CN1187754A - FGF9 as specific ligand for FGFR3 - Google Patents

Abstract

The present invention concerns fibroblast growth factor 9 (FGF9) as a high affinity ligand for fibroblast growth factor receptor 3 (FGFR3) which ligand is capable of binding and activating FGFR3 in a specific manner. The present invention is also directed to methods for detection of FGFR3 by utilizing FGF9, as well as to pharmaceutical compositions for modulating the activity of FGFR3 comprising as an active ingredient FGF9, antagonists thereof or FGF binding agents which are capable of neutralizing native circulating FGF9. The present invention further concerns novel recombinant mouse and chicken FGF9, expression vectors comprising these recombinant FGF9s and a transgenic animal transformed with said expression vectors.

Description

The FGF 9 as specific ligand of FGFR3

Invention field

The present invention relates to fibroblast growth factor 9 (FGF9), the new high-affinity part of a kind of fibroblast growth factor receptor3 (FGFR3), detect the method for FGFR3 and be used to regulate the FGF9 that comprises of FGFR3 activity, the pharmaceutical compositions of its antagonist or FGF9 bond with described part.

Fibroblast growth factor (FGF) comprises and has at least 9 kinds to relate to the family that various bioprocesss comprise the multifunctional polypeptides of form generation, angiogenesis and tissue reconstruction.They can stimulate the breeding of mesenchyma to epithelium and neuroectodermal origin cell.FGF is structurally similar, but different on its target-specific and the expression general layout of space and time.Four kinds of FGF acceptors (FGFR) gene of coding transmembrane protein tyrosine kinase is cloned in mammal and identified, and description (Givol and Yayon that their homologue in birds, xenopus and Drosophila is arranged, FASEB J., 6:33623369 (1992)).Yet the actual quantity of functional receptor protein is more, because different RNA montages and a plurality of polyadenylations site will produce variant a large amount of cell combinations or secreted form.Except these high-affinity receptors, FGF can with heparan sulfate proteoglycan (HSPG) strong bonded of low-affinity, high quantity binding site.These Heparan sulfates are regulated FGF-receptors bind and biologically actives, and the inherent component of an obligate when forming as functional three compounds of FGF, FGFR and suitable HSPG.

Because the variant of part and acceptor is a lot, be their ligand-receptor specificity about a subject matter of FGF function.FGFR1 and FGFR2 and the similar affinity of being combined with of acid FGF/FGF1 and basic FGF/FGF2 (people such as Dionne, EMBO J., 9:2685-2692 (1990)).In fact all so test FGFR and FGF1 and FGF4 (hst/kfgf) be combined with moderate to height affinity, this proves that there is tangible Feng Yu in the FGF system.Opposite with FGFR1 and 2, find that FGFR3 only combines (Orntiz and Leder, J.Biol.Chem., 267:16305-16311 (1992) with FGF1 and FGF4 with moderate affinity; People such as Chellaiah, J.Biol.Chem., 269 (15): 11620-11622 (1994)).Now also do not identify the ligands specific of arbitrary splicing form of this acceptor.

Recently, the sudden change of FGFR3 has caused this modal hereditary nanism of achondroplasia.Through the FGFR3 order-checking to the achondroplasia patient, finding has sudden change at the diaphragm area of striding of acceptor.

For the requirement of this disease of research and its possible medicine of exploitation, the research that relates to achondroplastic acceptor FGFR3 just need a kind of at this acceptor, basically not with other three kinds of ligands specifics that FGFR combines.

Discover a kind of heparin-bounding neuroglia activity factor that obtains from the culture supernatants purifying of human glioma cell system by autoploidy, it is in the FGF family the 9th kind, therefore is called FGF9.208 amino acid whose protein of finder's FGF9 codified, it has the biologically active spectrum of the unique spongiocyte that excites nerve, PC-12 cell and BALB/C 3T3 fibroblast proliferation, but endothelial cell there is not short cell division effect (people such as Miyamote, Mol.Cell.Biol., 13 (7): 4251-4259 (1993); People such as Naro, J.Bio1.Chem., 267:16305-16311 (1993)).

Brief summary of the invention

According to wonderful discovery, the present invention relates to high-affinity (kD:0.25nM) part fibroblast growth factor 9 (FGF9) of fibroblast growth factor receptor3 (FGFR3), it does not combine with FGFR1 or FGFR4 and only combines with extremely low affinity with FGFR2.

Therefore, the present invention at first provides FGFR3 ligands specific fibroblast growth factor 9 (FGF9).This specificity FGFR3 part is used for detecting and pharmacotherapy.

The ligands specific of this new FGFR3 can be used for the FGFR3 in test sample or the tissue, and method comprises:

(i) FGF9 and sample or tissue contacts, make the formation receptor-ligand right and

(ii) detect the right existence of FGFR3-FGF9, positive testing result represents have FGFR3 to exist in sample or the tissue.

Sample can be body fluid such as blood sample, and soluble FGFR3 is wherein arranged, and tissue can be the tissue that for example obtains by the cartilage biopsy from the patient, perhaps, also can be individual in-vivo tissue, detects in this case and carries out in vivo.

What detect is for example to use suitable detectable label flag F GF9, measures on any protein that marks whether to be attached in the sample then or is attached to the existence of measuring FGFR3 on the cell surface in the tissue.Another kind of detection method can be undertaken by the antibody of crossing with mark at FGF9, and it can discern the FGF9 that combines with FGFR3.

According to the present invention, find that FGF9 is the FGFR3 part that heparin relies on.Therefore, according to the method that detects FGFR3 with the FGF9 part, heparin preferably is present in the detection matrix.

According to the present invention, find that also FGF9 not only combines with the FGFR3 specificity, but also specificity activates this receptor and do not activate FGFR1 and FGFR4 acceptor, and if select suitable concentration, it can not activate FGFR2 significantly.This discovery makes can pharmaceutical compositions, and it comprises pharmaceutically acceptable carrier and as the FGF9 of effective therapeutic dose of active component.This pharmaceutical composition can be used for stimulating the activity of FGFR3.

This discovery also makes can pharmaceutical compositions, and it comprises pharmaceutically acceptable carrier and as the FGF9 antagonist of active component, or a kind of FGF9 bond is as a kind of antibody at FGF9.

The pharmaceutical composition that comprises the FGF9 antagonist activity of FGFR3 that can directly weaken comprises the FGF9 bond as can the neutralize natural FGF9 of circulation of the pharmaceutical composition at the antibody of FGF9, the activity of the FGFR3 that therefore weakened indirectly.

The reparation of common cartilage and bone growth and cartilage and bone injury need the FGFR3 activity just regulating and negative the adjusting between a specific and balance is accurately arranged.Not being to wish combination in theory, supposing that active FGFR3 is essential in the initial period of cartilage-bone differentiation, after differentiation, is that cartilage-bone is repaired required.Therefore, the available pharmaceutical composition that comprises the active component FGF9 that stimulates the FGFR3 activity, by as administration promotes cartilage and bone reparation to damage location.And FGFR3 is present in the mescenchymal stem cell usually, disappears in its differentiation back.Use FGF9 and can stablize FGFR3, thereby prolonged its activated time before differentiation.FGF9 also has chemotaxis for the cell that carries FGFR3, and can promote this FGFR3 of carrying cell (being typically mescenchymal stem cell) to migrate to the position of hope, for example by the growth dish top of injection FGF9 to post.

According to this theory, the FGFR3 excessive activation after differential period will cause growth to stop at initial bone and cartilage cell, and this may just cause achondroplasia.Therefore, the pharmaceutical composition of antagonist that comprises the active component FGF9 of the FGFR3 activity that can weaken, or the pharmaceutical composition that comprises the FGF9 bond (as the antibody at FGF9) of the FGF9 of the natural circulation that neutralizes can be used for the overactive situation of FGFR3 acceptor in the differentiated tissue (this situation forms bone and cartilage-derived growth stops), this bone and cartilage-derived growth stop and will cause the achondroplasia nanism, or other bone and cartilage-derived growth deformity, for example multiple hereditary epostoma, single-shot sex inheritance epostoma, Out-Toeing deformity, synovia chondroma and interior chondroma.

Above-mentioned disease can be treated with maybe can the neutralize pharmaceutical composition of FGF9 bond of FGF9 of natural circulation of the antagonist that comprises FGF9, wherein two kinds of components activity of FGFR3 that all can weaken.

The present invention also relates to a kind of new reorganization MFGF9 and a kind of new reorganization chicken FGF9 and the dna sequence dna of these new recombinant proteins of encoding.

The invention still further relates to a kind of expression vector of the FGF9 of comprising sequence with strong promoter (as CMV or SV40) or cartilage/bone promotor (as collagen 2 type promotors) control expression.This expression vector can form the transgene mammal of an overexpression FGF9, thereby causes the excessive activation of FGFR3 acceptor to cause that growth stops.This animal can be used as growth stopping property disease such as the achondroplastic model of inheritance.

Invention is described with reference to some unrestricted drawings and Examples below.

Accompanying drawing describes in detail

The nucleotide of Fig. 1-MFGF9 and amino acid sequence have wherein shown FGF9:pET-3C and deduced amino acid.

Nucleotide and the amino acid sequence of Fig. 2-chicken FGF9 have wherein shown FGF9:pET-3C and deduced amino acid.

Fig. 3 A, 3B, 3C have shown mouse, the amino acid of rat and people FGF9 and the comparison of nucleotide sequence.

The purifying of Fig. 4-FGF9.Partially purified FGF9 combines and uses 0.2-2M salt gradient wash-out with heparin sepharose, protein content is measured with spectrophotometer (A).Be to differentiate the FCF9 in the elution fraction, each component 10ml is separated with 15%SDS PAGE, be transferred on the NC Nitroncellulose, (B) carry out Western blotting with specific antibody (anti-SP32).The purity of component is measured by add 5ml silver coloring agent in each component of separating in 15%SDS PAGE (C).

The binding specificity of Fig. 5-FGF9.The FGF9 of purifying is fixed on the heparin sepharose pearl binding ability (A) in the solvable extracellular region territory of the various FGFR that mensuration FGF9 is connected with alkaline phosphatase.The amount of FGFR is estimated according to alkaline phosphatase activities (B).Immunoprecipitation can be come with the alkali resistance phosphatase antibody in the solvable extracellular region territory of the equivalent of FGFR1,2,7-IIIb, 3,3-IIIb and 4 alkaline phosphatase enzyme fusion proteins.When being with or without 0.5 μ g/ml heparin and hundred times of excessive unlabelled FGF9 (excessive unmarked), make with described material and method ¹²⁵I-FGF9 combination and crosslinked.

The analysis of the FGF9 of Fig. 6-combine with solubility FGFR2 and FGFR3.Under described material and method, concentration is increased ¹²⁵I-FGF9 be adsorbed on maxisorb plate dish on FGFR2 (A) and the solvable extracellular region territory of FGFR3 (B) combine.Analyze with Scatchard analytical method (inserting little figure) in conjunction with the result.

Fig. 7-FGF9 is crosslinked with the heparin dependence of the Chinese hamster ovary celI of expressing FGFR3.Be with or without under 1mg/ml heparin and the 100 times of excessive unmarked FGF9 of mistake (excessive unmarked) 5ng/ml 40 ℃ the time as described ¹²⁵The K1 of the FGFR3 transfection of I-FGF9 and individual layer and A745 Chinese hamster ovary celI are cultivated.As with as described in material and method carry out crosslinked and electrophoretic separation.

The DNA that the FGF9 that Fig. 8-heparin and heparin component rely on induces is synthetic.Make the CHO-A745 cell of individual layer FGFR3 transfection be in the serum starvation state, and cultivate with 10ng/ml FGF9, the heparin (A) of specified amount or the heparin component (B) that 2mg/ml specifies number monosaccharide unit.

Fig. 9-by the plasmid of the FGF9 of collagen 2 type promotors control.

Detailed Description Of The Invention

I. material and method

(a) cell

Wild type (KI) and the CHO mutant cell cultivating Dr.J.D.Esko (department of biochemistry, University of Birmingham, Alabama) and provide with additional 10% hyclone of F12 medium are A745.With 10 μ gFGFR3 transfection CHO cells in the pZL plasmid that neomycin resistance is arranged be by with Gene Pulcer (Bio-Rad) in 960 microfarads, 250 volts time are carried out that electroporation realizes.Select single stable clone with G418 (0.5mg/ml).

(b) antibody

Anti-FGF9 polyclonal antibody is to produce by New Zealand white rabbit is injected and collect serum behind two additional dosage.Anti-FGF9 antibody uses MBS at two peptide sections (SP31:Cys-Ser-Asn-Leu-Tyr-Lys-His-Val-Gln-Thr-Gly-Arg-Arg-Tyr, the SP32:Asp-His-Leu-Lys-Gly-Ile-Leu-Arg-Arg-Arg-Gln-Leu-Tyr-Cys) prepare coupled with KLH (keyhole  hemocyanin).The serum that obtains is further purified on a-protein Ago-Gel (Repligen) and obtains the IgG component.

(c) radioactive label of FGF9

Reorganization MFGF9 Na ¹²⁵I (0.5mCi) marks by the toluene-sodium-sulfonchloramide method, and separates with the iodine that dissociates on the heparin sepharose post.Than scope alive is 0.5-2 * 10 ⁵Cpm/ng.

The clone and the expression of the mouse homologue of embodiment 1:FGF9

Extracting goes out whole RNA and is used for polymerase chain reaction (PCR) based on FGF9 clone from 12.5 days mouse embryo.Auele Specific Primer (the forward: GGGAATTCCATATGGCTCCCTTAGGTGAAG of personnel selection FGF9; Oppositely: CGGGATCCTCAACTTTGGCTTAGAATATCC) and mouse RNA template carry out PCR.(35 circulations, each circulates in 94 ℃ of sex change 1 minute, 56 ℃ of annealing 2 minutes, 72 ℃ were extended 3 minutes).Obtaining single expectation size is the DNA product of 630bp, and it is directly used in subclone people pET-3C bacterial expression vector (Novagene).

Sequence analysis discloses and to be expected to be the long transcript (Fig. 1) of 672bp and people FGF9 cDNA and to have 93% identical.The FGF9:pET-3C plasmid is used for the B1-21 bacterial strain of transformed into escherichia coli.At exponential phase, the bacterium of conversion was induced 2 hours with lmMIPTG, centrifugation under 7000RPM, and with the probe ultrasonic generator (Soniprep150 is MSE) 3 of ultrasonic processing on ice 15 seconds.The supernatant that the centrifugal back of bacterium ultrasonication thing is obtained is splined on heparin sepharose post (Pharmacia, Upsala, Sweden), post is with the 0.15MNaCl of 10 times of column volumes, 0.05%Chaps, the 0.7M NaCl of 20mM Tris pH7.4 and 10 times of column volumes, 0.05%Chaps, 20mM Tris pH7.4 fully washs, then, in conjunction with protein at the 2M of 0.5ml NaCl, 0.05%Chaps, 10mM Tris pH7.4 component place wash-out, water dilute also again upper prop in the small-sized FPLC post of the 1ml of pre-equilibration heparin sepharose (Pharmacia at 1: 10, Upsala, Sweden).After fully washing post, post is with continuous 0.2-2M NaCl gradient elution, and decides the protein curve by the absorbance at 280nm place.Component is measured its biologically active by mix the 3H-thymidine in the BALB/c-3T3 fibroblast, is used in the polyclonal antibody at the FGF9 specific polypeptide that produces in the rabbit by the Western blotting and measures specificity.The main protein band that obtains at estimated molecular weight 27kDal place can with the antibody generation specific reaction of two different specificitys at FGF9 peptide section.

Carry out PCR with clone's MFGF9 (mFGF9) with the cDNA that makes from 12.5 days mouse embryo RNA.The FGF9 of MFGF9 cDNA and people and rat has 93% and 98% sequence homology (Fig. 3 A-3C) respectively.The amino acid sequence of mFGF9 is identical with the amino acid sequence of big MFGF9, with the amino acid sequence of people FGF9 only in the position 9 places different (they are serine, and people FGF9 is an asparagine).The MFGF9 of reorganization is expressed in colibacillary B1-21 bacterial strain, and obtains by two circulations of purifying on the heparin sepharose post from bacterial lysate.FGF9 is with 1.0-1.2M NaCl wash-out from the heparin sepharose, and measures absorbance (Fig. 4 A) at 280nm.The existence of FGF9 is used at the polyclonal antibody of FGF9 specific peptide section by Western blotting and is measured in the component, and the main protein band of this proof at the estimated molecular weight place is the non-glycosylated protein matter (as Fig. 4 B) of 27kDal.The purity of each preparation also uses argentation (Fig. 4 C) further to measure.The reorganization MFGF9 has biologically active, it stimulates in the dose dependent mode, and DNA's in the BALB/C 3T3 fibroblast is synthetic, half of maximum 3H-thymidine value of mixing is the 0.5ng/ml (not shown), this and coming to the same thing of obtaining from the people FGF9 of purifying (people such as Nauro, J.Bio1.Chem., 267:16305-16311 (1993)).

Embodiment 2: the clone and the expression of chicken FGF9 homologue

The clone of chicken FGF9 homologue and expression are used from chicken mRNA such as the embodiment 1 described method that obtains of deriving and are carried out.

Embodiment 3: acellular in conjunction with measuring

Mouse FGFR1 had been described in the past, FGFR2, the extracellular region territory of the two kinds of isoforms of the FGFR3 in keratinocyte growth factor acceptor (KGFR) and the alkaline phosphatase expression vector (Givol D. and YayonA., Adv.Cancer Res.160,1-41 (1993); (people such as Lev, biochemistry, 267,15970-15977 (1992)).From the conditioned medium of NIH 3T3 transfectional cell, collect FGFR-alkaline phosphatase enzyme fusion proteins and be directly used in combination and measure.The content of receptor protein detects to determine by as substrate (as people such as Lev, the same described) alkaline phosphatase activity being carried out spectrophotometer with the p-nitrophenol phosphate at 405nm.Soluble receptors bind reactant mixture comprises acceptor-AP conditioned medium, radiolabeled part and heparin or other HSPG.In conjunction with compound come immunoprecipitation with the polyclonal antibody (Zymed) and the a-protein Ago-Gel (Repligen) of alkali resistance phosphatase.All components at room temperature are blended in the binding buffer liquid that cumulative volume is 250ml (DMEM wherein adds 25mMHepes in addition, pH7.4 and 0.1% bovine serum albumin(BSA)).Association reaction at room temperature carried out 2 hours.In conjunction with part (2000g) reclaimed in centrifugal 10 seconds at 6000rpm, and use 150nM NaCl, 0.1%Triton-X-100 and 50mM Hepes, the solution of pH7.4 (HNTG) give a baby a bath on the third day after its birth time with little centrifuge. ¹²⁵The factor of I-combination is directly counted pipe by γ-counter and is measured.After washing, (disccinimidyl DSS) or in 1mMBis (sulfosuccinimide base) suberate (BS3) the adding phosphate buffer (PBS) carried out cross-linking reaction 30 minutes with 0.15mM two succinimido suberates under the room temperature.Compound PBS washed twice, and boiled 5 minutes with sample buffer.Sample is separating with electroporation under reducing condition on the sds page, and desiccant gel also is placed on Kodak (Eastman Kodak Co., Rochester is NY) under the X-Omat AR film.

Perhaps, (Sigma Chemicals, 96 hole maxisorb plates (Nunk) Isrcal) at room temperature reacted 2 hours with acceptor-AP fusion by anti-PLAP's monoclone antibody to make the bag that spends the night in advance.After with the washing of binding buffer liquid, plate is at room temperature with variable concentrations ¹²⁵The FGF9 of I mark cultivated when being with or without heparin 2 hours.Cultivating the last of time, plate is with binding buffer liquid washed twice, and with the 20mM that contains 1.6MNaCl, the sodium acetate wash-out of pH5.4.Acid extract is counted in gamma counter.

Be the receptors bind character of explanation FGF9, utilized extracellular region territory a series of and the FGF acceptor that the PLAP is coupled.Confirm as the front, the solvable extracellular region territory of FGF acceptor can be successfully specifically with the part reaction, thereby provide a good instrument (Rimion for the specificity of analyzing ligand-receptor, D.L, Prof.Clin.Bi01.Res.187,131-140 (1985), people such as Lev, the same).Reaction between FGF9 and solvable acceptor is at first analyzed by the alkaline phosphatase activities that mensuration is fixed on the FGF9 on the heparin-agarose gel.The FGF9 that is fixed on the heparin-agarose gel combines with FGFR2 and FGFR3 fusion, but does not combine (Fig. 5 A) with FGFR1 or FGFR4.Only the IIIc of FGFR2 and FGFR3 combines with FGF9 with the I type, and the IIIb of these acceptors does not demonstrate with the FGF9 specificity with the I type and combines.FGF9 further combines by the FGF9 that radioactive label is crossed and crosslinked analysis the (Fig. 5 B) with reaction between solvable acceptor.When the 0.5mg/ml heparin exists, FGF9 only combine with FGFR2 and FGFR3 and get along well FGFR1 or FGFR4 in conjunction with and any IIIb montage tested of getting along well with the combination of I type.When no heparin, do not find to have significant combination, this expression heparin is to the obligate effect of high-affinity FGF9-receptors bind.Monomer and dimeric forms that two covalently bound compounds of FGF9 and FGFR2 and FGFR3 more likely are the receptor-ligand compounds.With ¹²⁵The soluble FGFR2 of I-FGF9 affinity labeling and FGFR3 protein are eliminated in the unmarked part of 100 times of molar excess, and this shows that the combination of these acceptors and mark are specific.

Be the combination of quantitative description FGF9 and FGFR2 and FGFR3, carry out the direct mensuration that combines of radiolabeled FGF9 and solvable acceptor.FGF9 is specific with combining of two acceptors and is saturated (Fig. 6 A and 6B).Analysis result (Fig. 6 inserts little figure) by the Scatchard analytical method shows that the dissociation constant that FGF9 combines with FGFR2 is 2.38nM, and the dissociation constant of reacting with FGFR3 is 0.78nM.Two additional tests obtain closely similar result.In single test, compare with FGFR3 with the affinity of FGFR2 and will hang down about 3 times.FGF9 does not have significance and specificity (not shown) with combining of FGFRI.

Embodiment 4:FGF9 combines with the high-affinity of cell surface receptor and is crosslinked

With 24 the confluent culture in the porose disc (Nunk) be chilled to 4 ℃ and with binding buffer liquid washed twice in advance.Make then they at 4 ℃ with variable concentrations ¹²⁵I-FGF9 cultivated 2 hours being with or without under the heparin situation in binding buffer liquid.Discard in conjunction with medium, cell washs once with the 25mM Hepes pH7.5 that contains 0.5M NaCl with binding buffer liquid washed twice.With the 20mM that contains 1.6M NaCl, the factor of pH4.5 sodium acetate elution of bound is also counted the factor of measuring the high-affinity combination in gamma counter.Determine that in conjunction with the numerical value that obtains association reaction does not have specificity according to the high-affinity in 100 times of excessive unmarked factors.Crosslinked for carrying out, in PBS, carry out association reaction, after cultivating 1 hour, add DSS and be 0.15M and react more than 1 hour to ultimate density.Cell is washed twice in PBS, scrapes broken and cracking in the lysis buffer of small size, and lysis buffer contains 150mM NaCl, 20mM Tris (pH8.0), 1mM MgCl ₂, 0.1mM ZnCl ₂, 0.5%NP-40,1mg aprotinin, 1mg/ml leupeptin and 2mM PMSF.The cell lysate of centrifugal clarificationization is boiled and under reducing condition, on sds page, carry out electroporation.

As mentioned above, FGF9 and the strict existence that depends on heparin of combining of FGFR2 and FGFR3.Be the specificity needs to heparin of combining of FGF9 relatively and each acceptor, we at first measure the FGF9 heparin amount required with combining of solvable FGFR2 and FGFR3.In crosslinked test, only find compound seldom when in FGFR2 or FGFR3, not adding heparin.Yet,, find that two kinds of acceptors have significant difference to the demand of heparin along with the increase of heparin concentration.

Immunoprecipitation is come with the antibody of alkali resistance phosphatase in the solvable extracellular region territory of FGFR2 that links to each other with alkaline phosphatase and FGFR3, and and 5ng/ml ¹²⁵The heparin of I-FGF9 and increase concentration is cultivated.Crosslinked and electrophoretic separation is carried out as embodiment 3 is described.The binding capacity optical density determination method of FGF9 and FGFR2 (Fig. 5 A) and FGFR3 (Fig. 5 B) is come quantitatively.

FGF9 is very sensitive with combining heparin of FGFR2, just can make and is combined with tangible increase as long as add the heparin reach 0.5ng/ml less, and maximum receptors bind is about 5ng/ml.Yet FGF9 and FGFR3 combine the unbound heparin that needs about 20 times higher level, and the maximum receptors bind 100ng/ml heparin of only having an appointment, heparin concentration during greater than 500ng/ml in conjunction with inhibition is arranged slightly.

FGF9 and FGFR2 or FGFR3 in conjunction with different may the explanation between required heparin level, FGFR3 more has specific heparin structure in conjunction with one of needs, it comprises the less relatively part of used heparin mixture.For research promotes FGF9 in conjunction with required heparin structure, we have measured a series of sizes is that the heparin component of 4 to 18 monosaccharide unit is for the influence that combine of FGF9 with the solvable extracellular region territory of FGFR2 and FGFR3.

In order to determine observed high-affinity in the body, to depend on the FGF9 of heparin and the physiological relation of the reaction between FGFR3, saltant (745pgs) Chinese hamster ovary celI (but the known low expression level endogenous of this cell FGFR (Yayon A. in wild type (KI) and Heparan sulfate defective, Deng the people, cell, 64:841-848 (1991))) the middle total length mouse FGFR3 that expresses.Because the cell of untransfected does not demonstrate the combination of detectable radioactive label FGF9, do not express the protein of covalent cross-linking yet, the CHO-KI cell of FGFR3 transfection demonstrates the protein band of 145kDal, its monomer with acceptor FGF9 compound corresponding (Fig. 7).According to expectation, ¹²⁵I-FGF9 combines and the crosslinked influence that is not subjected to exogenous heparin with the wild type CHO-KI cell of expressing FGFR3.Yet when not having heparin, not detecting FGF9 has crosslinked (Fig. 7) with the saltant HS deficiency CHO-745 cell of expressing FGFR3, and this has supported the efficient compatible reaction of FGF9 to need the viewpoint of heparin quasi-molecule.After adding heparin, 745-FGF3 with ¹²⁵The I-FGF9 affinity labeling is significant, can't distinguish with wild-type cell, and this explanation heparin can be supported the high-affinity combination between FGF9 and FGFR3.Combination on two kinds of cells all is specific and saturated (when the 1mg/ml heparin exists), and the kD of CHO-KI cell and CHO745 cell is respectively 0.06 and 0.1nM.Obtain typical heparin dose dependent and increase when FGF9 combines with CHO 745-FGFR3 transfectional cell, maximum specificity is combined into the heparin (data are unlisted) of about 500ng/ml.

Embodiment 5:DNA is synthetic to be measured

Be used in 24 orifice plates, the confluent culture of growing in the F12 culture of additional 10% hyclone can be measured the thymidine that mixes CHO.Make cell under serum-free hungry 24 hours, then with or do not cultivate again 14 hours with the FGF9 of various concentration or with 10% serum (in contrast), add 3H-thymidine (0.5mCi/ml) then and reacted again 2 hours.Last what cultivate, cell is fixed 20 minutes with cold PBS washed twice with 5% ice-cold trichloroacetic acid, with 95% washing with alcohol and be dissolved among the 0.1MNaOH.Measure the relevant radioactivity of DNA with liquid scintillation counting (LSC).

For whether the activation of measuring FGFR3 also needs heparin, we have studied the synthetic required heparin amount of the interior DNA of HS-defective CHO 745 cells of FGF9 abduction delivering FGFR3.When not having exogenous heparin, then mix the 3H-thymidine by FGF9 and do not find that significant increase (Fig. 8 A) is arranged, this is consistent with lacking of receptors bind and similar to the strictness needs of heparin to the FGF of other research.Add the heparin of low concentration can be significantly so that to promote to depend on the DNA of FGF9 synthetic with dose-dependent mode, and a half-sum ceiling effect of ceiling effect is respectively at 100ng/ml and 2mg/ml.Using heparin does not separately have influence to DNA is synthetic, and the DNA that FGF9 induces among the CHO-KI is synthetic and the irrelevant (not shown) of exogenous heparin.

For the research heparin promotes FGF9 in conjunction with required structure, we have analyzed a series of sizes is that the heparin component of 6 to 18 monosaccharide units is for the synthetic effect of FGF9 inducing DNA.Although the heparin component of 6 monomers has suppressed the effect of FGF9, find to have DNA to synthesize at the 8-10 monomer component and induce, when heparin fragment was the 14-16 monomer, FGF9 had ceiling effect (Fig. 8 B).These results represent that FGFR3 is activated the heparin of a specific size of needs by FGF9.

Embodiment 6 expresses the plasmid construction thing of FGF9

Be the FGF9 of express recombinant, come the cDNA of subclone MFGF9 with the Ndel/BamH site of bacterial expression vector pET-3C.After BL-21 cell transformation and 1mM IPTG induce, cell lysis and purifying FGF 9 on the heparin-agarose gel column.

With the downstream of the acceptor splicing site of total length MFGF9 cDNA subclone people collagen I IAl gene, after collagen I IAl gene is positioned at its promotor and cartilage specificity enhancer.Construction is linearized, and is used for being injected into the mouse ovum of fertilization to produce trangenic mice.

The FGF9 overexpression of embodiment 7 transgenic animal

Trangenic mice transforms with the carrier of above-mentioned overexpression FGF9.These trangenic mices are with closely similar with the trangenic mice of FGFR3-Ach sudden change (achondroplastic FGFR3 sudden change is arranged), and just the bodily form is little, the feature of short-tail and short hind leg.This trangenic mice can be used as various nanisms and by the model of the excessive abnormal symptom that causes of FGF9.

Claims (20)

1. the method for the fibroblast growth factor receptor3 (FGFR3) in test sample or the tissue comprising:

(i) fibroblast growth factor 9 (FGF9) and sample or tissue contacts, make the formation receptor-ligand right and

(ii) detect the right existence of FGFR3-FGF9, positive testing result represents have FGFR3 to exist in sample or the tissue.

2. method according to claim 1, wherein sample or tissue are to carry out in the presence of heparin with contacting of FGF9.

3. pharmaceutical composition of regulating the FGFR3 activity comprises a kind of pharmaceutically acceptable carrier and as the FGF9 of effective therapeutic dose of active component.

4. pharmaceutical composition according to claim 3, it is used to improve the activity of FGFR3.

5. pharmaceutical composition according to claim 4, it is used to promote the reparation of bone and cartilage.

6. pharmaceutical composition of regulating the FGFR3 activity comprises a kind of pharmaceutically acceptable carrier and as the antagonist of the FGF9 of active component, or a kind of FGF9 bond.

7. pharmaceutical composition according to claim 6, wherein the FGF9 bond is the antibody at FGF9.

8. according to claim 6 or 7 described pharmaceutical compositions, it is used to reduce the activity of FGFR3.

9. pharmaceutical composition according to claim 8, it is used for the treatment of and is selected from multiple or single-shot sex inheritance epostoma, Out-Toeing deformity, achondroplasia, synovia chondroma and interior chondromatous disease.

10. reorganization MFGF9 DNA that nucleotide sequence shown in Figure 1 is arranged.

11. reorganization chicken FGF9 DNA that nucleotide sequence shown in Figure 2 is arranged.

12. a peptide species comprises the amino acid sequence of the described reorganization MFGF9 of claim 10 dna encoding.

13. a peptide species comprises the amino acid sequence of the described reorganization of claim 11 chicken FGF9 dna encoding.

14. an expression vector is included in claim 10 described reorganization MFGF9 DNA or the described reorganization of claim 11 chicken type FGF9DNA under the control expression of strong promoter and/or cartilage/bone tissue-specific promoter.

15. expression vector according to claim 14, wherein promotor is collagen 2 type promotors.

16. transgenic animal with claim 14 or 15 described expression vector transfections.

17. one kind promotes the method for cartilage or bone reparation to comprise:

The position of required reparation is applied the FGF9 of effective therapeutic dose and any one pharmaceutically acceptable carrier.

18. a pharmacotherapy is by FGF9 too much or FGFR3 overactivity and the method for the disease that causes comprises:

Object to the needs treatment applies the FGF9-bond of effective therapeutic dose or the antagonist of FGF9.

19. method according to claim 18, wherein the FGF9-bond is the antibody at FGF9.

20. according to claim 18 or 19 described methods, wherein disease is selected from:

Multiple or single-shot sex inheritance epostoma, Out-Toeing deformity, achondroplasia, synovia chondroma and interior chondromatous disease.

Images