ -estradiol
  • Apomixis can be induced by introducing WUS into a plant cell in such a manner that the WUS gene is expressed in the appropriate tissues (e.g., nucellus tissue). This can be by means of, but is not limited to, placing the WUS gene under the control of a tissue-specific promoter (e.g., a nucellus-specific promoter), an inducible promoter, or a promoter that is both inducible and tissue-specific. Inducing expression of the WUS gene, e.g. in the nucellus, produces apomixis leading to an apomictic plant. This plant may then be used to establish a true-breeding plant line.
  • tissue-specific promoter e.g., a nucellus-specific promoter
  • an inducible promoter e.g., a promoter that is both inducible and tissue-specific.
  • the vector utilized to transfer WUS into the plant cell can include any other desired heterologous gene in addition to WUS, including but not limited to, a marker gene or a gene to confer a desirable trait upon the plant, e.g., a gene resulting in larger plants, faster growth, resistance to stress, etc. This would lead to the development of an apomictic line with the desired trait.
  • plant expression cassettes including but not limited to monocot or dicot expression cassettes, directing WUS expression to the inner integument or nucellus can easily be constructed.
  • An expression cassette directing expression of the WUS DNA sequences to the nucellus was made using the barley Nuc1 promoter (Doan et al., 1996). The expression was used for plant transformation. Other genes which confer desirable traits can also be included in the cassette.
  • transgenic plants carrying the expression cassette will then be capable of producing de novo embryos from WUS expressing nucellar cells. In the case of maize, this is complemented by pollinating the ears to promote normal central cell fertilization and endosperm development.
  • Nuc1:WUS transformations could be done using a fie (fertility-independent endosperm)-null genetic background which would promote both de novo embryo development and endosperm development without fertilization (Ohad et al., 1999). Upon microscopic examination of the developing embryos it will be apparent that apomixis has occurred by the presence of embryos budding off the nucellus.
  • the WUS DNA sequences could be delivered as described above into a homozygous zygotic-embryo-lethal genotype. Only the adventive embryos produced from somatic nucellus tissue would develop in the seed.
  • Clark, S. E. Cell signalling at the shoot meristem. Nat. Rev. Mol. Cell Biol., 2001. 2: p. 276-284.
  • Lotan, T., Ohto, M., Yee, K. M., West, M. A., Lo, R., Kwong, R. W., Yamagishi, K., Fischer, R. L., Goldberg, R. B., and Harada, J. J., Arabidopsis LEAFY COTYLEDON 1 is sufficient to induce embryo development in vegetative cells. Cell, 1998. 93: p. 1195-1205.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
US09/984,274 2001-10-29 2001-10-29 Promotion of somatic embryogenesis in plants by wuschel gene expression Abandoned US20030082813A1 (en)

Priority Applications (20)

Application Number Priority Date Filing Date Title
US09/984,274 US20030082813A1 (en) 2001-10-29 2001-10-29 Promotion of somatic embryogenesis in plants by wuschel gene expression
CA2821597A CA2821597C (fr) 2001-10-29 2002-10-28 Activation de l'embryogenese somatique chez les plantes par expression d'un gene wuschel
EP07075071A EP1785481B1 (fr) 2001-10-29 2002-10-28 Promotion de l embryogenese somatique dans les plantes par l'expression du gene Wuschel.
ES02776339T ES2286290T3 (es) 2001-10-29 2002-10-28 Promocion de embriogenesis somatica en plantas mediante la expresion del gen wuschel.
MXPA04004003A MXPA04004003A (es) 2001-10-29 2002-10-28 Promocion de la embriogenesis somatica en vegetales mediante la expresion de un gene de wuschel.
DE60219673T DE60219673T2 (de) 2001-10-29 2002-10-28 Förderung der somatischen embryogenese in pflanzen durch wuschel-genexpression
CA2464147A CA2464147C (fr) 2001-10-29 2002-10-28 Activation de l'embryogenese somatique chez les plantes par expression d'un gene wuschel
EP02776339A EP1451301B1 (fr) 2001-10-29 2002-10-28 Activation de l'embryogenese somatique chez les plantes par expression d'un gene wuschel
AT07075071T ATE452966T1 (de) 2001-10-29 2002-10-28 Förderung der somatische embryogenese in pflanzen durch die expression des wuschel gens
DE60234877T DE60234877D1 (de) 2001-10-29 2002-10-28 Förderung der Somatische Embryogenese in Pflanzen durch die Expression des Wuschel Gens
AU2002342173A AU2002342173B2 (en) 2001-10-29 2002-10-28 Promotion of somatic embryogenesis in plants by wuschel gene expression
PCT/US2002/034534 WO2003037072A2 (fr) 2001-10-29 2002-10-28 Activation de l'embryogenese somatique chez les plantes par expression d'un gene wuschel
AT02776339T ATE360060T1 (de) 2001-10-29 2002-10-28 Förderung der somatischen embryogenese in pflanzen durch wuschel-genexpression
US10/956,120 US7700829B2 (en) 2001-10-29 2004-10-04 Promotion of somatic embryogenesis in plants by wuschel gene expression
AU2007201633A AU2007201633B2 (en) 2001-10-29 2007-04-13 Promotion of somatic embryogenesis in plants by wuschel gene expression
US12/722,981 US7816580B2 (en) 2001-10-29 2010-03-12 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US12/888,636 US7977534B2 (en) 2001-10-29 2010-09-23 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/164,904 US8101821B2 (en) 2001-10-29 2011-06-21 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/347,839 US8431773B2 (en) 2001-10-29 2012-01-11 Promotion of somatic embryogenesis in plants by wuschel gene expression
US13/856,623 US8581037B2 (en) 2001-10-29 2013-04-04 Promotion of somatic embryogenesis in plants by Wuschel gene expression

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US09/984,274 US20030082813A1 (en) 2001-10-29 2001-10-29 Promotion of somatic embryogenesis in plants by wuschel gene expression

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/956,120 Division US7700829B2 (en) 2001-10-29 2004-10-04 Promotion of somatic embryogenesis in plants by wuschel gene expression

Publications (1)

Publication Number Publication Date
US20030082813A1 true US20030082813A1 (en) 2003-05-01

Family

ID=25530423

Family Applications (7)

Application Number Title Priority Date Filing Date
US09/984,274 Abandoned US20030082813A1 (en) 2001-10-29 2001-10-29 Promotion of somatic embryogenesis in plants by wuschel gene expression
US10/956,120 Expired - Lifetime US7700829B2 (en) 2001-10-29 2004-10-04 Promotion of somatic embryogenesis in plants by wuschel gene expression
US12/722,981 Expired - Fee Related US7816580B2 (en) 2001-10-29 2010-03-12 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US12/888,636 Expired - Fee Related US7977534B2 (en) 2001-10-29 2010-09-23 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/164,904 Expired - Fee Related US8101821B2 (en) 2001-10-29 2011-06-21 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/347,839 Expired - Lifetime US8431773B2 (en) 2001-10-29 2012-01-11 Promotion of somatic embryogenesis in plants by wuschel gene expression
US13/856,623 Expired - Lifetime US8581037B2 (en) 2001-10-29 2013-04-04 Promotion of somatic embryogenesis in plants by Wuschel gene expression

Family Applications After (6)

Application Number Title Priority Date Filing Date
US10/956,120 Expired - Lifetime US7700829B2 (en) 2001-10-29 2004-10-04 Promotion of somatic embryogenesis in plants by wuschel gene expression
US12/722,981 Expired - Fee Related US7816580B2 (en) 2001-10-29 2010-03-12 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US12/888,636 Expired - Fee Related US7977534B2 (en) 2001-10-29 2010-09-23 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/164,904 Expired - Fee Related US8101821B2 (en) 2001-10-29 2011-06-21 Promotion of somatic embryogenesis in plants by Wuschel gene expression
US13/347,839 Expired - Lifetime US8431773B2 (en) 2001-10-29 2012-01-11 Promotion of somatic embryogenesis in plants by wuschel gene expression
US13/856,623 Expired - Lifetime US8581037B2 (en) 2001-10-29 2013-04-04 Promotion of somatic embryogenesis in plants by Wuschel gene expression

Country Status (9)

Country Link
US (7) US20030082813A1 (fr)
EP (2) EP1785481B1 (fr)
AT (2) ATE360060T1 (fr)
AU (1) AU2002342173B2 (fr)
CA (2) CA2821597C (fr)
DE (2) DE60234877D1 (fr)
ES (1) ES2286290T3 (fr)
MX (1) MXPA04004003A (fr)
WO (1) WO2003037072A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7148402B2 (en) 2004-05-21 2006-12-12 Rockefeller University Promotion of somatic embryogenesis in plants by PGA37 gene expression
US20090328252A1 (en) * 2004-02-02 2009-12-31 Pioneer Hi-Bred International, Inc. Ap2 domain transcription factor odp2 (ovule development protein 2) and methods of use
US20110165679A1 (en) * 2009-12-30 2011-07-07 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted polynucleotide modification
US20110167516A1 (en) * 2009-12-30 2011-07-07 Pioneer Hi-Bred International, Inc. Methods and compositions for the introduction and regulated expression of genes in plants
US20170121722A1 (en) * 2015-10-30 2017-05-04 Pioneer Hi-Bred International, Inc. Methods and compositions for rapid plant transformation

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7256322B2 (en) 1999-10-01 2007-08-14 Pioneer Hi-Bred International, Inc. Wuschel (WUS) Gene Homologs
AU2006254350B2 (en) * 2005-05-31 2011-05-12 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Method of producing haploid and doubled haploid plant embryos
US8878002B2 (en) 2005-12-09 2014-11-04 Council Of Scientific And Industrial Research Nucleic acids and methods for producing seeds with a full diploid complement of the maternal genome in the embryo
US8586824B2 (en) 2006-02-13 2013-11-19 Temasek Life Sciences Laboratory Plant homeodomain protein-encoding genes and their uses
WO2013103365A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteurs de pollen préférés et procédés d'utilisation
BR112014016785A2 (pt) * 2012-01-06 2020-11-03 Pioneer Hi-Bred International, Inc construto de expressão, célula de planta, planta ou semente, método para promover um estado, método para expressar um polipeptídeo de rkd
US10125371B2 (en) * 2013-11-22 2018-11-13 Bangladesh Jute Research Institute Nucleotide sequence encoding WUSCHEL-related homeobox4 (WOX4) protein from Corchorus olitorius and Corchorus capsularis and methods of use for same
CN111465321B (zh) 2017-10-13 2022-12-06 先锋国际良种公司 用于植物细胞的细胞重编程的系统和方法
EP3827665A1 (fr) * 2019-11-26 2021-06-02 Consejo Superior de Investigaciones Científicas (CSIC) Inhibiteurs de kinases de mammifères pour favoriser l'induction de l'embryogenèse in vitro des plantes
US20210285006A1 (en) * 2020-03-10 2021-09-16 Pioneer Hi-Bred International, Inc. Systems and methods for high-throughput automated clonal plant production
CN111972289A (zh) * 2020-08-24 2020-11-24 云南农业大学 一种诱导椪柑成熟果实胚乳产生愈伤组织的方法

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5811636A (en) 1995-09-22 1998-09-22 The United States Of America As Represented By The Secretary Of Agriculture Apomixis for producing true-breeding plant progenies
US5710367A (en) 1995-09-22 1998-01-20 The United States Of America As Represented By The Secretary Of Agriculture Apomictic maize
US6028185A (en) 1998-01-07 2000-02-22 The United States Of America As Represented By The Secretary Of Agriculture Nucleic acid markers for apospory-specific genomic region
US6239327B1 (en) 1998-04-16 2001-05-29 Cold Spring Harbor Laboratory Seed specific polycomb group gene and methods of use for same
US6229064B1 (en) 1998-05-01 2001-05-08 The Regents Of The University Of California Nucleic acids that control endosperm development in plants
US7238860B2 (en) * 2001-04-18 2007-07-03 Mendel Biotechnology, Inc. Yield-related polynucleotides and polypeptides in plants
GB9823098D0 (en) 1998-10-22 1998-12-16 Novartis Ag Organic compounds
US6512224B1 (en) 1999-07-21 2003-01-28 The Charles Stark Draper Laboratory, Inc. Longitudinal field driven field asymmetric ion mobility filter and detection system
AU7727000A (en) * 1999-09-30 2001-04-30 E.I. Du Pont De Nemours And Company Wuschel (wus) gene homologs
US7256322B2 (en) * 1999-10-01 2007-08-14 Pioneer Hi-Bred International, Inc. Wuschel (WUS) Gene Homologs

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10954525B2 (en) 2004-02-02 2021-03-23 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (Ovule Development Protein 2) and methods of use
US10954524B2 (en) 2004-02-02 2021-03-23 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US10113175B2 (en) 2004-02-02 2018-10-30 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US20090328252A1 (en) * 2004-02-02 2009-12-31 Pioneer Hi-Bred International, Inc. Ap2 domain transcription factor odp2 (ovule development protein 2) and methods of use
US10947550B2 (en) 2004-02-02 2021-03-16 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US8420893B2 (en) 2004-02-02 2013-04-16 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US20110010795A9 (en) * 2004-02-02 2011-01-13 Pioneer Hi-Bred International, Inc. Ap2 domain transcription factor odp2 (ovule development protein 2) and methods of use
US9340796B2 (en) 2004-02-02 2016-05-17 Pioneer Hi Bred International Inc AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US10125372B2 (en) 2004-02-02 2018-11-13 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US7148402B2 (en) 2004-05-21 2006-12-12 Rockefeller University Promotion of somatic embryogenesis in plants by PGA37 gene expression
US20110165679A1 (en) * 2009-12-30 2011-07-07 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted polynucleotide modification
US8704041B2 (en) 2009-12-30 2014-04-22 Pioneer Hi Bred International Inc Methods and compositions for targeted polynucleotide modification
US10443064B2 (en) 2009-12-30 2019-10-15 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted polynucleotide modification
US9765352B2 (en) 2009-12-30 2017-09-19 E I Du Pont De Nemours And Company Methods and compositions for the introduction and regulated expression of genes in plants
US20110167516A1 (en) * 2009-12-30 2011-07-07 Pioneer Hi-Bred International, Inc. Methods and compositions for the introduction and regulated expression of genes in plants
US10968458B2 (en) 2009-12-30 2021-04-06 Pioneer Hi-Bred International, Inc. Methods and compositions for the introduction and regulated expression of genes in plants
US11512321B2 (en) 2009-12-30 2022-11-29 E. I. Du Pont De Nemours And Company Methods and compositions for the introduction and regulated expression of genes in plants
US9926571B2 (en) 2009-12-30 2018-03-27 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted polynucleotide modification
US20170121722A1 (en) * 2015-10-30 2017-05-04 Pioneer Hi-Bred International, Inc. Methods and compositions for rapid plant transformation
AU2016346630B2 (en) * 2015-10-30 2022-02-03 Pioneer Hi-Bred International, Inc. Methods and compositions for rapid plant transformation
US20220124998A1 (en) * 2015-10-30 2022-04-28 Pioneer Hi-Bred International, Inc. Methods and compositions for rapid plant transformation
US11330776B2 (en) * 2015-10-30 2022-05-17 Pioneer Hi-Bred International, Inc. Methods and compositions for rapid plant transformation

Also Published As

Publication number Publication date
US20120102594A1 (en) 2012-04-26
DE60219673D1 (de) 2007-05-31
US7816580B2 (en) 2010-10-19
ES2286290T3 (es) 2007-12-01
US7977534B2 (en) 2011-07-12
WO2003037072A2 (fr) 2003-05-08
US20100169997A1 (en) 2010-07-01
AU2002342173B2 (en) 2007-01-18
US8101821B2 (en) 2012-01-24
US20110078823A1 (en) 2011-03-31
MXPA04004003A (es) 2004-10-29
CA2464147A1 (fr) 2003-05-08
US20110252506A1 (en) 2011-10-13
CA2821597A1 (fr) 2003-05-08
EP1785481B1 (fr) 2009-12-23
US8431773B2 (en) 2013-04-30
WO2003037072A3 (fr) 2003-10-16
US20130205442A1 (en) 2013-08-08
EP1785481A1 (fr) 2007-05-16
US20050071898A1 (en) 2005-03-31
ATE360060T1 (de) 2007-05-15
DE60219673T2 (de) 2007-08-16
US7700829B2 (en) 2010-04-20
DE60234877D1 (de) 2010-02-04
EP1451301A2 (fr) 2004-09-01
CA2821597C (fr) 2018-01-02
EP1451301B1 (fr) 2007-04-18
EP1451301A4 (fr) 2005-03-16
US8581037B2 (en) 2013-11-12
CA2464147C (fr) 2013-02-12
ATE452966T1 (de) 2010-01-15

Similar Documents

Publication Publication Date Title
US8581037B2 (en) Promotion of somatic embryogenesis in plants by Wuschel gene expression
Zuo et al. The WUSCHEL gene promotes vegetative‐to‐embryonic transition in Arabidopsis
WO2005112609A2 (fr) Promotion de l'embryogenese somatique chez les plantes par l'expression du gene pga37
AU2002342173A1 (en) Promotion of somatic embryogenesis in plants by wuschel gene expression
US20120192308A1 (en) Method for Providing Fertile Plants via Induction of BBM During Transformation
EP0951558B1 (fr) Procedes permettant de produire des plantes transgeniques parthenocarpiques ou femelles steriles
Heidmann et al. A protocol for transformation and regeneration ofAntirrhinum majus.
US20060041959A1 (en) Control of plant growth and developmental process
AU2007201633B2 (en) Promotion of somatic embryogenesis in plants by wuschel gene expression

Legal Events

Date Code Title Description
AS Assignment

Owner name: ROCKEFELLER UNIVERSITY, THE, NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FRUGIS, GIOVANNA;CHUA, NAM-HAI;ZUO, JIANRU;AND OTHERS;REEL/FRAME:012523/0750;SIGNING DATES FROM 20020102 TO 20020128

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION