US20020193309A1 - FGF9 as a specific ligand for FGFR3 - Google Patents

FGF9 as a specific ligand for FGFR3 Download PDF

Info

Publication number
US20020193309A1
US20020193309A1 US10/212,357 US21235702A US2002193309A1 US 20020193309 A1 US20020193309 A1 US 20020193309A1 US 21235702 A US21235702 A US 21235702A US 2002193309 A1 US2002193309 A1 US 2002193309A1
Authority
US
United States
Prior art keywords
fgf9
fgfr3
gly
leu
heparin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/212,357
Inventor
Avner Yayon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yeda Research and Development Co Ltd
Original Assignee
Yeda Research and Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research and Development Co Ltd filed Critical Yeda Research and Development Co Ltd
Priority to US10/212,357 priority Critical patent/US20020193309A1/en
Publication of US20020193309A1 publication Critical patent/US20020193309A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966Animal cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475Assays involving growth factors
    • G01N2333/50Fibroblast growth factors [FGF]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/912Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205Phosphotransferases in general
    • G01N2333/9121Phosphotransferases in general with an alcohol group as acceptor (2.7.1), e.g. general tyrosine, serine or threonine kinases

Definitions

  • the present invention concerns fibroblast growth factor 9 (FGF9), a novel high affinity ligand for fibroblast growth factor receptor 3 (FGFR3), methods for detecting FGFR3 using said ligand and pharmaceutical compositions for modulating FGFR3 activity comprising FGF9, an antagonist thereof, or FGF9 binding-agents.
  • FGF9 fibroblast growth factor 9
  • FGFR3 fibroblast growth factor receptor 3
  • Fibroblast growth factors comprise a family of at least nine multifunctional polypeptides involved in a variety of biological processes including morphogenesis, angiogenesis and tissue remodeling. They stimulate the proliferation of cells from mesenchymal to epithelial and neuroectodermal origin. FGFs share structural similarity, but differ in their target specificity and spatial and temporal expression pattern.
  • FGF receptor FGFR
  • FGFR FGF receptor genes encoding transmembrane protein tyrosine kinases, have been cloned and identified in mammals and their homologues described in birds, Xenopus and Drosophila (Givol and Yayon, FASEB J., 6:33623369 (1992)).
  • FGFs bind tightly to low affinity, high capacity binding sites identified as heparan sulfate proteoglycans (HSPGs). These heparan sulfates modulate FGF-receptor binding and biological activity and serve as an obligatory integral component in the formation of a functional tertiary complex between FGF, FGFR and the appropriate HSPG.
  • HSPGs heparan sulfate proteoglycans
  • FGF function In light of the large number of ligand and receptor variants, a major question regarding FGF function is their ligand-receptor specificity. Both FGFR1 and FGFR2 bind acidic FGF/FGF1 and basic FGF/FGF2 with similar affinity (Dionne et al., EMBO J., 9:2685-2692 (1990)). In fact all FGFRs tested so far bind FGF1 and FGF4 (hst/kfgf) with moderate to high affinity, demonstrating an apparent redundancy in the FGF system. In contrast to FGFRs 1 and 2, FGFR3 was found to bind only FGF1 and FGF4 albeit with moderate affinity (Ornitz and Leder, J.
  • a heparin-binding, glia-activating factor purified from the culture supernatant of a human glioma cell-line was found, by a homology search, to be the ninth member of the FGF family and was thus termed FGF9.
  • Human FGF9 was found to code for a 208 amino acid protein and presents a unique spectrum of biological activity as it stimulates the proliferation of glial cells, PC-12 cells and BALB/C 3T3 fibroblasts, but nevertheless is not mitogenic for endothelial cells (Miyamote et al., Mol. Cell Biol., 13(7):4251-4259 (1993): Naro et al., J. Biol. Chem., 267:16305-16311 (1993)).
  • the present invention is based on the surprising finding that fibroblast growth factor 9 (FGF9) is a high affinity (kD: 0.25 nM) ligand for fibroblast growth factor receptor 3 (FGFR3) which does not bind to FGFR1 or FGFR4 and binds to FGFR2 only at a substantially lower affinity.
  • FGF9 fibroblast growth factor 9
  • FGFR3 fibroblast growth factor receptor 3
  • the present invention provides for the first time a specific ligand for FGFR3 being a fibroblast growth factor 9 (FGF9).
  • This specific FGFR3 ligand may be used both for detection and for therapeutical treatment purposes.
  • This specific novel ligand for FGFR3 may be used in a method for the detection of FGFR3 in a sample or tissue comprising:
  • the sample may be a sample of body fluid such as blood, in which soluble FGFR3 is present and the tissue may be a tissue obtained from a patient, for example by cartilage biopsy or alternatively, may be a tissue within the body of an individual and in such a case the detection is carried out in vivo.
  • Detection may be carried out for example by labelling the FGF9 with a suitable detectable label, and then determining whether any label is bound to proteins in the sample or to the surface of cells in the tissue which is assayed for the presence of FGFR3.
  • detection may be carried out by using labeled antibodies against FGF9, capable of recognizing FGF9 which is bound to FGFR3.
  • FGF9 is a heparin-dependent ligand for FGFR3.
  • heparin would also be present in the detection medium.
  • FGF9 not only specifically binds to the FGFR-3, but also specifically activates this receptor without activating the FGFR1 and FGFR4 receptors and, if appropriate concentrations are chosen, without significantly activating FGFR2.
  • This finding leads to the preparation of pharmaceutical compositions comprising a pharmaceutically acceptable carrier and as an active ingredient a therapeutically effective amount of FGF9.
  • Such a pharmaceutical compositions may be used for stimulating the activity of FGFR3.
  • compositions comprising a pharmaceutically acceptable carrier and as an active ingredient an antagonist of the FGF9, or an FGF9 binding agent an example being an antibody against FGF9.
  • compositions comprising an antagonist of FGF9 may be used to attenuate directly the activity of the FGFR3, and pharmaceutical compositions comprising an FGF9 binding agent such as an antibody against FGF9, may neutralize circulating native FGF9 and thus attenuate indirectly the activity of FGFR3.
  • the pharmaceutical composition comprising as an active ingredient FGF9, which stimulates the activity of FGFR3, may be used in order to encourage cartilage and bone repair, for example by administration to the site of injury.
  • FGF9 may serve to stabilize FGFR3 and thus prolong the period in which it is active prior to differentiation.
  • FGF9 has also a chemotactic affect of FGFR3-carrying cells and can promote migration of such FGFR3 carrying cells, typically mesenchymal stem cells, to a desired site, for example, by injection of FGF9 to the growth plate top of the column.
  • FGFR3 after the stage of initial differentiation of bone and cartilage cells, leads to halted growth, and is probably the cause of achondroplasia.
  • a pharmaceutical composition comprising as an active ingredient an antagonist of FGF9 which attenuates the activity of FGFR3, or comprising an FGF9 binding agent (such as an antibody against FGF9), which neutralizes native circulating FGF9, should be used in cases of overactivity of the FGFR3 receptor in differentiated tissues, which causes bone and cartilage growth arrest.
  • Such bone and cartilage growth arrest may lead to achondroplasia dwarfism, or other abnormalities of bone and cartilage growth, for example, multiple hereditary exostosis, solitary hereditary exostosis, hallux valgus deformity, synovial chondromatosis and endochondromas.
  • the above conditions may be treated with a pharmaceutical composition comprising either an antagonist of FGF9, or an FGF9 binding agents capable of neutralizing native circulating FGF9, which both serve to attenuate the activity of the FGFR3.
  • the present invention also concerns a novel recombinant mouse FGF9, and a novel recombinant chicken FGF9, as well as DNA sequences coding for these novel recombinant proteins.
  • the present invention still further concerns an expression vector comprising the sequence of FGF9 under the expression control of a strong promoter such as the CMV or SV40 or a cartilage/bone promoter such as collagen type-2 promoter.
  • a strong promoter such as the CMV or SV40 or a cartilage/bone promoter such as collagen type-2 promoter.
  • Such an expression vector may be used to produce a transgenic mammal, which over-expresses FGF9, leading to overactivation of the FGFR3 receptor and thus to halted growth.
  • Such an animal may serve as a model for diseases and disorders resulting from halted growth, such as genetic achondroplasia.
  • FIG. 1 Nucleotide and amino acid sequences of mouse FGF9. The nucleotide sequence of FGF9:pET-3C and deduced amino acid sequence are shown.
  • FIG. 2 Nucleotide and amino acid sequences of chicken FGF9. The nucleotide sequence of FGF9:pET-3C and deduced amino acid sequence are shown.
  • FIGS. 3A, 3B, 3 C shows comparison of amino acid and nucleotide sequences of mouse, rat and human FGF9.
  • FIG. 4 Purification of FGF9.
  • Partially purified FGF9 was bound to heparin sepharose and eluted with a 0.2-2 M salt gradient, protein amount was estimated by spectrophotometer (A).
  • A spectrophotometer
  • 10 ml of each fraction were resolved on 15% SDS PAGE, transferred to nitrocellulose and immunoblotted with specific antibodies (anti SP32) (B).
  • B specific antibodies
  • C The purity of the fractions was tested by silver staining of 5 ml of each fraction resolved on 15% SDS PAGE (C).
  • FIG. 5 FGF9 binding specificity.
  • Purified FGF9 was immobilized on heparin sepharose beads and its ability to bind the soluble extracellular domain of different FGFRs coupled to alkaline phosphatase was tested (A). The amounts of FGFRs were estimated according to alkaline phosphatase activity (B). Equal amounts of soluble extracellular domain of FGFRs 1, 2, 2-IIIb, 3, 3-IIIb and 4 alkaline phosphatase fusion proteins, were immunoprecipitated with anti alkaline phosphatase antibodies. Binding and cross-linking of 125 I-FGF9 in the presence or absence of 0.5 ⁇ g/ml heparin and hundred fold excess unlabeled FGF9 (Ex. cold) was done as described under materials and methods.
  • FIG. 6 Analysis of FGF9 binding to soluble FGFR2 and FGFR3. Binding of increasing concentrations of 125 I-FGF9 to soluble extracellular domain of FGFR2 (A) and FGFR3 (B) adsorbed to maxisorb plate was done as described under materials and methods. Binding results were analyzed by Scatchard analysis (inserts).
  • FIG. 7 Heparin dependent cross-linking of FGF9 to FGFR3 expressing CHO cells. Monolayers of FGFR3 transfected KI and A745 CHO cells were incubated at 40° C. with 5 ng/ml 125 I-FGF9 in the presence or absence of 1 mg/ml heparin and 100-fold excess of unlabeled FGF9 (Ex. cold) as indicated. Cross-linking and electrophoresis separation were done as described under materials and methods.
  • FIG. 8 Heparin and heparin fragments dependent FGF9 induced DNA synthesis. Monolayers of FGFR3 transfected CHO-A745 cells were serum starved and incubated with 10 ng/ml FGF9 and the indicated amount of heparin (A) or 2 mg/ml of heparin fragment (B) at the indicated number of monosaccharide units.
  • FIG. 9 Plasmid of FGF9 under control of collagen type-2 promoter.
  • Polyclonal anti FGF9 antibodies were generated by injecting New Zealand white rabbits and collecting serum after two additional boosts.
  • Anti FGF9 antibodies were prepared against two peptides (SP3.1: Cys-Ser-Asn-Leu-Tyr-Lys-His-Val-Gln-Thr-Gly-Arg-Arg-Tyr, SP32: Asp-His-Leu-Lys-Gly-Ile-Leu-Arg-Arg-Arg-Gln-Leu-Tyr-Cys) coupled to KLH (keyhole lympet hemocyanin) by MBS. Serum obtained was further purified on protein A sepharose (Repligen) to obtain the IgG fraction.
  • SP3.1 Cys-Ser-Asn-Leu-Tyr-Lys-His-Val-Gln-Thr-Gly-Arg-Arg-Tyr
  • SP32 Asp-His-Leu-Lys-Gly-Ile-Leu-
  • Recombinant murine FGF9 was labeled with Na 125 I (0.5 mCi) using the Chloramine-T method and separated from free iodine on a heparin-sepharose column.
  • the range of specific activity was 0.5-2 ⁇ 10 5 cpm/ng.
  • RNA extracted from a 12.5 day old mouse embryo was used for polymerase chain reaction (PCR) based cloning of FGF9.
  • Primer specific for the human FGF9 forward: GGGAATTCCATATGGCTCCCTTAGGTGAAG; backward: CGGGATCCTCAACFTTGGCTTAGAATATCC
  • a single DNA product with an expected size of 630 bp was obtained and was used directly for subcloning into pET-3C bacterial expression vector (Novagene).
  • FGF9:pET-3C plasmid was used to transform B1-21 strain of E. coli. At logarithmic growth phase the transformed bacteria were induced with 1 mM IPTG for 2 hours, precipitated by centrifugation at 7000 RPM and sonicated 3 ⁇ 15′′ using probe sonicator (Soniprep150, MSE) on ice.
  • the supernatant obtained by centrifugation of the bacterial sonicate was loaded onto a heparin-sepharose column (Pharmacia, Upsala, Sweden) and the column was washed extensively with 10 column volumes of 0.15 M NaCl, 0.05% Chaps, 20 mM Tris pH 7.4, and 10 column volumes of 0.7 M NaCl, 0.05% Chaps, 20 mM Tris pH 7.4.
  • Mouse FGF9 (mFGF9) was cloned by PCR on cDNA prepared from 12.5 days mouse embryos RNA. Mouse FGF9 cDNA shares 93 and 98% sequence homology with human and rat FGF9 respectively (FIGS. 3 A- 3 C). The amino acid sequence of mFGF9 is identical to that of the rat FGF9 and differs from human FGF9 in one amino acid only having a serine at position 9 instead of an asparagine. Recombinant mouse-FGF9 was expressed in B1-21 strain of E. coli and purified from the bacteria lysate by two cycles on a heparin-sepharose column.
  • FGF9 elutes from heparin sepharose with 1.0-1.2 M NaCl as determined by adsorbance at 280 nM (FIG. 4A). The presence of FGF9 in the fractions was tested by an immunoblot using polyclonal antibodies directed against FGF9 specific peptides, demonstrating a major protein band at the expected molecular weight for a non-glycosylated protein of 27 kDal (FIG. 4B). The purity of each preparation was further assessed by silver stain (FIG. 4C).
  • Recombinant mouse FGF9 is biologically active and stimulates DNA synthesis in BALB/C 3T3 fibroblasts, in a dose dependent manner, with half maximal 3H-Thymidine incorporation at 0.5 ng/ml (not shown), similar to that obtained for purified human FGF9 (Nauro, et al., J. Biol. Chem., 267:16305-16311 (1993)).
  • Receptor protein content was estimated by alkaline phosphatase activity which was monitored spectro-photometrically at 405 nm using para-nitrophenyl phosphate as a substrate, essentially as described (Lev et al., supra).
  • the soluble receptor binding reaction mixture included receptor-AP conditioned medium, radiolabeled ligand and heparin or other HSPGs.
  • the bound complex was immunoprecipitated with anti-alkaline phosphatase polyclonal antibodies (Zymed) and protein A-Sepharose (Repligen). All components are mixed at room temperature in a total volume of 250 ml of binding buffer (DMEM supplemented with 25 mM Hepes pH 7.4 and 0.1% bovine serum albumin).
  • the binding reaction was allowed to proceed for 2 h at room temperature.
  • Bound ligand was recovered by centrifuging for 10 s at 6000 rpm in a microcentrifuge ( ⁇ 2000 g) and washing three times with a solution of 150 nM NaCl, 0.1% Triton-X-100 and 50 mM Hepes pH 7.4 (HNTG).
  • 125 I-bound factor was determined by counting the tubes directly in a gamma-counter.
  • For cross-linking after washing 0.15 mM disuccinimidyl suberate (DSS) or 1 mM Bis(sulfosuccinimidyl)suberate (BS3) was added in phosphate buffered saline (PBS) for 30 min at room temperature.
  • DSS disuccinimidyl suberate
  • BS3 phosphate buffered saline
  • the complexes were washed twice with PBS, and boiled for 5 min with sample buffer.
  • the samples were separated by electroporation under reducing conditions on SDS-polyacrylamide gel, the gel was dried and exposed to Kodak (Eastman Kodak Co., Rochester, N.Y.) X-Omat AR film.
  • 96-well maxisorb plates pre-coated overnight with monoclonal anti-human placental alkaline phosphatase antibodies (Sigma Chemicals, Israel) were reacted with receptor-AP fusion proteins for 2 h at room temperature. After washing with binding buffer, plates were incubated for 2 h at room temperature with different concentrations of 125 I-labeled FGF9 in the presence or absence of heparin. At the end of the incubation time, the plates were washed twice with binding buffer, and eluted with 1.6 M NaCl in 20 mM sodium acetate pH 4.5. The acid extract was counted in a gamma counter.
  • FGF9 In order to elucidate the receptor binding properties of FGF9, use was made of a series of FGF receptors' ectodomains coupled to human placental alkaline phosphatase. As was previously demonstrated, soluble ectodomains of FGF receptors can successfully and specifically interact with the ligands, thereby providing an excellent tool for the analysis of ligand-receptor specificity (Rimion, D. L, Prof. Clin. Biol. Res. 187, 131-140 (1985), Lev et al, supra). The interaction between FGF9 and the soluble receptors was first analyzed with FGF9 immobilized on heparin-sepharose and measurement of the associated alkaline phosphatase activity.
  • Heparin-sepharose immobilized FGF9 binds FGFR2 and FGFR3 fusion proteins but not FGFR1 or FGFR4 (FIG. 5A). Only the IIIe isoforms of FGFR2 and FGFR3 bind FGF9, while the IIIb isoforms of these receptors do not show any specific binding to FGF9.
  • the interaction of FGF9 with the soluble receptors was further analyzed by direct binding and covalent cross-linking of radiolabeled FGF9 (FIG. 5B).
  • FGF9 binds only to FGFR2 and FGFR3 but not to FGFR1 or FGFR4 and not to any of the IIIb spliced isoforms tested. No significant binding is observed without heparin, indicating its obligatory role in high affinity FGF9-receptor binding.
  • the two covalently linked complexes of FGF9 with FGFR2 and FGFR3 correspond most probably to the monomer and dimer forms of the receptor-ligand complex.
  • Nonspecific binding was considered as the value obtained for high affinity binding in the presence of a 100-fold excess of non-labeled factor.
  • the binding was done in PBS and after 1 h incubation, DSS was added to a final concentration of 0.15 M for 1 h more.
  • the cells were washed twice with PBS, scraped, and lysed in a small volume of lysis buffer containing 150 mM NaCl, 20 mM Tris (pH 8.0), 1 mM MgCl 2 , 0.1 mM ZnCl 2 , 0.5% NP-40, 1 mg of aprotinin, 1 mg/ml leupeptin, and 2 mM PMSF.
  • Binding of FGF9 to FGFR2 is very sensitive to heparin and addition of as little as 0.5 ng/ml heparin causes an apparent increase in binding, with maximal receptor binding at around 5 ng/ml. Binding of FGF9 to FGFR3 however, requires about 20-fold higher levels of free heparin, with maximal receptor binding only at around 100 ng/ml heparin, and with a slight inhibition of binding at heparin concentrations above 500 ng/ml.
  • FGFR3 In order to address the physiological relevance of the in vitro observed high affinity, heparin-dependent interaction of FGF9 with FGFR3, a full length mouse FGFR3 was expressed in wild type (KI) and heparan-sulfate deficient mutant (745 pgs) CHO cells, known to express low levels of endogenous FGFRs (Yayon, A., et al., Cell, 64:841-848 (1991). Whereas untransfected cells displayed neither detectable binding of radiolabeled FGF9 nor covalently cross-linked proteins, FGFR3 transfected CHO-KI cells show a protein band of a 145 kDal, corresponding to a monomer of receptor-FGF9 complex (FIG.
  • Thymidine incorporation into CHO cells was measured using confluent cultures grown in 24 well plates, in F12 medium supplemented with 10% fetal calf serum. The cells were starved for 24 h with no serum and then incubated with or without various concentrations of FGF9 or 10% serum as a control for an additional 14 h, after which 3H-Thymidine (0.5 mCi/ml) was added for additional 2 h. At the end of the incubation, the cells were washed twice with cold PBS, fixed for 20 min with ice-cold 5% trichloroacetic acid, washed with 95% ethanol and dissolved in 0.1 M NaOH. DNA associated radioactivity was measured by liquid scintillation counting.
  • the mouse FGF9 cDNA was sub-cloned using the Ndel/BamH sites of the bacterial expression vector pET-3C. After transformation of BL-21 cells and induction with 1 mM of IPTG, the cells were lysed and FGF9 was purified on a heparin-sepharose column.
  • Full length mouse FGF9 cDNA was subcloned downstream of a splice acceptor site from the collagen IIA1 gene following the collagen IIA1 promoter and cartilage specific enhancer. This construct was linearized and used for injection into fertilized mice eggs for the generation of transgenic mice.
  • Transgenic mice transformed by the vector as described above feature an over-expression of FGF9.
  • the phenotype of these transgenic mice is very similar to that of transgenic mice with FGFR3-Ach mutation (having the FGFR3 mutation of achondroplasia) characterized by an exceptionally small body size with a short tail and short hindlimbs.
  • Such transgenic mice may serve as a model for various types of dwarfism as well as a model for abnormalities resulting from an excess of FGF9.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Endocrinology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Diabetes (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention concerns fibroblast growth factor 9 (FGF9) as a high affinity ligand for fibroblast growth factor receptor 3 (FGFR3) which ligand is capable of binding and activating FGFR3 in a specific manner. The present invention is also directed to methods for detection of FGFR3 by utilizing FGF9, as well as to pharmaceutical compositions for modulating the activity of FGFR3 comprising as an active ingredient FGF9, antagonists thereof or FGF binding agents which are capable of neutralizing native circulating FGF9. The present invention further concerns novel recombinant mouse and chicken FGF9, expression vectors comprising these recombinant FGF9s and a transgenic animal transformed with said expression vectors.

Description

    FIELD OF THE INVENTION
  • The present invention concerns fibroblast growth factor 9 (FGF9), a novel high affinity ligand for fibroblast growth factor receptor 3 (FGFR3), methods for detecting FGFR3 using said ligand and pharmaceutical compositions for modulating FGFR3 activity comprising FGF9, an antagonist thereof, or FGF9 binding-agents. [0001]
  • BACKGROUND OF THE INVENTION
  • Fibroblast growth factors (FGF) comprise a family of at least nine multifunctional polypeptides involved in a variety of biological processes including morphogenesis, angiogenesis and tissue remodeling. They stimulate the proliferation of cells from mesenchymal to epithelial and neuroectodermal origin. FGFs share structural similarity, but differ in their target specificity and spatial and temporal expression pattern. Four FGF receptor (FGFR) genes encoding transmembrane protein tyrosine kinases, have been cloned and identified in mammals and their homologues described in birds, Xenopus and Drosophila (Givol and Yayon, [0002] FASEB J., 6:33623369 (1992)). The actual number of functional receptor proteins is however much greater since multiple variants are generated, as cell bound or secreted forms, by alternative RNA splicing and multiple polyadenylation sites. Beside these high affinity receptors. FGFs bind tightly to low affinity, high capacity binding sites identified as heparan sulfate proteoglycans (HSPGs). These heparan sulfates modulate FGF-receptor binding and biological activity and serve as an obligatory integral component in the formation of a functional tertiary complex between FGF, FGFR and the appropriate HSPG.
  • In light of the large number of ligand and receptor variants, a major question regarding FGF function is their ligand-receptor specificity. Both FGFR1 and FGFR2 bind acidic FGF/FGF1 and basic FGF/FGF2 with similar affinity (Dionne et al., [0003] EMBO J., 9:2685-2692 (1990)). In fact all FGFRs tested so far bind FGF1 and FGF4 (hst/kfgf) with moderate to high affinity, demonstrating an apparent redundancy in the FGF system. In contrast to FGFRs 1 and 2, FGFR3 was found to bind only FGF1 and FGF4 albeit with moderate affinity (Ornitz and Leder, J. Biol Chem., 267:16305-16311 (1992); Chellaiah et al., J. Biol. Chem., 269(15):11620-11622, (1994)). No specific ligand has been identified so far, for either of the spliced forms of this receptor.
  • Recently, mutations in FGFR3 have been shown to be responsible for achondroplasia, the most common form of genetic dwarfism. Examination of the sequence of FGFR3 in achondroplasia patients identified a mutation in the transmembrane domain of the receptor. [0004]
  • The focus of FGFR3 as the receptor involved in achondroplasia raised the need for a specific ligand for this receptor, which does not substantially bind to the other three FGFRs, both for the purpose of research and study of this disease as well as for the purpose of developing possible medicaments for its treatment. [0005]
  • A heparin-binding, glia-activating factor purified from the culture supernatant of a human glioma cell-line was found, by a homology search, to be the ninth member of the FGF family and was thus termed FGF9. Human FGF9 was found to code for a 208 amino acid protein and presents a unique spectrum of biological activity as it stimulates the proliferation of glial cells, PC-12 cells and BALB/C 3T3 fibroblasts, but nevertheless is not mitogenic for endothelial cells (Miyamote et al., [0006] Mol. Cell Biol., 13(7):4251-4259 (1993): Naro et al., J. Biol. Chem., 267:16305-16311 (1993)).
  • SUMMARY OF THE INVENTION
  • The present invention is based on the surprising finding that fibroblast growth factor 9 (FGF9) is a high affinity (kD: 0.25 nM) ligand for fibroblast growth factor receptor 3 (FGFR3) which does not bind to FGFR1 or FGFR4 and binds to FGFR2 only at a substantially lower affinity. [0007]
  • Thus, the present invention provides for the first time a specific ligand for FGFR3 being a fibroblast growth factor 9 (FGF9). This specific FGFR3 ligand may be used both for detection and for therapeutical treatment purposes. [0008]
  • This specific novel ligand for FGFR3 may be used in a method for the detection of FGFR3 in a sample or tissue comprising: [0009]
  • (i) contacting the sample or tissue with FGF9 and allowing formation of receptor-ligand pairs, and [0010]
  • (ii) detecting the presence of FGFR3-FGF9 pairs, a positive detection indicating the presence of FGFR3 in the sample or tissue. [0011]
  • The sample may be a sample of body fluid such as blood, in which soluble FGFR3 is present and the tissue may be a tissue obtained from a patient, for example by cartilage biopsy or alternatively, may be a tissue within the body of an individual and in such a case the detection is carried out in vivo. [0012]
  • Detection may be carried out for example by labelling the FGF9 with a suitable detectable label, and then determining whether any label is bound to proteins in the sample or to the surface of cells in the tissue which is assayed for the presence of FGFR3. Alternatively detection may be carried out by using labeled antibodies against FGF9, capable of recognizing FGF9 which is bound to FGFR3. [0013]
  • In accordance with the present invention, it was found that FGF9 is a heparin-dependent ligand for FGFR3. Thus, in accordance with the method of detection of FGFR3 by use of the FGF9 ligand, it is preferable that heparin would also be present in the detection medium. [0014]
  • In accordance with the present invention, it was further found that FGF9 not only specifically binds to the FGFR-3, but also specifically activates this receptor without activating the FGFR1 and FGFR4 receptors and, if appropriate concentrations are chosen, without significantly activating FGFR2. This finding leads to the preparation of pharmaceutical compositions comprising a pharmaceutically acceptable carrier and as an active ingredient a therapeutically effective amount of FGF9. Such a pharmaceutical compositions may be used for stimulating the activity of FGFR3. [0015]
  • This finding also leads to the preparation of pharmaceutical compositions comprising a pharmaceutically acceptable carrier and as an active ingredient an antagonist of the FGF9, or an FGF9 binding agent an example being an antibody against FGF9. [0016]
  • Pharmaceutical compositions comprising an antagonist of FGF9 may be used to attenuate directly the activity of the FGFR3, and pharmaceutical compositions comprising an FGF9 binding agent such as an antibody against FGF9, may neutralize circulating native FGF9 and thus attenuate indirectly the activity of FGFR3. [0017]
  • Normal cartilage and bone growth and repair of damage to the cartilage and bone requires a specific and delicate balance between up regulation and down regulation of the activity of the FGFR3. Without wishing to be bound by theory, it is assumed that active FGFR3 is necessary in the initial stages of cartilage-bone differentiation, and after differentiation is required for cartilage-bone repair. Thus, the pharmaceutical composition comprising as an active ingredient FGF9, which stimulates the activity of FGFR3, may be used in order to encourage cartilage and bone repair, for example by administration to the site of injury. Furthermore, FGFR3 exists usually temporarily on mesenchymal stem cells and usually disappears after differentiation. Administration of FGF9 may serve to stabilize FGFR3 and thus prolong the period in which it is active prior to differentiation. FGF9 has also a chemotactic affect of FGFR3-carrying cells and can promote migration of such FGFR3 carrying cells, typically mesenchymal stem cells, to a desired site, for example, by injection of FGF9 to the growth plate top of the column. [0018]
  • According to this theory, overactivation of FGFR3 after the stage of initial differentiation of bone and cartilage cells, leads to halted growth, and is probably the cause of achondroplasia. Thus, a pharmaceutical composition comprising as an active ingredient an antagonist of FGF9 which attenuates the activity of FGFR3, or comprising an FGF9 binding agent (such as an antibody against FGF9), which neutralizes native circulating FGF9, should be used in cases of overactivity of the FGFR3 receptor in differentiated tissues, which causes bone and cartilage growth arrest. Such bone and cartilage growth arrest may lead to achondroplasia dwarfism, or other abnormalities of bone and cartilage growth, for example, multiple hereditary exostosis, solitary hereditary exostosis, hallux valgus deformity, synovial chondromatosis and endochondromas. [0019]
  • The above conditions may be treated with a pharmaceutical composition comprising either an antagonist of FGF9, or an FGF9 binding agents capable of neutralizing native circulating FGF9, which both serve to attenuate the activity of the FGFR3. [0020]
  • The present invention also concerns a novel recombinant mouse FGF9, and a novel recombinant chicken FGF9, as well as DNA sequences coding for these novel recombinant proteins. [0021]
  • The present invention still further concerns an expression vector comprising the sequence of FGF9 under the expression control of a strong promoter such as the CMV or SV40 or a cartilage/bone promoter such as collagen type-2 promoter. Such an expression vector may be used to produce a transgenic mammal, which over-expresses FGF9, leading to overactivation of the FGFR3 receptor and thus to halted growth. Such an animal may serve as a model for diseases and disorders resulting from halted growth, such as genetic achondroplasia. [0022]
  • In the following the invention will be illustrated with reference to some non-limiting drawings and examples.[0023]
  • DETAILED DESCRIPTION OF THE DRAWINGS
  • FIG. 1—Nucleotide and amino acid sequences of mouse FGF9. The nucleotide sequence of FGF9:pET-3C and deduced amino acid sequence are shown. [0024]
  • FIG. 2—Nucleotide and amino acid sequences of chicken FGF9. The nucleotide sequence of FGF9:pET-3C and deduced amino acid sequence are shown. [0025]
  • FIGS. 3A, 3B, [0026] 3C shows comparison of amino acid and nucleotide sequences of mouse, rat and human FGF9.
  • FIG. 4—Purification of FGF9. Partially purified FGF9 was bound to heparin sepharose and eluted with a 0.2-2 M salt gradient, protein amount was estimated by spectrophotometer (A). To identify FGF9 in the clution fractions, 10 ml of each fraction were resolved on 15% SDS PAGE, transferred to nitrocellulose and immunoblotted with specific antibodies (anti SP32) (B). The purity of the fractions was tested by silver staining of 5 ml of each fraction resolved on 15% SDS PAGE (C). [0027]
  • FIG. 5—FGF9 binding specificity. Purified FGF9 was immobilized on heparin sepharose beads and its ability to bind the soluble extracellular domain of different FGFRs coupled to alkaline phosphatase was tested (A). The amounts of FGFRs were estimated according to alkaline phosphatase activity (B). Equal amounts of soluble extracellular domain of [0028] FGFRs 1, 2, 2-IIIb, 3, 3-IIIb and 4 alkaline phosphatase fusion proteins, were immunoprecipitated with anti alkaline phosphatase antibodies. Binding and cross-linking of 125I-FGF9 in the presence or absence of 0.5 μg/ml heparin and hundred fold excess unlabeled FGF9 (Ex. cold) was done as described under materials and methods.
  • FIG. 6—Analysis of FGF9 binding to soluble FGFR2 and FGFR3. Binding of increasing concentrations of [0029] 125I-FGF9 to soluble extracellular domain of FGFR2 (A) and FGFR3 (B) adsorbed to maxisorb plate was done as described under materials and methods. Binding results were analyzed by Scatchard analysis (inserts).
  • FIG. 7—Heparin dependent cross-linking of FGF9 to FGFR3 expressing CHO cells. Monolayers of FGFR3 transfected KI and A745 CHO cells were incubated at 40° C. with 5 ng/ml [0030] 125I-FGF9 in the presence or absence of 1 mg/ml heparin and 100-fold excess of unlabeled FGF9 (Ex. cold) as indicated. Cross-linking and electrophoresis separation were done as described under materials and methods.
  • FIG. 8—Heparin and heparin fragments dependent FGF9 induced DNA synthesis. Monolayers of FGFR3 transfected CHO-A745 cells were serum starved and incubated with 10 ng/ml FGF9 and the indicated amount of heparin (A) or 2 mg/ml of heparin fragment (B) at the indicated number of monosaccharide units. [0031]
  • FIG. 9—Plasmid of FGF9 under control of collagen type-2 promoter. [0032]
  • DETAILED DESCRIPTION OF THE INVENTION
  • I. Materials and Methods [0033]
  • (a) Cells. [0034]
  • Wild type (KI) and the CHO mutant cell line A745 kindly provided by Dr. J. D. Esko (Dept. of Biochemistry, University of Birmingham, Ala.) were cultured in F12 medium supplemented with 10% Fetal Calf Serum. Transfection of CHO cells with 10 μg FGFR3 in pZL plasmid that contain neomycin resistance, was done by electroporation with Gene Pulcer (Bio-Rad) at 960 micro farads and 250 volt. Individual stable clones were selected with G418 (0.5 mg/ml). [0035]
  • (b) Antibodies [0036]
  • Polyclonal anti FGF9 antibodies were generated by injecting New Zealand white rabbits and collecting serum after two additional boosts. Anti FGF9 antibodies were prepared against two peptides (SP3.1: Cys-Ser-Asn-Leu-Tyr-Lys-His-Val-Gln-Thr-Gly-Arg-Arg-Tyr, SP32: Asp-His-Leu-Lys-Gly-Ile-Leu-Arg-Arg-Arg-Gln-Leu-Tyr-Cys) coupled to KLH (keyhole lympet hemocyanin) by MBS. Serum obtained was further purified on protein A sepharose (Repligen) to obtain the IgG fraction. [0037]
  • (c) Radiolabeling of FGF9 [0038]
  • Recombinant murine FGF9 was labeled with Na[0039] 125I (0.5 mCi) using the Chloramine-T method and separated from free iodine on a heparin-sepharose column. The range of specific activity was 0.5-2×105 cpm/ng.
  • EXAMPLE 1 Cloning and Expression of the Mouse Homologue of FGF9
  • Total RNA extracted from a 12.5 day old mouse embryo was used for polymerase chain reaction (PCR) based cloning of FGF9. Primer specific for the human FGF9 (forward: GGGAATTCCATATGGCTCCCTTAGGTGAAG; backward: CGGGATCCTCAACFTTGGCTTAGAATATCC) were used for PCR using as a template mouse RNA. (35 cycles of [0040] denaturation 1 min at 94° C., annealing 2 min at 56° C. elongation 3 min at 72° C.). A single DNA product with an expected size of 630 bp was obtained and was used directly for subcloning into pET-3C bacterial expression vector (Novagene).
  • Sequence analysis reveals the expected 627 bp long transcript (FIG. 1) with 93% identity to the human FGF9 cDNA. The FGF9:pET-3C plasmid was used to transform B1-21 strain of [0041] E. coli. At logarithmic growth phase the transformed bacteria were induced with 1 mM IPTG for 2 hours, precipitated by centrifugation at 7000 RPM and sonicated 3×15″ using probe sonicator (Soniprep150, MSE) on ice. The supernatant obtained by centrifugation of the bacterial sonicate was loaded onto a heparin-sepharose column (Pharmacia, Upsala, Sweden) and the column was washed extensively with 10 column volumes of 0.15 M NaCl, 0.05% Chaps, 20 mM Tris pH 7.4, and 10 column volumes of 0.7 M NaCl, 0.05% Chaps, 20 mM Tris pH 7.4. The bound proteins were then eluted with 0.5 ml fractions of 2 M NaCl, 0.05% Chaps, 10 mM Tris pH 7.4, diluted 1:10 with H2O and reloaded on a pre-equilibrated 1 ml heparin-sepharose mini FPLC column (Pharmacia, Upsala, Sweden). After extensive wash the column was eluted with a continuous 0.2-2 M NaCl gradient and the protein profile determined by adsorbance at 280 nM. The fractions were tested for biological activity measured as 3H-thymidine incorporation into BALB/c-3T3 fibroblasts and for specificity by Western blot using polyclonal antibodies generated in rabbits against FGF9 specific peptides. A major protein band at the expected molecular weight of 27 kDal was obtained that reacted specifically with two different anti-peptide antibodies specific for FGF9.
  • Mouse FGF9 (mFGF9) was cloned by PCR on cDNA prepared from 12.5 days mouse embryos RNA. Mouse FGF9 cDNA shares 93 and 98% sequence homology with human and rat FGF9 respectively (FIGS. [0042] 3A-3C). The amino acid sequence of mFGF9 is identical to that of the rat FGF9 and differs from human FGF9 in one amino acid only having a serine at position 9 instead of an asparagine. Recombinant mouse-FGF9 was expressed in B1-21 strain of E. coli and purified from the bacteria lysate by two cycles on a heparin-sepharose column. FGF9 elutes from heparin sepharose with 1.0-1.2 M NaCl as determined by adsorbance at 280 nM (FIG. 4A). The presence of FGF9 in the fractions was tested by an immunoblot using polyclonal antibodies directed against FGF9 specific peptides, demonstrating a major protein band at the expected molecular weight for a non-glycosylated protein of 27 kDal (FIG. 4B). The purity of each preparation was further assessed by silver stain (FIG. 4C). Recombinant mouse FGF9 is biologically active and stimulates DNA synthesis in BALB/C 3T3 fibroblasts, in a dose dependent manner, with half maximal 3H-Thymidine incorporation at 0.5 ng/ml (not shown), similar to that obtained for purified human FGF9 (Nauro, et al., J. Biol. Chem., 267:16305-16311 (1993)).
  • EXAMPLE 2 Cloning and Expression of the Chicken Homologue of FGF9
  • Cloning and expression of chicken homologue of FGF9 was conducted as described in Example 1 with chicken-derived mRNA. [0043]
  • EXAMPLE 3 Cell Free Binding Assays
  • The extracellular region of murine FGFR1, FGFR2, keratinocyte growth factor receptor (KGFR) and the two isoforms of FGFR3 in the alkaline phosphatase-expression vector were previously described (Givol D. and Yayon A., Adv. Cancer Res. 160, 1-41 (1993); (Lev et al, J. Biol. Chem., 267, 15970-15977 (1992)). FGFR-alkaline phosphatase fusion proteins were collected from conditioned medium of transfected NIH 3T3 cells and used directly for binding assays. Receptor protein content was estimated by alkaline phosphatase activity which was monitored spectro-photometrically at 405 nm using para-nitrophenyl phosphate as a substrate, essentially as described (Lev et al., supra). The soluble receptor binding reaction mixture included receptor-AP conditioned medium, radiolabeled ligand and heparin or other HSPGs. The bound complex was immunoprecipitated with anti-alkaline phosphatase polyclonal antibodies (Zymed) and protein A-Sepharose (Repligen). All components are mixed at room temperature in a total volume of 250 ml of binding buffer (DMEM supplemented with 25 mM Hepes pH 7.4 and 0.1% bovine serum albumin). The binding reaction was allowed to proceed for 2 h at room temperature. Bound ligand was recovered by centrifuging for 10 s at 6000 rpm in a microcentrifuge (−2000 g) and washing three times with a solution of 150 nM NaCl, 0.1% Triton-X-100 and 50 mM Hepes pH 7.4 (HNTG). [0044] 125I-bound factor was determined by counting the tubes directly in a gamma-counter. For cross-linking, after washing 0.15 mM disuccinimidyl suberate (DSS) or 1 mM Bis(sulfosuccinimidyl)suberate (BS3) was added in phosphate buffered saline (PBS) for 30 min at room temperature. The complexes were washed twice with PBS, and boiled for 5 min with sample buffer. The samples were separated by electroporation under reducing conditions on SDS-polyacrylamide gel, the gel was dried and exposed to Kodak (Eastman Kodak Co., Rochester, N.Y.) X-Omat AR film.
  • Alternatively, 96-well maxisorb plates (Nunk) pre-coated overnight with monoclonal anti-human placental alkaline phosphatase antibodies (Sigma Chemicals, Israel) were reacted with receptor-AP fusion proteins for 2 h at room temperature. After washing with binding buffer, plates were incubated for 2 h at room temperature with different concentrations of [0045] 125I-labeled FGF9 in the presence or absence of heparin. At the end of the incubation time, the plates were washed twice with binding buffer, and eluted with 1.6 M NaCl in 20 mM sodium acetate pH 4.5. The acid extract was counted in a gamma counter.
  • In order to elucidate the receptor binding properties of FGF9, use was made of a series of FGF receptors' ectodomains coupled to human placental alkaline phosphatase. As was previously demonstrated, soluble ectodomains of FGF receptors can successfully and specifically interact with the ligands, thereby providing an excellent tool for the analysis of ligand-receptor specificity (Rimion, D. L, Prof. Clin. Biol. Res. 187, 131-140 (1985), Lev et al, supra). The interaction between FGF9 and the soluble receptors was first analyzed with FGF9 immobilized on heparin-sepharose and measurement of the associated alkaline phosphatase activity. Heparin-sepharose immobilized FGF9 binds FGFR2 and FGFR3 fusion proteins but not FGFR1 or FGFR4 (FIG. 5A). Only the IIIe isoforms of FGFR2 and FGFR3 bind FGF9, while the IIIb isoforms of these receptors do not show any specific binding to FGF9. The interaction of FGF9 with the soluble receptors was further analyzed by direct binding and covalent cross-linking of radiolabeled FGF9 (FIG. 5B). In the presence of 0.5 mg/ml heparin, FGF9 binds only to FGFR2 and FGFR3 but not to FGFR1 or FGFR4 and not to any of the IIIb spliced isoforms tested. No significant binding is observed without heparin, indicating its obligatory role in high affinity FGF9-receptor binding. The two covalently linked complexes of FGF9 with FGFR2 and FGFR3 correspond most probably to the monomer and dimer forms of the receptor-ligand complex. Affinity labeling of soluble FGFR2 and FGFR3 proteins by [0046] 125I-FGF9 is abolished in the presence of a 100 fold molar excess of unlabeled ligand, indicating that binding and labeling of these receptors is specific.
  • To quantitatively characterize the binding of FGF9 to FGFR2 and FGFR3, direct binding analysis of radiolabeled FGF9 to the soluble receptors was performed. Binding of FGF9 to both receptors is specific and saturable (FIGS. 6A and 6B). Analyzing the results by Scatchard analysis (FIG. 6, inserts) indicate a dissociation constant of 2.38 nM for binding of FGFR2 and 0.78 nM for the interaction of FGF9 with FGFR3. Two additional experiments yield very similar results. Within every single experiment the affinity for FGFR2 was about 3-fold lower compared to that for FGFR3. The binding of FGF9 to FGFR1 was neither significant nor specific (not shown). [0047]
  • EXAMPLE 4 High Affinity Binding and Cross-Linking of FGF9 to Cell Surface Receptors
  • Confluent cultures in 24 wells dishes (Nunk) were pre-cooled to 4° C. and washed twice with binding buffer. Subsequently they were incubated for 2 h at 4° C. with different concentrations of [0048] 125I-FGF9 in binding buffer in the presence or absence of heparin. The binding medium was discarded, and the cells were washed twice with binding buffer and once with 0.5 M NaCl in 25 mM Hepes pH 7.5. High affinity bound factor was determined by cluting the bound factor with 1.6 M NaCl in 20 mM sodium acetate pH 4.5 and counting in a gamma counter. Nonspecific binding was considered as the value obtained for high affinity binding in the presence of a 100-fold excess of non-labeled factor. For cross-linking, the binding was done in PBS and after 1 h incubation, DSS was added to a final concentration of 0.15 M for 1 h more. The cells were washed twice with PBS, scraped, and lysed in a small volume of lysis buffer containing 150 mM NaCl, 20 mM Tris (pH 8.0), 1 mM MgCl2, 0.1 mM ZnCl2, 0.5% NP-40, 1 mg of aprotinin, 1 mg/ml leupeptin, and 2 mM PMSF. The cell lysates, clarified by centrifugation, were boiled and electrophorated under reducing conditions on SDS-polyacrylamide gel.
  • As mentioned above, the binding of FGF9 to both FGFR2 and FGFR3 is strictly dependent on the presence of heparin. To compare the specific demands for heparin in FGF9 binding to each receptor, we first measured the heparin required for binding of FGF9 to soluble FGFR3 and FGFR2. In cross-linking experiments only faint complexes are observed without the addition of heparin to either FGFR2 or FGFR3. However, at increasing heparin concentrations a marked difference in the requirement for heparin the two receptors is observed. [0049]
  • The soluble extracellular domains of FGFR2 and FGFR3 coupled to alkaline phosphatase, were immunoprecipitated with anti-alkaline phosphatase antibodies, and incubated with 5 ng/ml [0050] 125I-FGF9 and increasing concentrations of heparin. Cross-linking and electrophoresis separation were done as described under Example 3. The amount of FGF9 bound to FGFR2 (FIG. 3A) and FGFR3 (FIG. 5B) was quantitated by densitometry analysis.
  • Binding of FGF9 to FGFR2 is very sensitive to heparin and addition of as little as 0.5 ng/ml heparin causes an apparent increase in binding, with maximal receptor binding at around 5 ng/ml. Binding of FGF9 to FGFR3 however, requires about 20-fold higher levels of free heparin, with maximal receptor binding only at around 100 ng/ml heparin, and with a slight inhibition of binding at heparin concentrations above 500 ng/ml. [0051]
  • A difference in the heparin levels required for FGF9 binding to either FGFR2 or FGFR3, might indicate that a more specific heparin structure, which comprises a relatively minor fraction of the heparin mixture which was used, is required for FGFR3 binding. To study structural requirements of heparin for promoting FGF9 binding, we analyzed the effects of a series of heparin fragments ranging in size from 4 to 18 monosaccharide units, on FGF9 binding to the soluble ectodomains of FGFR2 and FGFR3. [0052]
  • In order to address the physiological relevance of the in vitro observed high affinity, heparin-dependent interaction of FGF9 with FGFR3, a full length mouse FGFR3 was expressed in wild type (KI) and heparan-sulfate deficient mutant (745 pgs) CHO cells, known to express low levels of endogenous FGFRs (Yayon, A., et al., [0053] Cell, 64:841-848 (1991). Whereas untransfected cells displayed neither detectable binding of radiolabeled FGF9 nor covalently cross-linked proteins, FGFR3 transfected CHO-KI cells show a protein band of a 145 kDal, corresponding to a monomer of receptor-FGF9 complex (FIG. 7). As expected, binding and cross-linking of 125I-FGF9 to wild type CHO-KI cells expressing FGFR3 is not affected by exogenous heparin. There is however no detectably, cross-linking of FGF9 to the mutant HS defficient CHO-745 cells expressing FGFR3 in the absence of heparin (FIG. 7), supporting the notion that heparin-like molecules are required for efficient high affinity interaction of FGF9. Upon the addition of heparin affinity labeling of the 745-FGFR3 cells with 125I-FGF9 is prominent and indistinguishable from that of wild type cells, indicating that heparin can support high affinity binding of FGF9 to FGFR3. The binding to both kinds of cells was specific and saturable (in the presence of 1 mg/ml heparin) with kD of 0.06 and 0.1 nM for CHO-KI and CHO 745 cells respectively. A typical heparin dose dependent increase in FGF9 binding to CHO 745-FGFR3 transfected cells was obtained, with maximal specific binding at around 500 ng/ml of heparin (data not shown).
  • EXAMPLE 5 DNA Synthesis Assay
  • Thymidine incorporation into CHO cells was measured using confluent cultures grown in 24 well plates, in F12 medium supplemented with 10% fetal calf serum. The cells were starved for 24 h with no serum and then incubated with or without various concentrations of FGF9 or 10% serum as a control for an additional 14 h, after which 3H-Thymidine (0.5 mCi/ml) was added for additional 2 h. At the end of the incubation, the cells were washed twice with cold PBS, fixed for 20 min with ice-cold 5% trichloroacetic acid, washed with 95% ethanol and dissolved in 0.1 M NaOH. DNA associated radioactivity was measured by liquid scintillation counting. [0054]
  • To test whether activation of FGFR3 may also require heparin, we investigated the requirement for heparin for FGF9 induced DNA synthesis in FGFR3 expressing HS-[0055] defficient CHO 745 cells. Without exogenous heparin no significant increase in 3H-Thymidine incorporation by FGF9 is observed (FIG. 5A), in agreement with the lack of receptor binding and similar to the strict heparin requirement for other FGFs investigated so far. Addition of heparin at low concentrations markedly stimulated FGF9 dependent DNA synthesis and in a dose dependent manner with half maximal and maximal effects at 100 ng/ml and 2 mg/ml respectively. Heparin alone had no effect on DNA synthesis and FGF9 induced DNA synthesis in CHO-KI is independent of exogenous heparin (not shown).
  • To study structural requirements of heparin for promoting FGF9 binding, we analyzed the effects of a series of heparin fragments ranging in size from 6 to 18 monosaccharide units, on FGF9 induced DNA synthesis. While a 6 mer heparin fragment inhibited the effect of FGF9, induction of DNA synthesis is observed with 8-10 mer fragments with maximal effect of FGF9 in the presence of 14-16 mer heparin fragments (FIG. 8B). These results indicate that a specific heparin size is required for activation of FGFR3 by FGF9. [0056]
  • EXAMPLE 6 Plasmid Construct for the Expression of FGF9
  • For the expression of recombinant FGF9, the mouse FGF9 cDNA was sub-cloned using the Ndel/BamH sites of the bacterial expression vector pET-3C. After transformation of BL-21 cells and induction with 1 mM of IPTG, the cells were lysed and FGF9 was purified on a heparin-sepharose column. [0057]
  • Full length mouse FGF9 cDNA was subcloned downstream of a splice acceptor site from the collagen IIA1 gene following the collagen IIA1 promoter and cartilage specific enhancer. This construct was linearized and used for injection into fertilized mice eggs for the generation of transgenic mice. [0058]
  • EXAMPLE 7 Transgenic Animal with Over Expression of FGF9
  • Transgenic mice transformed by the vector as described above feature an over-expression of FGF9. The phenotype of these transgenic mice is very similar to that of transgenic mice with FGFR3-Ach mutation (having the FGFR3 mutation of achondroplasia) characterized by an exceptionally small body size with a short tail and short hindlimbs. Such transgenic mice may serve as a model for various types of dwarfism as well as a model for abnormalities resulting from an excess of FGF9. [0059]
  • 1 13 1 682 DNA Mus pahari 1 acaacggttt ccctctagaa ataattttgt ttaactttaa gaaggagata tacatatggc 60 tcccttaggt gaagttggga gctatttcgg tgtgcaggac gcggtaccgt tcgggaacgt 120 accggtgttg ccggtggaca gtccggtgtt gctaagtgac cacctgggtc agtccgaagc 180 aggggggctg ccccggggcc ccgcagtcac ggacttggat catttaaagg ggattctcag 240 gcggaggcag ctgtactgca ggactggatt tcatttagag atcttcccca acggtactat 300 ccagggaacc aggaaagacc acagccgctt cggcattctg gaatttatca gtatagcagt 360 gggcctggtc agcattcgcg gtgtggacag tggactctac ctcggcatga acgagaaggg 420 ggagctgtat ggatcagaaa aactaacaca ggaatgtgtg ttcagagaac agtttgaaga 480 gaactggtac aacacctact cttccaacct ctataaacat gtggacaccg gaaggagata 540 ctatgttgca ttaaataagg acgggactcc aagagaaggg accaggacta aacggcacca 600 gaaatttaca cattttttac ctagaccagt ggaccctgac aaagtacctg aactatataa 660 ggatattcta agccaaagtt ga 682 2 627 DNA Mus pahari 2 atggctccct taggtgaagt tgggagctat ttcggtgtgc aggacgcggt accgttcggg 60 aacgtaccgg tgttgccggt ggacagtccg gtgttgctaa gtgaccacct gggtcagtcc 120 gaagcagggg ggctgccccg gggccccgca gtcacggact tggatcattt aaaggggatt 180 ctcaggcgga ggcagctgta ctgcaggact ggatttcatt tagagatctt ccccaacggt 240 actatccagg gaaccaggaa agaccacagc cgcttcggca ttctggaatt tatcagtata 300 gcagtgggcc tggtcagcat tcgcggtgtg gacagtggac tctacctcgg catgaacgag 360 aagggggagc tgtatggatc agaaaaacta acacaggaat gtgtgttcag agaacagttt 420 gaagagaact ggtacaacac ctactcttcc aacctctata aacatgtgga caccggaagg 480 agatactatg ttgcattaaa taaggacggg actccaagag aagggaccag gactaaacgg 540 caccagaaat ttacacattt tttacctaga ccagtggacc ctgacaaagt acctgaacta 600 tataaggata ttctaagcca aagttga 627 3 208 PRT Mus pahari 3 Met Ala Pro Leu Gly Glu Val Gly Ser Tyr Phe Gly Val Gln Asp Ala 1 5 10 15 Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20 25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly 65 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly Ile Leu Glu 85 90 95 Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser 195 200 205 4 660 DNA Gallus domesticus 4 ccgcgggatt gggaattcca tatggctccc ttaggtgaag tcgggaacta tttcggtgtg 60 caggacgcgg tgccctttgg gaacgtgccc gcgctgccgg cggacagccc ggttttgctc 120 agtgaccacc tgggccaggc tgaggcaggt gggctgccca ggggccccgc ggtcacggac 180 ttggaccatt taaaggggat cctcaggagg aggcagcttt actgcaggac tggatttcat 240 ttagaaatct tccccaatgg tactatccag ggcaccaggc aagaccacag ccgattcggt 300 atactggagt tcatcagtat agcagtgggc ctggtcagca tccgaggagt agacagcgga 360 ctctaccttg gaatgaatga gaaaggggag ctctacggct cggaaaaatt aacccaggag 420 tgtgtattca gagagcagtt tgaagaaaac tggtataaca catattcatc aaatctatat 480 aaacacgtgg acactggaag acgatactac gtggcgttaa ataaagatgg aactccaaga 540 gaagggacta ggactaaacg gcatcaaaaa tttacacatt tttcacctag accagtggac 600 cctgagaaag tacctgaact atataaggat attctaagcc aaagttgagg atcccgaatc 660 5 220 PRT Gallus domesticus VARIANT (1)...(220) Xaa = Any Amino Acid 5 Pro Arg Asp Trp Glu Phe His Met Ala Pro Leu Gly Glu Val Gly Asn 1 5 10 15 Tyr Phe Gly Val Gln Asp Ala Val Pro Phe Gly Asn Val Pro Ala Leu 20 25 30 Pro Ala Asp Ser Pro Val Leu Leu Ser Asp His Leu Gly Gln Ala Glu 35 40 45 Ala Gly Gly Leu Pro Arg Gly Pro Ala Val Thr Asp Leu Asp His Leu 50 55 60 Lys Gly Ile Leu Arg Arg Arg Gln Leu Tyr Cys Arg Thr Gly Phe His 65 70 75 80 Leu Glu Ile Phe Pro Asn Gly Thr Ile Gln Gly Thr Arg Gln Asp His 85 90 95 Ser Arg Phe Gly Ile Leu Glu Phe Ile Ser Ile Ala Val Gly Leu Val 100 105 110 Ser Ile Arg Gly Val Asp Ser Gly Leu Tyr Leu Gly Met Asn Glu Lys 115 120 125 Gly Glu Leu Tyr Gly Ser Glu Lys Leu Thr Gln Glu Cys Val Phe Arg 130 135 140 Glu Gln Phe Glu Glu Asn Trp Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr 145 150 155 160 Lys His Val Asp Thr Gly Arg Arg Tyr Tyr Val Ala Leu Asn Lys Asp 165 170 175 Gly Thr Pro Arg Glu Gly Thr Arg Thr Lys Arg His Gln Lys Phe Thr 180 185 190 His Phe Ser Pro Arg Pro Val Asp Pro Glu Lys Val Pro Glu Leu Tyr 195 200 205 Lys Asp Ile Leu Ser Gln Ser Xaa Gly Ser Arg Ile 210 215 220 6 14 PRT Artificial Sequence Synthetically generated peptide 6 Cys Ser Asn Leu Tyr Lys His Val Gln Thr Gly Arg Arg Tyr 1 5 10 7 14 PRT Mus pahari 7 Asp His Leu Lys Gly Ile Leu Arg Arg Arg Gln Leu Tyr Cys 1 5 10 8 30 DNA Artificial Sequence Primer 8 gggaattcca tatggctccc ttaggtgaag 30 9 30 DNA Artificial Sequence Primer 9 cgggatcctc aactttggct tagaatatcc 30 10 208 PRT Rattus norvegicus 10 Met Ala Pro Leu Gly Glu Val Gly Ser Tyr Phe Gly Val Gln Asp Ala 1 5 10 15 Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20 25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly 65 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly Ile Leu Glu 85 90 95 Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser 195 200 205 11 208 PRT Homo sapiens 11 Met Ala Pro Leu Gly Glu Val Gly Asn Tyr Phe Gly Val Gln Asp Ala 1 5 10 15 Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20 25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly 65 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly Ile Leu Glu 85 90 95 Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser 195 200 205 12 627 DNA Rattus norvegicus 12 atggctccct taggtgaagt tgggagctat ttcggtgtgc aggacgcggt accgttcggg 60 aacgtaccgg tgttgccggt ggacagtccg gtgttgctaa gtgaccacct gggtcagtcc 120 gaagcagggg ggctgccccg gggacccgca gtcacggact tggatcattt aaaggggatt 180 ctcaggcgga ggcagctgta ctgcaggact ggatttcact tagaaatctt ccccaacggt 240 actatccagg gaaccaggaa agaccacagc cgattcggca ttctggaatt tatcagtata 300 gcagtgggcc tggtcagcat tcgtggtgtg gacagtggac tctacctcgg catgaacgag 360 aagggggagc tgtatggatc agaaaaacta acacaggagt gcgtgttcag agaacagttt 420 gaagaaaact ggtacaacac ctactcttcc aacctgtaca agcacgtgga caccggaagg 480 agatactatg ttgcattaaa taaggatggg actccaagag aagggaccag gactaaacgg 540 caccagaaat ttacacattt tttacctaga ccagtggacc ctgacaaagt acctgaacta 600 tataaggata ttctaagcca aagttga 627 13 627 DNA Homo sapiens 13 atggctccct taggtgaagt tgggaactat ttcggtgtgc aggatgcggt accgtttggg 60 aatgtgcccg tgttgccggt ggacagcccg gttttgttaa gtgaccacct gggtcagtcc 120 gaagcagggg ggctccccag gggacccgca gtcacggact tggatcattt aaaggggatt 180 ctcaggcgga ggcagctata ctgcaggact ggatttcact tagaaatctt ccccaatggt 240 actatccagg gaaccaggaa agaccacagc cgatttggca ttctggaatt tatcagtata 300 gcagtgggcc tggtcagcat tcgaggcgtg gacagtggac tctacctcgg gatgaatgag 360 aagggggagc tgtatggatc agaaaaacta acccaagagt gtgtattcag agaacagttc 420 gaagagaact ggtataatac gtactcgtca aacctatata agcacgtgga cactggaagg 480 cgatactatg ttgcattaaa taaagatggg accccgagag aagggactag gactaaacgg 540 caccagaaat tcacacattt tttacctaga ccagtggacc ccgacaaagt acctgaactg 600 tataaggata ttctaagcca aagttga 627

Claims (20)

1. A method for the detection of fibroblast growth factor receptor 3 (FGFR3) in a sample or tissue comprising:
(i) contacting the sample or tissue with fibroblast growth factor 9 (FGF9) and allowing formation of receptor-ligand pairs; and
(ii) detecting the presence of FGFR3-FGF9 pairs, a positive detection indicating the presence of FGFR3 in the sample or tissue.
2. A method according to claim 1, wherein the contact of sample or tissue with FGF9 is carried out in the presence of heparin.
3. A pharmaceutical composition for modulating of the activity of FGFR3 comprising a pharmaceutically acceptable carrier and as an active ingredient a therapeutically effective amount of FGF9.
4. A pharmaceutical composition according to claim 3 for increasing the activity of FGFR3.
5. A pharmaceutical composition according to claim 4 for stimulating bone and cartilage repair.
6. A pharmaceutical composition for modulating of the activity of FGFR3 comprising a pharmaceutically acceptable carrier and as an active ingredient an antagonist of FGF9, or an FGF9 binding agent.
7. A pharmaceutical composition according to claim 6, wherein the FGF9 binding agent is an antibody against FGF9.
8. A pharmaceutical composition according to claim 6 or 7 for decreasing the activity of FGFR3.
9. A pharmaceutical composition according to claim 8 for the treatment of a disease or a disorder selected from the group consisting of:
multiple or solitary hereditary exostosis, hallux vagus deformity, achondroplasia, synovial chondromatosis and endochondromas.
10. A recombinant mouse FGF9 DNA having the nucleic acid sequence as depicted in FIG. 1.
11. A recombinant chicken FGF9 DNA having the nucleic acid sequence as depicted in FIG. 2.
12. A polypeptide comprising an amino acid sequence encoded by the recombinant mouse FGF9 DNA of claim 10.
13. A polypeptide comprising an amino acid sequence encoded by the recombinant chicken FGF9 DNA of claim 11.
14. An expression vector comprising the recombinant mouse FGF9 DNA sequence of claim 10 or the recombinant chicken FGF9 DNA sequence of claim 11 under the expression control of a strong promoter and/or a cartilage/bone tissue specific promoter.
15. An expression vector according to claim 14, wherein the promoter is collagen type-2 promoter.
16. A transgenic animal transfected with an expression vector according to claim 14 or 15.
17. A method for the stimulation of cartilage or bone repair comprising:
administering to the site of desired repair a therapeutically effective amount of FGF9, optionally together with a pharmaceutically acceptable carrier.
18. A method for the therapeutical treatment of a disease or disorder caused by an excess of FGF9 or over activity of FGFR3 comprising:
administering to a subject in need of such treatment a therapeutically effective amount of a FGF9-binding agent or an antagonist of FGF9.
19. A method according to claim 18, wherein the FGF9-binding agent is an antibody against FGF9.
20. A method according to claim 13 or 19, wherein the disease or disorder is selected from the group consisting of:
multiple or solitary hereditary exostosis, hallux vagus deformity, achondroplasia, synovial chondromatosis and endochondromas.
US10/212,357 1995-06-12 2002-08-02 FGF9 as a specific ligand for FGFR3 Abandoned US20020193309A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/212,357 US20020193309A1 (en) 1995-06-12 2002-08-02 FGF9 as a specific ligand for FGFR3

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US13795P 1995-06-12 1995-06-12
US08/981,030 US6447783B1 (en) 1995-06-12 1996-06-12 Compositions comprising FGF9 and use thereof for stimulating cartilage and bone repair
US10/212,357 US20020193309A1 (en) 1995-06-12 2002-08-02 FGF9 as a specific ligand for FGFR3

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/IL1996/000011 Continuation WO1996041523A1 (en) 1995-06-12 1996-06-12 Fgf9 as a specific ligand for fgfr3
US08/981,030 Continuation US6447783B1 (en) 1995-06-12 1996-06-12 Compositions comprising FGF9 and use thereof for stimulating cartilage and bone repair

Publications (1)

Publication Number Publication Date
US20020193309A1 true US20020193309A1 (en) 2002-12-19

Family

ID=21690089

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/981,030 Expired - Lifetime US6447783B1 (en) 1995-06-12 1996-06-12 Compositions comprising FGF9 and use thereof for stimulating cartilage and bone repair
US10/212,357 Abandoned US20020193309A1 (en) 1995-06-12 2002-08-02 FGF9 as a specific ligand for FGFR3

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/981,030 Expired - Lifetime US6447783B1 (en) 1995-06-12 1996-06-12 Compositions comprising FGF9 and use thereof for stimulating cartilage and bone repair

Country Status (12)

Country Link
US (2) US6447783B1 (en)
EP (3) EP0833620B1 (en)
JP (3) JPH11507828A (en)
CN (1) CN1195982A (en)
AT (2) ATE225652T1 (en)
AU (2) AU721773B2 (en)
CA (2) CA2223701C (en)
DE (2) DE69619526T2 (en)
DK (2) DK0836380T3 (en)
ES (2) ES2173289T3 (en)
IL (2) IL122473A (en)
WO (2) WO1996041523A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8277459B2 (en) 2009-09-25 2012-10-02 Tarsus Medical Inc. Methods and devices for treating a structural bone and joint deformity
US8652141B2 (en) 2010-01-21 2014-02-18 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US8696719B2 (en) 2010-06-03 2014-04-15 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US8870876B2 (en) 2009-02-13 2014-10-28 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US11021528B2 (en) 2016-07-07 2021-06-01 INSERM (Institut National de la Santé et de la Recherche Médicale Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof
US11702642B2 (en) 2013-01-16 2023-07-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders

Families Citing this family (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735773B2 (en) 2007-02-14 2014-05-27 Conformis, Inc. Implant device and method for manufacture
US9603711B2 (en) 2001-05-25 2017-03-28 Conformis, Inc. Patient-adapted and improved articular implants, designs and related guide tools
US8083745B2 (en) 2001-05-25 2011-12-27 Conformis, Inc. Surgical tools for arthroplasty
US7799077B2 (en) 2002-10-07 2010-09-21 Conformis, Inc. Minimally invasive joint implant with 3-dimensional geometry matching the articular surfaces
US7534263B2 (en) 2001-05-25 2009-05-19 Conformis, Inc. Surgical tools facilitating increased accuracy, speed and simplicity in performing joint arthroplasty
US8480754B2 (en) 2001-05-25 2013-07-09 Conformis, Inc. Patient-adapted and improved articular implants, designs and related guide tools
US8556983B2 (en) 2001-05-25 2013-10-15 Conformis, Inc. Patient-adapted and improved orthopedic implants, designs and related tools
US7618451B2 (en) 2001-05-25 2009-11-17 Conformis, Inc. Patient selectable joint arthroplasty devices and surgical tools facilitating increased accuracy, speed and simplicity in performing total and partial joint arthroplasty
US8882847B2 (en) 2001-05-25 2014-11-11 Conformis, Inc. Patient selectable knee joint arthroplasty devices
US8771365B2 (en) 2009-02-25 2014-07-08 Conformis, Inc. Patient-adapted and improved orthopedic implants, designs, and related tools
US7468075B2 (en) 2001-05-25 2008-12-23 Conformis, Inc. Methods and compositions for articular repair
US8617242B2 (en) 2001-05-25 2013-12-31 Conformis, Inc. Implant device and method for manufacture
US8545569B2 (en) 2001-05-25 2013-10-01 Conformis, Inc. Patient selectable knee arthroplasty devices
US6136040A (en) * 1998-03-05 2000-10-24 Washington University Animal model with disrupted FGF-9 gene
US7184814B2 (en) 1998-09-14 2007-02-27 The Board Of Trustees Of The Leland Stanford Junior University Assessing the condition of a joint and assessing cartilage loss
ATE439806T1 (en) 1998-09-14 2009-09-15 Univ Leland Stanford Junior DETERMINING THE CONDITION OF A JOINT AND PREVENTING DAMAGE
US7239908B1 (en) 1998-09-14 2007-07-03 The Board Of Trustees Of The Leland Stanford Junior University Assessing the condition of a joint and devising treatment
US20020058036A1 (en) * 1999-07-27 2002-05-16 Michael Jeffers Novel fibroblast growth factor and nucleic acids encoding same
PT1218037E (en) 1999-10-06 2005-05-31 Tigenix Nv IN VITRO TESTS AND MOLECULAR MARKERS TO TEST THE PHENOTIPICAL STABILITY OF CELLULAR POPULATIONS, AND POPULATIONS OF CELLS SELECTED FOR AUTO TRANSPLANTATION
DE20023640U1 (en) 1999-10-06 2005-06-23 Tigenix N.V. Detecting an embryonic cell surface marker e.g. cartilage-derived morphogenic protein CDMP-1 so as to positively identify viable precursor cells that have entered a post-natal differentiation pathway
US7482114B2 (en) 1999-10-06 2009-01-27 Tigenix N.V. In vivo assay and molecular markers for testing the phenotypic stability of cell populations, and selected cell populations for autologous transplantation
JP2003523190A (en) * 2000-02-14 2003-08-05 スミスクライン・ビーチャム・コーポレイション New compound
US20020037557A1 (en) * 2000-03-13 2002-03-28 Amgen, Inc. Fibroblast growth factor-like molecules and uses thereof
ATE426357T1 (en) 2000-09-14 2009-04-15 Univ Leland Stanford Junior ASSESSING THE CONDITION OF A JOINT AND PLANNING TREATMENT
CA2434881A1 (en) * 2001-02-02 2002-08-15 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Method for identifying functional nucleic acids
US8439926B2 (en) 2001-05-25 2013-05-14 Conformis, Inc. Patient selectable joint arthroplasty devices and surgical tools
DE60239674D1 (en) 2001-05-25 2011-05-19 Conformis Inc METHOD AND COMPOSITIONS FOR REPAIRING THE SURFACE OF JOINTS
DE60233509D1 (en) 2001-06-20 2009-10-08 Fibron Ltd FGFR3 BLOCKING ANTIBODIES, METHOD OF SCREENING THEREOF AND USES THEREOF
WO2003076467A1 (en) * 2002-03-14 2003-09-18 Yeda Research And Development Co. Ltd. Compositions and methods for inducing and regulating bone formation
WO2004022095A1 (en) * 2002-09-04 2004-03-18 Abtech Anti-idiotypic antibodies as vegf or fgf agonists for bone therapy
EP1558181B1 (en) 2002-11-07 2015-08-26 ConforMIS, Inc. Methods for determining meniscal size and shape and for devising treatment
AU2011211453B2 (en) * 2004-06-21 2015-01-15 The Board Of Trustees Of The Leland Stanford Junior University Genes and pathways differentially expressed in bipolar disorder and/or major depressive disorder
WO2006002262A2 (en) 2004-06-21 2006-01-05 The Board Of Trustees Of The Leland Stanford Junior University Genes and pathways differentially expressed in bipolar disorder and/or major depressive disorder
US8697139B2 (en) 2004-09-21 2014-04-15 Frank M. Phillips Method of intervertebral disc treatment using articular chondrocyte cells
EP2348105B1 (en) * 2004-09-24 2018-10-24 Mesoblast, Inc. Multipotential expanded mesenchymal precursor cell progeny (MEMP) and uses thereof
US7391676B2 (en) * 2004-12-22 2008-06-24 Asml Netherlands B.V. Ultrasonic distance sensors
US20060183712A1 (en) * 2005-02-17 2006-08-17 The Texas A&M University System Affinity purified heparin/heparan sulfate for controlling the biological activity of the FGF receptor
US20070049739A1 (en) * 2005-08-30 2007-03-01 Biomet Manufacturing Corp. Method and system for extracting blood-derived growth factors
US8500740B2 (en) 2006-02-06 2013-08-06 Conformis, Inc. Patient-specific joint arthroplasty devices for ligament repair
EP2671521A3 (en) 2006-02-06 2013-12-25 ConforMIS, Inc. Patient selectable joint arthroplasty devices and surgical tools
US8623026B2 (en) 2006-02-06 2014-01-07 Conformis, Inc. Patient selectable joint arthroplasty devices and surgical tools incorporating anatomical relief
KR101503939B1 (en) * 2007-01-23 2015-03-18 고리츠다이가쿠호진 요코하마시리츠다이가쿠 Method for preparation of cartilage cell
WO2008157412A2 (en) 2007-06-13 2008-12-24 Conformis, Inc. Surgical cutting guide
US8682052B2 (en) 2008-03-05 2014-03-25 Conformis, Inc. Implants for altering wear patterns of articular surfaces
AU2009246474B2 (en) 2008-05-12 2015-04-16 Conformis, Inc. Devices and methods for treatment of facet and other joints
US9017334B2 (en) 2009-02-24 2015-04-28 Microport Orthopedics Holdings Inc. Patient specific surgical guide locator and mount
US8808297B2 (en) 2009-02-24 2014-08-19 Microport Orthopedics Holdings Inc. Orthopedic surgical guide
EP2405865B1 (en) 2009-02-24 2019-04-17 ConforMIS, Inc. Automated systems for manufacturing patient-specific orthopedic implants and instrumentation
US8808303B2 (en) 2009-02-24 2014-08-19 Microport Orthopedics Holdings Inc. Orthopedic surgical guide
HUE061117T2 (en) 2009-03-25 2023-05-28 Genentech Inc Anti-fgfr3 antibodies and methods using same
EP2509539B1 (en) 2009-12-11 2020-07-01 ConforMIS, Inc. Patient-specific and patient-engineered orthopedic implants
WO2012112702A2 (en) 2011-02-15 2012-08-23 Conformis, Inc. Patient-adapted and improved articular implants, designs and related guide tools
US9486226B2 (en) 2012-04-18 2016-11-08 Conformis, Inc. Tibial guides, tools, and techniques for resecting the tibial plateau
US9675471B2 (en) 2012-06-11 2017-06-13 Conformis, Inc. Devices, techniques and methods for assessing joint spacing, balancing soft tissues and obtaining desired kinematics for joint implant components
EP2985024A4 (en) 2013-03-10 2016-09-14 Univ Nagoya Nat Univ Corp Therapeutic agent for systemic bone disease and use thereof
JP2020015733A (en) * 2019-08-19 2020-01-30 アンセルムInserm Soluble fibroblast growth factor receptor 3 (fgr3) polypeptide for use in prevention or treatment of skeletal growth retardation disorders
IT201900025126A1 (en) * 2019-12-20 2021-06-20 Sildeha Swiss S A USE OF HYALURONIC ACID DERIVATIVES IN THE REGENERATION OF BONE TISSUES AND CARTILAGE
CN116162589A (en) * 2022-12-30 2023-05-26 西北工业大学 Stem cells, preparation method and application thereof, labeling composition and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270197A (en) * 1990-12-20 1993-12-14 The Children's Medical Center Corporation Cells expressing a substantial number of surface high affinity HBGF receptors but relatively few low affinity HBGF binding sites and system for assaying binding to HBGF receptor
US5571895A (en) * 1992-12-22 1996-11-05 Takeda Chemical Industries, Ltd. Modified GAF polypeptides

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5226914A (en) * 1990-11-16 1993-07-13 Caplan Arnold I Method for treating connective tissue disorders
JP3385040B2 (en) * 1991-02-14 2003-03-10 武田薬品工業株式会社 Glial activator and method for producing the same
WO1994021813A1 (en) * 1993-03-17 1994-09-29 The Whittier Institute For Diabetes And Endocrinology Monoclonal antibodies specific for fibroblast growth factor receptors, immunotoxins, and use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270197A (en) * 1990-12-20 1993-12-14 The Children's Medical Center Corporation Cells expressing a substantial number of surface high affinity HBGF receptors but relatively few low affinity HBGF binding sites and system for assaying binding to HBGF receptor
US5571895A (en) * 1992-12-22 1996-11-05 Takeda Chemical Industries, Ltd. Modified GAF polypeptides

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8870876B2 (en) 2009-02-13 2014-10-28 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US8277459B2 (en) 2009-09-25 2012-10-02 Tarsus Medical Inc. Methods and devices for treating a structural bone and joint deformity
US8795286B2 (en) 2009-09-25 2014-08-05 Tarsus Medical Inc. Methods and devices for treating a structural bone and joint deformity
US8652141B2 (en) 2010-01-21 2014-02-18 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US8696719B2 (en) 2010-06-03 2014-04-15 Tarsus Medical Inc. Methods and devices for treating hallux valgus
US11702642B2 (en) 2013-01-16 2023-07-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders
US11814654B2 (en) 2013-01-16 2023-11-14 Institut National De La Sante Et De La Recherche Medicale Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders
US11021528B2 (en) 2016-07-07 2021-06-01 INSERM (Institut National de la Santé et de la Recherche Médicale Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof
US11697678B2 (en) 2016-07-07 2023-07-11 Pfizer Inc. Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof

Also Published As

Publication number Publication date
AU6014496A (en) 1997-01-09
EP0833620A1 (en) 1998-04-08
DK0833620T3 (en) 2003-01-13
EP1342476A2 (en) 2003-09-10
ATE225652T1 (en) 2002-10-15
IL122472A0 (en) 1998-06-15
EP0836380A4 (en) 1999-03-31
ES2183957T3 (en) 2003-04-01
WO1996041620A1 (en) 1996-12-27
CN1195982A (en) 1998-10-14
CA2224229A1 (en) 1996-12-27
DE69619526T2 (en) 2002-10-31
ATE213590T1 (en) 2002-03-15
US6447783B1 (en) 2002-09-10
JPH11507828A (en) 1999-07-13
WO1996041523A1 (en) 1996-12-27
EP1342476A3 (en) 2003-09-17
EP0833620B1 (en) 2002-10-09
AU715996B2 (en) 2000-02-17
EP0836380B1 (en) 2002-02-27
EP0833620A4 (en) 1998-05-06
JPH11508358A (en) 1999-07-21
DK0836380T3 (en) 2002-04-22
DE69624239T2 (en) 2003-07-10
EP0836380A1 (en) 1998-04-22
CA2223701A1 (en) 1996-12-27
JP2004305221A (en) 2004-11-04
ES2173289T3 (en) 2002-10-16
DE69624239D1 (en) 2002-11-14
IL122473A (en) 2003-11-23
IL122473A0 (en) 1998-06-15
DE69619526D1 (en) 2002-04-04
CA2223701C (en) 2010-02-16
AU6014596A (en) 1997-01-09
IL122472A (en) 2003-11-23
JP3673281B2 (en) 2005-07-20
AU721773B2 (en) 2000-07-13

Similar Documents

Publication Publication Date Title
US6447783B1 (en) Compositions comprising FGF9 and use thereof for stimulating cartilage and bone repair
Hecht et al. Identification of fibroblast growth factor 9 (FGF9) as a high affinity, heparin dependent ligand for FGF receptors 3 and 2 but not for FGF receptors 1 and 4
Roghani et al. Heparin increases the affinity of basic fibroblast growth factor for its receptor but is not required for binding.
Aviezer et al. Heparin-dependent binding and autophosphorylation of epidermal growth factor (EGF) receptor by heparin-binding EGF-like growth factor but not by EGF.
US7067260B2 (en) Methods of identifying morphogen receptor-binding analogs
US5830671A (en) Method for assaying for modulators of cytokines of the TFG β superfamily
Meier et al. Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins
EP0567585B1 (en) Hepatic growth factor receptor is the met proto-oncogene
US20030104406A1 (en) Modified and stabilized GDF propeptides and uses thereof
Tang Inhibitors of neuronal regeneration: mediators and signaling mechanisms
US20060030520A1 (en) GDF3 propeptides and related methods
JP2008537488A (en) Detection of GDF-8 modulating substances
WO2003011908A2 (en) Mutant forms of the tgf-b type ii receptor which bind all tgf-b isoforms and the use thereof
JP2005506275A (en) Novel fibroblast growth factor
Stephani et al. Nerve growth factor (NGF) in serum: Evaluation of serum NGF level with a sensitive bioassay employing embryonic sensory neurons
EP1334365B1 (en) Screening methods for bone morphogenetic mimetics
Ito et al. Dual effects of heparin on VEGF binding to VEGF receptor-1 and transduction of biological responses
Hopf et al. Heparin inhibits acetylcholine receptor aggregation at two distinct steps in the agrin‐induced pathway
JP2010506930A (en) Compositions and methods for modulating the activity of TLR14
JP2002500755A (en) Assay for ligands for tyrosine kinase receptors
CN1187754A (en) FGF9 as specific ligand for FGFR3
WO1995025166A1 (en) Methods for treatment or diagnosis of diseases or conditions associated with abnormal signal transduction
JP2003079378A (en) Novel endothelial zinc finger protein ezi and gene thereof
JP2003079376A (en) Novel endothelial zinc finger protein (ezi) and gene thereof
Zhou Characterization of the cysteine-rich fibroblast growth factor receptor: A novel fibroblast growth factor binding protein localized in Golgi apparatus of the cells

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION