US20020116737A1 - Plant cell death system - Google Patents

Plant cell death system Download PDF

Info

Publication number
US20020116737A1
US20020116737A1 US09/978,274 US97827401A US2002116737A1 US 20020116737 A1 US20020116737 A1 US 20020116737A1 US 97827401 A US97827401 A US 97827401A US 2002116737 A1 US2002116737 A1 US 2002116737A1
Authority
US
United States
Prior art keywords
pap
plant
sequence
inducing
specific cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/978,274
Other languages
English (en)
Inventor
Chrisotpher Thomas
Michael McPherson
Howard Atkinson
Anil Neelam
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Advanced Technologies Cambridge Ltd
Original Assignee
Advanced Technologies Cambridge Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Advanced Technologies Cambridge Ltd filed Critical Advanced Technologies Cambridge Ltd
Assigned to ADVANCED TECHNOLOGIES (CAMBRIDGE) LIMITED reassignment ADVANCED TECHNOLOGIES (CAMBRIDGE) LIMITED ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NEELAM, ANIL, THOMAS, CHRISTOPHER JOHN ROBERT, ATKINSON, HOWARD JOHN, MCPHERSON, MICHAEL JOHN
Publication of US20020116737A1 publication Critical patent/US20020116737A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8285Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for nematode resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289Male sterility
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to a plant cell death system, and in particular to transgenic plants which harbour within their genome a chimaeric gene which when expressed produces a cytotoxic protein.
  • hybrids are generally superior in a variety of characteristics to either parent, a phenomenon known as hybrid vigour. Such hybrid crosses may be performed by manual cross pollination, a tedious and time consuming procedure.
  • female parent may be emasculated by hand, e.g. in the production of hybrid corn by de-tasseling.
  • female parent lines male sterile
  • female parent lines may also be generated by genetic male sterility, a known trait in many plants, usually being recessive and monogenic. The problem with this approach is that it is difficult to obtain pure lines of male sterile parents for every cross.
  • the most widely used system of producing male sterility for use in hybrid production is cytoplasmic male sterility (cms). In this case cytoplasmic factors are responsible for pollen abortion.
  • male sterile cytoplasm may be associated with other undesirable characteristics, e.g. T-cytoplasm in maize and susceptibility to Helminthosporium maydis ; its application requires isogenic maintainer male fertile lines to propagate the male parent; and it is limited to species in which a cytoplasmic source of sterility is available.
  • Another advantage of a male sterility system would be the production of pollen-free plants. This would be desirable in a number of ornamental flower varieties, and would also have application in the containment of genetic traits by the prevention of outcrossing.
  • a further desirable property of a sterility system is that female sterile plants could be produced such that fruit development would occur in the absence of seed set. Seedless fruit varieties would be advantageous for processing e.g., tomatoes, and also desirable to the consumer, e.g. melon. Seedless varieties are available and there are established breeding programmes, but the development of seedless fruit has been limited by the availability of the appropriate germplasm in many species.
  • a genetic modification approach could provide sterility by providing a cell death system whereby necrosis occurs in specific cells in the reproductive tissues.
  • WO 89/10396 discloses a plant cell death system wherein a chimaeric gene is introduced into a plant, which chimaeric gene comprises an anther specific promoter attached to a RNAse protein or polypeptide which, when expressed, causes disruption of cell metabolism.
  • expression of the chimaeric gene results in necrosis of the anther cells and results in male sterility in the plants.
  • a similar cell death system whereby the target site may be the ovule of the plant, could be used to provide female sterility in plants.
  • WO 93/18170 and WO 92/04453 disclose plant cell death systems which are specific to controlling nematode infection.
  • a gene comprising a coding sequence, which coding sequence encodes for a product which is disruptive of nematode attack is introduced into a host plant species.
  • the gene further comprises a promoter region, which promoter region controls the expression of the coding sequence such that expression occurs upon nematode attack and substantially specifically within or adjacent to the nematode feeding site cells.
  • the product may be either inimical to the plant cells which differentiate into nematode feeding site cells or cells adjacent thereto, or inimical to the nematodes directly.
  • Economically important plant parasitic nematodes include cyst nematodes, such as potato cyst nematodes ( Globodera rostochiensis and G. pallida ), soybean cyst nematode ( Heterodera glycines ), beet cyst nematode ( Heterodera schachtii ) and cereal cyst nematode ( Heterodera avenae ), and root knot nematodes, such as Meloidogyne spp.
  • cyst nematodes such as potato cyst nematodes ( Globodera rostochiensis and G. pallida ), soybean cyst nematode ( Heterodera glycines ), beet cyst nematode ( Heterodera schachtii ) and cereal cyst nematode ( Heterodera avenae ), and root knot nematodes, such as Meloidogyne spp.
  • the target site may be specific parts of the flower, thereby altering the morphology of the flower.
  • the target site may be lateral roots, thorns or stinging hairs.
  • Abscission of leaf or fruit might be achieved by the targeting of the abscission zone of the leaf or the fruit.
  • Facilitating the release of seeds from plants, by targeting the funicle might be achievable.
  • targeting other organs such as trichomes, which trichomes are typically-glandular, the production of chemical substances by these organs can be cessated or prevented.
  • Another application might be the inducible abscission of roots, leaves, flowers, or fruit at the end of the growing season.
  • NZ 260511 a plant cell death system is proposed with increased tissue specificity.
  • This system comprises the expression of a cytotoxic molecule (under the control of a first promoter, which first promoter causes expression in specific target cells and at one or more other sites in the plant), in conjunction with a protective molecule (under the control of a second promoter, which second promoter causes expression in all of the sites where the first promoter is active except the specific target cells).
  • suitable cytotoxic and protective molecules are proteases and protease inhibitors, respectively, or nucleases and nuclease inhibitors, respectively.
  • WO 93/10251 discloses the use of a cytotoxic ribonuclease molecule Barnase together with the protective, inhibitor molecule Barstar.
  • WO 98/44138 discloses a method for improving the specificity of gene expression by targeting a specific expression site of a target gene.
  • a chimaeric gene which chimaeric gene comprises a promoter which expresses in more than one region of the organism to be affected.
  • the promoter is linked to an agent which affects the functioning of an endogenous gene in the plant which is also expressed in more than one region of the plant.
  • the promoter and agent are selected so that there is an overlap in their expression sites at one or more desired locations. This overlap site(s) gives increased specificity and targeting of gene expression.
  • Ribosome-inactivating proteins are a group of toxic plant proteins that catalytically inactivate eukaryotic ribosomes (Stirpe and Barbieri 1986). RIPs function as N-glycosidases to remove a specific adenine in a conserved loop of the large rRNA, and thereby prevent binding of Elongation Factor 2, thus blocking cellular protein synthesis.
  • Type 1 RIPs such as pokeweed antiviral protein (PAP) and barley translation inhibitor are each comprised of a single polypeptide chain, each with an approximate Mr value of 30,000.
  • Type 2 RIPs such as ricin, abrin and modeccin each comprise two polypeptide chains. One polypeptide with RIP activity (A-chain) is linked by a disulphide bond to a galactose-binding lectin (B-chain; Stirpe et al 1978). The Mr value of each Type 2 RIP is approximately 60,000.
  • Type 3 RIPs such as maize RIP comprise a single polypeptide chain which subsequently undergoes proteolytic cleavage to release two active peptide domains.
  • Pokeweed Phytolacca americana produces three distinct antiviral proteins, namely PAP′, PAPII and PAP-S that appear in spring leaves, summer leaves and seeds, respectively. Amino acid similarities between these three proteins have been observed.
  • PAP covers all three of these antiviral proteins.
  • PAP′ or PAPII are stored in the cell wall matrix of leaf mesophyll cells and may be isolated by aqueous extraction of macerated leaf tissue (Ready et al, 1986). It has been found that their exogenous application to the surface of plant leaves can confer protection against infection by a range of viruses in several different host plants (Chen et al, 1991; Lodge et al, 1993).
  • U.S. Pat. No. 6,015,940 discloses the preparation of a cDNA clone of PAP′ prepared from spring leaves of pokeweed, and the use thereof under the control of a constitutive promoter (either cauliflower mosaic virus 35S promoter or the figwort mosaic virus 35S promoter) in the production of transgenic tobacco and potato plants resistant to infection by the viruses PVX and PVY.
  • a constitutive promoter either cauliflower mosaic virus 35S promoter or the figwort mosaic virus 35S promoter
  • a negative feature of the resistant phenotype was that plants which expressed PAP′ at levels above 10 ng/mg protein exhibited mottled leaves and stunted growth. The plants that accumulated the highest levels of PAP′ were sterile.
  • the PAP gene is expressed in vivo in leaves initially to produce an inactive Pro-PAP protein. It is known that following translation, the Pro-PAP′ protein molecule is targeted to the cell wall. At some stage during this process the N- and C-terminal extensions of the Pro-PAP′ molecule are cleaved to produce an activated PAP′ molecule (mature PAP′). In the case of PAP-S (expressed in seeds) the cellular localisation is not known. However, the N-terminal processed region of PAP-S appears to have properties similar to signal sequences for targeting.
  • the structure of the mature PAP-S protein may be described in terms of two separate domains, corresponding to the two domains of Type 3 RIPs, or the two polypeptides of Type 2 RIPS, i.e. the ribosome binding domain and the catalytic domain.
  • Described herein are recombinant PAP-S molecules comprising separately the PAP-S ⁇ sequence or the PAP-S ⁇ sequence.
  • PAP-S ⁇ contains the RNA recognition motif and ribosome binding domain regions, whilst PAP-S ⁇ contains the critical catalytic residue site.
  • the present invention demonstrates that, surprisingly, expression of either the PAP-S ⁇ protein or the PAP-S ⁇ protein alone results in a significant inhibition of ribosome activity.
  • the present invention provides a method of inducing a necrotic effect in specific cells of a plant, wherein a plant is transformed with a chimaeric gene, the coding sequence of said gene coding for a mature pokeweed antiviral protein or part thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to said plant, so that said mature pokeweed antiviral protein or part thereof is expressed in specific cells of said plant.
  • the present invention further provides a plant transformed with a chimaeric gene, the coding sequence of said gene coding for a mature pokeweed antiviral protein or part thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to said plant, so that said mature pokeweed antiviral protein or part thereof is expressed in specific cells of said plant.
  • the present invention yet further provides a recombinant plant cell transformed with a chimaeric gene, the coding sequence of said gene coding for a mature pokeweed antiviral protein or part thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to said plant, so that said mature pokeweed antiviral protein or part thereof is expressed in specific cells of said plant.
  • the present invention also provides a DNA isolate comprising a chimaeric gene, the coding sequence of said gene coding for a mature pokeweed antiviral protein or part thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to said plant, so that said mature pokeweed antiviral protein or part thereof is expressed in specific cells of said plant.
  • the present invention further provides a biologically functional expression vehicle containing a chimaeric gene, the coding sequence of said gene coding for a mature pokeweed antiviral protein or part thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to said plant, so that said mature pokeweed antiviral protein or part thereof is expressed in specific cells of said plant.
  • part means a part of a gene encoding for a pokeweed antiviral protein, which part is active in inhibiting protein synthesis.
  • the chimaeric gene preferably encodes the mature PAP-S protein, the nucleotide sequence being given in SEQ. ID. No. 3 and the amino acid sequence being given in SEQ. ID. No. 4, or PAP-S ⁇ , the nucleotide sequence being given in SEQ. ID. No. 5 and the amino acid sequence being given in SEQ. ID. No. 6, or PAP-S ⁇ , the nucleotide sequence being given in SEQ. ID. No. 7 and the amino acid sequence being given in SEQ. ID. No. 8, or mature PAP′ or a variant thereof as described in U.S. Pat. No. 6,015,940 (i.e. nucleotides 290-1076 of SEQ. ID. Nos. 30 and 31), or mature PAPII as described in International Patent Application, Publication No. WO 99/60843 (i.e. nucleotides 75-903 of SEQ. ID. No. 32).
  • hybridisation procedures using conditions of high stringency are as follows: hybridisation to filter-bound DNA in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1 ⁇ SSC/0.1% SDS at 68° C. (Ausubel F. M. et al, eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley and Sons, Inc., New York, at p. 2.10.3).
  • Hybridisation procedures using conditions of moderate stringency that may be used are as follows: hybridisation to filter-bound DNA in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.2 ⁇ SSC/0.1% SDS at 42° C. (Ausubel et al, 1989, supra).
  • SSC Standard Saline Citrate
  • SSPE Standard Saline Citrate
  • SSPE Standard Saline Citrate
  • SSC Standard Saline Citrate
  • SSPE Standard Saline Sodium Phosphate EDTA
  • Suitable homologous sequences are sequences that are at least 70%, preferably 80% and even more preferably 90% or 95% homologous with each sequence listed herein, which such homolgous sequences retain the required enzymatic activity.
  • the suitable sequences may also be variants thereof.
  • Variant in relation to the present invention may mean any substitution of, variation of, modification of, replacement of or deletion of or the addition of one or more nucleic acid(s)/amino acids from or to the sequence, providing the resulting sequence expresses or exhibits the required enzymatic activity.
  • a derivative or mutation may also be suitable in the invention.
  • a derivative has some modifications, usually chemical, compared with the naturally-occurring polypeptide expressed by the nucleic acid.
  • the present invention provides in a second aspect a method of inducing a necrotic effect in specific cells of a plant, wherein a plant is transformed with two chimaeric genes, a coding sequence of one of said genes coding for an inactivated pokeweed antiviral protein, and a coding sequence of the other of said genes coding for a second molecule, which molecule is an activator of the inactivated pokeweed antiviral protein, each of said two genes comprising a promoter, which promoters act conjointly in response to the application of a specific stimulus to said plant so that said inactivated pokeweed antiviral protein is activated in specific cells of a plant.
  • the present invention further provides a plant transformed with two chimaeric genes, a coding sequence of one of said genes coding for an inactivated pokeweed antiviral protein, and a coding sequence of the other of said genes coding for a second molecule, which molecule is an activator of the inactivated pokeweed antiviral protein, each of said two genes comprising a promoter, which promoters act conjointly in response to the application of a specific stimulus to said plant so that said inactivated pokeweed antiviral protein is activated in specific cells of a plant.
  • the present invention yet further provides a recombinant plant cell, a DNA isolate of two chimaeric genes, and a biologically functional expression vehicle containing two chimaeric genes, each chimaeric gene being in accordance with the second aspect of the invention hereof.
  • inactivated pokeweed antiviral protein is a mature pokeweed antiviral protein, such as PAP-S, for example, operably linked to a heterologous or homologous N- or C-terminal blocking sequence.
  • the chimaeric gene preferably encodes the mature PAP-S protein, the nucleotide sequence being given in SEQ. ID. No. 3 and the amino acid sequence being given in SEQ. ID. No. 4, or PAP-S ⁇ , the nucleotide sequence being given in SEQ. ID. No. 5 and the amino acid sequence being given in SEQ. ID. No. 6, or PAP-S ⁇ , the nucleotide sequence being given in SEQ. ID. No. 7 and the amino acid sequence being given in SEQ. ID. No. 8, or mature PAP′ or a variant thereof as described in U.S. Pat. No. 6,015,940 (i.e. nucleotides 290-1076 of SEQ. ID. Nos.
  • the terminal blocking sequence is advantageously a sequence that may have an additional necrotic effect on the cell or pathogen.
  • the terminal blocking sequence is the oryzacystatin sequence (A86 cystatin sequence) known herein as SEQ. ID. No. 17.
  • A86 cystatin sequence blocks the action of natural proteases thus preventing natural expression of the PAP coding sequence.
  • Cystatins are small ( ⁇ 100aa) protein inhibitors of cysteine proteases found in many plants [Ryan, 1990; Richardson, 1991] and a large number of genes (>60) have been sequenced.
  • Phytocystatins represent a distinct class from the type I and II cystatins [Kondo et al. 1991].
  • Oryzacystatin I from rice seed [Abe et al., 1987] is an efficient inhibitor, though significantly less potent than the animal cystatins, such as chicken egg white cystatin (CEWC).
  • Recombinant variants of OC-1 produced via protein engineering have been described by Uwrin et al. (1995), and the deletion mutant ⁇ -Asp86 (OC-I ⁇ D86) exhibited increased inhibitory activity.
  • the terminal blocking sequence is merely a mature PAP inactivating molecule.
  • the terminal blocking sequence is a native Pro-PAP terminal sequence from any Pro-PAP molecule.
  • the blocking sequence may be located at the N-terminal or the C-terminal end of the mature PAP sequence.
  • the blocking sequence is a C-terminal blocking sequence.
  • cleavage site is also required in the inactivated pokeweed antiviral protein and is located between the mature pokeweed antiviral protein sequence and the blocking sequence.
  • the cleavage site is preferably located between the mature pokeweed antiviral protein and the blocking sequence.
  • the specific cleavage site is the Tobacco Etch Virus (TEV) NIa Protease cleavage site (Carrington and Dougherty, 1998), known herein as SEQ. ID. NO. 28 and SEQ. ID. No. 29.
  • the recognition site for this protease is the heptapeptide Glu-Xaa-Xaa-Tyr-Xaa-Gln-Gly or the heptapeptide Glu-Xaa-Xaa-Tyr-Xaa-Gln-Ser with cleavage occurring between Gln and Gly (or Ser).
  • the coding sequence for the second molecule is preferably a protease which cleaves the specific cleavage site.
  • the protease is suitably TEV NIa Protease.
  • Other specific cleavage sites and proteases will be readily available to the skilled person.
  • the site specific protease Enterokinase could be used to cleave an appropriate cleavage site linked to the mature pokeweed antiviral protein.
  • the said stimulus in respect of the subject invention as applied to a plant may be constituted by a pathogenic attack.
  • the stimulus may be chemically induced or could be induced as a result of the natural development of the plant.
  • the first and second aspects of the subject invention have widespread application throughout the plant kingdom for protection from attack by, for example, fungi, nematodes, bacteria and viruses, and for other purposes.
  • the term “necrotic effect” embraces the concept of substantial impairment of metabolism such that the objective, e.g. disease protection, of employing the subject invention is attained.
  • the promoters of this second aspect of the present invention (the two component system) have an overlapping expression zone(s).
  • the overlapping expression characteristics of the two promoters and the respective responses thereof to the said stimulus are such as to effect the direction of the expression of the inactivated pokeweed antiviral protein and the activator molecule therefor so that a lethal or detrimental effect is produced in, and only in, the specific cells.
  • the promoters may have the same expression sites or the expressed proteins may otherwise accumulate at the target site.
  • the present invention provides a method of inducing a necrotic effect in specific cells of a plant, wherein the plant is transformed with a chimaeric gene, the coding sequence of said gene coding for a precusor PAP molecule or a C-terminal deletion thereof, said gene comprising a promoter which acts in response to the application of a specific stimulus to the plant, so that the protein expressed by the coding sequence is expressed in specific cells of said plant, said promoter being appropriately selected to provide one of the following effects: nematode infection disruption, sterility, changes in flower morphology, abscission, seed release or trichome development.
  • the present invention further provides a plant transformed in accordance with the method of the third aspect of the invention.
  • the present invention even further provides a recombinant plant cell, a DNA isolate of a chimaeric gene, and a biologically functional expression vehicle each containing a chimaeric gene as described in accordance with the third aspect of the invention.
  • the coding sequence preferably encodes one of the following list: the Pro-PAP-S, the nucleotide sequence being given in SEQ. ID. No. 1 and the amino acid sequence being given in SEQ. ID. No. 2, or PAP′, or a variant thereof as described in U.S. Pat. No. 6,015,940 known herein as SEQ. ID. Nos. 30 and 31, or PAPII as described in International Patent Application, Publication No. WO 99/60843 and known herein as SEQ. ID. No. 32.
  • suitable promoters will depend upon the specific cells. If protection is sought against nematode attack the specific cells may be the nematode feeding site cells. In which case, in the second aspect of the invention, suitable promoters would be the KNT1 promoter acting conjointly with the TobRB7 promoter. In the first and third aspects of the invention these promoters may be used individually.
  • the isolation of the KNT1 promoter is taught in NZ Patent No. 260511 and is further recited below and the isolation of the TobRB7 promoter is taught in International Patent Application WO 94/17194. The subject matter thereof relating to such isolation is incorporated herein by reference. Further suitable promoters are the Lemmi promoters, the isolation of which is disclosed in International Patent Application, Publication No. WO 92/21757.
  • the inactivated pokeweed antiviral protein coding sequence may be under the control of the TobRB7 promoter whilst the activator molecule coding sequence may be under the control of the KNT1 promoter.
  • the promoter KNT1 is expressed in nematode feeding site cells, root tips and to a lesser extent in other meristems, whereas the TobRB7 promoter is expressed in roots and giant cells (Conkling et al 1990). In fact studies have shown the TobRB7 promoter to be expressed in the body of the root but not the root tips. Thus the overlapping expression zone of the KNT1 and TobRB7 promoters is in the giant cells (nematode feeding site cells) of the plant.
  • the specific cells may be anther cells to cause male sterility in plants.
  • suitable promoters are disclosed in Twell et al (1991) and Mariani et al (1990).
  • the target site may be a nematode feeding site.
  • the promoter selected is one which is induced at and/or adjacent to the nematode feeding site. Such a promoter is preferably induced upon nematode infection of the plant.
  • An example of a suitable promoter is the KNTL promoter.
  • Other suitable promoters include the TobRB7 promoter and the Lemmi promoters.
  • the nematode feeding site may be comprised of, for example, plant cells at the local site of infection which later redifferentiate to form a syncytium (in the case of cyst nematodes) or the giant cells and/or the accompanying hypertrophic cells (in the case of root knot nematodes), and/or one or more of the syncytium cells, the giant cells and the accompanying hypertrophic cells.
  • plant cells at the local site of infection which later redifferentiate to form a syncytium (in the case of cyst nematodes) or the giant cells and/or the accompanying hypertrophic cells (in the case of root knot nematodes), and/or one or more of the syncytium cells, the giant cells and the accompanying hypertrophic cells.
  • nematode resistant plant By targeting the nematode feeding site a nematode resistant plant may be obtained.
  • nematode resistant plant it is meant a plant which upon infection by plant parasitic nematodes is capable of preventing, slowing or otherwise adversely affecting the growth and development of nematodes that attack the plant, thereby preventing economically significant densities of plant parasitic nematodes from building up during a single crop growing period.
  • the nematodes may, for example, die or the nematodes' life cycle may be slowed resulting in a delay in the time taken to reach maturity and hence produce eggs, or the mature female nematodes may be of reduced size and thus have a lower egg-laying capacity as egg laying only commences after female nematodes have reached a critical, minimum size.
  • the present invention is applicable to, but in no way limited to, use with the following nematode species: Globodera spp., Heterodera spp. and Meloidogyne spp.
  • the method is directed to effecting male sterility in plants.
  • the target site may be one or more of a plant's pollen, anther or tapetum.
  • the promoter selected is one that is induced in and/or adjacent to the tapetum.
  • a suitable tapetum promoter is the tobacco TA29 promoter as disclosed in Mariani et al (1990). Anther specific promoters are disclosed in Twell et al (1991).
  • the method is directed to effecting female sterility in plants.
  • the target site may be the ovule of the plant. That is to say, the promoter selected is one that is induced in and/or adjacent to the ovule.
  • An example of a suitable promoter is the AGL15 promoter as disclosed in Perry et al, 1996.
  • the morphology of the flower of a plant is manipulated.
  • the target site may be specific parts of the flower, the aim being that when these specific parts of the flower do not develop the morphology of the flower is changed.
  • the promoter selected is one that is induced in and/or adjacent to the sepal, carpel, petal, and/or stamen. Examples of suitable promoters are the found in the agamous, apetala3, globosa, pistillata and deficiens genes (Sieburth and Meyerowitz, 1997; Samach et al, 1997, and references therein).
  • the method is used to assist in or promote leaf and/or fruit abscission in plants.
  • the target site may be the abscission zone of the leaf and/or the fruit.
  • the promoter selected is one that is induced in and/or adjacent to such an abscission zone.
  • a sixth embodiment of the present invention is the targeting of trichomes, which trichomes are typically glandular.
  • the promoter selected is one that is induced in and/or adjacent to the trichomes. By causing necrosis of the trichomes of the plant the production of chemical substances by the trichome can be cessated or prevented.
  • a seventh embodiment of the present invention is the targeting of lateral roots, thorns or stinging hairs.
  • the method is directed to the control of virus infections.
  • virus infections there are a number of genes which are induced specifically, or substantially specifically, within the cells actually infected by the virus.
  • the promoter selected is one that is induced in and/or adjacent to the cells infected by the virus.
  • the method is directed to facilitating the release of seeds from plants, by targeting the seeds.
  • seed development there are a number of genes which are induced specifically, or substantially specifically, within certain cells/parts of the seed.
  • a promoter that is externally inducible and that is induced in, for example, the roots of the plant is selected.
  • Such a promoter could be used to effect root abscission at the end of a growing season.
  • Comparable promoters induced in, for example, leaf petioles, pedicels or peduncles could be used to effect abscission of leaves, flowers, or fruit at the end of the growing season.
  • each chimaeric gene further comprises a 3′ untranslated, terminator sequence.
  • the terminator sequence may be obtained from the plant, bacterial or viral genes. Suitable terminator sequences are the pea rbcs E9 terminator sequence, the Nos terminator sequence derived from the nopaline synthase gene of Agrobacterium tumefaciens and the 35S terminator sequence from cauliflower mosaic virus, for example. A person skilled in the art will be readily aware of other suitable terminator sequences.
  • the chimaeric gene may optionally comprise transcriptional or translational enhancer sequences, such as those described in International Patent Application, Publication No.
  • WO 97/20056 intracellular targeting sequences and introns for example, as well as nucleotide sequences operable to facilitate the transformation process and the stable expression of the chimaeric gene, such as T-DNA border regions, matrix attachment regions and excision/recombination sequences.
  • Techniques for transforming plants are well known within the art and include Agrobacterium-mediated transformation, for example.
  • Agrobacterium-mediated transformation a binary vector carrying a foreign DNA of interest, i.e. a chimaeric gene, is transferred from an appropriate Agrobacterium strain to a target plant by the co-cultivation of the Agrobacterium with explants from the target plant.
  • Transformed plant tissue is then regenerated on selection media, which selection media comprises a selectable marker and plant growth hormones.
  • transformation methods include direct gene transfer into protoplasts using polyethylene glycol or electroporation techniques, particle bombardment, micro-injection and the use of silicon carbide fibres for example.
  • Suitable plant species which may be transformed in accordance with the present invention include, but are not limited to rice, wheat, maize, canola, potato, tobacco, sugar beet, soybean, tomato, peanut, cotton, vine, watermelon, papaya, vegetables and food legumes.
  • both chimaeric genes are introduced into the plant in a single expression cassette.
  • each chimaeric gene is introduced into the plant in a separate expression cassette through sequential or simultaneous transformation with two transgene constructs.
  • Such a two-component system may also be produced by the crossing of two plants each containing one individual component.
  • FIG. 1 shows in schematic form promoter constructs for PAP expression in protoplasts
  • FIG. 2 shows the vector pDVM
  • FIG. 3 shows the plant transformation vector PATC
  • FIG. 4 shows in schematic form nematode inducible promoter constructs for PAP expression in transgenic plants
  • FIG. 5 shows the effect of PAP-S protein on tobacco ribosomes as measured by the GUS protein synthesis
  • FIG. 6 shows the effect of modified PAP-S proteins on tobacco ribosomes as measured by the GUS protein synthesis
  • FIG. 7 shows the effect of PAP-S ⁇ and PAP-S ⁇ on protoplasts
  • FIG. 8 shows in schematic form the PAP-S/Protease Cleavage Site (PCS)/Cystatin AD86 fusion construct, and the constructs in pBluescript vectors used in TnT experiments;
  • FIG. 9 shows the effect of PAP proteins on translation of luciferase protein in rabbit reticulocyte lysates
  • FIG. 10 shows the effect of modified PAP-S/Cystatin protein on tobacco ribosomes as measured by the GUS protein synthesis
  • FIG. 11 shows in schematic form the nematode inducible promoter construct for regulated expression of PAP-S-PCS-Cystatin ⁇ D86 and TEV NIa protease in transgenic plants;
  • FIG. 12 shows a resistance screen of potato plants transformed with Pro-PAP-S and infected with potato cyst nematode race 2 ⁇ 3 compared to a susceptible control (Hermes) and a commercial resistant cultivar (Sante);
  • FIG. 13 shows a Root Knot Nematode resistance trial of tobacco plants containing the Pro-PAP-S construct (pATC05502) compared to tissue culture control plants (ncc). Sizes of infecting nematodes are recorded in eyepiece graticule units;
  • FIG. 14 shows a schematic diagram of the production of PAP-S variants by PCR
  • FIG. 15 shows a comparison of mean cyst counts in potato plants transformed with genes containing Pro PAP-S, KNT1 antisense or Cowpea Trypsin Inhibitor (CpTI).
  • Pokeweed Antiviral Protein PAP-S
  • the Pro-PAP-S sequence was isolated from pokeweed leaf -DNA by polymerase chain reaction (PCR) using Pfu polymerase. The sequence was isolated in two segments, and which were then combined, in order to remove an XbaI site in the centre of the molecule. The 5′ portion of the molecule was amplified using primers PPS1BF and PSXDR (SEQ. ID. Nos. 9 and 16 respectively), and the 3′ portion using primers PSXDF and PPS2SR (SEQ. ID. Nos. 15 and 10 respectively). The two PCR products were combined, and the overlapping DNA fragments extended with Pfu polymerase, and reamplified using primers PPSlBF and PPS2SR (SEQ. ID. Nos. 9 and 10 respectively). The PCR product was digested with restriction endonucleases XbaI and SalI and cloned into pBluescript to produce the clone pBS/Pro-PAP-S (FIG. 14).
  • the PAP-S sequence was amplified by PCR using primers PSlBF and PS2SR (SEQ. ID. Nos. 11 and 12 respectively) to eliminate the N- and C-terminal regions.
  • PSlBF and PS2SR SEQ. ID. Nos. 11 and 12 respectively
  • a methionine start codon and a TAA stop codon were added via the PCR primers.
  • the start and stop codons are shown in SEQ. ID. No. 3 but the enzyme cloning sites are not shown in SEQ. ID. No. 3.
  • the added methionine residue is shown in SEQ. ID. No. 4.
  • the PCR product was digested with restriction endonucleases XbaI and SalI and cloned into pBluescript to produce the clone pBS/PAP-S. Sequencing of the PAP-S clone revealed only one nucleotide change from the database sequence. Suitable primer combinations were used to remove either the N- or the C-terminal regions independently.
  • PAP-S ⁇ and PAP-S ⁇ polypeptide domains were defined based on the corresponding Maize RIP ⁇ , ⁇ and central domain regions (described in our co-pending application of even date).
  • PAP-S ⁇ and PAP-S ⁇ polypeptide domains were amplified from PAP-S clone plasmid DNA using PS1BF plus PSlSR (SEQ. ID. Nos. 11 and 14 respectively) and PS2BF plus PS2SR primer pairs respectively (SEQ. ID. Nos. 13 and 12 respectively).
  • Methionine start codons and TAA stop codons were added via the PCR primers. The start and stop codons are shown in SEQ. ID.
  • a method is hereby presented for the isolation of a promoter, which method is by way of an example. Alternative methods for the isolation of a suitable promoter for use in the present invention will be readily available to the skilled person, some of which methods are referenced above.
  • Seed of C319 tobacco were germinated on Fisons Fl compost under conditions as follows: light intensity of 4500 to 5000 lux; 16 hr day/8 hr night; temperature 20-25° C. After c. 3 weeks seedlings were gently washed in tap water to remove soil and transferred to pouches (Northrup-King), 2 plants per pouch, and grown for a further week in a Conviron at 25° C. with lighting as above. Roots were lifted from the back of the pouch and supported with Whatman GF/A glassfibre paper at their tips. Three-day-old nematodes ( M.
  • javanica javanica
  • 10 ⁇ l (50 nematodes) aliquots were then delivered to the tips of these roots in 10 ⁇ l (50 nematodes) aliquots and a second piece of GF/A paper was placed on top to fully encapsulate the root tip.
  • the GF/A paper was removed to ensure synchronous infection.
  • the root knots were dissected out (leaving healthy root and root tip tissue behind) and frozen immediately in liquid nitrogen. Approximately 0.5-1.0 g of infected root tissue was harvested from 80 inoculated plants.
  • Roots were harvested from 3 day post infected plants and immersed for 90 seconds in lactophenol containing 0.1% Cotton Blue at 95° C. Following a 5 second rinse in water, the roots were placed in lactophenol at room temperature (RT) for 3-4 days to clear. Stained nematodes were visualised using light microscopy.
  • Root tissue was ground to a fine powder in a liquid nitrogen chilled pestle and mortar. Approximate 100 mg aliquots were then transferred to similarly chilled microfuge tubes and 300l of hot phenol extraction buffer (50% phenol, 50% extraction buffer: 0.1M lithium chloride, 0.1M Tris-HCl pH8.0 (RT), 10 mM EDTA, 1% SDS) added, and incubated at 80° C. for 5 minutes. An equal volume of chloroform was then added and the homogenate microfuged for 15 minutes at 4° C. The aqueous phase was then extracted with 600 ⁇ l of phenol/chloroform and microfuged as above.
  • hot phenol extraction buffer 50% phenol, 50% extraction buffer: 0.1M lithium chloride, 0.1M Tris-HCl pH8.0 (RT), 10 mM EDTA, 1% SDS
  • RNA quality was assessed by denaturing gel electrophoresis. (Adapted from Shirzadegan et al, 1991).
  • Poly(A) + RNA was isolated from 200 ⁇ g total RNA samples from healthy and infected C319 root tissue using magnetic oligo dT Dynabeads according to the manufacturer's instructions. First strand cDNA synthesis was performed in situ on the Dynabead-bound poly(A) + fraction from healthy tissue to provide Driver DNA. First and second strand synthesis was performed in situ on the Dynabead-bound poly(A) + fraction from the infected tissue to provide Target DNA. All cDNA reactions were carried out using a cDNA synthesis kit according to the manufacturer's instructions (Pharmacia).
  • SUB21 Three oligonucleotides, SUB21 (5′CTCTTGCTTGAATTCGGACTA 3′) known herein as SEQ. ID. No. 30, SUB25 (5′ TAGTCCGAATTCAAGCAAGAGCACA 3′) (sequences from Duguid & Dinauer, 1990) and known herein as SEQ. ID. No. 31 and LDT15 (5′ GACAGAAGCGGATCCd(T) 15 3′) (O'Reilly, 1991) known herein as SEQ. ID. No. 32 were kinased with T4 polynucleotide kinase according to Maniatis et al (1982).
  • SUB21 and SUB25 were then annealed to form a linker which was then ligated to the Target DNA with T4 DNA ligase according to King & Blakesley (1986). Subsequently the beads carrying the Target DNA were washed extensively with TE and the second strand of the cDNA eluted at 95° C. in 5 ⁇ SSC.
  • RNA bound to the Dynabead-bound Driver DNA was removed by heat and the eluted Target DNA hybridised to the Driver DNA at 55° C. in 5 ⁇ SSC for 5 hours.
  • Non-hybridising Target DNA was separated from the bead-bound Driver DNA at room temperature (RT) as per the manufacturer's instructions, following which, hybridising Target DNA was similarly separated from the bead-bound Driver DNA at 95° C.
  • RT room temperature
  • the RT eluted Target DNA was then added back to the Driver DNA and the hybridisation repeated. This process was repeated until the amount of Target hybridising to the Driver no longer exceeded the amount that did not hybridise.
  • DNA concentrations were established using DNA Dipstick (Invitrogen) in accordance with the manufacturer's instructions.
  • RNA samples of 10 ⁇ g total RNA from healthy and infected tissue were treated with 2.5 units DNasel at 37° C. for 15 minutes. The DNasel was then denatured at 95° C. for 10 minutes before cDNA synthesis was performed using the manufacturer's protocol (Pharmacia). The RNA was then removed by the presence of 0.4M sodium hydroxide for 10 minutes at RT and the cDNA purified through a spun Sephacryl 400HR column. Yield and concentration was determined using DNA Dipsticks (Invitrogen). The cDNA was labelled, using c. 35 ng/probe using the standard Pharmacia oligolabelling protocol.
  • RNA blots comprised 25 ⁇ g RNA per lane
  • poly(A) + RNA blots comprised 0.5-1.0 ⁇ g RNA per lane.
  • the RNA was electrophoresed on formaldehyde gels and blotted onto Pall Biodyne B membrane as described by Fourney et al (1988). Probes were labelled and hybridised as above.
  • tobacco C319 and M. javanica DNA were prepared as described by Gawel and Jarret (1991). Southern blots were prepared comprising 10 ⁇ g EcoRI and HindIII digested DNA per lane. The blots were hybridised to oligolabelled probes as described above.
  • RNAs of interest were determined by using 5′ RACE as described by Frohman et al (1988).
  • the promoter regions of the genes of interest were isolated by vector-ligated PCR. 100 ng samples of restriction endonuclease digested C319 genomic DNA were ligated for 4 hours at RT (King and Blakesley, 1986) with 100 ng samples of pBluescript (digested with a restriction endonuclease producing compatible termini). Typically enzymes used were EcoRI, BamHI, HindIII, BglII, XhoI, ClaI, SalI, KpnI, PstI, and SstI. PCR was then performed on the ligations using a vector primer such as the ⁇ 40 Sequencing primer and a primer complementary to the 5′ terminus of the mRNA. The PCR products were then cloned and sequenced. If necessary the process was repeated with a new primer complementary to the 5′ terminus of the promoter fragment to ensure that the control sequences of the promoters were isolated.
  • a vector primer such as the ⁇ 40 Sequencing primer and a
  • KNT1 a gene, KNT1 was identified and isolated from tobacco plants.
  • the resulting construct, pBIN05101 was used to transform tobacco plants.
  • strong GUS expression was observed in the nematode feeding site.
  • the KNT1 gene was shown to have homologues in species of plant other than tobacco. These include, but are not limited to Solanum tuberosum, Lycopersicon esculentum and Beta vulgaris.
  • the KNT1 gene is also induced by both root knot and cyst nematode species.
  • the construct pBIN05101 was deposited by Advanced Technologies (Cambridge) Limited of 210 Cambridge Science Park, Cambridge CB40WA, England under the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the purposes of Patent Procedure at the National Collections of Industrial, Food and Marine Bacteria (NCIMB), 23 St. Machar Street, Aberdeen, Scotland on Mar. 20, 1997 under accession number NCIMB 40870.
  • the vector contains the left and right borders of Agrobacterium tumefaciens C58 strain T-DNA. Between the borders are a multiple cloning site and a kanamycin resistance gene under the control of a plant promoter (Nos). External to the borders the vector contains a bacterial kanamycin resistance gene.
  • the insert in the vector consists of a KNT1 promoter—glucuronidase coding sequence—Nos terminator.
  • Constructs containing PAP-S effector components were also prepared in binary vectors with different promoters for plant transformation studies.
  • the PAP-S sequences were first cloned into pDVM donor vectors (as shown in FIG. 2) containing the nematode-inducible promoter KNT1 and the Nos terminator.
  • the promoter-gene-terminator cassettes were then excised and cloned into the PATC binary vector (FIG. 3) and introduced into Agrobacterium tumefaciens strain LBA4404 by electroporation.
  • PAP-S mediated ribosome inactivation was detected by way of assessing GUS protein synthesis.
  • Protoplasts were prepared from leaves of in vitro-maintained tobacco plants and were electroporated with the PAP-S constructs.
  • the protein translation efficiency of ribosomes in the tobacco protoplasts was evaluated with a GUS reporter gene in a pDE4 construct under the control of a CaMV 35S promoter.
  • a GUS pDE4 construct was co-electroporated with each PAP-S construct.
  • a GUS-positive control was used, wherein a non-toxic BiP chaperone protein construct, pDE800 (Leborgna-Castel et al, 1999) was co-electroporated into tobacco protoplasts together with the GUS pDE4 construct.
  • a GUS-negative control was also used, wherein an empty pDE4 vector was electroporated into tobacco protoplasts together with the non-toxic BiP chaperone protein construct.
  • PAP-S constructs were co-electroporated with the GUS construct into tobacco protoplasts.
  • the effect of PAP-S activity on ribosomes was assayed by measuring the levels of GUS activity after 24 hours of expression (FIG. 5).
  • the results indicate that PAP-S ⁇ protein inactivates tobacco ribosomes efficiently. Consequently only basal levels of GUS activity were observed in comparison with the GUS positive control.
  • This provides a two component activation system based on a ⁇ -N Pro-PAP-S with a specific cleavage site introduced adjacent to the C-terminal region, or alternatively, or in addition, a ⁇ -C Pro-PAP-S with a sequence which blocks endogenous proteases but acts as a specific cleavage site introduced adjacent to the N-terminal region.
  • PAP-S ⁇ and PAP-S ⁇ polypeptide regions were also expressed either individually or in combination in tobacco protoplasts (FIG. 7).
  • PAP-S ⁇ contains the RNA recognition motif and ribosome binding domain regions, whilst PAP-S ⁇ contains the critical catalytic residue site.
  • PAP-S ⁇ protein may be preventing protein translation by binding to ribosomes and preventing protein translation. The results imply that PAP-S ⁇ is adopting a correctly folded conformation and is capable of specific molecular recognition.
  • PAP-S ⁇ contains the active site residue necessary for ribosome depurination but might not be expected to be capable of recognising and interacting with the ribosome.
  • Inhibition of PAP action by preventing rRNA binding might be mediated by generating a fusion protein extending into the active site vicinity of PAP.
  • a suitable component selected for creating a fusion protein was the cystatin protein from rice (oryzacystatin), and a synthetic version of the gene was synthesised containing the codon usage pattern suitable for optimal expression in potato (SEQ. ID. No. 17). To ensure that the cystatin would occupy a position in the region of the PAP active site, 7 amino acids were deleted from the C-terminus of PAP. The fusion with the cystatin was created using a linker sequence encoding the cleavage site for NIa protease of Tobacco Etch Virus (TEV).
  • TSV Tobacco Etch Virus
  • the two PCR fragments were then used to amplify the full length fusion protein (PAPS-PCS-Cystatin Delta86) by overlap extension PCR using PSLBF and SYNPOTDelta86SR primers (SEQ. ID. Nos. 11 and 22).
  • the fusion PCR product was cloned into pBluescript vector and was confirmed by sequence analysis.
  • TnT reactions were incubated at 30° C. for a total period of 60 minutes with different PAP constructs along with positive control luciferase construct. After initial incubation of PAP constructs in TnT reactions for 30 minutes, an equal quantity of luciferase template was added to all the reactions and continued for a further 30 minutes. Aliquots of different reactions were mixed with Luciferase Assay Reagent and the luciferase activity was measured in a luminometer for 10 seconds (FIG. 9).
  • the results of Pro PAP-S and PAP-S protein translation indicated that the proteins inactivated the translation by rabbit ribosomes as expected.
  • the modified PAP fusion protein was relatively inactive in comparison with PAP.
  • the translation of different PAP proteins was confirmed by incorporation of biotinylated lysyl tRNA as label during translation and detected with streptavidin conjugated alkaline phosphatase.
  • the Pro PAP-S and PAP-S proteins translated were undetectable due to rapid ribosome inactivation whereas a relatively large amounts of modified PAP fusion protein was observed, indicating the relative inactivity of this PAP fusion protein towards rabbit ribosomes.
  • the TEV NIa protease gene was amplified from a cDNA clone of TEV. A SpeI restriction site was removed for cloning purposes using the overlapping removal primers.
  • the NIa protease was first amplified as two PCR fragments using primers NIAPROBF (SEQ. ID. No. 23) plus NIAPPROSR (SEQ. ID. No. 26) and NIAPROSDF (SEQ. ID. NO. 25) plus NIAPROSR (SEQ. ID. NO. 24) and a full length protease was then amplified by overlap extension PCR using primers NIAPROBF (SEQ. ID. No. 23) plus NIAPROSR (SEQ. ID. No. 24).
  • KNT1 nematode-inducible promoters
  • KNT2 SEQ. ID. No. 27
  • KNT2 expresses in the root body (but not in the root tips) and giant cells of a nematode infected plant.
  • TEV NIa protease gene was amplified with Pfu DNA polymerase and the PCR product was cloned as an XbaI and SalI fragment into pBluescript vectors. The recombinant clone was sequenced to confirm its identity.
  • PAP-S-PCS-Cystatin AD86 fusion and TEV NIa protease genes were cloned separately into pDVM donor vectors as individual constructs with KNT2 and KNT1 promoters respectively.
  • the double construct (FIG. 11) was made in a pDVM intermediate donor vector and recloned into a PATC binary plant transformation vector for generation of transgenic plants and nematode resistance trials.
  • Transgenic Pro-PAP-S tobacco plants were entered into a standard resistance trial with root knot nematodes Meloidogyne javanica .
  • Transgenic and control tobacco plantlets were planted in a randomised blind experimental design into rootrainers fine potting compost without fertiliser and the larger leaves trimmed by half. The plants were covered with polythene to maintain high humidity whilst weaning. Gradually holes were slit in the polythene to decrease humidity before weaning was completed.
  • the small plants were infected with 200 hatched J2 Meloidogyne javanica nematodes. Watering with liquid feed thereafter was only done once the soil had dried sufficiently to cause the leaves to start wilting.
  • the rootrainers were placed in trays on heated matting to maintain the soil temperature between 25-30° C. The leaves were trimmed back once a week in order to even out growth and prevent the growing points becoming covered with larger leaves due to density of planting.
  • Root knot nematodes were categorised into three groups: a) vermiform nematodes, b) saccate nematodes that are not producing eggs and c) saccate nematodes producing eggs. The diameters of the essentially saccate nematodes were measured using an eyepiece graticule.
  • Rootrainers or conetainers were filled with a mixture of 50:50 loam and sand. 12 liters of loam and sand is moistened with 1250 mls of water to give a 40% water content. 3 cysts were placed onto the roots of each plantlet which was then inserted into a hole in the compost and the compost gently closed around the roots. The plants were weaned and thereafter, only watered once weekly with liquid feed or when the soil had dried sufficiently. Once the plants reached approx. 10 cm in height, the tips were trimmed off to even out growth.
  • the plants were grown for approximately three months to permit the cysts to mature. The plants were then allowed to dry out for another month. Cysts were recovered from the plants by washing the soil and roots vigorously in a beaker of 250 ml water. The soil was permitted to settle for a few minutes and the supernatant poured into a large filter funnel with a 32 cm diameter Whatman No. 1 filter paper disc. The supernatant was left to stand in the funnel for a minute and then the centre of the solution surface was touched with a drop of Hederol detergent to displace the material on the surface meniscus of the solution to the side of the filter. The base of the filter was then pierced to remove the remainder of the solution. The filter disc was removed and the number of cysts adhering to it is counted.
  • KNT1 is a gene substantially specifically induced in giant cells during nematode infection. It is believed that KNT1 is important in the process of infection and giant cell development. Introducing an antisense KNT1 sequence was believed to inhibit the nematode infection process.
  • Cowpea Trypsin Inhibitor is a protein which inhibits the digestive enzymes in the nematode, and its expression should prevent nematode feeding and development. It is not a cell-death system per se but a direct attack on the nematode.
  • the comparative data suggest transformation of plants with a construct containing Pro PAP-S to have greater effect on reducing nematode infection than lines containing either antisense KNT1 or CPTI.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US09/978,274 2000-10-14 2001-10-15 Plant cell death system Abandoned US20020116737A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0025225.4A GB0025225D0 (en) 2000-10-14 2000-10-14 Plant cell death system
GB0025225.4 2000-10-14

Publications (1)

Publication Number Publication Date
US20020116737A1 true US20020116737A1 (en) 2002-08-22

Family

ID=9901296

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/978,274 Abandoned US20020116737A1 (en) 2000-10-14 2001-10-15 Plant cell death system
US09/978,273 Expired - Fee Related US7282624B2 (en) 2000-10-14 2001-10-15 Plant cell death system
US11/651,756 Abandoned US20070107079A1 (en) 2000-10-14 2007-01-09 Plant cell death system

Family Applications After (2)

Application Number Title Priority Date Filing Date
US09/978,273 Expired - Fee Related US7282624B2 (en) 2000-10-14 2001-10-15 Plant cell death system
US11/651,756 Abandoned US20070107079A1 (en) 2000-10-14 2007-01-09 Plant cell death system

Country Status (13)

Country Link
US (3) US20020116737A1 (es)
EP (1) EP1328649B1 (es)
AR (1) AR033582A1 (es)
AT (1) ATE418617T1 (es)
AU (2) AU9404101A (es)
BR (1) BR0114820A (es)
CA (1) CA2425321C (es)
DE (1) DE60137138D1 (es)
ES (1) ES2316481T3 (es)
GB (1) GB0025225D0 (es)
PL (1) PL204381B1 (es)
RU (2) RU2275426C1 (es)
WO (1) WO2002033106A2 (es)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040253325A1 (en) * 2003-06-10 2004-12-16 Frank Steven R. Method and composition for the treatment of shingles and related afflictions

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0025225D0 (en) 2000-10-14 2000-11-29 Cambridge Advanced Tech Plant cell death system
GB0421598D0 (en) 2004-09-29 2004-10-27 Cambridge Advanced Tech Modification of plant development and morphology
CA2815116A1 (en) * 2010-10-27 2012-05-03 Devgen Nv Down-regulating gene expression in insect pests
MX347392B (es) 2010-11-05 2017-04-25 Agrigenetics Inc Marcadores de soya ligados a resistencia al nematodo del quiste de la soya.
MX360318B (es) * 2013-11-04 2018-10-29 Dow Agrosciences Llc Óptimos loci de maíz.
EP3744839A1 (en) * 2019-05-31 2020-12-02 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. A genetically encoded protein synthesis inhibitor (gepsi)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6140554A (en) * 1997-03-27 2000-10-31 Advanced Technologies (Cambridge) Limited Specificity of gene expression

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8810120D0 (en) * 1988-04-28 1988-06-02 Plant Genetic Systems Nv Transgenic nuclear male sterile plants
US5635384A (en) * 1990-06-11 1997-06-03 Dowelanco Ribosome-inactivating proteins, inactive precursor forms thereof, a process for making and a method of using
US5248606A (en) * 1990-06-11 1993-09-28 Dowelanco Dna encoding inactive precursor and active forms of maize ribosome inactivating protein
EP0548197B1 (en) 1990-09-10 1998-06-03 Advanced Technolgies (Cambridge) Limited Plant parasitic nematode control
CA2110169A1 (en) 1991-05-30 1992-12-10 Walter Van Der Eycken Nematode-responsive plant promoters
GB9205474D0 (en) 1992-03-13 1992-04-29 Cambridge Advanced Tech Root knot nematode resistance
US6015940A (en) * 1992-04-07 2000-01-18 Monsanto Company Virus resistant potato plants
US5332808A (en) * 1992-09-08 1994-07-26 North Carolina State University DNA encoding a ribosome inactivating protein
ZA939767B (en) * 1993-01-21 1994-09-14 Univ North Carolina State Nematode-resistant transgenic plants
US6008436A (en) * 1993-01-21 1999-12-28 North Carolina State University Nematode-resistant transgenic plants
CN1190433A (zh) 1995-07-11 1998-08-12 拉脱格斯州立大学 在植株内表现出抗病毒和/或抗真菌活性的pap突变蛋白
FR2736930B1 (fr) * 1995-07-17 1997-09-19 Biocem Procede de production, par des cellules vegetales, de proteines heminiques, proteines ainsi obtenues et produits contenant ces proteines
GB9524350D0 (en) 1995-11-29 1996-01-31 Lynxvale Ltd Enhancer-increased gene expression in plants
CA2277817A1 (en) 1997-01-24 1998-07-30 Dna Plant Technology Corporation Two component plant cell lethality methods and compositions
WO1999060843A1 (en) 1998-05-22 1999-12-02 Rutgers, The State University Transgenic plants producing a pap ii protein
GB0025225D0 (en) 2000-10-14 2000-11-29 Cambridge Advanced Tech Plant cell death system

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6140554A (en) * 1997-03-27 2000-10-31 Advanced Technologies (Cambridge) Limited Specificity of gene expression

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040253325A1 (en) * 2003-06-10 2004-12-16 Frank Steven R. Method and composition for the treatment of shingles and related afflictions
US6936288B2 (en) * 2003-06-10 2005-08-30 Klearsen Corporation Method and composition for the treatment of shingles and related afflictions

Also Published As

Publication number Publication date
GB0025225D0 (en) 2000-11-29
CA2425321A1 (en) 2002-04-25
AR033582A1 (es) 2003-12-26
EP1328649B1 (en) 2008-12-24
WO2002033106A2 (en) 2002-04-25
RU2004127975A (ru) 2006-02-20
US20020138869A1 (en) 2002-09-26
PL362052A1 (en) 2004-10-18
BR0114820A (pt) 2004-02-03
CA2425321C (en) 2010-03-23
US7282624B2 (en) 2007-10-16
AU9404101A (en) 2002-04-29
RU2275426C1 (ru) 2006-04-27
AU2001294041B2 (en) 2006-05-18
RU2261277C2 (ru) 2005-09-27
US20070107079A1 (en) 2007-05-10
WO2002033106A3 (en) 2002-08-01
PL204381B1 (pl) 2010-01-29
ES2316481T3 (es) 2009-04-16
ATE418617T1 (de) 2009-01-15
EP1328649A2 (en) 2003-07-23
DE60137138D1 (de) 2009-02-05

Similar Documents

Publication Publication Date Title
CA2325344C (en) Methods and means for obtaining modified phenotypes
US8624086B2 (en) Nucleic acid molecules and their use in plant sterility
Sudhakar et al. Expression and immunolocalisation of the snowdrop lectin, GNA in transgenic rice plants
CA2105592A1 (en) Male-sterile plants, method for obtaining male-sterile plants and recombinant dna for use therein
JP3595335B2 (ja) アブラナ亜種のタペータムに特異的なプロモーター
US8598332B1 (en) Methods and means for obtaining modified phenotypes
US20070107079A1 (en) Plant cell death system
WO2004082366A2 (en) Methods to confer enhanced floral properties to plants
US5932784A (en) Method for obtaining male-sterile plants
EP0797674B1 (en) Microspore-specific regulatory element
CA2270872C (en) Nematode-inducible regulatory dna sequences
AU2001294050B2 (en) Plant cell death system
AU2001294041A1 (en) Plant cell death system
AU2001294050A1 (en) Plant cell death system
AU2006201828B2 (en) Plant cell death system
AU2005253642B8 (en) Nucleic acid molecules and their use in plant male sterility
AU2007201023A1 (en) Methods and Means for Obtaining Modified Phenotypes
AU2003227291A1 (en) Methods and Means for Obtaining Modified Phenotypes

Legal Events

Date Code Title Description
AS Assignment

Owner name: ADVANCED TECHNOLOGIES (CAMBRIDGE) LIMITED, ENGLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:THOMAS, CHRISTOPHER JOHN ROBERT;MCPHERSON, MICHAEL JOHN;ATKINSON, HOWARD JOHN;AND OTHERS;REEL/FRAME:012670/0256;SIGNING DATES FROM 20011204 TO 20020123

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION