US11525157B2 - Error correction in amplification of samples - Google Patents

Error correction in amplification of samples Download PDF

Info

Publication number
US11525157B2
US11525157B2 US16/232,287 US201816232287A US11525157B2 US 11525157 B2 US11525157 B2 US 11525157B2 US 201816232287 A US201816232287 A US 201816232287A US 11525157 B2 US11525157 B2 US 11525157B2
Authority
US
United States
Prior art keywords
barcoded
targets
label
primers
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US16/232,287
Other versions
US20190119726A1 (en
Inventor
Eleen Shum
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Becton Dickinson and Co
Original Assignee
Becton Dickinson and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Becton Dickinson and Co filed Critical Becton Dickinson and Co
Priority to US16/232,287 priority Critical patent/US11525157B2/en
Publication of US20190119726A1 publication Critical patent/US20190119726A1/en
Assigned to CELLULAR RESEARCH, INC. reassignment CELLULAR RESEARCH, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SHUM, Eleen
Assigned to BECTON, DICKINSON AND COMPANY reassignment BECTON, DICKINSON AND COMPANY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CELLULAR RESEARCH, INC.
Assigned to CELLULAR RESEARCH, INC. reassignment CELLULAR RESEARCH, INC. MERGER (SEE DOCUMENT FOR DETAILS). Assignors: TUCSON ACQUISITION CORP.
Priority to US18/053,603 priority patent/US12331351B2/en
Application granted granted Critical
Publication of US11525157B2 publication Critical patent/US11525157B2/en
Priority to US19/209,707 priority patent/US20250277261A1/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00Reaction characterised by the enzymatic activity
    • C12Q2521/10Nucleotidyl transfering
    • C12Q2521/107RNA dependent DNA polymerase,(i.e. reverse transcriptase)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/514Detection characterised by immobilisation to a surface characterised by the use of the arrayed oligonucleotides as identifier tags, e.g. universal addressable array, anti-tag or tag complement array
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/519Detection characterised by immobilisation to a surface characterised by the capture moiety being a single stranded oligonucleotide

Definitions

  • Sequence Listing is provided as a file entitled Sequence_Listing_BDCRI_018C1.txt, created Nov. 27, 2018, which is 4.12 kilobytes in size.
  • the information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
  • the present disclosure relates generally to the field of molecular biology and more particularly error correction in amplification of samples with stochastically barcoded targets.
  • Methods and techniques such as stochastic barcoding are useful for cell analysis, in particular deciphering gene expression profiles to determine the states of cells using, for example, reverse transcription, polymerase chain reaction (PCR) amplification, and next generation sequencing (NGS).
  • PCR polymerase chain reaction
  • NGS next generation sequencing
  • these methods and techniques can introduce errors caused by, for example, PCR crossover that may result in over-estimated molecular counts.
  • the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined sample labels are variants of the sample labels; amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded
  • contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes.
  • the defined molecular label can be 5-20 nucleotides in length.
  • the defined molecular label and the molecular label can have the same length.
  • the molecular label can comprise 5-20 nucleotides.
  • Some of the molecular labels of the stochastic barcodes and some of the defined molecular labels of the one or more defined barcoded primers can have the same sequence.
  • the molecular labels of different stochastic barcodes can be different from one another.
  • the defined sample label can be 5-20 nucleotides in length.
  • the one or more defined barcoded primers can comprise one or more types of defined barcoded primers.
  • the defined molecular labels of one type of defined barcoded primers can differ from one another by at least one nucleotide. Some defined molecular labels of different types of defined barcoded primers can have the same sequence. Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primers can differ by at most 10 nucleotides.
  • the defined sample labels of different types of defined barcoded primers can have different sequences. The sample label and the defined sample label can have the same length.
  • the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 2 or 4.
  • the stochastic barcodes and the one or more types of defined barcoded primers can have the same length or different lengths.
  • the method further comprise: removing at least 50% of the oligonucleotides comprising stochastic barcodes not incorporated into the stochastically barcoded targets and the one or more defined barcoded primers from each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the stochastic barcodes may not be removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
  • amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • determining the pre-correction number of each of the plurality of targets using the molecular label comprises: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences. Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences each with a read length of 100 or more bases.
  • determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers. Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
  • determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers.
  • Determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded can comprise determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • the amplification noise can comprise noise caused by PCR crossover.
  • the method can comprise pooling the stochastically barcoded targets to generate a pool of stochastically barcoded targets.
  • stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets.
  • stochastically barcoding the plurality of targets can be performed with a solid support comprising the plurality of oligonucleotides comprising the stochastic barcodes.
  • the solid support can comprise a plurality of synthetic particles associated with the plurality of oligonucleotides comprising the stochastic barcodes.
  • the synthetic particles can be beads.
  • the beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof.
  • the solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
  • the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell.
  • the method can comprise lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof.
  • the cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
  • the plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
  • RNAs ribonucleic acids
  • mRNAs messenger RNAs
  • microRNAs microRNAs
  • small interfering RNAs siRNAs
  • RNA degradation products RNAs each comprising a poly(A) tail, and any combination thereof.
  • the method comprise: reverse transcribing a plurality targets in each of one or more samples using oligonucleotides comprising reverse transcription primers to generate reverse transcribed targets; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined molecular label; amplifying the reverse transcribed targets and the one or more defined barcoded primers to generate a plurality of amplified reverse transcribed targets and a plurality of amplified defined barcoded primers; and determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of defined barcoded primers.
  • the method can be multiplexed.
  • each oligonucleotide comprises a stochastic barcode, wherein the stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two plurality of stochastic barcodes differ from one another by at least one nucleotide, wherein each of the one or more defined barcoded primers comprises a defined sample label, wherein the defined sample labels are variants of the sample label, and wherein the Hamming distance between the sample labels of stochastic barcodes and the defined sample labels of the defined barcoded primers is at least 2.
  • contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the oligonucleotides comprising the reverse transcription primers.
  • the defined molecular label can be 5-20 nucleotides in length.
  • the defined molecular label and the molecular label can have the same length.
  • Some of the molecular labels of the stochastic barcodes and some of the defined molecular labels of the one or more defined barcoded primers can have the same sequence.
  • the molecular label can comprise 5-20 nucleotides.
  • the molecular labels of different reverse stochastic barcodes can be different from one another.
  • the defined sample label can be 5-20 nucleotides in length.
  • the one or more defined barcoded primers comprise one or more types of defined barcoded primers.
  • the defined molecular labels of one type of defined barcoded primers differ from one another by at least one nucleotide. Some defined molecular labels of different types of defined barcoded primers can have the same sequence. Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primer can differ by at most 10 nucleotides.
  • the sample labels of different types of defined barcoded primer can have different sequences. The sample label and the defined sample label can have the same length.
  • the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 4.
  • the stochastic barcodes and the one or more types of defined barcoded primers have the same length.
  • the stochastic barcodes and the one or more types of defined barcoded primers can have different lengths.
  • the method comprises removing at least 50% of the oligonucleotides comprising the reverse transcription primers not incorporated into the reverse transcribed targets and the one or more defined barcoded primers each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the reverse transcription primers may not be removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the oligonucleotides comprising the reverse transcription primers not removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the oligonucleotides comprising the reverse transcription primers not removed from each of the one or more samples.
  • amplifying the reverse transcribed targets and the one or more defined barcoded primers to generate the plurality of amplified reverse transcribed targets and the plurality of amplified defined barcoded primers comprises amplifying the reverse transcribed targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences for each type amplified defined barcoded primers. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the amplified defined barcoded primers in the plurality of amplified defined barcoded primers. Sequencing some or all of the amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
  • determining the number of defined molecular labels with different sequences in the plurality of amplified reverse transcribed targets comprises determining the number of defined molecular labels in the plurality of amplified reverse transcribed targets with different sequences for each type of amplified defined barcoded primers. Determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers can comprise determining the average number of the molecular labels with different sequences for different types of amplified defined barcoded primers.
  • determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises determining the maximum number of the molecular labels with different sequences for different types of amplified defined barcoded primers.
  • the amplification noise can comprise noise caused by PCR crossover.
  • the method comprises pooling the reverse transcribed targets to generate a pool of reverse transcribed targets.
  • the method comprises estimating the number of each of the plurality of targets.
  • Estimating the number of each of the plurality of targets can comprise: determining sequences of molecular labels of the amplified reverse transcribed targets; and counting the number of the molecular labels with different sequences.
  • Estimating the number of each of the plurality of targets can comprise: determining a pre-correction number of each of the targets using the molecular label; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the targets.
  • reverse transcribing the plurality of targets using oligonucleotides comprising reverse transcription primers comprises hybridizing the oligonucleotides comprising the reverse transcription primers with the plurality of targets to generate the reverse transcribed targets.
  • reverse transcribing the plurality of targets using the reverse transcription primers can be performed with a solid support comprising the oligonucleotides comprising the reverse transcription primers.
  • the solid support can comprise a plurality of synthetic particles associated with the oligonucleotides comprising the reverse transcription primers.
  • the synthetic particles can be beads.
  • the beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof.
  • the solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
  • the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell.
  • the method comprises lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof.
  • the cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
  • the plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
  • RNAs ribonucleic acids
  • mRNAs messenger RNAs
  • microRNAs microRNAs
  • small interfering RNAs siRNAs
  • RNA degradation products RNAs each comprising a poly(A) tail, and any combination thereof.
  • the method comprises: stochastically barcoding a plurality of targets in each of one or more samples in microwells of a microwell array using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each well, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; pooling the stochastically barcoded targets from the microwells of the microwell array to generate a pool of stochastically barcoded targets; contacting defined barcoded primers of one or more types of defined barcoded primers with each of the one or more samples, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers of the
  • contacting the defined barcoded primers with each of the one or more samples can comprise introducing the defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes.
  • the defined molecular label can be 5-20 nucleotides in length.
  • the defined molecular label and the molecular label can have the same length.
  • the molecular labels of some of the stochastic barcodes and the defined molecular labels of some of the defined barcoded primers can have the same sequence.
  • the molecular label can comprise 5-20 nucleotides.
  • the defined sample label can be 5-20 nucleotides in length.
  • the defined molecular labels of some defined barcoded primers of different types of defined barcoded primers can have the same sequence.
  • the defined barcoded primers of different types of defined barcoded primers can have the same length.
  • the lengths of different types of defined barcoded primers can differ by at most 10 nucleotides.
  • the sample label and the defined sample label can have the same length.
  • the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 4.
  • the stochastic barcodes and the defined barcoded primers can have the same length.
  • the stochastic barcodes and some of the defined barcoded primers can have different lengths.
  • the method comprises removing at least 50% of the oligonucleotides comprising stochastic barcodes not incorporated into the stochastically barcoded targets and the one or more types of defined barcoded primers from each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the stochastic barcodes may not be removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
  • amplifying the stochastically barcoded targets and the one or more types of defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the one or more defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more types defined barcoded primers by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • Determining the pre-correction number of each of the plurality of targets using the molecular label can comprise: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences.
  • Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences each with a read length of 100 or more base.
  • determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers. Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
  • estimating the amplification noise can comprise determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers.
  • Estimating the amplification noise can comprise determining the number of defined molecular labels with different sequences in the amplified defined barcoded primers comprises determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • Estimating the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • the amplification noise comprises noise caused by PCR crossover.
  • the method comprises pooling the stochastically barcoded targets to generate a pool of stochastically barcoded targets.
  • stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets.
  • Stochastically barcoding the plurality of targets in each of one or more samples in the microwells of the microwell array can be performed with a solid support comprising the plurality of oligonucleotides comprising the stochastic barcodes.
  • the solid support can comprise a plurality of synthetic particles associated with the oligonucleotides comprising the reverse transcription primers.
  • the synthetic particles can be beads.
  • the beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof.
  • the solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
  • the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell.
  • the method comprises lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof.
  • the cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
  • the plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
  • RNAs ribonucleic acids
  • mRNAs messenger RNAs
  • microRNAs microRNAs
  • small interfering RNAs siRNAs
  • RNA degradation products RNAs each comprising a poly(A) tail, and any combination thereof.
  • kits for determining the number of targets in one or more samples comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers are variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
  • the defined sample label can be 5-20 nucleotides in length and the defined molecular label can be 5-20 nucleotides in length.
  • the defined molecular label and the molecular label have the same length.
  • different types of defined barcoded primers have the same length. The lengths of different types of defined barcoded primers can differ by at most 10 nucleotides.
  • the sample label and the defined sample label can have the same length.
  • the Hamming distance between the sample label and the defined sample label can be at least 2 or 4.
  • the stochastic barcodes and the defined barcoded primers can have the same length.
  • the stochastic barcodes and the defined barcoded primers can have different lengths.
  • the plurality of oligonucleotides comprising the stochastic barcodes can be associated with a solid support.
  • the solid support can comprise a plurality of synthetic particles associated with the plurality of oligonucleotides comprising stochastic barcodes.
  • the plurality of synthetic particles can be beads.
  • the beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof.
  • the synthetic particles can be magnetic beads.
  • the solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
  • the kit comprises a buffer.
  • the kit can comprise a cartridge.
  • the solid support can be pre-loaded on a substrate.
  • the kit can comprise one or more reagents for a reverse transcription reaction.
  • the kit can comprise one or more reagents for an amplification reaction.
  • FIG. 1 illustrates a non-limiting exemplary stochastic barcode.
  • FIG. 2 shows a non-limiting exemplary workflow of stochastic barcoding and digital counting.
  • FIG. 3 is a schematic illustration showing a non-limiting exemplary process for generating an indexed library of the stochastically barcoded targets from a plurality of targets.
  • FIG. 4 is a flowchart showing a non-limiting exemplary embodiment of removing amplification noises caused by PCR crossover.
  • FIGS. 5 A- 5 C depict a non-limiting exemplary cartridge for use in the methods of the disclosure.
  • FIGS. 6 A- 6 D show bar charts of molecular label counts vs. wells for GAPDH and CD3D before and after correction for PCR amplification noises.
  • FIG. 7 panels (a)-(d) are non-limiting exemplary plots of molecular label counts vs. the number of reads per molecular label (ML), showing that the amplification noises determined using defined barcoded primers (DBPs) were similar to the noise levels determined using no-template controls (NTCs).
  • nucleic acids for example messenger ribonucleic acid (mRNA) molecules
  • mRNA messenger ribonucleic acid
  • Stochastic barcoding with, for example, the PreciseTM assay (Cellular Research, Inc. (Palo Alto, Calif.)) can be used to determine the number of molecules, for example mRNA molecules, in a cell.
  • the number of molecules determined by stochastic barcoding can include PCR amplification noises.
  • PCR amplification noises can be caused by stochastic barcodes still present during PCR amplification after barcode removal with Ampure beads.
  • rigorous barcode removal can be performed prior to PCR amplification.
  • rigorous barcode removal may also wash away many of the stochastically barcoded molecules giving rise to sequencing “signal.” The methods and systems disclosed herein can preserve the sequencing “signal” while eliminating PCR amplification noises to provide more accurate determinations of, for example, gene expression profiles.
  • the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples.
  • Defined barcoded primers can be variants of the stochastic barcodes.
  • a defined barcoded primer can have a corresponding stochastic barcode, where the defined barcoded primer is a variant of the corresponding stochastic barcode.
  • the defined barcoded primer can have a different sequence in one or more regions as compared to the corresponding stochastic barcode.
  • a defined barcoded primer can comprise a defined sample label and a defined molecular label.
  • the defined sample label of a defined barcoded primer can be a variant of the sample label of a stochastic barcode (e.g., the sample label of the corresponding stochastic barcode).
  • the defined sample label differs from the sample label in one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides.
  • the defined sample label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the sample label can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the defined sample label and the sample label for example, a defined sample label of a defined barcoded primer and a sample label of the corresponding stochastic barcode, can have the same length or different length.
  • the defined sample label and the sample label can both be 8 nucleotides in length.
  • the sequence of the defined sample label and the sequence of the sample label can differ by one nucleotide.
  • the Hamming distance between the defined sample label and the sample label can be 2 or 4.
  • the defined molecular label of a defined barcoded primer can be a variant of the molecular label of a stochastic barcode (e.g., the molecular label of the corresponding stochastic barcode).
  • the sequence of the defined molecular label and the sequence of the molecular label differ by one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides.
  • the defined molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the defined molecular label and the molecular label for example a defined molecular label of a defined barcoded primer and a molecular label of the corresponding stochastic barcode, can have the same length.
  • the defined molecular label and the molecular label can both be 8 nucleotides in length.
  • the defined molecular labels of different defined barcoded primers can be different from one another.
  • the molecular labels of different stochastic barcodes can be different from one another. Some molecular labels of the stochastic barcodes and some defined molecular labels of the defined barcoded primers can have the same sequence.
  • the method comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein estimating the number of each of the plurality of targets comprises: determining a pre-correction number of each of the plurality of targets using the molecular label; determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets.
  • the methods can be multiplexed.
  • Kits for determining the number of targets in one or more samples are also disclosed herein.
  • the kit comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers are variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
  • the term “adaptor” can mean a sequence to facilitate amplification or sequencing of associated nucleic acids.
  • the associated nucleic acids can comprise target nucleic acids.
  • the associated nucleic acids can comprise one or more of spatial labels, target labels, sample labels, indexing label, barcodes, stochastic barcodes, or molecular labels.
  • the adapters can be linear.
  • the adaptors can be pre-adenylated adapters.
  • the adaptors can be double- or single-stranded.
  • One or more adaptor can be located on the 5′ or 3′ end of a nucleic acid. When the adaptors comprise known sequences on the 5′ and 3′ ends, the known sequences can be the same or different sequences.
  • An adaptor located on the 5′ and/or 3′ ends of a polynucleotide can be capable of hybridizing to one or more oligonucleotides immobilized on a surface.
  • An adapter can, in some embodiments, comprise a universal sequence.
  • a universal sequence can be a region of nucleotide sequence that is common to two or more nucleic acid molecules. The two or more nucleic acid molecules can also have regions of different sequence.
  • the 5′ adapters can comprise identical and/or universal nucleic acid sequences and the 3′ adapters can comprise identical and/or universal sequences.
  • a universal sequence that may be present in different members of a plurality of nucleic acid molecules can allow the replication or amplification of multiple different sequences using a single universal primer that is complementary to the universal sequence.
  • at least one, two (e.g., a pair) or more universal sequences that may be present in different members of a collection of nucleic acid molecules can allow the replication or amplification of multiple different sequences using at least one, two (e.g., a pair) or more single universal primers that are complementary to the universal sequences.
  • a universal primer includes a sequence that can hybridize to such a universal sequence.
  • the target nucleic acid sequence-bearing molecules may be modified to attach universal adapters (e.g., non-target nucleic acid sequences) to one or both ends of the different target nucleic acid sequences.
  • the one or more universal primers attached to the target nucleic acid can provide sites for hybridization of universal primers.
  • the one or more universal primers attached to the target nucleic acid can be the same or different from each other.
  • association can mean that two or more species are identifiable as being co-located at a point in time.
  • An association can mean that two or more species are or were within a similar container.
  • An association can be an informatics association, where for example digital information regarding two or more species is stored and can be used to determine that one or more of the species were co-located at a point in time.
  • An association can also be a physical association.
  • two or more associated species are “tethered”, “attached”, or “immobilized” to one another or to a common solid or semisolid surface.
  • An association may refer to covalent or non-covalent means for attaching labels to solid or semi-solid supports such as beads.
  • An association may be a covalent bond between a target and a label.
  • the term “complementary” can refer to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding with a nucleotide of another nucleic acid, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be “partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single-stranded molecules.
  • a first nucleotide sequence can be said to be the “complement” of a second sequence if the first nucleotide sequence is complementary to the second nucleotide sequence.
  • a first nucleotide sequence can be said to be the “reverse complement” of a second sequence, if the first nucleotide sequence is complementary to a sequence that is the reverse (i.e., the order of the nucleotides is reversed) of the second sequence.
  • the terms “complement”, “complementary”, and “reverse complement” can be used interchangeably. It is understood from the disclosure that if a molecule can hybridize to another molecule it may be the complement of the molecule that is hybridizing.
  • digital counting can refer to a method for estimating a number of target molecules in a sample.
  • Digital counting can include the step of determining a number of unique labels that have been associated with targets in a sample. This stochastic methodology transforms the problem of counting molecules from one of locating and identifying identical molecules to a series of yes/no digital questions regarding detection of a set of predefined labels.
  • label can refer to nucleic acid codes associated with a target within a sample.
  • a label can be, for example, a nucleic acid label.
  • a label can be an entirely or partially amplifiable label.
  • a label can be entirely or partially sequencable label.
  • a label can be a portion of a native nucleic acid that is identifiable as distinct.
  • a label can be a known sequence.
  • a label can comprise a junction of nucleic acid sequences, for example a junction of a native and non-native sequence.
  • label can be used interchangeably with the terms, “index”, “tag,” or “label-tag.” Labels can convey information. For example, in various embodiments, labels can be used to determine an identity of a sample, a source of a sample, an identity of a cell, and/or a target.
  • non-depleting reservoirs can refer to a pool of stochastic barcodes made up of many different labels.
  • a non-depleting reservoir can comprise large numbers of different stochastic barcodes such that when the non-depleting reservoir is associated with a pool of targets each target is likely to be associated with a unique stochastic barcode.
  • the uniqueness of each labeled target molecule can be determined by the statistics of random choice, and depends on the number of copies of identical target molecules in the collection compared to the diversity of labels.
  • the size of the resulting set of labeled target molecules can be determined by the stochastic nature of the barcoding process, and analysis of the number of stochastic barcodes detected then allows calculation of the number of target molecules present in the original collection or sample.
  • the labeled target molecules are highly unique (i.e. there is a very low probability that more than one target molecule will have been labeled with a given label).
  • nucleic acid refers to a polynucleotide sequence, or fragment thereof.
  • a nucleic acid can comprise nucleotides.
  • a nucleic acid can be exogenous or endogenous to a cell.
  • a nucleic acid can exist in a cell-free environment.
  • a nucleic acid can be a gene or fragment thereof.
  • a nucleic acid can be DNA.
  • a nucleic acid can be RNA.
  • a nucleic acid can comprise one or more analogs (e.g. altered backbone, sugar, or nucleobase).
  • analogs include: 5-bromouracil, peptide nucleic acid, xeno nucleic acid, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g.
  • nucleic acid can be used interchangeably.
  • a nucleic acid can comprise one or more modifications (e.g., a base modification, a backbone modification), to provide the nucleic acid with a new or enhanced feature (e.g., improved stability).
  • a nucleic acid can comprise a nucleic acid affinity tag.
  • a nucleoside can be a base-sugar combination. The base portion of the nucleoside can be a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides can be nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to the 2′, the 3′, or the 5′ hydroxyl moiety of the sugar.
  • the phosphate groups can covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds are generally suitable.
  • linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound.
  • the phosphate groups can commonly be referred to as forming the internucleoside backbone of the nucleic acid. The linkage or backbone can be a 3′ to 5′ phosphodiester linkage.
  • a nucleic acid can comprise a modified backbone and/or modified internucleoside linkages.
  • Modified backbones can include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • Suitable modified nucleic acid backbones containing a phosphorus atom therein can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonate such as 3′-alkylene phosphonates, 5′-alkylene phosphonates, chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkyl phosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, se
  • a nucleic acid can comprise polynucleotide backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • These can include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • siloxane backbones siloxane backbones
  • sulfide, sulfoxide and sulfone backbones formacetyl and thioformacetyl backbones
  • a nucleic acid can comprise a nucleic acid mimetic.
  • mimetic can be intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring can also be referred as being a sugar surrogate.
  • the heterocyclic base moiety or a modified heterocyclic base moiety can be maintained for hybridization with an appropriate target nucleic acid.
  • One such nucleic acid can be a peptide nucleic acid (PNA).
  • the sugar-backbone of a polynucleotide can be replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleotides can be retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • the backbone in PNA compounds can comprise two or more linked aminoethylglycine units which gives PNA an amide containing backbone.
  • the heterocyclic base moieties can be bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • a nucleic acid can comprise a morpholino backbone structure.
  • a nucleic acid can comprise a 6-membered morpholino ring in place of a ribose ring.
  • a phosphorodiamidate or other non-phosphodiester internucleoside linkage can replace a phosphodiester linkage.
  • p A nucleic acid can comprise linked morpholino units (i.e. morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. Linking groups can link the morpholino monomeric units in a morpholino nucleic acid. Non-ionic morpholino-based oligomeric compounds can have less undesired interactions with cellular proteins.
  • Morpholino-based polynucleotides can be nonionic mimics of nucleic acids.
  • a variety of compounds within the morpholino class can be joined using different linking groups.
  • a further class of polynucleotide mimetic can be referred to as cyclohexenyl nucleic acids (CeNA).
  • the furanose ring normally present in a nucleic acid molecule can be replaced with a cyclohexenyl ring.
  • CeNA DMT protected phosphoramidite monomers can be prepared and used for oligomeric compound synthesis using phosphoramidite chemistry. The incorporation of CeNA monomers into a nucleic acid chain can increase the stability of a DNA/RNA hybrid.
  • CeNA oligoadenylates can form complexes with nucleic acid complements with similar stability to the native complexes.
  • a further modification can include Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 4′ carbon atom of the sugar ring thereby forming a 2′-C, 4′-C-oxymethylene linkage thereby forming a bicyclic sugar moiety.
  • the linkage can be a methylene (—CH2—), group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2.
  • a nucleic acid may also include nucleobase (often referred to simply as “base”) modifications or substitutions.
  • nucleobase can include the purine bases, (e.g. adenine (A) and guanine (G)), and the pyrimidine bases, (e.g. thymine (T), cytosine (C) and uracil (U)).
  • Modified nucleobases can include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C ⁇ C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guan
  • Modified nucleobases can include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b) (1,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • sample can refer to a composition comprising targets.
  • Suitable samples for analysis by the disclosed methods, devices, and systems include cells, tissues, organs, or organisms.
  • sampling device can refer to a device which may take a section of a sample and/or place the section on a substrate.
  • a sample device can refer to, for example, a fluorescence activated cell sorting (FACS) machine, a cell sorter machine, a biopsy needle, a biopsy device, a tissue sectioning device, a microfluidic device, a blade grid, and/or a microtome.
  • FACS fluorescence activated cell sorting
  • solid support can refer to discrete solid or semi-solid surfaces to which a plurality of stochastic barcodes may be attached.
  • a solid support may encompass any type of solid, porous, or hollow sphere, ball, bearing, cylinder, or other similar configuration composed of plastic, ceramic, metal, or polymeric material (e.g., hydrogel) onto which a nucleic acid may be immobilized (e.g., covalently or non-covalently).
  • a solid support may comprise a discrete particle that may be spherical (e.g., microspheres) or have a non-spherical or irregular shape, such as cubic, cuboid, pyramidal, cylindrical, conical, oblong, or disc-shaped, and the like.
  • a plurality of solid supports spaced in an array may not comprise a substrate.
  • a solid support may be used interchangeably with the term “bead.”
  • a solid support can refer to a “substrate.”
  • a substrate can be a type of solid support.
  • a substrate can refer to a continuous solid or semi-solid surface on which the methods of the disclosure may be performed.
  • a substrate can refer to an array, a cartridge, a chip, a device, and a slide, for example.
  • spatial label can refer to a label which can be associated with a position in space.
  • stochastic barcode can refer to a polynucleotide sequence comprising labels.
  • a stochastic barcode can be a polynucleotide sequence that can be used for stochastic barcoding.
  • Stochastic barcodes can be used to quantify targets within a sample.
  • Stochastic barcodes can be used to control for errors which may occur after a label is associated with a target.
  • a stochastic barcode can be used to assess amplification or sequencing errors.
  • a stochastic barcode associated with a target can be called a stochastic barcode-target or stochastic barcode-tag-target.
  • the term “gene-specific stochastic barcode” can refer to a polynucleotide sequence comprising labels and a target-binding region that is gene-specific.
  • a stochastic barcode can be a polynucleotide sequence that can be used for stochastic barcoding.
  • Stochastic barcodes can be used to quantify targets within a sample.
  • Stochastic barcodes can be used to control for errors which may occur after a label is associated with a target.
  • a stochastic barcode can be used to assess amplification or sequencing errors.
  • a stochastic barcode associated with a target can be called a stochastic barcode-target or stochastic barcode-tag-target.
  • the term “stochastic barcoding” can refer to the random labeling (e.g., barcoding) of nucleic acids. Stochastic barcoding can utilize a recursive Poisson strategy to associate and quantify labels associated with targets. As used herein, the term “stochastic barcoding” can be used interchangeably with “gene-specific stochastic barcoding.”
  • target can refer to a composition which can be associated with a stochastic barcode.
  • exemplary suitable targets for analysis by the disclosed methods, devices, and systems include oligonucleotides, DNA, RNA, mRNA, microRNA, tRNA, and the like. Targets can be single or double stranded. In some embodiments targets can be proteins. In some embodiments targets are lipids.
  • reverse transcriptases can refer to a group of enzymes having reverse transcriptase activity (i.e., that catalyze synthesis of DNA from an RNA template).
  • enzymes include, but are not limited to, retroviral reverse transcriptase, retrotransposon reverse transcriptase, retroplasmid reverse transcriptases, retron reverse transcriptases, bacterial reverse transcriptases, group II intron-derived reverse transcriptase, and mutants, variants or derivatives thereof.
  • Non-retroviral reverse transcriptases include non-LTR retrotransposon reverse transcriptases, retroplasmid reverse transcriptases, retron reverse transciptases, and group II intron reverse transcriptases.
  • group II intron reverse transcriptases examples include the Lactococcus lactis LI.LtrB intron reverse transcriptase, the Thermosynechococcus elongates TeI4c intron reverse transcriptase, or the Geobacillus stearothermophilus GsI-IIC intron reverse transcriptase.
  • Other classes of reverse transcriptases can include many classes of non-retroviral reverse transcriptases (i.e., retrons, group II introns, and diversity-generating retroelements among others).
  • universal adaptor primer refers to a nucleotide sequence that can be used to hybridize stochastic barcodes to generate gene-specific stochastic barcodes.
  • a universal adaptor sequence can, for example, be a known sequence that is universal across all stochastic barcodes used in methods of the disclosure. For example, when multiple targets are being labeled using the methods disclosed herein, each of the target-specific sequences may be linked to the same universal adaptor sequence. In some embodiments, more than one universal adaptor sequences may be used in the methods disclosed herein.
  • a universal adaptor primer and its complement may be included in two oligonucleotides, one of which comprises a target-specific sequence and the other comprises a stochastic barcode.
  • a universal adaptor sequence may be part of an oligonucleotide comprising a target-specific sequence to generate a nucleotide sequence that is complementary to a target nucleic acid.
  • a second oligonucleotide comprising a stochastic barcode and a complementary sequence of the universal adaptor sequence may hybridize with the nucleotide sequence and generate a target-specific stochastic barcode.
  • a universal adaptor primer has a sequence that is different from a universal PCR primer used in the methods of this disclosure.
  • a stochastic barcode can be a polynucleotide sequence that may be used to stochastically label (e.g., barcode, tag) a target.
  • a stochastic barcode can comprise one or more labels. Exemplary labels can include a universal label, a cell label, a molecular label, a sample label, a plate label, a spatial label, and/or a pre-spatial label.
  • the stochastic barcode 104 can comprise a 5′amine that may link the stochastic barcode to a solid support 105 .
  • the stochastic barcode can comprise a universal label, a dimension label, a spatial label, a cell label, and/or a molecular label.
  • the order of different labels (including but not limited to the universal label, the dimension label, the spatial label, the cell label, and the molecule label) in the stochastic barcode can vary.
  • the universal label may be the 5′-most label
  • the molecular label may be the 3′-most label.
  • the spatial label, dimension label, and the cell label may be in any order.
  • the universal label, the spatial label, the dimension label, the cell label, and the molecular label are in any order.
  • a label for example the cell label, can comprise a unique set of nucleic acid sub-sequences of defined length, e.g. seven nucleotides each (equivalent to the number of bits used in some Hamming error correction codes), which can be designed to provide error correction capability.
  • the set of error correction sub-sequences comprise seven nucleotide sequences can be designed such that any pairwise combination of sequences in the set exhibits a defined “genetic distance” (or number of mismatched bases), for example, a set of error correction sub-sequences can be designed to exhibit a genetic distance of three nucleotides.
  • the length of the nucleic acid sub-sequences used for creating error correction codes can vary, for example, they can be, or be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 31, 40, 50, or a number or a range between any two of these values, nucleotides in length.
  • nucleic acid sub-sequences of other lengths can be used for creating error correction codes.
  • the stochastic barcode can comprise a target-binding region.
  • the target-binding region can interact with a target in a sample.
  • the target can be, or comprise, ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, or any combination thereof.
  • the plurality of targets can include deoxyribonucleic acids (DNAs).
  • a target-binding region can comprise an oligo(dT) sequence which can interact with poly(A) tails of mRNAs.
  • One or more of the labels of the stochastic barcode e.g., the universal label, the dimension label, the spatial label, the cell label, and the molecular label
  • the spacer can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides.
  • none of the labels of the stochastic barcode is separated by spacer.
  • a stochastic barcode can comprise one or more universal labels.
  • the one or more universal labels can be the same for all stochastic barcodes in the set of stochastic barcodes attached to a given solid support.
  • the one or more universal labels can be the same for all stochastic barcodes attached to a plurality of beads.
  • a universal label can comprise a nucleic acid sequence that is capable of hybridizing to a sequencing primer.
  • Sequencing primers can be used for sequencing stochastic barcodes comprising a universal label.
  • Sequencing primers (e.g., universal sequencing primers) can comprise sequencing primers associated with high-throughput sequencing platforms.
  • a universal label can comprise a nucleic acid sequence that is capable of hybridizing to a PCR primer. In some embodiments, the universal label can comprise a nucleic acid sequence that is capable of hybridizing to a sequencing primer and a PCR primer. The nucleic acid sequence of the universal label that is capable of hybridizing to a sequencing or PCR primer can be referred to as a primer binding site.
  • a universal label can comprise a sequence that can be used to initiate transcription of the stochastic barcode. A universal label can comprise a sequence that can be used for extension of the stochastic barcode or a region within the stochastic barcode.
  • a universal label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a universal label can comprise at least about 10 nucleotides.
  • a universal label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
  • a cleavable linker or modified nucleotide can be part of the universal label sequence to enable the stochastic barcode to be cleaved off from the support.
  • a stochastic barcode can comprise one or more dimension labels.
  • a dimension label can comprise a nucleic acid sequence that provides information about a dimension in which the stochastic labeling occurred.
  • a dimension label can provide information about the time at which a target was stochastically barcoded.
  • a dimension label can be associated with a time of stochastic barcoding in a sample.
  • a dimension label can be activated at the time of stochastic labeling. Different dimension labels can be activated at different times.
  • the dimension label provides information about the order in which targets, groups of targets, and/or samples were stochastically barcoded. For example, a population of cells can be stochastically barcoded at the G0 phase of the cell cycle.
  • the cells can be pulsed again with stochastic barcodes at the G1 phase of the cell cycle.
  • the cells can be pulsed again with stochastic barcodes at the S phase of the cell cycle, and so on.
  • Stochastic barcodes at each pulse can comprise different dimension labels.
  • the dimension label provides information about which targets were labelled at which phase of the cell cycle.
  • Dimension labels can interrogate many different biological times. Exemplary biological times can include, but are not limited to, the cell cycle, transcription (e.g., transcription initiation), and transcript degradation.
  • a sample e.g., a cell, a population of cells
  • the changes in the number of copies of distinct targets can be indicative of the sample's response to the drug and/or therapy.
  • a dimension label can be activatable.
  • An activatable dimension label can be activated at a specific time point.
  • the activatable label can be, for example, constitutively activated (e.g., not turned off).
  • the activatable dimension label can be, for example, reversibly activated (e.g., the activatable dimension label can be turned on and turned off).
  • the dimension label can be, for example, reversibly activatable at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times.
  • the dimension label can be reversibly activatable, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times.
  • the dimension label can be activated with fluorescence, light, a chemical event (e.g., cleavage, ligation of another molecule, addition of modifications (e.g., pegylated, sumoylated, acetylated, methylated, deacetylated, demethylated), a photochemical event (e.g., photocaging), and introduction of a non-natural nucleotide.
  • a chemical event e.g., cleavage, ligation of another molecule, addition of modifications (e.g., pegylated, sumoylated, acetylated, methylated, deacetylated, demethylated)
  • a photochemical event e.g., photocaging
  • the dimension label can, in some embodiments, be identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads). In some embodiments, at least 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of stochastic barcodes on the same solid support can comprise the same dimension label. In some embodiments, at least 60% of stochastic barcodes on the same solid support can comprise the same dimension label. In some embodiments, at least 95% of stochastic barcodes on the same solid support can comprise the same dimension label.
  • a dimension label can be, or be about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a dimension label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
  • a dimension label can comprise between about 5 to about 200 nucleotides.
  • a dimension label can comprise between about 10 to about 150 nucleotides.
  • a dimension label can comprise between about 20 to about 125 nucleotides in length.
  • a stochastic barcode can comprise one or more spatial labels.
  • a spatial label can comprise a nucleic acid sequence that provides information about the spatial orientation of a target molecule which is associated with the stochastic barcode.
  • a spatial label can be associated with a coordinate in a sample.
  • the coordinate can be a fixed coordinate.
  • a coordinate can be fixed in reference to a substrate.
  • a spatial label can be in reference to a two or three-dimensional grid.
  • a coordinate can be fixed in reference to a landmark.
  • the landmark can be identifiable in space.
  • a landmark can be a structure which can be imaged.
  • a landmark can be a biological structure, for example an anatomical landmark.
  • a landmark can be a cellular landmark, for instance an organelle.
  • a landmark can be a non-natural landmark such as a structure with an identifiable identifier such as a color code, bar code, magnetic property, fluorescents, radioactivity, or a unique size or shape.
  • a spatial label can be associated with a physical partition (e.g. a well, a container, or a droplet). In some embodiments, multiple spatial labels are used together to encode one or more positions in space.
  • the spatial label can be identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads).
  • the percentage of stochastic barcodes on the same solid support comprising the same spatial label can be, or be about, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values.
  • the percentage of stochastic barcodes on the same solid support comprising the same spatial label can be at least, or at most, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%.
  • at least 60% of stochastic barcodes on the same solid support can comprise the same spatial label.
  • at least 95% of stochastic barcodes on the same solid support can comprise the same spatial label.
  • a spatial label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a spatial label can be at least or at most 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
  • a spatial label can comprise between about 5 to about 200 nucleotides.
  • a spatial label can comprise between about 10 to about 150 nucleotides.
  • a spatial label can comprise between about 20 to about 125 nucleotides in length.
  • a stochastic barcodes can comprise one or more cell labels.
  • a cell label can comprise a nucleic acid sequence that provides information for determining which target nucleic acid originated from which cell.
  • the cell label is identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads).
  • the percentage of stochastic barcodes on the same solid support comprising the same cell label can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values.
  • the percentage of stochastic barcodes on the same solid support comprising the same cell label can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%.
  • at least 60% of stochastic barcodes on the same solid support can comprise the same cell label.
  • at least 95% of stochastic barcodes on the same solid support can comprise the same cell label.
  • a cell label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a cell label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
  • a cell label can comprise between about 5 to about 200 nucleotides.
  • a cell label can comprise between about 10 to about 150 nucleotides.
  • a cell label can comprise between about 20 to about 125 nucleotides in length.
  • a stochastic barcodes can comprise one or more molecular labels.
  • a molecular label can comprise a nucleic acid sequence that provides identifying information for the specific type of target nucleic acid species hybridized to the stochastic barcode.
  • a molecular label can comprise a nucleic acid sequence that provides a counter for the specific occurrence of the target nucleic acid species hybridized to the stochastic barcode (e.g., target-binding region).
  • a diverse set of molecular labels are attached to a given solid support (e.g., bead).
  • a given solid support e.g., bead
  • a plurality of stochastic barcodes can comprise about 6561 molecular labels with distinct sequences.
  • a plurality of stochastic barcodes can comprise about 65536 molecular labels with distinct sequences.
  • the unique molecular label sequences attached to a given solid support e.g., bead).
  • a molecular label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a molecular label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
  • a stochastic barcodes can comprise one or more target binding regions.
  • a target-binding region can hybridize with a target of interest.
  • the target binding regions can comprise a nucleic acid sequence that hybridizes specifically to a target (e.g. target nucleic acid, target molecule, e.g., a cellular nucleic acid to be analyzed), for example to a specific gene sequence.
  • a target binding region can comprise a nucleic acid sequence that can attach (e.g., hybridize) to a specific location of a specific target nucleic acid.
  • the target binding region can comprise a nucleic acid sequence that is capable of specific hybridization to a restriction enzyme site overhang (e.g. an EcoRI sticky-end overhang). The stochastic barcode can then ligate to any nucleic acid molecule comprising a sequence complementary to the restriction site overhang.
  • a target binding region can comprise a non-specific target nucleic acid sequence.
  • a non-specific target nucleic acid sequence can refer to a sequence that can bind to multiple target nucleic acids, independent of the specific sequence of the target nucleic acid.
  • target binding region can comprise a random multimer sequence, or an oligo(dT) sequence that hybridizes to the poly(A) tail on mRNA molecules.
  • a random multimer sequence can be, for example, a random dimer, trimer, quatramer, pentamer, hexamer, septamer, octamer, nonamer, decamer, or higher multimer sequence of any length.
  • the target binding region is the same for all stochastic barcodes attached to a given bead.
  • the target binding regions for the plurality of stochastic barcodes attached to a given bead can comprise two or more different target binding sequences.
  • a target binding region can be, or be about, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length.
  • a target binding region can be at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length.
  • a target-binding region can comprise an oligo(dT) which can hybridize with mRNAs comprising poly-adenylated ends.
  • a target-binding region can be gene-specific.
  • a target-binding region can be configured to hybridize to a specific region of a target.
  • a target-binding region can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, or a number or a range between any two of these values, nucleotides in length.
  • a target-binding region can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, or 30, nucleotides in length.
  • a target-binding region can be about 5-30 nucleotides in length.
  • a stochastic barcode can comprise one or more orientation properties which can be used to orient (e.g., align) the stochastic barcodes.
  • a stochastic barcode can comprise a moiety for isoelectric focusing. Different stochastic barcodes can comprise different isoelectric focusing points. When these stochastic barcodes are introduced to a sample, the sample can undergo isoelectric focusing in order to orient the stochastic barcodes into a known way. In this way, the orientation property can be used to develop a known map of stochastic barcodes in a sample.
  • Exemplary orientation properties can include, electrophoretic mobility (e.g., based on size of the stochastic barcode), isoelectric point, spin, conductivity, and/or self-assembly. For example, stochastic barcodes with an orientation property of self-assembly, can self-assemble into a specific orientation (e.g., nucleic acid nanostructure) upon activation.
  • a stochastic barcode can comprise one or more affinity properties.
  • a spatial label can comprise an affinity property.
  • An affinity property can include a chemical and/or biological moiety that can facilitate binding of the stochastic barcode to another entity (e.g., cell receptor).
  • an affinity property can comprise an antibody, for example, an antibody specific for a specific moiety (e.g., receptor) on a sample.
  • the antibody can guide the stochastic barcode to a specific cell type or molecule. Targets at and/or near the specific cell type or molecule can be stochastically labeled.
  • the affinity property can, in some embodiments, provide spatial information in addition to the nucleotide sequence of the spatial label because the antibody can guide the stochastic barcode to a specific location.
  • the antibody can be a therapeutic antibody, for example a monoclonal antibody or a polyclonal antibody.
  • the antibody can be humanized or chimeric.
  • the antibody can be a naked antibody or a fusion antibody.
  • the antibody can be a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (e.g., an IgG antibody) or an immunologically active (i.e., specifically binding) portion of an immunoglobulin molecule, like an antibody fragment.
  • immunoglobulin molecule e.g., an IgG antibody
  • immunologically active i.e., specifically binding
  • the antibody fragment can be, for example, a portion of an antibody such as F(ab')2, Fab', Fab, Fv, sFv and the like. In some embodiments, the antibody fragment can bind with the same antigen that is recognized by the full-length antibody.
  • the antibody fragment can include isolated fragments consisting of the variable regions of antibodies, such as the “Fv” fragments consisting of the variable regions of the heavy and light chains and recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (“scFv proteins”).
  • Exemplary antibodies can include, but are not limited to, antibodies for cancer cells, antibodies for viruses, antibodies that bind to cell surface receptors (CD8, CD34, CD45), and therapeutic antibodies.
  • a stochastic barcode can comprise one or more universal adaptor primers.
  • a gene-specific stochastic barcode can comprise a universal adaptor primer.
  • a universal adaptor primer can refer to a nucleotide sequence that is universal across all stochastic barcodes.
  • a universal adaptor primer can be used for building gene-specific stochastic barcodes.
  • a universal adaptor primer can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, or a number or a range between any two of these nucleotides in length.
  • a universal adaptor primer can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, or 30 nucleotides in length.
  • a universal adaptor primer can be from 5-30 nucleotides in length.
  • Stochastic barcodes disclosed herein can, in some embodiments, be associated with a solid support.
  • the solid support can be, for example, a synthetic particle.
  • some or all of the molecular labels (e.g., the first molecular labels) of a plurality of stochastic barcodes (e.g., the first plurality of stochastic barcodes) on a solid support differ by at least one nucleotide.
  • the cell labels of the stochastic barcodes on the same solid support can be the same.
  • the cell labels of the stochastic barcodes on different solid supports can differ by at least one nucleotide.
  • first cell labels of a first plurality of stochastic barcodes on a first solid support can have the same sequence
  • second cell labels of a second plurality of stochastic barcodes on a second solid support can have the same sequence.
  • the first cell labels of the first plurality of stochastic barcodes on the first solid support and the second cell labels of the second plurality of stochastic barcodes on the second solid support can differ by at least one nucleotide.
  • a cell label can be, for example, about 5-20 nucleotides long.
  • a molecular label can be, for example, about 5-20 nucleotides long.
  • the synthetic particle can be, for example, a bead.
  • the bead can be, for example, a silica gel bead, a controlled pore glass bead, a magnetic bead, a Dynabead, a Sephadex/Sepharose bead, a cellulose bead, a polystyrene bead, or any combination thereof.
  • the bead can comprise a material such as polydimethylsiloxane (PDMS), polystyrene, glass, polypropylene, agarose, gelatin, hydrogel, paramagnetic, ceramic, plastic, glass, methylstyrene, acrylic polymer, titanium, latex, sepharose, cellulose, nylon, silicone, or any combination thereof.
  • PDMS polydimethylsiloxane
  • the bead can be a polymeric bead, for example a deformable bead or a gel bead, functionalized with stochastic barcodes (such as gel beads from 10X Genomics (San Francisco, Calif.).
  • a gel bead can comprise a polymer based gels. Gel beads can be generated, for example, by encapsulating one or more polymeric precursors into droplets. Upon exposure of the polymeric precursors to an accelerator (e.g., tetramethylethylenediamine (TEMED)), a gel bead may be generated.
  • an accelerator e.g., tetramethylethylenediamine (TEMED)
  • the polymeric bead can dissolve, melt, or degrade, for example, under a desired condition.
  • the desired condition can include an environmental condition.
  • the desired condition may result in the polymeric bead dissolving, melting, or degrading in a controlled manner.
  • a gel bead may dissolve, melt, or degrade due to a chemical stimulus, a physical stimulus, a biological stimulus, a thermal stimulus, a magnetic stimulus, an electric stimulus, a light stimulus, or any combination thereof.
  • Analytes and/or reagents such as oligonucleotide barcodes, for example, may be coupled/immobilized to the interior surface of a gel bead (e.g., the interior accessible via diffusion of an oligonucleotide barcode and/or materials used to generate an oligonucleotide barcode) and/or the outer surface of a gel bead or any other microcapsule described herein. Coupling/immobilization may be via any form of chemical bonding (e.g., covalent bond, ionic bond) or physical phenomena (e.g., Van der Waals forces, dipole-dipole interactions, etc.).
  • chemical bonding e.g., covalent bond, ionic bond
  • physical phenomena e.g., Van der Waals forces, dipole-dipole interactions, etc.
  • coupling/immobilization of a reagent to a gel bead or any other microcapsule described herein may be reversible, such as, for example, via a labile moiety (e.g., via a chemical cross-linker, including chemical cross-linkers described herein).
  • a labile moiety e.g., via a chemical cross-linker, including chemical cross-linkers described herein.
  • the labile moiety may be cleaved and the immobilized reagent set free.
  • the labile moiety is a disulfide bond.
  • oligonucleotide barcode is immobilized to a gel bead via a disulfide bond
  • exposure of the disulfide bond to a reducing agent can cleave the disulfide bond and free the oligonucleotide barcode from the bead.
  • the labile moiety may be included as part of a gel bead or microcapsule, as part of a chemical linker that links a reagent or analyte to a gel bead or microcapsule, and/or as part of a reagent or analyte.
  • a gel bead can comprise a wide range of different polymers including but not limited to: polymers, heat sensitive polymers, photosensitive polymers, magnetic polymers, pH sensitive polymers, salt-sensitive polymers, chemically sensitive polymers, polyelectrolytes, polysaccharides, peptides, proteins, and/or plastics.
  • Polymers may include but are not limited to materials such as poly(N-isopropylacrylamide) (PNIPAAm), poly(styrene sulfonate) (PSS), poly(allyl amine) (PAAm), poly(acrylic acid) (PAA), poly(ethylene imine) (PEI), poly(diallyldimethyl-ammonium chloride) (PDADMAC), poly(pyrolle) (PPy), poly(vinylpyrrolidone) (PVPON), poly(vinyl pyridine) (PVP), poly(methacrylic acid) (PMAA), poly(methyl methacrylate) (PMMA), polystyrene (PS), poly(tetrahydrofuran) (PTHF), poly(phthaladehyde) (PTHF), poly(hexyl viologen) (PHV), poly(L-lysine) (PLL), poly(L-arginine) (PARG), poly(lactic-co-glycolic acid) (PLGA).
  • Numerous chemical stimuli can be used to trigger the disruption or degradation of the beads.
  • Examples of these chemical changes may include, but are not limited to pH-mediated changes to the bead wall, disintegration of the bead wall via chemical cleavage of crosslink bonds, triggered depolymerization of the bead wall, and bead wall switching reactions. Bulk changes may also be used to trigger disruption of the beads.
  • Bulk or physical changes to the microcapsule through various stimuli also offer many advantages in designing capsules to release reagents.
  • Bulk or physical changes occur on a macroscopic scale, in which bead rupture is the result of mechano-physical forces induced by a stimulus. These processes may include, but are not limited to pressure induced rupture, bead wall melting, or changes in the porosity of the bead wall.
  • Bio stimuli may also be used to trigger disruption or degradation of beads.
  • biological triggers resemble chemical triggers, but many examples use biomolecules, or molecules commonly found in living systems such as enzymes, peptides, saccharides, fatty acids, nucleic acids and the like.
  • beads may comprise polymers with peptide cross-links that are sensitive to cleavage by specific proteases. More specifically, one example may comprise a microcapsule comprising GFLGK peptide cross links. Upon addition of a biological trigger such as the protease Cathepsin B, the peptide cross links of the shell well are cleaved and the contents of the beads are released. In other cases, the proteases may be heat-activated.
  • beads comprise a shell wall comprising cellulose. Addition of the hydrolytic enzyme chitosan serves as biologic trigger for cleavage of cellulosic bonds, depolymerization of the shell wall, and release of its inner contents.
  • the beads may also be induced to release their contents upon the application of a thermal stimulus.
  • a change in temperature can cause a variety changes to the beads.
  • a change in heat may cause melting of a bead such that the bead wall disintegrates.
  • the heat may increase the internal pressure of the inner components of the bead such that the bead ruptures or explodes.
  • the heat may transform the bead into a shrunken dehydrated state.
  • the heat may also act upon heat-sensitive polymers within the wall of a bead to cause disruption of the bead.
  • a device of this disclosure may comprise magnetic beads for either purpose.
  • incorporation of Fe 3 O 4 nanoparticles into polyelectrolyte containing beads triggers rupture in the presence of an oscillating magnetic field stimulus.
  • a bead may also be disrupted or degraded as the result of electrical stimulation. Similar to magnetic particles described in the previous section, electrically sensitive beads can allow for both triggered rupture of the beads as well as other functions such as alignment in an electric field, electrical conductivity or redox reactions. In one example, beads containing electrically sensitive material are aligned in an electric field such that release of inner reagents can be controlled. In other examples, electrical fields may induce redox reactions within the bead wall itself that may increase porosity.
  • a light stimulus may also be used to disrupt the beads.
  • Numerous light triggers are possible and may include systems that use various molecules such as nanoparticles and chromophores capable of absorbing photons of specific ranges of wavelengths.
  • metal oxide coatings can be used as capsule triggers.
  • UV irradiation of polyelectrolyte capsules coated with SiO 2 may result in disintegration of the bead wall.
  • photo switchable materials such as azobenzene groups may be incorporated in the bead wall.
  • chemicals such as these undergo a reversible cis-to-trans isomerization upon absorption of photons.
  • incorporation of photon switches result in a bead wall that may disintegrate or become more porous upon the application of a light trigger.
  • beads can be introduced onto the plurality of microwells of the microwell array at block 212 .
  • Each microwell can comprise one bead.
  • the beads can comprise a plurality of stochastic barcodes.
  • a stochastic barcode can comprise a 5′ amine region attached to a bead.
  • the stochastic barcode can comprise a universal label, a molecular label, a target-binding region, or any combination thereof.
  • the stochastic barcodes disclosed herein can be associated with (e.g., attached to) a solid support (e.g., a bead).
  • the stochastic barcodes associated with a solid support can each comprise a molecular label selected from a group comprising at least 100 or 1000 molecular labels with unique sequences.
  • different stochastic barcodes associated with a solid support can comprise molecular labels of different sequences.
  • a percentage of stochastic barcodes associated with a solid support comprises the same cell label. For example, the percentage can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values.
  • the percentage can be at least, or at most 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%.
  • stochastic barcodes associated with a solid support can have the same cell label.
  • the stochastic barcodes associated with different solid supports can have different cell labels selected from a group comprising at least 100 or 1000 cell labels with unique sequences.
  • the stochastic barcodes disclosed herein can be associated to (e.g., attached to) a solid support (e.g., a bead).
  • stochastically barcoding the plurality of targets in the sample can be performed with a solid support including a plurality of synthetic particles associated with the plurality of stochastic barcodes.
  • the solid support can include a plurality of synthetic particles associated with the plurality of stochastic barcodes.
  • the spatial labels of the plurality of stochastic barcodes on different solid supports can differ by at least one nucleotide.
  • the solid support can, for example, include the plurality of stochastic barcodes in two dimensions or three dimensions.
  • the synthetic particles can be beads.
  • the beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof.
  • the solid support can include a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
  • the solid supports can be free floating.
  • the solid supports can be embedded in a semi-solid or solid array.
  • the stochastic barcodes may not be associated with solid supports.
  • the stochastic barcodes can be individual nucleotides.
  • the stochastic barcodes can be associated with a substrate.
  • the terms “tethered”, “attached”, and “immobilized” are used interchangeably, and can refer to covalent or non-covalent means for attaching stochastic barcodes to a solid support. Any of a variety of different solid supports can be used as solid supports for attaching pre-synthesized stochastic barcodes or for in situ solid-phase synthesis of stochastic barcode.
  • the solid support is a bead.
  • the bead can comprise one or more types of solid, porous, or hollow sphere, ball, bearing, cylinder, or other similar configuration which a nucleic acid can be immobilized (e.g., covalently or non-covalently).
  • the bead can be, for example, composed of plastic, ceramic, metal, polymeric material, or any combination thereof.
  • a bead can be, or comprise, a discrete particle that is spherical (e.g., microspheres) or have a non-spherical or irregular shape, such as cubic, cuboid, pyramidal, cylindrical, conical, oblong, or disc-shaped, and the like.
  • a bead can be non-spherical in shape.
  • Beads can comprise a variety of materials including, but not limited to, paramagnetic materials (e.g. magnesium, molybdenum, lithium, and tantalum), superparamagnetic materials (e.g. ferrite (Fe 3 O 4; magnetite) nanoparticles), ferromagnetic materials (e.g. iron, nickel, cobalt, some alloys thereof, and some rare earth metal compounds), ceramic, plastic, glass, polystyrene, silica, methylstyrene, acrylic polymers, titanium, latex, sepharose, agarose, hydrogel, polymer, cellulose, nylon, or any combination thereof.
  • paramagnetic materials e.g. magnesium, molybdenum, lithium, and tantalum
  • superparamagnetic materials e.g. ferrite (Fe 3 O 4; magnetite) nanoparticles
  • ferromagnetic materials e.g. iron, nickel, cobalt, some alloys thereof, and some rare earth metal compounds
  • ceramic
  • the bead (e.g., the bead to which the stochastic labels are attached) is a hydrogel bead. In some embodiments, the bead comprises hydrogel.
  • Each of the particles can comprise a plurality of oligonucleotides (e.g., stochastic barcodes).
  • Each of the plurality of oligonucleotides can comprise a molecular label sequence, a cell label sequence, and a target-binding region (e.g., an oligo dT sequence, a gene-specific sequence, a random multimer, or a combination thereof).
  • the cell label sequence of each of the plurality of oligonucleotides can be the same.
  • the cell label sequences of oligonucleotides on different particles can be different such that the oligonucleotides on different particles can be identified.
  • the number of different cell label sequences can be different in different implementations.
  • the number of cell label sequences can be, or about 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 10 6 , 10 7 , 10 8 , 10 9 , a number or a range between any two of these values, or more.
  • the number of cell label sequences can be at least, or at most 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 10 6 , 10 7 , 10 8 , or 10 9 .
  • no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more of the plurality of the particles include oligonucleotides with the same cell sequence.
  • the plurality of particles that include oligonucleotides with the same cell sequence can be at most 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more. In some embodiments, none of the plurality of the particles has the same cell label sequence.
  • the plurality of oligonucleotides on each particle can comprise different molecular label sequences.
  • the number of molecular label sequences can be, or about 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 10 6 , 10 7 , 10 8 , 10 9 , or a number or a range between any two of these values.
  • the number of molecular label sequences can be at least, or at most 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 10 6 , 10 7 , 10 8 , or 10 9 .
  • at least 100 of the plurality of oligonucleotides comprise different molecular label sequences.
  • a single particle at least 100, 500, 1000, 5000, 10000, 15000, 20000, 50000, a number or a range between any two of these values, or more of the plurality of oligonucleotides comprise different molecular label sequences.
  • Some embodiments provide a plurality of the particles comprising stochastic barcodes.
  • the ratio of an occurrence (or a copy or a number) of a target to be labeled and the different molecular label sequences can be at least 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, or more.
  • each of the plurality of oligonucleotides further comprises a sample label, a universal label, or both.
  • the particle can be, for example, a nanoparticle or microparticle.
  • the size of the beads can vary.
  • the diameter of the bead can range from 0.1 micrometer to 50 micrometer.
  • the diameters of beads can be, or be about, 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 micrometer, or a number or a range between any two of these values.
  • the diameters of the bead can be related to the diameter of the wells of the substrate. In some embodiments, the diameters of the bead can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a number or a range between any two of these values, longer or shorter than the diameter of the well.
  • the diameter of the beads can be related to the diameter of a cell (e.g., a single cell entrapped by a well of the substrate).
  • the diameters of the beads can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, or a number or a range between any two of these values, longer or shorter than the diameter of the cell.
  • a bead can be attached to and/or embedded in a substrate.
  • a bead can be attached to and/or embedded in a gel, hydrogel, polymer and/or matrix.
  • the spatial position of a bead within a substrate e.g., gel, matrix, scaffold, or polymer
  • a substrate e.g., gel, matrix, scaffold, or polymer
  • beads can include, but are not limited to, streptavidin beads, agarose beads, magnetic beads, Dynabeads®, MACS® microbeads, antibody conjugated beads (e.g., anti-immunoglobulin microbeads), protein A conjugated beads, protein G conjugated beads, protein A/G conjugated beads, protein L conjugated beads, oligo(dT) conjugated beads, silica beads, silica-like beads, anti-biotin microbeads, anti-fluorochrome microbeads, and BcMagTM Carboxyl-Terminated Magnetic Beads.
  • a bead can be associated with (e.g. impregnated with) quantum dots or fluorescent dyes to make it fluorescent in one fluorescence optical channel or multiple optical channels.
  • a bead can be associated with iron oxide or chromium oxide to make it paramagnetic or ferromagnetic. Beads can be identifiable. For example, a bead can be imaged using a camera.
  • a bead can have a detectable code associated with the bead.
  • a bead can comprise a stochastic barcode.
  • a bead can change size, for example due to swelling in an organic or inorganic solution.
  • a bead can be hydrophobic.
  • a bead can be hydrophilic.
  • a bead can be biocompatible.
  • a solid support (e.g., bead) can be visualized.
  • the solid support can comprise a visualizing tag (e.g., fluorescent dye).
  • a solid support (e.g., bead) can be etched with an identifier (e.g., a number). The identifier can be visualized through imaging the beads.
  • a substrate can refer to a type of solid support.
  • a substrate can refer to a solid support that can comprise stochastic barcodes of the disclosure.
  • a substrate can, for example, comprise a plurality of microwells.
  • a substrate can be a well array comprising two or more microwells.
  • a microwell can comprise a small reaction chamber of defined volume.
  • a microwell can entrap one or more cells.
  • a microwell can entrap only one cell.
  • a microwell can entrap one or more solid supports.
  • a microwell can entrap only one solid support.
  • a microwell entraps a single cell and a single solid support (e.g., bead).
  • the disclosure provides for methods for estimating the number of distinct targets at distinct locations in a physical sample (e.g., tissue, organ, tumor, cell).
  • the methods can comprise placing the stochastic barcodes in close proximity with the sample, lysing the sample, associating distinct targets with the stochastic barcodes, amplifying the targets and/or digitally counting the targets.
  • the method can further comprise analyzing and/or visualizing the information obtained from the spatial labels on the stochastic barcodes.
  • a method comprises visualizing the plurality of targets in the sample. Mapping the plurality of targets onto the map of the sample can include generating a two dimensional map or a three dimensional map of the sample.
  • the two dimensional map and the three dimensional map can be generated prior to or after stochastically barcoding the plurality of targets in the sample.
  • Visualizing the plurality of targets in the sample can include mapping the plurality of targets onto a map of the sample. Mapping the plurality of targets onto the map of the sample can include generating a two dimensional map or a three dimensional map of the sample.
  • the two dimensional map and the three dimensional map can be generated prior to or after stochastically barcoding the plurality of targets in the sample.
  • the two dimensional map and the three dimensional map can be generated before or after lysing the sample. Lysing the sample before or after generating the two dimensional map or the three dimensional map can include heating the sample, contacting the sample with a detergent, changing the pH of the sample, or any combination thereof.
  • stochastically barcoding the plurality of targets comprises hybridizing a plurality of stochastic barcodes with a plurality of targets to create stochastically barcoded targets.
  • Stochastically barcoding the plurality of targets can comprise generating an indexed library of the stochastically barcoded targets.
  • Generating an indexed library of the stochastically barcoded targets can be performed with a solid support comprising the plurality of stochastic barcodes.
  • the disclosure provides for methods for contacting a sample (e.g., cells) to a substrate of the disclosure.
  • a sample comprising, for example, a cell, organ, or tissue thin section, can be contacted to stochastic barcodes.
  • the cells can be contacted, for example, by gravity flow wherein the cells can settle and create a monolayer.
  • the sample can be a tissue thin section.
  • the thin section can be placed on the substrate.
  • the sample can be one-dimensional (e.g., form a planar surface).
  • the sample e.g., cells
  • the targets When stochastic barcodes are in close proximity to targets, the targets can hybridize to the stochastic barcode.
  • the stochastic barcodes can be contacted at a non-depletable ratio such that each distinct target can associate with a distinct stochastic barcode of the disclosure.
  • the targets can be crosslinked to the stochastic barcode.
  • the cells can be lysed to liberate the target molecules.
  • Cell lysis can be accomplished by any of a variety of means, for example, by chemical or biochemical means, by osmotic shock, or by means of thermal lysis, mechanical lysis, or optical lysis.
  • Cells can be lysed by addition of a cell lysis buffer comprising a detergent (e.g. SDS, Li dodecyl sulfate, Triton X-100, Tween-20, or NP-40), an organic solvent (e.g. methanol or acetone), or digestive enzymes (e.g. proteinase K, pepsin, or trypsin), or any combination thereof.
  • a detergent e.g. SDS, Li dodecyl sulfate, Triton X-100, Tween-20, or NP-40
  • an organic solvent e.g. methanol or acetone
  • digestive enzymes e.g. proteinase K, pepsin,
  • the sample can be lysed using a filter paper.
  • the filter paper can be soaked with a lysis buffer on top of the filter paper.
  • the filter paper can be applied to the sample with pressure which can facilitate lysis of the sample and hybridization of the targets of the sample to the substrate.
  • lysis can be performed by mechanical lysis, heat lysis, optical lysis, and/or chemical lysis.
  • Chemical lysis can include the use of digestive enzymes such as proteinase K, pepsin, and trypsin.
  • Lysis can be performed by the addition of a lysis buffer to the substrate.
  • a lysis buffer can comprise Tris HCl.
  • a lysis buffer can comprise at least about 0.01, 0.05, 0.1, 0.5, or 1 M or more Tris HCl.
  • a lysis buffer can comprise at most about 0.01, 0.05, 0.1, 0.5, or 1 M or more Tris HCL.
  • a lysis buffer can comprise about 0.1 M Tris HCl.
  • the pH of the lysis buffer can be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more.
  • the pH of the lysis buffer can be at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. In some embodiments, the pH of the lysis buffer is about 7.5.
  • the lysis buffer can comprise a salt (e.g., LiCl).
  • the concentration of salt in the lysis buffer can be at least about 0.1, 0.5, or 1 M or more.
  • the concentration of salt in the lysis buffer can be at most about 0.1, 0.5, or 1 M or more. In some embodiments, the concentration of salt in the lysis buffer is about 0.5M.
  • the lysis buffer can comprise a detergent (e.g., SDS, Li dodecyl sufate, triton X, tween, NP-40).
  • concentration of the detergent in the lysis buffer can be at least about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, or 7% or more.
  • the concentration of the detergent in the lysis buffer can be at most about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, or 7% or more.
  • the concentration of the detergent in the lysis buffer is about 1% Li dodecyl sulfate.
  • the time used in the method for lysis can be dependent on the amount of detergent used. In some embodiments, the more detergent used, the less time needed for lysis.
  • the lysis buffer can comprise a chelating agent (e.g., EDTA, EGTA).
  • the concentration of a chelating agent in the lysis buffer can be at least about 1, 5, 10, 15, 20, 25, or 30 mM or more.
  • the concentration of a chelating agent in the lysis buffer can be at most about 1, 5, 10, 15, 20, 25, or 30 mM or more. In some embodiments, the concentration of chelating agent in the lysis buffer is about 10 mM.
  • the lysis buffer can comprise a reducing reagent (e.g., beta-mercaptoethanol, DTT).
  • the concentration of the reducing reagent in the lysis buffer can be at least about 1, 5, 10, 15, or 20 mM or more.
  • the concentration of the reducing reagent in the lysis buffer can be at most about 1, 5, 10, 15, or 20 mM or more.
  • the concentration of reducing reagent in the lysis buffer is about 5 mM.
  • a lysis buffer can comprise about 0.1M TrisHCl, about pH 7.5, about 0.5M LiCl, about 1% lithium dodecyl sulfate, about 10 mM EDTA, and about 5 mM DTT.
  • Lysis can be performed at a temperature of about 4, 10, 15, 20, 25, or 30° C. Lysis can be performed for about 1, 5, 10, 15, or 20 or more minutes.
  • a lysed cell can comprise at least about 100000, 200000, 300000, 400000, 500000, 600000, or 700000 or more target nucleic acid molecules.
  • a lysed cell can comprise at most about 100000, 200000, 300000, 400000, 500000, 600000, or 700000 or more target nucleic acid molecules.
  • the nucleic acid molecules can randomly associate with the stochastic barcodes of the co-localized solid support. Association can comprise hybridization of a stochastic barcode's target recognition region to a complementary portion of the target nucleic acid molecule (e.g., oligo(dT) of the stochastic barcode can interact with a poly(A) tail of a target).
  • the assay conditions used for hybridization e.g. buffer pH, ionic strength, temperature, etc.
  • the nucleic acid molecules released from the lysed cells can associate with the plurality of probes on the substrate (e.g., hybridize with the probes on the substrate).
  • the probes comprise oligo(dT)
  • mRNA molecules can hybridize to the probes and be reverse transcribed.
  • the oligo(dT) portion of the oligonucleotide can act as a primer for first strand synthesis of the cDNA molecule.
  • mRNA molecules can hybridize to stochastic barcodes on beads.
  • single-stranded nucleotide fragments can hybridize to the target-binding regions of stochastic barcodes.
  • Attachment can further comprise ligation of a stochastic barcode's target recognition region and a portion of the target nucleic acid molecule.
  • the target binding region can comprise a nucleic acid sequence that can be capable of specific hybridization to a restriction site overhang (e.g. an EcoRI sticky-end overhang).
  • the assay procedure can further comprise treating the target nucleic acids with a restriction enzyme (e.g. EcoRI) to create a restriction site overhang.
  • the stochastic barcode can then be ligated to any nucleic acid molecule comprising a sequence complementary to the restriction site overhang.
  • a ligase e.g., T4 DNA ligase
  • T4 DNA ligase can be used to join the two fragments.
  • the labeled targets from a plurality of cells (or a plurality of samples) can be subsequently pooled, for example, into a tube.
  • the labeled targets can be pooled by, for example, retrieving the stochastic barcodes and/or the beads to which the target-barcode molecules are attached.
  • the retrieval of solid support-based collections of attached target-barcode molecules can be implemented by use of magnetic beads and an externally-applied magnetic field. Once the target-barcode molecules have been pooled, all further processing can proceed in a single reaction vessel. Further processing can include, for example, reverse transcription reactions, amplification reactions, cleavage reactions, dissociation reactions, and/or nucleic acid extension reactions. Further processing reactions can be performed within the microwells, that is, without first pooling the labeled target nucleic acid molecules from a plurality of cells.
  • the disclosure provides for a method to create a stochastic target-barcode conjugate using reverse transcription (e.g., at block 224 of FIG. 2 ).
  • the stochastic target-barcode conjugate can comprise the stochastic barcode and a complementary sequence of all or a portion of the target nucleic acid (i.e. a stochastically barcoded cDNA molecule).
  • Reverse transcription of the associated RNA molecule can occur by the addition of a reverse transcription primer along with the reverse transcriptase.
  • the reverse transcription primer can be an oligo(dT) primer, a random hexanucleotide primer, or a target-specific oligonucleotide primer.
  • Oligo(dT) primers can be, or can be about, 12-18 nucleotides in length and bind to the endogenous poly(A) tail at the 3′ end of mammalian mRNA. Random hexanucleotide primers can bind to mRNA at a variety of complementary sites. Target-specific oligonucleotide primers typically selectively prime the mRNA of interest.
  • reverse transcription of the labeled-RNA molecule can occur by the addition of a reverse transcription primer.
  • the reverse transcription primer is an oligo(dT) primer, random hexanucleotide primer, or a target-specific oligonucleotide primer.
  • oligo(dT) primers are 12-18 nucleotides in length and bind to the endogenous poly(A)+ tail at the 3′ end of mammalian mRNA.
  • Random hexanucleotide primers can bind to mRNA at a variety of complementary sites.
  • Target-specific oligonucleotide primers typically selectively prime the mRNA of interest.
  • Reverse transcription can occur repeatedly to produce multiple labeled-cDNA molecules.
  • the methods disclosed herein can comprise conducting at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 reverse transcription reactions.
  • the method can comprise conducting at least about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 reverse transcription reactions.
  • One or more nucleic acid amplification reactions can be performed to create multiple copies of the labeled target nucleic acid molecules.
  • Amplification can be performed in a multiplexed manner, wherein multiple target nucleic acid sequences are amplified simultaneously.
  • the amplification reaction can be used to add sequencing adaptors to the nucleic acid molecules.
  • the amplification reactions can comprise amplifying at least a portion of a sample label, if present.
  • the amplification reactions can comprise amplifying at least a portion of the cellular and/or molecular label.
  • the amplification reactions can comprise amplifying at least a portion of a sample tag, a cell label, a spatial label, a molecular label, a target nucleic acid, or a combination thereof.
  • the amplification reactions can comprise amplifying 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 100%, or a range or a number between any two of these values, of the plurality of nucleic acids.
  • the method can further comprise conducting one or more cDNA synthesis reactions to produce one or more cDNA copies of target-barcode molecules comprising a sample label, a cell label, a spatial label, and/or a molecular label.
  • amplification can be performed using a polymerase chain reaction (PCR).
  • PCR can refer to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA.
  • PCR can encompass derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, digital PCR, and assembly PCR.
  • Amplification of the labeled nucleic acids can comprise non-PCR based methods.
  • non-PCR based methods include, but are not limited to, multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, rolling circle amplification, or circle-to-circle amplification.
  • MDA multiple displacement amplification
  • TMA transcription-mediated amplification
  • NASBA nucleic acid sequence-based amplification
  • SDA strand displacement amplification
  • real-time SDA rolling circle amplification
  • rolling circle amplification or circle-to-circle amplification.
  • Non-PCR-based amplification methods include multiple cycles of DNA-dependent RNA polymerase-driven RNA transcription amplification or RNA-directed DNA synthesis and transcription to amplify DNA or RNA targets, a ligase chain reaction (LCR), and a Q ⁇ replicase (Q ⁇ ) method, use of palindromic probes, strand displacement amplification, oligonucleotide-driven amplification using a restriction endonuclease, an amplification method in which a primer is hybridized to a nucleic acid sequence and the resulting duplex is cleaved prior to the extension reaction and amplification, strand displacement amplification using a nucleic acid polymerase lacking 5′ exonuclease activity, rolling circle amplification, and ramification extension amplification (RAM).
  • the amplification does not produce circularized transcripts.
  • the methods disclosed herein further comprise conducting a polymerase chain reaction on the labeled nucleic acid (e.g., labeled-RNA, labeled-DNA, labeled-cDNA) to produce a stochastically labeled-amplicon.
  • the labeled-amplicon can be double-stranded molecule.
  • the double-stranded molecule can comprise a double-stranded RNA molecule, a double-stranded DNA molecule, or a RNA molecule hybridized to a DNA molecule.
  • One or both of the strands of the double-stranded molecule can comprise a sample label, a spatial label, a cell label, and/or a molecular label.
  • the stochastically labeled-amplicon can be a single-stranded molecule.
  • the single-stranded molecule can comprise DNA, RNA, or a combination thereof.
  • the nucleic acids of the disclosure can comprise synthetic or altered nucleic acids.
  • Amplification can comprise use of one or more non-natural nucleotides.
  • Non-natural nucleotides can comprise photolabile or triggerable nucleotides.
  • Examples of non-natural nucleotides can include, but are not limited to, peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA).
  • PNA peptide nucleic acid
  • LNA morpholino and locked nucleic acid
  • GMA glycol nucleic acid
  • TAA threose nucleic acid
  • Non-natural nucleotides can be added to one or more cycles of an amplification reaction. The addition of the non-natural nucleotides can be used to identify products as specific cycles or time points in the amplification reaction.
  • Conducting the one or more amplification reactions can comprise the use of one or more primers.
  • the one or more primers can comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides.
  • the one or more primers can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides.
  • the one or more primers can comprise less than 12-15 nucleotides.
  • the one or more primers can anneal to at least a portion of the plurality of stochastically labeled targets.
  • the one or more primers can anneal to the 3′ end or 5′ end of the plurality of stochastically labeled targets.
  • the one or more primers can anneal to an internal region of the plurality of stochastically labeled targets.
  • the internal region can be at least about 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides from the 3′ ends the plurality of stochastically labeled targets.
  • the one or more primers can comprise a fixed panel of primers.
  • the one or more primers can comprise at least one or more custom primers.
  • the one or more primers can comprise at least one or more control primers.
  • the one or more primers can comprise at least one or more gene-specific primers.
  • the one or more primers can comprise a universal primer.
  • the universal primer can anneal to a universal primer binding site.
  • the one or more custom primers can anneal to a first sample label, a second sample label, a spatial label, a cell label, a molecular label, a target, or any combination thereof.
  • the one or more primers can comprise a universal primer and a custom primer.
  • the custom primer can be designed to amplify one or more targets.
  • the targets can comprise a subset of the total nucleic acids in one or more samples.
  • the targets can comprise a subset of the total stochastically labeled targets in one or more samples.
  • the one or more primers can comprise at least 96 or more custom primers.
  • the one or more primers can comprise at least 960 or more custom primers.
  • the one or more primers can comprise at least 9600 or more custom primers.
  • the one or more custom primers can anneal to two or more different labeled nucleic acids.
  • the two or more different labeled nucleic acids can correspond to one or more genes.
  • the first round PCR can amplify molecules attached to the bead using a gene specific primer and a primer against the universal Illumina sequencing primer 1 sequence.
  • the second round of PCR can amplify the first PCR products using a nested gene specific primer flanked by Illumina sequencing primer 2 sequence, and a primer against the universal Illumina sequencing primer 1 sequence.
  • the third round of PCR adds P5 and P7 and sample index to turn PCR products into an Illumina sequencing library. Sequencing using 150bp ⁇ 2 sequencing can reveal the cell label and molecular label on read 1, the gene on read 2, and the sample index on index 1 read.
  • nucleic acids can be removed from the substrate using chemical cleavage.
  • a chemical group or a modified base present in a nucleic acid can be used to facilitate its removal from a solid support.
  • an enzyme can be used to remove a nucleic acid from a substrate.
  • a nucleic acid can be removed from a substrate through a restriction endonucelase digestion.
  • treatment of a nucleic acid containing a dUTP or ddUTP with uracil-d-glycosylase (UDG) can be used to remove a nucleic acid from a substrate.
  • UDG uracil-d-glycosylase
  • a nucleic acid can be removed from a substrate using an enzyme that performs nucleotide excision, such as a base excision repair enzyme, such as an apurinic/apyrimidinic (AP) endonuclease.
  • a nucleic acid can be removed from a substrate using a photocleavable group and light.
  • a cleavable linker can be used to remove a nucleic acid from the substrate.
  • the cleavable linker can comprise at least one of biotin/avidin, biotin/streptavidin, biotin/neutravidin, Ig-protein A, a photo-labile linker, acid or base labile linker group, or an aptamer.
  • the molecules can hybridize to the probes and be reverse transcribed and/or amplified.
  • the nucleic acid after the nucleic acid has been synthesized (e.g., reverse transcribed), it can be amplified. Amplification can be performed in a multiplex manner, wherein multiple target nucleic acid sequences are amplified simultaneously. Amplification can add sequencing adaptors to the nucleic acid.
  • amplification can be performed on the substrate, for example, with bridge amplification.
  • cDNAs can be homopolymer tailed in order to generate a compatible end for bridge amplification using oligo(dT) probes on the substrate.
  • the primer that is complementary to the 3′ end of the template nucleic acid can be the first primer of each pair that is covalently attached to the solid particle.
  • the template molecule can be annealed to the first primer and the first primer is elongated in the forward direction by addition of nucleotides to form a duplex molecule consisting of the template molecule and a newly formed DNA strand that is complementary to the template.
  • the duplex molecule can be denatured, releasing the template molecule from the particle and leaving the complementary DNA strand attached to the particle through the first primer.
  • the complementary strand can hybridize to the second primer, which is complementary to a segment of the complementary strand at a location removed from the first primer. This hybridization can cause the complementary strand to form a bridge between the first and second primers secured to the first primer by a covalent bond and to the second primer by hybridization.
  • the second primer can be elongated in the reverse direction by the addition of nucleotides in the same reaction mixture, thereby converting the bridge to a double-stranded bridge.
  • the next cycle then begins, and the double-stranded bridge can be denatured to yield two single-stranded nucleic acid molecules, each having one end attached to the particle surface via the first and second primers, respectively, with the other end of each unattached.
  • each strand can hybridize to a further complementary primer, previously unused, on the same particle, to form new single-strand bridges.
  • the two previously unused primers that are now hybridized elongate to convert the two new bridges to double-strand bridges.
  • the amplification reactions can comprise amplifying at least, or at least about, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of the plurality of nucleic acids.
  • Amplification of the labeled nucleic acids can comprise PCR-based methods or non-PCR based methods.
  • Amplification of the labeled nucleic acids can comprise exponential amplification of the labeled nucleic acids.
  • Amplification of the labeled nucleic acids can comprise linear amplification of the labeled nucleic acids.
  • Amplification can be performed by polymerase chain reaction (PCR).
  • PCR can refer to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA.
  • PCR can encompass derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, digital PCR, suppression PCR, semi-suppressive PCR and assembly PCR.
  • amplification of the labeled nucleic acids comprises non-PCR based methods.
  • non-PCR based methods include, but are not limited to, multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, rolling circle amplification, or circle-to-circle amplification.
  • MDA multiple displacement amplification
  • TMA transcription-mediated amplification
  • NASBA nucleic acid sequence-based amplification
  • SDA strand displacement amplification
  • real-time SDA rolling circle amplification
  • rolling circle amplification or circle-to-circle amplification.
  • Non-PCR-based amplification methods include multiple cycles of DNA-dependent RNA polymerase-driven RNA transcription amplification or RNA-directed DNA synthesis and transcription to amplify DNA or RNA targets, a ligase chain reaction (LCR), a Q ⁇ replicase (Q ⁇ ), use of palindromic probes, strand displacement amplification, oligonucleotide-driven amplification using a restriction endonuclease, an amplification method in which a primer is hybridized to a nucleic acid sequence and the resulting duplex is cleaved prior to the extension reaction and amplification, strand displacement amplification using a nucleic acid polymerase lacking 5′ exonuclease activity, rolling circle amplification, and/or ramification extension amplification (RAM).
  • LCR ligase chain reaction
  • Q ⁇ Q ⁇ replicase
  • amplification method in which a primer is hybridized to a nucleic acid sequence and the resulting duplex is cle
  • the methods disclosed herein further comprise conducting a nested polymerase chain reaction on the amplified amplicon (e.g., target).
  • the amplicon can be double-stranded molecule.
  • the double-stranded molecule can comprise a double-stranded RNA molecule, a double-stranded DNA molecule, or a RNA molecule hybridized to a DNA molecule.
  • One or both of the strands of the double-stranded molecule can comprise a sample tag or molecular identifier label.
  • the amplicon can be a single-stranded molecule.
  • the single-stranded molecule can comprise DNA, RNA, or a combination thereof.
  • the nucleic acids of the present invention can comprise synthetic or altered nucleic acids.
  • the method comprises repeatedly amplifying the labeled nucleic acid to produce multiple amplicons.
  • the methods disclosed herein can comprise conducting at least, or at least about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amplification reactions.
  • the method comprises conducting at least, or at least about, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amplification reactions.
  • Amplification can further comprise adding one or more control nucleic acids to one or more samples comprising a plurality of nucleic acids.
  • Amplification can further comprise adding one or more control nucleic acids to a plurality of nucleic acids.
  • the control nucleic acids can comprise a control label.
  • Amplification can comprise use of one or more non-natural nucleotides.
  • Non-natural nucleotides can comprise photolabile and/or triggerable nucleotides.
  • Examples of non-natural nucleotides include, but are not limited to, peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA).
  • PNA peptide nucleic acid
  • LNA morpholino and locked nucleic acid
  • GMA glycol nucleic acid
  • TAA threose nucleic acid
  • Non-natural nucleotides can be added to one or more cycles of an amplification reaction. The addition of the non-natural nucleotides can be used to identify products as specific cycles or time points in the amplification reaction.
  • Conducting the one or more amplification reactions can comprise the use of one or more primers.
  • the one or more primers can comprise one or more oligonucleotides.
  • the one or more oligonucleotides can comprise at least about 7-9 nucleotides.
  • the one or more oligonucleotides can comprise less than 12-15 nucleotides.
  • the one or more primers can anneal to at least a portion of the plurality of labeled nucleic acids.
  • the one or more primers can anneal to the 3′ end and/or 5′ end of the plurality of labeled nucleic acids.
  • the one or more primers can anneal to an internal region of the plurality of labeled nucleic acids.
  • the internal region can be at least or at least about, 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides from the 3′ ends the plurality of labeled nucleic acids.
  • the one or more primers can comprise a fixed panel of primers.
  • the one or more primers can comprise at least one or more custom primers.
  • the one or more primers can comprise at least one or more control primers.
  • the one or more primers can comprise at least one or more housekeeping gene primers.
  • the one or more primers can comprise a universal primer.
  • the universal primer can anneal to a universal primer binding site.
  • the one or more custom primers can anneal to the first sample tag, the second sample tag, the molecular identifier label, the nucleic acid or a product thereof.
  • the one or more primers can comprise a universal primer and a custom primer.
  • the custom primer can be designed to amplify one or more target nucleic acids.
  • the target nucleic acids can comprise a subset of the total nucleic acids in one or more samples.
  • the primers are the probes attached to the array of the disclosure.
  • stochastically barcoding the plurality of targets in the sample further comprises generating an indexed library of the stochastically barcoded fragments.
  • the molecular labels of different stochastic barcodes can be different from one another.
  • Generating an indexed library of the stochastically barcoded targets includes generating a plurality of indexed polynucleotides from the plurality of targets in the sample.
  • the label region of the first indexed polynucleotide can differ from the label region of the second indexed polynucleotide by, by about, by at least, or by at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or a number or a range between any two of these values, nucleotides.
  • generating an indexed library of the stochastically barcoded targets includes contacting a plurality of targets, for example mRNA molecules, with a plurality of oligonucleotides including a poly(T) region and a label region; and conducting a first strand synthesis using a reverse transcriptase to produce single-strand labeled cDNA molecules each comprising a cDNA region and a label region, wherein the plurality of targets includes at least two mRNA molecules of different sequences and the plurality of oligonucleotides includes at least two oligonucleotides of different sequences.
  • Generating an indexed library of the stochastically barcoded targets can further comprise amplifying the single-strand labeled cDNA molecules to produce double-strand labeled cDNA molecules; and conducting nested PCR on the double-strand labeled cDNA molecules to produce labeled amplicons.
  • the method can include generating an adaptor-labeled amplicon.
  • Stochastic barcoding can use nucleic acid barcodes or tags to label individual nucleic acid (e.g., DNA or RNA) molecules. In some embodiments, it involves adding DNA barcodes or tags to cDNA molecules as they are generated from mRNA. Nested PCR can be performed to minimize PCR amplification bias. Adaptors can be added for sequencing using, for example, next generation sequencing (NGS). The sequencing results can be used to determine cell labels, molecular labels, and sequences of nucleotide fragments of the one or more copies of the targets, for example at block 232 of FIG. 2 .
  • NGS next generation sequencing
  • FIG. 3 is a schematic illustration showing a non-limiting exemplary process of generating an indexed library of the stochastically barcoded targets, for example mRNAs.
  • the reverse transcription process can encode each mRNA molecule with a unique molecular label, a cell label, and a universal PCR site.
  • RNA molecules 302 can be reverse transcribed to produce labeled cDNA molecules 304 , including a cDNA region 306 , by the stochastic hybridization of a set of molecular identifier labels 310 to the poly(A) tail region 308 of the RNA molecules 302 .
  • Each of the molecular identifier labels 310 can comprise a target-binding region, for example a poly(dT) region 312 , a label region 314 , and a universal PCR region 316 .
  • the cell label can include 3 to 20 nucleotides. In some embodiments, the molecular label can include 3 to 20 nucleotides. In some embodiments, each of the plurality of stochastic barcodes further comprises one or more of a universal label and a cell label, wherein universal labels are the same for the plurality of stochastic barcodes on the solid support and cell labels are the same for the plurality of stochastic barcodes on the solid support. In some embodiments, the universal label can include 3 to 20 nucleotides. In some embodiments, the cell label comprises 3 to 20 nucleotides.
  • the label region 314 can include a molecular label 318 and a cell label 320 .
  • the label region 314 can include one or more of a universal label, a dimension label, and a cell label.
  • the molecular label 318 can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
  • the cell label 320 can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
  • the universal label can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
  • Universal labels can be the same for the plurality of stochastic barcodes on the solid support and cell labels are the same for the plurality of stochastic barcodes on the solid support.
  • the dimension label can be, can be about, can be at least, or can be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
  • the label region 314 can comprise, comprise about, comprise at least, or comprise at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any of these values, different labels, such as a molecular label 318 and a cell label 320 .
  • Each label can be, can be about, can be at least, or can be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
  • a set of molecular identifier labels 310 can contain, contain about, contain at least, or can be at most, 10, 20, 40, 50, 70, 80, 90, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 20 , or a number or a range between any of these values, molecular identifier labels 310 .
  • the set of molecular identifier labels 310 can, for example, each contain a unique label region 314 .
  • the labeled cDNA molecules 304 can be purified to remove excess molecular identifier labels 310 . Purification can comprise Ampure bead purification.
  • products from the reverse transcription process in step 1 can be pooled into 1 tube and PCR amplified with a 1 st PCR primer pool and a 1 st universal PCR primer. Pooling is possible because of the unique label region 314 .
  • the labeled cDNA molecules 304 can be amplified to produce nested PCR labeled amplicons 322 .
  • Amplification can comprise multiplex PCR amplification.
  • Amplification can comprise a multiplex PCR amplification with 96 multiplex primers in a single reaction volume.
  • multiplex PCR amplification can utilize, utilize about, utilize at least, or utilize at most, 10, 20, 40, 50, 70, 80, 90, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 20 , or a number or a range between any of these values, multiplex primers in a single reaction volume.
  • Amplification can comprise 1 st PCR primer pool 324 of custom primers 326 A-C targeting specific genes and a universal primer 328 .
  • the custom primers 326 can hybridize to a region within the cDNA portion 306 ′ of the labeled cDNA molecule 304 .
  • the universal primer 328 can hybridize to the universal PCR region 316 of the labeled cDNA molecule 304 .
  • products from PCR amplification in step 2 can be amplified with a nested PCR primers pool and a 2 nd universal PCR primer.
  • Nested PCR can minimize PCR amplification bias.
  • the nested PCR labeled amplicons 322 can be further amplified by nested PCR.
  • the nested PCR can comprise multiplex PCR with nested PCR primers pool 330 of nested PCR primers 332 a - c and a 2 nd universal PCR primer 328 ′ in a single reaction volume.
  • the nested PCR primer pool 328 can contain, contain about, contain at least, or contain at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any of these values, different nested PCR primers 330 .
  • the nested PCR primers 332 can contain an adaptor 334 and hybridize to a region within the cDNA portion 306 ′′ of the labeled amplicon 322 .
  • the universal primer 328 ′ can contain an adaptor 336 and hybridize to the universal PCR region 316 of the labeled amplicon 322 .
  • step 3 produces adaptor-labeled amplicon 338 .
  • nested PCR primers 332 and the 2 nd universal PCR primer 328 ′ may not contain the adaptors 334 and 336 .
  • the adaptors 334 and 336 can instead be ligated to the products of nested PCR to produce adaptor-labeled amplicon 338 .
  • PCR products from step 3 can be PCR amplified for sequencing using library amplification primers.
  • the adaptors 334 and 336 can be used to conduct one or more additional assays on the adaptor-labeled amplicon 338 .
  • the adaptors 334 and 336 can be hybridized to primers 340 and 342 .
  • the one or more primers 340 and 342 can be PCR amplification primers.
  • the one or more primers 340 and 342 can be sequencing primers.
  • the one or more adaptors 334 and 336 can be used for further amplification of the adaptor-labeled amplicons 338 .
  • the one or more adaptors 334 and 336 can be used for sequencing the adaptor-labeled amplicon 338 .
  • the primer 342 can contain a plate index 344 so that amplicons generated using the same set of molecular identifier labels 318 can be sequenced in one sequencing reaction using next generation sequencing (NGS).
  • NGS next generation sequencing
  • stochastic barcodes not incorporated into cDNA molecules can be removed by, for example, Ampure bead purification.
  • the removal method for example Ampure bead purification, may not completely remove the stochastic barcodes that are not extended by reverse transcription to be incorporated into stochastically barcoded cDNA molecules.
  • stochastic barcodes that are not extended by reverse transcription to be incorporated into stochastically barcoded cDNA molecules may not be removed by Ampure bead purification.
  • These unremoved stochastic barcodes can, for example, result in amplification noises during amplification of cDNA molecules (e.g., in 228 of FIG. 2 ) for sequencing.
  • the stochastic barcodes between samples can be highly similar, for example the stochastic barcodes can be identical except for the sample labels and the molecular labels.
  • PCR cross over can occur because these unremoved stochastic barcodes can hybridize to other nucleic acid molecules from other samples, for example the stochastic barcode regions of stochastically barcoded mRNA molecules, during PCR and can result in amplification noises after sequencing (e.g., in 232 of FIG. 2 ).
  • the method comprises: determining a pre-correction number of a target; determining an amplification noise; and removing the amplification noise from the pre-correction number of the targets to generate the estimated number of the target.
  • the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined sample labels can be variants of the sample labels; amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein
  • FIG. 4 is a flowchart showing a non-limiting exemplary embodiment of removing amplification noise caused by PCR crossover.
  • the embodiment 400 starts at beginning block 404 .
  • a plurality of targets in each of one or more samples can be stochastically barcoded using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets.
  • stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets.
  • a stochastic barcode can comprise a molecular label and an identical sample label. The molecular labels of at least two stochastic barcodes can differ from one another by at least one nucleotide.
  • the stochastically barcoded targets can be optionally pooled, for example, into a tube to generate a pool of stochastically barcoded targets.
  • one or more defined barcoded primers can be contacted with each of the one or more samples. For example, if the stochastically barcoded targets have been pooled into a tube to generate a pool of stochastically barcoded target, then defined barcoded primers can be added to the pool of stochastically barcoded targets. As another example, if the stochastically barcoded targets have not been pooled into a tube, then defined barcoded primers can be added to one or more samples.
  • the defined barcoded primers added to different samples can be the same or can be different, for example, defined barcoded primers for different genes.
  • contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes.
  • Defined barcoded primers can be variants of the stochastic barcodes.
  • a defined barcoded primer can have a corresponding stochastic barcode, where the defined barcoded primer is a variant of the corresponding stochastic barcode.
  • the defined barcoded primer can have a different sequence in one or more regions as compared to the corresponding stochastic barcode.
  • a defined barcoded primer can comprise a defined sample label and a defined molecular label.
  • the defined sample label of a defined barcoded primer can be a variant of the sample label of a stochastic barcode (e.g., the sample label of the corresponding stochastic barcode).
  • the defined sample label differs from the sample label in one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides.
  • the defined sample label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the sample label can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the defined sample label and the sample label for example, a defined sample label of a defined barcoded primer and a sample label of the corresponding stochastic barcode, can have the same length or different length.
  • the defined sample label and the sample label can both be 8 nucleotides in length.
  • the sequence of the defined sample label and the sequence of the sample label can differ by one nucleotide.
  • the Hamming distance between the defined sample label and the sample label can be 2 or 4.
  • the defined molecular label of a defined barcoded primer can be a variant of the molecular label of a stochastic barcode (e.g., the molecular label of the corresponding stochastic barcode).
  • the sequence of the defined molecular label and the sequence of the molecular label differ by one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides.
  • the defined molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length.
  • the defined molecular label and the molecular label for example a defined molecular label of a defined barcoded primer and a molecular label of the corresponding stochastic barcode, can have the same length.
  • the defined molecular label and the molecular label can both be 8 nucleotides in length.
  • the defined molecular labels of different defined barcoded primers can be different from one another.
  • the molecular labels of different stochastic barcodes can be different from one another. Some molecular labels of the stochastic barcodes and some defined molecular labels of the defined barcoded primers can have the same sequence.
  • the one or more defined barcoded primers can comprise one or more types of defined barcoded primers. As disclosed herein, there can be different types of stochastic barcodes. In some embodiments, one type of defined barcoded primers can have a corresponding type of stochastic barcodes, where the one type of the defined barcoded primers is a variant of the corresponding type of stochastic barcodes. For example, one type of defined barcoded primers and the corresponding type of stochastic barcodes can both include poly(T) regions as their target binding region. Other types of defined barcoded primers and their corresponding types of stochastic barcodes can both include gene specific target binding regions.
  • one type of defined barcoded primers and the corresponding type of stochastic barcode can both include target binding regions for TCR alpha.
  • another type of defined barcoded primer and its corresponding type of stochastic barcodes can include target binding regions for TCR alpha.
  • the defined sample labels of one type of defined barcoded primers and the sample labels of the corresponding type of stochastic barcodes can have different sequences.
  • the defined sample labels of the same type of defined barcoded primers can have the same sequence.
  • the defined molecular labels of the same type of defined barcoded primers can differ from one another by at least one nucleotide.
  • the sample labels of different types of stochastic barcodes can have different sequences.
  • Some defined molecular labels of different types of defined barcoded primers can have the same sequence.
  • Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primers can be different.
  • the lengths of different types of defined barcoded primers can differ by, or by about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between any two of these values, nucleotides. In some embodiments, the lengths of different types of defined barcoded primers can differ by at least, or by at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
  • the defined sample labels of different types of defined barcoded primers can have different sequences. The sample label and the defined sample label can have the same length.
  • the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be more than 0. In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or a number or a range between any two of these values. In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.
  • the stochastic barcodes and the one or more types of defined barcoded primers can have the same length or different lengths.
  • the oligonucleotides comprising stochastic barcodes that are not incorporated into the stochastically barcoded targets, and the defined barcoded primers from each of the one or more samples can be removed.
  • the percentage of unincorporated stochastic barcodes not removed can vary. In some embodiments, the percentage of unincorporated stochastic barcodes not removed can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or a number or a range between any two of these values. In some embodiments, the percentage of unincorporated stochastic barcodes not removed can be at least, or at most, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
  • the percentage of the one or more defined barcoded primers not removed from each of the one or more samples and the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples can be within can be within 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, or a number or a range between any two of these values, of each other.
  • the stochastically barcoded targets and the one or more defined barcoded primers can be amplified to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers.
  • amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can be sequenced, by for example next generation sequencing (described in further details below).
  • a pre-correction number of each of the plurality of targets using the molecular label can be determined.
  • determining the pre-correction number of each of the plurality of targets using the molecular label comprises: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences.
  • Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences of the amplified stochastically barcoded targets.
  • the read length of a sequence can vary. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any two of these values, bases. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 bases.
  • an amplification noise can be determined.
  • the amplification noise can be determined by the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers.
  • determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers.
  • Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences of the amplified defined barcoded primers.
  • the read length of a sequence can vary. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any two of these values, bases. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 bases.
  • determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers.
  • Determining the amplification noise can comprise determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded can comprise determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
  • the amplification noise can comprise noise caused by PCR crossover.
  • the number of each of the plurality of targets can be estimated. Estimating the number of each of the plurality of targets can comprise: removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets.
  • the embodiment 400 ends at block 444 .
  • the embodiment 400 can be used for determining amplification noise.
  • stochastically barcoding a plurality of targets using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets can comprise reverse transcribing the plurality targets in each of one or more samples using oligonucleotides comprising reverse transcription primers to generate reverse transcribed targets.
  • the embodiment 400 can be used, for example, for determining the number of targets in microwells of a microwell array.
  • stochastically barcoding a plurality of targets using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets can comprise stochastically barcoding a plurality of targets in each of one or more samples in microwells of a microwell array using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets.
  • each stochastic barcode can comprise a molecular label and an identical sample label. The molecular labels of at least two stochastic barcodes can differ from one another by at least one nucleotide.
  • estimating the number of different stochastically barcoded targets can comprise determining the sequences of the labeled targets, the spatial label, the molecular label, the sample label, the cell label, or any product thereof (e.g. labeled-amplicons, or labeled-cDNA molecules).
  • An amplified target can be subjected to sequencing.
  • Determining the sequence of the stochastically barcoded target or any product thereof can comprise conducting a sequencing reaction to determine the sequence of at least a portion of a sample label, a spatial label, a cell label, a molecular label, at least a portion of the stochastically labeled target, a complement thereof, a reverse complement thereof, or any combination thereof.
  • Determination of the sequence of a stochastically barcoded target can be performed using variety of sequencing methods including, but not limited to, sequencing by hybridization (SBH), sequencing by ligation (SBL), quantitative incremental fluorescent nucleotide addition sequencing (QIFNAS), stepwise ligation and cleavage, fluorescence resonance energy transfer (FRET), molecular beacons, TaqMan reporter probe digestion, pyrosequencing, fluorescent in situ sequencing (FISSEQ), FISSEQ beads, wobble sequencing, multiplex sequencing, polymerized colony (POLONY) sequencing; nanogrid rolling circle sequencing (ROLONY), allele-specific oligo ligation assays (e.g., oligo ligation assay (OLA), single template molecule OLA using a ligated linear probe and a rolling circle amplification (RCA) readout, ligated padlock probes
  • SBH sequencing by hybridization
  • SBL sequencing by ligation
  • QIFNAS quantitative incremental fluorescent nucleotide addition sequencing
  • FRET fluor
  • determining the sequence of the stochastically barcoded target or any product thereof comprises paired-end sequencing, nanopore sequencing, high-throughput sequencing, shotgun sequencing, dye-terminator sequencing, multiple-primer DNA sequencing, primer walking, Sanger dideoxy sequencing, Maxim-Gilbert sequencing, pyrosequencing, true single molecule sequencing, or any combination thereof.
  • the sequence of the stochastically barcoded target or any product thereof can be determined by electron microscopy or a chemical-sensitive field effect transistor (chemFET) array.
  • chemFET chemical-sensitive field effect transistor
  • sequencing can comprise MiSeq sequencing. In some embodiment, sequencing can comprise HiSeq sequencing.
  • the stochastically labeled targets can comprise nucleic acids representing from about 0.01% of the genes of an organism's genome to about 100% of the genes of an organism's genome. For example, about 0.01% of the genes of an organism's genome to about 100% of the genes of an organism's genome can be sequenced using a target complimentary region comprising a plurality of multimers by capturing the genes containing a complimentary sequence from the sample.
  • the stochastically barcoded targets comprise nucleic acids representing from about 0.01% of the transcripts of an organism's transcriptome to about 100% of the transcripts of an organism's transcriptome. For example, about 0.501% of the transcripts of an organism's transcriptome to about 100% of the transcripts of an organism's transcriptome can be sequenced using a target complimentary region comprising a poly(T) tail by capturing the mRNAs from the sample.
  • Determining the sequences of the spatial labels and the molecular labels of the plurality of the stochastic barcodes can include sequencing 0.00001%, 0.0001%, 0.001%, 0.01%, 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, 100%, or a number or a range between any two of these values, of the plurality of stochastic barcodes.
  • Determining the sequences of the labels of the plurality of stochastic barcodes can include sequencing 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 15 , 10 19 , 10 20 , or a number or a range between any two of these values, of the plurality of stochastic barcodes.
  • Sequencing some or all of the plurality of stochastic barcodes can include generating sequences with read lengths of, of about, of at least, or of at most, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or a number or a range between any two of these values, of nucleotides or bases.
  • Sequencing can comprise sequencing at least or at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides or base pairs of the stochastically barcoded targets.
  • sequencing can comprise generating sequencing data with sequences with read lengths of 50, 75, or 100, or more nucleotides by performing polymerase chain reaction (PCR) amplification on the plurality of stochastically barcoded targets.
  • Sequencing can comprise sequencing at least or at least about 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more nucleotides or base pairs of the stochastically barcoded targets.
  • Sequencing can comprise sequencing at least or at least about 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 or more nucleotides or base pairs of the stochastically barcoded targets.
  • Sequencing can comprise at least about 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more sequencing reads per run. In some embodiments, sequencing comprises sequencing at least or at least about 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 or more sequencing reads per run. Sequencing can comprise less than or equal to about 1,600,000,000 sequencing reads per run. Sequencing can comprise less than or equal to about 200,000,000 reads per run.
  • the plurality of targets can be comprised in one or more samples.
  • a sample can comprise one or more cells, or nucleic acids from one or more cells.
  • a sample can be, for example, a single cell or nucleic acids from a single cell.
  • the one or more cells can be of one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
  • a sample for use in the method of the disclosure can comprise one or more cells.
  • a sample can refer to one or more cells.
  • the plurality of cells can include one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
  • the cells are cancer cells excised from a cancerous tissue, for example, breast cancer, lung cancer, colon cancer, prostate cancer, ovarian cancer, pancreatic cancer, brain cancer, melanoma and non-melanoma skin cancers, and the like.
  • the cells are derived from a cancer but collected from a bodily fluid (e.g. circulating tumor cells).
  • cancers can include, adenoma, adenocarcinoma, squamous cell carcinoma, basal cell carcinoma, small cell carcinoma, large cell undifferentiated carcinoma, chondrosarcoma, and fibrosarcoma.
  • the sample can include a tissue, a cell monolayer, fixed cells, a tissue section, or any combination thereof.
  • the sample can include a biological sample, a clinical sample, an environmental sample, a biological fluid, a tissue, or a cell from a subject.
  • the sample can be obtained from a human, a mammal, a dog, a rat, a mouse, a fish, a fly, a worm, a plant, a fungus, a bacterium, a virus, a vertebrate, or an invertebrate.
  • the cells are cells that have been infected with virus and contain viral oligonucleotides.
  • the viral infection can be caused by a virus such as single-stranded (+ strand or “sense”) DNA viruses (e.g. parvoviruses), or double-stranded RNA viruses (e.g. reoviruses).
  • the cells are bacteria. These can include either gram-positive or gram-negative bacteria.
  • the cells are fungi.
  • the cells are protozoans or other parasites.
  • the term “cell” can refer to one or more cells.
  • the cells are normal cells, for example, human cells in different stages of development, or human cells from different organs or tissue types.
  • the cells are non-human cells, for example, other types of mammalian cells (e.g. mouse, rat, pig, dog, cow, or horse).
  • the cells are other types of animal or plant cells.
  • the cells can be any prokaryotic or eukaryotic cells.
  • the cells are sorted prior to associating a cell with a bead.
  • the cells can be sorted by fluorescence-activated cell sorting or magnetic-activated cell sorting, or more generally by flow cytometry.
  • the cells can be filtered by size.
  • a retentate contains the cells to be associated with the bead.
  • the flow through contains the cells to be associated with the bead.
  • a sample can refer to a plurality of cells.
  • the sample can refer to a monolayer of cells.
  • the sample can refer to a thin section (e.g., tissue thin section).
  • the sample can refer to a solid or semi-solid collection of cells that can be place in one dimension on an array.
  • kits for determining the number of targets in one or more samples comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers can be variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
  • the microwell array substrate can be packaged within a flow cell that provides for convenient interfacing with the rest of the fluid handling system and facilitates the exchange of fluids, e.g. cell and solid support suspensions, lysis buffers, rinse buffers, etc., that are delivered to the microwell array and/or emulsion droplet.
  • Design features can include: (i) one or more inlet ports for introducing cell samples, solid support suspensions, or other assay reagents, (ii) one or more microwell array chambers designed to provide for uniform filling and efficient fluid-exchange while minimizing back eddies or dead zones, and (iii) one or more outlet ports for delivery of fluids to a sample collection point or a waste reservoir.
  • the design of the flow cell can include a plurality of microarray chambers that interface with a plurality of microwell arrays such that one or more different cell samples can be processed in parallel.
  • the design of the flow cell can further include features for creating uniform flow velocity profiles, i.e. “plug flow”, across the width of the array chamber to provide for more uniform delivery of cells and beads to the microwells, for example, by using a porous barrier located near the chamber inlet and upstream of the microwell array as a “flow diffuser”, or by dividing each array chamber into several subsections that collectively cover the same total array area, but through which the divided inlet fluid stream flows in parallel.
  • the flow cell can enclose or incorporate more than one microwell array substrate.
  • the integrated microwell array/flow cell assembly can constitute a fixed component of the system.
  • the microwell array/flow cell assembly can be removable from the instrument.
  • the dimensions of fluid channels and the array chamber(s) in flow cell designs will be optimized to (i) provide uniform delivery of cells and beads to the microwell array, and (ii) to minimize sample and reagent consumption.
  • the width of fluid channels will be between 50 um and 20 mm.
  • the width of fluid channels can be at least 50 um, at least 100 um, at least 200 um, at least 300 um, at least 400 um, at least 500 um, at least 750 um, at least 1 mm, at least 2.5 mm, at least 5 mm, at least 10 mm, at least 20 mm, at least 50 mm, at least 100 mm, or at least 150 mm.
  • the width of fluid channels can be at most 150 mm, at most 100 mm, at most 50 mm, at most 20 mm, at most 10 mm, at most 5 mm, at most 2.5 mm, at most 1 mm, at most 750 um, at most 500 um, at most 400 um, at most 300 um, at most 200 um, at most 100 um, or at most 50 um.
  • the width of fluid channels is about 2 mm.
  • the width of the fluid channels can fall within any range bounded by any of these values (e.g. from about 250 um to about 3 mm).
  • the depth of the fluid channels will be between 50 um and 2 mm. In other embodiments, the depth of fluid channels can be at least 50 um, at least 100 um, at least 200 um, at least 300 um, at least 400 um, at least 500 um, at least 750 um, at least 1 mm, at least 1.25 mm, at least 1.5 mm, at least 1.75 mm, or at least 2 mm. In yet other embodiments, the depth of fluid channels can at most 2 mm, at most 1.75 mm, at most 1.5 mm, at most 1.25 mm, at most 1 mm, at most 750 um, at most 500 um, at most 400 um, at most 300 um, at most 200 um, at most 100 um, or at most 50 um. In one embodiment, the depth of the fluid channels is about 1 mm. The depth of the fluid channels can fall within any range bounded by any of these values (e.g. from about 800 um to about 1 mm).
  • Flow cells can be fabricated using a variety of techniques and materials known to those of skill in the art.
  • the flow cell will be fabricated as a separate part and subsequently either mechanically clamped or permanently bonded to the microwell array substrate.
  • suitable fabrication techniques include conventional machining, CNC machining, injection molding, 3D printing, alignment and lamination of one or more layers of laser or die-cut polymer films, or any of a number of microfabrication techniques such as photolithography and wet chemical etching, dry etching, deep reactive ion etching, or laser micromachining.
  • microwell array substrate by clamping it against the microwell array substrate (with or without the use of a gasket), or it can be bonded directly to the microwell array substrate using any of a variety of techniques (depending on the choice of materials used) known to those of skill in the art, for example, through the use of anodic bonding, thermal bonding, or any of a variety of adhesives or adhesive films, including epoxy-based, acrylic-based, silicone-based, UV curable, polyurethane-based, or cyanoacrylate-based adhesives.
  • Flow cells can be fabricated using a variety of materials known to those of skill in the art. In general, the choice of material used will depend on the choice of fabrication technique used, and vice versa. Examples of suitable materials include, but are not limited to, silicon, fused-silica, glass, any of a variety of polymers, e.g. polydimethylsiloxane (PDMS; elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers (COL), polyethylene terephthalate (PET), epoxy resins, metals (e.g. aluminum, stainless steel, copper, nickel, chromium, and titanium), a non-stick material such as teflon (PTFE), or a combination of these materials.
  • PDMS polydimethylsiloxane
  • PMMA polymethylme
  • the microwell array with or without an attached flow cell, can be packaged within a consumable cartridge that interfaces with the instrument system.
  • Design features of cartridges can include (i) one or more inlet ports for creating fluid connections with the instrument or manually introducing cell samples, bead suspensions, or other assay reagents into the cartridge, (ii) one or more bypass channels, i.e.
  • the cartridge can be designed to process more than one sample in parallel.
  • the cartridge can further comprise one or more removable sample collection chamber(s) that are suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments.
  • the cartridge itself can be suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments.
  • the term “cartridge” as used in this disclosure can be meant to include any assembly of parts which contains the sample and beads during performance of the assay.
  • the cartridge can further comprise components that are designed to create physical or chemical barriers that prevent diffusion of (or increase path lengths and diffusion times for) large molecules in order to minimize cross-contamination between microwells.
  • barriers can include, but are not limited to, a pattern of serpentine channels used for delivery of cells and solid supports (e.g., beads) to the microwell array, a retractable platen or deformable membrane that is pressed into contact with the surface of the microwell array substrate during lysis or incubation steps, the use of larger beads, e.g.
  • the dimensions of fluid channels and the array chamber(s) in cartridge designs can be optimized to (i) provide uniform delivery of cells and beads to the microwell array, and (ii) to minimize sample and reagent consumption.
  • the width of fluid channels can be between 50 micrometers and 20 mm. In other embodiments, the width of fluid channels can be at least 50 micrometers, at least 100 micrometers, at least 200 micrometers, at least 300 micrometers, at least 400 micrometers, at least 500 micrometers, at least 750 micrometers, at least 1 mm, at least 2.5 mm, at least 5 mm, at least 10 mm, or at least 20 mm.
  • the width of fluid channels can at most 20 mm, at most 10 mm, at most 5 mm, at most 2.5 mm, at most 1 mm, at most 750 micrometers, at most 500 micrometers, at most 400 micrometers, at most 300 micrometers, at most 200 micrometers, at most 100 micrometers, or at most 50 micrometers.
  • the width of fluid channels can be about 2 mm.
  • the width of the fluid channels can fall within any range bounded by any of these values (e.g. from about 250 um to about 3 mm).
  • the fluid channels in the cartridge can have a depth.
  • the depth of the fluid channels in cartridge designs can be between 50 micrometers and 2 mm.
  • the depth of fluid channels can be at least 50 micrometers, at least 100 micrometers, at least 200 micrometers, at least 300 micrometers, at least 400 micrometers, at least 500 micrometers, at least 750 micrometers, at least 1 mm, at least 1.25 mm, at least 1.5 mm, at least 1.75 mm, or at least 2 mm.
  • the depth of fluid channels can at most 2 mm, at most 1.75 mm, at most 1.5 mm, at most 1.25 mm, at most 1 mm, at most 750 micrometers, at most 500 micrometers, at most 400 micrometers, at most 300 micrometers, at most 200 micrometers, at most 100 micrometers, or at most 50 micrometers.
  • the depth of the fluid channels can be about 1 mm.
  • the depth of the fluid channels can fall within any range bounded by any of these values (e.g. from about 800 micrometers to about 1 mm).
  • Cartridges can be fabricated using a variety of techniques and materials known to those of skill in the art. In general, the cartridges will be fabricated as a series of separate component parts ( FIGS. 5 A- 5 C ) and subsequently assembled using any of a number of mechanical assemblies or bonding techniques. Examples of suitable fabrication techniques include, but are not limited to, conventional machining, CNC machining, injection molding, thermoforming, and 3D printing.
  • cartridge components can be mechanically assembled using screws, clips, and the like, or permanently bonded using any of a variety of techniques (depending on the choice of materials used), for example, through the use of thermal bonding/welding or any of a variety of adhesives or adhesive films, including epoxy-based, acrylic-based, silicone-based, UV curable, polyurethane-based, or cyanoacrylate-based adhesives.
  • Cartridge components can be fabricated using any of a number of suitable materials, including but not limited to silicon, fused-silica, glass, any of a variety of polymers, e.g. polydimethylsiloxane (PDMS; elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers (COL), polyethylene terephthalate (PET), epoxy resins, non-stick materials such as teflon (PTFE), metals (e.g. aluminum, stainless steel, copper, nickel, chromium, and titanium), or any combination thereof.
  • PDMS polydimethylsiloxane
  • PMMA polymethylmethacrylate
  • PC polycarbonate
  • PP polypropylene
  • PE polyethylene
  • HDPE high density polyethylene
  • COP cyclic ole
  • the inlet and outlet features of the cartridge can be designed to provide convenient and leak-proof fluid connections with the instrument, or can serve as open reservoirs for manual pipetting of samples and reagents into or out of the cartridge.
  • Examples of convenient mechanical designs for the inlet and outlet port connectors can include, but are not limited to, threaded connectors, Luer lock connectors, Luer slip or “slip tip” connectors, press fit connectors, and the like.
  • the inlet and outlet ports of the cartridge can further comprise caps, spring-loaded covers or closures, or polymer membranes that can be opened or punctured when the cartridge is positioned in the instrument, and which serve to prevent contamination of internal cartridge surfaces during storage or which prevent fluids from spilling when the cartridge is removed from the instrument.
  • the one or more outlet ports of the cartridge can further comprise a removable sample collection chamber that is suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments.
  • the cartridge can include integrated miniature pumps or other fluid actuation mechanisms for control of fluid flow through the device.
  • suitable miniature pumps or fluid actuation mechanisms can include, but are not limited to, electromechanically- or pneumatically-actuated miniature syringe or plunger mechanisms, membrane diaphragm pumps actuated pneumatically or by an external piston, pneumatically-actuated reagent pouches or bladders, or electro-osmotic pumps.
  • the cartridge can include miniature valves for compartmentalizing pre-loaded reagents or controlling fluid flow through the device.
  • suitable miniature valves can include, but are not limited to, one-shot “valves” fabricated using wax or polymer plugs that can be melted or dissolved, or polymer membranes that can be punctured; pinch valves constructed using a deformable membrane and pneumatic, magnetic, electromagnetic, or electromechanical (solenoid) actuation, one-way valves constructed using deformable membrane flaps, and miniature gate valves.
  • the cartridge can include vents for providing an escape path for trapped air. Vents can be constructed according to a variety of techniques, for example, using a porous plug of polydimethylsiloxane (PDMS) or other hydrophobic material that allows for capillary wicking of air but blocks penetration by water.
  • PDMS polydimethylsiloxane
  • the mechanical interface features of the cartridge can provide for easily removable but highly precise and repeatable positioning of the cartridge relative to the instrument system.
  • Suitable mechanical interface features can include, but are not limited to, alignment pins, alignment guides, mechanical stops, and the like.
  • the mechanical design features can include relief features for bringing external apparatus, e.g. magnets or optical components, into close proximity with the microwell array chamber ( FIG. 5 B ).
  • the cartridge can also include temperature control components or thermal interface features for mating to external temperature control modules.
  • suitable temperature control elements can include, but are not limited to, resistive heating elements, miniature infrared-emitting light sources, Peltier heating or cooling devices, heat sinks, thermistors, thermocouples, and the like.
  • Thermal interface features can be fabricated from materials that are good thermal conductors (e.g. copper, gold, silver, etc.) and can comprise one or more flat surfaces capable of making good thermal contact with external heating blocks or cooling blocks.
  • the cartridge can include optical interface features for use in optical imaging or spectroscopic interrogation of the microwell array.
  • the cartridge can include an optically transparent window, e.g. the microwell substrate itself or the side of the flow cell or microarray chamber that is opposite the microwell array, fabricated from a material that meets the spectral requirements for the imaging or spectroscopic technique used to probe the microwell array.
  • suitable optical window materials can include, but are not limited to, glass, fused-silica, polymethylmethacrylate (PMMA), polycarbonate (PC), cyclic olefin polymers (COP), or cyclic olefin copolymers (COL).
  • This example demonstrates removing amplification noises. After determining the amplification noises, the amplification noises were subtracted from the pre-correction numbers of targets in samples to generate the estimated numbers of targets.
  • RNA samples Single cells were deposited into BD PreciseTM 96-well plates that did not include defined barcoded primers (DBPs). Each well contained stochastic barcodes with different molecular labels and the same sample label to identify the sample origins.
  • the stochastic barcodes were used as reverse transcription (RT) primers for generating complementary deoxyribonucleic acid (cDNA).
  • RT reverse transcription
  • cDNA complementary deoxyribonucleic acid
  • the reaction volume per well during reverse transcription was 10 ⁇ L.
  • concentration of the defined barcoded primers during reverse transcription was 0.2 ⁇ M.
  • cDNAs from each well were pooled together into a single tube. Only about 8 ⁇ L of reaction mixture was recovered from the 10 ⁇ L reaction volume. After pooling, 8 ⁇ L of a defined barcoded primer mixture, including 4 DBPs at 0.2 uM each, was added into the pooled tube to create a combined reaction mixture. Primers were removed from the combined reaction mixture using Ampure XP beads (Beckman Coulter Inc. (Brea, Calif.)) for subsequent library preparation steps.
  • Table 1 shows experimental data of the sequencing readouts derived from 3 different types of defined barcoded that were mixed together: 1) oligo(dT) primers; 2) TRAC primers for T Cell Receptor Alpha C Region; and 3) TRBC primers for T Cell Receptor Beta C Region.
  • Table 2 shows the 3 different types of defined barcoded primers, each with 4 different defined barcoded primers.
  • the defined sample labels bolded in Table 2, were used to identify the amplification noises from DBP crossover.
  • the defined molecular labels are underlined.
  • the oligo(dT) primer captured poly(A) RNA transcripts, and TRAC and TRBC captured only the T Cell Receptor genes.
  • TRAC and TRBC captured only the T Cell Receptor genes.
  • For the oligo(dT)-primed cDNAs approximately 100 genes were amplified into the final library.
  • RT-primer derived read and each non-RT-primer derived read the number of molecular labels within each read was determined.
  • X01-X04 show the 4 defined barcoded primers used, and A01-A12 show to actual wells with samples.
  • FIGS. 6 A-D show bar charts of molecular label counts vs. wells for GAPDH and CD3D before and after correction for PCR amplification noises.
  • FIGS. 6 A-B show bar charts of molecular label counts vs. wells for GAPDH before ( FIG. 6 A ) and after correction ( FIG. 6 B ) for PCR amplification noises.
  • FIGS. 6 C-D show bar charts of molecular label counts vs. wells for CD3D before ( FIG. 6 C ) and after correction ( FIG. 6 D ) for PCR amplification noises.
  • This example demonstrates that amplification noises during library preparation can be determined using defined barcoded primers.
  • the experimental protocol used in this example was similar to that used in Example 1. Briefly, single cells were deposited into some wells of BD PreciseTM TCR 96-well plates with each well containing stochastic barcodes with different molecular labels and the same sample label to identify the sample origins. Wells without cells were no-template controls (NTCs). The stochastic barcodes were used as reverse transcription (RT) primers for generating complementary deoxyribonucleic acid (cDNA). After reverse transcription, cDNAs from each well were pooled together into a single tube. After pooling, DBPs shown in Table 2 were added into the pooled tube to create a combined reaction mixture. Primers were removed from the combined reaction mixture using Ampure XP beads (Beckman Coulter Inc. (Brea, Calif.)) for subsequent library preparation steps.
  • RT reverse transcription
  • cDNAs from each well were pooled together into a single tube. After pooling, DBPs shown in Table 2 were added into the pooled tube to
  • FIG. 7 contains non-limiting exemplary plots of molecular label counts vs. the number of reads per molecular label (ML), showing that the amplification noises determined using defined barcoded primers (DBPs) were similar to the noise levels determined using no-template controls (NTCs).
  • FIG. 7 panels (a)-(b) show that the amplification noises determined using DBPs mimicking T-cell receptor (TCR) alpha (86 and 46 respectively for two samples) were similar to the noises determined using NTCs (97 and 36 respectively for the two samples).
  • FIG. 7 panels (c)-(d) show that the amplification noises determined using DBPs mimicking TCR beta (74 and 64 respectively for two samples) were similar to the noises determined using NTCs (86 and 37 respectively for the two samples).
  • amplification noises caused by during library preparation can be efficiently, easily, and accurately determined using defined barcoded primers.
  • the amplification noises determined can in turn be used to filter numbers of targets to generate estimated numbers of targets.
  • a range includes each individual member.
  • a group having 1-3 articles refers to groups having 1, 2, or 3 articles.
  • a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed herein are methods and systems for correcting errors in sample amplification, including the errors occurred in determining the number of targets in samples. In some embodiments, the method comprises: stochastically barcoding a plurality of targets in the samples using oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets; contacting one or more defined barcoded primers with each of the one or more samples; and determining an amplification noise.

Description

RELATED APPLICATION
The present application is a continuation of U.S. patent application Ser. No. 15/608,780, filed on May 30, 2017, now U.S. Pat. No. 10,202,641, which claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62/343,689, filed on May 31, 2016. The content of these related applications is incorporated herein by reference in its entirety.
REFERENCE TO SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled Sequence_Listing_BDCRI_018C1.txt, created Nov. 27, 2018, which is 4.12 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
BACKGROUND Field
The present disclosure relates generally to the field of molecular biology and more particularly error correction in amplification of samples with stochastically barcoded targets.
Description of the Related Art
Methods and techniques such as stochastic barcoding are useful for cell analysis, in particular deciphering gene expression profiles to determine the states of cells using, for example, reverse transcription, polymerase chain reaction (PCR) amplification, and next generation sequencing (NGS). However, these methods and techniques can introduce errors caused by, for example, PCR crossover that may result in over-estimated molecular counts.
Thus, there is a need for methods and techniques capable of correcting errors caused by, for example, PCR crossover in order to attain accurate molecular counts estimated using stochastic barcoding.
SUMMARY
Disclosed herein are methods for determining the number of targets in one or more samples. In some embodiments, the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined sample labels are variants of the sample labels; amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein estimating the number of each of the plurality of targets comprises: determining a pre-correction number of each of the plurality of targets using the molecular label; determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets. The method can be multiplexed.
In some embodiments, contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes. The defined molecular label can be 5-20 nucleotides in length. The defined molecular label and the molecular label can have the same length. The molecular label can comprise 5-20 nucleotides. Some of the molecular labels of the stochastic barcodes and some of the defined molecular labels of the one or more defined barcoded primers can have the same sequence. The molecular labels of different stochastic barcodes can be different from one another. The defined sample label can be 5-20 nucleotides in length.
In some embodiments, the one or more defined barcoded primers can comprise one or more types of defined barcoded primers. The defined molecular labels of one type of defined barcoded primers can differ from one another by at least one nucleotide. Some defined molecular labels of different types of defined barcoded primers can have the same sequence. Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primers can differ by at most 10 nucleotides. The defined sample labels of different types of defined barcoded primers can have different sequences. The sample label and the defined sample label can have the same length.
In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 2 or 4. The stochastic barcodes and the one or more types of defined barcoded primers can have the same length or different lengths.
In some embodiments, the method further comprise: removing at least 50% of the oligonucleotides comprising stochastic barcodes not incorporated into the stochastically barcoded targets and the one or more defined barcoded primers from each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the stochastic barcodes may not be removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
In some embodiments, amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
In some embodiments, determining the pre-correction number of each of the plurality of targets using the molecular label comprises: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences. Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences each with a read length of 100 or more bases.
In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers. Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
In some embodiments, determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers. Determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded can comprise determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
In some embodiments, determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers. The amplification noise can comprise noise caused by PCR crossover. In some embodiments, the method can comprise pooling the stochastically barcoded targets to generate a pool of stochastically barcoded targets.
In some embodiments, stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets.
In some embodiments, stochastically barcoding the plurality of targets can be performed with a solid support comprising the plurality of oligonucleotides comprising the stochastic barcodes. The solid support can comprise a plurality of synthetic particles associated with the plurality of oligonucleotides comprising the stochastic barcodes. The synthetic particles can be beads. The beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof. The solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
In some embodiments, the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell. In some embodiments, the method can comprise lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof. The cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof. The plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
Disclosed herein are methods for determining amplification noise. In some embodiments, the method comprise: reverse transcribing a plurality targets in each of one or more samples using oligonucleotides comprising reverse transcription primers to generate reverse transcribed targets; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined molecular label; amplifying the reverse transcribed targets and the one or more defined barcoded primers to generate a plurality of amplified reverse transcribed targets and a plurality of amplified defined barcoded primers; and determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of defined barcoded primers. The method can be multiplexed.
In some embodiments, for each sample, each oligonucleotide comprises a stochastic barcode, wherein the stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two plurality of stochastic barcodes differ from one another by at least one nucleotide, wherein each of the one or more defined barcoded primers comprises a defined sample label, wherein the defined sample labels are variants of the sample label, and wherein the Hamming distance between the sample labels of stochastic barcodes and the defined sample labels of the defined barcoded primers is at least 2.
In some embodiments, contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the oligonucleotides comprising the reverse transcription primers. The defined molecular label can be 5-20 nucleotides in length. The defined molecular label and the molecular label can have the same length. Some of the molecular labels of the stochastic barcodes and some of the defined molecular labels of the one or more defined barcoded primers can have the same sequence. The molecular label can comprise 5-20 nucleotides. The molecular labels of different reverse stochastic barcodes can be different from one another. The defined sample label can be 5-20 nucleotides in length.
In some embodiments, the one or more defined barcoded primers comprise one or more types of defined barcoded primers. The defined molecular labels of one type of defined barcoded primers differ from one another by at least one nucleotide. Some defined molecular labels of different types of defined barcoded primers can have the same sequence. Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primer can differ by at most 10 nucleotides. The sample labels of different types of defined barcoded primer can have different sequences. The sample label and the defined sample label can have the same length.
In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 4. The stochastic barcodes and the one or more types of defined barcoded primers have the same length. The stochastic barcodes and the one or more types of defined barcoded primers can have different lengths.
In some embodiments, the method comprises removing at least 50% of the oligonucleotides comprising the reverse transcription primers not incorporated into the reverse transcribed targets and the one or more defined barcoded primers each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the reverse transcription primers may not be removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the oligonucleotides comprising the reverse transcription primers not removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the oligonucleotides comprising the reverse transcription primers not removed from each of the one or more samples.
In some embodiments, amplifying the reverse transcribed targets and the one or more defined barcoded primers to generate the plurality of amplified reverse transcribed targets and the plurality of amplified defined barcoded primers comprises amplifying the reverse transcribed targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences for each type amplified defined barcoded primers. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the amplified defined barcoded primers in the plurality of amplified defined barcoded primers. Sequencing some or all of the amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified reverse transcribed targets comprises determining the number of defined molecular labels in the plurality of amplified reverse transcribed targets with different sequences for each type of amplified defined barcoded primers. Determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers can comprise determining the average number of the molecular labels with different sequences for different types of amplified defined barcoded primers.
In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises determining the maximum number of the molecular labels with different sequences for different types of amplified defined barcoded primers. The amplification noise can comprise noise caused by PCR crossover. In some embodiments, the method comprises pooling the reverse transcribed targets to generate a pool of reverse transcribed targets.
In some embodiments, the method comprises estimating the number of each of the plurality of targets. Estimating the number of each of the plurality of targets can comprise: determining sequences of molecular labels of the amplified reverse transcribed targets; and counting the number of the molecular labels with different sequences. Estimating the number of each of the plurality of targets can comprise: determining a pre-correction number of each of the targets using the molecular label; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the targets.
In some embodiments, reverse transcribing the plurality of targets using oligonucleotides comprising reverse transcription primers comprises hybridizing the oligonucleotides comprising the reverse transcription primers with the plurality of targets to generate the reverse transcribed targets.
In some embodiments reverse transcribing the plurality of targets using the reverse transcription primers can be performed with a solid support comprising the oligonucleotides comprising the reverse transcription primers. The solid support can comprise a plurality of synthetic particles associated with the oligonucleotides comprising the reverse transcription primers. The synthetic particles can be beads. The beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof. The solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
In some embodiments, the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell. In some embodiments, the method comprises lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof. The cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof. The plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
Disclosed herein are methods for determining the number of targets in microwells of a microwell array. In some embodiments, the method comprises: stochastically barcoding a plurality of targets in each of one or more samples in microwells of a microwell array using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each well, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; pooling the stochastically barcoded targets from the microwells of the microwell array to generate a pool of stochastically barcoded targets; contacting defined barcoded primers of one or more types of defined barcoded primers with each of the one or more samples, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers of the same type of defined barcoded primers have the same sequence, wherein the defined sample labels of different types of defined barcoded primers have different sequences, wherein the sample labels of the stochastic barcodes and the defined sample labels are variants of the sample label, and wherein the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers is at least 2; amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein estimating the number of each of the plurality of targets comprises: determining a pre-correction number of each of the plurality of targets using the molecular label; determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets.
In some embodiments, contacting the defined barcoded primers with each of the one or more samples can comprise introducing the defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes. The defined molecular label can be 5-20 nucleotides in length. The defined molecular label and the molecular label can have the same length. The molecular labels of some of the stochastic barcodes and the defined molecular labels of some of the defined barcoded primers can have the same sequence. The molecular label can comprise 5-20 nucleotides. The defined sample label can be 5-20 nucleotides in length. The defined molecular labels of some defined barcoded primers of different types of defined barcoded primers can have the same sequence. The defined barcoded primers of different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primers can differ by at most 10 nucleotides. The sample label and the defined sample label can have the same length.
In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least 4. The stochastic barcodes and the defined barcoded primers can have the same length. The stochastic barcodes and some of the defined barcoded primers can have different lengths.
In some embodiments, the method comprises removing at least 50% of the oligonucleotides comprising stochastic barcodes not incorporated into the stochastically barcoded targets and the one or more types of defined barcoded primers from each of the one or more samples. Less than 10% of the unincorporated oligonucleotides comprising the stochastic barcodes may not be removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples. The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be within 10% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples.
In some embodiments, amplifying the stochastically barcoded targets and the one or more types of defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the one or more defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more types defined barcoded primers by polymerase chain reaction (PCR). Determining the pre-correction number of each of the plurality of targets using the molecular label can comprise: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences. Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences each with a read length of 100 or more base.
In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers. Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences each with a read length of 100 or more bases.
In some embodiments, estimating the amplification noise can comprise determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers. Estimating the amplification noise can comprise determining the number of defined molecular labels with different sequences in the amplified defined barcoded primers comprises determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers. Estimating the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers. In some embodiments, the amplification noise comprises noise caused by PCR crossover. In some embodiments, the method comprises pooling the stochastically barcoded targets to generate a pool of stochastically barcoded targets.
In some embodiments, stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets. Stochastically barcoding the plurality of targets in each of one or more samples in the microwells of the microwell array can be performed with a solid support comprising the plurality of oligonucleotides comprising the stochastic barcodes. The solid support can comprise a plurality of synthetic particles associated with the oligonucleotides comprising the reverse transcription primers. The synthetic particles can be beads. The beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof. The solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
In some embodiments, the one or more samples comprise cells. At least one of the one or more samples can comprise a single cell. In some embodiments, the method comprises lysing the cells. Lysing the cells can comprise heating the one or more samples, contacting the one or more samples with a detergent, changing the pH of the one or more samples, or any combination thereof. The cells can comprise one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof. The plurality of targets can comprise ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, and any combination thereof.
Disclosed herein are kits for determining the number of targets in one or more samples. In some embodiments, a kit comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers are variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
In some embodiments, the defined sample label can be 5-20 nucleotides in length and the defined molecular label can be 5-20 nucleotides in length. The defined molecular label and the molecular label have the same length. In some embodiments, different types of defined barcoded primers have the same length. The lengths of different types of defined barcoded primers can differ by at most 10 nucleotides. The sample label and the defined sample label can have the same length.
In some embodiments, the Hamming distance between the sample label and the defined sample label can be at least 2 or 4. The stochastic barcodes and the defined barcoded primers can have the same length. The stochastic barcodes and the defined barcoded primers can have different lengths.
In some embodiments, the plurality of oligonucleotides comprising the stochastic barcodes can be associated with a solid support. The solid support can comprise a plurality of synthetic particles associated with the plurality of oligonucleotides comprising stochastic barcodes. The plurality of synthetic particles can be beads. The beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof. The synthetic particles can be magnetic beads. The solid support can comprise a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof.
In some embodiments, the kit comprises a buffer. The kit can comprise a cartridge. The solid support can be pre-loaded on a substrate. The kit can comprise one or more reagents for a reverse transcription reaction. The kit can comprise one or more reagents for an amplification reaction.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates a non-limiting exemplary stochastic barcode.
FIG. 2 shows a non-limiting exemplary workflow of stochastic barcoding and digital counting.
FIG. 3 is a schematic illustration showing a non-limiting exemplary process for generating an indexed library of the stochastically barcoded targets from a plurality of targets.
FIG. 4 is a flowchart showing a non-limiting exemplary embodiment of removing amplification noises caused by PCR crossover.
FIGS. 5A-5C depict a non-limiting exemplary cartridge for use in the methods of the disclosure.
FIGS. 6A-6D show bar charts of molecular label counts vs. wells for GAPDH and CD3D before and after correction for PCR amplification noises.
FIG. 7 panels (a)-(d) are non-limiting exemplary plots of molecular label counts vs. the number of reads per molecular label (ML), showing that the amplification noises determined using defined barcoded primers (DBPs) were similar to the noise levels determined using no-template controls (NTCs).
DETAILED DESCRIPTION
In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein and made part of the disclosure herein.
All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.
Quantifying small numbers of nucleic acids, for example messenger ribonucleic acid (mRNA) molecules, is clinically important for determining, for example, the genes that are expressed in a cell at different stages of development or under different environmental conditions. However, it can also be very challenging to determine the absolute number of nucleic acid molecules (e.g., mRNA molecules), especially when the number of molecules is very small. Stochastic barcoding with, for example, the Precise™ assay (Cellular Research, Inc. (Palo Alto, Calif.)) can be used to determine the number of molecules, for example mRNA molecules, in a cell.
However, the number of molecules determined by stochastic barcoding can include PCR amplification noises. PCR amplification noises can be caused by stochastic barcodes still present during PCR amplification after barcode removal with Ampure beads. To reduce PCR amplification noises, rigorous barcode removal can be performed prior to PCR amplification. However, such rigorous barcode removal may also wash away many of the stochastically barcoded molecules giving rise to sequencing “signal.” The methods and systems disclosed herein can preserve the sequencing “signal” while eliminating PCR amplification noises to provide more accurate determinations of, for example, gene expression profiles.
Methods and systems for determining the number of targets in one or more samples are disclosed herein. In some embodiments, the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples.
Defined barcoded primers can be variants of the stochastic barcodes. For example, a defined barcoded primer can have a corresponding stochastic barcode, where the defined barcoded primer is a variant of the corresponding stochastic barcode. The defined barcoded primer can have a different sequence in one or more regions as compared to the corresponding stochastic barcode. For example, a defined barcoded primer can comprise a defined sample label and a defined molecular label.
In some embodiments, the defined sample label of a defined barcoded primer can be a variant of the sample label of a stochastic barcode (e.g., the sample label of the corresponding stochastic barcode). For example, the defined sample label differs from the sample label in one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides. The defined sample label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The sample label can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The defined sample label and the sample label, for example, a defined sample label of a defined barcoded primer and a sample label of the corresponding stochastic barcode, can have the same length or different length. For example, the defined sample label and the sample label can both be 8 nucleotides in length. In some embodiments, the sequence of the defined sample label and the sequence of the sample label can differ by one nucleotide. In some embodiments, the Hamming distance between the defined sample label and the sample label can be 2 or 4.
In some embodiments, the defined molecular label of a defined barcoded primer can be a variant of the molecular label of a stochastic barcode (e.g., the molecular label of the corresponding stochastic barcode). For example, the sequence of the defined molecular label and the sequence of the molecular label differ by one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides. The defined molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The defined molecular label and the molecular label, for example a defined molecular label of a defined barcoded primer and a molecular label of the corresponding stochastic barcode, can have the same length. For example, the defined molecular label and the molecular label can both be 8 nucleotides in length. The defined molecular labels of different defined barcoded primers can be different from one another. The molecular labels of different stochastic barcodes can be different from one another. Some molecular labels of the stochastic barcodes and some defined molecular labels of the defined barcoded primers can have the same sequence.
In some embodiments, the method comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein estimating the number of each of the plurality of targets comprises: determining a pre-correction number of each of the plurality of targets using the molecular label; determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets. The methods can be multiplexed.
Kits for determining the number of targets in one or more samples are also disclosed herein. In some embodiments, the kit comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers are variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
Definitions
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. See, e.g. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989). For purposes of the present disclosure, the following terms are defined below.
As used herein, the term “adaptor” can mean a sequence to facilitate amplification or sequencing of associated nucleic acids. The associated nucleic acids can comprise target nucleic acids. The associated nucleic acids can comprise one or more of spatial labels, target labels, sample labels, indexing label, barcodes, stochastic barcodes, or molecular labels. The adapters can be linear. The adaptors can be pre-adenylated adapters. The adaptors can be double- or single-stranded. One or more adaptor can be located on the 5′ or 3′ end of a nucleic acid. When the adaptors comprise known sequences on the 5′ and 3′ ends, the known sequences can be the same or different sequences. An adaptor located on the 5′ and/or 3′ ends of a polynucleotide can be capable of hybridizing to one or more oligonucleotides immobilized on a surface. An adapter can, in some embodiments, comprise a universal sequence. A universal sequence can be a region of nucleotide sequence that is common to two or more nucleic acid molecules. The two or more nucleic acid molecules can also have regions of different sequence. Thus, for example, the 5′ adapters can comprise identical and/or universal nucleic acid sequences and the 3′ adapters can comprise identical and/or universal sequences. A universal sequence that may be present in different members of a plurality of nucleic acid molecules can allow the replication or amplification of multiple different sequences using a single universal primer that is complementary to the universal sequence. Similarly, at least one, two (e.g., a pair) or more universal sequences that may be present in different members of a collection of nucleic acid molecules can allow the replication or amplification of multiple different sequences using at least one, two (e.g., a pair) or more single universal primers that are complementary to the universal sequences. Thus, a universal primer includes a sequence that can hybridize to such a universal sequence. The target nucleic acid sequence-bearing molecules may be modified to attach universal adapters (e.g., non-target nucleic acid sequences) to one or both ends of the different target nucleic acid sequences. The one or more universal primers attached to the target nucleic acid can provide sites for hybridization of universal primers. The one or more universal primers attached to the target nucleic acid can be the same or different from each other.
As used herein the term “associated” or “associated with” can mean that two or more species are identifiable as being co-located at a point in time. An association can mean that two or more species are or were within a similar container. An association can be an informatics association, where for example digital information regarding two or more species is stored and can be used to determine that one or more of the species were co-located at a point in time. An association can also be a physical association. In some embodiments, two or more associated species are “tethered”, “attached”, or “immobilized” to one another or to a common solid or semisolid surface. An association may refer to covalent or non-covalent means for attaching labels to solid or semi-solid supports such as beads. An association may be a covalent bond between a target and a label.
As used herein, the term “complementary” can refer to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding with a nucleotide of another nucleic acid, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be “partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single-stranded molecules. A first nucleotide sequence can be said to be the “complement” of a second sequence if the first nucleotide sequence is complementary to the second nucleotide sequence. A first nucleotide sequence can be said to be the “reverse complement” of a second sequence, if the first nucleotide sequence is complementary to a sequence that is the reverse (i.e., the order of the nucleotides is reversed) of the second sequence. As used herein, the terms “complement”, “complementary”, and “reverse complement” can be used interchangeably. It is understood from the disclosure that if a molecule can hybridize to another molecule it may be the complement of the molecule that is hybridizing.
As used herein, the term “digital counting” can refer to a method for estimating a number of target molecules in a sample. Digital counting can include the step of determining a number of unique labels that have been associated with targets in a sample. This stochastic methodology transforms the problem of counting molecules from one of locating and identifying identical molecules to a series of yes/no digital questions regarding detection of a set of predefined labels.
As used herein, the term “label” or “labels” can refer to nucleic acid codes associated with a target within a sample. A label can be, for example, a nucleic acid label. A label can be an entirely or partially amplifiable label. A label can be entirely or partially sequencable label. A label can be a portion of a native nucleic acid that is identifiable as distinct. A label can be a known sequence. A label can comprise a junction of nucleic acid sequences, for example a junction of a native and non-native sequence. As used herein, the term “label” can be used interchangeably with the terms, “index”, “tag,” or “label-tag.” Labels can convey information. For example, in various embodiments, labels can be used to determine an identity of a sample, a source of a sample, an identity of a cell, and/or a target.
As used herein, the term “non-depleting reservoirs” can refer to a pool of stochastic barcodes made up of many different labels. A non-depleting reservoir can comprise large numbers of different stochastic barcodes such that when the non-depleting reservoir is associated with a pool of targets each target is likely to be associated with a unique stochastic barcode. The uniqueness of each labeled target molecule can be determined by the statistics of random choice, and depends on the number of copies of identical target molecules in the collection compared to the diversity of labels. The size of the resulting set of labeled target molecules can be determined by the stochastic nature of the barcoding process, and analysis of the number of stochastic barcodes detected then allows calculation of the number of target molecules present in the original collection or sample. When the ratio of the number of copies of a target molecule present to the number of unique stochastic barcodes is low, the labeled target molecules are highly unique (i.e. there is a very low probability that more than one target molecule will have been labeled with a given label).
As used herein, the term “nucleic acid” refers to a polynucleotide sequence, or fragment thereof. A nucleic acid can comprise nucleotides. A nucleic acid can be exogenous or endogenous to a cell. A nucleic acid can exist in a cell-free environment. A nucleic acid can be a gene or fragment thereof. A nucleic acid can be DNA. A nucleic acid can be RNA. A nucleic acid can comprise one or more analogs (e.g. altered backbone, sugar, or nucleobase). Some non-limiting examples of analogs include: 5-bromouracil, peptide nucleic acid, xeno nucleic acid, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g. rhodamine or fluorescein linked to the sugar), thiol containing nucleotides, biotin linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queuosine, and wyosine. “Nucleic acid”, “polynucleotide, “target polynucleotide”, and “target nucleic acid” can be used interchangeably.
A nucleic acid can comprise one or more modifications (e.g., a base modification, a backbone modification), to provide the nucleic acid with a new or enhanced feature (e.g., improved stability). A nucleic acid can comprise a nucleic acid affinity tag. A nucleoside can be a base-sugar combination. The base portion of the nucleoside can be a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides can be nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, the 3′, or the 5′ hydroxyl moiety of the sugar. In forming nucleic acids, the phosphate groups can covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds are generally suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within nucleic acids, the phosphate groups can commonly be referred to as forming the internucleoside backbone of the nucleic acid. The linkage or backbone can be a 3′ to 5′ phosphodiester linkage.
A nucleic acid can comprise a modified backbone and/or modified internucleoside linkages. Modified backbones can include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Suitable modified nucleic acid backbones containing a phosphorus atom therein can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonate such as 3′-alkylene phosphonates, 5′-alkylene phosphonates, chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkyl phosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, a 5′ to 5′ or a 2′ to 2′ linkage.
A nucleic acid can comprise polynucleotide backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These can include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
A nucleic acid can comprise a nucleic acid mimetic. The term “mimetic” can be intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring can also be referred as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety can be maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid can be a peptide nucleic acid (PNA). In a PNA, the sugar-backbone of a polynucleotide can be replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides can be retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. The backbone in PNA compounds can comprise two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties can be bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
A nucleic acid can comprise a morpholino backbone structure. For example, a nucleic acid can comprise a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodiester internucleoside linkage can replace a phosphodiester linkage. p A nucleic acid can comprise linked morpholino units (i.e. morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. Linking groups can link the morpholino monomeric units in a morpholino nucleic acid. Non-ionic morpholino-based oligomeric compounds can have less undesired interactions with cellular proteins. Morpholino-based polynucleotides can be nonionic mimics of nucleic acids. A variety of compounds within the morpholino class can be joined using different linking groups. A further class of polynucleotide mimetic can be referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a nucleic acid molecule can be replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers can be prepared and used for oligomeric compound synthesis using phosphoramidite chemistry. The incorporation of CeNA monomers into a nucleic acid chain can increase the stability of a DNA/RNA hybrid. CeNA oligoadenylates can form complexes with nucleic acid complements with similar stability to the native complexes. A further modification can include Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 4′ carbon atom of the sugar ring thereby forming a 2′-C, 4′-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (—CH2—), group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNA and LNA analogs can display very high duplex thermal stabilities with complementary nucleic acid (Tm=+3 to +10° C.), stability towards 3′-exonucleolytic degradation and good solubility properties.
A nucleic acid may also include nucleobase (often referred to simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases can include the purine bases, (e.g. adenine (A) and guanine (G)), and the pyrimidine bases, (e.g. thymine (T), cytosine (C) and uracil (U)). Modified nucleobases can include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C═C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Modified nucleobases can include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b) (1,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-(b) (1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-(b) (1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), pyridoindole cytidine (H-pyrido(3′,′:4,5)pyrrolo [2,3-d]pyrimidin-2-one).
As used herein, the term “sample” can refer to a composition comprising targets. Suitable samples for analysis by the disclosed methods, devices, and systems include cells, tissues, organs, or organisms.
As used herein, the term “sampling device” or “device” can refer to a device which may take a section of a sample and/or place the section on a substrate. A sample device can refer to, for example, a fluorescence activated cell sorting (FACS) machine, a cell sorter machine, a biopsy needle, a biopsy device, a tissue sectioning device, a microfluidic device, a blade grid, and/or a microtome.
As used herein, the term “solid support” can refer to discrete solid or semi-solid surfaces to which a plurality of stochastic barcodes may be attached. A solid support may encompass any type of solid, porous, or hollow sphere, ball, bearing, cylinder, or other similar configuration composed of plastic, ceramic, metal, or polymeric material (e.g., hydrogel) onto which a nucleic acid may be immobilized (e.g., covalently or non-covalently). A solid support may comprise a discrete particle that may be spherical (e.g., microspheres) or have a non-spherical or irregular shape, such as cubic, cuboid, pyramidal, cylindrical, conical, oblong, or disc-shaped, and the like. A plurality of solid supports spaced in an array may not comprise a substrate. A solid support may be used interchangeably with the term “bead.”
A solid support can refer to a “substrate.” A substrate can be a type of solid support. A substrate can refer to a continuous solid or semi-solid surface on which the methods of the disclosure may be performed. A substrate can refer to an array, a cartridge, a chip, a device, and a slide, for example.
As used here, the term, “spatial label” can refer to a label which can be associated with a position in space.
As used herein, the term “stochastic barcode” can refer to a polynucleotide sequence comprising labels. A stochastic barcode can be a polynucleotide sequence that can be used for stochastic barcoding. Stochastic barcodes can be used to quantify targets within a sample. Stochastic barcodes can be used to control for errors which may occur after a label is associated with a target. For example, a stochastic barcode can be used to assess amplification or sequencing errors. A stochastic barcode associated with a target can be called a stochastic barcode-target or stochastic barcode-tag-target.
As used herein, the term “gene-specific stochastic barcode” can refer to a polynucleotide sequence comprising labels and a target-binding region that is gene-specific. A stochastic barcode can be a polynucleotide sequence that can be used for stochastic barcoding. Stochastic barcodes can be used to quantify targets within a sample. Stochastic barcodes can be used to control for errors which may occur after a label is associated with a target. For example, a stochastic barcode can be used to assess amplification or sequencing errors. A stochastic barcode associated with a target can be called a stochastic barcode-target or stochastic barcode-tag-target.
As used herein, the term “stochastic barcoding” can refer to the random labeling (e.g., barcoding) of nucleic acids. Stochastic barcoding can utilize a recursive Poisson strategy to associate and quantify labels associated with targets. As used herein, the term “stochastic barcoding” can be used interchangeably with “gene-specific stochastic barcoding.”
As used here, the term “target” can refer to a composition which can be associated with a stochastic barcode. Exemplary suitable targets for analysis by the disclosed methods, devices, and systems include oligonucleotides, DNA, RNA, mRNA, microRNA, tRNA, and the like. Targets can be single or double stranded. In some embodiments targets can be proteins. In some embodiments targets are lipids.
As used herein, the term “reverse transcriptases” can refer to a group of enzymes having reverse transcriptase activity (i.e., that catalyze synthesis of DNA from an RNA template). In general, such enzymes include, but are not limited to, retroviral reverse transcriptase, retrotransposon reverse transcriptase, retroplasmid reverse transcriptases, retron reverse transcriptases, bacterial reverse transcriptases, group II intron-derived reverse transcriptase, and mutants, variants or derivatives thereof. Non-retroviral reverse transcriptases include non-LTR retrotransposon reverse transcriptases, retroplasmid reverse transcriptases, retron reverse transciptases, and group II intron reverse transcriptases. Examples of group II intron reverse transcriptases include the Lactococcus lactis LI.LtrB intron reverse transcriptase, the Thermosynechococcus elongates TeI4c intron reverse transcriptase, or the Geobacillus stearothermophilus GsI-IIC intron reverse transcriptase. Other classes of reverse transcriptases can include many classes of non-retroviral reverse transcriptases (i.e., retrons, group II introns, and diversity-generating retroelements among others).
The terms “universal adaptor primer,” “universal primer adaptor” or “universal adaptor sequence” are used interchangeably to refer to a nucleotide sequence that can be used to hybridize stochastic barcodes to generate gene-specific stochastic barcodes. A universal adaptor sequence can, for example, be a known sequence that is universal across all stochastic barcodes used in methods of the disclosure. For example, when multiple targets are being labeled using the methods disclosed herein, each of the target-specific sequences may be linked to the same universal adaptor sequence. In some embodiments, more than one universal adaptor sequences may be used in the methods disclosed herein. For example, when multiple targets are being labeled using the methods disclosed herein, at least two of the target-specific sequences are linked to different universal adaptor sequences. A universal adaptor primer and its complement may be included in two oligonucleotides, one of which comprises a target-specific sequence and the other comprises a stochastic barcode. For example, a universal adaptor sequence may be part of an oligonucleotide comprising a target-specific sequence to generate a nucleotide sequence that is complementary to a target nucleic acid. A second oligonucleotide comprising a stochastic barcode and a complementary sequence of the universal adaptor sequence may hybridize with the nucleotide sequence and generate a target-specific stochastic barcode. In some embodiments, a universal adaptor primer has a sequence that is different from a universal PCR primer used in the methods of this disclosure.
Stochastic Barcodes
Stochastic barcoding has been described in, for example, US20150299784, WO2015031691, and Fu et al, Proc Natl Acad Sci U.S.A. 2011 May 31; 108(22):9026-31, the content of these publications is incorporated hereby in its entirety. Briefly, a stochastic barcode can be a polynucleotide sequence that may be used to stochastically label (e.g., barcode, tag) a target. A stochastic barcode can comprise one or more labels. Exemplary labels can include a universal label, a cell label, a molecular label, a sample label, a plate label, a spatial label, and/or a pre-spatial label. FIG. 1 illustrates an exemplary stochastic barcode 104 with a spatial label. The stochastic barcode 104 can comprise a 5′amine that may link the stochastic barcode to a solid support 105. The stochastic barcode can comprise a universal label, a dimension label, a spatial label, a cell label, and/or a molecular label. The order of different labels (including but not limited to the universal label, the dimension label, the spatial label, the cell label, and the molecule label) in the stochastic barcode can vary. For example, as shown in FIG. 1 , the universal label may be the 5′-most label, and the molecular label may be the 3′-most label. The spatial label, dimension label, and the cell label may be in any order. In some embodiments, the universal label, the spatial label, the dimension label, the cell label, and the molecular label are in any order.
A label, for example the cell label, can comprise a unique set of nucleic acid sub-sequences of defined length, e.g. seven nucleotides each (equivalent to the number of bits used in some Hamming error correction codes), which can be designed to provide error correction capability. The set of error correction sub-sequences comprise seven nucleotide sequences can be designed such that any pairwise combination of sequences in the set exhibits a defined “genetic distance” (or number of mismatched bases), for example, a set of error correction sub-sequences can be designed to exhibit a genetic distance of three nucleotides. In this case, review of the error correction sequences in the set of sequence data for labeled target nucleic acid molecules (described more fully below) can allow one to detect or correct amplification or sequencing errors. In some embodiments, the length of the nucleic acid sub-sequences used for creating error correction codes can vary, for example, they can be, or be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 31, 40, 50, or a number or a range between any two of these values, nucleotides in length. In some embodiments, nucleic acid sub-sequences of other lengths can be used for creating error correction codes.
The stochastic barcode can comprise a target-binding region. The target-binding region can interact with a target in a sample. The target can be, or comprise, ribonucleic acids (RNAs), messenger RNAs (mRNAs), microRNAs, small interfering RNAs (siRNAs), RNA degradation products, RNAs each comprising a poly(A) tail, or any combination thereof. In some embodiments, the plurality of targets can include deoxyribonucleic acids (DNAs).
In some embodiments, a target-binding region can comprise an oligo(dT) sequence which can interact with poly(A) tails of mRNAs. One or more of the labels of the stochastic barcode (e.g., the universal label, the dimension label, the spatial label, the cell label, and the molecular label) can be separated by a spacer from another one or two of the remaining labels of the stochastic barcode. The spacer can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides. In some embodiments, none of the labels of the stochastic barcode is separated by spacer.
Universal Labels
A stochastic barcode can comprise one or more universal labels. In some embodiments, the one or more universal labels can be the same for all stochastic barcodes in the set of stochastic barcodes attached to a given solid support. In some embodiments, the one or more universal labels can be the same for all stochastic barcodes attached to a plurality of beads. In some embodiments, a universal label can comprise a nucleic acid sequence that is capable of hybridizing to a sequencing primer. Sequencing primers can be used for sequencing stochastic barcodes comprising a universal label. Sequencing primers (e.g., universal sequencing primers) can comprise sequencing primers associated with high-throughput sequencing platforms. In some embodiments, a universal label can comprise a nucleic acid sequence that is capable of hybridizing to a PCR primer. In some embodiments, the universal label can comprise a nucleic acid sequence that is capable of hybridizing to a sequencing primer and a PCR primer. The nucleic acid sequence of the universal label that is capable of hybridizing to a sequencing or PCR primer can be referred to as a primer binding site. A universal label can comprise a sequence that can be used to initiate transcription of the stochastic barcode. A universal label can comprise a sequence that can be used for extension of the stochastic barcode or a region within the stochastic barcode. A universal label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. For example, a universal label can comprise at least about 10 nucleotides. A universal label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length. In some embodiments, a cleavable linker or modified nucleotide can be part of the universal label sequence to enable the stochastic barcode to be cleaved off from the support.
Dimension Labels
A stochastic barcode can comprise one or more dimension labels. In some embodiments, a dimension label can comprise a nucleic acid sequence that provides information about a dimension in which the stochastic labeling occurred. For example, a dimension label can provide information about the time at which a target was stochastically barcoded. A dimension label can be associated with a time of stochastic barcoding in a sample. A dimension label can be activated at the time of stochastic labeling. Different dimension labels can be activated at different times. The dimension label provides information about the order in which targets, groups of targets, and/or samples were stochastically barcoded. For example, a population of cells can be stochastically barcoded at the G0 phase of the cell cycle. The cells can be pulsed again with stochastic barcodes at the G1 phase of the cell cycle. The cells can be pulsed again with stochastic barcodes at the S phase of the cell cycle, and so on. Stochastic barcodes at each pulse (e.g., each phase of the cell cycle), can comprise different dimension labels. In this way, the dimension label provides information about which targets were labelled at which phase of the cell cycle. Dimension labels can interrogate many different biological times. Exemplary biological times can include, but are not limited to, the cell cycle, transcription (e.g., transcription initiation), and transcript degradation. In another example, a sample (e.g., a cell, a population of cells) can be stochastically labeled before and/or after treatment with a drug and/or therapy. The changes in the number of copies of distinct targets can be indicative of the sample's response to the drug and/or therapy.
A dimension label can be activatable. An activatable dimension label can be activated at a specific time point. The activatable label can be, for example, constitutively activated (e.g., not turned off). The activatable dimension label can be, for example, reversibly activated (e.g., the activatable dimension label can be turned on and turned off). The dimension label can be, for example, reversibly activatable at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times. The dimension label can be reversibly activatable, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times. In some embodiments, the dimension label can be activated with fluorescence, light, a chemical event (e.g., cleavage, ligation of another molecule, addition of modifications (e.g., pegylated, sumoylated, acetylated, methylated, deacetylated, demethylated), a photochemical event (e.g., photocaging), and introduction of a non-natural nucleotide.
The dimension label can, in some embodiments, be identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads). In some embodiments, at least 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of stochastic barcodes on the same solid support can comprise the same dimension label. In some embodiments, at least 60% of stochastic barcodes on the same solid support can comprise the same dimension label. In some embodiments, at least 95% of stochastic barcodes on the same solid support can comprise the same dimension label.
There can be as many as 106 or more unique dimension label sequences represented in a plurality of solid supports (e.g., beads). A dimension label can be, or be about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. A dimension label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length. A dimension label can comprise between about 5 to about 200 nucleotides. A dimension label can comprise between about 10 to about 150 nucleotides. A dimension label can comprise between about 20 to about 125 nucleotides in length.
Spatial Labels
A stochastic barcode can comprise one or more spatial labels. In some embodiments, a spatial label can comprise a nucleic acid sequence that provides information about the spatial orientation of a target molecule which is associated with the stochastic barcode. A spatial label can be associated with a coordinate in a sample. The coordinate can be a fixed coordinate. For example a coordinate can be fixed in reference to a substrate. A spatial label can be in reference to a two or three-dimensional grid. A coordinate can be fixed in reference to a landmark. The landmark can be identifiable in space. A landmark can be a structure which can be imaged. A landmark can be a biological structure, for example an anatomical landmark. A landmark can be a cellular landmark, for instance an organelle. A landmark can be a non-natural landmark such as a structure with an identifiable identifier such as a color code, bar code, magnetic property, fluorescents, radioactivity, or a unique size or shape. A spatial label can be associated with a physical partition (e.g. a well, a container, or a droplet). In some embodiments, multiple spatial labels are used together to encode one or more positions in space.
The spatial label can be identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads). In some embodiments, the percentage of stochastic barcodes on the same solid support comprising the same spatial label can be, or be about, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values. In some embodiments, the percentage of stochastic barcodes on the same solid support comprising the same spatial label can be at least, or at most, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%. In some embodiments, at least 60% of stochastic barcodes on the same solid support can comprise the same spatial label. In some embodiments, at least 95% of stochastic barcodes on the same solid support can comprise the same spatial label.
There can be as many as 106 or more unique spatial label sequences represented in a plurality of solid supports (e.g., beads). A spatial label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. A spatial label can be at least or at most 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length. A spatial label can comprise between about 5 to about 200 nucleotides. A spatial label can comprise between about 10 to about 150 nucleotides. A spatial label can comprise between about 20 to about 125 nucleotides in length.
Cell Labels
A stochastic barcodes can comprise one or more cell labels. In some embodiments, a cell label can comprise a nucleic acid sequence that provides information for determining which target nucleic acid originated from which cell. In some embodiments, the cell label is identical for all stochastic barcodes attached to a given solid support (e.g., bead), but different for different solid supports (e.g., beads). In some embodiments, the percentage of stochastic barcodes on the same solid support comprising the same cell label can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values. In some embodiments, the percentage of stochastic barcodes on the same solid support comprising the same cell label can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%. For example, at least 60% of stochastic barcodes on the same solid support can comprise the same cell label. As another example, at least 95% of stochastic barcodes on the same solid support can comprise the same cell label.
There can be as many as 106 or more unique cell label sequences represented in a plurality of solid supports (e.g., beads). A cell label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. A cell label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length. For example, a cell label can comprise between about 5 to about 200 nucleotides. As another example, a cell label can comprise between about 10 to about 150 nucleotides. As yet another example, a cell label can comprise between about 20 to about 125 nucleotides in length.
Molecular Labels
A stochastic barcodes can comprise one or more molecular labels. In some embodiments, a molecular label can comprise a nucleic acid sequence that provides identifying information for the specific type of target nucleic acid species hybridized to the stochastic barcode. A molecular label can comprise a nucleic acid sequence that provides a counter for the specific occurrence of the target nucleic acid species hybridized to the stochastic barcode (e.g., target-binding region).
In some embodiments, a diverse set of molecular labels are attached to a given solid support (e.g., bead). In some embodiments, there can be, or be about, 102, 103, 104, 105, 106, 107, 108, 109, or a number or a range of unique molecular label sequences. For example, a plurality of stochastic barcodes can comprise about 6561 molecular labels with distinct sequences. As another example, a plurality of stochastic barcodes can comprise about 65536 molecular labels with distinct sequences. In some embodiments, there can be at least, or at most, 102, 103, 104, 105, 106, 107, 108, or 109, unique molecular label sequences. The unique molecular label sequences attached to a given solid support (e.g., bead).
A molecular label can be, or be about, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. A molecular label can be at least, or at most, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides in length.
Target-Binding Region
A stochastic barcodes can comprise one or more target binding regions. In some embodiments, a target-binding region can hybridize with a target of interest. In some embodiments, the target binding regions can comprise a nucleic acid sequence that hybridizes specifically to a target (e.g. target nucleic acid, target molecule, e.g., a cellular nucleic acid to be analyzed), for example to a specific gene sequence. In some embodiments, a target binding region can comprise a nucleic acid sequence that can attach (e.g., hybridize) to a specific location of a specific target nucleic acid. In some embodiments, the target binding region can comprise a nucleic acid sequence that is capable of specific hybridization to a restriction enzyme site overhang (e.g. an EcoRI sticky-end overhang). The stochastic barcode can then ligate to any nucleic acid molecule comprising a sequence complementary to the restriction site overhang.
In some embodiments, a target binding region can comprise a non-specific target nucleic acid sequence. A non-specific target nucleic acid sequence can refer to a sequence that can bind to multiple target nucleic acids, independent of the specific sequence of the target nucleic acid. For example, target binding region can comprise a random multimer sequence, or an oligo(dT) sequence that hybridizes to the poly(A) tail on mRNA molecules. A random multimer sequence can be, for example, a random dimer, trimer, quatramer, pentamer, hexamer, septamer, octamer, nonamer, decamer, or higher multimer sequence of any length. In some embodiments, the target binding region is the same for all stochastic barcodes attached to a given bead. In some embodiments, the target binding regions for the plurality of stochastic barcodes attached to a given bead can comprise two or more different target binding sequences. A target binding region can be, or be about, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or a number or a range between any two of these values, nucleotides in length. A target binding region can be at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length.
In some embodiments, a target-binding region can comprise an oligo(dT) which can hybridize with mRNAs comprising poly-adenylated ends. A target-binding region can be gene-specific. For example, a target-binding region can be configured to hybridize to a specific region of a target. A target-binding region can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, or a number or a range between any two of these values, nucleotides in length. A target-binding region can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, or 30, nucleotides in length. A target-binding region can be about 5-30 nucleotides in length. When a stochastic barcode comprises a gene-specific target-binding region, the stochastic barcode can be referred to as a gene-specific stochastic barcode.
Orientation Property
A stochastic barcode can comprise one or more orientation properties which can be used to orient (e.g., align) the stochastic barcodes. A stochastic barcode can comprise a moiety for isoelectric focusing. Different stochastic barcodes can comprise different isoelectric focusing points. When these stochastic barcodes are introduced to a sample, the sample can undergo isoelectric focusing in order to orient the stochastic barcodes into a known way. In this way, the orientation property can be used to develop a known map of stochastic barcodes in a sample. Exemplary orientation properties can include, electrophoretic mobility (e.g., based on size of the stochastic barcode), isoelectric point, spin, conductivity, and/or self-assembly. For example, stochastic barcodes with an orientation property of self-assembly, can self-assemble into a specific orientation (e.g., nucleic acid nanostructure) upon activation.
Affinity Property
A stochastic barcode can comprise one or more affinity properties. For example, a spatial label can comprise an affinity property. An affinity property can include a chemical and/or biological moiety that can facilitate binding of the stochastic barcode to another entity (e.g., cell receptor). For example, an affinity property can comprise an antibody, for example, an antibody specific for a specific moiety (e.g., receptor) on a sample. In some embodiments, the antibody can guide the stochastic barcode to a specific cell type or molecule. Targets at and/or near the specific cell type or molecule can be stochastically labeled. The affinity property can, in some embodiments, provide spatial information in addition to the nucleotide sequence of the spatial label because the antibody can guide the stochastic barcode to a specific location. The antibody can be a therapeutic antibody, for example a monoclonal antibody or a polyclonal antibody. The antibody can be humanized or chimeric. The antibody can be a naked antibody or a fusion antibody.
The antibody can be a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (e.g., an IgG antibody) or an immunologically active (i.e., specifically binding) portion of an immunoglobulin molecule, like an antibody fragment.
The antibody fragment can be, for example, a portion of an antibody such as F(ab')2, Fab', Fab, Fv, sFv and the like. In some embodiments, the antibody fragment can bind with the same antigen that is recognized by the full-length antibody. The antibody fragment can include isolated fragments consisting of the variable regions of antibodies, such as the “Fv” fragments consisting of the variable regions of the heavy and light chains and recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (“scFv proteins”). Exemplary antibodies can include, but are not limited to, antibodies for cancer cells, antibodies for viruses, antibodies that bind to cell surface receptors (CD8, CD34, CD45), and therapeutic antibodies.
Universal Adaptor Primer
A stochastic barcode can comprise one or more universal adaptor primers. For example, a gene-specific stochastic barcode can comprise a universal adaptor primer. A universal adaptor primer can refer to a nucleotide sequence that is universal across all stochastic barcodes. A universal adaptor primer can be used for building gene-specific stochastic barcodes. A universal adaptor primer can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, or a number or a range between any two of these nucleotides in length. A universal adaptor primer can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, or 30 nucleotides in length. A universal adaptor primer can be from 5-30 nucleotides in length.
Solid Supports
Stochastic barcodes disclosed herein can, in some embodiments, be associated with a solid support. The solid support can be, for example, a synthetic particle. In some embodiments, some or all of the molecular labels (e.g., the first molecular labels) of a plurality of stochastic barcodes (e.g., the first plurality of stochastic barcodes) on a solid support differ by at least one nucleotide. The cell labels of the stochastic barcodes on the same solid support can be the same. The cell labels of the stochastic barcodes on different solid supports can differ by at least one nucleotide. For example, first cell labels of a first plurality of stochastic barcodes on a first solid support can have the same sequence, and second cell labels of a second plurality of stochastic barcodes on a second solid support can have the same sequence. The first cell labels of the first plurality of stochastic barcodes on the first solid support and the second cell labels of the second plurality of stochastic barcodes on the second solid support can differ by at least one nucleotide. A cell label can be, for example, about 5-20 nucleotides long. A molecular label can be, for example, about 5-20 nucleotides long. The synthetic particle can be, for example, a bead.
The bead can be, for example, a silica gel bead, a controlled pore glass bead, a magnetic bead, a Dynabead, a Sephadex/Sepharose bead, a cellulose bead, a polystyrene bead, or any combination thereof. The bead can comprise a material such as polydimethylsiloxane (PDMS), polystyrene, glass, polypropylene, agarose, gelatin, hydrogel, paramagnetic, ceramic, plastic, glass, methylstyrene, acrylic polymer, titanium, latex, sepharose, cellulose, nylon, silicone, or any combination thereof.
In some embodiments, the bead can be a polymeric bead, for example a deformable bead or a gel bead, functionalized with stochastic barcodes (such as gel beads from 10X Genomics (San Francisco, Calif.). In some implementation, a gel bead can comprise a polymer based gels. Gel beads can be generated, for example, by encapsulating one or more polymeric precursors into droplets. Upon exposure of the polymeric precursors to an accelerator (e.g., tetramethylethylenediamine (TEMED)), a gel bead may be generated.
In some embodiments, the polymeric bead can dissolve, melt, or degrade, for example, under a desired condition. The desired condition can include an environmental condition. The desired condition may result in the polymeric bead dissolving, melting, or degrading in a controlled manner. A gel bead may dissolve, melt, or degrade due to a chemical stimulus, a physical stimulus, a biological stimulus, a thermal stimulus, a magnetic stimulus, an electric stimulus, a light stimulus, or any combination thereof.
Analytes and/or reagents, such as oligonucleotide barcodes, for example, may be coupled/immobilized to the interior surface of a gel bead (e.g., the interior accessible via diffusion of an oligonucleotide barcode and/or materials used to generate an oligonucleotide barcode) and/or the outer surface of a gel bead or any other microcapsule described herein. Coupling/immobilization may be via any form of chemical bonding (e.g., covalent bond, ionic bond) or physical phenomena (e.g., Van der Waals forces, dipole-dipole interactions, etc.). In some cases, coupling/immobilization of a reagent to a gel bead or any other microcapsule described herein may be reversible, such as, for example, via a labile moiety (e.g., via a chemical cross-linker, including chemical cross-linkers described herein). Upon application of a stimulus, the labile moiety may be cleaved and the immobilized reagent set free. In some cases, the labile moiety is a disulfide bond. For example, in the case where an oligonucleotide barcode is immobilized to a gel bead via a disulfide bond, exposure of the disulfide bond to a reducing agent can cleave the disulfide bond and free the oligonucleotide barcode from the bead. The labile moiety may be included as part of a gel bead or microcapsule, as part of a chemical linker that links a reagent or analyte to a gel bead or microcapsule, and/or as part of a reagent or analyte.
In some embodiments, a gel bead can comprise a wide range of different polymers including but not limited to: polymers, heat sensitive polymers, photosensitive polymers, magnetic polymers, pH sensitive polymers, salt-sensitive polymers, chemically sensitive polymers, polyelectrolytes, polysaccharides, peptides, proteins, and/or plastics. Polymers may include but are not limited to materials such as poly(N-isopropylacrylamide) (PNIPAAm), poly(styrene sulfonate) (PSS), poly(allyl amine) (PAAm), poly(acrylic acid) (PAA), poly(ethylene imine) (PEI), poly(diallyldimethyl-ammonium chloride) (PDADMAC), poly(pyrolle) (PPy), poly(vinylpyrrolidone) (PVPON), poly(vinyl pyridine) (PVP), poly(methacrylic acid) (PMAA), poly(methyl methacrylate) (PMMA), polystyrene (PS), poly(tetrahydrofuran) (PTHF), poly(phthaladehyde) (PTHF), poly(hexyl viologen) (PHV), poly(L-lysine) (PLL), poly(L-arginine) (PARG), poly(lactic-co-glycolic acid) (PLGA).
Numerous chemical stimuli can be used to trigger the disruption or degradation of the beads. Examples of these chemical changes may include, but are not limited to pH-mediated changes to the bead wall, disintegration of the bead wall via chemical cleavage of crosslink bonds, triggered depolymerization of the bead wall, and bead wall switching reactions. Bulk changes may also be used to trigger disruption of the beads.
Bulk or physical changes to the microcapsule through various stimuli also offer many advantages in designing capsules to release reagents. Bulk or physical changes occur on a macroscopic scale, in which bead rupture is the result of mechano-physical forces induced by a stimulus. These processes may include, but are not limited to pressure induced rupture, bead wall melting, or changes in the porosity of the bead wall.
Biological stimuli may also be used to trigger disruption or degradation of beads. Generally, biological triggers resemble chemical triggers, but many examples use biomolecules, or molecules commonly found in living systems such as enzymes, peptides, saccharides, fatty acids, nucleic acids and the like. For example, beads may comprise polymers with peptide cross-links that are sensitive to cleavage by specific proteases. More specifically, one example may comprise a microcapsule comprising GFLGK peptide cross links. Upon addition of a biological trigger such as the protease Cathepsin B, the peptide cross links of the shell well are cleaved and the contents of the beads are released. In other cases, the proteases may be heat-activated. In another example, beads comprise a shell wall comprising cellulose. Addition of the hydrolytic enzyme chitosan serves as biologic trigger for cleavage of cellulosic bonds, depolymerization of the shell wall, and release of its inner contents.
The beads may also be induced to release their contents upon the application of a thermal stimulus. A change in temperature can cause a variety changes to the beads. A change in heat may cause melting of a bead such that the bead wall disintegrates. In other cases, the heat may increase the internal pressure of the inner components of the bead such that the bead ruptures or explodes. In still other cases, the heat may transform the bead into a shrunken dehydrated state. The heat may also act upon heat-sensitive polymers within the wall of a bead to cause disruption of the bead.
Inclusion of magnetic nanoparticles to the bead wall of microcapsules may allow triggered rupture of the beads as well as guide the beads in an array. A device of this disclosure may comprise magnetic beads for either purpose. In one example, incorporation of Fe3O4 nanoparticles into polyelectrolyte containing beads triggers rupture in the presence of an oscillating magnetic field stimulus.
A bead may also be disrupted or degraded as the result of electrical stimulation. Similar to magnetic particles described in the previous section, electrically sensitive beads can allow for both triggered rupture of the beads as well as other functions such as alignment in an electric field, electrical conductivity or redox reactions. In one example, beads containing electrically sensitive material are aligned in an electric field such that release of inner reagents can be controlled. In other examples, electrical fields may induce redox reactions within the bead wall itself that may increase porosity.
A light stimulus may also be used to disrupt the beads. Numerous light triggers are possible and may include systems that use various molecules such as nanoparticles and chromophores capable of absorbing photons of specific ranges of wavelengths. For example, metal oxide coatings can be used as capsule triggers. UV irradiation of polyelectrolyte capsules coated with SiO2 may result in disintegration of the bead wall. In yet another example, photo switchable materials such as azobenzene groups may be incorporated in the bead wall. Upon the application of UV or visible light, chemicals such as these undergo a reversible cis-to-trans isomerization upon absorption of photons. In this aspect, incorporation of photon switches result in a bead wall that may disintegrate or become more porous upon the application of a light trigger.
For example, in a non-limiting example of stochastic barcoding illustrated in FIG. 2 , after introducing cells such as single cells onto a plurality of microwells of a microwell array at block 208, beads can be introduced onto the plurality of microwells of the microwell array at block 212. Each microwell can comprise one bead. The beads can comprise a plurality of stochastic barcodes. A stochastic barcode can comprise a 5′ amine region attached to a bead. The stochastic barcode can comprise a universal label, a molecular label, a target-binding region, or any combination thereof.
The stochastic barcodes disclosed herein can be associated with (e.g., attached to) a solid support (e.g., a bead). The stochastic barcodes associated with a solid support can each comprise a molecular label selected from a group comprising at least 100 or 1000 molecular labels with unique sequences. In some embodiments, different stochastic barcodes associated with a solid support can comprise molecular labels of different sequences. In some embodiments, a percentage of stochastic barcodes associated with a solid support comprises the same cell label. For example, the percentage can be, or be about 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 100%, or a number or a range between any two of these values. As another example, the percentage can be at least, or at most 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%. In some embodiments, stochastic barcodes associated with a solid support can have the same cell label. The stochastic barcodes associated with different solid supports can have different cell labels selected from a group comprising at least 100 or 1000 cell labels with unique sequences.
The stochastic barcodes disclosed herein can be associated to (e.g., attached to) a solid support (e.g., a bead). In some embodiments, stochastically barcoding the plurality of targets in the sample can be performed with a solid support including a plurality of synthetic particles associated with the plurality of stochastic barcodes. In some embodiments, the solid support can include a plurality of synthetic particles associated with the plurality of stochastic barcodes. The spatial labels of the plurality of stochastic barcodes on different solid supports can differ by at least one nucleotide. The solid support can, for example, include the plurality of stochastic barcodes in two dimensions or three dimensions. The synthetic particles can be beads. The beads can be silica gel beads, controlled pore glass beads, magnetic beads, Dynabeads, Sephadex/Sepharose beads, cellulose beads, polystyrene beads, or any combination thereof. The solid support can include a polymer, a matrix, a hydrogel, a needle array device, an antibody, or any combination thereof. In some embodiments, the solid supports can be free floating. In some embodiments, the solid supports can be embedded in a semi-solid or solid array. The stochastic barcodes may not be associated with solid supports. The stochastic barcodes can be individual nucleotides. The stochastic barcodes can be associated with a substrate.
As used herein, the terms “tethered”, “attached”, and “immobilized” are used interchangeably, and can refer to covalent or non-covalent means for attaching stochastic barcodes to a solid support. Any of a variety of different solid supports can be used as solid supports for attaching pre-synthesized stochastic barcodes or for in situ solid-phase synthesis of stochastic barcode.
In some embodiments, the solid support is a bead. The bead can comprise one or more types of solid, porous, or hollow sphere, ball, bearing, cylinder, or other similar configuration which a nucleic acid can be immobilized (e.g., covalently or non-covalently). The bead can be, for example, composed of plastic, ceramic, metal, polymeric material, or any combination thereof. A bead can be, or comprise, a discrete particle that is spherical (e.g., microspheres) or have a non-spherical or irregular shape, such as cubic, cuboid, pyramidal, cylindrical, conical, oblong, or disc-shaped, and the like. In some embodiments, a bead can be non-spherical in shape.
Beads can comprise a variety of materials including, but not limited to, paramagnetic materials (e.g. magnesium, molybdenum, lithium, and tantalum), superparamagnetic materials (e.g. ferrite (Fe3O4; magnetite) nanoparticles), ferromagnetic materials (e.g. iron, nickel, cobalt, some alloys thereof, and some rare earth metal compounds), ceramic, plastic, glass, polystyrene, silica, methylstyrene, acrylic polymers, titanium, latex, sepharose, agarose, hydrogel, polymer, cellulose, nylon, or any combination thereof.
In some embodiments, the bead (e.g., the bead to which the stochastic labels are attached) is a hydrogel bead. In some embodiments, the bead comprises hydrogel.
Some embodiments disclosed herein include one or more particles (for example beads). Each of the particles can comprise a plurality of oligonucleotides (e.g., stochastic barcodes). Each of the plurality of oligonucleotides can comprise a molecular label sequence, a cell label sequence, and a target-binding region (e.g., an oligo dT sequence, a gene-specific sequence, a random multimer, or a combination thereof). The cell label sequence of each of the plurality of oligonucleotides can be the same. The cell label sequences of oligonucleotides on different particles can be different such that the oligonucleotides on different particles can be identified. The number of different cell label sequences can be different in different implementations. In some embodiments, the number of cell label sequences can be, or about 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 106, 107, 108, 109, a number or a range between any two of these values, or more. In some embodiments, the number of cell label sequences can be at least, or at most 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 106, 107, 108, or 109. In some embodiments, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more of the plurality of the particles include oligonucleotides with the same cell sequence. In some embodiment, the plurality of particles that include oligonucleotides with the same cell sequence can be at most 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more. In some embodiments, none of the plurality of the particles has the same cell label sequence.
The plurality of oligonucleotides on each particle can comprise different molecular label sequences. In some embodiments, the number of molecular label sequences can be, or about 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 106, 107, 108, 109, or a number or a range between any two of these values. In some embodiments, the number of molecular label sequences can be at least, or at most 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 106, 107, 108, or 109. For example, at least 100 of the plurality of oligonucleotides comprise different molecular label sequences. As another example example, in a single particle, at least 100, 500, 1000, 5000, 10000, 15000, 20000, 50000, a number or a range between any two of these values, or more of the plurality of oligonucleotides comprise different molecular label sequences. Some embodiments provide a plurality of the particles comprising stochastic barcodes. In some embodiments, the ratio of an occurrence (or a copy or a number) of a target to be labeled and the different molecular label sequences can be at least 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, or more. In some embodiments, each of the plurality of oligonucleotides further comprises a sample label, a universal label, or both. The particle can be, for example, a nanoparticle or microparticle.
The size of the beads can vary. For example, the diameter of the bead can range from 0.1 micrometer to 50 micrometer. In some embodiments, the diameters of beads can be, or be about, 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 micrometer, or a number or a range between any two of these values.
The diameters of the bead can be related to the diameter of the wells of the substrate. In some embodiments, the diameters of the bead can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a number or a range between any two of these values, longer or shorter than the diameter of the well. The diameter of the beads can be related to the diameter of a cell (e.g., a single cell entrapped by a well of the substrate). In some embodiments, the diameters of the beads can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, or a number or a range between any two of these values, longer or shorter than the diameter of the cell.
A bead can be attached to and/or embedded in a substrate. A bead can be attached to and/or embedded in a gel, hydrogel, polymer and/or matrix. The spatial position of a bead within a substrate (e.g., gel, matrix, scaffold, or polymer) can be identified using the spatial label present on the stochastic barcode on the bead which can serve as a location address.
Examples of beads can include, but are not limited to, streptavidin beads, agarose beads, magnetic beads, Dynabeads®, MACS® microbeads, antibody conjugated beads (e.g., anti-immunoglobulin microbeads), protein A conjugated beads, protein G conjugated beads, protein A/G conjugated beads, protein L conjugated beads, oligo(dT) conjugated beads, silica beads, silica-like beads, anti-biotin microbeads, anti-fluorochrome microbeads, and BcMag™ Carboxyl-Terminated Magnetic Beads.
A bead can be associated with (e.g. impregnated with) quantum dots or fluorescent dyes to make it fluorescent in one fluorescence optical channel or multiple optical channels. A bead can be associated with iron oxide or chromium oxide to make it paramagnetic or ferromagnetic. Beads can be identifiable. For example, a bead can be imaged using a camera. A bead can have a detectable code associated with the bead. For example, a bead can comprise a stochastic barcode. A bead can change size, for example due to swelling in an organic or inorganic solution. A bead can be hydrophobic. A bead can be hydrophilic. A bead can be biocompatible.
A solid support (e.g., bead) can be visualized. The solid support can comprise a visualizing tag (e.g., fluorescent dye). A solid support (e.g., bead) can be etched with an identifier (e.g., a number). The identifier can be visualized through imaging the beads.
Substrates and Microwell Array
As used herein, a substrate can refer to a type of solid support. A substrate can refer to a solid support that can comprise stochastic barcodes of the disclosure. A substrate can, for example, comprise a plurality of microwells. For example, a substrate can be a well array comprising two or more microwells. In some embodiments, a microwell can comprise a small reaction chamber of defined volume. In some embodiments, a microwell can entrap one or more cells. In some embodiments, a microwell can entrap only one cell. In some embodiments, a microwell can entrap one or more solid supports. In some embodiments, a microwell can entrap only one solid support. In some embodiments, a microwell entraps a single cell and a single solid support (e.g., bead).
Methods of Stochastic Barcoding
The disclosure provides for methods for estimating the number of distinct targets at distinct locations in a physical sample (e.g., tissue, organ, tumor, cell). The methods can comprise placing the stochastic barcodes in close proximity with the sample, lysing the sample, associating distinct targets with the stochastic barcodes, amplifying the targets and/or digitally counting the targets. The method can further comprise analyzing and/or visualizing the information obtained from the spatial labels on the stochastic barcodes. In some embodiments, a method comprises visualizing the plurality of targets in the sample. Mapping the plurality of targets onto the map of the sample can include generating a two dimensional map or a three dimensional map of the sample. The two dimensional map and the three dimensional map can be generated prior to or after stochastically barcoding the plurality of targets in the sample. Visualizing the plurality of targets in the sample can include mapping the plurality of targets onto a map of the sample. Mapping the plurality of targets onto the map of the sample can include generating a two dimensional map or a three dimensional map of the sample. The two dimensional map and the three dimensional map can be generated prior to or after stochastically barcoding the plurality of targets in the sample. In some embodiments, the two dimensional map and the three dimensional map can be generated before or after lysing the sample. Lysing the sample before or after generating the two dimensional map or the three dimensional map can include heating the sample, contacting the sample with a detergent, changing the pH of the sample, or any combination thereof.
In some embodiments, stochastically barcoding the plurality of targets comprises hybridizing a plurality of stochastic barcodes with a plurality of targets to create stochastically barcoded targets. Stochastically barcoding the plurality of targets can comprise generating an indexed library of the stochastically barcoded targets. Generating an indexed library of the stochastically barcoded targets can be performed with a solid support comprising the plurality of stochastic barcodes.
Contacting a Sample and a Stochastic Barcode
The disclosure provides for methods for contacting a sample (e.g., cells) to a substrate of the disclosure. A sample comprising, for example, a cell, organ, or tissue thin section, can be contacted to stochastic barcodes. The cells can be contacted, for example, by gravity flow wherein the cells can settle and create a monolayer. The sample can be a tissue thin section. The thin section can be placed on the substrate. The sample can be one-dimensional (e.g., form a planar surface). The sample (e.g., cells) can be spread across the substrate, for example, by growing/culturing the cells on the substrate.
When stochastic barcodes are in close proximity to targets, the targets can hybridize to the stochastic barcode. The stochastic barcodes can be contacted at a non-depletable ratio such that each distinct target can associate with a distinct stochastic barcode of the disclosure. To ensure efficient association between the target and the stochastic barcode, the targets can be crosslinked to the stochastic barcode.
Cell Lysis
Following the distribution of cells and stochastic barcodes, the cells can be lysed to liberate the target molecules. Cell lysis can be accomplished by any of a variety of means, for example, by chemical or biochemical means, by osmotic shock, or by means of thermal lysis, mechanical lysis, or optical lysis. Cells can be lysed by addition of a cell lysis buffer comprising a detergent (e.g. SDS, Li dodecyl sulfate, Triton X-100, Tween-20, or NP-40), an organic solvent (e.g. methanol or acetone), or digestive enzymes (e.g. proteinase K, pepsin, or trypsin), or any combination thereof. To increase the association of a target and a stochastic barcode, the rate of the diffusion of the target molecules can be altered by for example, reducing the temperature and/or increasing the viscosity of the lysate.
In some embodiments, the sample can be lysed using a filter paper. The filter paper can be soaked with a lysis buffer on top of the filter paper. The filter paper can be applied to the sample with pressure which can facilitate lysis of the sample and hybridization of the targets of the sample to the substrate.
In some embodiments, lysis can be performed by mechanical lysis, heat lysis, optical lysis, and/or chemical lysis. Chemical lysis can include the use of digestive enzymes such as proteinase K, pepsin, and trypsin. Lysis can be performed by the addition of a lysis buffer to the substrate. A lysis buffer can comprise Tris HCl. A lysis buffer can comprise at least about 0.01, 0.05, 0.1, 0.5, or 1 M or more Tris HCl. A lysis buffer can comprise at most about 0.01, 0.05, 0.1, 0.5, or 1 M or more Tris HCL. A lysis buffer can comprise about 0.1 M Tris HCl. The pH of the lysis buffer can be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. The pH of the lysis buffer can be at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. In some embodiments, the pH of the lysis buffer is about 7.5. The lysis buffer can comprise a salt (e.g., LiCl). The concentration of salt in the lysis buffer can be at least about 0.1, 0.5, or 1 M or more. The concentration of salt in the lysis buffer can be at most about 0.1, 0.5, or 1 M or more. In some embodiments, the concentration of salt in the lysis buffer is about 0.5M. The lysis buffer can comprise a detergent (e.g., SDS, Li dodecyl sufate, triton X, tween, NP-40). The concentration of the detergent in the lysis buffer can be at least about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, or 7% or more. The concentration of the detergent in the lysis buffer can be at most about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, or 7% or more. In some embodiments, the concentration of the detergent in the lysis buffer is about 1% Li dodecyl sulfate. The time used in the method for lysis can be dependent on the amount of detergent used. In some embodiments, the more detergent used, the less time needed for lysis. The lysis buffer can comprise a chelating agent (e.g., EDTA, EGTA). The concentration of a chelating agent in the lysis buffer can be at least about 1, 5, 10, 15, 20, 25, or 30 mM or more. The concentration of a chelating agent in the lysis buffer can be at most about 1, 5, 10, 15, 20, 25, or 30 mM or more. In some embodiments, the concentration of chelating agent in the lysis buffer is about 10 mM. The lysis buffer can comprise a reducing reagent (e.g., beta-mercaptoethanol, DTT). The concentration of the reducing reagent in the lysis buffer can be at least about 1, 5, 10, 15, or 20 mM or more. The concentration of the reducing reagent in the lysis buffer can be at most about 1, 5, 10, 15, or 20 mM or more. In some embodiments, the concentration of reducing reagent in the lysis buffer is about 5 mM. In some embodiments, a lysis buffer can comprise about 0.1M TrisHCl, about pH 7.5, about 0.5M LiCl, about 1% lithium dodecyl sulfate, about 10 mM EDTA, and about 5 mM DTT.
Lysis can be performed at a temperature of about 4, 10, 15, 20, 25, or 30° C. Lysis can be performed for about 1, 5, 10, 15, or 20 or more minutes. A lysed cell can comprise at least about 100000, 200000, 300000, 400000, 500000, 600000, or 700000 or more target nucleic acid molecules. A lysed cell can comprise at most about 100000, 200000, 300000, 400000, 500000, 600000, or 700000 or more target nucleic acid molecules.
Attachment of Stochastic Barcodes to Target Nucleic Acid Molecules
Following lysis of the cells and release of nucleic acid molecules therefrom, the nucleic acid molecules can randomly associate with the stochastic barcodes of the co-localized solid support. Association can comprise hybridization of a stochastic barcode's target recognition region to a complementary portion of the target nucleic acid molecule (e.g., oligo(dT) of the stochastic barcode can interact with a poly(A) tail of a target). The assay conditions used for hybridization (e.g. buffer pH, ionic strength, temperature, etc.) can be chosen to promote formation of specific, stable hybrids. In some embodiments, the nucleic acid molecules released from the lysed cells can associate with the plurality of probes on the substrate (e.g., hybridize with the probes on the substrate). When the probes comprise oligo(dT), mRNA molecules can hybridize to the probes and be reverse transcribed. The oligo(dT) portion of the oligonucleotide can act as a primer for first strand synthesis of the cDNA molecule. For example, in a non-limiting example of stochastic barcoding illustrated in FIG. 2 , at block 216, mRNA molecules can hybridize to stochastic barcodes on beads. For example, single-stranded nucleotide fragments can hybridize to the target-binding regions of stochastic barcodes.
Attachment can further comprise ligation of a stochastic barcode's target recognition region and a portion of the target nucleic acid molecule. For example, the target binding region can comprise a nucleic acid sequence that can be capable of specific hybridization to a restriction site overhang (e.g. an EcoRI sticky-end overhang). The assay procedure can further comprise treating the target nucleic acids with a restriction enzyme (e.g. EcoRI) to create a restriction site overhang. The stochastic barcode can then be ligated to any nucleic acid molecule comprising a sequence complementary to the restriction site overhang. A ligase (e.g., T4 DNA ligase) can be used to join the two fragments.
For example, in a non-limiting example of stochastic barcoding illustrated in FIG. 2 , at block 220, the labeled targets from a plurality of cells (or a plurality of samples) (e.g., target-barcode molecules) can be subsequently pooled, for example, into a tube. The labeled targets can be pooled by, for example, retrieving the stochastic barcodes and/or the beads to which the target-barcode molecules are attached.
The retrieval of solid support-based collections of attached target-barcode molecules can be implemented by use of magnetic beads and an externally-applied magnetic field. Once the target-barcode molecules have been pooled, all further processing can proceed in a single reaction vessel. Further processing can include, for example, reverse transcription reactions, amplification reactions, cleavage reactions, dissociation reactions, and/or nucleic acid extension reactions. Further processing reactions can be performed within the microwells, that is, without first pooling the labeled target nucleic acid molecules from a plurality of cells.
Reverse Transcription
The disclosure provides for a method to create a stochastic target-barcode conjugate using reverse transcription (e.g., at block 224 of FIG. 2 ). The stochastic target-barcode conjugate can comprise the stochastic barcode and a complementary sequence of all or a portion of the target nucleic acid (i.e. a stochastically barcoded cDNA molecule). Reverse transcription of the associated RNA molecule can occur by the addition of a reverse transcription primer along with the reverse transcriptase. The reverse transcription primer can be an oligo(dT) primer, a random hexanucleotide primer, or a target-specific oligonucleotide primer. Oligo(dT) primers can be, or can be about, 12-18 nucleotides in length and bind to the endogenous poly(A) tail at the 3′ end of mammalian mRNA. Random hexanucleotide primers can bind to mRNA at a variety of complementary sites. Target-specific oligonucleotide primers typically selectively prime the mRNA of interest.
In some embodiments, reverse transcription of the labeled-RNA molecule can occur by the addition of a reverse transcription primer. In some embodiments, the reverse transcription primer is an oligo(dT) primer, random hexanucleotide primer, or a target-specific oligonucleotide primer. Generally, oligo(dT) primers are 12-18 nucleotides in length and bind to the endogenous poly(A)+ tail at the 3′ end of mammalian mRNA. Random hexanucleotide primers can bind to mRNA at a variety of complementary sites. Target-specific oligonucleotide primers typically selectively prime the mRNA of interest.
Reverse transcription can occur repeatedly to produce multiple labeled-cDNA molecules. The methods disclosed herein can comprise conducting at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 reverse transcription reactions. The method can comprise conducting at least about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 reverse transcription reactions.
Amplification
One or more nucleic acid amplification reactions (e.g., at block 228 of FIG. 2 ) can be performed to create multiple copies of the labeled target nucleic acid molecules. Amplification can be performed in a multiplexed manner, wherein multiple target nucleic acid sequences are amplified simultaneously. The amplification reaction can be used to add sequencing adaptors to the nucleic acid molecules. The amplification reactions can comprise amplifying at least a portion of a sample label, if present. The amplification reactions can comprise amplifying at least a portion of the cellular and/or molecular label. The amplification reactions can comprise amplifying at least a portion of a sample tag, a cell label, a spatial label, a molecular label, a target nucleic acid, or a combination thereof. The amplification reactions can comprise amplifying 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 100%, or a range or a number between any two of these values, of the plurality of nucleic acids. The method can further comprise conducting one or more cDNA synthesis reactions to produce one or more cDNA copies of target-barcode molecules comprising a sample label, a cell label, a spatial label, and/or a molecular label.
In some embodiments, amplification can be performed using a polymerase chain reaction (PCR). As used herein, PCR can refer to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. As used herein, PCR can encompass derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, digital PCR, and assembly PCR.
Amplification of the labeled nucleic acids can comprise non-PCR based methods. Examples of non-PCR based methods include, but are not limited to, multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, rolling circle amplification, or circle-to-circle amplification. Other non-PCR-based amplification methods include multiple cycles of DNA-dependent RNA polymerase-driven RNA transcription amplification or RNA-directed DNA synthesis and transcription to amplify DNA or RNA targets, a ligase chain reaction (LCR), and a Qβ replicase (Qβ) method, use of palindromic probes, strand displacement amplification, oligonucleotide-driven amplification using a restriction endonuclease, an amplification method in which a primer is hybridized to a nucleic acid sequence and the resulting duplex is cleaved prior to the extension reaction and amplification, strand displacement amplification using a nucleic acid polymerase lacking 5′ exonuclease activity, rolling circle amplification, and ramification extension amplification (RAM). In some embodiments, the amplification does not produce circularized transcripts.
In some embodiments, the methods disclosed herein further comprise conducting a polymerase chain reaction on the labeled nucleic acid (e.g., labeled-RNA, labeled-DNA, labeled-cDNA) to produce a stochastically labeled-amplicon. The labeled-amplicon can be double-stranded molecule. The double-stranded molecule can comprise a double-stranded RNA molecule, a double-stranded DNA molecule, or a RNA molecule hybridized to a DNA molecule. One or both of the strands of the double-stranded molecule can comprise a sample label, a spatial label, a cell label, and/or a molecular label. The stochastically labeled-amplicon can be a single-stranded molecule. The single-stranded molecule can comprise DNA, RNA, or a combination thereof. The nucleic acids of the disclosure can comprise synthetic or altered nucleic acids.
Amplification can comprise use of one or more non-natural nucleotides. Non-natural nucleotides can comprise photolabile or triggerable nucleotides. Examples of non-natural nucleotides can include, but are not limited to, peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Non-natural nucleotides can be added to one or more cycles of an amplification reaction. The addition of the non-natural nucleotides can be used to identify products as specific cycles or time points in the amplification reaction.
Conducting the one or more amplification reactions can comprise the use of one or more primers. The one or more primers can comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides. The one or more primers can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides. The one or more primers can comprise less than 12-15 nucleotides. The one or more primers can anneal to at least a portion of the plurality of stochastically labeled targets. The one or more primers can anneal to the 3′ end or 5′ end of the plurality of stochastically labeled targets. The one or more primers can anneal to an internal region of the plurality of stochastically labeled targets. The internal region can be at least about 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides from the 3′ ends the plurality of stochastically labeled targets. The one or more primers can comprise a fixed panel of primers. The one or more primers can comprise at least one or more custom primers. The one or more primers can comprise at least one or more control primers. The one or more primers can comprise at least one or more gene-specific primers.
The one or more primers can comprise a universal primer. The universal primer can anneal to a universal primer binding site. The one or more custom primers can anneal to a first sample label, a second sample label, a spatial label, a cell label, a molecular label, a target, or any combination thereof. The one or more primers can comprise a universal primer and a custom primer. The custom primer can be designed to amplify one or more targets. The targets can comprise a subset of the total nucleic acids in one or more samples. The targets can comprise a subset of the total stochastically labeled targets in one or more samples. The one or more primers can comprise at least 96 or more custom primers. The one or more primers can comprise at least 960 or more custom primers. The one or more primers can comprise at least 9600 or more custom primers. The one or more custom primers can anneal to two or more different labeled nucleic acids. The two or more different labeled nucleic acids can correspond to one or more genes.
Any amplification scheme can be used in the methods of the present disclosure. For example, in one scheme, the first round PCR can amplify molecules attached to the bead using a gene specific primer and a primer against the universal Illumina sequencing primer 1 sequence. The second round of PCR can amplify the first PCR products using a nested gene specific primer flanked by Illumina sequencing primer 2 sequence, and a primer against the universal Illumina sequencing primer 1 sequence. The third round of PCR adds P5 and P7 and sample index to turn PCR products into an Illumina sequencing library. Sequencing using 150bp×2 sequencing can reveal the cell label and molecular label on read 1, the gene on read 2, and the sample index on index 1 read.
In some embodiments, nucleic acids can be removed from the substrate using chemical cleavage. For example, a chemical group or a modified base present in a nucleic acid can be used to facilitate its removal from a solid support. For example, an enzyme can be used to remove a nucleic acid from a substrate. For example, a nucleic acid can be removed from a substrate through a restriction endonucelase digestion. For example, treatment of a nucleic acid containing a dUTP or ddUTP with uracil-d-glycosylase (UDG) can be used to remove a nucleic acid from a substrate. For example, a nucleic acid can be removed from a substrate using an enzyme that performs nucleotide excision, such as a base excision repair enzyme, such as an apurinic/apyrimidinic (AP) endonuclease. In some embodiments, a nucleic acid can be removed from a substrate using a photocleavable group and light. In some embodiments, a cleavable linker can be used to remove a nucleic acid from the substrate. For example, the cleavable linker can comprise at least one of biotin/avidin, biotin/streptavidin, biotin/neutravidin, Ig-protein A, a photo-labile linker, acid or base labile linker group, or an aptamer.
When the probes are gene-specific, the molecules can hybridize to the probes and be reverse transcribed and/or amplified. In some embodiments, after the nucleic acid has been synthesized (e.g., reverse transcribed), it can be amplified. Amplification can be performed in a multiplex manner, wherein multiple target nucleic acid sequences are amplified simultaneously. Amplification can add sequencing adaptors to the nucleic acid.
In some embodiments, amplification can be performed on the substrate, for example, with bridge amplification. cDNAs can be homopolymer tailed in order to generate a compatible end for bridge amplification using oligo(dT) probes on the substrate. In bridge amplification, the primer that is complementary to the 3′ end of the template nucleic acid can be the first primer of each pair that is covalently attached to the solid particle. When a sample containing the template nucleic acid is contacted with the particle and a single thermal cycle is performed, the template molecule can be annealed to the first primer and the first primer is elongated in the forward direction by addition of nucleotides to form a duplex molecule consisting of the template molecule and a newly formed DNA strand that is complementary to the template. In the heating step of the next cycle, the duplex molecule can be denatured, releasing the template molecule from the particle and leaving the complementary DNA strand attached to the particle through the first primer. In the annealing stage of the annealing and elongation step that follows, the complementary strand can hybridize to the second primer, which is complementary to a segment of the complementary strand at a location removed from the first primer. This hybridization can cause the complementary strand to form a bridge between the first and second primers secured to the first primer by a covalent bond and to the second primer by hybridization. In the elongation stage, the second primer can be elongated in the reverse direction by the addition of nucleotides in the same reaction mixture, thereby converting the bridge to a double-stranded bridge. The next cycle then begins, and the double-stranded bridge can be denatured to yield two single-stranded nucleic acid molecules, each having one end attached to the particle surface via the first and second primers, respectively, with the other end of each unattached. In the annealing and elongation step of this second cycle, each strand can hybridize to a further complementary primer, previously unused, on the same particle, to form new single-strand bridges. The two previously unused primers that are now hybridized elongate to convert the two new bridges to double-strand bridges.
The amplification reactions can comprise amplifying at least, or at least about, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of the plurality of nucleic acids.
Amplification of the labeled nucleic acids can comprise PCR-based methods or non-PCR based methods. Amplification of the labeled nucleic acids can comprise exponential amplification of the labeled nucleic acids. Amplification of the labeled nucleic acids can comprise linear amplification of the labeled nucleic acids. Amplification can be performed by polymerase chain reaction (PCR). PCR can refer to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. PCR can encompass derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, digital PCR, suppression PCR, semi-suppressive PCR and assembly PCR.
In some embodiments, amplification of the labeled nucleic acids comprises non-PCR based methods. Examples of non-PCR based methods include, but are not limited to, multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, rolling circle amplification, or circle-to-circle amplification. Other non-PCR-based amplification methods include multiple cycles of DNA-dependent RNA polymerase-driven RNA transcription amplification or RNA-directed DNA synthesis and transcription to amplify DNA or RNA targets, a ligase chain reaction (LCR), a Qβ replicase (Qβ), use of palindromic probes, strand displacement amplification, oligonucleotide-driven amplification using a restriction endonuclease, an amplification method in which a primer is hybridized to a nucleic acid sequence and the resulting duplex is cleaved prior to the extension reaction and amplification, strand displacement amplification using a nucleic acid polymerase lacking 5′ exonuclease activity, rolling circle amplification, and/or ramification extension amplification (RAM).
In some embodiments, the methods disclosed herein further comprise conducting a nested polymerase chain reaction on the amplified amplicon (e.g., target). The amplicon can be double-stranded molecule. The double-stranded molecule can comprise a double-stranded RNA molecule, a double-stranded DNA molecule, or a RNA molecule hybridized to a DNA molecule. One or both of the strands of the double-stranded molecule can comprise a sample tag or molecular identifier label. Alternatively, the amplicon can be a single-stranded molecule. The single-stranded molecule can comprise DNA, RNA, or a combination thereof. The nucleic acids of the present invention can comprise synthetic or altered nucleic acids.
In some embodiments, the method comprises repeatedly amplifying the labeled nucleic acid to produce multiple amplicons. The methods disclosed herein can comprise conducting at least, or at least about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amplification reactions. Alternatively, the method comprises conducting at least, or at least about, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amplification reactions.
Amplification can further comprise adding one or more control nucleic acids to one or more samples comprising a plurality of nucleic acids. Amplification can further comprise adding one or more control nucleic acids to a plurality of nucleic acids. The control nucleic acids can comprise a control label.
Amplification can comprise use of one or more non-natural nucleotides. Non-natural nucleotides can comprise photolabile and/or triggerable nucleotides. Examples of non-natural nucleotides include, but are not limited to, peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Non-natural nucleotides can be added to one or more cycles of an amplification reaction. The addition of the non-natural nucleotides can be used to identify products as specific cycles or time points in the amplification reaction.
Conducting the one or more amplification reactions can comprise the use of one or more primers. The one or more primers can comprise one or more oligonucleotides. The one or more oligonucleotides can comprise at least about 7-9 nucleotides. The one or more oligonucleotides can comprise less than 12-15 nucleotides. The one or more primers can anneal to at least a portion of the plurality of labeled nucleic acids. The one or more primers can anneal to the 3′ end and/or 5′ end of the plurality of labeled nucleic acids. The one or more primers can anneal to an internal region of the plurality of labeled nucleic acids. The internal region can be at least or at least about, 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotides from the 3′ ends the plurality of labeled nucleic acids. The one or more primers can comprise a fixed panel of primers. The one or more primers can comprise at least one or more custom primers. The one or more primers can comprise at least one or more control primers. The one or more primers can comprise at least one or more housekeeping gene primers. The one or more primers can comprise a universal primer. The universal primer can anneal to a universal primer binding site. The one or more custom primers can anneal to the first sample tag, the second sample tag, the molecular identifier label, the nucleic acid or a product thereof. The one or more primers can comprise a universal primer and a custom primer. The custom primer can be designed to amplify one or more target nucleic acids. The target nucleic acids can comprise a subset of the total nucleic acids in one or more samples. In some embodiments, the primers are the probes attached to the array of the disclosure.
In some embodiments, stochastically barcoding the plurality of targets in the sample further comprises generating an indexed library of the stochastically barcoded fragments. The molecular labels of different stochastic barcodes can be different from one another. Generating an indexed library of the stochastically barcoded targets includes generating a plurality of indexed polynucleotides from the plurality of targets in the sample. For example, for an indexed library of the stochastically barcoded targets comprising a first indexed target and a second indexed target, the label region of the first indexed polynucleotide can differ from the label region of the second indexed polynucleotide by, by about, by at least, or by at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or a number or a range between any two of these values, nucleotides. In some embodiments, generating an indexed library of the stochastically barcoded targets includes contacting a plurality of targets, for example mRNA molecules, with a plurality of oligonucleotides including a poly(T) region and a label region; and conducting a first strand synthesis using a reverse transcriptase to produce single-strand labeled cDNA molecules each comprising a cDNA region and a label region, wherein the plurality of targets includes at least two mRNA molecules of different sequences and the plurality of oligonucleotides includes at least two oligonucleotides of different sequences. Generating an indexed library of the stochastically barcoded targets can further comprise amplifying the single-strand labeled cDNA molecules to produce double-strand labeled cDNA molecules; and conducting nested PCR on the double-strand labeled cDNA molecules to produce labeled amplicons. In some embodiments, the method can include generating an adaptor-labeled amplicon.
Stochastic barcoding can use nucleic acid barcodes or tags to label individual nucleic acid (e.g., DNA or RNA) molecules. In some embodiments, it involves adding DNA barcodes or tags to cDNA molecules as they are generated from mRNA. Nested PCR can be performed to minimize PCR amplification bias. Adaptors can be added for sequencing using, for example, next generation sequencing (NGS). The sequencing results can be used to determine cell labels, molecular labels, and sequences of nucleotide fragments of the one or more copies of the targets, for example at block 232 of FIG. 2 .
FIG. 3 is a schematic illustration showing a non-limiting exemplary process of generating an indexed library of the stochastically barcoded targets, for example mRNAs. As shown in step 1, the reverse transcription process can encode each mRNA molecule with a unique molecular label, a cell label, and a universal PCR site. In particular, RNA molecules 302 can be reverse transcribed to produce labeled cDNA molecules 304, including a cDNA region 306, by the stochastic hybridization of a set of molecular identifier labels 310 to the poly(A) tail region 308 of the RNA molecules 302. Each of the molecular identifier labels 310 can comprise a target-binding region, for example a poly(dT) region 312, a label region 314, and a universal PCR region 316.
In some embodiments, the cell label can include 3 to 20 nucleotides. In some embodiments, the molecular label can include 3 to 20 nucleotides. In some embodiments, each of the plurality of stochastic barcodes further comprises one or more of a universal label and a cell label, wherein universal labels are the same for the plurality of stochastic barcodes on the solid support and cell labels are the same for the plurality of stochastic barcodes on the solid support. In some embodiments, the universal label can include 3 to 20 nucleotides. In some embodiments, the cell label comprises 3 to 20 nucleotides.
In some embodiments, the label region 314 can include a molecular label 318 and a cell label 320. In some embodiments, the label region 314 can include one or more of a universal label, a dimension label, and a cell label. The molecular label 318 can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length. The cell label 320 can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length. The universal label can be, can be about, can be at least, or can be at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length. Universal labels can be the same for the plurality of stochastic barcodes on the solid support and cell labels are the same for the plurality of stochastic barcodes on the solid support. The dimension label can be, can be about, can be at least, or can be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length.
In some embodiments, the label region 314 can comprise, comprise about, comprise at least, or comprise at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any of these values, different labels, such as a molecular label 318 and a cell label 320. Each label can be, can be about, can be at least, or can be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or a number or a range between any of these values, of nucleotides in length. A set of molecular identifier labels 310 can contain, contain about, contain at least, or can be at most, 10, 20, 40, 50, 70, 80, 90, 102, 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1020, or a number or a range between any of these values, molecular identifier labels 310. And the set of molecular identifier labels 310 can, for example, each contain a unique label region 314. The labeled cDNA molecules 304 can be purified to remove excess molecular identifier labels 310. Purification can comprise Ampure bead purification.
As shown in step 2, products from the reverse transcription process in step 1 can be pooled into 1 tube and PCR amplified with a 1st PCR primer pool and a 1st universal PCR primer. Pooling is possible because of the unique label region 314. In particular, the labeled cDNA molecules 304 can be amplified to produce nested PCR labeled amplicons 322. Amplification can comprise multiplex PCR amplification. Amplification can comprise a multiplex PCR amplification with 96 multiplex primers in a single reaction volume. In some embodiments, multiplex PCR amplification can utilize, utilize about, utilize at least, or utilize at most, 10, 20, 40, 50, 70, 80, 90, 102, 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1020, or a number or a range between any of these values, multiplex primers in a single reaction volume. Amplification can comprise 1st PCR primer pool 324 of custom primers 326A-C targeting specific genes and a universal primer 328. The custom primers 326 can hybridize to a region within the cDNA portion 306′ of the labeled cDNA molecule 304. The universal primer 328 can hybridize to the universal PCR region 316 of the labeled cDNA molecule 304.
As shown in step 3 of FIG. 3 , products from PCR amplification in step 2 can be amplified with a nested PCR primers pool and a 2nd universal PCR primer. Nested PCR can minimize PCR amplification bias. In particular, the nested PCR labeled amplicons 322 can be further amplified by nested PCR. The nested PCR can comprise multiplex PCR with nested PCR primers pool 330 of nested PCR primers 332 a-c and a 2nd universal PCR primer 328′ in a single reaction volume. The nested PCR primer pool 328 can contain, contain about, contain at least, or contain at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any of these values, different nested PCR primers 330. The nested PCR primers 332 can contain an adaptor 334 and hybridize to a region within the cDNA portion 306″ of the labeled amplicon 322. The universal primer 328′ can contain an adaptor 336 and hybridize to the universal PCR region 316 of the labeled amplicon 322. Thus, step 3 produces adaptor-labeled amplicon 338. In some embodiments, nested PCR primers 332 and the 2nd universal PCR primer 328′ may not contain the adaptors 334 and 336. The adaptors 334 and 336 can instead be ligated to the products of nested PCR to produce adaptor-labeled amplicon 338.
As shown in step 4, PCR products from step 3 can be PCR amplified for sequencing using library amplification primers. In particular, the adaptors 334 and 336 can be used to conduct one or more additional assays on the adaptor-labeled amplicon 338. The adaptors 334 and 336 can be hybridized to primers 340 and 342. The one or more primers 340 and 342 can be PCR amplification primers. The one or more primers 340 and 342 can be sequencing primers. The one or more adaptors 334 and 336 can be used for further amplification of the adaptor-labeled amplicons 338. The one or more adaptors 334 and 336 can be used for sequencing the adaptor-labeled amplicon 338. The primer 342 can contain a plate index 344 so that amplicons generated using the same set of molecular identifier labels 318 can be sequenced in one sequencing reaction using next generation sequencing (NGS).
Correction of Amplification Noise
After reverse transcribing mRNA molecules into cDNA molecules (e.g., in 224 of FIG. 2 ), stochastic barcodes not incorporated into cDNA molecules can be removed by, for example, Ampure bead purification. The removal method, for example Ampure bead purification, may not completely remove the stochastic barcodes that are not extended by reverse transcription to be incorporated into stochastically barcoded cDNA molecules. For example, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, or a range between any of these two values of stochastic barcodes that are not extended by reverse transcription to be incorporated into stochastically barcoded cDNA molecules may not be removed by Ampure bead purification. These unremoved stochastic barcodes can, for example, result in amplification noises during amplification of cDNA molecules (e.g., in 228 of FIG. 2 ) for sequencing. The stochastic barcodes between samples can be highly similar, for example the stochastic barcodes can be identical except for the sample labels and the molecular labels. Thus, PCR cross over can occur because these unremoved stochastic barcodes can hybridize to other nucleic acid molecules from other samples, for example the stochastic barcode regions of stochastically barcoded mRNA molecules, during PCR and can result in amplification noises after sequencing (e.g., in 232 of FIG. 2 ).
Disclosed herein are methods for determining the number of targets in one or more samples, where the methods comprise one or more steps for correcting amplification noises. In some embodiments, the method comprises: determining a pre-correction number of a target; determining an amplification noise; and removing the amplification noise from the pre-correction number of the targets to generate the estimated number of the target. In some embodiments, the method comprises: stochastically barcoding a plurality of targets in each of one or more samples using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets, wherein for each sample, each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide; contacting one or more defined barcoded primers with each of the one or more samples, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined sample labels can be variants of the sample labels; amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and estimating the number of each of the plurality of targets, wherein estimating the number of each of the plurality of targets comprises: determining a pre-correction number of each of the plurality of targets using the molecular label; determining an amplification noise by determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers; and removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets. The method can be multiplexed.
Determine Molecular Label Counts
FIG. 4 is a flowchart showing a non-limiting exemplary embodiment of removing amplification noise caused by PCR crossover. The embodiment 400 starts at beginning block 404. At block 408, a plurality of targets in each of one or more samples can be stochastically barcoded using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets. In some embodiments, stochastically barcoding the plurality of targets comprises hybridizing the plurality of oligonucleotides comprising the stochastic barcodes with the plurality of targets to generate the stochastically barcoded targets. For each sample, a stochastic barcode can comprise a molecular label and an identical sample label. The molecular labels of at least two stochastic barcodes can differ from one another by at least one nucleotide.
At block 412, the stochastically barcoded targets can be optionally pooled, for example, into a tube to generate a pool of stochastically barcoded targets. At block 416, one or more defined barcoded primers can be contacted with each of the one or more samples. For example, if the stochastically barcoded targets have been pooled into a tube to generate a pool of stochastically barcoded target, then defined barcoded primers can be added to the pool of stochastically barcoded targets. As another example, if the stochastically barcoded targets have not been pooled into a tube, then defined barcoded primers can be added to one or more samples. The defined barcoded primers added to different samples can be the same or can be different, for example, defined barcoded primers for different genes. In some embodiments, contacting the one or more defined barcoded primers with each of the one or more samples comprises introducing the one or more defined barcoded primers at the same concentration of the plurality of oligonucleotides comprising the stochastic barcodes.
Defined barcoded primers can be variants of the stochastic barcodes. For example, a defined barcoded primer can have a corresponding stochastic barcode, where the defined barcoded primer is a variant of the corresponding stochastic barcode. The defined barcoded primer can have a different sequence in one or more regions as compared to the corresponding stochastic barcode. For example, a defined barcoded primer can comprise a defined sample label and a defined molecular label.
In some embodiments, the defined sample label of a defined barcoded primer can be a variant of the sample label of a stochastic barcode (e.g., the sample label of the corresponding stochastic barcode). For example, the defined sample label differs from the sample label in one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides. The defined sample label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The sample label can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The defined sample label and the sample label, for example, a defined sample label of a defined barcoded primer and a sample label of the corresponding stochastic barcode, can have the same length or different length. For example, the defined sample label and the sample label can both be 8 nucleotides in length. In some embodiments, the sequence of the defined sample label and the sequence of the sample label can differ by one nucleotide. In some embodiments, the Hamming distance between the defined sample label and the sample label can be 2 or 4.
In some embodiments, the defined molecular label of a defined barcoded primer can be a variant of the molecular label of a stochastic barcode (e.g., the molecular label of the corresponding stochastic barcode). For example, the sequence of the defined molecular label and the sequence of the molecular label differ by one, two, three, four, five, six, seven, eight, nine, ten, or a range between any two of these values, nucleotides. The defined molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The molecular label can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, or a range between any two of these values, nucleotides in length. The defined molecular label and the molecular label, for example a defined molecular label of a defined barcoded primer and a molecular label of the corresponding stochastic barcode, can have the same length. For example, the defined molecular label and the molecular label can both be 8 nucleotides in length. The defined molecular labels of different defined barcoded primers can be different from one another. The molecular labels of different stochastic barcodes can be different from one another. Some molecular labels of the stochastic barcodes and some defined molecular labels of the defined barcoded primers can have the same sequence.
In some embodiments, the one or more defined barcoded primers can comprise one or more types of defined barcoded primers. As disclosed herein, there can be different types of stochastic barcodes. In some embodiments, one type of defined barcoded primers can have a corresponding type of stochastic barcodes, where the one type of the defined barcoded primers is a variant of the corresponding type of stochastic barcodes. For example, one type of defined barcoded primers and the corresponding type of stochastic barcodes can both include poly(T) regions as their target binding region. Other types of defined barcoded primers and their corresponding types of stochastic barcodes can both include gene specific target binding regions. For example, one type of defined barcoded primers and the corresponding type of stochastic barcode can both include target binding regions for TCR alpha. As another example, another type of defined barcoded primer and its corresponding type of stochastic barcodes can include target binding regions for TCR alpha. In some embodiments, the defined sample labels of one type of defined barcoded primers and the sample labels of the corresponding type of stochastic barcodes can have different sequences.
In some embodiments, the defined sample labels of the same type of defined barcoded primers can have the same sequence. The defined molecular labels of the same type of defined barcoded primers can differ from one another by at least one nucleotide. The sample labels of different types of stochastic barcodes can have different sequences. Some defined molecular labels of different types of defined barcoded primers can have the same sequence. Different types of defined barcoded primers can have the same length. The lengths of different types of defined barcoded primers can be different. In some embodiments, the lengths of different types of defined barcoded primers can differ by, or by about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between any two of these values, nucleotides. In some embodiments, the lengths of different types of defined barcoded primers can differ by at least, or by at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. The defined sample labels of different types of defined barcoded primers can have different sequences. The sample label and the defined sample label can have the same length.
The Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be more than 0. In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be, or be about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or a number or a range between any two of these values. In some embodiments, the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers can be at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. The stochastic barcodes and the one or more types of defined barcoded primers can have the same length or different lengths.
At block 420, the oligonucleotides comprising stochastic barcodes that are not incorporated into the stochastically barcoded targets, and the defined barcoded primers from each of the one or more samples can be removed. The percentage of unincorporated stochastic barcodes not removed can vary. In some embodiments, the percentage of unincorporated stochastic barcodes not removed can be, or be about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or a number or a range between any two of these values. In some embodiments, the percentage of unincorporated stochastic barcodes not removed can be at least, or at most, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
The percentage of the one or more defined barcoded primers not removed from each of the one or more samples can be substantially the same as the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples. In some embodiments, the percentage of the one or more defined barcoded primers not removed from each of the one or more samples and the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from each of the one or more samples can be within can be within 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, or a number or a range between any two of these values, of each other.
At block 424, the stochastically barcoded targets and the one or more defined barcoded primers can be amplified to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers. In some embodiments, amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers comprises amplifying the stochastically barcoded targets and the one or more defined barcoded primers by polymerase chain reaction (PCR).
At block 428, the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can be sequenced, by for example next generation sequencing (described in further details below). At block 432, a pre-correction number of each of the plurality of targets using the molecular label can be determined. In some embodiments, determining the pre-correction number of each of the plurality of targets using the molecular label comprises: determining sequences of molecular labels of the amplified stochastically barcoded targets; and counting the number of the molecular labels with different sequences. Determining the sequences of the molecular labels of the amplified stochastically barcoded targets can comprise sequencing some or all of the plurality of amplified stochastically barcoded targets. Sequencing some or all of the amplified stochastically barcoded targets can comprise generating sequences of the amplified stochastically barcoded targets. The read length of a sequence can vary. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any two of these values, bases. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 bases.
At block 436, an amplification noise can be determined. The amplification noise can be determined by the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers. In some embodiments, determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises: determining sequences of the defined molecular labels of the amplified defined barcoded primers; and counting the number of defined molecular labels with different sequences. Determining the sequences of the defined molecular labels of the amplified defined barcoded primers can comprise sequencing some or all of the plurality of amplified defined barcoded primers. Sequencing some or all of the plurality of amplified defined barcoded primers can comprise generating sequences of the amplified defined barcoded primers. The read length of a sequence can vary. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or a number or a range between any two of these values, bases. In some embodiments, the read length of a sequence can be, or be about, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 bases.
In some embodiments, determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets comprises determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers. Determining the amplification noise can comprise determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded can comprise determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
In some embodiments, determining the amplification noise comprises determining the number of defined molecular labels with different sequences in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers can comprise determining the maximum number of defined molecular labels in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers. The amplification noise can comprise noise caused by PCR crossover.
At block 440, the number of each of the plurality of targets can be estimated. Estimating the number of each of the plurality of targets can comprise: removing the amplification noise from the pre-correction number of each of the plurality of targets to generate the estimated number of each of the plurality of targets. The embodiment 400 ends at block 444.
The embodiment 400 can be used for determining amplification noise. In some embodiments, stochastically barcoding a plurality of targets using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets can comprise reverse transcribing the plurality targets in each of one or more samples using oligonucleotides comprising reverse transcription primers to generate reverse transcribed targets.
The embodiment 400 can be used, for example, for determining the number of targets in microwells of a microwell array. In some embodiments, stochastically barcoding a plurality of targets using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets can comprise stochastically barcoding a plurality of targets in each of one or more samples in microwells of a microwell array using a plurality of oligonucleotides comprising stochastic barcodes to generate stochastically barcoded targets. For each well, each stochastic barcode can comprise a molecular label and an identical sample label. The molecular labels of at least two stochastic barcodes can differ from one another by at least one nucleotide.
Sequencing
In some embodiments, estimating the number of different stochastically barcoded targets can comprise determining the sequences of the labeled targets, the spatial label, the molecular label, the sample label, the cell label, or any product thereof (e.g. labeled-amplicons, or labeled-cDNA molecules). An amplified target can be subjected to sequencing. Determining the sequence of the stochastically barcoded target or any product thereof can comprise conducting a sequencing reaction to determine the sequence of at least a portion of a sample label, a spatial label, a cell label, a molecular label, at least a portion of the stochastically labeled target, a complement thereof, a reverse complement thereof, or any combination thereof.
Determination of the sequence of a stochastically barcoded target (e.g. amplified nucleic acid, labeled nucleic acid, cDNA copy of a labeled nucleic acid, etc.) can be performed using variety of sequencing methods including, but not limited to, sequencing by hybridization (SBH), sequencing by ligation (SBL), quantitative incremental fluorescent nucleotide addition sequencing (QIFNAS), stepwise ligation and cleavage, fluorescence resonance energy transfer (FRET), molecular beacons, TaqMan reporter probe digestion, pyrosequencing, fluorescent in situ sequencing (FISSEQ), FISSEQ beads, wobble sequencing, multiplex sequencing, polymerized colony (POLONY) sequencing; nanogrid rolling circle sequencing (ROLONY), allele-specific oligo ligation assays (e.g., oligo ligation assay (OLA), single template molecule OLA using a ligated linear probe and a rolling circle amplification (RCA) readout, ligated padlock probes, or single template molecule OLA using a ligated circular padlock probe and a rolling circle amplification (RCA) readout), and the like.
In some embodiments, determining the sequence of the stochastically barcoded target or any product thereof comprises paired-end sequencing, nanopore sequencing, high-throughput sequencing, shotgun sequencing, dye-terminator sequencing, multiple-primer DNA sequencing, primer walking, Sanger dideoxy sequencing, Maxim-Gilbert sequencing, pyrosequencing, true single molecule sequencing, or any combination thereof. Alternatively, the sequence of the stochastically barcoded target or any product thereof can be determined by electron microscopy or a chemical-sensitive field effect transistor (chemFET) array.
High-throughput sequencing methods, such as cyclic array sequencing using platforms such as Roche 454, Illumina Solexa, ABI-SOLiD, ION Torrent, Complete Genomics, Pacific Bioscience, Helicos, or the Polonator platform, can also be utilized. In some embodiment, sequencing can comprise MiSeq sequencing. In some embodiment, sequencing can comprise HiSeq sequencing.
The stochastically labeled targets can comprise nucleic acids representing from about 0.01% of the genes of an organism's genome to about 100% of the genes of an organism's genome. For example, about 0.01% of the genes of an organism's genome to about 100% of the genes of an organism's genome can be sequenced using a target complimentary region comprising a plurality of multimers by capturing the genes containing a complimentary sequence from the sample. In some embodiments, the stochastically barcoded targets comprise nucleic acids representing from about 0.01% of the transcripts of an organism's transcriptome to about 100% of the transcripts of an organism's transcriptome. For example, about 0.501% of the transcripts of an organism's transcriptome to about 100% of the transcripts of an organism's transcriptome can be sequenced using a target complimentary region comprising a poly(T) tail by capturing the mRNAs from the sample.
Determining the sequences of the spatial labels and the molecular labels of the plurality of the stochastic barcodes can include sequencing 0.00001%, 0.0001%, 0.001%, 0.01%, 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, 100%, or a number or a range between any two of these values, of the plurality of stochastic barcodes. Determining the sequences of the labels of the plurality of stochastic barcodes, for example the sample labels, the spatial labels, and the molecular labels, can include sequencing 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1015, 1019, 1020, or a number or a range between any two of these values, of the plurality of stochastic barcodes. Sequencing some or all of the plurality of stochastic barcodes can include generating sequences with read lengths of, of about, of at least, or of at most, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or a number or a range between any two of these values, of nucleotides or bases.
Sequencing can comprise sequencing at least or at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides or base pairs of the stochastically barcoded targets. For example, sequencing can comprise generating sequencing data with sequences with read lengths of 50, 75, or 100, or more nucleotides by performing polymerase chain reaction (PCR) amplification on the plurality of stochastically barcoded targets. Sequencing can comprise sequencing at least or at least about 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more nucleotides or base pairs of the stochastically barcoded targets. Sequencing can comprise sequencing at least or at least about 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 or more nucleotides or base pairs of the stochastically barcoded targets.
Sequencing can comprise at least about 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more sequencing reads per run. In some embodiments, sequencing comprises sequencing at least or at least about 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 or more sequencing reads per run. Sequencing can comprise less than or equal to about 1,600,000,000 sequencing reads per run. Sequencing can comprise less than or equal to about 200,000,000 reads per run.
Samples
In some embodiments, the plurality of targets can be comprised in one or more samples. A sample can comprise one or more cells, or nucleic acids from one or more cells. A sample can be, for example, a single cell or nucleic acids from a single cell. The one or more cells can be of one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof.
A sample for use in the method of the disclosure can comprise one or more cells. A sample can refer to one or more cells. In some embodiments, the plurality of cells can include one or more cell types. At least one of the one or more cell types can be brain cell, heart cell, cancer cell, circulating tumor cell, organ cell, epithelial cell, metastatic cell, benign cell, primary cell, circulatory cell, or any combination thereof. In some embodiments, the cells are cancer cells excised from a cancerous tissue, for example, breast cancer, lung cancer, colon cancer, prostate cancer, ovarian cancer, pancreatic cancer, brain cancer, melanoma and non-melanoma skin cancers, and the like. In some embodiments, the cells are derived from a cancer but collected from a bodily fluid (e.g. circulating tumor cells). Non-limiting examples of cancers can include, adenoma, adenocarcinoma, squamous cell carcinoma, basal cell carcinoma, small cell carcinoma, large cell undifferentiated carcinoma, chondrosarcoma, and fibrosarcoma. The sample can include a tissue, a cell monolayer, fixed cells, a tissue section, or any combination thereof. The sample can include a biological sample, a clinical sample, an environmental sample, a biological fluid, a tissue, or a cell from a subject. The sample can be obtained from a human, a mammal, a dog, a rat, a mouse, a fish, a fly, a worm, a plant, a fungus, a bacterium, a virus, a vertebrate, or an invertebrate.
In some embodiments, the cells are cells that have been infected with virus and contain viral oligonucleotides. In some embodiments, the viral infection can be caused by a virus such as single-stranded (+ strand or “sense”) DNA viruses (e.g. parvoviruses), or double-stranded RNA viruses (e.g. reoviruses). In some embodiments, the cells are bacteria. These can include either gram-positive or gram-negative bacteria. In some embodiments, the cells are fungi. In some embodiments, the cells are protozoans or other parasites.
As used herein, the term “cell” can refer to one or more cells. In some embodiments, the cells are normal cells, for example, human cells in different stages of development, or human cells from different organs or tissue types. In some embodiments, the cells are non-human cells, for example, other types of mammalian cells (e.g. mouse, rat, pig, dog, cow, or horse). In some embodiments, the cells are other types of animal or plant cells. In other embodiments, the cells can be any prokaryotic or eukaryotic cells.
In some embodiments the cells are sorted prior to associating a cell with a bead. For example the cells can be sorted by fluorescence-activated cell sorting or magnetic-activated cell sorting, or more generally by flow cytometry. The cells can be filtered by size. In some embodiments a retentate contains the cells to be associated with the bead. In some embodiments the flow through contains the cells to be associated with the bead.
A sample can refer to a plurality of cells. The sample can refer to a monolayer of cells. The sample can refer to a thin section (e.g., tissue thin section). The sample can refer to a solid or semi-solid collection of cells that can be place in one dimension on an array.
Devices
Disclosed herein are kits for determining the number of targets in one or more samples. In some embodiments, a kit comprises: a plurality of oligonucleotides comprising stochastic barcodes, wherein each stochastic barcode comprises a sample label and a molecular label, wherein the sample labels of at least two stochastic barcodes have different sequences, and wherein the molecular labels of stochastic barcodes with sample labels of the same sequence differ from one another by at least one nucleotide; defined barcoded primers, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers can be variants of the sample labels of the stochastic barcodes, and wherein the Hamming distance between the sample label and the defined sample label is at least 2; and instructions for using the plurality oligonucleotides comprising the plurality of oligonucleotides and the defined barcoded primers.
Flow Cells
The microwell array substrate can be packaged within a flow cell that provides for convenient interfacing with the rest of the fluid handling system and facilitates the exchange of fluids, e.g. cell and solid support suspensions, lysis buffers, rinse buffers, etc., that are delivered to the microwell array and/or emulsion droplet. Design features can include: (i) one or more inlet ports for introducing cell samples, solid support suspensions, or other assay reagents, (ii) one or more microwell array chambers designed to provide for uniform filling and efficient fluid-exchange while minimizing back eddies or dead zones, and (iii) one or more outlet ports for delivery of fluids to a sample collection point or a waste reservoir. The design of the flow cell can include a plurality of microarray chambers that interface with a plurality of microwell arrays such that one or more different cell samples can be processed in parallel. The design of the flow cell can further include features for creating uniform flow velocity profiles, i.e. “plug flow”, across the width of the array chamber to provide for more uniform delivery of cells and beads to the microwells, for example, by using a porous barrier located near the chamber inlet and upstream of the microwell array as a “flow diffuser”, or by dividing each array chamber into several subsections that collectively cover the same total array area, but through which the divided inlet fluid stream flows in parallel. In some embodiments, the flow cell can enclose or incorporate more than one microwell array substrate. In some embodiments, the integrated microwell array/flow cell assembly can constitute a fixed component of the system. In some embodiments, the microwell array/flow cell assembly can be removable from the instrument.
In general, the dimensions of fluid channels and the array chamber(s) in flow cell designs will be optimized to (i) provide uniform delivery of cells and beads to the microwell array, and (ii) to minimize sample and reagent consumption. In some embodiments, the width of fluid channels will be between 50 um and 20 mm. In other embodiments, the width of fluid channels can be at least 50 um, at least 100 um, at least 200 um, at least 300 um, at least 400 um, at least 500 um, at least 750 um, at least 1 mm, at least 2.5 mm, at least 5 mm, at least 10 mm, at least 20 mm, at least 50 mm, at least 100 mm, or at least 150 mm. In yet other embodiments, the width of fluid channels can be at most 150 mm, at most 100 mm, at most 50 mm, at most 20 mm, at most 10 mm, at most 5 mm, at most 2.5 mm, at most 1 mm, at most 750 um, at most 500 um, at most 400 um, at most 300 um, at most 200 um, at most 100 um, or at most 50 um. In one embodiment, the width of fluid channels is about 2 mm. The width of the fluid channels can fall within any range bounded by any of these values (e.g. from about 250 um to about 3 mm).
In some embodiments, the depth of the fluid channels will be between 50 um and 2 mm. In other embodiments, the depth of fluid channels can be at least 50 um, at least 100 um, at least 200 um, at least 300 um, at least 400 um, at least 500 um, at least 750 um, at least 1 mm, at least 1.25 mm, at least 1.5 mm, at least 1.75 mm, or at least 2 mm. In yet other embodiments, the depth of fluid channels can at most 2 mm, at most 1.75 mm, at most 1.5 mm, at most 1.25 mm, at most 1 mm, at most 750 um, at most 500 um, at most 400 um, at most 300 um, at most 200 um, at most 100 um, or at most 50 um. In one embodiment, the depth of the fluid channels is about 1 mm. The depth of the fluid channels can fall within any range bounded by any of these values (e.g. from about 800 um to about 1 mm).
Flow cells can be fabricated using a variety of techniques and materials known to those of skill in the art. In general, the flow cell will be fabricated as a separate part and subsequently either mechanically clamped or permanently bonded to the microwell array substrate. Examples of suitable fabrication techniques include conventional machining, CNC machining, injection molding, 3D printing, alignment and lamination of one or more layers of laser or die-cut polymer films, or any of a number of microfabrication techniques such as photolithography and wet chemical etching, dry etching, deep reactive ion etching, or laser micromachining. Once the flow cell part has been fabricated it can be attached to the microwell array substrate mechanically, e.g. by clamping it against the microwell array substrate (with or without the use of a gasket), or it can be bonded directly to the microwell array substrate using any of a variety of techniques (depending on the choice of materials used) known to those of skill in the art, for example, through the use of anodic bonding, thermal bonding, or any of a variety of adhesives or adhesive films, including epoxy-based, acrylic-based, silicone-based, UV curable, polyurethane-based, or cyanoacrylate-based adhesives.
Flow cells can be fabricated using a variety of materials known to those of skill in the art. In general, the choice of material used will depend on the choice of fabrication technique used, and vice versa. Examples of suitable materials include, but are not limited to, silicon, fused-silica, glass, any of a variety of polymers, e.g. polydimethylsiloxane (PDMS; elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers (COL), polyethylene terephthalate (PET), epoxy resins, metals (e.g. aluminum, stainless steel, copper, nickel, chromium, and titanium), a non-stick material such as teflon (PTFE), or a combination of these materials.
Cartridges
In some embodiments of the system, the microwell array, with or without an attached flow cell, can be packaged within a consumable cartridge that interfaces with the instrument system. Design features of cartridges can include (i) one or more inlet ports for creating fluid connections with the instrument or manually introducing cell samples, bead suspensions, or other assay reagents into the cartridge, (ii) one or more bypass channels, i.e. for self-metering of cell samples and bead suspensions, to avoid overfilling or back flow, (iii) one or more integrated microwell array/flow cell assemblies, or one or more chambers within which the microarray substrate(s) are positioned, (iv) integrated miniature pumps or other fluid actuation mechanisms for controlling fluid flow through the device, (v) integrated miniature valves (or other containment mechanisms) for compartmentalizing pre-loaded reagents (for example, bead suspensions) or controlling fluid flow through the device, (vi) one or more vents for providing an escape path for trapped air, (vii) one or more sample and reagent waste reservoirs, (viii) one or more outlet ports for creating fluid connections with the instrument or providing a processed sample collection point, (ix) mechanical interface features for reproducibly positioning the removable, consumable cartridge with respect to the instrument system, and for providing access so that external magnets can be brought into close proximity with the microwell array, (x) integrated temperature control components or a thermal interface for providing good thermal contact with the instrument system, and (xi) optical interface features, e.g. a transparent window, for use in optical interrogation of the microwell array.
The cartridge can be designed to process more than one sample in parallel. The cartridge can further comprise one or more removable sample collection chamber(s) that are suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments. The cartridge itself can be suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments. The term “cartridge” as used in this disclosure can be meant to include any assembly of parts which contains the sample and beads during performance of the assay.
The cartridge can further comprise components that are designed to create physical or chemical barriers that prevent diffusion of (or increase path lengths and diffusion times for) large molecules in order to minimize cross-contamination between microwells. Examples of such barriers can include, but are not limited to, a pattern of serpentine channels used for delivery of cells and solid supports (e.g., beads) to the microwell array, a retractable platen or deformable membrane that is pressed into contact with the surface of the microwell array substrate during lysis or incubation steps, the use of larger beads, e.g. Sephadex beads as described previously, to block the openings of the microwells, or the release of an immiscible, hydrophobic fluid from a reservoir within the cartridge during lysis or incubation steps, to effectively separate and compartmentalize each microwell in the array.
The dimensions of fluid channels and the array chamber(s) in cartridge designs can be optimized to (i) provide uniform delivery of cells and beads to the microwell array, and (ii) to minimize sample and reagent consumption. The width of fluid channels can be between 50 micrometers and 20 mm. In other embodiments, the width of fluid channels can be at least 50 micrometers, at least 100 micrometers, at least 200 micrometers, at least 300 micrometers, at least 400 micrometers, at least 500 micrometers, at least 750 micrometers, at least 1 mm, at least 2.5 mm, at least 5 mm, at least 10 mm, or at least 20 mm. In yet other embodiments, the width of fluid channels can at most 20 mm, at most 10 mm, at most 5 mm, at most 2.5 mm, at most 1 mm, at most 750 micrometers, at most 500 micrometers, at most 400 micrometers, at most 300 micrometers, at most 200 micrometers, at most 100 micrometers, or at most 50 micrometers. The width of fluid channels can be about 2 mm. The width of the fluid channels can fall within any range bounded by any of these values (e.g. from about 250 um to about 3 mm).
The fluid channels in the cartridge can have a depth. The depth of the fluid channels in cartridge designs can be between 50 micrometers and 2 mm. The depth of fluid channels can be at least 50 micrometers, at least 100 micrometers, at least 200 micrometers, at least 300 micrometers, at least 400 micrometers, at least 500 micrometers, at least 750 micrometers, at least 1 mm, at least 1.25 mm, at least 1.5 mm, at least 1.75 mm, or at least 2 mm. The depth of fluid channels can at most 2 mm, at most 1.75 mm, at most 1.5 mm, at most 1.25 mm, at most 1 mm, at most 750 micrometers, at most 500 micrometers, at most 400 micrometers, at most 300 micrometers, at most 200 micrometers, at most 100 micrometers, or at most 50 micrometers. The depth of the fluid channels can be about 1 mm. The depth of the fluid channels can fall within any range bounded by any of these values (e.g. from about 800 micrometers to about 1 mm).
Cartridges can be fabricated using a variety of techniques and materials known to those of skill in the art. In general, the cartridges will be fabricated as a series of separate component parts (FIGS. 5A-5C) and subsequently assembled using any of a number of mechanical assemblies or bonding techniques. Examples of suitable fabrication techniques include, but are not limited to, conventional machining, CNC machining, injection molding, thermoforming, and 3D printing. Once the cartridge components have been fabricated they can be mechanically assembled using screws, clips, and the like, or permanently bonded using any of a variety of techniques (depending on the choice of materials used), for example, through the use of thermal bonding/welding or any of a variety of adhesives or adhesive films, including epoxy-based, acrylic-based, silicone-based, UV curable, polyurethane-based, or cyanoacrylate-based adhesives.
Cartridge components can be fabricated using any of a number of suitable materials, including but not limited to silicon, fused-silica, glass, any of a variety of polymers, e.g. polydimethylsiloxane (PDMS; elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers (COL), polyethylene terephthalate (PET), epoxy resins, non-stick materials such as teflon (PTFE), metals (e.g. aluminum, stainless steel, copper, nickel, chromium, and titanium), or any combination thereof.
The inlet and outlet features of the cartridge can be designed to provide convenient and leak-proof fluid connections with the instrument, or can serve as open reservoirs for manual pipetting of samples and reagents into or out of the cartridge. Examples of convenient mechanical designs for the inlet and outlet port connectors can include, but are not limited to, threaded connectors, Luer lock connectors, Luer slip or “slip tip” connectors, press fit connectors, and the like. The inlet and outlet ports of the cartridge can further comprise caps, spring-loaded covers or closures, or polymer membranes that can be opened or punctured when the cartridge is positioned in the instrument, and which serve to prevent contamination of internal cartridge surfaces during storage or which prevent fluids from spilling when the cartridge is removed from the instrument. The one or more outlet ports of the cartridge can further comprise a removable sample collection chamber that is suitable for interfacing with stand-alone PCR thermal cyclers or sequencing instruments.
The cartridge can include integrated miniature pumps or other fluid actuation mechanisms for control of fluid flow through the device. Examples of suitable miniature pumps or fluid actuation mechanisms can include, but are not limited to, electromechanically- or pneumatically-actuated miniature syringe or plunger mechanisms, membrane diaphragm pumps actuated pneumatically or by an external piston, pneumatically-actuated reagent pouches or bladders, or electro-osmotic pumps.
The cartridge can include miniature valves for compartmentalizing pre-loaded reagents or controlling fluid flow through the device. Examples of suitable miniature valves can include, but are not limited to, one-shot “valves” fabricated using wax or polymer plugs that can be melted or dissolved, or polymer membranes that can be punctured; pinch valves constructed using a deformable membrane and pneumatic, magnetic, electromagnetic, or electromechanical (solenoid) actuation, one-way valves constructed using deformable membrane flaps, and miniature gate valves.
The cartridge can include vents for providing an escape path for trapped air. Vents can be constructed according to a variety of techniques, for example, using a porous plug of polydimethylsiloxane (PDMS) or other hydrophobic material that allows for capillary wicking of air but blocks penetration by water.
The mechanical interface features of the cartridge can provide for easily removable but highly precise and repeatable positioning of the cartridge relative to the instrument system. Suitable mechanical interface features can include, but are not limited to, alignment pins, alignment guides, mechanical stops, and the like. The mechanical design features can include relief features for bringing external apparatus, e.g. magnets or optical components, into close proximity with the microwell array chamber (FIG. 5B).
The cartridge can also include temperature control components or thermal interface features for mating to external temperature control modules. Examples of suitable temperature control elements can include, but are not limited to, resistive heating elements, miniature infrared-emitting light sources, Peltier heating or cooling devices, heat sinks, thermistors, thermocouples, and the like. Thermal interface features can be fabricated from materials that are good thermal conductors (e.g. copper, gold, silver, etc.) and can comprise one or more flat surfaces capable of making good thermal contact with external heating blocks or cooling blocks.
The cartridge can include optical interface features for use in optical imaging or spectroscopic interrogation of the microwell array. The cartridge can include an optically transparent window, e.g. the microwell substrate itself or the side of the flow cell or microarray chamber that is opposite the microwell array, fabricated from a material that meets the spectral requirements for the imaging or spectroscopic technique used to probe the microwell array. Examples of suitable optical window materials can include, but are not limited to, glass, fused-silica, polymethylmethacrylate (PMMA), polycarbonate (PC), cyclic olefin polymers (COP), or cyclic olefin copolymers (COL).
While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
EXAMPLES
Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure.
Example 1 Removing Amplification Noises
This example demonstrates removing amplification noises. After determining the amplification noises, the amplification noises were subtracted from the pre-correction numbers of targets in samples to generate the estimated numbers of targets.
Experimental Protocol
Single cells were deposited into BD Precise™ 96-well plates that did not include defined barcoded primers (DBPs). Each well contained stochastic barcodes with different molecular labels and the same sample label to identify the sample origins. The stochastic barcodes were used as reverse transcription (RT) primers for generating complementary deoxyribonucleic acid (cDNA). The reaction volume per well during reverse transcription was 10 μL. The concentration of the defined barcoded primers during reverse transcription was 0.2 μM.
After reverse transcription, cDNAs from each well were pooled together into a single tube. Only about 8 μL of reaction mixture was recovered from the 10 μL reaction volume. After pooling, 8 μL of a defined barcoded primer mixture, including 4 DBPs at 0.2 uM each, was added into the pooled tube to create a combined reaction mixture. Primers were removed from the combined reaction mixture using Ampure XP beads (Beckman Coulter Inc. (Brea, Calif.)) for subsequent library preparation steps.
Computation Error Correction
Table 1 shows experimental data of the sequencing readouts derived from 3 different types of defined barcoded that were mixed together: 1) oligo(dT) primers; 2) TRAC primers for T Cell Receptor Alpha C Region; and 3) TRBC primers for T Cell Receptor Beta C Region. Table 2 shows the 3 different types of defined barcoded primers, each with 4 different defined barcoded primers. The defined sample labels, bolded in Table 2, were used to identify the amplification noises from DBP crossover. The defined molecular labels are underlined.
The oligo(dT) primer captured poly(A) RNA transcripts, and TRAC and TRBC captured only the T Cell Receptor genes. For the oligo(dT)-primed cDNAs, approximately 100 genes were amplified into the final library. For each RT-primer derived read and each non-RT-primer derived read, the number of molecular labels within each read was determined. In Table 1, X01-X04 show the 4 defined barcoded primers used, and A01-A12 show to actual wells with samples.
TABLE 1
Sequencing readouts derived from 3 different RT primers
TRAC TRBC Oligo(dT) TRAC TRBC Oligo(dT)
Sample Reads Reads Reads ML MLs MLs
X01 88 78 528 28 21 122
X02 40 39 949 30 17 111
X03 36 10 86 27 8 53
X04 58 33 216 31 14 116
A01 24957 7357 54806 214 87 827
A02 656 171 20406 133 67 682
A03 3136 3677 16791 104 52 445
A04 16126 1332 11934 78 64 430
A05 11847 15601 42007 115 128 589
A06 7083 5172 39541 125 84 679
A07 11646 83 30812 170 45 664
A08 23720 13598 37545 175 100 666
A09 4456 7463 13628 104 77 367
A10 60 62 29830 37 36 426
A11 12730 24718 28377 159 168 528
A12 7472 2939 24293 111 56 537
TABLE 2
Sequences of defined barcoded primers mimicking Oligo(dT)
RT primers, TCR alpha RT primers, TCR beta RT primers
Seq ID
DBP Type Defined Barcoded Primer Sequences No
Mimicking ACACGACGCTCTTCCGATCTAGCATCAC NNNNNNNNTTTTTTTTTTTTT  1
Oligo(dT) TTTTTV
RT primers ACACGACGCTCTTCCGATCTCATATACA NNNNNNNNTTTTTTTTTTTTT  2
TTTTTV
ACACGACGCTCTTCCGATCTGTAATGTT NNNNNNNNTTTTTTTTTTTTT
 3
TTTTTV
ACACGACGCTCTTCCGATCTTGATTAGT NNNNNNNNTTTTTTTTTTTTT
 4
TTTTTV
Mimicking ACACGACGCTCTTCCGATCTAGCATCAC NNNNNNNNCAGACAGACTTGT  5
TCR alpha ACACGACGCTCTTCCGATCTCATATACA NNNNNNNNCAGACAGACTTGT  6
RT primers ACACGACGCTCTTCCGATCTGTAATGTT NNNNNNNNCAGACAGACTTGT  7
ACACGACGCTCTTCCGATCTTGATTAGT NNNNNNNNCAGACAGACTTGT  8
Mimicking ACACGACGCTCTTCCGATCTAGCATCAC NNNNNNNNCCTTTTGGGTGTG  9
TCR beta ACACGACGCTCTTCCGATCTCATATACA NNNNNNNNCCTTTTGGGTGTG 10
RT primers ACACGACGCTCTTCCGATCTGTAATGTT NNNNNNNNCCTTTTGGGTGTG 11
ACACGACGCTCTTCCGATCTTGATTAGT NNNNNNNNCCTTTTGGGTGTG 12
Once the amplification noise for each gene in the library was defined, a cross-panel noise deduction was performed to correct for PCR crossover errors according to Equation 1.
Final ML Read Count=(ML Read Count from Signal wells)−(ML Read Count from DBP).  (1)
This subtraction was done on a gene-by-gene basis. For example, if Oligo(dT) RT primer was used to label GAPDH and CD3D and identified 40 and 8 MLs respectively, and the Oligo(dT) DBP identified 2 and 1 MI as noise, the final output would be 38 MI for GAPDH, and 7 MI for CD3D.
FIGS. 6A-D show bar charts of molecular label counts vs. wells for GAPDH and CD3D before and after correction for PCR amplification noises. FIGS. 6A-B show bar charts of molecular label counts vs. wells for GAPDH before (FIG. 6A) and after correction (FIG. 6B) for PCR amplification noises. FIGS. 6C-D show bar charts of molecular label counts vs. wells for CD3D before (FIG. 6C) and after correction (FIG. 6D) for PCR amplification noises.
Altogether these data demonstrate removing the amplification noises caused by PCR crossover to generate estimated numbers of targets.
Example 2 Defined Barcoded Primers Mimic No-Template Control Behavior
This example demonstrates that amplification noises during library preparation can be determined using defined barcoded primers.
The experimental protocol used in this example was similar to that used in Example 1. Briefly, single cells were deposited into some wells of BD Precise™ TCR 96-well plates with each well containing stochastic barcodes with different molecular labels and the same sample label to identify the sample origins. Wells without cells were no-template controls (NTCs). The stochastic barcodes were used as reverse transcription (RT) primers for generating complementary deoxyribonucleic acid (cDNA). After reverse transcription, cDNAs from each well were pooled together into a single tube. After pooling, DBPs shown in Table 2 were added into the pooled tube to create a combined reaction mixture. Primers were removed from the combined reaction mixture using Ampure XP beads (Beckman Coulter Inc. (Brea, Calif.)) for subsequent library preparation steps.
FIG. 7 contains non-limiting exemplary plots of molecular label counts vs. the number of reads per molecular label (ML), showing that the amplification noises determined using defined barcoded primers (DBPs) were similar to the noise levels determined using no-template controls (NTCs). FIG. 7 panels (a)-(b) show that the amplification noises determined using DBPs mimicking T-cell receptor (TCR) alpha (86 and 46 respectively for two samples) were similar to the noises determined using NTCs (97 and 36 respectively for the two samples). FIG. 7 panels (c)-(d) show that the amplification noises determined using DBPs mimicking TCR beta (74 and 64 respectively for two samples) were similar to the noises determined using NTCs (86 and 37 respectively for the two samples).
Altogether these data demonstrate that the amplification noises caused by during library preparation can be efficiently, easily, and accurately determined using defined barcoded primers. The amplification noises determined can in turn be used to filter numbers of targets to generate estimated numbers of targets.
In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.
It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and/or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

Claims (20)

What is claimed is:
1. A method comprising:
stochastically barcoding a plurality of targets in a sample using a plurality of stochastic barcodes to generate stochastically barcoded targets, wherein each stochastic barcode comprises a molecular label and an identical sample label, and wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide;
contacting one or more defined barcoded primers with the plurality of stochastic barcodes, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined barcoded primers are variants of the stochastic barcodes;
amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and
detecting the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers by detecting the molecular labels present on the plurality of stochastically barcoded targets and the defined molecular labels present on the plurality of amplified defined barcoded primers,
wherein the number of molecular labels with different sequences associated with each of the plurality of targets in the plurality of amplified stochastically barcoded targets detected indicates a pre-correction number of the target,
wherein the number of defined molecular labels in the plurality of amplified defined barcoded primers indicate an amplification noise, and
wherein a difference between the number of molecular labels with different sequences associated with each of the plurality of targets and number of defined molecular labels with different sequences indicate the number of copies of the target.
2. The method of claim 1, wherein contacting the one or more defined barcoded primers with the plurality of stochastic barcodes comprises introducing the one or more defined barcoded primers at the same concentration of the plurality of stochastic barcodes.
3. The method of claim 1, wherein the defined molecular label is 5-20 nucleotides in length, or wherein the defined molecular label and the molecular label have the same length.
4. The method of claim 1, wherein the molecular label of one or more of the stochastic barcodes and the defined molecular labels of one or more of the one or more defined barcoded primers have the same sequence.
5. The method of claim 1, wherein the defined sample label is 5-20 nucleotides in length.
6. The method of claim 1, wherein the one or more defined barcoded primers comprise one or more types of defined barcoded primers.
7. The method of claim 6, wherein the defined molecular labels of one type of defined barcoded primers differ from one another by at least one nucleotide.
8. The method of claim 7,
wherein some defined molecular labels of different types of defined barcoded primers have the same sequence,
wherein different types of defined barcoded primers have the same length,
wherein the lengths of different types of defined barcoded primers differ by at most 10 nucleotides, or
wherein the defined sample labels of different types of defined barcoded primers have different sequences.
9. The method of claim 7, wherein the stochastic barcodes and the one or more types of defined barcoded primers have the same length.
10. The method of claim 1, wherein the sample label and the defined sample label have the same length.
11. The method of claim 1, wherein the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers is at least 2.
12. The method of claim 1, further comprising removing at least 50% of the stochastic barcodes not incorporated into the stochastically barcoded targets and the one or more defined barcoded primers from the sample.
13. The method of claim 12,
wherein less than 10% of the unincorporated stochastic barcodes are not removed from the sample,
wherein the percentage of the one or more defined barcoded primers not removed from the sample is within 5% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from the sample, or
wherein the percentage of the one or more defined barcoded primers not removed from the sample is within 10% of the percentage of the plurality of oligonucleotides comprising the stochastic barcodes not removed from the sample.
14. The method of claim 1,
wherein determining the pre-correction number of each of the plurality of targets using the molecular label comprises:
determining sequences of molecular labels of the amplified stochastically barcoded targets; and
determining the number of the molecular labels with different sequences, and
wherein determining the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers comprises:
determining sequences of the defined molecular labels of the amplified defined barcoded primers; and
determining the number of defined molecular labels with different sequences.
15. The method of claim 1, wherein determining the amplification noise comprises one or more of:
determining the number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for each type of amplified defined barcoded primers,
determining the average number of defined molecular labels in the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers, and
determining the maximum number of defined molecular labels in the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers with different sequences for different types of amplified defined barcoded primers.
16. The method of claim 1, wherein the amplification noise comprises noise caused by PCR crossover.
17. The method of claim 1, wherein the sample comprises a single cell or a lysate of a single cell.
18. The method of claim 17, comprising lysing the single cell.
19. A method comprising:
stochastically barcoding a plurality of targets in a sample using a plurality of stochastic barcodes, in the presence of one or more defined barcoded primers, to generate stochastically barcoded targets, wherein each stochastic barcode comprises a molecular label and an identical sample label, wherein the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide, wherein each of the one or more defined barcoded primers comprises a defined sample label and a defined molecular label, and wherein the defined barcoded primers are variants of the stochastic barcodes;
amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and
detecting the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers by detecting the molecular labels present on the plurality of stochastically barcoded targets and the defined molecular labels present on the plurality of amplified defined barcoded primers,
wherein the number of molecular labels with different sequences associated with each of the plurality of targets in the plurality of amplified stochastically barcoded targets detected indicates a pre-correction number of the target,
wherein the number of defined molecular labels in the plurality of amplified defined barcoded primers indicate an amplification noise, and
wherein a difference between the number of molecular labels with different sequences associated with each of the plurality of targets and number of defined molecular labels with different sequences indicate the number of copies of the target.
20. A method comprising:
stochastically barcoding a plurality of targets in a sample in a plurality of partitions using a plurality of stochastic barcodes to generate stochastically barcoded targets, wherein for each partition, each stochastic barcode comprises a molecular label and an identical sample label, and the molecular labels of at least two stochastic barcodes differ from one another by at least one nucleotide;
pooling the stochastically barcoded targets from the plurality of partitions to generate a pool of stochastically barcoded targets;
contacting defined barcoded primers of one or more types of defined barcoded primers with the plurality of stochastic barcoded targets in the partitions, wherein each defined barcoded primer comprises a defined sample label and a defined molecular label, wherein the defined sample labels of defined barcoded primers of the same type of defined barcoded primers have the same sequence, wherein the defined sample labels of different types of defined barcoded primers have different sequences, wherein the sample labels of the stochastic barcodes and the defined sample labels are variants of the sample label, and wherein the Hamming distance between the sample labels of the stochastic barcodes and the defined sample labels of the defined barcoded primers is at least 2;
amplifying the stochastically barcoded targets and the one or more defined barcoded primers to generate a plurality of amplified stochastically barcoded targets and a plurality of amplified defined barcoded primers; and
detecting the plurality of amplified stochastically barcoded targets and the plurality of amplified defined barcoded primers:
wherein the number of molecular labels with different sequences associated with each of the plurality of targets in the plurality of amplified stochastically barcoded targets detected indicates a pre-correction number of the target,
wherein the number of defined molecular labels with different sequences in the plurality of amplified defined barcoded primers detected indicates an amplification noise, and
wherein a difference between the number of molecular labels with different sequences associated with each of the plurality of targets and the number of defined molecular labels with different sequences indicate the number of copies of the target.
US16/232,287 2016-05-31 2018-12-26 Error correction in amplification of samples Active 2039-12-10 US11525157B2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US16/232,287 US11525157B2 (en) 2016-05-31 2018-12-26 Error correction in amplification of samples
US18/053,603 US12331351B2 (en) 2016-05-31 2022-11-08 Error correction in amplification of samples
US19/209,707 US20250277261A1 (en) 2016-05-31 2025-05-15 Error correction in amplification of samples

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201662343689P 2016-05-31 2016-05-31
US15/608,780 US10202641B2 (en) 2016-05-31 2017-05-30 Error correction in amplification of samples
US16/232,287 US11525157B2 (en) 2016-05-31 2018-12-26 Error correction in amplification of samples

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US15/608,780 Continuation US10202641B2 (en) 2016-05-31 2017-05-30 Error correction in amplification of samples

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/053,603 Continuation US12331351B2 (en) 2016-05-31 2022-11-08 Error correction in amplification of samples

Publications (2)

Publication Number Publication Date
US20190119726A1 US20190119726A1 (en) 2019-04-25
US11525157B2 true US11525157B2 (en) 2022-12-13

Family

ID=60421368

Family Applications (4)

Application Number Title Priority Date Filing Date
US15/608,780 Active US10202641B2 (en) 2016-05-31 2017-05-30 Error correction in amplification of samples
US16/232,287 Active 2039-12-10 US11525157B2 (en) 2016-05-31 2018-12-26 Error correction in amplification of samples
US18/053,603 Active 2037-08-14 US12331351B2 (en) 2016-05-31 2022-11-08 Error correction in amplification of samples
US19/209,707 Pending US20250277261A1 (en) 2016-05-31 2025-05-15 Error correction in amplification of samples

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US15/608,780 Active US10202641B2 (en) 2016-05-31 2017-05-30 Error correction in amplification of samples

Family Applications After (2)

Application Number Title Priority Date Filing Date
US18/053,603 Active 2037-08-14 US12331351B2 (en) 2016-05-31 2022-11-08 Error correction in amplification of samples
US19/209,707 Pending US20250277261A1 (en) 2016-05-31 2025-05-15 Error correction in amplification of samples

Country Status (1)

Country Link
US (4) US10202641B2 (en)

Families Citing this family (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
EP3321378B1 (en) 2012-02-27 2021-11-10 Becton, Dickinson and Company Compositions for molecular counting
ES2711168T3 (en) 2013-08-28 2019-04-30 Becton Dickinson Co Massive parallel analysis of individual cells
WO2016134078A1 (en) 2015-02-19 2016-08-25 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
ES2836802T3 (en) 2015-02-27 2021-06-28 Becton Dickinson Co Spatially addressable molecular barcodes
ES2934982T3 (en) 2015-03-30 2023-02-28 Becton Dickinson Co Methods for encoding with combinatorial barcodes
WO2016172373A1 (en) 2015-04-23 2016-10-27 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
US11124823B2 (en) 2015-06-01 2021-09-21 Becton, Dickinson And Company Methods for RNA quantification
EP3347465B1 (en) 2015-09-11 2019-06-26 Cellular Research, Inc. Methods and compositions for nucleic acid library normalization
JP7129343B2 (en) 2016-05-02 2022-09-01 ベクトン・ディキンソン・アンド・カンパニー Accurate molecular barcoding
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
EP3465502B1 (en) 2016-05-26 2024-04-10 Becton, Dickinson and Company Molecular label counting adjustment methods
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
EP3516400B1 (en) 2016-09-26 2023-08-16 Becton, Dickinson and Company Measurement of protein expression using reagents with barcoded oligonucleotide sequences
CN110573253B (en) 2017-01-13 2021-11-02 赛卢拉研究公司 Hydrophilic coating for fluid channels
US11319583B2 (en) 2017-02-01 2022-05-03 Becton, Dickinson And Company Selective amplification using blocking oligonucleotides
CA3059559A1 (en) 2017-06-05 2018-12-13 Becton, Dickinson And Company Sample indexing for single cells
WO2019126209A1 (en) 2017-12-19 2019-06-27 Cellular Research, Inc. Particles associated with oligonucleotides
CN108596258B (en) * 2018-04-27 2022-03-29 南京邮电大学 Image classification method based on convolutional neural network random pooling
ES2945191T3 (en) 2018-05-03 2023-06-29 Becton Dickinson Co High-throughput multi-omics sample analysis
JP7358388B2 (en) 2018-05-03 2023-10-10 ベクトン・ディキンソン・アンド・カンパニー Molecular barcoding at opposite transcript ends
US11639517B2 (en) 2018-10-01 2023-05-02 Becton, Dickinson And Company Determining 5′ transcript sequences
JP7618548B2 (en) 2018-11-08 2025-01-21 ベクトン・ディキンソン・アンド・カンパニー Whole-transcriptome analysis of single cells using random priming
US11492660B2 (en) 2018-12-13 2022-11-08 Becton, Dickinson And Company Selective extension in single cell whole transcriptome analysis
WO2020150356A1 (en) 2019-01-16 2020-07-23 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
EP4242322B1 (en) 2019-01-23 2024-08-21 Becton, Dickinson and Company Oligonucleotides associated with antibodies
WO2020167920A1 (en) 2019-02-14 2020-08-20 Cellular Research, Inc. Hybrid targeted and whole transcriptome amplification
EP3959337A4 (en) * 2019-04-24 2023-08-30 Genepath Diagnostics Inc. Method for detecting specific nucleic acids in samples
WO2020243160A1 (en) * 2019-05-28 2020-12-03 Chan Zuckerberg Biohub, Inc. Methods and compositions for multiple-parameter single-cell analysis using spectrally encoded microbeads
CN114051534B (en) 2019-07-22 2025-02-21 贝克顿迪金森公司 Single-cell chromatin immunoprecipitation sequencing assay
JP7522189B2 (en) 2019-11-08 2024-07-24 ベクトン・ディキンソン・アンド・カンパニー Use of Random Priming to Obtain Full-Length V(D)J Information for Immune Repertoire Sequencing
US11649497B2 (en) 2020-01-13 2023-05-16 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and RNA
CN115335520A (en) 2020-01-29 2022-11-11 贝克顿迪金森公司 Barcoded wells for spatial mapping of single cells by sequencing
EP4111168A1 (en) 2020-02-25 2023-01-04 Becton Dickinson and Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
CN115605614A (en) 2020-05-14 2023-01-13 贝克顿迪金森公司(Us) Primers for immune repertoire profiling
US12157913B2 (en) 2020-06-02 2024-12-03 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
WO2022026909A1 (en) 2020-07-31 2022-02-03 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
CN116635533A (en) 2020-11-20 2023-08-22 贝克顿迪金森公司 Profile analysis of highly expressed and low expressed proteins
CN116685850A (en) 2020-12-15 2023-09-01 贝克顿迪金森公司 Single-cell secretome analysis
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11236388B1 (en) 2021-06-17 2022-02-01 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
AU2023325064A1 (en) 2022-08-15 2025-03-06 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids

Citations (516)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4510244A (en) 1980-04-17 1985-04-09 The Board Of Trustees Of The Leland Stanford Jr. University Cell labeling with antigen-coupled microspheres
US4725536A (en) 1985-09-19 1988-02-16 Genetics Institute, Inc. Reagent polynucleotide complex with multiple target binding regions, and kit and methods
WO1989001050A1 (en) 1987-07-31 1989-02-09 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
JPH04108385A (en) 1990-08-27 1992-04-09 Res Dev Corp Of Japan Production of equalized cdna library
US5124246A (en) 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5149625A (en) 1987-08-11 1992-09-22 President And Fellows Of Harvard College Multiplex analysis of DNA
US5200314A (en) 1990-03-23 1993-04-06 Chiron Corporation Polynucleotide capture assay employing in vitro amplification
US5308990A (en) 1991-05-15 1994-05-03 Hitachi, Ltd. Method for measuring microparticles, quantitative measuring method therefor and instrument for measuring microparticles
US5424413A (en) 1992-01-22 1995-06-13 Gen-Probe Incorporated Branched nucleic acid probes
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
GB2293238A (en) 1994-09-13 1996-03-20 Inceltec Ltd Primers for replication and/or amplification reactions
WO1996024061A1 (en) 1995-02-02 1996-08-08 Ontogen Corporation Methods and apparatus for synthesizing labeled combinatorial chemical libraries
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
WO1997010365A1 (en) 1995-09-15 1997-03-20 Affymax Technologies N.V. Expression monitoring by hybridization to high density oligonucleotide arrays
US5635352A (en) 1993-12-08 1997-06-03 Chiron Corporation Solution phase nucleic acid sandwich assays having reduced background noise
US5648245A (en) 1995-05-09 1997-07-15 Carnegie Institution Of Washington Method for constructing an oligonucleotide concatamer library by rolling circle replication
US5656731A (en) 1987-10-15 1997-08-12 Chiron Corporation Nucleic acid-amplified immunoassay probes
US5658737A (en) 1994-10-28 1997-08-19 Gen-Probe Incorporated Compositions and methods for the simultaneous detection and quantification of multiple specific nucleic acid sequences
US5714330A (en) 1994-04-04 1998-02-03 Lynx Therapeutics, Inc. DNA sequencing by stepwise ligation and cleavage
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5759778A (en) 1993-08-10 1998-06-02 Life Technologies, Inc. Method of nucleic acid sequence selection
US5763175A (en) 1995-11-17 1998-06-09 Lynx Therapeutics, Inc. Simultaneous sequencing of tagged polynucleotides
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5830712A (en) 1996-02-06 1998-11-03 Allelix Biopharmaceuticals Inc. Selective template deletion method
US5846719A (en) 1994-10-13 1998-12-08 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5871928A (en) 1989-06-07 1999-02-16 Fodor; Stephen P. A. Methods for nucleic acid analysis
WO1999015702A1 (en) 1997-09-24 1999-04-01 Life Technologies, Inc. Normalized nucleic acid libraries and methods of production thereof
WO1999028505A1 (en) 1997-12-03 1999-06-10 Curagen Corporation Methods and devices for measuring differential gene expression
US5925525A (en) 1989-06-07 1999-07-20 Affymetrix, Inc. Method of identifying nucleotide differences
US5935793A (en) 1996-09-27 1999-08-10 The Chinese University Of Hong Kong Parallel polynucleotide sequencing method using tagged primers
US5962272A (en) 1996-01-03 1999-10-05 Clontech Laboratories, Inc. Methods and compositions for full-length cDNA Cloning using a template-switching oligonucleotide
US5968740A (en) 1995-07-24 1999-10-19 Affymetrix, Inc. Method of Identifying a Base in a Nucleic Acid
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US5981179A (en) 1991-11-14 1999-11-09 Digene Diagnostics, Inc. Continuous amplification reaction
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US6046005A (en) 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US6060596A (en) 1992-03-30 2000-05-09 The Scripps Research Institute Encoded combinatorial chemical libraries
US6064755A (en) 1996-07-05 2000-05-16 Fuji Photo Film Co., Ltd. Image analyzing apparatus for producing density profile data of an image
US6114149A (en) 1988-07-26 2000-09-05 Genelabs Technologies, Inc. Amplification of mixed sequence nucleic acid fragments
US6117631A (en) 1996-10-29 2000-09-12 Polyprobe, Inc. Detection of antigens via oligonucleotide antibody conjugates
US6124092A (en) 1996-10-04 2000-09-26 The Perkin-Elmer Corporation Multiplex polynucleotide capture methods and compositions
WO2000058516A2 (en) 1999-03-26 2000-10-05 Whitehead Institute For Biomedical Research Universal arrays
US6140489A (en) 1994-10-13 2000-10-31 Lynx Therapeutics, Inc. Compositions for sorting polynucleotides
US6197554B1 (en) 1998-11-20 2001-03-06 Shi-Lung Lin Method for generating full-length cDNA library from single cells
JP2001078768A (en) 1999-09-16 2001-03-27 Otsuka Pharmaceut Co Ltd Assay of gene expression
US6214558B1 (en) 1996-08-14 2001-04-10 Exact Laboratories, Inc. Methods for the detection of chromosomal aberrations
US6235483B1 (en) 2000-01-31 2001-05-22 Agilent Technologies, Inc. Methods and kits for indirect labeling of nucleic acids
WO2001048242A2 (en) 1999-12-29 2001-07-05 Mergen Ltd. Methods for amplifying and detecting multiple polynucleotides on a solid phase support
US6265163B1 (en) 1998-01-09 2001-07-24 Lynx Therapeutics, Inc. Solid phase selection of differentially expressed genes
WO2001053539A1 (en) 2000-01-24 2001-07-26 Phylos, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US6268152B1 (en) 1993-06-25 2001-07-31 Affymetrix, Inc. Probe kit for identifying a base in a nucleic acid
US6284485B1 (en) 1995-12-22 2001-09-04 Amgen Inc. Nucleic acids encoding osteoprotegerin
US6309823B1 (en) 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
US6309822B1 (en) 1989-06-07 2001-10-30 Affymetrix, Inc. Method for comparing copy number of nucleic acid sequences
US6326148B1 (en) 1999-07-12 2001-12-04 The Regents Of The University Of California Detection of copy number changes in colon cancer
US20020019005A1 (en) 1999-02-18 2002-02-14 Arcaris, Inc. Process for identification of genes encoding proteins having cell proliferation-promoting activity
WO2002018643A2 (en) 2000-08-11 2002-03-07 Nanosphere Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US6372813B1 (en) 1999-06-25 2002-04-16 Motorola Methods and compositions for attachment of biomolecules to solid supports, hydrogels, and hydrogel arrays
US20020051986A1 (en) 2000-06-13 2002-05-02 Luis Baez Method for the detection of an analyte by means of a nucleic acid reporter
US20020065609A1 (en) 2000-04-10 2002-05-30 Matthew Ashby Methods for the survey and genetic analysis of populations
US20020072058A1 (en) 2000-03-24 2002-06-13 Voelker Leroy L. Method for amplifying quinolone-resistance-determining-regions and identifying polymorphic variants thereof
WO2002046472A2 (en) 2000-12-08 2002-06-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6406848B1 (en) 1997-05-23 2002-06-18 Lynx Therapeutics, Inc. Planar arrays of microparticle-bound polynucleotides
WO2002056014A2 (en) 2000-12-22 2002-07-18 Glaxo Group Limited Methods for encoding and decoding complex mixtures in arrayed assays
US20020094116A1 (en) 2000-08-25 2002-07-18 Amnis Corporation Method and apparatus for reading reporter labeled beads
WO2002059355A2 (en) 2001-01-25 2002-08-01 Tm Bioscience Corporation Polynucleotides for use as tags and tag complements, manufacture and use thereof
US20020106666A1 (en) 2000-08-25 2002-08-08 Yoshihide Hayashizaki Method of preparing normalized and/or subtracted cDNA
US6436675B1 (en) 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
WO2002070684A2 (en) 2001-01-11 2002-09-12 Lion Bioscience Ag Gene library for screening methods
US6451536B1 (en) 1990-12-06 2002-09-17 Affymetrix Inc. Products for detecting nucleic acids
US20020132241A1 (en) 2000-02-07 2002-09-19 Jian-Bing Fan Multiplexed detection of analytes
WO2002072772A2 (en) 2001-03-09 2002-09-19 Nugen Technologies, Inc. Methods and compositions for amplification of rna sequences
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
WO2002079490A2 (en) 2001-03-28 2002-10-10 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified particles
WO2002083922A2 (en) 2001-04-11 2002-10-24 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Modified random primers for probe labeling
US6480791B1 (en) 1998-10-28 2002-11-12 Michael P. Strathmann Parallel methods for genomic analysis
US20020168665A1 (en) 2001-03-21 2002-11-14 Olympus Optical Co., Ltd. Biochemical examination method
US20020172953A1 (en) 1996-07-29 2002-11-21 Mirkin Chad A. Movement of biomolecule-coated nanoparticles in an electric field
US6489114B2 (en) 1999-12-17 2002-12-03 Bio Merieux Process for labeling a ribonucleic acid, and labeled RNA fragments which are obtained thereby
US6492121B2 (en) 1999-04-20 2002-12-10 Japan Bioindustry Association Method for determining a concentration of target nucleic acid molecules, nucleic acid probes for the method, and method for analyzing data obtained by the method
US20020187480A1 (en) 2001-05-04 2002-12-12 Genomics Research Partners Pty Ltd Diagnostic method for assessing a condition of a performance animal
US20020192687A1 (en) 2000-03-28 2002-12-19 Mirkin Chad A. Bio-barcodes based on oligonucleotide-modified nanoparticles
WO2002101358A2 (en) 2001-06-11 2002-12-19 Illumina, Inc. Multiplexed detection methods
US20030013091A1 (en) 2001-07-03 2003-01-16 Krassen Dimitrov Methods for detection and quantification of analytes in complex mixtures
US6512105B1 (en) 1986-11-24 2003-01-28 Gen-Probe Incorporated Methods for making oligonucleotide probes for the detection and/or quantitation of non-viral organisms
US20030032049A1 (en) 2000-01-24 2003-02-13 Wagner Richard W. Sensitive, multiplexed diagnostic assays for protein analysis
US20030049616A1 (en) 2001-01-08 2003-03-13 Sydney Brenner Enzymatic synthesis of oligonucleotide tags
US6551784B2 (en) 1989-06-07 2003-04-22 Affymetrix Inc Method of comparing nucleic acid sequences
US20030077611A1 (en) 2001-10-24 2003-04-24 Sention Methods and systems for dynamic gene expression profiling
US20030082818A1 (en) 2001-07-12 2003-05-01 Automated Cell, Inc. Method and apparatus for monitoring of proteins and cells
WO2003035829A2 (en) 2001-10-09 2003-05-01 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20030087242A1 (en) 1996-07-29 2003-05-08 Mirkin Chad A. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6600996B2 (en) 1994-10-21 2003-07-29 Affymetrix, Inc. Computer-aided techniques for analyzing biological sequences
CA2474509A1 (en) 2002-02-14 2003-08-21 Immunivest Corporation Methods and algorithms for cell enumeration in a low-cost cytometer
US20030165935A1 (en) 2001-11-21 2003-09-04 Vann Charles S. Digital assay
US20030175908A1 (en) 2002-01-29 2003-09-18 Sten Linnarsson Methods and means for manipulating nucleic acid
US6629040B1 (en) 1999-03-19 2003-09-30 University Of Washington Isotope distribution encoded tags for protein identification
US20030186251A1 (en) 2002-04-01 2003-10-02 Brookhaven Science Associates, Llc Genome sequence tags
US20030207300A1 (en) 2000-04-28 2003-11-06 Matray Tracy J. Multiplex analytical platform using molecular tags
US20030207296A1 (en) 1996-07-29 2003-11-06 So-Jung Park Nanoparticles having oligonucleotides attached thereto and uses therefor
US6653077B1 (en) 1998-09-04 2003-11-25 Lynx Therapeutics, Inc. Method of screening for genetic polymorphism
WO2004017374A2 (en) 2002-08-16 2004-02-26 Clinical Microarrays, Inc. Reading of fluorescent arrays
US20040047769A1 (en) 2001-06-12 2004-03-11 Yokogawa Electric Corporation Biochip
WO2004021986A2 (en) 2002-09-03 2004-03-18 Quanta Biosciences, Inc. Improved compositions and methods for cdna synthesis
WO2004033669A2 (en) 2002-10-11 2004-04-22 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Methods of manipulating nucleic acids
US20040091864A1 (en) 2000-03-29 2004-05-13 French David John Hybridisation beacon and method of rapid sequence detection and discrimination
US20040096892A1 (en) 2002-11-15 2004-05-20 The Johns Hopkins University Digital karyotyping
US20040096368A1 (en) 2002-06-28 2004-05-20 Igen International, Inc. Assay systems and components
US20040121342A1 (en) 2002-12-20 2004-06-24 Orchid Biosciences, Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
US20040147435A1 (en) 1994-06-13 2004-07-29 Vanderbilt University Compositions and methods for importing biologically active molecules into cells and for treating inflammation
WO2004066185A1 (en) 2003-01-23 2004-08-05 U.S. Genomics, Inc. Methods for analyzing polymer populations
US20040157243A1 (en) 2002-11-11 2004-08-12 Affymetrix, Inc. Methods for identifying DNA copy number changes
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
WO2004081225A2 (en) 2003-03-07 2004-09-23 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
US6808906B2 (en) 2002-05-08 2004-10-26 Rigel Pharmaceuticals, Inc. Directionally cloned random cDNA expression vector libraries, compositions and methods of use
EP1473080A2 (en) 2003-04-30 2004-11-03 Agilent Technologies, Inc. Chemical array reading
US20040224325A1 (en) 2002-12-20 2004-11-11 Caliper Life Sciences, Inc. Single molecule amplification and detection of DNA
US20040259118A1 (en) 2003-06-23 2004-12-23 Macevicz Stephen C. Methods and compositions for nucleic acid sequence analysis
US20050019776A1 (en) 2002-06-28 2005-01-27 Callow Matthew James Universal selective genome amplification and universal genotyping system
US6849404B2 (en) 2001-05-07 2005-02-01 Bioneer Corporation Polymerase chain reaction of DNA of which base sequence is completely unidentified
US6858412B2 (en) 2000-10-24 2005-02-22 The Board Of Trustees Of The Leland Stanford Junior University Direct multiplex characterization of genomic DNA
WO2005017206A1 (en) 2003-08-13 2005-02-24 Affymetrix, Inc. Methods and kits for preparing nucleic acid samples
US20050048500A1 (en) 2003-09-02 2005-03-03 Lawton Robert L. Soluble analyte detection and amplification
US20050053952A1 (en) 2002-10-02 2005-03-10 California Institute Of Technology Microfluidic nucleic acid analysis
WO2005042759A2 (en) 2003-09-10 2005-05-12 Althea Technologies, Inc. Expression profiling using microarrays
US20050105077A1 (en) 2000-08-02 2005-05-19 Aravind Padmanabhan Miniaturized cytometer for detecting multiple species in a sample
WO2005071110A2 (en) 2004-01-23 2005-08-04 Lingvitae As Improving polynucleotide ligation reactions
US20050175993A1 (en) 2002-04-12 2005-08-11 Chia-Lin Wei Method for making full-length coding sequence cDNA libraries
WO2005080604A2 (en) 2004-02-12 2005-09-01 Compass Genetics, Llc Genetic analysis by sequence-specific sorting
JP2005233974A (en) 2001-03-21 2005-09-02 Olympus Corp Biochemical inspection method
US20050196760A1 (en) 2004-03-05 2005-09-08 Alexander Pemov Dual phase multiplex polymerase chain reaction
US20050214825A1 (en) 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
US20050250147A1 (en) 2004-05-10 2005-11-10 Macevicz Stephen C Digital profiling of polynucleotide populations
US20050250146A1 (en) 2004-05-07 2005-11-10 Mcmillan William A Multiplexed detection of biological agents
US20060002824A1 (en) 2004-06-07 2006-01-05 Irm, Llc Dispensing systems, software, and related methods
US20060035258A1 (en) 2004-08-06 2006-02-16 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20060040297A1 (en) 2003-01-29 2006-02-23 Leamon John H Methods of amplifying and sequencing nucleic acids
US20060041385A1 (en) 2004-08-18 2006-02-23 Bauer Kenneth D Method of quantitating proteins and genes in cells using a combination of immunohistochemistry and in situ hybridization
US20060057634A1 (en) 2002-05-29 2006-03-16 Philip Rye Assay for glycosylated proteins
WO2006026828A1 (en) 2004-09-10 2006-03-16 Human Genetic Signatures Pty Ltd Amplification blocker comprising intercalating nucleic acids (tna) containing intercalating pseudonucleotides (ipn)
US20060073506A1 (en) 2004-09-17 2006-04-06 Affymetrix, Inc. Methods for identifying biological samples
WO2006071776A2 (en) 2004-12-23 2006-07-06 Ge Healthcare Bio-Sciences Corp. Ligation-based rna amplification
US20060211030A1 (en) 2005-03-16 2006-09-21 Sydney Brenner Methods and compositions for assay readouts on multiple analytical platforms
WO2006102264A1 (en) 2005-03-18 2006-09-28 Fluidigm Corporation Thermal reaction device and method for using the same
US20060257902A1 (en) 2005-03-25 2006-11-16 Ambion, Inc. Methods and compositions for depleting abundant RNA transcripts
US20060263789A1 (en) 2005-05-19 2006-11-23 Robert Kincaid Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using
US20060263709A1 (en) 2005-05-19 2006-11-23 Fuji Xerox Co., Ltd. Process for producing resin particle liquid dispersion for electrostatic image developing toner, electrostatic image developing toner and production process thereof
US20060280352A1 (en) 2005-06-10 2006-12-14 The Cleveland Clinic Foundation Image analysis of biological objects
US20060281092A1 (en) 2003-07-24 2006-12-14 Tanja Wille Method for the reverse transcription and/or amplification of nucleic acids
US20060286570A1 (en) 2003-09-09 2006-12-21 Rowlen Kathy L Use of photopolymerization for amplification and detection of a molecular recognition event
US7155050B1 (en) 1999-11-03 2006-12-26 Ge Healthcare Bio-Sciences Ab Method of analyzing cell samples, by creating and analyzing a resultant image
WO2006137932A2 (en) 2004-11-03 2006-12-28 Leucadia Technologies, Inc. Homogeneous analyte detection
US20070020640A1 (en) 2005-07-21 2007-01-25 Mccloskey Megan L Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis
US20070031829A1 (en) 2002-09-30 2007-02-08 Hideyuki Yasuno Oligonucleotides for genotyping thymidylate synthase gene
US20070042400A1 (en) 2003-11-10 2007-02-22 Choi K Y Methods of preparing nucleic acid for detection
US20070042419A1 (en) 1996-05-29 2007-02-22 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US20070065844A1 (en) 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US20070065823A1 (en) 2003-07-05 2007-03-22 Devin Dressman Method and compositions for detection and enumeration of genetic variations
US20070105090A1 (en) 2003-08-16 2007-05-10 Andrew Cassidy Amplification method
US20070117134A1 (en) 2005-11-18 2007-05-24 Kou Zhong C Method for detection and quantification of T-cell receptor Vbeta repertoire
US20070117177A1 (en) 2005-08-11 2007-05-24 Dan Luo Nucleic Acid-Based Matrixes for Protein Production
US20070117121A1 (en) 2005-09-16 2007-05-24 Hutchison Stephen K cDNA library preparation
US20070133856A1 (en) 2005-12-09 2007-06-14 Cytyc Corporation Cross-frame object reconstruction for image-based cytology applications
US20070172873A1 (en) 2006-01-23 2007-07-26 Sydney Brenner Molecular counting
US20070178478A1 (en) 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
WO2007087310A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Nucleic acid analysis using sequence tokens
US20070202523A1 (en) 2004-08-27 2007-08-30 Becker Michael M Methods and kits for amplifying dna
EP1845160A1 (en) 2005-02-10 2007-10-17 Riken Method for amplification of nucleotide sequence
US20070281317A1 (en) 2006-06-06 2007-12-06 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
WO2007147079A2 (en) 2006-06-14 2007-12-21 Living Microsystems, Inc. Rare cell analysis using sample splitting and dna tags
US20080038727A1 (en) 2006-03-10 2008-02-14 Applera Corporation MicroRNA and Messenger RNA Detection on Arrays
US20080070303A1 (en) 2005-11-21 2008-03-20 West Michael D Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby
WO2008047428A1 (en) 2006-10-18 2008-04-24 Osaki Electric Co., Ltd. Electronic watthour meter
WO2008051928A2 (en) 2006-10-23 2008-05-02 The Salk Institute For Biological Studies Target-oriented whole genome amplification of nucliec acids
WO2008057163A2 (en) 2006-10-09 2008-05-15 Carnegie Mellon University Preparation of functional gel particles with a dual crosslink network
US20080119736A1 (en) 2006-11-22 2008-05-22 General Electric Company Heart rate demodulation of periodic movement in ultrasound data for object identification
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
US7407757B2 (en) 2005-02-10 2008-08-05 Population Genetics Technologies Genetic analysis by sequence-specific sorting
WO2008096318A2 (en) 2007-02-09 2008-08-14 Koninklijke Philips Electronics N.V. Identification system
US20080194414A1 (en) 2006-04-24 2008-08-14 Albert Thomas J Enrichment and sequence analysis of genomic regions
WO2008104380A2 (en) 2007-02-27 2008-09-04 Sentoclone Ab Multiplex detection of tumour cells using a panel of agents binding to extracellular markers
JP2008256428A (en) 2007-04-03 2008-10-23 Intec Systems Institute Inc Method for detecting block position of microarray image
US20080269068A1 (en) 2007-02-06 2008-10-30 President And Fellows Of Harvard College Multiplex decoding of sequence tags in barcodes
US20080268508A1 (en) 2007-04-30 2008-10-30 Sowlay Mohankumar R Methods and kits for negative selection of desired nucleic acid sequences
US20080274458A1 (en) 2007-05-01 2008-11-06 Latham Gary J Nucleic acid quantitation methods
US20080299609A1 (en) 2007-03-12 2008-12-04 Sungkyunkwan University Foundation For Corporate Collaboration Uracil-DNA glycosylase of psychrobacter sp. HJ147 and use thereof
WO2008147428A1 (en) 2006-10-05 2008-12-04 Nanopoint, Inc. Systems and methods for active microfluidic cell handling
WO2008150432A1 (en) 2007-06-01 2008-12-11 454 Life Sciences Corporation System and meth0d for identification of individual samples from a multiplex mixture
US7476786B2 (en) 2002-09-20 2009-01-13 Intel Corporation Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM) reading
US20090053669A1 (en) 2004-12-14 2009-02-26 Align Technology, Inc. System and methods for casting physical tooth model
US20090061513A1 (en) 2007-05-15 2009-03-05 Picovitro Ab Cell sorting and cell cultivation methods
EP2036989A1 (en) 2007-09-12 2009-03-18 Institut Pasteur Single cell based reporter assay to monitor gene expression patterns with high spatio-temporal resolution
WO2009048530A2 (en) 2007-10-05 2009-04-16 Panomics, Inc. Highly multiplexed particle-based assays
US20090137407A1 (en) 2006-05-18 2009-05-28 President And Fellows Of Harvard College Genomic library construction
US20090220385A1 (en) 2005-11-01 2009-09-03 Brown Jeffrey A Liquid dispensing for high-throughput experimentation
US20090226891A2 (en) 1995-04-25 2009-09-10 Nexus Biosystems, Inc. Encoded solid supports for biological processing and assays using same
US20090253586A1 (en) 2008-02-21 2009-10-08 Gentel Biosciences, Inc. Substrates for multiplexed assays and uses thereof
US20090252414A1 (en) 2007-01-16 2009-10-08 Olympus Corporation Fluorescent signal analyzing apparatus and fluorescent signal analyzing method
US20090283676A1 (en) 2006-04-04 2009-11-19 Sidec Technologies Ab Extended electron tomography
US20090290151A1 (en) 2008-03-03 2009-11-26 Ajjer Llc Analysis of arrays by laser induced breakdown spectroscopy
DE102008025656A1 (en) 2008-05-28 2009-12-03 Genxpro Gmbh Method for quantitative analysis of nicoleic acids, markers therefor and their use
US20090298709A1 (en) 2008-05-28 2009-12-03 Affymetrix, Inc. Assays for determining telomere length and repeated sequence copy number
WO2009148560A2 (en) 2008-05-30 2009-12-10 Board Of Regents, The Universtiy Of Texas System Methods and compositions for nucleic acid sequencing
US20090311694A1 (en) 2008-04-14 2009-12-17 Medical Diagnostic Laboratoiries, Llc Splice variants of human IL-23 receptor (IL-23R) mRNA and use of a delta 9 isoform in predicting inflammatory bowel diseases
US7635566B2 (en) 2007-06-29 2009-12-22 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
US20100069250A1 (en) 2008-08-16 2010-03-18 The Board Of Trustees Of The Leland Stanford Junior University Digital PCR Calibration for High Throughput Sequencing
US20100105112A1 (en) 2006-08-07 2010-04-29 Christian Holtze Fluorocarbon emulsion stabilizing surfactants
US20100105886A1 (en) 2003-08-29 2010-04-29 Life Technologies Corporation Compositions, methods, and kits for fabricating coded molecular tags
US20100105049A1 (en) 2008-09-16 2010-04-29 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US20100120098A1 (en) 2008-10-24 2010-05-13 Epicentre Technologies Corporation Transposon end compositions and methods for modifying nucleic acids
US20100120630A1 (en) 2007-01-30 2010-05-13 The Regents Of The University Of California Methods and devices for biomolecular arrays
WO2010059820A1 (en) 2008-11-21 2010-05-27 Saint Louis University Biosensor for detecting multiple epitopes on a target
US20100136544A1 (en) 2007-03-07 2010-06-03 Jeremy Agresti Assays and other reactions involving droplets
US20100159533A1 (en) 2008-11-24 2010-06-24 Helicos Biosciences Corporation Simplified sample preparation for rna analysis
US20100255471A1 (en) 2009-01-20 2010-10-07 Stanford University Single cell gene expression for diagnosis, prognosis and identification of drug targets
WO2010117620A2 (en) 2009-03-30 2010-10-14 Illumina, Inc. Gene expression analysis in single cells
US20100267028A1 (en) 2008-12-24 2010-10-21 Boris Pasche Tgfbr1 HAPLOINSUFFICIENCY MODIFIES RISK FOR CANCER
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
WO2010131645A1 (en) 2009-05-14 2010-11-18 和光純薬工業株式会社 Method for synthesis of double-stranded dna corresponding to rna, and method for amplification of the dna
US20100291666A1 (en) 2004-12-23 2010-11-18 Gordon Bruce Collier Molecular diagnostics system and methods
US20100300895A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems, Inc. Apparatus and methods for performing electrochemical reactions
US20100323348A1 (en) 2009-01-31 2010-12-23 The Regents Of The University Of Colorado, A Body Corporate Methods and Compositions for Using Error-Detecting and/or Error-Correcting Barcodes in Nucleic Acid Amplification Process
US20100330574A1 (en) 2009-06-29 2010-12-30 Whitman Douglas F Chimeric primers with hairpin conformations and methods of using same
US20110038507A1 (en) 2009-06-29 2011-02-17 Hager Environmental and Atmospheric Technologie, LLC Device and Method for Quantification of Gases in Plumes by Remote Sensing
US20110059436A1 (en) 2000-07-07 2011-03-10 Life Technologies Corporation Methods for sequence determination
US20110059556A1 (en) 2009-09-04 2011-03-10 The Research Foundation Of State University Of New York Rapid and Continuous Analyte Processing in Droplet Microfluidic Devices
US20110070584A1 (en) 2001-10-22 2011-03-24 Xdx, Inc. Methods and compositions for diagnosing and monitoring autoimmune and chronic inflammatory diseases
US20110072889A1 (en) 2009-09-30 2011-03-31 Quest Diagnostics Investments Incorporated Bcr-abl truncation mutations
US20110160078A1 (en) 2009-12-15 2011-06-30 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
WO2011091393A1 (en) 2010-01-25 2011-07-28 Rd Biosciences, Inc. Self-folding amplification of target nucleic acid
US20110201507A1 (en) 2010-01-19 2011-08-18 Rava Richard P Sequencing methods and compositions for prenatal diagnoses
WO2011106738A2 (en) 2010-02-25 2011-09-01 Fred Hutchinson Cancer Research Center Use of tcr clonotypes as biomarkers for disease
US20110230358A1 (en) 2010-01-19 2011-09-22 Artemis Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
US20110245111A1 (en) 2010-04-05 2011-10-06 Prognosys Biosciences, Inc. Spatially encoded biological assays
US20110244455A1 (en) 2010-02-12 2011-10-06 Raindance Technologies, Inc. Digital analyte analysis
WO2011123246A2 (en) 2010-04-01 2011-10-06 Illumina, Inc. Solid-phase clonal amplification and related methods
US20110263457A1 (en) 2007-02-16 2011-10-27 Krutzik Peter O Multiplex Cellular Assays Using Detectable Cell Barcodes
WO2011143659A2 (en) 2010-05-14 2011-11-17 Fluidigm Corporation Nucleic acid isolation methods
US20110294689A1 (en) 2010-05-27 2011-12-01 Affymetrix, Inc Multiplex Amplification Methods
WO2011155833A2 (en) 2010-06-09 2011-12-15 Keygene N.V. Combinatorial sequence barcodes for high throughput screening
US20120004132A1 (en) 2010-07-02 2012-01-05 Affymetrix, Inc. Detection of Nucleic Acids and Proteins
US20120014977A1 (en) 2010-02-19 2012-01-19 National University Corporation Chiba University NOVEL ALTERNATIVE SPLICING VARIANT OF OATP1B3 mRNA
US8110351B2 (en) 2002-01-16 2012-02-07 Invitrogen Dynal As Method for isolating nucleic acids and protein from a single sample
US20120034607A1 (en) 2006-12-14 2012-02-09 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale fet arrays
US20120040843A1 (en) 2010-08-12 2012-02-16 Dublin City University Centrifugal capture system
US20120058902A1 (en) 2009-06-25 2012-03-08 Livingston Robert J Method of measuring adaptive immunity
US20120065081A1 (en) 2009-04-30 2012-03-15 Chee Mark S Nucleic acid constructs and methods of use
US20120071331A1 (en) 2010-09-21 2012-03-22 James Casbon Increasing confidence of allele calls with molecular counting
WO2012041802A1 (en) 2010-09-29 2012-04-05 Deutsches Krebsforschungszentrum Means and methods for improved protein interaction screening
WO2012042374A2 (en) 2010-10-01 2012-04-05 Anssi Jussi Nikolai Taipale Method of determining number or concentration of molecules
WO2012047297A2 (en) 2010-10-08 2012-04-12 Chen Gao Highly multiplexed real-time pcr using encoded microbeads
US20120087862A1 (en) 2006-08-09 2012-04-12 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2012048341A1 (en) 2010-10-08 2012-04-12 President And Fellows Of Harvard College High-throughput single cell barcoding
US20120142018A1 (en) 2010-12-05 2012-06-07 Wenbin Jiang Rapid Single Cell Based Parallel Biological Cell Sorter
US20120149603A1 (en) 2010-12-09 2012-06-14 Akonni Biosystems Sample analysis system
WO2012083225A2 (en) 2010-12-16 2012-06-21 Gigagen, Inc. System and methods for massively parallel analysis of nycleic acids in single cells
US20120156675A1 (en) 2009-06-09 2012-06-21 Oxford Gene Technology Ip Limited Picowell capture devices for analysing single cells or other particles
US8206913B1 (en) 2003-03-07 2012-06-26 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
US20120163681A1 (en) 2010-11-29 2012-06-28 Jesper Lohse Methods and systems for analyzing images of specimens processed by a programmable quantitative assay
US20120165219A1 (en) 2009-09-01 2012-06-28 Koninklijke Philips Electronics N.V. Devices and methods for microarray selection
US20120173159A1 (en) 2010-12-30 2012-07-05 Life Technologies Corporation Methods, systems, and computer readable media for nucleic acid sequencing
WO2012099896A2 (en) 2011-01-17 2012-07-26 Life Technologies Corporation Workflow for detection of ligands using nucleic acids
US20120190020A1 (en) 2011-01-25 2012-07-26 Aria Diagnostics, Inc. Detection of genetic abnormalities
WO2012103154A1 (en) 2011-01-24 2012-08-02 Nugen Technologies, Inc. Stem-loop composite rna-dna adaptor-primers: compositions and methods for library generation, amplification and other downstream manipulations
WO2012108864A1 (en) 2011-02-08 2012-08-16 Illumina, Inc. Selective enrichment of nucleic acids
WO2012112804A1 (en) 2011-02-18 2012-08-23 Raindance Technoligies, Inc. Compositions and methods for molecular labeling
US20120220022A1 (en) 2009-09-01 2012-08-30 Trustees Of Boston University High throughput multichannel reader and uses thereof
US20120231972A1 (en) 2009-03-19 2012-09-13 Golyshin Peter N Probe Compound for Detecting and Isolating Enzymes and Means and Methods Using the Same
WO2012129363A2 (en) 2011-03-24 2012-09-27 President And Fellows Of Harvard College Single cell nucleic acid detection and analysis
US20120252012A1 (en) 2009-05-14 2012-10-04 Assistance Publique - Hopitaux De Marseille Method for detecting prokaryotic dna from a feces sample
US20120253689A1 (en) 2005-06-07 2012-10-04 Rogan Peter K Ab initio generation of single copy genomic probes
WO2012142213A2 (en) 2011-04-15 2012-10-18 The Johns Hopkins University Safe sequencing system
WO2012140224A1 (en) 2011-04-13 2012-10-18 Jonas Frisen Method and product for localised or spatial detection of nucleic acid in a tissue sample
US8298767B2 (en) 2009-08-20 2012-10-30 Population Genetics Technologies Ltd Compositions and methods for intramolecular nucleic acid rearrangement
WO2012149042A2 (en) 2011-04-25 2012-11-01 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
WO2012156744A2 (en) 2011-05-17 2012-11-22 Cambridge Enterprise Limited Gel beads in microfluidic droplets
WO2012162267A2 (en) 2011-05-20 2012-11-29 Fluidigm Corporation Nucleic acid encoding reactions
US20120322681A1 (en) 2011-06-15 2012-12-20 Gen9, Inc. Methods for Preparative In Vitro Cloning
EP2538220A1 (en) 2006-02-21 2012-12-26 Trustees Of Tufts College Methods and arrays for target analyte detection and determination of target analyte concentration in solution
WO2012177639A2 (en) 2011-06-22 2012-12-27 Alnylam Pharmaceuticals, Inc. Bioprocessing and bioproduction using avian cell lines
US20130022977A1 (en) 2004-02-27 2013-01-24 Sequenom, Inc Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
WO2013019075A2 (en) 2011-08-01 2013-02-07 연세대학교산학협력단 Method of preparing nucleic acid molecules
US20130045994A1 (en) 2009-03-05 2013-02-21 Daiichi Sankyo Company, Limited Pyridine derivative
JP2013039275A (en) 2011-08-18 2013-02-28 Olympus Corp Fluorescence observation device, fluorescence observation system and method for processing fluorescence image
US20130116130A1 (en) 2009-12-15 2013-05-09 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Label-Tags
WO2013070990A1 (en) 2011-11-11 2013-05-16 Glezer Eli N Co-binder assisted assay methods
WO2013096802A1 (en) 2011-12-22 2013-06-27 Ibis Biosciences, Inc. Amplification primers and methods
US20130190206A1 (en) 2010-07-13 2013-07-25 Dublin City University Direct Clone Analysis and Selection Technology
US20130210659A1 (en) 2012-02-10 2013-08-15 Andrew Watson Molecular diagnostic screening assay
WO2013117595A2 (en) 2012-02-07 2013-08-15 Illumina Cambridge Limited Targeted enrichment and amplification of nucleic acids on a support
US20130225623A1 (en) 2010-10-27 2013-08-29 Mount Sinai School Of Medicine Methods of Treating Psychiatric or Neurological Disorders with MGLUR Antagonists
US20130225418A1 (en) 2012-02-24 2013-08-29 Andrew Watson Labeling and sample preparation for sequencing
WO2013130674A1 (en) 2012-02-27 2013-09-06 Cellular Research, Inc. Compositions and kits for molecular counting
WO2013137737A1 (en) 2012-03-16 2013-09-19 Flexgen B.V. Methods of creating and screening of dna encoded combinatorial libraries of chemical antibodies
WO2013148525A1 (en) 2012-03-29 2013-10-03 Complete Genomics, Inc. Flow cells for high density array chips
WO2013173394A2 (en) 2012-05-14 2013-11-21 Cb Biotechnologies, Inc. Method for increasing accuracy in quantitative detection of polynucleotides
WO2013177206A2 (en) 2012-05-21 2013-11-28 Fluidigm Corporation Single-particle analysis of particle populations
WO2013176767A1 (en) 2012-05-25 2013-11-28 The University Of North Carolina At Chapel Hill Microfluidic devices, solid supports for reagents and related methods
US8603749B2 (en) 2006-11-15 2013-12-10 Biospherex, LLC Multitag sequencing ecogenomics analysis-US
WO2013188872A1 (en) 2012-06-15 2013-12-19 The Board Of Regents Of The University Of Texas System High throughput sequencing of multiple transcripts of a single cell
WO2013188831A1 (en) 2012-06-15 2013-12-19 Adaptive Biotechnologies Corporation Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set
WO2013191775A2 (en) 2012-06-18 2013-12-27 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US20140004569A1 (en) 2011-02-23 2014-01-02 Board Of Regents, The University Of Texas System Use of template switching for dna synthesis
WO2014015098A1 (en) 2012-07-18 2014-01-23 Siemens Healthcare Diagnostics Inc. A method of normalizing biological samples
WO2014015084A2 (en) 2012-07-17 2014-01-23 Counsyl, Inc. System and methods for detecting genetic variation
WO2014018093A1 (en) 2012-07-26 2014-01-30 Illumina, Inc. Compositions and methods for the amplification of nucleic acids
WO2014018460A1 (en) 2012-07-24 2014-01-30 Sequenta, Inc. Single cell analysis using sequence tags
WO2014028537A1 (en) 2012-08-14 2014-02-20 10X Technologies, Inc. Microcapsule compositions and methods
WO2014031997A1 (en) 2012-08-24 2014-02-27 Yale University System, device and method for high-throughput multi-plexed detection
EP2702146A2 (en) 2011-04-28 2014-03-05 The Board of Trustees of The Leland Stanford Junior University Identification of polynucleotides associated with a sample
WO2014065756A1 (en) 2012-10-22 2014-05-01 National University Of Singapore Assay for the parallel detection of biological material based on pcr
WO2014071361A1 (en) 2012-11-05 2014-05-08 Rubicon Genomics Barcoding nucleic acids
US20140147860A1 (en) 2011-06-27 2014-05-29 Life Technologies Corporation Acoustic Cytometry Methods and Protocols
WO2014093676A1 (en) 2012-12-14 2014-06-19 10X Technologies, Inc. Methods and systems for processing polynucleotides
US20140178438A1 (en) 2011-05-24 2014-06-26 Ugur Sahin Individualized vaccines for cancer
US20140194324A1 (en) 2013-01-09 2014-07-10 Illumina Cambridge Limited Sample preparation on a solid support
WO2014108850A2 (en) 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. High throughput transcriptome analysis
US20140206547A1 (en) 2013-01-22 2014-07-24 The Board Of Trustees Of The Leland Stanford Junior University Haplotying of hla loci with ultra-deep shotgun sequencing
US20140206079A1 (en) 2013-01-24 2014-07-24 Sabic Innovative Plastics Ip B.V. Microwell plate
US20140216128A1 (en) 2013-02-01 2014-08-07 Becton Dickinson And Company Methods and systems for assessing sample behavior in a flow cytometer
WO2014124046A1 (en) 2013-02-08 2014-08-14 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
US20140227684A1 (en) 2013-02-08 2014-08-14 10X Technologies, Inc. Partitioning and processing of analytes and other species
WO2014126937A1 (en) 2013-02-14 2014-08-21 The Board Of Trustees Of The Leland Stanford Junior University Suspension arrays and multiplexed assays based thereon
US20140244742A1 (en) 2013-02-26 2014-08-28 PortAura Group Method and system for providing recommendations using location information
US20140243242A1 (en) 2011-08-08 2014-08-28 The Broad Institute. Inc. Compositions and methods for co-amplifying subsequences of a nucleic acid fragment sequence
US8835110B2 (en) 2008-11-04 2014-09-16 The Johns Hopkins University DNA integrity assay (DIA) for cancer diagnostics, using confocal fluorescence spectroscopy
WO2014144495A1 (en) 2013-03-15 2014-09-18 Abvitro, Inc. Single cell bar-coding for antibody discovery
US20140274811A1 (en) 2013-03-14 2014-09-18 Lyle J. Arnold Methods for Amplifying a Complete Genome or Transcriptome
WO2014145458A1 (en) 2013-03-15 2014-09-18 Arizona Board Of Regents On Behalf Of Arizona State University Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
US20140272952A1 (en) 2009-04-02 2014-09-18 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
US8856410B2 (en) 2011-03-29 2014-10-07 SK Hynix Inc. Semiconductor memory apparatus
US20140303005A1 (en) 2013-04-05 2014-10-09 Raindance Technologies, Inc. Rare cell analysis after negative selection
US20140309945A1 (en) 2011-11-30 2014-10-16 Samsung Sds Co., Ltd. Genome sequence alignment apparatus and method
US20140315211A1 (en) 2011-05-26 2014-10-23 Brandeis University Methods for suppression pcr
EP2805769A1 (en) 2013-05-24 2014-11-26 European Molecular Biology Laboratory Methods for nano-scale single cell analysis
WO2014201273A1 (en) 2013-06-12 2014-12-18 The Broad Institute, Inc. High-throughput rna-seq
WO2014200767A1 (en) 2013-06-12 2014-12-18 The General Hospital Corporation Methods, kits, and systems for multiplexed detection of target molecules and uses thereof
WO2014204939A2 (en) 2013-06-17 2014-12-24 Kim Lewis Methods for quantitative determination of protein-nucleic acid interactions in complex mixtures
US20140378349A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20140378322A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20140378350A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20140378345A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
WO2014210225A1 (en) 2013-06-25 2014-12-31 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
WO2014210353A2 (en) 2013-06-27 2014-12-31 10X Technologies, Inc. Compositions and methods for sample processing
US20150005199A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US20150005200A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
WO2015002908A1 (en) 2013-07-01 2015-01-08 Sequenta, Inc. Large-scale biomolecular analysis with sequence tags
US20150017654A1 (en) 2005-10-12 2015-01-15 The Research Foundation For The State University Of New York Absolute PCR Quantification
WO2015031691A1 (en) 2013-08-28 2015-03-05 Cellular Research, Inc. Massively parallel single cell analysis
US20150066385A1 (en) 2013-08-30 2015-03-05 10X Technologies, Inc. Sequencing methods
US20150072873A1 (en) * 2013-05-03 2015-03-12 Cambrian Genomics, Inc. Method and apparatus for producing sequence verified dna
WO2015035087A1 (en) 2013-09-04 2015-03-12 Fluidigm Corporation Proximity assays for detecting nucleic acids and proteins in a single cell
US20150072867A1 (en) 2012-04-03 2015-03-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Analysis of nucleic acid molecules distributed on a surface or within a layer by sequencing with position identification
WO2015044428A1 (en) 2013-09-30 2015-04-02 Sten Linnarsson Method for capturing and encoding nucleic acid from a plurality of single cells
WO2015047186A1 (en) 2013-09-30 2015-04-02 Di Wu Methods to profile molecular complexes by using proximity bar-coding
WO2015057985A1 (en) 2013-10-17 2015-04-23 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
US20150111256A1 (en) 2012-02-17 2015-04-23 President And Fellows Of Harvard College Assembly of Nucleic Acid Sequences in Emulsions
WO2015061844A1 (en) 2013-10-30 2015-05-07 The University Of Sydney Assay to stratify cancer patients
US20150152409A1 (en) 2011-09-16 2015-06-04 Lexogen Gmbh Nucleic acid transcription method
WO2015103339A1 (en) 2013-12-30 2015-07-09 Atreca, Inc. Analysis of nucleic acids associated with single cells using nucleic acid barcodes
US20150203897A1 (en) 2012-05-08 2015-07-23 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed pcr reactions
US20150211050A1 (en) 2014-01-27 2015-07-30 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
WO2015117163A2 (en) 2014-02-03 2015-08-06 Integrated Dna Technologies, Inc. Methods to capture and/or remove highly abundant rnas from a heterogeneous rna sample
US20150253237A1 (en) * 2013-10-25 2015-09-10 Massachusetts Institute Of Technology Method and apparatus for tracking cell identity
WO2015134787A2 (en) 2014-03-05 2015-09-11 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
WO2015160439A2 (en) 2014-04-17 2015-10-22 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US20150298091A1 (en) 2014-04-21 2015-10-22 President And Fellows Of Harvard College Systems and methods for barcoding nucleic acids
WO2015168161A2 (en) 2014-04-29 2015-11-05 Illumina, Inc. Multiplexed single cell gene expression analysis using template switch and tagmentation
US20150329852A1 (en) 2012-08-08 2015-11-19 Garry P. Nolan Increasing dynamic range for identifying multiple epitopes in cells
WO2015179339A1 (en) 2014-05-19 2015-11-26 William Marsh Rice University Allele-specific amplification using a composition of overlapping non-allele-specific primer and allele-specific blocker oligonucleotides
WO2015200869A1 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Analysis of nucleic acid sequences
WO2015200893A2 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Methods of analyzing nucleic acids from individual cells or cell populations
EP2970957A1 (en) 2013-03-15 2016-01-20 Illumina, Inc. METHODS FOR PRODUCING STRANDED cDNA LIBRARIES
EP2970958A2 (en) 2013-03-15 2016-01-20 Lineage Biosciences, Inc. Methods of sequencing the immune repertoire
US20160017320A1 (en) 2014-07-15 2016-01-21 Qiagen Sciences, Llc Semi-random barcodes for nucleic acid analysis
US20160026758A1 (en) 2012-02-27 2016-01-28 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
US9262376B2 (en) 2010-07-07 2016-02-16 Advantest Corporation Test apparatus and test method
US20160053253A1 (en) 2014-04-29 2016-02-25 Illumina, Inc. Nucleic acid sequence analysis from single cells
US20160055632A1 (en) 2013-10-07 2016-02-25 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
EP2989215A1 (en) 2013-04-25 2016-03-02 Firefly Bioworks, Inc. Multiplexed analysis of target nucleic acids
US20160060621A1 (en) 2014-06-24 2016-03-03 Bio-Rad Laboratories, Inc. Digital pcr barcoding
US20160068889A1 (en) 2014-09-10 2016-03-10 Good Start Genetics, Inc. Methods for selectively suppressing non-target sequences
WO2016044227A1 (en) 2014-09-15 2016-03-24 Abvitro, Inc. High-throughput nucleotide library sequencing
US9297047B2 (en) 2011-10-24 2016-03-29 Jennifer Furchak Molecular beacon based assay for the detection of biomarkers for breast cancer metastasis
WO2016049418A1 (en) 2014-09-25 2016-03-31 Everspin Technologies, Inc. Ecc word configuration for system-level ecc compatibility
WO2016061517A2 (en) 2014-10-17 2016-04-21 Illumina Cambridge Limited Contiguity preserving transposition
US20160153973A1 (en) 2013-07-09 2016-06-02 Lucas David Smith Device and method of rapid linker mediated label-based immunoassays
WO2016100976A2 (en) 2014-12-19 2016-06-23 Apprise Bio, Inc. Methods for identifying multiple epitopes in selected sub-populations of cells
WO2016118915A1 (en) 2015-01-22 2016-07-28 Becton, Dickinson And Company Devices and systems for molecular barcoding of nucleic acid targets in single cells
US20160232291A1 (en) 2015-02-09 2016-08-11 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
US20160244828A1 (en) 2015-02-19 2016-08-25 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
WO2016138496A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Spatially addressable molecular barcoding
WO2016138500A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Methods and compositions for barcoding nucleic acids for sequencing
WO2016145409A1 (en) 2015-03-11 2016-09-15 The Broad Institute, Inc. Genotype and phenotype coupling
US20160266094A1 (en) 2015-03-13 2016-09-15 University Of Iowa Research Foundation Cellular barcode
WO2016149418A1 (en) 2015-03-18 2016-09-22 Cellular Research, Inc. Methods and compositions for labeling targets and haplotype phasing
US20160289740A1 (en) 2015-03-30 2016-10-06 Cellular Research, Inc. Methods and compositions for combinatorial barcoding
WO2016160965A1 (en) 2015-03-30 2016-10-06 Rubicon Genomics, Inc. Methods and compositions for repair of dna ends by multiple enzymatic activities
WO2016168825A1 (en) 2015-04-17 2016-10-20 Centrillion Technology Holdings Corporation Methods for performing spatial profiling of biological molecules
US20160312276A1 (en) 2015-04-23 2016-10-27 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
US20160320720A1 (en) 2015-04-28 2016-11-03 Kyocera Document Solutions Inc. Image forming apparatus
WO2016191272A1 (en) 2015-05-22 2016-12-01 Sigma-Aldrich Co. Llc Methods for next generation genome walking and related compositions and kits
WO2016190795A1 (en) 2015-05-28 2016-12-01 Kaarel Krjutskov Blocking oligonucleotides
WO2017032808A1 (en) 2015-08-24 2017-03-02 Qiagen Gmbh Method for generating a rna-sequencing library
WO2017040306A1 (en) 2015-08-28 2017-03-09 Illumina, Inc. Nucleic acid sequence analysis from single cells
US9593365B2 (en) 2012-10-17 2017-03-14 Spatial Transcriptions Ab Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
WO2017044574A1 (en) 2015-09-11 2017-03-16 Cellular Research, Inc. Methods and compositions for nucleic acid library normalization
WO2017053905A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Affinity-oligonucleotide conjugates and uses thereof
WO2017079593A1 (en) 2015-11-04 2017-05-11 Atreca, Inc. Combinatorial sets of nucleic acid barcodes for analysis of nucleic acids associated with single cells
WO2017087873A1 (en) 2015-11-18 2017-05-26 Wafergen, Inc. Systems and methods for pooling samples from multi-well devices
WO2017096239A1 (en) 2015-12-04 2017-06-08 St. Jude Children's Research Hospital, Inc. Cloning and expression system for t-cell receptors
WO2017097939A1 (en) 2015-12-08 2017-06-15 Hifibio Method for transcriptome analysis of single cells
US20170192013A1 (en) 2015-12-30 2017-07-06 Bio-Rad Laboratories, Inc. Digital protein quantification
WO2017125508A1 (en) 2016-01-19 2017-07-27 General Electric Company Multifunctional beads and methods of use for capturing target cells
WO2017139690A1 (en) 2016-02-11 2017-08-17 10X Genomics, Inc. Cell population analysis using single nucleotide polymorphisms from single cell transcriptomes
WO2017164936A1 (en) 2016-03-21 2017-09-28 The Broad Institute, Inc. Methods for determining spatial and temporal gene expression dynamics in single cells
WO2017173328A1 (en) 2016-04-01 2017-10-05 Baylor College Of Medicine Methods of whole transcriptome amplification
US9787810B1 (en) 2016-05-28 2017-10-10 Hong Fu Jin Precision Industry (Shenzhen) Co., Ltd. Angle adjusting mechanism for telephone
US20170314067A1 (en) 2016-05-02 2017-11-02 Cellular Research, Inc. Accurate molecular barcoding
US20170344866A1 (en) 2016-05-26 2017-11-30 Cellular Research, Inc. Molecular label counting adjustment methods
US20170342465A1 (en) 2016-05-31 2017-11-30 Cellular Research, Inc. Error correction in amplification of samples
US20170342405A1 (en) 2016-05-31 2017-11-30 Cellular Research, Inc. Molecular indexing of internal sequences
US20170342484A1 (en) 2016-05-25 2017-11-30 Cellular Research, Inc. Normalization of nucleic acid libraries
US9856530B2 (en) 2012-12-14 2018-01-02 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180002738A1 (en) 2015-01-23 2018-01-04 Qiagen Sciences, Llc High multiplex pcr with molecular barcoding
US20180016634A1 (en) 2014-06-26 2018-01-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2018017949A1 (en) 2016-07-22 2018-01-25 Verily Life Sciences Llc Quantitative massively parallel proteomics
WO2018020489A1 (en) 2016-07-24 2018-02-01 Yeda Research And Development Co. Ltd. Methods and kits for analyzing dna binding moieties attached to dna
US20180037942A1 (en) 2016-08-03 2018-02-08 Cellular Research, Inc. Enzyme-independent molecular indexing
WO2018031631A1 (en) 2016-08-10 2018-02-15 President And Fellows Of Harvard College Methods of de novo assembly of barcoded genomic dna fragments
WO2018058073A2 (en) 2016-09-26 2018-03-29 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
WO2018064640A1 (en) 2016-10-01 2018-04-05 Berkeley Lights, Inc. Dna barcode compositions and methods of in situ identification in a microfluidic device
US20180105808A1 (en) 2016-10-19 2018-04-19 10X Genomics, Inc. Methods and systems for barcoding nucleic acid molecules from individual cells or cell populations
US20180163201A1 (en) 2016-12-12 2018-06-14 Grail, Inc. Methods for tagging and amplifying rna template molecules for preparing sequencing libraries
US20180179591A1 (en) 2016-12-22 2018-06-28 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2018115852A1 (en) 2016-12-23 2018-06-28 Cs Genetics Limited Reagents and methods for molecular barcoding of nucleic acids of single cells
US10017761B2 (en) 2013-01-28 2018-07-10 Yale University Methods for preparing cDNA from low quantities of cells
US10023910B2 (en) 2013-03-15 2018-07-17 Complete Genomics, Inc. Multiple tagging of individual long DNA fragments
WO2018132635A1 (en) 2017-01-12 2018-07-19 Massachusetts Institute Of Technology Methods for analyzing t cell receptors and b cell receptors
US20180208975A1 (en) 2017-01-20 2018-07-26 Merck Sharp & Dohme Corp. Assay for simultaneous genomic and proteomic analysis
US20180216174A1 (en) 2017-02-01 2018-08-02 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
WO2018140966A1 (en) 2017-01-30 2018-08-02 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
WO2018144813A1 (en) 2017-02-02 2018-08-09 New York Genome Center Methods and compositions for identifying or quantifying targets in a biological sample
WO2018174827A1 (en) 2017-03-24 2018-09-27 National University Of Singapore Methods for multiplex detection of molecules
US20180276332A1 (en) 2017-03-24 2018-09-27 Cellular Research, Inc. Synthetic multiplets for multiplets determination
US10138518B2 (en) 2001-12-08 2018-11-27 Seegene, Inc. Annealing control primer and its uses
WO2018217862A1 (en) 2017-05-23 2018-11-29 Centrillion Technologies, Inc. Methods for performing spatial profiling of biological molecules
WO2018218222A1 (en) 2017-05-26 2018-11-29 Goldfless Stephen Jacob High-throughput polynucleotide library sequencing and transcriptome analysis
US20180340170A1 (en) 2017-05-26 2018-11-29 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
WO2018222548A1 (en) 2017-05-29 2018-12-06 President And Fellows Of Harvard College A method of amplifying single cell transcriptome
US20180346969A1 (en) 2017-06-05 2018-12-06 Cellular Research, Inc. Sample indexing for single cells
US20180371536A1 (en) 2015-06-01 2018-12-27 Cellular Research, Inc. Methods for rna quantification
US20190010552A1 (en) 2016-11-17 2019-01-10 GenomiCare Biotechnology (Shanghai) Co. Ltd Systems and Methods for Monitoring Lifelong Tumor Evolution Field of Invention
WO2019055852A1 (en) 2017-09-15 2019-03-21 Apton Biosystems, Inc. Heterogeneous single cell profiling using molecular barcoding
US20190095578A1 (en) 2017-09-25 2019-03-28 Cellular Research, Inc. Immune receptor-barcode error correction
WO2019076768A1 (en) 2017-10-16 2019-04-25 Tervisetehnoloogiate Arenduskeskus As Method and kit for dna library preparation
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2019084046A1 (en) 2017-10-23 2019-05-02 The Broad Institute, Inc. Single cell cellular component enrichment from barcoded sequencing libraries
US20190136316A1 (en) 2012-08-14 2019-05-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190136317A1 (en) 2012-08-14 2019-05-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10288608B2 (en) 2013-11-08 2019-05-14 Prognosys Biosciences, Inc. Polynucleotide conjugates and methods for analyte detection
WO2019099906A1 (en) 2017-11-16 2019-05-23 The Regents Of The University Of Colorado, A Body Corporate Methods to measure functional heterogeneity among single cells
US20190161743A1 (en) 2016-05-09 2019-05-30 President And Fellows Of Harvard College Self-Targeting Guide RNAs in CRISPR System
US20190177800A1 (en) 2017-12-08 2019-06-13 10X Genomics, Inc. Methods and compositions for labeling cells
WO2019113499A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. High-throughput methods for identifying gene interactions and networks
WO2019113506A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
WO2019113533A1 (en) 2017-12-08 2019-06-13 10X Genomics, Inc. Methods and compositions for labeling cells
WO2019113457A1 (en) 2017-12-07 2019-06-13 Massachusetts Institute Of Technology Single cell analyses
WO2019118355A1 (en) 2017-12-12 2019-06-20 10X Genomics, Inc. Systems and methods for single cell processing
WO2019126789A1 (en) 2017-12-22 2019-06-27 10X Genomics, Inc. Systems and methods for processing nucleic acid molecules from one or more cells
US20190211395A1 (en) 2018-01-05 2019-07-11 Billiontoone, Inc. Quality control templates ensuring validity of sequencing-based assays
US20190221292A1 (en) 2016-09-29 2019-07-18 Fujifilm Corporation Method for designing primers for multiplex pcr
US20190221287A1 (en) 2016-09-29 2019-07-18 Fujifilm Corporation Method for designing primers for multiplex pcr
WO2019157529A1 (en) 2018-02-12 2019-08-15 10X Genomics, Inc. Methods characterizing multiple analytes from individual cells or cell populations
US20190256907A1 (en) 2010-05-18 2019-08-22 Natera, Inc. Methods for non-invasive prenatal paternity testing
WO2019178164A1 (en) 2018-03-12 2019-09-19 Silicon Valley Scientific, Inc. Method and apparatus for processing tissue and other samples encoding cellular spatial position information
US20190338357A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company High throughput multiomics sample analysis
US20190338278A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
US20190338353A1 (en) 2016-12-22 2019-11-07 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2019218101A1 (en) 2018-05-17 2019-11-21 中国科学院大连化学物理研究所 High-throughput multiparametric single cell-derived extracellular vesicle analysis chip and use thereof
US20190390253A1 (en) 2016-12-22 2019-12-26 Guardant Health, Inc. Methods and systems for analyzing nucleic acid molecules
WO2020028266A1 (en) 2018-08-03 2020-02-06 Cellular Research, Inc. Nuclei barcoding and capture in single cells
WO2020033164A1 (en) 2018-08-08 2020-02-13 Vanderbilt University Systems and methods for simultaneous detection of antigens and antigen specific antibodies
WO2020037065A1 (en) 2018-08-17 2020-02-20 Cellular Research, Inc. Aptamer barcoding
WO2020046833A1 (en) 2018-08-28 2020-03-05 Cellular Research, Inc. Sample multiplexing using carbohydrate-binding and membrane-permeable reagents
WO2020072380A1 (en) 2018-10-01 2020-04-09 Cellular Research, Inc. Determining 5' transcript sequences
US20200149037A1 (en) 2018-11-08 2020-05-14 Cellular Research, Inc. Whole transcriptome analysis of single cells using random priming
WO2020123384A1 (en) 2018-12-13 2020-06-18 Cellular Research, Inc. Selective extension in single cell whole transcriptome analysis
WO2020131699A2 (en) 2018-12-17 2020-06-25 Natera, Inc. Methods for analysis of circulating cells
WO2020154247A1 (en) 2019-01-23 2020-07-30 Cellular Research, Inc. Oligonucleotides associated with antibodies
WO2020167920A1 (en) 2019-02-14 2020-08-20 Cellular Research, Inc. Hybrid targeted and whole transcriptome amplification
WO2020214642A1 (en) 2019-04-19 2020-10-22 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
US20210214784A1 (en) 2020-01-13 2021-07-15 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and rna
US20210214770A1 (en) 2020-01-13 2021-07-15 Becton, Dickinson And Company Cell capture using du-containing oligonucleotides
US20210222244A1 (en) 2020-01-17 2021-07-22 Becton, Dickinson And Company Methods and compositions for single cell secretomics
US20210230583A1 (en) 2020-01-29 2021-07-29 Becton, Dickinson And Company Barcoded wells for spatial mapping of single cells through sequencing
US20210230666A1 (en) 2018-04-27 2021-07-29 X Gen Us Co. Methods and compositions for preparing polynucleotides
WO2021155284A1 (en) 2020-01-31 2021-08-05 Becton Dickinson And Company Mesophilic dna polymerase extension blockers
US20210246492A1 (en) 2020-02-12 2021-08-12 Becton, Dickinson And Company Intracellular abseq
US11092607B2 (en) 2015-10-28 2021-08-17 The Board Institute, Inc. Multiplex analysis of single cell constituents
US20210263019A1 (en) 2020-02-25 2021-08-26 Becton, Dickinson And Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
US20210355484A1 (en) 2020-05-14 2021-11-18 Becton, Dickinson And Company Primers for immune repertoire profiling
US20210371909A1 (en) 2020-06-02 2021-12-02 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
US20220010362A1 (en) 2020-07-13 2022-01-13 Becton, Dickinson And Company cDNA SPIKE-IN CONTROL FOR SINGLE CELL ANALYSIS
US20220010361A1 (en) 2020-07-13 2022-01-13 Becton, Dickinson And Company TARGET ENRICHMENT USING NUCLEIC ACID PROBES FOR scRNAseq
US20220033810A1 (en) 2020-07-31 2022-02-03 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
WO2022040453A1 (en) 2020-08-20 2022-02-24 Becton, Dickinson And Company Blood cell lysing agent for isolating bacteria from blood culture
US20220154288A1 (en) 2020-11-17 2022-05-19 Becton, Dickinson And Company Combined analysis of cell-free nucleic acids and single cells for oncology diagnostics
US20220162773A1 (en) 2020-11-20 2022-05-26 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
US20220162695A1 (en) 2020-11-20 2022-05-26 Becton, Dickinson And Company Use of dextramer in single cell analysis

Family Cites Families (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE81724T1 (en) 1987-11-09 1992-11-15 Becton Dickinson Co PROCEDURE FOR ANALYZING HAEMATOPOIETIC CELLS IN A SAMPLE.
WO1992005801A1 (en) 1990-10-04 1992-04-16 University Of Virginia Alumni Patents Foundation Primate erythrocyte bound monoclonal antibody heteropolymers
CN102586228A (en) 1999-09-13 2012-07-18 纽亘技术公司 Methods and composition for linear isothermal amplification of polynucleotide sequences
WO2003031591A2 (en) 2001-10-10 2003-04-17 Superarray Bioscience Corporation Detecting targets by unique identifier nucleotide tags
US20090208936A1 (en) 2005-01-04 2009-08-20 Univeristy Of Florida Research Foundations Inc. Identification of molecular interactions and therapeutic uses thereof
SI2963709T1 (en) 2008-10-24 2017-10-30 Epicentre Technologies Corporation Transposon end compositions and methods for modifying nucleic acids
US8309306B2 (en) 2008-11-12 2012-11-13 Nodality, Inc. Detection composition
US8415161B2 (en) 2008-11-13 2013-04-09 Becton, Dickinson And Company Instrument setup system for a fluorescence analyzer
WO2010093872A2 (en) 2009-02-13 2010-08-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Molecular-based method of cancer diagnosis and prognosis
GB201011971D0 (en) 2010-07-15 2010-09-01 Olink Ab Methods and product
CN103703143B (en) 2011-01-31 2016-12-14 爱普瑞斯生物公司 Method for identifying multiple epitopes in a cell
EP2670894B1 (en) 2011-02-02 2017-11-29 University Of Washington Through Its Center For Commercialization Massively parallel continguity mapping
US8946389B2 (en) 2011-04-25 2015-02-03 University Of Washington Compositions and methods for multiplex biomarker profiling
US9834766B2 (en) 2011-09-02 2017-12-05 Atreca, Inc. DNA barcodes for multiplexed sequencing
CN107541546B (en) 2012-10-15 2021-06-15 生命技术公司 Compositions, methods, systems, and kits for target nucleic acid enrichment
JP6475718B2 (en) 2013-07-30 2019-02-27 プレジデント アンド フェローズ オブ ハーバード カレッジ Quantitative DNA-based imaging and super-resolution imaging
US9526450B2 (en) 2013-11-27 2016-12-27 Elwha Llc Devices and methods for profiling microbiota of skin
WO2015128272A2 (en) 2014-02-26 2015-09-03 Ventana Medical Systems, Inc. Photo-selective method for biological sample analysis field
EP3155426B1 (en) 2014-06-13 2023-07-19 Immudex ApS General detection and isolation of specific cells by binding of labeled molecules
WO2016126871A2 (en) 2015-02-04 2016-08-11 The Regents Of The University Of California Sequencing of nucleic acids via barcoding in discrete entities
CA2976681A1 (en) 2015-02-27 2016-09-01 Fluidigm Corporation Single-cell nucleic acids for high-throughput studies
US10844428B2 (en) 2015-04-28 2020-11-24 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
AU2017259794B2 (en) 2016-05-02 2023-04-13 Encodia, Inc. Macromolecule analysis employing nucleic acid encoding
WO2018015365A1 (en) 2016-07-18 2018-01-25 Roche Sequencing Solutions, Inc. Asymmetric templates and asymmetric method of nucleic acid sequencing
ES2873723T3 (en) 2016-07-22 2021-11-03 Univ Oregon Health & Science Single cell whole genome collections and combinatorial indexing methods to prepare them
EP3490616B1 (en) 2016-07-27 2022-09-28 The Board of Trustees of the Leland Stanford Junior University Highly-multiplexed fluorescent imaging
US12065644B2 (en) 2017-02-16 2024-08-20 Takara Bio Usa, Inc. Methods of preparing nucleic acid libraries and compositions and kits for practicing the same
CN109415758B (en) 2017-02-21 2022-08-30 Illumina公司 Tagmentation using adaptor-containing immobilized transposomes
CA3055817A1 (en) 2017-03-08 2018-09-13 President And Fellows Of Harvard College Methods of amplifying dna to maintain methylation status
US12180546B2 (en) 2017-03-17 2024-12-31 Massachusetts Institute Of Technology Methods for identifying and modulating co-occurant cellular phenotypes
JP2020522243A (en) 2017-05-23 2020-07-30 プレジデント アンド フェローズ オブ ハーバード カレッジ Multiplexed end-tagging amplification of nucleic acids
AU2018335575B2 (en) 2017-09-25 2024-07-04 Fred Hutchinson Cancer Center High efficiency targeted in situ genome-wide profiling
WO2019152108A1 (en) 2018-02-05 2019-08-08 The Board Of Trustees Of The Leland Stanford Junior University Systems and methods for multiplexed measurements in single and ensemble cells
US12275936B2 (en) 2018-04-18 2025-04-15 The Regents Of The University Of California Method to connect chromatin accessibility and transcriptome
GB201810571D0 (en) 2018-06-27 2018-08-15 Cs Genetics Ltd Reagents and methods for the analysis of circulating microparticles
US20210222163A1 (en) 2018-07-11 2021-07-22 X Gen Us Co. Transposome enabled dna/rna-sequencing (ted rna-seq)
WO2020159757A1 (en) 2019-01-28 2020-08-06 Becton, Dickinson And Company Oligonucleotide-comprising cellular component-binding reagents and methods of using the same
WO2020219721A1 (en) 2019-04-23 2020-10-29 The Broad Institute, Inc. Compositions and methods characterizing metastasis
SG10201904897UA (en) 2019-05-30 2020-12-30 Nat Univ Singapore Method, structures and system for nucleic acid sequence topology assembly for multiplexed profiling of proteins.
EP3997217A4 (en) 2019-07-12 2023-06-28 New York Genome Center, Inc. Methods and compositions for scalable pooled rna screens with single cell chromatin accessibility profiling
CN114051534B (en) 2019-07-22 2025-02-21 贝克顿迪金森公司 Single-cell chromatin immunoprecipitation sequencing assay
CN110498858B (en) 2019-07-26 2024-01-23 深圳市达科为生物工程有限公司 Method for dynamically detecting secretion condition of single-cell exoprotein
US20210039582A1 (en) 2019-08-07 2021-02-11 ZF Passive Safety Systems US Inc. Airbag package with improved packaging
JP7522189B2 (en) 2019-11-08 2024-07-24 ベクトン・ディキンソン・アンド・カンパニー Use of Random Priming to Obtain Full-Length V(D)J Information for Immune Repertoire Sequencing
EP4339299B1 (en) 2020-01-10 2025-08-27 10X Genomics, Inc. Methods for determining a location of a target nucleic acid in a biological sample
WO2021168015A1 (en) 2020-02-17 2021-08-26 Universal Sequencing Technology Corporation Methods of barcoding nucleic acid for detection and sequencing
EP4107282A1 (en) 2020-02-21 2022-12-28 10X Genomics, Inc. Capturing genetic targets using a hybridization approach
EP4114965A1 (en) 2020-03-05 2023-01-11 Biolegend, Inc. Methods and compositions for detecting targets
US20230235384A1 (en) 2020-06-18 2023-07-27 Nanostring Technologies, Inc. Compositions and methods for in situ single cell analysis using enzymatic nucleic acid extension
EP4225934B1 (en) 2020-10-09 2024-07-24 10X Genomics, Inc. Methods and compositions for analyzing antigen binding molecules
WO2022115608A1 (en) 2020-11-25 2022-06-02 Alida Biosciences, Inc. Multiplexed profiling of rna and dna modifications
US20220178909A1 (en) 2020-12-09 2022-06-09 Becton, Dickinson And Company Multiplexed single cell immunoassay
CN116685850A (en) 2020-12-15 2023-09-01 贝克顿迪金森公司 Single-cell secretome analysis
US20240384259A1 (en) 2020-12-31 2024-11-21 Beijing Institute of Genomics, Chinese Academy of Sciences (China National Center for Bioinformation Method and kit for labeling nucleic acid molecules
KR20230142832A (en) 2021-01-08 2023-10-11 셀라노메, 인크. Devices and methods for analyzing biological samples
CN117396613A (en) 2021-06-01 2024-01-12 10X基因组学有限公司 Methods and compositions for analyte detection and probe interpretation
US20240376522A1 (en) 2021-08-30 2024-11-14 Becton, Dickinson And Company Template switch oligonucleotide (tso) for mrna 5' analysis
US20240287591A1 (en) 2021-08-31 2024-08-29 Becton, Dickinson And Company Use of decoy polynucleotides in single cell multiomics
CN117897498A (en) 2021-08-31 2024-04-16 贝克顿迪金森公司 RNA preservation and recovery from immobilized cells
CN117897613A (en) 2021-08-31 2024-04-16 贝克顿迪金森公司 Multiplex proteomic analysis using oligonucleotide conjugated antibodies
CN117916389A (en) 2021-09-01 2024-04-19 贝克顿迪金森公司 Spatial multi-omics using in situ reverse transcription
CN117999358A (en) 2021-09-08 2024-05-07 贝克顿迪金森公司 Non-sequencing PCR-based method for detecting antibody-conjugated oligonucleotides

Patent Citations (816)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4510244A (en) 1980-04-17 1985-04-09 The Board Of Trustees Of The Leland Stanford Jr. University Cell labeling with antigen-coupled microspheres
US4725536A (en) 1985-09-19 1988-02-16 Genetics Institute, Inc. Reagent polynucleotide complex with multiple target binding regions, and kit and methods
US6512105B1 (en) 1986-11-24 2003-01-28 Gen-Probe Incorporated Methods for making oligonucleotide probes for the detection and/or quantitation of non-viral organisms
WO1989001050A1 (en) 1987-07-31 1989-02-09 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
US5149625A (en) 1987-08-11 1992-09-22 President And Fellows Of Harvard College Multiplex analysis of DNA
US5124246A (en) 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5656731A (en) 1987-10-15 1997-08-12 Chiron Corporation Nucleic acid-amplified immunoassay probes
US6114149A (en) 1988-07-26 2000-09-05 Genelabs Technologies, Inc. Amplification of mixed sequence nucleic acid fragments
US6551784B2 (en) 1989-06-07 2003-04-22 Affymetrix Inc Method of comparing nucleic acid sequences
US6395491B1 (en) 1989-06-07 2002-05-28 Affymetrix, Inc. Method of information storage and recovery
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US6576424B2 (en) 1989-06-07 2003-06-10 Affymetrix Inc. Arrays and methods for detecting nucleic acids
US6197506B1 (en) 1989-06-07 2001-03-06 Affymetrix, Inc. Method of detecting nucleic acids
US5871928A (en) 1989-06-07 1999-02-16 Fodor; Stephen P. A. Methods for nucleic acid analysis
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5925525A (en) 1989-06-07 1999-07-20 Affymetrix, Inc. Method of identifying nucleotide differences
US6440667B1 (en) 1989-06-07 2002-08-27 Affymetrix Inc. Analysis of target molecules using an encoding system
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US6309822B1 (en) 1989-06-07 2001-10-30 Affymetrix, Inc. Method for comparing copy number of nucleic acid sequences
US6355432B1 (en) 1989-06-07 2002-03-12 Affymetrix Lnc. Products for detecting nucleic acids
US5200314A (en) 1990-03-23 1993-04-06 Chiron Corporation Polynucleotide capture assay employing in vitro amplification
JPH04108385A (en) 1990-08-27 1992-04-09 Res Dev Corp Of Japan Production of equalized cdna library
US6544739B1 (en) 1990-12-06 2003-04-08 Affymetrix, Inc. Method for marking samples
US6451536B1 (en) 1990-12-06 2002-09-17 Affymetrix Inc. Products for detecting nucleic acids
US5308990A (en) 1991-05-15 1994-05-03 Hitachi, Ltd. Method for measuring microparticles, quantitative measuring method therefor and instrument for measuring microparticles
US5981179A (en) 1991-11-14 1999-11-09 Digene Diagnostics, Inc. Continuous amplification reaction
US5424413A (en) 1992-01-22 1995-06-13 Gen-Probe Incorporated Branched nucleic acid probes
US6060596A (en) 1992-03-30 2000-05-09 The Scripps Research Institute Encoded combinatorial chemical libraries
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US6284460B1 (en) 1993-06-25 2001-09-04 Affymetrix Inc. Hybridization and sequencing of nucleic acids using base pair mismatches
US6268152B1 (en) 1993-06-25 2001-07-31 Affymetrix, Inc. Probe kit for identifying a base in a nucleic acid
US6852488B2 (en) 1993-06-25 2005-02-08 Affymetrix, Inc. Identifying a base in a nucleic acid
US5759778A (en) 1993-08-10 1998-06-02 Life Technologies, Inc. Method of nucleic acid sequence selection
US6309823B1 (en) 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
US5635352A (en) 1993-12-08 1997-06-03 Chiron Corporation Solution phase nucleic acid sandwich assays having reduced background noise
US5714330A (en) 1994-04-04 1998-02-03 Lynx Therapeutics, Inc. DNA sequencing by stepwise ligation and cleavage
US20040147435A1 (en) 1994-06-13 2004-07-29 Vanderbilt University Compositions and methods for importing biologically active molecules into cells and for treating inflammation
GB2293238A (en) 1994-09-13 1996-03-20 Inceltec Ltd Primers for replication and/or amplification reactions
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5846719A (en) 1994-10-13 1998-12-08 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5654413A (en) 1994-10-13 1997-08-05 Spectragen, Inc. Compositions for sorting polynucleotides
US5635400A (en) 1994-10-13 1997-06-03 Spectragen, Inc. Minimally cross-hybridizing sets of oligonucleotide tags
US6235475B1 (en) 1994-10-13 2001-05-22 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US6172214B1 (en) 1994-10-13 2001-01-09 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US6140489A (en) 1994-10-13 2000-10-31 Lynx Therapeutics, Inc. Compositions for sorting polynucleotides
US6138077A (en) 1994-10-13 2000-10-24 Lynx Therapeutics, Inc. Method, apparatus and computer program product for determining a set of non-hybridizing oligonucleotides
US6600996B2 (en) 1994-10-21 2003-07-29 Affymetrix, Inc. Computer-aided techniques for analyzing biological sequences
US5658737A (en) 1994-10-28 1997-08-19 Gen-Probe Incorporated Compositions and methods for the simultaneous detection and quantification of multiple specific nucleic acid sequences
WO1996024061A1 (en) 1995-02-02 1996-08-08 Ontogen Corporation Methods and apparatus for synthesizing labeled combinatorial chemical libraries
US20090226891A2 (en) 1995-04-25 2009-09-10 Nexus Biosystems, Inc. Encoded solid supports for biological processing and assays using same
US5648245A (en) 1995-05-09 1997-07-15 Carnegie Institution Of Washington Method for constructing an oligonucleotide concatamer library by rolling circle replication
US5968740A (en) 1995-07-24 1999-10-19 Affymetrix, Inc. Method of Identifying a Base in a Nucleic Acid
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
WO1997010365A1 (en) 1995-09-15 1997-03-20 Affymax Technologies N.V. Expression monitoring by hybridization to high density oligonucleotide arrays
US5763175A (en) 1995-11-17 1998-06-09 Lynx Therapeutics, Inc. Simultaneous sequencing of tagged polynucleotides
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6284485B1 (en) 1995-12-22 2001-09-04 Amgen Inc. Nucleic acids encoding osteoprotegerin
US5962271A (en) 1996-01-03 1999-10-05 Cloutech Laboratories, Inc. Methods and compositions for generating full-length cDNA having arbitrary nucleotide sequence at the 3'-end
US5962272A (en) 1996-01-03 1999-10-05 Clontech Laboratories, Inc. Methods and compositions for full-length cDNA Cloning using a template-switching oligonucleotide
US5830712A (en) 1996-02-06 1998-11-03 Allelix Biopharmaceuticals Inc. Selective template deletion method
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
US20030104436A1 (en) 1996-04-04 2003-06-05 Affymetrix, Inc. Methods and compositions for selecting tag nucleic acids and probe arrays
US20040146901A1 (en) 1996-04-04 2004-07-29 Affymetrix, Inc. Selecting tag nucleic acids
US20070042419A1 (en) 1996-05-29 2007-02-22 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US6064755A (en) 1996-07-05 2000-05-16 Fuji Photo Film Co., Ltd. Image analyzing apparatus for producing density profile data of an image
US20020172953A1 (en) 1996-07-29 2002-11-21 Mirkin Chad A. Movement of biomolecule-coated nanoparticles in an electric field
US20030087242A1 (en) 1996-07-29 2003-05-08 Mirkin Chad A. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20030207296A1 (en) 1996-07-29 2003-11-06 So-Jung Park Nanoparticles having oligonucleotides attached thereto and uses therefor
US6214558B1 (en) 1996-08-14 2001-04-10 Exact Laboratories, Inc. Methods for the detection of chromosomal aberrations
US5935793A (en) 1996-09-27 1999-08-10 The Chinese University Of Hong Kong Parallel polynucleotide sequencing method using tagged primers
US6124092A (en) 1996-10-04 2000-09-26 The Perkin-Elmer Corporation Multiplex polynucleotide capture methods and compositions
US6514699B1 (en) 1996-10-04 2003-02-04 Pe Corporation (Ny) Multiplex polynucleotide capture methods and compositions
US6117631A (en) 1996-10-29 2000-09-12 Polyprobe, Inc. Detection of antigens via oligonucleotide antibody conjugates
US6468744B1 (en) 1997-01-03 2002-10-22 Affymetrix, Inc. Analysis of genetic polymorphisms and gene copy number
US6046005A (en) 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US6406848B1 (en) 1997-05-23 2002-06-18 Lynx Therapeutics, Inc. Planar arrays of microparticle-bound polynucleotides
WO1999015702A1 (en) 1997-09-24 1999-04-01 Life Technologies, Inc. Normalized nucleic acid libraries and methods of production thereof
WO1999028505A1 (en) 1997-12-03 1999-06-10 Curagen Corporation Methods and devices for measuring differential gene expression
US6265163B1 (en) 1998-01-09 2001-07-24 Lynx Therapeutics, Inc. Solid phase selection of differentially expressed genes
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
US6653077B1 (en) 1998-09-04 2003-11-25 Lynx Therapeutics, Inc. Method of screening for genetic polymorphism
US6480791B1 (en) 1998-10-28 2002-11-12 Michael P. Strathmann Parallel methods for genomic analysis
US6197554B1 (en) 1998-11-20 2001-03-06 Shi-Lung Lin Method for generating full-length cDNA library from single cells
US20020019005A1 (en) 1999-02-18 2002-02-14 Arcaris, Inc. Process for identification of genes encoding proteins having cell proliferation-promoting activity
US6629040B1 (en) 1999-03-19 2003-09-30 University Of Washington Isotope distribution encoded tags for protein identification
WO2000058516A2 (en) 1999-03-26 2000-10-05 Whitehead Institute For Biomedical Research Universal arrays
US6492121B2 (en) 1999-04-20 2002-12-10 Japan Bioindustry Association Method for determining a concentration of target nucleic acid molecules, nucleic acid probes for the method, and method for analyzing data obtained by the method
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US6372813B1 (en) 1999-06-25 2002-04-16 Motorola Methods and compositions for attachment of biomolecules to solid supports, hydrogels, and hydrogel arrays
US6326148B1 (en) 1999-07-12 2001-12-04 The Regents Of The University Of California Detection of copy number changes in colon cancer
US7824889B2 (en) 1999-08-02 2010-11-02 The Johns Hopkins University Digital amplification
US7915015B2 (en) 1999-08-02 2011-03-29 The Johns Hopkins University Digital amplification
US6753147B2 (en) 1999-08-02 2004-06-22 The Johns Hopkins University Digital amplification
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
JP2001078768A (en) 1999-09-16 2001-03-27 Otsuka Pharmaceut Co Ltd Assay of gene expression
US6436675B1 (en) 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
US7155050B1 (en) 1999-11-03 2006-12-26 Ge Healthcare Bio-Sciences Ab Method of analyzing cell samples, by creating and analyzing a resultant image
US6489114B2 (en) 1999-12-17 2002-12-03 Bio Merieux Process for labeling a ribonucleic acid, and labeled RNA fragments which are obtained thereby
US20010036632A1 (en) 1999-12-29 2001-11-01 Zailin Yu Methods for amplifying and detecting multiple polynucleotides on a solid phase support
US6500620B2 (en) 1999-12-29 2002-12-31 Mergen Ltd. Methods for amplifying and detecting multiple polynucleotides on a solid phase support
WO2001048242A2 (en) 1999-12-29 2001-07-05 Mergen Ltd. Methods for amplifying and detecting multiple polynucleotides on a solid phase support
WO2001053539A1 (en) 2000-01-24 2001-07-26 Phylos, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US20010024784A1 (en) 2000-01-24 2001-09-27 Wagner Richard W. Sensitive, multiplexed diagnostic assays for protein analysis
US6489116B2 (en) 2000-01-24 2002-12-03 Phylos, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US7022479B2 (en) 2000-01-24 2006-04-04 Compound Therapeutics, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US20030032049A1 (en) 2000-01-24 2003-02-13 Wagner Richard W. Sensitive, multiplexed diagnostic assays for protein analysis
US6235483B1 (en) 2000-01-31 2001-05-22 Agilent Technologies, Inc. Methods and kits for indirect labeling of nucleic acids
US20020132241A1 (en) 2000-02-07 2002-09-19 Jian-Bing Fan Multiplexed detection of analytes
US20050214825A1 (en) 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
US20030003490A1 (en) 2000-02-07 2003-01-02 Illumina, Inc. Nucleic acid detection methods using universal priming
US6890741B2 (en) 2000-02-07 2005-05-10 Illumina, Inc. Multiplexed detection of analytes
US20020072058A1 (en) 2000-03-24 2002-06-13 Voelker Leroy L. Method for amplifying quinolone-resistance-determining-regions and identifying polymorphic variants thereof
US6974669B2 (en) 2000-03-28 2005-12-13 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified nanoparticles
US20020192687A1 (en) 2000-03-28 2002-12-19 Mirkin Chad A. Bio-barcodes based on oligonucleotide-modified nanoparticles
US7323309B2 (en) 2000-03-28 2008-01-29 Northwestern University Bio-barcodes based on oligonucleotide-modified particles
US20040091864A1 (en) 2000-03-29 2004-05-13 French David John Hybridisation beacon and method of rapid sequence detection and discrimination
US20020065609A1 (en) 2000-04-10 2002-05-30 Matthew Ashby Methods for the survey and genetic analysis of populations
US20030207300A1 (en) 2000-04-28 2003-11-06 Matray Tracy J. Multiplex analytical platform using molecular tags
US20020051986A1 (en) 2000-06-13 2002-05-02 Luis Baez Method for the detection of an analyte by means of a nucleic acid reporter
US20110059436A1 (en) 2000-07-07 2011-03-10 Life Technologies Corporation Methods for sequence determination
US20050105077A1 (en) 2000-08-02 2005-05-19 Aravind Padmanabhan Miniaturized cytometer for detecting multiple species in a sample
WO2002018643A2 (en) 2000-08-11 2002-03-07 Nanosphere Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20020106666A1 (en) 2000-08-25 2002-08-08 Yoshihide Hayashizaki Method of preparing normalized and/or subtracted cDNA
US20020094116A1 (en) 2000-08-25 2002-07-18 Amnis Corporation Method and apparatus for reading reporter labeled beads
US6858412B2 (en) 2000-10-24 2005-02-22 The Board Of Trustees Of The Leland Stanford Junior University Direct multiplex characterization of genomic DNA
WO2002046472A2 (en) 2000-12-08 2002-06-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002056014A2 (en) 2000-12-22 2002-07-18 Glaxo Group Limited Methods for encoding and decoding complex mixtures in arrayed assays
US20030049616A1 (en) 2001-01-08 2003-03-13 Sydney Brenner Enzymatic synthesis of oligonucleotide tags
WO2002070684A2 (en) 2001-01-11 2002-09-12 Lion Bioscience Ag Gene library for screening methods
WO2002059355A2 (en) 2001-01-25 2002-08-01 Tm Bioscience Corporation Polynucleotides for use as tags and tag complements, manufacture and use thereof
WO2002072772A2 (en) 2001-03-09 2002-09-19 Nugen Technologies, Inc. Methods and compositions for amplification of rna sequences
US20100167354A1 (en) 2001-03-09 2010-07-01 Nurith Kurn Methods and compositions for amplification of rna sequences
US8071311B2 (en) 2001-03-09 2011-12-06 Nugen Technologies, Inc. Methods and compositions for amplification of RNA sequences
US7771946B2 (en) 2001-03-09 2010-08-10 Nugen Technologies, Inc. Methods, kits and compositions for single primer linear isothermal amplification of nucleic acid sequences
US9181582B2 (en) 2001-03-09 2015-11-10 Nugen Technologies, Inc. Compositions for amplification of RNA sequences using composite primers
US6946251B2 (en) 2001-03-09 2005-09-20 Nugen Technologies, Inc. Methods and compositions for amplification of RNA sequences using RNA-DNA composite primers
JP2005233974A (en) 2001-03-21 2005-09-02 Olympus Corp Biochemical inspection method
US20020168665A1 (en) 2001-03-21 2002-11-14 Olympus Optical Co., Ltd. Biochemical examination method
EP1379693A2 (en) 2001-03-28 2004-01-14 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified particles
WO2002079490A2 (en) 2001-03-28 2002-10-10 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified particles
WO2002083922A2 (en) 2001-04-11 2002-10-24 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Modified random primers for probe labeling
US20020187480A1 (en) 2001-05-04 2002-12-12 Genomics Research Partners Pty Ltd Diagnostic method for assessing a condition of a performance animal
US6849404B2 (en) 2001-05-07 2005-02-01 Bioneer Corporation Polymerase chain reaction of DNA of which base sequence is completely unidentified
WO2002101358A2 (en) 2001-06-11 2002-12-19 Illumina, Inc. Multiplexed detection methods
US20040047769A1 (en) 2001-06-12 2004-03-11 Yokogawa Electric Corporation Biochip
US20030013091A1 (en) 2001-07-03 2003-01-16 Krassen Dimitrov Methods for detection and quantification of analytes in complex mixtures
US7473767B2 (en) 2001-07-03 2009-01-06 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US20030082818A1 (en) 2001-07-12 2003-05-01 Automated Cell, Inc. Method and apparatus for monitoring of proteins and cells
WO2003035829A2 (en) 2001-10-09 2003-05-01 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20110070584A1 (en) 2001-10-22 2011-03-24 Xdx, Inc. Methods and compositions for diagnosing and monitoring autoimmune and chronic inflammatory diseases
US20030077611A1 (en) 2001-10-24 2003-04-24 Sention Methods and systems for dynamic gene expression profiling
US20030165935A1 (en) 2001-11-21 2003-09-04 Vann Charles S. Digital assay
US10138518B2 (en) 2001-12-08 2018-11-27 Seegene, Inc. Annealing control primer and its uses
US8110351B2 (en) 2002-01-16 2012-02-07 Invitrogen Dynal As Method for isolating nucleic acids and protein from a single sample
US20030175908A1 (en) 2002-01-29 2003-09-18 Sten Linnarsson Methods and means for manipulating nucleic acid
CA2474509A1 (en) 2002-02-14 2003-08-21 Immunivest Corporation Methods and algorithms for cell enumeration in a low-cost cytometer
US20030186251A1 (en) 2002-04-01 2003-10-02 Brookhaven Science Associates, Llc Genome sequence tags
US20050175993A1 (en) 2002-04-12 2005-08-11 Chia-Lin Wei Method for making full-length coding sequence cDNA libraries
US20070178478A1 (en) 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
US20050032110A1 (en) 2002-05-08 2005-02-10 Mary Shen Directionally cloned random cDNA expression vector libraries, compositions and methods of use
US7034145B2 (en) 2002-05-08 2006-04-25 Rigel Pharmaceuticals, Inc. Directionally cloned random cDNA expression vector libraries, compositions and methods of use
US6808906B2 (en) 2002-05-08 2004-10-26 Rigel Pharmaceuticals, Inc. Directionally cloned random cDNA expression vector libraries, compositions and methods of use
US20060057634A1 (en) 2002-05-29 2006-03-16 Philip Rye Assay for glycosylated proteins
US20040096368A1 (en) 2002-06-28 2004-05-20 Igen International, Inc. Assay systems and components
US20050019776A1 (en) 2002-06-28 2005-01-27 Callow Matthew James Universal selective genome amplification and universal genotyping system
WO2004017374A2 (en) 2002-08-16 2004-02-26 Clinical Microarrays, Inc. Reading of fluorescent arrays
US9988660B2 (en) 2002-09-03 2018-06-05 Quanta Biosciences Compositions and methods for cDNA synthesis
US7470515B2 (en) 2002-09-03 2008-12-30 Quanta Biosciences Compositions and methods for cDNA synthesis
WO2004021986A2 (en) 2002-09-03 2004-03-18 Quanta Biosciences, Inc. Improved compositions and methods for cdna synthesis
US8420324B2 (en) 2002-09-03 2013-04-16 Quanta Biosciences Compositions and methods for cDNA synthesis
US7638612B2 (en) 2002-09-03 2009-12-29 Quanta Biosciences, Inc. Compositions and methods for cDNA synthesis
US7476786B2 (en) 2002-09-20 2009-01-13 Intel Corporation Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM) reading
US20070031829A1 (en) 2002-09-30 2007-02-08 Hideyuki Yasuno Oligonucleotides for genotyping thymidylate synthase gene
US20050053952A1 (en) 2002-10-02 2005-03-10 California Institute Of Technology Microfluidic nucleic acid analysis
WO2004033669A2 (en) 2002-10-11 2004-04-22 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Methods of manipulating nucleic acids
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20040157243A1 (en) 2002-11-11 2004-08-12 Affymetrix, Inc. Methods for identifying DNA copy number changes
US7424368B2 (en) 2002-11-11 2008-09-09 Affymetix, Inc. Methods for identifying DNA copy number changes
US20040096892A1 (en) 2002-11-15 2004-05-20 The Johns Hopkins University Digital karyotyping
US20040224325A1 (en) 2002-12-20 2004-11-11 Caliper Life Sciences, Inc. Single molecule amplification and detection of DNA
US20040121342A1 (en) 2002-12-20 2004-06-24 Orchid Biosciences, Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
WO2004066185A1 (en) 2003-01-23 2004-08-05 U.S. Genomics, Inc. Methods for analyzing polymer populations
US20060040297A1 (en) 2003-01-29 2006-02-23 Leamon John H Methods of amplifying and sequencing nucleic acids
US7718403B2 (en) 2003-03-07 2010-05-18 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
WO2004081225A2 (en) 2003-03-07 2004-09-23 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
US8206913B1 (en) 2003-03-07 2012-06-26 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
US20180030522A1 (en) 2003-03-07 2018-02-01 Takara Bio Usa, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
US20040209298A1 (en) 2003-03-07 2004-10-21 Emmanuel Kamberov Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
US20160355879A1 (en) 2003-03-07 2016-12-08 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
EP1473080A2 (en) 2003-04-30 2004-11-03 Agilent Technologies, Inc. Chemical array reading
US20040259118A1 (en) 2003-06-23 2004-12-23 Macevicz Stephen C. Methods and compositions for nucleic acid sequence analysis
US20070065823A1 (en) 2003-07-05 2007-03-22 Devin Dressman Method and compositions for detection and enumeration of genetic variations
US20060281092A1 (en) 2003-07-24 2006-12-14 Tanja Wille Method for the reverse transcription and/or amplification of nucleic acids
WO2005017206A1 (en) 2003-08-13 2005-02-24 Affymetrix, Inc. Methods and kits for preparing nucleic acid samples
US20070105090A1 (en) 2003-08-16 2007-05-10 Andrew Cassidy Amplification method
US20100105886A1 (en) 2003-08-29 2010-04-29 Life Technologies Corporation Compositions, methods, and kits for fabricating coded molecular tags
US20100184076A1 (en) 2003-09-02 2010-07-22 Restalyst Pte Ltd Soluble analyte detection and amplification
US20050048500A1 (en) 2003-09-02 2005-03-03 Lawton Robert L. Soluble analyte detection and amplification
WO2005021731A2 (en) 2003-09-02 2005-03-10 Binax Inc Soluble analyte detection and amplification
EP2204456A1 (en) 2003-09-02 2010-07-07 Robert L. Lawton Soluble analyte detection and amplification
US20060286570A1 (en) 2003-09-09 2006-12-21 Rowlen Kathy L Use of photopolymerization for amplification and detection of a molecular recognition event
US20050170373A1 (en) 2003-09-10 2005-08-04 Althea Technologies, Inc. Expression profiling using microarrays
JP2007504831A (en) 2003-09-10 2007-03-08 アルセア・テクノロジーズ・インク. Expression profiling using microarrays
WO2005042759A2 (en) 2003-09-10 2005-05-12 Althea Technologies, Inc. Expression profiling using microarrays
US7824856B2 (en) 2003-09-10 2010-11-02 Althea Technologies, Inc. Expression profiling using microarrays
US20070042400A1 (en) 2003-11-10 2007-02-22 Choi K Y Methods of preparing nucleic acid for detection
US20080261204A1 (en) 2004-01-23 2008-10-23 Lingvitae As Polynucleotide Ligation Reactions
WO2005071110A2 (en) 2004-01-23 2005-08-04 Lingvitae As Improving polynucleotide ligation reactions
WO2005080604A2 (en) 2004-02-12 2005-09-01 Compass Genetics, Llc Genetic analysis by sequence-specific sorting
US20130022977A1 (en) 2004-02-27 2013-01-24 Sequenom, Inc Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
US7432055B2 (en) 2004-03-05 2008-10-07 Uchicago Argonne Llc Dual phase multiplex polymerase chain reaction
US20050196760A1 (en) 2004-03-05 2005-09-08 Alexander Pemov Dual phase multiplex polymerase chain reaction
US7294466B2 (en) 2004-05-07 2007-11-13 Cepheid Multiplexed detection of biological agents
WO2005111243A2 (en) 2004-05-07 2005-11-24 Cepheid Multiplexed detection of biological agents
EP1745155A2 (en) 2004-05-07 2007-01-24 Cepheid Multiplexed detection of biological agents
US20050250146A1 (en) 2004-05-07 2005-11-10 Mcmillan William A Multiplexed detection of biological agents
US20050250147A1 (en) 2004-05-10 2005-11-10 Macevicz Stephen C Digital profiling of polynucleotide populations
WO2005111242A2 (en) 2004-05-10 2005-11-24 Parallele Bioscience, Inc. Digital profiling of polynucleotide populations
US20060002824A1 (en) 2004-06-07 2006-01-05 Irm, Llc Dispensing systems, software, and related methods
US20060035258A1 (en) 2004-08-06 2006-02-16 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20060041385A1 (en) 2004-08-18 2006-02-23 Bauer Kenneth D Method of quantitating proteins and genes in cells using a combination of immunohistochemistry and in situ hybridization
US20070202523A1 (en) 2004-08-27 2007-08-30 Becker Michael M Methods and kits for amplifying dna
WO2006026828A1 (en) 2004-09-10 2006-03-16 Human Genetic Signatures Pty Ltd Amplification blocker comprising intercalating nucleic acids (tna) containing intercalating pseudonucleotides (ipn)
EP1647600A2 (en) 2004-09-17 2006-04-19 Affymetrix, Inc. (A US Entity) Methods for identifying biological samples by addition of nucleic acid bar-code tags
US20060073506A1 (en) 2004-09-17 2006-04-06 Affymetrix, Inc. Methods for identifying biological samples
WO2006137932A2 (en) 2004-11-03 2006-12-28 Leucadia Technologies, Inc. Homogeneous analyte detection
US20090053669A1 (en) 2004-12-14 2009-02-26 Align Technology, Inc. System and methods for casting physical tooth model
US20100291666A1 (en) 2004-12-23 2010-11-18 Gordon Bruce Collier Molecular diagnostics system and methods
WO2006071776A2 (en) 2004-12-23 2006-07-06 Ge Healthcare Bio-Sciences Corp. Ligation-based rna amplification
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
US8318433B2 (en) 2005-02-10 2012-11-27 Population Genetics Technologies Ltd. Methods and compositions for tagging and identifying polynucleotides
US8148068B2 (en) 2005-02-10 2012-04-03 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
US8168385B2 (en) 2005-02-10 2012-05-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
US8470996B2 (en) 2005-02-10 2013-06-25 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
EP1845160A1 (en) 2005-02-10 2007-10-17 Riken Method for amplification of nucleotide sequence
US20080318802A1 (en) 2005-02-10 2008-12-25 Population Genetics Technologies Ltd. Methods and compositions for tagging and identifying polynucleotides
US8476018B2 (en) 2005-02-10 2013-07-02 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
US7407757B2 (en) 2005-02-10 2008-08-05 Population Genetics Technologies Genetic analysis by sequence-specific sorting
US20060211030A1 (en) 2005-03-16 2006-09-21 Sydney Brenner Methods and compositions for assay readouts on multiple analytical platforms
WO2006102264A1 (en) 2005-03-18 2006-09-28 Fluidigm Corporation Thermal reaction device and method for using the same
US20060257902A1 (en) 2005-03-25 2006-11-16 Ambion, Inc. Methods and compositions for depleting abundant RNA transcripts
US20060263789A1 (en) 2005-05-19 2006-11-23 Robert Kincaid Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using
US20060263709A1 (en) 2005-05-19 2006-11-23 Fuji Xerox Co., Ltd. Process for producing resin particle liquid dispersion for electrostatic image developing toner, electrostatic image developing toner and production process thereof
US20120253689A1 (en) 2005-06-07 2012-10-04 Rogan Peter K Ab initio generation of single copy genomic probes
US20070065844A1 (en) 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US20060280352A1 (en) 2005-06-10 2006-12-14 The Cleveland Clinic Foundation Image analysis of biological objects
US20070020640A1 (en) 2005-07-21 2007-01-25 Mccloskey Megan L Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis
US20070117177A1 (en) 2005-08-11 2007-05-24 Dan Luo Nucleic Acid-Based Matrixes for Protein Production
US20070117121A1 (en) 2005-09-16 2007-05-24 Hutchison Stephen K cDNA library preparation
US20150017654A1 (en) 2005-10-12 2015-01-15 The Research Foundation For The State University Of New York Absolute PCR Quantification
US20090220385A1 (en) 2005-11-01 2009-09-03 Brown Jeffrey A Liquid dispensing for high-throughput experimentation
US20070117134A1 (en) 2005-11-18 2007-05-24 Kou Zhong C Method for detection and quantification of T-cell receptor Vbeta repertoire
US20080070303A1 (en) 2005-11-21 2008-03-20 West Michael D Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby
US20070133856A1 (en) 2005-12-09 2007-06-14 Cytyc Corporation Cross-frame object reconstruction for image-based cytology applications
US7537897B2 (en) 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
US20070172873A1 (en) 2006-01-23 2007-07-26 Sydney Brenner Molecular counting
US7544473B2 (en) 2006-01-23 2009-06-09 Population Genetics Technologies Ltd. Nucleic acid analysis using sequence tokens
US8445205B2 (en) 2006-01-23 2013-05-21 Population Genetics Technologies Ltd. Nucleic acid analysis using sequence tokens
WO2007087312A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Molecular counting
WO2007087310A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Nucleic acid analysis using sequence tokens
EP2538220A1 (en) 2006-02-21 2012-12-26 Trustees Of Tufts College Methods and arrays for target analyte detection and determination of target analyte concentration in solution
US20080038727A1 (en) 2006-03-10 2008-02-14 Applera Corporation MicroRNA and Messenger RNA Detection on Arrays
US20090283676A1 (en) 2006-04-04 2009-11-19 Sidec Technologies Ab Extended electron tomography
US20080194414A1 (en) 2006-04-24 2008-08-14 Albert Thomas J Enrichment and sequence analysis of genomic regions
US20090137407A1 (en) 2006-05-18 2009-05-28 President And Fellows Of Harvard College Genomic library construction
US7985546B2 (en) 2006-05-18 2011-07-26 President And Fellows Of Harvard College Genomic library construction
US20070281317A1 (en) 2006-06-06 2007-12-06 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
WO2007147079A2 (en) 2006-06-14 2007-12-21 Living Microsystems, Inc. Rare cell analysis using sample splitting and dna tags
US20100105112A1 (en) 2006-08-07 2010-04-29 Christian Holtze Fluorocarbon emulsion stabilizing surfactants
US20120087862A1 (en) 2006-08-09 2012-04-12 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2008147428A1 (en) 2006-10-05 2008-12-04 Nanopoint, Inc. Systems and methods for active microfluidic cell handling
US8367051B2 (en) 2006-10-09 2013-02-05 Carnegie Mellon University Preparation of functional gel particles with a dual crosslink network
WO2008057163A2 (en) 2006-10-09 2008-05-15 Carnegie Mellon University Preparation of functional gel particles with a dual crosslink network
WO2008047428A1 (en) 2006-10-18 2008-04-24 Osaki Electric Co., Ltd. Electronic watthour meter
WO2008051928A2 (en) 2006-10-23 2008-05-02 The Salk Institute For Biological Studies Target-oriented whole genome amplification of nucliec acids
US8603749B2 (en) 2006-11-15 2013-12-10 Biospherex, LLC Multitag sequencing ecogenomics analysis-US
US20080119736A1 (en) 2006-11-22 2008-05-22 General Electric Company Heart rate demodulation of periodic movement in ultrasound data for object identification
US20120034607A1 (en) 2006-12-14 2012-02-09 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale fet arrays
US20120045844A1 (en) 2006-12-14 2012-02-23 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale fet arrays
US20090252414A1 (en) 2007-01-16 2009-10-08 Olympus Corporation Fluorescent signal analyzing apparatus and fluorescent signal analyzing method
US20100120630A1 (en) 2007-01-30 2010-05-13 The Regents Of The University Of California Methods and devices for biomolecular arrays
US20080269068A1 (en) 2007-02-06 2008-10-30 President And Fellows Of Harvard College Multiplex decoding of sequence tags in barcodes
WO2008096318A2 (en) 2007-02-09 2008-08-14 Koninklijke Philips Electronics N.V. Identification system
US20110263457A1 (en) 2007-02-16 2011-10-27 Krutzik Peter O Multiplex Cellular Assays Using Detectable Cell Barcodes
US20110312511A1 (en) 2007-02-27 2011-12-22 Ola Winquist Multiplex Detection of Tumour Cells Using a Panel of Agents Binding to Extracellular Markers
WO2008104380A2 (en) 2007-02-27 2008-09-04 Sentoclone Ab Multiplex detection of tumour cells using a panel of agents binding to extracellular markers
US20100136544A1 (en) 2007-03-07 2010-06-03 Jeremy Agresti Assays and other reactions involving droplets
US20080299609A1 (en) 2007-03-12 2008-12-04 Sungkyunkwan University Foundation For Corporate Collaboration Uracil-DNA glycosylase of psychrobacter sp. HJ147 and use thereof
JP2008256428A (en) 2007-04-03 2008-10-23 Intec Systems Institute Inc Method for detecting block position of microarray image
US20080268508A1 (en) 2007-04-30 2008-10-30 Sowlay Mohankumar R Methods and kits for negative selection of desired nucleic acid sequences
US20080274458A1 (en) 2007-05-01 2008-11-06 Latham Gary J Nucleic acid quantitation methods
US20090061513A1 (en) 2007-05-15 2009-03-05 Picovitro Ab Cell sorting and cell cultivation methods
WO2008150432A1 (en) 2007-06-01 2008-12-11 454 Life Sciences Corporation System and meth0d for identification of individual samples from a multiplex mixture
US20090105959A1 (en) 2007-06-01 2009-04-23 Braverman Michael S System and method for identification of individual samples from a multiplex mixture
US7635566B2 (en) 2007-06-29 2009-12-22 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
US8241850B2 (en) 2007-06-29 2012-08-14 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
EP2036989A1 (en) 2007-09-12 2009-03-18 Institut Pasteur Single cell based reporter assay to monitor gene expression patterns with high spatio-temporal resolution
US8685753B2 (en) 2007-10-05 2014-04-01 Affymetrix, Inc. Highly multiplexed particle-based assays
US8114681B2 (en) 2007-10-05 2012-02-14 Affymetrix, Inc. Highly multiplexed particle-based assays
US20120202293A1 (en) 2007-10-05 2012-08-09 Affymetrix, Inc. Highly Multiplexed Particle-Based Assays
WO2009048530A2 (en) 2007-10-05 2009-04-16 Panomics, Inc. Highly multiplexed particle-based assays
US20090131269A1 (en) 2007-10-05 2009-05-21 Panomics, Inc. Highly multiplexed particle-based assays
EP2203749A2 (en) 2007-10-05 2010-07-07 Panomics, Inc. Highly multiplexed particle-based assays
EP3136103A1 (en) 2007-10-05 2017-03-01 Affymetrix, Inc. Highly multiplexed assays
EP2511708A1 (en) 2007-10-05 2012-10-17 Affymetrix, Inc. Highly multiplexed particle-based assays
US20090253586A1 (en) 2008-02-21 2009-10-08 Gentel Biosciences, Inc. Substrates for multiplexed assays and uses thereof
US20090290151A1 (en) 2008-03-03 2009-11-26 Ajjer Llc Analysis of arrays by laser induced breakdown spectroscopy
US20090311694A1 (en) 2008-04-14 2009-12-17 Medical Diagnostic Laboratoiries, Llc Splice variants of human IL-23 receptor (IL-23R) mRNA and use of a delta 9 isoform in predicting inflammatory bowel diseases
US20090298709A1 (en) 2008-05-28 2009-12-03 Affymetrix, Inc. Assays for determining telomere length and repeated sequence copy number
DE102008025656A1 (en) 2008-05-28 2009-12-03 Genxpro Gmbh Method for quantitative analysis of nicoleic acids, markers therefor and their use
WO2009152928A2 (en) 2008-05-28 2009-12-23 Genxpro Gmbh Method for the quantitative analysis of nucleic acids, markers therefor and their use
WO2009148560A2 (en) 2008-05-30 2009-12-10 Board Of Regents, The Universtiy Of Texas System Methods and compositions for nucleic acid sequencing
US20100069250A1 (en) 2008-08-16 2010-03-18 The Board Of Trustees Of The Leland Stanford Junior University Digital PCR Calibration for High Throughput Sequencing
US20100105049A1 (en) 2008-09-16 2010-04-29 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US20100120098A1 (en) 2008-10-24 2010-05-13 Epicentre Technologies Corporation Transposon end compositions and methods for modifying nucleic acids
US8835110B2 (en) 2008-11-04 2014-09-16 The Johns Hopkins University DNA integrity assay (DIA) for cancer diagnostics, using confocal fluorescence spectroscopy
WO2010059820A1 (en) 2008-11-21 2010-05-27 Saint Louis University Biosensor for detecting multiple epitopes on a target
US20100159533A1 (en) 2008-11-24 2010-06-24 Helicos Biosciences Corporation Simplified sample preparation for rna analysis
US20100267028A1 (en) 2008-12-24 2010-10-21 Boris Pasche Tgfbr1 HAPLOINSUFFICIENCY MODIFIES RISK FOR CANCER
US20100255471A1 (en) 2009-01-20 2010-10-07 Stanford University Single cell gene expression for diagnosis, prognosis and identification of drug targets
US20100323348A1 (en) 2009-01-31 2010-12-23 The Regents Of The University Of Colorado, A Body Corporate Methods and Compositions for Using Error-Detecting and/or Error-Correcting Barcodes in Nucleic Acid Amplification Process
US20130045994A1 (en) 2009-03-05 2013-02-21 Daiichi Sankyo Company, Limited Pyridine derivative
US20120231972A1 (en) 2009-03-19 2012-09-13 Golyshin Peter N Probe Compound for Detecting and Isolating Enzymes and Means and Methods Using the Same
US20120010091A1 (en) 2009-03-30 2012-01-12 Illumina, Inc. Gene expression analysis in single cells
WO2010117620A2 (en) 2009-03-30 2010-10-14 Illumina, Inc. Gene expression analysis in single cells
US20140272952A1 (en) 2009-04-02 2014-09-18 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
US20120065081A1 (en) 2009-04-30 2012-03-15 Chee Mark S Nucleic acid constructs and methods of use
EP2431465A1 (en) 2009-05-14 2012-03-21 Wako Pure Chemical Industries, Ltd. Method for synthesis of double-stranded dna corresponding to rna, and method for amplification of the dna
US20120058520A1 (en) 2009-05-14 2012-03-08 Wako Pure Chemical Industries, Ltd. Method for synthesis of double-stranded dna corresponding to rna, and method for amplification of the dna
WO2010131645A1 (en) 2009-05-14 2010-11-18 和光純薬工業株式会社 Method for synthesis of double-stranded dna corresponding to rna, and method for amplification of the dna
US20120252012A1 (en) 2009-05-14 2012-10-04 Assistance Publique - Hopitaux De Marseille Method for detecting prokaryotic dna from a feces sample
US20100300895A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems, Inc. Apparatus and methods for performing electrochemical reactions
US20120156675A1 (en) 2009-06-09 2012-06-21 Oxford Gene Technology Ip Limited Picowell capture devices for analysing single cells or other particles
US20120058902A1 (en) 2009-06-25 2012-03-08 Livingston Robert J Method of measuring adaptive immunity
US20110038507A1 (en) 2009-06-29 2011-02-17 Hager Environmental and Atmospheric Technologie, LLC Device and Method for Quantification of Gases in Plumes by Remote Sensing
US20100330574A1 (en) 2009-06-29 2010-12-30 Whitman Douglas F Chimeric primers with hairpin conformations and methods of using same
US8679756B1 (en) 2009-08-20 2014-03-25 Population Genetics Technologies Ltd Compositions and methods for intramolecular nucleic acid rearrangement
US8298767B2 (en) 2009-08-20 2012-10-30 Population Genetics Technologies Ltd Compositions and methods for intramolecular nucleic acid rearrangement
US8563274B2 (en) 2009-08-20 2013-10-22 Population Genetics Technologies Ltd Compositions and methods for intramolecular nucleic acid rearrangement
US20120165219A1 (en) 2009-09-01 2012-06-28 Koninklijke Philips Electronics N.V. Devices and methods for microarray selection
US20120220022A1 (en) 2009-09-01 2012-08-30 Trustees Of Boston University High throughput multichannel reader and uses thereof
US20110059556A1 (en) 2009-09-04 2011-03-10 The Research Foundation Of State University Of New York Rapid and Continuous Analyte Processing in Droplet Microfluidic Devices
US20110072889A1 (en) 2009-09-30 2011-03-31 Quest Diagnostics Investments Incorporated Bcr-abl truncation mutations
US20160222378A1 (en) 2009-12-15 2016-08-04 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20180327835A1 (en) 2009-12-15 2018-11-15 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US20150099661A1 (en) 2009-12-15 2015-04-09 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9290809B2 (en) 2009-12-15 2016-03-22 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20110160078A1 (en) 2009-12-15 2011-06-30 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US10619203B2 (en) 2009-12-15 2020-04-14 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US20150141292A1 (en) 2009-12-15 2015-05-21 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20150005185A1 (en) 2009-12-15 2015-01-01 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US20150119257A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US20150119256A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US10392661B2 (en) 2009-12-15 2019-08-27 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US20150118680A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US20150119255A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20160326584A1 (en) 2009-12-15 2016-11-10 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20150119290A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US20150119258A1 (en) 2009-12-15 2015-04-30 Cellular Research, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels
US20160376648A1 (en) 2009-12-15 2016-12-29 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20160376583A1 (en) 2009-12-15 2016-12-29 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20150099673A1 (en) 2009-12-15 2015-04-09 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20190100798A1 (en) 2009-12-15 2019-04-04 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US9708659B2 (en) 2009-12-15 2017-07-18 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US10202646B2 (en) 2009-12-15 2019-02-12 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US9290808B2 (en) 2009-12-15 2016-03-22 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9816137B2 (en) 2009-12-15 2017-11-14 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20180327836A1 (en) 2009-12-15 2018-11-15 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US10059991B2 (en) 2009-12-15 2018-08-28 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9845502B2 (en) 2009-12-15 2017-12-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US10047394B2 (en) 2009-12-15 2018-08-14 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US20130116130A1 (en) 2009-12-15 2013-05-09 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Label-Tags
US20110230358A1 (en) 2010-01-19 2011-09-22 Artemis Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
US20110201507A1 (en) 2010-01-19 2011-08-18 Rava Richard P Sequencing methods and compositions for prenatal diagnoses
WO2011091393A1 (en) 2010-01-25 2011-07-28 Rd Biosciences, Inc. Self-folding amplification of target nucleic acid
US20110244455A1 (en) 2010-02-12 2011-10-06 Raindance Technologies, Inc. Digital analyte analysis
US9228229B2 (en) 2010-02-12 2016-01-05 Raindance Technologies, Inc. Digital analyte analysis
US8535889B2 (en) 2010-02-12 2013-09-17 Raindance Technologies, Inc. Digital analyte analysis
US20120014977A1 (en) 2010-02-19 2012-01-19 National University Corporation Chiba University NOVEL ALTERNATIVE SPLICING VARIANT OF OATP1B3 mRNA
WO2011106738A2 (en) 2010-02-25 2011-09-01 Fred Hutchinson Cancer Research Center Use of tcr clonotypes as biomarkers for disease
WO2011123246A2 (en) 2010-04-01 2011-10-06 Illumina, Inc. Solid-phase clonal amplification and related methods
US20110245111A1 (en) 2010-04-05 2011-10-06 Prognosys Biosciences, Inc. Spatially encoded biological assays
US9371598B2 (en) 2010-04-05 2016-06-21 Prognosys Biosciences, Inc. Spatially encoded biological assays
US20160298180A1 (en) 2010-04-05 2016-10-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
EP2556171A1 (en) 2010-04-05 2013-02-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10308982B2 (en) 2010-04-05 2019-06-04 Prognosys Biosciences, Inc. Spatially encoded biological assays
WO2011127099A1 (en) 2010-04-05 2011-10-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
WO2011143659A2 (en) 2010-05-14 2011-11-17 Fluidigm Corporation Nucleic acid isolation methods
US20190256907A1 (en) 2010-05-18 2019-08-22 Natera, Inc. Methods for non-invasive prenatal paternity testing
US20110294689A1 (en) 2010-05-27 2011-12-01 Affymetrix, Inc Multiplex Amplification Methods
WO2011155833A2 (en) 2010-06-09 2011-12-15 Keygene N.V. Combinatorial sequence barcodes for high throughput screening
US20120004132A1 (en) 2010-07-02 2012-01-05 Affymetrix, Inc. Detection of Nucleic Acids and Proteins
US9262376B2 (en) 2010-07-07 2016-02-16 Advantest Corporation Test apparatus and test method
US20130190206A1 (en) 2010-07-13 2013-07-25 Dublin City University Direct Clone Analysis and Selection Technology
US20120040843A1 (en) 2010-08-12 2012-02-16 Dublin City University Centrifugal capture system
US8715967B2 (en) 2010-09-21 2014-05-06 Population Genetics Technologies Ltd. Method for accurately counting starting molecules
US8741606B2 (en) 2010-09-21 2014-06-03 Population Genetics Technologies Ltd. Method of tagging using a split DBR
US20120071331A1 (en) 2010-09-21 2012-03-22 James Casbon Increasing confidence of allele calls with molecular counting
WO2012038839A2 (en) 2010-09-21 2012-03-29 Population Genetics Technologies Ltd. Increasing confidence of allele calls with molecular counting
US8685678B2 (en) 2010-09-21 2014-04-01 Population Genetics Technologies Ltd Increasing confidence of allele calls with molecular counting
US8722368B2 (en) 2010-09-21 2014-05-13 Population Genetics Technologies Ltd. Method for preparing a counter-tagged population of nucleic acid molecules
US8728766B2 (en) 2010-09-21 2014-05-20 Population Genetics Technologies Ltd. Method of adding a DBR by primer extension
US20130224743A1 (en) 2010-09-21 2013-08-29 Population Genetics Technologies Ltd Method for accurately counting starting molecules
US20130203047A1 (en) 2010-09-21 2013-08-08 Population Genetics Technologies Ltd Increasing Confidence of Allele Calls with Molecular Counting
US20130210643A1 (en) 2010-09-21 2013-08-15 Population Genetics Technologies Ltd Method for preparing a counter-tagged population of nucleic acid molecules.
US8481292B2 (en) 2010-09-21 2013-07-09 Population Genetics Technologies Litd. Increasing confidence of allele calls with molecular counting
US20130267424A1 (en) 2010-09-21 2013-10-10 Population Genetics Technologies Ltd Method of tagging using a split DBR
EP2623613A1 (en) 2010-09-21 2013-08-07 Population Genetics Technologies Ltd. Increasing confidence of allele calls with molecular counting
US20130237458A1 (en) 2010-09-21 2013-09-12 Population Genetics Technologies Ltd Method of adding a DBR by primer extension
WO2012041802A1 (en) 2010-09-29 2012-04-05 Deutsches Krebsforschungszentrum Means and methods for improved protein interaction screening
WO2012042374A2 (en) 2010-10-01 2012-04-05 Anssi Jussi Nikolai Taipale Method of determining number or concentration of molecules
US20130274117A1 (en) 2010-10-08 2013-10-17 President And Fellows Of Harvard College High-Throughput Single Cell Barcoding
WO2012048341A1 (en) 2010-10-08 2012-04-12 President And Fellows Of Harvard College High-throughput single cell barcoding
WO2012047297A2 (en) 2010-10-08 2012-04-12 Chen Gao Highly multiplexed real-time pcr using encoded microbeads
US10246703B2 (en) 2010-10-08 2019-04-02 President And Fellows Of Harvard College High-throughput single cell barcoding
US20130225623A1 (en) 2010-10-27 2013-08-29 Mount Sinai School Of Medicine Methods of Treating Psychiatric or Neurological Disorders with MGLUR Antagonists
US20120163681A1 (en) 2010-11-29 2012-06-28 Jesper Lohse Methods and systems for analyzing images of specimens processed by a programmable quantitative assay
US20120142018A1 (en) 2010-12-05 2012-06-07 Wenbin Jiang Rapid Single Cell Based Parallel Biological Cell Sorter
US20120149603A1 (en) 2010-12-09 2012-06-14 Akonni Biosystems Sample analysis system
WO2012148477A1 (en) 2010-12-15 2012-11-01 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US20140057799A1 (en) 2010-12-16 2014-02-27 Gigagen System and Methods for Massively Parallel Analysis of Nucleic Acids in Single Cells
WO2012083225A2 (en) 2010-12-16 2012-06-21 Gigagen, Inc. System and methods for massively parallel analysis of nycleic acids in single cells
US20120173159A1 (en) 2010-12-30 2012-07-05 Life Technologies Corporation Methods, systems, and computer readable media for nucleic acid sequencing
WO2012099896A2 (en) 2011-01-17 2012-07-26 Life Technologies Corporation Workflow for detection of ligands using nucleic acids
WO2012103154A1 (en) 2011-01-24 2012-08-02 Nugen Technologies, Inc. Stem-loop composite rna-dna adaptor-primers: compositions and methods for library generation, amplification and other downstream manipulations
US20120190020A1 (en) 2011-01-25 2012-07-26 Aria Diagnostics, Inc. Detection of genetic abnormalities
WO2012108864A1 (en) 2011-02-08 2012-08-16 Illumina, Inc. Selective enrichment of nucleic acids
US20120220494A1 (en) 2011-02-18 2012-08-30 Raindance Technolgies, Inc. Compositions and methods for molecular labeling
US20160289670A1 (en) 2011-02-18 2016-10-06 Raindance Technologies, Inc. Compositions and methods for molecular labeling
US9150852B2 (en) 2011-02-18 2015-10-06 Raindance Technologies, Inc. Compositions and methods for molecular labeling
US20160201125A1 (en) 2011-02-18 2016-07-14 Raindance Technologies, Inc. Compositions and methods for molecular labeling
WO2012112804A1 (en) 2011-02-18 2012-08-23 Raindance Technoligies, Inc. Compositions and methods for molecular labeling
US20140004569A1 (en) 2011-02-23 2014-01-02 Board Of Regents, The University Of Texas System Use of template switching for dna synthesis
US20140155274A1 (en) 2011-03-24 2014-06-05 President And Fellows Of Harvard College Single Cell Nucleic Acid Detection and Analysis
WO2012129363A2 (en) 2011-03-24 2012-09-27 President And Fellows Of Harvard College Single cell nucleic acid detection and analysis
US8856410B2 (en) 2011-03-29 2014-10-07 SK Hynix Inc. Semiconductor memory apparatus
US20140066318A1 (en) 2011-04-13 2014-03-06 Spatial Transcriptomics Ab Method and product for localized or spatial detection of nucleic acid in a tissue sample
WO2012140224A1 (en) 2011-04-13 2012-10-18 Jonas Frisen Method and product for localised or spatial detection of nucleic acid in a tissue sample
US20140227705A1 (en) 2011-04-15 2014-08-14 The Johns Hopkins University Safe sequencing system
WO2012142213A2 (en) 2011-04-15 2012-10-18 The Johns Hopkins University Safe sequencing system
US20120316074A1 (en) 2011-04-25 2012-12-13 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
WO2012149042A2 (en) 2011-04-25 2012-11-01 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
EP2702146A2 (en) 2011-04-28 2014-03-05 The Board of Trustees of The Leland Stanford Junior University Identification of polynucleotides associated with a sample
WO2012156744A2 (en) 2011-05-17 2012-11-22 Cambridge Enterprise Limited Gel beads in microfluidic droplets
US20130005585A1 (en) 2011-05-20 2013-01-03 Fluidigm Corporation Nucleic acid encoding reactions
WO2012162267A2 (en) 2011-05-20 2012-11-29 Fluidigm Corporation Nucleic acid encoding reactions
US20160208322A1 (en) 2011-05-20 2016-07-21 Fluidigm Corporation Nucleic acid encoding reactions
US20140178438A1 (en) 2011-05-24 2014-06-26 Ugur Sahin Individualized vaccines for cancer
US20140315211A1 (en) 2011-05-26 2014-10-23 Brandeis University Methods for suppression pcr
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
US20120322681A1 (en) 2011-06-15 2012-12-20 Gen9, Inc. Methods for Preparative In Vitro Cloning
WO2012177639A2 (en) 2011-06-22 2012-12-27 Alnylam Pharmaceuticals, Inc. Bioprocessing and bioproduction using avian cell lines
US20140147860A1 (en) 2011-06-27 2014-05-29 Life Technologies Corporation Acoustic Cytometry Methods and Protocols
WO2013019075A2 (en) 2011-08-01 2013-02-07 연세대학교산학협력단 Method of preparing nucleic acid molecules
US20140243242A1 (en) 2011-08-08 2014-08-28 The Broad Institute. Inc. Compositions and methods for co-amplifying subsequences of a nucleic acid fragment sequence
JP2013039275A (en) 2011-08-18 2013-02-28 Olympus Corp Fluorescence observation device, fluorescence observation system and method for processing fluorescence image
US20150152409A1 (en) 2011-09-16 2015-06-04 Lexogen Gmbh Nucleic acid transcription method
US9297047B2 (en) 2011-10-24 2016-03-29 Jennifer Furchak Molecular beacon based assay for the detection of biomarkers for breast cancer metastasis
WO2013070990A1 (en) 2011-11-11 2013-05-16 Glezer Eli N Co-binder assisted assay methods
US20140309945A1 (en) 2011-11-30 2014-10-16 Samsung Sds Co., Ltd. Genome sequence alignment apparatus and method
WO2013096802A1 (en) 2011-12-22 2013-06-27 Ibis Biosciences, Inc. Amplification primers and methods
WO2013117595A2 (en) 2012-02-07 2013-08-15 Illumina Cambridge Limited Targeted enrichment and amplification of nucleic acids on a support
US20130210659A1 (en) 2012-02-10 2013-08-15 Andrew Watson Molecular diagnostic screening assay
US20150111256A1 (en) 2012-02-17 2015-04-23 President And Fellows Of Harvard College Assembly of Nucleic Acid Sequences in Emulsions
US20130225418A1 (en) 2012-02-24 2013-08-29 Andrew Watson Labeling and sample preparation for sequencing
US20150133319A1 (en) 2012-02-27 2015-05-14 Cellular Research, Inc. Compositions and kits for molecular counting
US20160026758A1 (en) 2012-02-27 2016-01-28 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
WO2013130674A1 (en) 2012-02-27 2013-09-06 Cellular Research, Inc. Compositions and kits for molecular counting
US20210230582A1 (en) 2012-02-27 2021-07-29 Becton, Dickinson And Company Compositions and kits for molecular counting
WO2013137737A1 (en) 2012-03-16 2013-09-19 Flexgen B.V. Methods of creating and screening of dna encoded combinatorial libraries of chemical antibodies
WO2013148525A1 (en) 2012-03-29 2013-10-03 Complete Genomics, Inc. Flow cells for high density array chips
US20150072867A1 (en) 2012-04-03 2015-03-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Analysis of nucleic acid molecules distributed on a surface or within a layer by sequencing with position identification
US20150203897A1 (en) 2012-05-08 2015-07-23 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed pcr reactions
WO2013173394A2 (en) 2012-05-14 2013-11-21 Cb Biotechnologies, Inc. Method for increasing accuracy in quantitative detection of polynucleotides
US20130323732A1 (en) 2012-05-21 2013-12-05 Fluidigm Corporation Single-particle analysis of particle populations
WO2013177206A2 (en) 2012-05-21 2013-11-28 Fluidigm Corporation Single-particle analysis of particle populations
WO2013176767A1 (en) 2012-05-25 2013-11-28 The University Of North Carolina At Chapel Hill Microfluidic devices, solid supports for reagents and related methods
WO2013188872A1 (en) 2012-06-15 2013-12-19 The Board Of Regents Of The University Of Texas System High throughput sequencing of multiple transcripts of a single cell
WO2013188831A1 (en) 2012-06-15 2013-12-19 Adaptive Biotechnologies Corporation Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set
US20140322716A1 (en) 2012-06-15 2014-10-30 Adaptive Biotechnologies Corporation Uniquely Tagged Rearranged Adaptive Immune Receptor Genes in a Complex Gene Set
WO2013191775A2 (en) 2012-06-18 2013-12-27 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
WO2014015084A2 (en) 2012-07-17 2014-01-23 Counsyl, Inc. System and methods for detecting genetic variation
WO2014015098A1 (en) 2012-07-18 2014-01-23 Siemens Healthcare Diagnostics Inc. A method of normalizing biological samples
WO2014018460A1 (en) 2012-07-24 2014-01-30 Sequenta, Inc. Single cell analysis using sequence tags
US20150247182A1 (en) 2012-07-24 2015-09-03 Adaptive Biotechnologies Corp. Single cell analysis using sequence tags
US20150360193A1 (en) 2012-07-26 2015-12-17 Illumina, Inc. Compositions and methods for the amplification of nucleic acids
EP3428290A1 (en) 2012-07-26 2019-01-16 Illumina, Inc. Compositions and methods for the amplification of nucleic acids
WO2014018093A1 (en) 2012-07-26 2014-01-30 Illumina, Inc. Compositions and methods for the amplification of nucleic acids
US20150329852A1 (en) 2012-08-08 2015-11-19 Garry P. Nolan Increasing dynamic range for identifying multiple epitopes in cells
US9689024B2 (en) 2012-08-14 2017-06-27 10X Genomics, Inc. Methods for droplet-based sample preparation
US20150225777A1 (en) 2012-08-14 2015-08-13 10X Genomics, Inc. Capsule array devices and methods of use
US20150005200A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US20150005199A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US20140378322A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20190203291A1 (en) 2012-08-14 2019-07-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190136317A1 (en) 2012-08-14 2019-05-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20140378350A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US9695468B2 (en) 2012-08-14 2017-07-04 10X Genomics, Inc. Methods for droplet-based sample preparation
US10450607B2 (en) 2012-08-14 2019-10-22 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20150225778A1 (en) 2012-08-14 2015-08-13 10X Genomics, Inc. Capsule array devices and methods of use
US20140378349A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20190136316A1 (en) 2012-08-14 2019-05-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2014028537A1 (en) 2012-08-14 2014-02-20 10X Technologies, Inc. Microcapsule compositions and methods
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20140155295A1 (en) 2012-08-14 2014-06-05 10X Technologies, Inc. Capsule array devices and methods of use
US20190177788A1 (en) 2012-08-14 2019-06-13 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20140287963A1 (en) 2012-08-14 2014-09-25 10X Technologies, Inc. Capsule Array Devices and Methods of Use
US20140378345A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US9188586B2 (en) 2012-08-24 2015-11-17 Yale University System, device and method for high-throughput multi-plexed detection
WO2014031997A1 (en) 2012-08-24 2014-02-27 Yale University System, device and method for high-throughput multi-plexed detection
US9593365B2 (en) 2012-10-17 2017-03-14 Spatial Transcriptions Ab Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
US20150275295A1 (en) 2012-10-22 2015-10-01 National University Of Singapore Assay for the parallel detection of biological material based on pcr
WO2014065756A1 (en) 2012-10-22 2014-05-01 National University Of Singapore Assay for the parallel detection of biological material based on pcr
WO2014071361A1 (en) 2012-11-05 2014-05-08 Rubicon Genomics Barcoding nucleic acids
US9856530B2 (en) 2012-12-14 2018-01-02 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190136319A1 (en) 2012-12-14 2019-05-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10253364B2 (en) 2012-12-14 2019-04-09 10X Genomics, Inc. Method and systems for processing polynucleotides
US10227648B2 (en) 2012-12-14 2019-03-12 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180258482A1 (en) 2012-12-14 2018-09-13 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2014093676A1 (en) 2012-12-14 2014-06-19 10X Technologies, Inc. Methods and systems for processing polynucleotides
US20150307874A1 (en) 2013-01-09 2015-10-29 Yeda Research And Development Co. Ltd High throughput transcriptome analysis
US20140194324A1 (en) 2013-01-09 2014-07-10 Illumina Cambridge Limited Sample preparation on a solid support
WO2014108850A2 (en) 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. High throughput transcriptome analysis
US20140206547A1 (en) 2013-01-22 2014-07-24 The Board Of Trustees Of The Leland Stanford Junior University Haplotying of hla loci with ultra-deep shotgun sequencing
US20140206079A1 (en) 2013-01-24 2014-07-24 Sabic Innovative Plastics Ip B.V. Microwell plate
US10017761B2 (en) 2013-01-28 2018-07-10 Yale University Methods for preparing cDNA from low quantities of cells
US20140216128A1 (en) 2013-02-01 2014-08-07 Becton Dickinson And Company Methods and systems for assessing sample behavior in a flow cytometer
WO2014124046A1 (en) 2013-02-08 2014-08-14 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
US20140228255A1 (en) 2013-02-08 2014-08-14 10X Technologies, Inc. Polynucleotide barcode generation
US9644204B2 (en) 2013-02-08 2017-05-09 10X Genomics, Inc. Partitioning and processing of analytes and other species
WO2014124336A2 (en) 2013-02-08 2014-08-14 10X Technologies, Inc. Partitioning and processing of analytes and other species
US9850515B2 (en) 2013-02-08 2017-12-26 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
US20140227684A1 (en) 2013-02-08 2014-08-14 10X Technologies, Inc. Partitioning and processing of analytes and other species
WO2014124338A1 (en) 2013-02-08 2014-08-14 10X Technologies, Inc. Polynucleotide barcode generation
US20140228239A1 (en) 2013-02-08 2014-08-14 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
EP2954102A1 (en) 2013-02-08 2015-12-16 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
US20140235506A1 (en) 2013-02-08 2014-08-21 10X Technologies, Inc. Polynucleotide barcode generation
WO2014126937A1 (en) 2013-02-14 2014-08-21 The Board Of Trustees Of The Leland Stanford Junior University Suspension arrays and multiplexed assays based thereon
US20140244742A1 (en) 2013-02-26 2014-08-28 PortAura Group Method and system for providing recommendations using location information
US20140274811A1 (en) 2013-03-14 2014-09-18 Lyle J. Arnold Methods for Amplifying a Complete Genome or Transcriptome
US20180201923A1 (en) 2013-03-15 2018-07-19 Arizona Board Of Regents On Behalf Of Arizona State University Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
US10023910B2 (en) 2013-03-15 2018-07-17 Complete Genomics, Inc. Multiple tagging of individual long DNA fragments
EP2970957A1 (en) 2013-03-15 2016-01-20 Illumina, Inc. METHODS FOR PRODUCING STRANDED cDNA LIBRARIES
EP2970958A2 (en) 2013-03-15 2016-01-20 Lineage Biosciences, Inc. Methods of sequencing the immune repertoire
WO2014144495A1 (en) 2013-03-15 2014-09-18 Abvitro, Inc. Single cell bar-coding for antibody discovery
EP3327123A1 (en) 2013-03-15 2018-05-30 Lineage Biosciences, Inc. Methods of sequencing the immune repertoire
US20180127743A1 (en) 2013-03-15 2018-05-10 Abvitro Llc Single cell bar-coding for antibody discovery
US20160122751A1 (en) 2013-03-15 2016-05-05 Joshua Labaer Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
US20140357500A1 (en) 2013-03-15 2014-12-04 Abvitro, Inc. Single cell bar-coding for antibody discovery
US9938523B2 (en) 2013-03-15 2018-04-10 Arizona Board Of Regents On Behalf Of Arizona State University Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
WO2014145458A1 (en) 2013-03-15 2014-09-18 Arizona Board Of Regents On Behalf Of Arizona State University Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
US20140303005A1 (en) 2013-04-05 2014-10-09 Raindance Technologies, Inc. Rare cell analysis after negative selection
US20160060682A1 (en) 2013-04-25 2016-03-03 Firefly Bioworks, Inc. Multiplexed analysis of target nucleic acids
EP2989215A1 (en) 2013-04-25 2016-03-02 Firefly Bioworks, Inc. Multiplexed analysis of target nucleic acids
US20150072873A1 (en) * 2013-05-03 2015-03-12 Cambrian Genomics, Inc. Method and apparatus for producing sequence verified dna
EP2805769A1 (en) 2013-05-24 2014-11-26 European Molecular Biology Laboratory Methods for nano-scale single cell analysis
WO2014201273A1 (en) 2013-06-12 2014-12-18 The Broad Institute, Inc. High-throughput rna-seq
US20160122753A1 (en) 2013-06-12 2016-05-05 Tarjei Mikkelsen High-throughput rna-seq
US20170275669A1 (en) 2013-06-12 2017-09-28 The General Hospital Corporation Methods, kits, and systems for multiplexed detection of target molecules and uses thereof
US20190256888A1 (en) 2013-06-12 2019-08-22 The General Hospital Corporation Methods, kits, and systems for multiplexed detection of target molecules and uses thereof
WO2014200767A1 (en) 2013-06-12 2014-12-18 The General Hospital Corporation Methods, kits, and systems for multiplexed detection of target molecules and uses thereof
WO2014204939A2 (en) 2013-06-17 2014-12-24 Kim Lewis Methods for quantitative determination of protein-nucleic acid interactions in complex mixtures
US20160145677A1 (en) 2013-06-25 2016-05-26 Prognosys Biosciences, Inc. Spatially encoded biological assays using a microfluidic device
WO2014210223A1 (en) 2013-06-25 2014-12-31 Prognosys Biosciences, Inc. Spatially encoded biological assays using a microfluidic device
WO2014210225A1 (en) 2013-06-25 2014-12-31 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9879313B2 (en) 2013-06-25 2018-01-30 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US20160138091A1 (en) 2013-06-25 2016-05-19 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US20180201980A1 (en) 2013-06-25 2018-07-19 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9868979B2 (en) 2013-06-25 2018-01-16 Prognosys Biosciences, Inc. Spatially encoded biological assays using a microfluidic device
WO2014210353A2 (en) 2013-06-27 2014-12-31 10X Technologies, Inc. Compositions and methods for sample processing
US20150259734A1 (en) 2013-07-01 2015-09-17 Sequenta, Inc. Large-scale biomolecular analysis with ssequence tags
WO2015002908A1 (en) 2013-07-01 2015-01-08 Sequenta, Inc. Large-scale biomolecular analysis with sequence tags
US20160153973A1 (en) 2013-07-09 2016-06-02 Lucas David Smith Device and method of rapid linker mediated label-based immunoassays
US20190040474A1 (en) 2013-08-28 2019-02-07 Becton, Dickinson And Company Massively parallel single cell analysis
US10151003B2 (en) 2013-08-28 2018-12-11 Cellular Research, Inc. Massively Parallel single cell analysis
US20160010151A1 (en) 2013-08-28 2016-01-14 Cellular Research, Inc. Massively parallel single cell analysis
US20160145683A1 (en) 2013-08-28 2016-05-26 Cellular Research, Inc. Massively parallel single cell analysis
US20180002764A1 (en) 2013-08-28 2018-01-04 Cellular Research, Inc. Massively parallel single cell analysis
US20180291470A1 (en) 2013-08-28 2018-10-11 Cellular Research, Inc. Massively parallel single cell analysis
US20180327867A1 (en) 2013-08-28 2018-11-15 Cellular Research, Inc. Massively parallel single cell analysis
US20150299784A1 (en) 2013-08-28 2015-10-22 Cellular Research, Inc. Massively parallel single cell analysis
WO2015031691A1 (en) 2013-08-28 2015-03-05 Cellular Research, Inc. Massively parallel single cell analysis
US20180327866A1 (en) 2013-08-28 2018-11-15 Cellular Research, Inc. Massively parallel single cell analysis
US9567646B2 (en) 2013-08-28 2017-02-14 Cellular Research, Inc. Massively parallel single cell analysis
US9567645B2 (en) 2013-08-28 2017-02-14 Cellular Research, Inc. Massively parallel single cell analysis
US10131958B1 (en) 2013-08-28 2018-11-20 Cellular Research, Inc. Massively parallel single cell analysis
US20190085412A1 (en) 2013-08-28 2019-03-21 Becton, Dickinson And Company Massively parallel single cell analysis
US10253375B1 (en) 2013-08-28 2019-04-09 Becton, Dickinson And Company Massively parallel single cell analysis
US10208356B1 (en) 2013-08-28 2019-02-19 Becton, Dickinson And Company Massively parallel single cell analysis
US20210198754A1 (en) 2013-08-28 2021-07-01 Becton, Dickinson And Company Massively parallel single cell analysis
US20160265069A1 (en) 2013-08-28 2016-09-15 Cellular Research Inc. Massively parallel single cell analysis
US20160258012A2 (en) 2013-08-28 2016-09-08 Cellular Research, Inc. Massively parallel single cell ananlysis
US20180258500A1 (en) 2013-08-28 2018-09-13 Cellular Research, Inc. Massively parallel single cell analysis
US9598736B2 (en) 2013-08-28 2017-03-21 Cellular Research, Inc. Massively parallel single cell analysis
US9637799B2 (en) 2013-08-28 2017-05-02 Cellular Research, Inc. Massively parallel single cell analysis
US20150066385A1 (en) 2013-08-30 2015-03-05 10X Technologies, Inc. Sequencing methods
WO2015035087A1 (en) 2013-09-04 2015-03-12 Fluidigm Corporation Proximity assays for detecting nucleic acids and proteins in a single cell
US20160244742A1 (en) 2013-09-30 2016-08-25 Sten Linnarsson Method for capturing and encoding nucleic acid from a plurality of single cells
WO2015047186A1 (en) 2013-09-30 2015-04-02 Di Wu Methods to profile molecular complexes by using proximity bar-coding
WO2015044428A1 (en) 2013-09-30 2015-04-02 Sten Linnarsson Method for capturing and encoding nucleic acid from a plurality of single cells
US9905005B2 (en) 2013-10-07 2018-02-27 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US20170154421A1 (en) 2013-10-07 2017-06-01 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US9582877B2 (en) 2013-10-07 2017-02-28 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US20160055632A1 (en) 2013-10-07 2016-02-25 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US10294511B2 (en) 2013-10-17 2019-05-21 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
US20160265027A1 (en) 2013-10-17 2016-09-15 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
WO2015057985A1 (en) 2013-10-17 2015-04-23 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
EP3058092A1 (en) 2013-10-17 2016-08-24 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
US20150253237A1 (en) * 2013-10-25 2015-09-10 Massachusetts Institute Of Technology Method and apparatus for tracking cell identity
WO2015061844A1 (en) 2013-10-30 2015-05-07 The University Of Sydney Assay to stratify cancer patients
US10288608B2 (en) 2013-11-08 2019-05-14 Prognosys Biosciences, Inc. Polynucleotide conjugates and methods for analyte detection
WO2015103339A1 (en) 2013-12-30 2015-07-09 Atreca, Inc. Analysis of nucleic acids associated with single cells using nucleic acid barcodes
US20150211050A1 (en) 2014-01-27 2015-07-30 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
WO2015117163A2 (en) 2014-02-03 2015-08-06 Integrated Dna Technologies, Inc. Methods to capture and/or remove highly abundant rnas from a heterogeneous rna sample
US20150218620A1 (en) 2014-02-03 2015-08-06 Integrated Dna Technologies, Inc. Methods to capture and/or remove highly abundant rnas from a heterogenous rna sample
WO2015134787A2 (en) 2014-03-05 2015-09-11 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
WO2015160439A2 (en) 2014-04-17 2015-10-22 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US20150298091A1 (en) 2014-04-21 2015-10-22 President And Fellows Of Harvard College Systems and methods for barcoding nucleic acids
US20160053253A1 (en) 2014-04-29 2016-02-25 Illumina, Inc. Nucleic acid sequence analysis from single cells
US20170044525A1 (en) 2014-04-29 2017-02-16 Illumina, Inc. Multiplexed single cell gene expression analysis using template switch and tagmentation
WO2015168161A2 (en) 2014-04-29 2015-11-05 Illumina, Inc. Multiplexed single cell gene expression analysis using template switch and tagmentation
WO2015179339A1 (en) 2014-05-19 2015-11-26 William Marsh Rice University Allele-specific amplification using a composition of overlapping non-allele-specific primer and allele-specific blocker oligonucleotides
US20160060621A1 (en) 2014-06-24 2016-03-03 Bio-Rad Laboratories, Inc. Digital pcr barcoding
US20180112266A1 (en) 2014-06-26 2018-04-26 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180094312A1 (en) 2014-06-26 2018-04-05 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180142292A1 (en) 2014-06-26 2018-05-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10208343B2 (en) 2014-06-26 2019-02-19 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10041116B2 (en) 2014-06-26 2018-08-07 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180094314A1 (en) 2014-06-26 2018-04-05 10X Genomics, Inc. Methods and Systems for Processing Polynucleotides
US20150376609A1 (en) 2014-06-26 2015-12-31 10X Genomics, Inc. Methods of Analyzing Nucleic Acids from Individual Cells or Cell Populations
US20180016634A1 (en) 2014-06-26 2018-01-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190032129A1 (en) 2014-06-26 2019-01-31 10X Genomics, Inc. Methods and Systems for Processing Polynucleotides
US20180094315A1 (en) 2014-06-26 2018-04-05 10X Genomics, Inc. Methods and Systems for Processing Polynucleotides
WO2015200869A1 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Analysis of nucleic acid sequences
US10030267B2 (en) 2014-06-26 2018-07-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2015200893A2 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Methods of analyzing nucleic acids from individual cells or cell populations
US10337061B2 (en) 2014-06-26 2019-07-02 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10344329B2 (en) 2014-06-26 2019-07-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20160017320A1 (en) 2014-07-15 2016-01-21 Qiagen Sciences, Llc Semi-random barcodes for nucleic acid analysis
US20160068889A1 (en) 2014-09-10 2016-03-10 Good Start Genetics, Inc. Methods for selectively suppressing non-target sequences
WO2016044227A1 (en) 2014-09-15 2016-03-24 Abvitro, Inc. High-throughput nucleotide library sequencing
WO2016049418A1 (en) 2014-09-25 2016-03-31 Everspin Technologies, Inc. Ecc word configuration for system-level ecc compatibility
WO2016061517A2 (en) 2014-10-17 2016-04-21 Illumina Cambridge Limited Contiguity preserving transposition
US20180320241A1 (en) 2014-12-19 2018-11-08 Roche Sequencing Solutions, Inc. Methods for identifying multiple epitopes in selected sub-populations of cells
WO2016100976A2 (en) 2014-12-19 2016-06-23 Apprise Bio, Inc. Methods for identifying multiple epitopes in selected sub-populations of cells
WO2016118915A1 (en) 2015-01-22 2016-07-28 Becton, Dickinson And Company Devices and systems for molecular barcoding of nucleic acid targets in single cells
US20160289669A1 (en) 2015-01-22 2016-10-06 Becton, Dickinson And Company Devices and systems for molecular barcoding of nucleic acid targets in single cells
US20180002738A1 (en) 2015-01-23 2018-01-04 Qiagen Sciences, Llc High multiplex pcr with molecular barcoding
WO2016130578A1 (en) 2015-02-09 2016-08-18 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
US20160232291A1 (en) 2015-02-09 2016-08-11 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
EP3256606A1 (en) 2015-02-09 2017-12-20 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
US20160244828A1 (en) 2015-02-19 2016-08-25 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
WO2016138500A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Methods and compositions for barcoding nucleic acids for sequencing
US20160257993A1 (en) 2015-02-27 2016-09-08 Cellular Research, Inc. Methods and compositions for labeling targets
US10002316B2 (en) 2015-02-27 2018-06-19 Cellular Research, Inc. Spatially addressable molecular barcoding
US20170337459A1 (en) 2015-02-27 2017-11-23 Cellular Research, Inc. Spatially addressable molecular barcoding
US9727810B2 (en) 2015-02-27 2017-08-08 Cellular Research, Inc. Spatially addressable molecular barcoding
US20160253584A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Spatially addressable molecular barcoding
WO2016138496A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Spatially addressable molecular barcoding
WO2016145409A1 (en) 2015-03-11 2016-09-15 The Broad Institute, Inc. Genotype and phenotype coupling
US20160266094A1 (en) 2015-03-13 2016-09-15 University Of Iowa Research Foundation Cellular barcode
WO2016149418A1 (en) 2015-03-18 2016-09-22 Cellular Research, Inc. Methods and compositions for labeling targets and haplotype phasing
WO2016160844A2 (en) 2015-03-30 2016-10-06 Cellular Research, Inc. Methods and compositions for combinatorial barcoding
WO2016160965A1 (en) 2015-03-30 2016-10-06 Rubicon Genomics, Inc. Methods and compositions for repair of dna ends by multiple enzymatic activities
US20160289740A1 (en) 2015-03-30 2016-10-06 Cellular Research, Inc. Methods and compositions for combinatorial barcoding
WO2016168825A1 (en) 2015-04-17 2016-10-20 Centrillion Technology Holdings Corporation Methods for performing spatial profiling of biological molecules
US20180057873A1 (en) 2015-04-17 2018-03-01 Centrillion Technology Holdings Corporation Methods for performing spatial profiling of biological materials
US20160312276A1 (en) 2015-04-23 2016-10-27 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
EP3286326A1 (en) 2015-04-23 2018-02-28 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
US20160320720A1 (en) 2015-04-28 2016-11-03 Kyocera Document Solutions Inc. Image forming apparatus
WO2016191272A1 (en) 2015-05-22 2016-12-01 Sigma-Aldrich Co. Llc Methods for next generation genome walking and related compositions and kits
WO2016190795A1 (en) 2015-05-28 2016-12-01 Kaarel Krjutskov Blocking oligonucleotides
US20180371536A1 (en) 2015-06-01 2018-12-27 Cellular Research, Inc. Methods for rna quantification
US20180230527A1 (en) 2015-08-24 2018-08-16 Qiagen Gmbh Method for generating a rna-sequencing library
WO2017032808A1 (en) 2015-08-24 2017-03-02 Qiagen Gmbh Method for generating a rna-sequencing library
WO2017040306A1 (en) 2015-08-28 2017-03-09 Illumina, Inc. Nucleic acid sequence analysis from single cells
WO2017044574A1 (en) 2015-09-11 2017-03-16 Cellular Research, Inc. Methods and compositions for nucleic acid library normalization
US10619186B2 (en) 2015-09-11 2020-04-14 Cellular Research, Inc. Methods and compositions for library normalization
US20170073730A1 (en) 2015-09-11 2017-03-16 Cellular Research, Inc. Methods and compositions for library normalization
US20190025304A1 (en) 2015-09-24 2019-01-24 Abvitro Llc Affinity-oligonucleotide conjugates and uses thereof
WO2017053905A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Affinity-oligonucleotide conjugates and uses thereof
US11092607B2 (en) 2015-10-28 2021-08-17 The Board Institute, Inc. Multiplex analysis of single cell constituents
WO2017079593A1 (en) 2015-11-04 2017-05-11 Atreca, Inc. Combinatorial sets of nucleic acid barcodes for analysis of nucleic acids associated with single cells
WO2017087873A1 (en) 2015-11-18 2017-05-26 Wafergen, Inc. Systems and methods for pooling samples from multi-well devices
WO2017096239A1 (en) 2015-12-04 2017-06-08 St. Jude Children's Research Hospital, Inc. Cloning and expression system for t-cell receptors
WO2017097939A1 (en) 2015-12-08 2017-06-15 Hifibio Method for transcriptome analysis of single cells
US20170192013A1 (en) 2015-12-30 2017-07-06 Bio-Rad Laboratories, Inc. Digital protein quantification
WO2017117358A1 (en) 2015-12-30 2017-07-06 Bio-Rad Laboratories, Inc. Digital protein quantification
WO2017125508A1 (en) 2016-01-19 2017-07-27 General Electric Company Multifunctional beads and methods of use for capturing target cells
WO2017139690A1 (en) 2016-02-11 2017-08-17 10X Genomics, Inc. Cell population analysis using single nucleotide polymorphisms from single cell transcriptomes
US20170260584A1 (en) 2016-02-11 2017-09-14 10X Genomics, Inc. Cell population analysis using single nucleotide polymorphisms from single cell transcriptomes
US20190218276A1 (en) 2016-03-21 2019-07-18 The Broad Institute, Inc. Methods for determining spatial and temporal gene expression dynamics in single cells
WO2017164936A1 (en) 2016-03-21 2017-09-28 The Broad Institute, Inc. Methods for determining spatial and temporal gene expression dynamics in single cells
WO2017173328A1 (en) 2016-04-01 2017-10-05 Baylor College Of Medicine Methods of whole transcriptome amplification
US20170314067A1 (en) 2016-05-02 2017-11-02 Cellular Research, Inc. Accurate molecular barcoding
US20190161743A1 (en) 2016-05-09 2019-05-30 President And Fellows Of Harvard College Self-Targeting Guide RNAs in CRISPR System
US20170342484A1 (en) 2016-05-25 2017-11-30 Cellular Research, Inc. Normalization of nucleic acid libraries
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
US20190292592A1 (en) 2016-05-25 2019-09-26 Cellular Research, Inc. Normalization of nucleic acid libraries
WO2017205691A1 (en) 2016-05-26 2017-11-30 Cellular Research, Inc. Molecular label counting adjustment methods
US20170344866A1 (en) 2016-05-26 2017-11-30 Cellular Research, Inc. Molecular label counting adjustment methods
US9787810B1 (en) 2016-05-28 2017-10-10 Hong Fu Jin Precision Industry (Shenzhen) Co., Ltd. Angle adjusting mechanism for telephone
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
US20170342405A1 (en) 2016-05-31 2017-11-30 Cellular Research, Inc. Molecular indexing of internal sequences
US20170342465A1 (en) 2016-05-31 2017-11-30 Cellular Research, Inc. Error correction in amplification of samples
EP3263715A1 (en) 2016-06-28 2018-01-03 Hifibio Method for transcriptome analysis of single cells
WO2018017949A1 (en) 2016-07-22 2018-01-25 Verily Life Sciences Llc Quantitative massively parallel proteomics
US20180024139A1 (en) 2016-07-22 2018-01-25 Verily Life Sciences Llc Quantitative massively parallel proteomics
WO2018020489A1 (en) 2016-07-24 2018-02-01 Yeda Research And Development Co. Ltd. Methods and kits for analyzing dna binding moieties attached to dna
US20190203270A1 (en) 2016-07-24 2019-07-04 Yeda Research And Development Co., Ltd. Methods and kits for analyzing dna binding moieties attached to dna
US20180037942A1 (en) 2016-08-03 2018-02-08 Cellular Research, Inc. Enzyme-independent molecular indexing
WO2018031631A1 (en) 2016-08-10 2018-02-15 President And Fellows Of Harvard College Methods of de novo assembly of barcoded genomic dna fragments
US20180267036A1 (en) 2016-09-26 2018-09-20 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US10338066B2 (en) 2016-09-26 2019-07-02 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
WO2018058073A2 (en) 2016-09-26 2018-03-29 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US20180088112A1 (en) 2016-09-26 2018-03-29 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US20200124601A1 (en) 2016-09-26 2020-04-23 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US20190221292A1 (en) 2016-09-29 2019-07-18 Fujifilm Corporation Method for designing primers for multiplex pcr
US20190221287A1 (en) 2016-09-29 2019-07-18 Fujifilm Corporation Method for designing primers for multiplex pcr
WO2018064640A1 (en) 2016-10-01 2018-04-05 Berkeley Lights, Inc. Dna barcode compositions and methods of in situ identification in a microfluidic device
US20180105808A1 (en) 2016-10-19 2018-04-19 10X Genomics, Inc. Methods and systems for barcoding nucleic acid molecules from individual cells or cell populations
WO2018075693A1 (en) 2016-10-19 2018-04-26 10X Genomics, Inc. Methods and systems for barcoding nucleic acid molecules from individual cells or cell populations
US20190010552A1 (en) 2016-11-17 2019-01-10 GenomiCare Biotechnology (Shanghai) Co. Ltd Systems and Methods for Monitoring Lifelong Tumor Evolution Field of Invention
US20180163201A1 (en) 2016-12-12 2018-06-14 Grail, Inc. Methods for tagging and amplifying rna template molecules for preparing sequencing libraries
WO2018111872A1 (en) 2016-12-12 2018-06-21 Grail, Inc. Methods for tagging and amplifying rna template molecules for preparing sequencing libraries
WO2018119447A2 (en) 2016-12-22 2018-06-28 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180282803A1 (en) 2016-12-22 2018-10-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190338353A1 (en) 2016-12-22 2019-11-07 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20190390253A1 (en) 2016-12-22 2019-12-26 Guardant Health, Inc. Methods and systems for analyzing nucleic acid molecules
US10550429B2 (en) 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10323278B2 (en) 2016-12-22 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180179591A1 (en) 2016-12-22 2018-06-28 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10011872B1 (en) 2016-12-22 2018-07-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20180179590A1 (en) 2016-12-22 2018-06-28 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2018115852A1 (en) 2016-12-23 2018-06-28 Cs Genetics Limited Reagents and methods for molecular barcoding of nucleic acids of single cells
WO2018132635A1 (en) 2017-01-12 2018-07-19 Massachusetts Institute Of Technology Methods for analyzing t cell receptors and b cell receptors
US20180208975A1 (en) 2017-01-20 2018-07-26 Merck Sharp & Dohme Corp. Assay for simultaneous genomic and proteomic analysis
WO2018140966A1 (en) 2017-01-30 2018-08-02 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US20180216174A1 (en) 2017-02-01 2018-08-02 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
WO2018144240A1 (en) 2017-02-01 2018-08-09 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
WO2018144813A1 (en) 2017-02-02 2018-08-09 New York Genome Center Methods and compositions for identifying or quantifying targets in a biological sample
US20180251825A1 (en) 2017-02-02 2018-09-06 New York Genome Center Inc. Methods and compositions for identifying or quantifying targets in a biological sample
WO2018174827A1 (en) 2017-03-24 2018-09-27 National University Of Singapore Methods for multiplex detection of molecules
US20180276332A1 (en) 2017-03-24 2018-09-27 Cellular Research, Inc. Synthetic multiplets for multiplets determination
WO2018217862A1 (en) 2017-05-23 2018-11-29 Centrillion Technologies, Inc. Methods for performing spatial profiling of biological molecules
WO2018218222A1 (en) 2017-05-26 2018-11-29 Goldfless Stephen Jacob High-throughput polynucleotide library sequencing and transcriptome analysis
US20180340170A1 (en) 2017-05-26 2018-11-29 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
WO2018222548A1 (en) 2017-05-29 2018-12-06 President And Fellows Of Harvard College A method of amplifying single cell transcriptome
US20180346969A1 (en) 2017-06-05 2018-12-06 Cellular Research, Inc. Sample indexing for single cells
WO2018226293A1 (en) 2017-06-05 2018-12-13 Becton, Dickinson And Company Sample indexing for single cells
US20180346970A1 (en) 2017-06-05 2018-12-06 Cellular Research, Inc. Sample indexing for single cells
WO2019055852A1 (en) 2017-09-15 2019-03-21 Apton Biosystems, Inc. Heterogeneous single cell profiling using molecular barcoding
US20190095578A1 (en) 2017-09-25 2019-03-28 Cellular Research, Inc. Immune receptor-barcode error correction
WO2019076768A1 (en) 2017-10-16 2019-04-25 Tervisetehnoloogiate Arenduskeskus As Method and kit for dna library preparation
WO2019084046A1 (en) 2017-10-23 2019-05-02 The Broad Institute, Inc. Single cell cellular component enrichment from barcoded sequencing libraries
WO2019099906A1 (en) 2017-11-16 2019-05-23 The Regents Of The University Of Colorado, A Body Corporate Methods to measure functional heterogeneity among single cells
US20190218607A1 (en) 2017-12-07 2019-07-18 Massachusetts Institute Of Technology Single cell analyses
WO2019113499A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. High-throughput methods for identifying gene interactions and networks
WO2019113506A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
WO2019113457A1 (en) 2017-12-07 2019-06-13 Massachusetts Institute Of Technology Single cell analyses
US20190177800A1 (en) 2017-12-08 2019-06-13 10X Genomics, Inc. Methods and compositions for labeling cells
WO2019113533A1 (en) 2017-12-08 2019-06-13 10X Genomics, Inc. Methods and compositions for labeling cells
WO2019118355A1 (en) 2017-12-12 2019-06-20 10X Genomics, Inc. Systems and methods for single cell processing
WO2019126789A1 (en) 2017-12-22 2019-06-27 10X Genomics, Inc. Systems and methods for processing nucleic acid molecules from one or more cells
US20190211395A1 (en) 2018-01-05 2019-07-11 Billiontoone, Inc. Quality control templates ensuring validity of sequencing-based assays
WO2019157529A1 (en) 2018-02-12 2019-08-15 10X Genomics, Inc. Methods characterizing multiple analytes from individual cells or cell populations
WO2019178164A1 (en) 2018-03-12 2019-09-19 Silicon Valley Scientific, Inc. Method and apparatus for processing tissue and other samples encoding cellular spatial position information
US20210230666A1 (en) 2018-04-27 2021-07-29 X Gen Us Co. Methods and compositions for preparing polynucleotides
WO2019213294A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company High throughput multiomics sample analysis
WO2019213237A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
US20190338278A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
US20190338357A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company High throughput multiomics sample analysis
WO2019218101A1 (en) 2018-05-17 2019-11-21 中国科学院大连化学物理研究所 High-throughput multiparametric single cell-derived extracellular vesicle analysis chip and use thereof
WO2020028266A1 (en) 2018-08-03 2020-02-06 Cellular Research, Inc. Nuclei barcoding and capture in single cells
WO2020033164A1 (en) 2018-08-08 2020-02-13 Vanderbilt University Systems and methods for simultaneous detection of antigens and antigen specific antibodies
WO2020037065A1 (en) 2018-08-17 2020-02-20 Cellular Research, Inc. Aptamer barcoding
WO2020046833A1 (en) 2018-08-28 2020-03-05 Cellular Research, Inc. Sample multiplexing using carbohydrate-binding and membrane-permeable reagents
WO2020072380A1 (en) 2018-10-01 2020-04-09 Cellular Research, Inc. Determining 5' transcript sequences
US20200109437A1 (en) 2018-10-01 2020-04-09 Cellular Research, Inc. Determining 5' transcript sequences
US20200149037A1 (en) 2018-11-08 2020-05-14 Cellular Research, Inc. Whole transcriptome analysis of single cells using random priming
WO2020097315A1 (en) 2018-11-08 2020-05-14 Cellular Research, Inc. Whole transcriptome analysis of single cells using random priming
WO2020123384A1 (en) 2018-12-13 2020-06-18 Cellular Research, Inc. Selective extension in single cell whole transcriptome analysis
WO2020131699A2 (en) 2018-12-17 2020-06-25 Natera, Inc. Methods for analysis of circulating cells
WO2020154247A1 (en) 2019-01-23 2020-07-30 Cellular Research, Inc. Oligonucleotides associated with antibodies
WO2020167920A1 (en) 2019-02-14 2020-08-20 Cellular Research, Inc. Hybrid targeted and whole transcriptome amplification
WO2020214642A1 (en) 2019-04-19 2020-10-22 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
US20210214770A1 (en) 2020-01-13 2021-07-15 Becton, Dickinson And Company Cell capture using du-containing oligonucleotides
WO2021146219A1 (en) 2020-01-13 2021-07-22 Becton, Dickinson And Company Cell capture using du-containing oligonucleotides
WO2021146207A1 (en) 2020-01-13 2021-07-22 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and rna
US20210214784A1 (en) 2020-01-13 2021-07-15 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and rna
WO2021146636A1 (en) 2020-01-17 2021-07-22 Becton, Dickinson And Company Methods and compositions for single cell secretomics
US20210222244A1 (en) 2020-01-17 2021-07-22 Becton, Dickinson And Company Methods and compositions for single cell secretomics
WO2021155057A1 (en) 2020-01-29 2021-08-05 Becton, Dickinson And Company Barcoded wells for spatial mapping of single cells through sequencing
US20210230583A1 (en) 2020-01-29 2021-07-29 Becton, Dickinson And Company Barcoded wells for spatial mapping of single cells through sequencing
WO2021155284A1 (en) 2020-01-31 2021-08-05 Becton Dickinson And Company Mesophilic dna polymerase extension blockers
US20210246492A1 (en) 2020-02-12 2021-08-12 Becton, Dickinson And Company Intracellular abseq
WO2021163374A2 (en) 2020-02-12 2021-08-19 Becton, Dickinson And Company Intracellular abseq
US20210263019A1 (en) 2020-02-25 2021-08-26 Becton, Dickinson And Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
US20210355484A1 (en) 2020-05-14 2021-11-18 Becton, Dickinson And Company Primers for immune repertoire profiling
US20210371909A1 (en) 2020-06-02 2021-12-02 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
WO2021247593A1 (en) 2020-06-02 2021-12-09 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
US20220010362A1 (en) 2020-07-13 2022-01-13 Becton, Dickinson And Company cDNA SPIKE-IN CONTROL FOR SINGLE CELL ANALYSIS
US20220010361A1 (en) 2020-07-13 2022-01-13 Becton, Dickinson And Company TARGET ENRICHMENT USING NUCLEIC ACID PROBES FOR scRNAseq
WO2022015667A1 (en) 2020-07-13 2022-01-20 Becton, Dickinson And Company Cdna spike-in control for single cell analysis
US20220033810A1 (en) 2020-07-31 2022-02-03 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
WO2022026909A1 (en) 2020-07-31 2022-02-03 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
WO2022040453A1 (en) 2020-08-20 2022-02-24 Becton, Dickinson And Company Blood cell lysing agent for isolating bacteria from blood culture
US20220154288A1 (en) 2020-11-17 2022-05-19 Becton, Dickinson And Company Combined analysis of cell-free nucleic acids and single cells for oncology diagnostics
US20220162773A1 (en) 2020-11-20 2022-05-26 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
US20220162695A1 (en) 2020-11-20 2022-05-26 Becton, Dickinson And Company Use of dextramer in single cell analysis

Non-Patent Citations (733)

* Cited by examiner, † Cited by third party
Title
10X Genomics, Inc., 2019, User Guide: Visium Spatial Gene Expression Reagent Kits, www.10xGenomics.com, 76 pp.
2018 Top 10 Innovations, The Scientist Magazine® (2018). Available at: https://www.thescientist.com/features/2018-top-10-innovations-65140, 16 pp.
Achim et al., "High-throughput spatial mapping of single-cell RNA-seq data to tissue of origin," Nature Biotechnology 2015, 33(5), 503-511.
Adey et al., "Rapid, low-input, low-bias construction of shotgun fragment libraries by high-density in vitro transposition," Genome Biology 2010, 11(R19), in 17 pages.
Advisory Action dated Aug. 25, 2020 in U.S. Appl. No. 15/084,307.
Advisory Action dated Dec. 2, 2019 in U.S. Appl. No. 15/055,407.
Advisory Action dated Nov. 29, 2019 in U.S. Appl. No. 15/084,307.
Agasti et al., "Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cell," J Am Chem Soc. 2012, 134(45), 18499-18502.
Ahern, "Biochemical, Reagent Kits Offer Scientists Good Return on Investment," The Scientist 1995, 9(15), in 5 pages.
Alexandra M. Ewing of Richards, Layton and Finger, P.A., Entry of Appearance dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 1 pp.
Alkan et al., "Personalized number and segmental duplication maps using next-generation sequencing," Nat Genet. 2009, 41(10):1061-1067.
Anderson, "Study Describes RNA Sequencing Applications for Molecular Indexing Methods," GenomeWeb 2014, 5 pp.
Ansorge, "Next-generation DNA sequencing techniques," New Biotechnology 2009, 25(4), 195-203.
Applied Biosystems, Apr. 2008, SOLiD™ System Barcoding, Application Note, 4 pp.
Argrawal et al., "Counting Single Native Biomolecules and Intact Viruses with Color-Coded Nanoparticles," Analytical Chemistry 2006, 78, 1061-1070.
Arslan et al., "An efficient algorithm for the stochastic simulation of the hybridization of DNA to microarrays," BMC Bioinformatics 2009, 10(411), 1-17.
Atanur et al., "The genome sequence of the spontaneously hypertensive rat: Analysis and functional significance." Genome Res. 2010, 20(6), 791-803.
Audic et al., "The Significance of Digital Gene Expression Profiles," Genome Res. 1997, 7, 986-995.
Baek et al., "Development of Hydrogel TentaGel Shell-Core Beads for Ultra-high Throughput Solution Phase Screening of Encoded OBOC Combinatorial Small Molecule Libraries," J. Comb Chem. 2009, 11(1), 91-102.
BD Life Sciences, 2018, BD AbSeq antibody-oligo conjugates, www.bd.com/genomics, 2 pp.
BD Life Sciences, 2018, BD AbSeq on the BD Rhapsody system: Exploration of single-cell gene regulation by simultaneous digital mRNA and protein quantification, www.bd.com/genomics, 7 pp.
Bendall et al., "Single-cell mass cytometry of differential immune and drug responses across a human hematopoietic continuum," Science 2011, 332(6030), 687-696.
Bionumbers, "Useful fundamental numbers in molecular biology," http://bionumbers.hms.harvard.edu/KeyNumbers/aspx, 1-4.
Biosciences Product Catalogue, Dynal® Catalog 1999, Oslo, Norway, 49-51.
Bioscribe "Massively parallel sequencing technology for single-cell gene expression published" (press release), PhysOrg 2015, 1-2.
Blainey, "The future is now: single-cell genomics of bacteria and archaea," FEMS Microbiol Rev. 2013, 37(3), 407-427.
Bogdanova et al., "Normalization of full-length enriched cDNA," Molecular Biosystems 2008, 4(3), 205-212.
Bolivar et al., "Targeted next-generation sequencing of endometrial cancer and matched circulating tumor DNA: identification of plasma-based, tumor-associated mutations in early stage patients," Modern Pathology 2019, 32(3), 405-414.
Bonaldo et al., "Normalization and Subtraction: Two Approaches to facilitate Gene Discovery," Genome Res. 1996, 6, 791-806.
Bontoux et al., "Integrating whole transcriptome assays on a lab-on-a-chip for single cell gene profiling", Lab on a Chip 2008, 8(3), 443-450.
Bose et al., "Scalable microfluidics for single-cell RNA printing and sequencing," Genome Biology 2015, 16(120), 1-16.
Brady et al., "Construction of cDNA libraries form single cells", Methods in Enzymology 1993, (225), 611-623.
Braha et al., "Simultaneous stochastic sensing of divalent metal ions," Nature Biotechnology 2000, 18, 1005-1007.
Bratke et al., "Differential expression of human granzymes A, B, and K in natural killer cells and during CD8+ T cell differentiation in peripheral blood," Eur J Immunol. 2005, 35, 2608-2616.
Brenner et al., "Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays," Nature Biotechnology 2000, 18, 630-634.
Brenner et al., "In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs," PNAS 2000, 97(4), 1665-1670.
Brinza et al., "Detection of somatic mutations at 0.1% frequency from cfDNA in peripheral blood with a multiplex next-generation sequencing assay," Conference Poster, AACR 107th Annual Meeting, Apr. 16-20, 2016, 1 p.
Brisco et al., "Quantification of RNA integrity and its use for measurement of transcript number," Nucleic Acids Research 2012, 40(18), e144, 1-9.
Brodin et al., "Challenges with Using Primer IDs to Improve Accuracy of Next Generation Sequencing," PLoS One 2015, 19(3), 1-12.
Brouilette et al., "A Simple and Novel Method for RNA-seq Library Preparation of Single Cell cDNA Analysis by Hyperactive Tn5 Transposase," Developmental Dynamics 2012, 241, 1584-1590.
Buggenum et al., "A covalent and cleavable antibody DNA conjugation strategy for sensitive protein detection via immunoPCR," Scientific Reports 2016, 6(22675), 1-12.
Buschmann et al., Enhancing the detection of barcoded reads in high throughput DNA sequencing DNA by controlling the false discovery rate, BMC Bioinformatics, 15(1), 264, 1-16.
Bustin, "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays," Journal of Molecular Endocrinology 2000, 25, 169-193.
Butkus, "Cellular research set to launch first gene expression platform using ‘molecular indexing’ technology," GenomeWeb 2014, 1-5.
Cai, "Turning single cells in microarrays by super-resolution bar-coding," Briefings in Functional Genomics 2012, 12(2), 75-80.
Cao et al., "Comprehensive single-cell transcriptional profiling of a multicellular organism," Science 2017, 357, 661-667.
Carr et al., "Inferring relative proportions of DNA variants from sequencing electropherograms," Bioinformatics 2009, 25(24), 3244-3250.
Caruccio et al., "Nextera (TM) Technology for NGS DNA Library Preparation: Simultaneous Fragmentation and Tagging by in Vitro Transposition," EpiBio 2009, 16(3), 4-6.
Casbon et al., "A method for counting PCR template molecules with application to next-generation sequencing," Nucleic Acids Res. 2011, 39(12), e81, 1-8.
Castellarnau et al., "Stochastic particle barcoding for single-cell tracking and multiparametric analysis," Small 2015, 11(4), 489-498.
Castle et al., "DNA number, including telomeres and mitochondria, assayed using next-generation sequencing," BMC Genomics 2010, 11(244), 1-11.
Chamberlain et al., "Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification," Nucleic Acids Res. 1988, 16(23), 11141-11156.
Chang et al., "Detection of Allelic Imbalance in Ascitic Supernatant by Digital Single Nucleotide Polymorphism Analysis," Clinical Cancer Research, 8, 2580-2585.
Chang et al., "Single-cell protein and gene expression profiling of stem memory T cells by BD Ab-seq," Annual Joint Meeting of the American Society for Cell Biology and the European Molecular Biology Organization 2017, 28(26), P1896.
Chapin et al., "Rapid microRNA Profiling on Encoded Gel Microparticles," Angew Chem Int Ed Engl. 2011, 50(10), 2289-2293.
Chee et al., "Accessing genetic information with high-density DNA arrays," Science 1996, 274, 610-614.
Chee, "Enzymatic multiplex DNA sequencing," Nucleic Acids Research 1991, 19(12), 3301-3305.
Chen et al., "High-throughput sequencing of the transcriptome and chromatin accessibility in the same cell," Nature Biotechnology 2019, 37, 1452-1457.
Chen et al., "Spatially resolved, highly multiplexed RNA profiling in single cells," Science Express 2015, 348(6233), aaa6090, 1-36.
Church et al., "Multiplex DNA sequencing," Science 1988, 240(4849), 185-188.
Civil Cover Sheet filed Nov. 15, 2018 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Clontech Laboratories, Inc., "SMART™ PCR cDNA Synthesis Kit User Manual," Clontech 2007, 1-39.
Cloonan et al., "Stem cell transcriptome profiling via massive-scale mRNA sequencing", Nature Methods 2008, 5(7), 613-619.
Combined Search and Examination Report dated Aug. 6, 2014 in UK Patent Application No. 1408829.8.
Combined Search and Examination Report dated Feb. 21, 2017 in UK Patent Application No. 1609740.4.
Communication of a Notice of Opposition dated Jul. 27, 2016 in European Patent Application No. EP 10762102.1.
Complaint filed in Becton, Dickinson and Company and Cellular Research Inc. v. 10X Genomics, Inc. dated Nov. 15, 2018 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 141 pp.
Costa et al., "Single-Tube Nested Real-Time PCR as a New Highly Sensitive Approach to Trace Hazelnut," Journal of Agricultural and Food Chemistry 2012, 60, 8103-8110.
Costello et al., "Discovery and characterization of artefactual mutations in deep coverage targeted capture sequencing data due to oxidative DNA damage during sample preparation," Nucleic Acids Res 2013, 41(6), e67, 1-12.
Cotten et al., "Selection of proteins with desired properties from natural proteome libraries using mRNA display," Nature Protocols 2011, 6, 1163-1182.
Cox, "Bar coding objects with DNA," Analyst 2001, 126, 545-547.
Craig et al., "Identification of genetic variants using bar-coded multiplexed sequencing," Nat Methods 2008, 5(10), 887-893.
Cusanovich et al., "Multiplex single-cell profiling of chromatin accessibility by combinatorial cellular indexing," Science 2015, 348(6237), 910-914.
Custom Antibody Services, Precision Antibody, accessed Apr. 16, 2014, 2 pp.
Daines et al., "High-throughput multiplex sequencing to discover number variants in Drosophila," Genetics 2009, 182(4), 182, 935-941.
Dalerba et al., "Single-cell dissection of transcriptional heterogeneity in human colon tumors," Nat Biotechnol. 2011, 29(12), 1120-1127.
D'Antoni et al., "Rapid quantitative analysis using a single molecule counting approach," Anal Biochem. 2006, 352, 97-109.
Daser et al., "Interrogation of genomes by molecular number counting (MCC)," Nature Methods 2006, 3(6), 447-453.
Day et al., "Immobilization of polynucleotides on magnetic particles," Biochem. J. 1991, 278, 735-740.
De Saizieu et al., "Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays," Nature Biotechnology 1988, 16, 45-48.
Decision of Refusal dated Aug. 21, 2017 in Japanese Patent Application No. 2014-558975.
Defendant 10X Genomic Inc.'s Notice of Service for Initial Requests for Production and Interrogatories Served to Becton, Dickinson, and Company and Cellular Research, Inc., dated May 31, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Defendant 10X Genomics Inc's, Notice of Service of Technical Documents, dated Jul. 8, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Defendant 10X Genomic's Motion for Admission Pro Hac Vice of Paul Ehrlich, Azra Hadzimehmedovic and Aaron Nathan, Pursuant to Local Rule 83.5, dated May 1, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 5 pp.
Defendant 10X Genomic's Notice of Service for Initial Disclosures served to Opposing Counsel, dated Jun. 7, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Defendant 10X Genomics Reply Brief in Support of its Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Apr. 12, 2019 in the USDC for the District of Delaware, C.A. No. 18-1800-RGA, 15 pp.
Defendant 10X Genomic's Request for Oral Argument Under D. Del. LR 7.1.4, dated Apr. 18, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA 2 pp.
Defendant 10X Genomic's Response Letter to Judge Richard G. Andrews re Request for a Rule 16, dated Apr. 16, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Defendant 10X Genomics, Inc.'s [Proposed] Order for Partial Dismissal Pursuant to Federal Rules of Civil Procedure 12(b)(6), dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 1 pp.
Defendant 10X Genomics, Inc.'s Letter to Judge Andrews in Response to Plaintiff's Letter of Supplemental Authority, dated Jul. 11, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Defendant 10X Genomics, Inc.'s Motion for Admission Pro Hac Vice Pursuant to Local Rule 83.5, dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 5 pp.
Defendant 10X Genomics, Inc.'s Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Jan. 18, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Defendant 10X Genomics, Inc.'s Motion to Dismiss the First Amended Complaint Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Mar. 1, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Defendant 10X Genomics, Inc.'s Opening Brief in Support of Its Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 1:18-cv-01800-RGA, 25 pp.
Defendant 10X Genomics, Inc.'s Opening Brief in Support of Its Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Mar. 1, 2019 in the USDC District of Delaware, C.A. No. 18-1800 RGA, 26 pp.
Defendant 10X Genomics, Inc.'s Rule 7.1 Disclosure Statement, dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 1 pp. 1.
Defendant 10X Genomics, Inc's Proposed Order for Dismissal pursuant to Federal Rules of Civil Procedure 12(b)(6), filed Mar. 1, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Defendant 10X Genomics's Reply Brief in support of its Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6), dated Apr. 12, 2019 in USDC District of Delaware, C.A. No. 18-1800 RGA, 15 pp.
Delley et al., "Combined aptamer and transcriptome sequencing of single cells," bioRxiv 2017, 1-10.
Dengl et al., "Engineered hapten-binding antibody derivatives for modulation of pharmacokinetic properties of small molecules and targeted payload delivery," Immunol Rev. 2016, 270, 165-177.
Di Carlo et al., "Dynamic single-cell analysis for quantitative biology," Analytical Chemistry 2006, 78(23), 7918-7925.
Dirks et al., Triggered amplification by hybridization chain reaction., Proc Natl Acad Sci 2014, 101(43), 15275-15278.
Eberwine et al., "Analysis of gene expression in single live neurons," Proc. Natl. Acad. Sci. 1992, 89, 3010-3014.
Evanko et al., "Hybridization chain reaction," Nature Methods 2004, 1(3), 186-187.
Examination Report dated Apr. 10, 2017 in European Patent Application No. 14761937.3.
Examination Report dated Apr. 26, 2019 in European Patent Application No. 16710357.1.
Examination Report dated Apr. 7, 2022 in Singapore Patent Application No. 10201806890V.
Examination Report dated Apr. 8, 2022 in Australian Patent Application No. 2018281745.
Examination Report dated Aug. 2, 2019 in European Patent Application No. 17202409.3.
Examination Report dated Dec. 12, 2018 in European Patent Application No. 16719706.0.
Examination Report dated Dec. 3, 2020 in European Patent Application No. 16719706.0.
Examination Report dated Dec. 4, 2019 in European Patent Application No. 16719706.0.
Examination Report dated Dec. 6, 2021 in European Patent Application No. 18703156.2.
Examination Report dated Dec. 9, 2021 in European Patent Application No. 19723988.2.
Examination Report dated Feb. 19, 2016 in United Kingdom Patent Application No. GB1511591.8.
Examination Report dated Feb. 19, 2020 in European Patent Application No. 16710551.9.
Examination Report dated Feb. 6, 2019 in European Patent Application No. 13754428.4.
Examination Report dated Jan. 2, 2019 in European Patent Application No. 16757986.1.
Examination Report dated Jan. 27, 2016 in United Kingdom Patent Application No. 1408829.8.
Examination Report dated Jan. 3, 2018 in UK Patent Application No. 1609740.4.
Examination Report dated Jul. 12, 2016 in European Patent Application No. 13755319.4.
Examination Report dated Jul. 20, 2018 in Australian Patent Application No. 2014312208.
Examination Report dated Jul. 24, 2019 in European Patent Application No. 16714081.3.
Examination Report dated Jul. 6, 2020 in European Patent Application No. 17781265.8.
Examination Report dated Jun. 15, 2016 in United Kingdom Patent Application No. GB1511591.8.
Examination Report dated Jun. 18, 2019 in European Patent Application No. 16710551.9.
Examination Report dated Jun. 8, 2016 in United Kingdom Patent Application No. 1408829.8.
Examination Report dated Mar. 16, 2018 in European Patent Application No. 13754428.4.
Examination Report dated Mar. 18, 2019 in Singapore Patent Application No. 11201405274W.
Examination Report dated Mar. 18, 2020 in European Patent Application No. 17202409.3.
Examination Report dated Mar. 25, 2021 in European Patent Application No. 17781265.8.
Examination Report dated May 12, 2020 in Australian Patent Application No. 2018220004.
Examination Report dated Nov. 12, 2020 in European Patent Application No. 18716877.8.
Examination Report dated Nov. 18, 2021 in European Patent Application No. 19724003.9.
Examination Report dated Nov. 24, 2021 in European Patent Application No. 19762517.1.
Examination Report dated Oct. 10, 2017 in European Patent Application No. 14761937.3.
Examination Report dated Oct. 11, 2019 in European Patent Application No. 16757986.1.
Examination Report dated Oct. 24, 2017 in Australian Patent Application No. 2013226081.
Examination Report dated Oct. 8, 2021 in European Patent Application No. 18716877.8.
Examination Report dated Sep. 21, 2020 in European Patent Application No. 18703156.2.
Examination Report dated Sep. 26, 2018 in European Patent Application No. 16714081.3.
Examination Report dated Sep. 5, 2018 in European Patent Application No. 16710357.1.
Exhibit A filed Jul. 10, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 25 pp.
Exhibits 12-32 filed Feb. 8, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 795 pp.
Exhibits A-D filed Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 1:18-cv-01800-RGA, 47 pp.
Exhibits A-E filed Mar. 1, 2019 in the USDC District of Delaware, C.A. No. 18-1800 RGA, 75 pp.
Extended European Search Report dated Dec. 14, 2015 in European Patent Application No. 13754428.4.
Extended European Search Report dated Feb. 8, 2018 in European Patent Application No. 17202409.3.
Extended European Search Report dated Jul. 17, 2015 in European Patent Application No. 13755319.4.
Extended European Search Report dated Jun. 11, 2018 in European Patent Application No. 16740872.3.
Extended European Search Report dated Mar. 22, 2019 in European Patent Application No. 18195513.9.
Extended European Search Report dated May 28, 2021 in European Patent Application No. 20209777.0.
Extended European Search Report dated May 6, 2021 in European Patent Application No. 20207621.2.
Fan et al., "Combinatorial labeling of single cells for gene expression cytometry," SCIENCE 2015, 347(6222), 1258366-1258369.
Fan et al., "Microfluidic digital PCR enables rapid prenatal diagnosis of fetal aneuploidy," Am Obstet Gynecol. 2009, 200, 543e1-543e7.
Fan et al., "Non-invasive Prenatal Measurement of the Fetal Genome," Nature 2012, 487(7407), 320-324.
Fan et al., "Parallel Genotyping of Human SNPs Using Generic High-density Oligonucleotide Tag Arrays," Genome Research 2000, 10, 853-860.
Fan, "Molecular counting: from noninvasive prenatal diagnostics to whole-genome haplotyping," Doctoral Dissertation, Stanford University 2010, 1-185.
Feldhaus et al., "Oligonucleotide-conjugated beads for transdominant genetic experiments," Nucleic Acids Res. 2000, 28(2), 534-543.
Final Office Action dated Apr. 11, 2016 for U.S. Appl. No. 14/800,526.
Final Office Action dated Apr. 12, 2022 in U.S. Appl. No. 15/084,307.
Final Office Action dated Apr. 22, 2019 in U.S. Appl. No. 15/987,851.
Final Office Action dated Apr. 28, 2020 in U.S. Appl. No. 15/134,967.
Final Office Action dated Aug. 10, 2021 in U.S. Appl. No. 16/012,584.
Final Office Action dated Aug. 12, 2016 in U.S. Appl. No. 14/381,488.
Final Office Action dated Aug. 19, 2020 in U.S. Appl. No. 15/875,816.
Final Office Action dated Aug. 27, 2021 in U.S. Appl. No. 15/055,407.
Final Office Action dated Dec. 4, 2019 in U.S. Appl. No. 15/596,364.
Final Office Action dated Dec. 7, 2020 in U.S. Appl. No. 16/012,584.
Final Office Action dated Feb. 11, 2021 in U.S. Appl. No. 15/134,967.
Final Office Action dated Feb. 13, 2017 in U.S. Appl. No. 14/381,488.
Final Office Action dated Feb. 19, 2019 in U.S. Appl. No. 14/381,526.
Final Office Action dated Feb. 23, 2022 in U.S. Appl. No. 16/707,780.
Final Office Action dated Feb. 4, 2020 in U.S. Appl. No. 15/715,028.
Final Office Action dated Jan. 16, 2020 in U.S. Appl. No. 16/012,584.
Final Office Action dated Jan. 18, 2022 in U.S. Appl. No. 16/588,405.
Final Office Action dated Jan. 25, 2018 in U.S. Appl. No. 14/381,526.
Final Office Action dated Jan. 29, 2020 in U.S. Appl. No. 14/381,488.
Final Office Action dated Jan. 8, 2020 in U.S. Appl. No. 15/459,977.
Final Office Action dated Jul. 15, 2021 in U.S. Appl. No. 16/836,750.
Final Office Action dated Jul. 20, 2016 for U.S. Appl. No. 14/281,706.
Final Office Action dated Jul. 20, 2018 in U.S. Appl. No. 15/217,886.
Final Office Action dated Jul. 5, 2018 in U.S. Appl. No. 15/004,618.
Final Office Action dated Jun. 14, 2022 in U.S. Appl. No. 15/055,407.
Final Office Action dated Jun. 15, 2021 in U.S. Appl. No. 15/084,307.
Final Office Action dated Jun. 5, 2020 in U.S. Appl. No. 15/084,307.
Final Office Action dated Mar. 1, 2019 in U.S. Appl. No. 16/012,584.
Final Office Action dated Mar. 15, 2022 in U.S. Appl. No. 16/374,626.
Final Office Action dated Mar. 16, 2021 in U.S. Appl. No. 15/715,028.
Final Office Action dated Mar. 25, 2021 in U.S. Appl. No. 16/374,626.
Final Office Action dated Mar. 25, 2022 in U.S. Appl. No. 16/551,620.
Final Office Action dated Mar. 9, 2020 in U.S. Appl. No. 15/987,851.
Final Office Action dated May 10, 2018 in U.S. Appl. No. 14/381,488.
Final Office Action dated May 2, 2019 in U.S. Appl. No. 16/012,635.
Final Office Action dated May 26, 2022 in U.S. Appl. No. 16/747,737.
Final Office Action dated May 3, 2018 in U.S. Appl. No. 15/046,225.
Final Office Action dated May 3, 2019 in U.S. Appl. No. 15/937,713.
Final Office Action dated May 8, 2017 in U.S. Appl. No. 15/224,460.
Final Office Action dated Nov. 16, 2017 in U.S. Appl. No. 14/381,488.
Final Office Action dated Nov. 16, 2018 in U.S. Appl. No. 15/134,967.
Final Office Action dated Nov. 2, 2021 in U.S. Appl. No. 16/789,311.
Final Office Action dated Oct. 1, 2021 in U.S. Appl. No. 16/677,012.
Final Office Action dated Oct. 16, 2017 in U.S. Appl. No. 15/409,355.
Final Office Action dated Oct. 2, 2019 in U.S. Appl. No. 15/084,307.
Final Office Action dated Oct. 6, 2015 in U.S. Appl. No. 14/540,018.
Final Office Action dated Sep. 1, 2015 for U.S. Appl. No. 14/540,029.
Final Office Action dated Sep. 14, 2020 in U.S. Appl. No. 16/789,358.
Final Office Action dated Sep. 18, 2019 in U.S. Appl. No. 15/055,407.
Final Office Action dated Sep. 22, 2020 in U.S. Appl. No. 16/789,311.
Final Office Action dated Sep. 24, 2015 for U.S. Appl. No. 14/540,007.
Final Office Action dated Sep. 24, 2021 in U.S. Appl. No. 16/788,743.
Final Office Action dated Sep. 25, 2020 in U.S. Appl. No. 15/055,407.
First Action Interview Office Action Summary dated Jan. 25, 2019 in U.S. Appl. No. 15/987,851.
First Action Interview Pilot Program Pre-Interview Communication dated Oct. 15, 2018 in U.S. Appl. No. 15/987,851.
Fitzgerald and Grivel, "A Universal Nanoparticle Cell Secretion Capture Assay," Cytometry Part A 2012, 83A(2), 205-211.
Flanigon et al., "Multiplex protein detection with DNA readout via mass spectrometry," N Biotechnol. 2013, 30(2), 153-158.
Forster et al., "A human gut bacterial genome and culture collection for improved metagenomic analyses," Nature Biotechnology 2019, 37, 186-192.
Fox-Walsh et al., "A multiplex RNA-seq strategy to profile poly(A+) RNA: application to analysis of transcription response and 3′ end formation," Genomics 2011, 98, 266-721.
Fu et al., "Counting individual DNA molecules by the stochastic attachment of diverse labels," Proc Natl Acad Sci 2011, 108(22), 9026-9031.
Fu et al., "Molecular indexing enables quantitative targeted RNA sequencing and reveals poor efficiencies in standard library preparation," PNAS 2014, 111(5), 1891-1896.
Fu et al., Digital Encoding of Cellular mRNAs Enabling Precise and Absolute Gene Expression Measurement by Single-Molecule Counting. Anal Chem. 2014, 86, 2867-2870.
GenBank Accession No. NM_000518.5 for Homo sapiens hemoglobin subunit beta (HBB), mRNA. Mar. 22, 2021 [online], [retrieved on Apr. 27, 2021], retrieved from the Internet: <URL: www.ncbi.nlm.nih.gov/nuccore/NM_ 000518.5?report=Genbank (Year: 2021).
Gerry et al., "Universal DNA Microarray Method for Multiplex Detection of Low Abundance Point Mutations," Journal of Molecular Biology 1999, 292, 251-262.
Gertz et al., "Transposase mediated construction of RNA-seq libraries," Genome Research 2012, 22, 134-141.
Gillespie, "Exact Stochastic Simulation of Coupled Chemical Reactions," Journal of Physical Chemistry 1977, 81(25), 2340-2361.
Gong et al., "Massively parallel detection of gene expression in single cells using subnanolitre wells," Lab Chip 2010, 10, 2334-2337.
Gong et al., "Simple Method Prepare Oligonucleotide-Conjugated Antibodies and Its Application in Multiplex Protein Detection in Single Cells," Bioconjugate Chem. 2016, 27, 217-225.
Goodridge et al., "Synthesis of Albumin and Malic Enzyme in Wheat-Germ Lysates and Xenopus laevis Oocytes Programmed with Chicken-Liver Messenger RNA," Eur. J. Biochem. 1979, 96, 1-8.
Grant et al., "SNP genotyping on a genome-wide amplified DOP-PCR template," Nucleic Acids Res 2002, 30(22), e25, 1-6.
Gratton et al., "Cell-permeable peptides improve cellular uptake and therapeutic gene delivery of replication-deficient viruses in cells and in vivo," Nature Medicine 2003, 9(3), 357-362.
Gu et al., "Complete workflow for detection of low frequency somatic mutations from cell-free DNA using Ion Torrent™ platforms," Conference Poster, AACR 107th Annual Meeting, Apr. 16-20, 2016, 1 p.
Gu et al., "Depletion of abundant sequences by hybridization (DSH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications," Genome Biology 2016, 17(41) 1-13.
Gunderson et al., "Decoding Randomly Ordered DNA Arrays," Genome Research 2004, 14, 870-877.
Gundry et al., "Direct mutation analysis by high-throughput sequencing: from germline to low-abundant, somatic variants," Mutat Res. 2012, 729(1-2), 1-15.
Gundry et al., "Direct, genome-wide assessment of DNA mutations in single cells," Nucleic Acids Research 2011, 40(5), 2032-2040.
Hacia et al., "Determination of ancestral alleles for human single-nucleotide polymorphisms using high-density oligonucleotide arrays," Nature Genetics 1999, 22, 164-167.
Haff, "Improved Quantitative PCR Using Nested Primers," PCR Methods and Applications 1994, 3, 332-337.
Hamady et al., "Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex," Nat Methods 2008, 5(3), 235-237.
Han et al., "An approach to multiplexing an immunosorbent assay with antibody-oligonucleotide conjugates," Bioconjug Chem. 2010, 21(12), 2190-2196.
Harbers, "The current status of cDNA cloning," Genomics 2008, 91, 232-242.
Harrington et al., Cross-sectional characterization of HIV-1 env compartmentalization in cerebrospinal fluid over the full disease course, AIDS 2009, 23(8), 907-915.
Hartmann, "Gene expression profiling of single cells on large-scale oligonucleotide arrays", Nucleic Acids Research, (Oct. 2006) vol. 34, No. 21, p. e143, 1-12.
Hashimshony et al., "CEL-Seq: Single-Cell RNA-Seq by Multiplexed Linear Amplification," Cell Rep. 2012, 2(3), 666-673.
Hensel et al., "Simultaneous identification of bacterial virulence genes by negative selection," Science 1995, 269(5222), 400-403.
Hiatt et al., "Parallel, tag-directed assembly of locally derived short sequence reads," Nat Methods 2010, 7(2), 119-122.
Hiatt et al., "Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation," Genome Res. 2013, 23(5), 843-854.
Holcomb et al., "Abstract 1853: Single-cell multiplexed profiling of protein-level changes induced by EGFR inhibitor gefitinib," Cancer Res 2016, 76(14 Suppl), Abstract 1853.
Hollas et al., "A stochastic approach to count RNA molecules using DNA sequencing methods," Algorithms in Bioinformatics. WABI 2003, Lecture Notes in Computer Science, 2812, 55-62.
How many species of bacteria are there? Wisegeek.org, accessed Jan. 21, 2014, 2 pp.
Hu et al., "Dissecting Cell-Type Composition and Activity-Dependent Transcriptional State in Mammalian Brains by Massively Parallel Single-Nucleus RNA-Seq," Molecular Cell 2017, 68, 1006-1015.
Hu et al., "Single Cell Multi-Omics Technology: Methodology and Application," Frontiers in Cell and Developmental Biology 2018, 6(28), 1-13.
Hug et al., Measure of the Number of Molecular of a Single mRNA Species in a Complex mRNA Preparation, Journal of Theoretical Biology 2003, 221, 615-624.
Ingolia et al., Genome-Wide Analysis in Vivo of Translation with Nucleotide Resolution Using Ribosome Profiling, Science 2009, 324(5924), 218-223.
International Preliminary Report on Patentability dated Aug. 15, 2019 in PCT Application No. PCT/US2018/014385.
International Preliminary Report on Patentability dated Mar. 26, 2019 in PCT Application No. PCT/US2017/053331.
International Search Report and Written Opinion dated Apr. 12, 2022, in PCT Application No. PCT/US2021/059573.
International Search Report and Written Opinion dated Apr. 21, 2021 in PCT Application No. PCT/US2021/015571.
International Search Report and Written Opinion dated Apr. 5, 2022, in PCT Application No. PCT/US2021/062473.
International Search Report and Written Opinion dated Apr. 9, 2021 in PCT Application No. PCT/US2021/013137.
International Search Report and Written Opinion dated Aug. 16, 2013 for PCT Application No. PCT/US2013/027891.
International Search Report and Written Opinion dated Aug. 31, 2021 in PCT Application No. PCT/US2021/035270.
International Search Report and Written Opinion dated Aug. 7, 2017 in PCT Application No. PCT/US2017/034576.
International Search Report and Written Opinion dated Aug. 9, 2016 in PCT Application No. PCT/US2016/019971.
International Search Report and Written Opinion dated Dec. 19, 2014 in PCT Application No. PCT/US2014/059542.
International Search Report and Written Opinion dated Dec. 4, 2019 in PCT Application No. PCT/US2019/053868.
International Search Report and Written Opinion dated Dec. 5, 2016 in PCT Application No. PCT/US2016/024783.
International Search Report and Written Opinion dated Dec. 6, 2021, in PCT Application No. PCT/US2021/046750.
International Search Report and Written Opinion dated Feb. 3, 2015 in PCT Application No. PCT/US2014/053301.
International Search Report and Written Opinion dated Jan. 19, 2021 in PCT Application No. PCT/US2020/059419.
International Search Report and Written Opinion dated Jan. 27, 2020 in PCT Application No. PCT/US2019/048179.
International Search Report and Written Opinion dated Jan. 31, 2017 in PCT Application No. PCT/US2016/050694.
International Search Report and Written Opinion dated Jul. 15, 2021 in PCT Application No. PCT/US2021/019475.
International Search Report and Written Opinion dated Jul. 16, 2018 in PCT Application No. PCT/US2018/024602.
International Search Report and Written Opinion dated Jul. 20, 2021 in PCT Application No. PCT/US2021/015898.
International Search Report and Written Opinion dated Jun. 14, 2013 in PCT Application No. PCT/US2013/028103.
International Search Report and Written Opinion dated Jun. 17, 2016 in PCT Application No. PCT/US2016/019962.
International Search Report and Written Opinion dated Jun. 20, 2016 in PCT Application No. PCT/US2016/014612.
International Search Report and Written Opinion dated Jun. 24, 2019 in PCT Application No. PCT/US2019/030175.
International Search Report and Written Opinion dated Jun. 30, 2020 in PCT Application No. PCT/US2020/017890.
International Search Report and Written Opinion dated Jun. 6, 2012 in PCT Application No. PCT/US2011/065291.
International Search Report and Written Opinion dated Jun. 8, 2022, in PCT Application No. PCT/US2022/021015.
International Search Report and Written Opinion dated Jun. 9, 2016 in PCT Application No. PCT/US2016/022712.
International Search Report and Written Opinion dated Mar. 10, 2022, in PCT Application No. PCT/US2021/060206.
International Search Report and Written Opinion dated Mar. 11, 2022, in PCT Application No. PCT/US2021/060197.
International Search Report and Written Opinion dated Mar. 20, 2018 in PCT Application No. PCT/US2017/053331.
International Search Report and Written Opinion dated Mar. 28, 2018 in PCT Application No. PCT/US2018/014385.
International Search Report and Written Opinion dated Mar. 30, 2020 in PCT Application No. PCT/US2019/060243.
International Search Report and Written Opinion dated Mar. 30, 2020 in PCT Application No. PCT/US2019/065237.
International Search Report and Written Opinion dated May 11, 2021 in PCT Application No. PCT/US2021/013748.
International Search Report and Written Opinion dated May 18, 2020 in PCT Application No. PCT/US2020/014339.
International Search Report and Written Opinion dated May 3, 2016 in PCT Application No. PCT/US2016/018354.
International Search Report and Written Opinion dated May 4, 2021 in PCT Application No. PCT/US2021/013109.
International Search Report and Written Opinion dated May 7, 2012 for PCT Application No. PCT/IB2011/003160.
International Search Report and Written Opinion dated Nov. 12, 2020 in PCT Application No. PCT/US2020/042880.
International Search Report and Written Opinion dated Nov. 12, 2021, in PCT Application No. PCT/US2021/044036.
International Search Report and Written Opinion dated Nov. 27, 2019 in PCT Application No. PCT/US2019/046549.
International Search Report and Written Opinion dated Oct. 12, 2021, in PCT Application No. PCT/US2021/041327.
International Search Report and Written Opinion dated Oct. 16, 2019 in PCT Application No. PCT/US2019/030245.
International Search Report and Written Opinion dated Oct. 29, 2021, in PCT Application No. PCT/US2021/032319.
International Search Report and Written Opinion dated Oct. 8, 2019 in PCT Application No. PCT/US2019/043949.
International Search Report and Written Opinion dated Sep. 22, 2021, in PCT Application No. PCT/US2021/013747.
International Search Report and Written Opinion dated Sep. 27, 2016 in PCT Application No. PCT/US2016/034473.
International Search Report and Written Opinion dated Sep. 27, 2021, in PCT Application No. PCT/US2021/013747.
International Search Report and Written Opinion dated Sep. 28, 2016 in PCT Application No. PCT/US2016/028694.
International Search Report and Written Opinion dated Sep. 8, 2017 in PCT Application No. PCT/US2017/030097.
Invitation to Pay Additional Search Fees dated Sep. 8, 2021 in PCT Application No. PCT/US2021/032319.
Invitation to Pay Fees dated Mar. 16, 2016 in PCT Application No. PCT/US2016/019971.
Invitation to Pay Fees dated May 16, 2018 in PCT Application No. PCT/US2018/024602.
Invitation to Pay Fees dated May 25, 2021 in PCT Application No. PCT/US2021/01598.
Invitation to Pay Fees dated May 7, 2020 in PCT Application No. PCT/US2020/017890.
Invitation to Pay Fees dated Nov. 26, 2019 in PCT Application No. PCT/US2019/048179.
Invitation to Provide Informal Clarification dated Jun. 9, 2021 in PCT Application No. PCT/US2021/019475.
Invitation to Respond to Written Opinion dated May 26, 2017 in Singapore Patent Application No. 11201405274W.
Islam et al., "Characterization of the single-cell transcriptional landscape by highly multiplex RNA-seq," Genome Research 2011, 21, 1160-1167.
Islam et al., "Highly multiplexed and strand specific single-cell RNA 5′ end sequencing," Nature Protocols 2012, 7(5), 813-828.
Islam et al., "Quantitative single-cell RNA-seq with unique molecular identifiers," Nature Methods 2014, 11(2), 163-168.
Jabara et al., "Accurate sampling and deep sequencing of the HIV-1 protease gene using a Primer ID," PNAS 2011, 108(50), 20166-20171.
Jabara, "Capturing the cloud: High throughput sequencing of multiple individual genomes from a retroviral population," Biology Lunch Bunch Series, Training Initiatives in Biomedical & Biological Sciences of the University of North Carolina at Chapel Hill 2010.
Jacobsen et al., "33rd Annual Meeting & Pre-Conference Programs of the Society for Immunotherapy of Cancer," Journal for Immunotherapy of Cancer 2018, 6(S1), 7-11.
Janeway et al., "Structural variation in immunoglobulin constant regions," Immunology: The Immune System in Health and Disease 1999, 101-103.
Jason J. Rawnsley of Richards, Layton and Finger, P.A., Entry of Appearance dated Jan. 18, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 1 pp.
Jiang et al., "Synthetic spike-in standards for RNA-seq experiments," Genome Res. 2011, 21, 1543-1551.
Joint Stipulation and Order to Extend Time to Respond to Plaintiff's First Amended Complaint, dated Feb. 21, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Joint Stipulation and Order to Extended Time to Submit Agreed Document Production Protocol, filed Jun. 28, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 1 pp.
Joint Stipulation and Order to Request Extended Time to File Opposition to Defendant's Motion to Dismiss dated, Mar. 8, 2019 in the USDC District of Delaware, C.A. No. 18-1800 RGA, 2 pp.
Joint Stipulation and Order to Request Extended Time to Submit a proposed Protective Order, dated Jun. 7, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Joint Stipulation and Order to Request Extended Time to Submit Agreed Document Production Protocol, dated Jul. 11, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 1 pp.
Junker et al., "Single-Cell Transcriptomics Enters the Age of Mass Production," Molecular Cell 2015, 58, 563-564.
Kanagawa, "Bias and artifacts in multi-template polymerase chain reactions (PCR)," Journal of Bioscience and Bioengineering 2003, 96(4), 317-323.
Kang et al., "Application of multi-omics in single cells," Ann Biotechnol. 2018, 2(1007), 1-8.
Kang et al., "Targeted sequencing with enrichment PCR: a novel diagnostic method for the detection of EGFR mutations," Oncotarget 2015, 6(15), 13742-13749.
Karrer et al., "In situ isolation of mRNA from individual plant cells: creation of cell-specific cDNA libraries," Proc. Natl. Acad. Sci. USA 1995, 92, 3814-3818.
Kausch et al., "Organelle Isolation by Magnetic Immunoabsorption," BioTechniques 1999, 26(2), 336-343.
Kebschull et al., "Sources of PCR-induced distortions in high-throughput sequencing data sets," Nucleic Acids Research 2015, 1-15.
Keys et al., Primer ID Informs Next-Generation Sequencing Platforms and Reveals Preexisting Drug Resistance Mutations in the HIV-1 Reverse Transcriptase Coding Domain, AIDS Research and Human Retroviruses 2015, 31(6), 658-668.
Kim et al., Polony Multiplex Analysis of Gene Expression (PMAGE) in Mouse Hypertrophic Cardiomyopathy, Science 2007, 316(5830), 1481-1484.
Kinde et al., "Detection and quantification of rare mutations with massively parallel sequencing," Proc. Natl Acad Sci 2011, 108(23), 9530-0535.
Kirsebom et al., "Stimuli-Responsive Polymers in the 21st Century: Elaborated Architecture to Achieve High Sensitivity, Fast Response, and Robust Behavior," Journal of Polymer Science: Part B: Polymer Physics 2011, 49, 173-178.
Kivioja et al., "Counting absolute numbers of molecules using unique molecular identifiers," Nature Proceedings 2011, 1-18.
Klein et al., Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic Stem Cells, Cell 2015, 161, 1187-1201.
Ko et al., "RNA-conjugated template-switching RT-PCR method for generating an Escherichia coli cDNA library for small RNAs," Journal of Microbiological Methods 2006, 64, 297-304.
Koboldt et al., VarScan: variant detection in massively parallel sequencing of individual and pooled samples, Bioinformatics 2009, 25(17), 2283-2285.
Kolodziejczyk et al., The Technology and Biology of Single-Cell RNA Sequencing, Molecular Cell 2015, 58, 610-620.
Konig et al., iCLIP reveals the function of hnRNAP particles in splicing at individual nucleotide resolution, Nature Structural & Molecular Biology 2010, 17(7), 909-916.
Kooiker & Xue, "cDNA Library Preparation," Cereal Genomics 2013, 1099, 29-40.
Kotake et al., "A simple nested RT-PCR method for quantitation of the relative amounts of multiple cytokine mRNAs in small tissue samples," Journal of Immunological Methods 1996, 199, 193-203.
Kozarewa & Turner, "96-Plex Molecular Barcoding for the Illumina Genome Analyzer," High-Throughput Next Generation Sequencing. Methods in Molecular Biology (Methods and Applications) 2011, 733, 24 pp. DOI: 10.1007/978-1-61779-089-8_20.
Kozlov et al., "A high-complexity, multiplexed solution-phase assay for profiling protease activity on microarrays," Comb Chem High Throughput Screen 2008, 11(1), 24-35.
Kurimoto et al., "An improved single-cell cDNA amplification method for efficient high-density oligonucleotide microarray analysis," Nucleic Acids Res. 2006, 34(5), e42, 1-17.
Kurimoto et al., "Global single-cell cDNA amplification to provide a template for representative high-density oligonucleotide microarray analysis," Nature Protocols 2007, 2(3), 739-752.
Lake et al., "Integrative single-cel I analysis of tra nscri ptiona l and epigenetic states in the human adult brain," Nature Biotechnology 2018, 36(1), 70-80.
Lamble et al., "Improved workflows for high throughput library preparation using the transposome-based nextera system," BMC Biotechnology 2013, 13, 104, 1-10.
Lan et al., "Droplet barcoding for massively parallel single-molecule deep sequencing," Nature Communications 2016, 7(11784), in 10 pages.
Larson et al., "A single molecule view of gene expression," Trends Cell Biol. 2009, 19(11), 630-637.
Lass-Napiorkowska et al., "Detection methodology based on target molecule-induced sequence-specific binding to a single-stranded oligonucleotide," Anal Chem. 2012, 84(7), 3382-3389.
Leamon et al., A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions, Electrophoresis 2003, 24, 3769-3777.
Lee et al., "Highly Multiplexed Subcellular RNA Sequencing in Situ," Science 2014, 343,1360-1363.
Lee et al., "Large-scale arrays of picolitre chambers for single-cell analysis of large cell populations," Lab Chip 2010, 10, 2952-2958.
Lee et al., "Universal process-inert encoding architecture for polymer microparticles," Nature Materials 2014, 13(5), 524-529.
Letter regarding the opposition procedure dated Jul. 22, 2015 for European Patent Application No. 11810645.9.
Letter to Judge Andrews regarding Agreement on Proposed Scheduling Order, dated May 7, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
Letter to Judge Andrews regarding Notice of Supplemental Authority, dated Jul. 10, 2019 in the USDC for the District of Delaware, C.A. 18-1800(RGA), 2pp.
Letter to Judge Richard G. Andrews Requesting a Rule 16 Conference, dated Apr. 15, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 1 pp.
Lin et al., "Self-Assembled Combinatorial Encoding Nanoarrays for Multiplexed Biosensin," Nano Lett. 2007, 7(2), 507-512.
Liu et al., "Single-cell transcriptome sequencing: recent advances and remaining challenges," F1000Research 2016, 5(F1000 Faculty Rev)(182), 1-9.
Livingstone, "rRNA depletion, poly(A) enrichment, or exonuclease treatment?" Tebu-Bio Blog 2015, in 1 page.
Lizardi et al., "Mutation detection and single-molecule counting using isothermal rolling-circle amplification," Nat Genet. 1998, 19, 225-232.
Lockhart et al., "Expression monitoring by hybridization to high-density oligonucleotide arrays," Nature Biotechnology 1996, 14, 1675-1680.
Lovatt et al., "Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue," Nat Methods 2014, 11(2), 190-196.
Loy et al., "A rapid library preparation method with custom assay designs for detection of variants at 0.1% allelic frequency in liquid biopsy samples," Oct. 2, 2018, 1 p.
Lucito et al., "Representational Oligonucleotide Microarray Analysis: A High-Resolution Method to Detect Genome Number Variation," Genome Research 2003, 13, 2291-2305.
Lundberg et al., "Practical innovations for high-throughput amplicon sequencing," Nature Methods 2013, 10(10), 999-1007.
Lundberg et al., "Supplementary Information for: Practical innovations for high-throughput amplicon sequencing," Nature Methods 2013, 1-24.
Lutz et al., "Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing," BMC Biotechnology 2011, 11(54), in 9 pages.
Maamar et al., "Noise in Gene Expression Determines Cell Fate in Bacillus subtilis," Science 2007, 317, 526-529.
MaCaulay et al., "G&T-seq: parallel sequencing of single-cell genomes and transcriptomes," Nature Methods 2015, 1-7.
MaCaulay et al., "Single Cell Genomics: Advances and Future Perspectives," PLoS Genetics 2014, 10(1), 1-9.
MaCosko et al., "Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets," Cell 2015, 161, 1202-1214.
Maeda et al., "Development of a DNA barcode tagging method for monitoring dynamic changes in gene expression by using an ultra high-throughput sequencer," BioTechniques 2008, 45(1), 95-97.
Mair et al., "A Targeted Multi-omic Analysis Approach Measures Protein Expression and Low-Abundance Transcripts on the Single-Cell Level", Cell Reports 2020, 31(1), 107499, in 20 pages.
Makrigiorgos et al., "A PCR-Based amplification method retaining quantities difference between two complex genomes," Nature Biotech 2002, 20(9), 936-939.
Marcus et al., 2006, "Microfluidic single-cell mRNA isolation and analysis," Anal Chem. 2006, 78, 3084-3089.
Mardis, "Next-generation DNA sequencing methods", Annu. Rev. Genomics Hum. Genet. 2008, 9, 387-402.
Marguerat et al., "Next-generation sequencing: applications beyond genomes," Biochem. Soc. Trans. 2008, 36(5), 1091-1096.
Marguiles et al., Genome sequencing in microfabricated high-density picolitre reactors, Nature 2005, 437, 376-380.
Martinez et al., "A microfluidic approach to encapsulate living cells in uniform alginate hydrogel microparticles," Macromol. Biosci 2012, 12, 946-951.
Massachusetts General Hospital, Overview of Illumina Chemistry, http://nextgen.mgh.harvard.edu/IlluminaChemistry.html, downloaded Jan. 28, 2020, 2 pp.
McCloskey et al., "Encoding PCR products with batch-stamps and barcodes," Biochem Genet. 2007, 45(11-12), 761-767.
Medvedev et al., "Detecting number variation with mated short reads," Genome Res. 2010, 20, 1613-1622.
Mei et al., "Identification of recurrent regions of Number Variants across multiple individuals," BMC Bioinformatics 2010, 11, 147, 1-14.
Merriam-Webster, definition of associate: http://www.merriam-webster.com/dictionary/associate, accessed Apr. 5, 2016.
Meyer et al., "Parallel tagged sequencing on the 454 platform," Nature Protocols 2008, 3(2), 267-278.
Miller et al., Directed evolution by in vitro compartmentalization, Nature Methods 2006, 3(7), 561-570.
Miner et al., "Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR," Nucleic Acids Research 2004, 32(17), e135, 1-4.
Monneron, "One-step Isolation and Characterization of Nuclear Membranes, 1974 Electron Microscopy and Composition of Biological Membranes and Envelops," The Royal Publishing Society 1974, 268, 101-108.
Mortazavi et al., "Mapping and quantifying mammalian transcriptomes by RNA-Seq," Nat. Methods 2008, 5(7), 621-628.
Motion and Order for Admission Pro Hac Vice Pursuant to Local Rule 83.5, dated Jan. 24, 2019 in the USDC District of Delaware, C.A. No. 18-1800-RGA, 7 pp.
Nadai et al., Protocol for nearly full-length sequencing of HIV-1 RNA from plasma, PLoS One 2008, 3(1), e1420, 1-6.
Nagai et al., "Development of a microchamber array for picoleter PCR," Anal. Chem. 2001, 73, 1043-1047.
Navin et al., "The first five years of single-cell cancer genomics and beyond," Genome Research 2015, 25, 1499-1507.
New COVID-19 Variants, Centers for Disease Control and Prevention 2021, accessed Jan. 21, 2021, 3 pp.
Newell et al., Cytometry by time-of-flight shows combinatorial cytokine expression and virus-specific cell niches within a continuum of CD8+ T cell phenotypes. Immunity 2012, 36(1), 142-152.
Non-Final Office Action dated Apr. 11, 2016 in U.S. Appl. No. 14/472,363.
Non-Final Office Action dated Apr. 14, 2021 in U.S. Appl. No. 16/789,311.
Non-Final Office Action dated Apr. 20, 2021 in U.S. Appl. No. 15/875,816.
Non-Final Office Action dated Apr. 5, 2022 in U.S. Appl. No. 16/400,885.
Non-Final Office Action dated Apr. 6, 2018 in U.S. Appl. No. 15/603,239.
Non-Final Office Action dated Aug. 17, 2016 for U.S. Appl. No. 14/800,526.
Non-Final Office Action dated Aug. 17, 2021 in U.S. Appl. No. 16/551,620.
Non-Final Office Action dated Aug. 19, 2020 in U.S. Appl. No. 16/374,626.
Non-Final Office Action dated Aug. 19, 2021 in U.S. Appl. No. 16/781,814.
Non-Final Office Action dated Aug. 20, 2019 for U.S. Appl. No. 15/715,028.
Non-Final Office Action dated Aug. 20, 2019 in U.S. Appl. No. 15/715,028.
Non-Final Office Action dated Aug. 25, 2020 in U.S. Appl. No. 14/381,488.
Non-Final Office Action dated Aug. 31, 2021 in U.S. Appl. No. 15/715,028.
Non-Final Office Action dated Aug. 4, 2020 in U.S. Appl. No. 15/459,977.
Non-Final Office Action dated Dec. 15, 2021 in U.S. Appl. No. 15/875,816.
Non-Final Office Action dated Dec. 21, 2021 in U.S. Appl. No. 15/055,407.
Non-Final Office Action dated Dec. 3, 2015 for U.S. Appl. No. 14/281,706.
Non-Final Office Action dated Dec. 31, 2015 for U.S. Appl. No. 14/800,526.
Non-Final Office Action dated Dec. 4, 2020 in U.S. Appl. No. 16/677,012.
Non-Final Office Action dated Dec. 9, 2020 in U.S. Appl. No. 16/788,743.
Non-Final Office Action dated Feb. 18, 2015 for U.S. Appl. No. 14/540,007.
Non-Final Office Action dated Feb. 19, 2019 in U.S. Appl. No. 14/381,526.
Non-Final Office Action dated Feb. 2, 2021 in U.S. Appl. No. 16/535,080.
Non-Final Office Action dated Feb. 2, 2022 in U.S. Appl. No. 16/747,737.
Non-Final Office Action dated Feb. 25, 2021 in U.S. Appl. No. 15/055,407.
Non-Final Office Action dated Feb. 25, 2021 in U.S. Appl. No. 15/084,307.
Non-Final Office Action dated Feb. 26, 2015 for U.S. Appl. No. 14/540,029.
Non-Final Office Action dated Feb. 5, 2020 in U.S. Appl. No. 15/875,816.
Non-Final Office Action dated Feb. 9, 2022 in U.S. Appl. No. 16/525,054.
Non-Final Office Action dated Jan. 12, 2018 in U.S. Appl. No. 15/217,886.
Non-Final Office Action dated Jan. 14, 2019 in U.S. Appl. No. 16/219,553.
Non-Final Office Action dated Jan. 17, 2020 in U.S. Appl. No. 15/084,307.
Non-Final Office Action dated Jan. 19, 2017 in U.S. Appl. No. 15/055,445.
Non-Final Office Action dated Jan. 19, 2021 in U.S. Appl. No. 16/836,750.
Non-Final Office Action dated Jan. 6, 2022 in U.S. Appl. No. 15/084,307.
Non-Final Office Action dated Jan. 7, 2019 in U.S. Appl. No. 15/055,407.
Non-Final Office Action dated Jan. 9, 2018 in U.S. Appl. No. 15/217,896.
Non-Final Office Action dated Jul. 25, 2018 in U.S. Appl. No. 15/108,268.
Non-Final Office Action dated Jul. 28, 2017 in U.S. Appl. No. 14/975,441.
Non-Final Office Action dated Jul. 7, 2022 in U.S. Appl. No. 16/677,012.
Non-Final Office Action dated Jul. 7, 2022 in U.S. Appl. No. 16/788,743.
Non-Final Office Action dated Jul. 9, 2019 in U.S. Appl. No. 15/596,364.
Non-Final Office Action dated Jun. 17, 2019 in U.S. Appl. No. 14/381,488.
Non-Final Office Action dated Jun. 2, 2017 in U.S. Appl. No. 14/381,526.
Non-Final Office Action dated Jun. 7, 2017 in U.S. Appl. No. 14/381,488.
Non-Final Office Action dated Jun. 8, 2020 in U.S. Appl. No. 15/715,028.
Non-Final Office Action dated Jun. 9, 2021 in U.S. Appl. No. 16/588,405.
Non-Final Office Action dated Mar. 12, 2020 in U.S. Appl. No. 16/789,358.
Non-Final Office Action dated Mar. 17, 2020 in U.S. Appl. No. 15/055,407.
Non-Final Office Action dated Mar. 19, 2015 in U.S. Appl. No. 14/540,018.
Non-Final Office Action dated Mar. 19, 2019 in U.S. Appl. No. 15/046,225.
Non-Final Office Action dated Mar. 24, 2017 in U.S. Appl. No. 15/409,355.
Non-Final Office Action dated Mar. 26, 2020 in U.S. Appl. No. 16/012,635.
Non-Final Office Action dated Mar. 26, 2020 in U.S. Appl. No. 16/789,311.
Non-Final Office Action dated Mar. 29, 2021 in U.S. Appl. No. 16/789,358.
Non-Final Office Action dated Mar. 8, 2018 in U.S. Appl. No. 15/608,780.
Non-Final Office Action dated May 10, 2016 in U.S. Appl. No. 14/381,488.
Non-Final Office Action dated May 11, 2022 in U.S. Appl. No. 16/588,405.
Non-Final Office Action dated May 13, 2016 in U.S. Appl. No. 14/508,911.
Non-Final Office Action dated May 15, 2019 in U.S. Appl. No. 15/084,307.
Non-Final Office Action dated May 18, 2021 in U.S. Appl. No. 16/535,080.
Non-Final Office Action dated May 19, 2022 in U.S. Appl. No. 16/459,444.
Non-Final Office Action dated May 23, 2019 in U.S. Appl. No. 15/459,977.
Non-Final Office Action dated May 3, 2022 in U.S. Appl. No. 16/012,584.
Non-Final Office Action dated May 7, 2015 for U.S. Appl. No. 13/327,526.
Non-Final Office Action dated Nov. 1, 2017 in U.S. Appl. No. 15/667,125.
Non-Final Office Action dated Nov. 26, 2018 in U.S. Appl. No. 15/937,713.
Non-Final Office Action dated Nov. 29, 2019 in U.S. Appl. No. 15/937,713.
Non-Final Office Action dated Nov. 5, 2018 in U.S. Appl. No. 16/038,790.
Non-Final Office Action dated Nov. 9, 2017 in U.S. Appl. No. 15/004,618.
Non-Final Office Action dated Oct. 1, 2021 in U.S. Appl. No. 16/677,012.
Non-Final Office Action dated Oct. 11, 2016 in U.S. Appl. No. 15/224,460.
Non-Final Office Action dated Oct. 25, 2018 in U.S. Appl. No. 16/012,584.
Non-Final Office Action dated Oct. 3, 2013 in U.S. Appl. No. 12/969,581.
Non-Final Office Action dated Oct. 4, 2018 in U.S. Appl. No. 15/260,106.
Non-Final Office Action dated Oct. 8, 2021 in U.S. Appl. No. 16/400,866.
Non-Final Office Action dated Sep. 1, 2021 in U.S. Appl. No. 16/789,358.
Non-Final Office Action dated Sep. 14, 2021 in U.S. Appl. No. 16/707,780.
Non-Final Office Action dated Sep. 18, 2019 in U.S. Appl. No. 16/194,819.
Non-Final Office Action dated Sep. 26, 2016 in U.S. Appl. No. 15/167,807.
Non-Final Office Action dated Sep. 28, 2021 in U.S. Appl. No. 16/400,885.
Non-Final Office Action dated Sep. 30, 2021 in U.S. Appl. No. 16/374,626.
Non-Final Office Action dated Sep. 8, 2017 in U.S. Appl. No. 15/046,225.
Non-Final Office Action dated Sep. 8, 2017 in U.S. Appl. No. 15/134,967.
Notice of Allowability dated Jun. 19, 2014 for U.S. Appl. No. 12/969,581.
Notice of Allowance dated Apr. 11, 2022 in U.S. Appl. No. 15/134,967.
Notice of Allowance dated Apr. 15, 2020 in U.S. Appl. No. 16/012,635.
Notice of Allowance dated Apr. 25, 2022 in Korean Patent Application No. 10-2018-7008560.
Notice of Allowance dated Apr. 26, 2021 in Japanese Patent Application No. 2019-014564.
Notice of Allowance dated Apr. 27, 2022 in U.S. Appl. No. 16/400,886.
Notice of Allowance dated Aug. 16, 2021 in Japanese Patent Application No. 2018-512152.
Notice of Allowance dated Aug. 22, 2014 for U.S. Appl. No. 12/969,581.
Notice of Allowance dated Dec. 15, 2015 for U.S. Appl. No. 14/540,007.
Notice of Allowance dated Dec. 21, 2015 in U.S. Appl. No. 14/540,018.
Notice of Allowance dated Dec. 27, 2019 in U.S. Appl. No. 15/260,106.
Notice of Allowance dated Dec. 7, 2021 in Chinese Patent Application No. 201680007652.
Notice of Allowance dated Feb. 11, 2022 in Chinese Patent Application No. 201680007351.2.
Notice of Allowance dated Feb. 16, 2022 in U.S. Appl. No. 15/875,816.
Notice of Allowance dated Feb. 21, 2022 in Korean Patent Application No. 10-2020-7033213.
Notice of Allowance dated Feb. 9, 2022 in U.S. Appl. No. 16/781,814.
Notice of Allowance dated Jan. 13, 2021 in U.S. Appl. No. 14/381,488.
Notice of Allowance dated Jan. 13, 2021 in U.S. Appl. No. 15/459,977.
Notice of Allowance dated Jan. 21, 2016 for U.S. Appl. No. 13/327,526.
Notice of Allowance dated Jan. 24, 2022 in Korean U.S. Appl. No. 16/836,750.
Notice of Allowance dated Jan. 9, 2019 in U.S. Appl. No. 15/603,239.
Notice of Allowance dated Jun. 10, 2021 in Chinese Patent Application No. 2018800377201.
Notice of Allowance dated Jun. 6, 2022 in U.S. Appl. No. 16/789,358.
Notice of Allowance dated Mar. 20, 2019 in U.S. Appl. No. 16/219,553.
Notice of Allowance dated Mar. 21, 2014 for U.S. Appl. No. 12/969,581.
Notice of Allowance dated Mar. 21, 2019 in U.S. Appl. No. 15/993,468.
Notice of Allowance dated Mar. 27, 2020 in U.S. Appl. No. 15/596,364.
Notice of Allowance dated Mar. 30, 2020 in U.S. Appl. No. 15/937,713.
Notice of Allowance dated Mar. 5, 2020 in U.S. Appl. No. 15/217,886.
Notice of Allowance dated May 15, 2022 in Japanese Patent Application No. 2019-540515.
Notice of Allowance dated May 23, 2022 in U.S. Appl. No. 15/715,028.
Notice of Allowance dated May 26, 2022 in Korean Patent Application No. 10-2019-7038794.
Notice of Allowance dated May 28, 2019 in U.S. Appl. No. 16/219,553.
Notice of Allowance dated May 9, 2022 in Australian Patent Application No. 2018281745.
Notice of Allowance dated Nov. 11, 2019 in Japanese Patent Application No. 2017-245295.
Notice of Allowance dated Nov. 16, 2021 in U.S. Appl. No. 16/836,750.
Notice of Allowance dated Nov. 29, 2019 in U.S. Appl. No. 16/012,635.
Notice of Allowance dated Oct. 29, 2020 in U.S. Appl. No. 15/987,851.
Notice of Allowance dated Sep. 10, 2021 in U.S. Appl. No. 16/535,080.
Notice of Allowance dated Sep. 23, 2020 in Korean Patent Application No. 10-2016-7008144.
Notice of Allowance dated Sep. 24, 2019 in U.S. Appl. No. 15/217,886.
Notice of Opposition dated Jul. 27, 2016 for European Patent Application No. 10762102.1.
Notice of Opposition dated Jul. 9, 2015 for European Patent Application No. 11810645.9.
Notice of Reason for Refusal dated Nov. 21, 2019 in Korean Patent Application No. 10-2016-7008144.
Notice of Reasons for Refusal dated May 11, 2020 in Japanese Patent Application No. 2017-549390.
Notice of Reasons for Rejection dated Apr. 2, 2018 in Japanese Patent Application No. 2014-558975.
Notice of Reasons for Rejection dated Aug. 31, 2018 in Japanese Patent Application No. 2016-520632.
Notice of Reasons for Rejection dated Dec. 28, 2016 in Japanese Patent Application No. 2014-558975.
Notice of Reasons for Rejection dated Dec. 5, 2018 in Japanese Patent Application No. 2017-245295.
Notice of Reasons for Rejection dated Feb. 25, 2020 in Japanese Patent Application No. 2019-014564.
Notice of Reasons for Rejection dated Jul. 30, 2018 in Japanese Patent Application No. 2016-537867.
Notice of Service of Disclosures to Opposing Counsel, dated Jun. 10, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 3 pp.
Notice of Service of Interrogatories and First Request of Documents and Things to Defendant 10X Genomics, Inc., dated Jul. 5, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 3 pp.
Notice, Consent, and Reference of a Civil Action to a Magistrate Judge (Rule 73.1), filed Nov. 15, 2018 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 3 pp.
Notification Prior to Examination dated Nov. 27, 2019 in Israeli Patent Application No. 265478.
Novak et al., "Single-Cell Multiplex Gene Detection and Sequencing with Microfluidically Generated Agarose Emulsions," Angew. Chem. Int. Ed. 2011, 50, 390-395.
Novus Biologicals, "Fixation and Permeability in ICC IF," Novus Biologicals 2021, 1-3.
Nowak et al., "Does the KIR2DS5 gene protect from some human diseases?," PLoS One 2010, 5(8), in 6 pages.
Office Action dated Aug. 13, 2021 in Chinese Patent Application No. 2017800587991.
Office Action dated Aug. 27, 2021 in Chinese Patent Application No. 2016800076525.
Office Action dated Aug. 30, 2021 in Japanese Patent Application No. 2019-540515.
Office Action dated Aug. 31, 2021, in Korean Patent Application No. 10-2019-7038794.
Office Action dated Dec. 13, 2018 in Canadian Patent Application No. 2,865,575.
Office Action dated Dec. 17, 2021 in Korean Patent Application No. 10-2018-7008560.
Office Action dated Dec. 19, 2017 in Chinese Patent Application No. 201480061859.1.
Office Action dated Dec. 23, 2021, in Japanese Patent Application No. 2019-566787.
Office Action dated Dec. 27, 2016 in Chinese Patent Application No. 201380022187.9.
Office Action dated Feb. 15, 2018 in Canadian Patent Application No. 2,865,575.
Office Action dated Feb. 17, 2017 in Canadian Patent Application No. 2,865,575.
Office Action dated Feb. 20, 2021 in Chinese Patent Application No. 201680022865.5.
Office Action dated Feb. 4, 2021 in Canadian Patent Application No. 2,865,575.
Office Action dated Feb. 9, 2022 in Japanese Patent Application No. 2019-540515.
Office Action dated Jan. 13, 2022 in Chinese Patent Application No. 2017800587991.
Office Action dated Jan. 14, 2021 in Japanese Patent Application No. 2019-014564.
Office Action dated Jan. 15, 2021 in Korean Patent Application No. 10-2020-7033213.
Office Action dated Jan. 2, 2019 in Chinese Patent Application No. 201480059505.3.
Office Action dated Jan. 26, 2021 in Chinese Patent Application No. 201680007351.2.
Office Action dated Jan. 4, 2021 in Japanese Patent Application No. 2017-549390.
Office Action dated Jan. 6, 2021 in Chinese Patent Application No. 201680052330.2.
Office Action dated Jul. 14, 2017 in Chinese Patent Application No. 201380022187.9.
Office Action dated Jul. 20, 2020 in Japanese Patent Application No. 2018-512152.
Office Action dated Jul. 26, 2021 in Korean Patent Application No. 10-2019-7011635.
Office Action dated Jul. 28, 2021 in Korean Patent Application No. 10-2020-7033213.
Office Action dated Jun. 22, 2020 in Chinese Patent Application No. 201680007351.2.
Office Action dated Jun. 22, 2020 in Chinese Patent Application No. 201680007652.5.
Office Action dated Jun. 23, 2020 in Chinese Patent Application No. 2016800157452.
Office Action dated Jun. 6, 2016 in Chinese Patent Application No. 201380022187.9.
Office Action dated Mar. 1, 2021 in Chinese Patent Application No. 201680007652.5.
Office Action dated Mar. 16, 2021 in Chinese Patent Application No. 2018800377201.
Office Action dated Mar. 2, 2021 in Chinese Patent Application No. 2016800157452.
Office Action dated Mar. 4, 2020 in Canadian Patent Application No. 2,865,575.
Office Action dated Mar. 7, 2022 in Korean Patent Application No. 10-2022-7004715.
Office Action dated Mar. 8, 2021 in Japanese Patent Application No. 2018-512152.
Office Action dated May 10, 2021 in Japanese Patent Application No. 2019-566787.
Office Action dated May 17, 2022 in Australian Patent Application No. 2019204928.
Office Action dated May 21, 2021 in Chinese Patent Application No. 201680007351.2.
Office Action dated May 24, 2022 in European Patent Application No. 20708266.0.
Office Action dated Nov. 2, 2021, in Japanese Patent Application No. 2017-549390.
Office Action dated Oct. 21, 2021, in Chinese Patent Application No. 2016800073512.
Office Action dated Oct. 29, 2020 in Chinese Patent Application No. 2018800377201.
Office Action dated Sep. 14, 2021, in Chinese Patent Application No. 2016800523302.
Office Action dated Sep. 7, 2018 in Chinese Patent Application No. 201480061859.1.
Ogino et al., "Quantification of PCR bias caused by a single nucleotide polymorphism in SMN gene dosage analysis," J Mol Diagn. 2002, 4(4), 185-190.
Opposition to Defendant's Motion to Dismiss Pursuant to Federal Rule of Civil Procedure 12(b)(6) dated Feb. 15, 2019, in the USDC for the District of Delaware, C.A. 18-800-RGA, 3 pp.
Oral Order by Judge Andrews Canceling Scheduling Conference set for May 8, 2019.
Order Scheduling ADR Mediation Teleconference, filed May 13, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 4pp.
Order Setting Rule 16(b) Conference as Ordered by Judge Andrews Pursuant to Fed. R. Civ. P. 16(b), ruling dated Apr. 17, 2019 in the USDC District of Delaware, C.A. 18-1800-RGA, 1 pp.
O'Shea et al., "Analysis of T Cell Receptor Beta Chain CDR3 Size Using RNA Extracted from Formalin Fixed Paraffin Wax Embedded Tissue," Journal of Clinical Pathology 1997, 50(10), 811-814.
Ozkumur et al., "Inertial Focusing for Tumor Antigen-Dependent and -Independent Sorting of Rare Circulating Tumor Cells," Science Translational Medicine 2013, 5(179), 1-20.
Parameswaran et al., "A pyrosequencing-tailored nucleotide barcode design unveils opportunities for large-scale sample multiplexing," Nucleic Acids Res. 2007, 35(19), e130, 1-9.
Park et al., "Discovery of common Asian number variants using integrated high-resolution array CGH and massively parallel DNA sequencing," Nat Genet. 2010, 42(5), 400-405.
Patanjali et al., "Construction of a uniform-abundance (normalized) CNDA library," Proceedings of the National Academy of Sciences 1991, 88(5), 1943-1947.
Peng et al., "Reducing amplification artifacts in high multiplex amplicon sequencing by using molecular barcodes," BMC Genomics 2015, 16(589), 1-12.
Pérez-Rentero et al., "Synthesis of Oligonucleotides Carrying Thiol Groups Using a Simple Reagent Derived from Threoninol," Molecules 2012, 17, 10026-10045.
Peterson et al., "Multiplexed quantification of proteins and transcripts in single cells," Nature Biotechnology 2017, 35, 936-939.
Pfaffl et al., "Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations," Biotechnology Letters, 26(6), 505-515.
Picelli et al., "Single-cell RNA-sequencing: The future of genome biology is now," RNA Biology 2017, 14(5), 637-650.
Picelli et al., "Tn5 transposase and tagmentation procedures for massively scaled sequencing projects," Genome Research 2014, 24(12), 2033-2040.
Pihlak et al., "Rapid genome sequencing with short universal tiling probes," Nature Biotechnology 2008, 26, 1-9.
Pinkel et al., "Comparative Genomic Hybridization," Annual Review of Genomics and Human Genetics 2005, 6, 331-354.
Plaintiff's Brief in Opposition to Defendant's Motion to Dismiss Pursuant to Fed. R. Civ. P. 12(b)(6), filed Mar. 29, 2019 in the USDC District of Delaware, C.A. No. 18-1800 (RGA), 27 pp.
Plaintiff's First Amended Complaint filed on Feb. 8, 2019, in the USDC for the District of Delaware, C.A. 18-1800-RGA, 178 pp.
Pleasance et al., "A small-cell lung cancer genome with complex signatures of tobacco exposure," Nature 2010, 463(7278), 184-190.
Plessy et al., "Population transcriptomics with single-cell resolution: a new field made possible by microfluidics: a technology for high throughput transcript counting and data-driven definition of cell types," Bioessays 2012, 35, 131-140.
Pre-interview communication dated Nov. 27, 2018 in U.S. Appl. No. 16/012,635.
Preissl et al., "Single-nucleus analysis of accessible chromatin in developing mouse forebrain reveals cell-type-specific transcriptional regulation," Nature Neuroscience 2018, 21(3), 432-439.
Prevette et al., "Polycation-Induced Cell Membrane Permeability Does Not Enhance Cellular Uptake or Expression Efficiency of Delivered DNA," Molecular Pharmaceutics 2010, 7(3), 870-883.
Pringle et al., "In Situ Hybridization Demonstration of Poly-Adenylated RNA Sequences in Formalin-Fixed Parafin Sections Using a Biotinylated Oligonucleotide Poly d(T) Probe," Journal of Pathology 1989, 158, 279-286.
Proposed Stipulated Protective Order Pursuant to Rule 26(c) of the Federal Rules of Civil Procedure, filed Jun. 20, 2019 In the USDC for the District of Delaware, C.A. 18-1800 (RGA), 26 pp.
Qiu et al., "DNA Sequence-Based "Bar Codes" for Tracking the Origins of Expressed Sequence Tags from a Maize cDNA Library Constructed Using Multiple mRNA Sources," Plant Physiol. 2003, 133, 475-481.
Quail et al., "SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing," BMC Genomics 2014, 15(110), in 13 pages.
Raj et al., "Imaging individual mRNA molecules using multiple singly labeled probes," Nature Methods 2008, 5(10), 877-879.
Raj et al., "Single-Molecule Approaches to Stochastic Gene Expression," Annu Rev Biophys 2009, 38, 255-270.
Raj et al., "Stochastic mRNA synthesis in mammalian cells," PLoS Biol. 2006, 4(10) 1707-1719.
Rajeevan et al., "Global amplification of sense RNA: a novel method to replicate and archive mRNA for gene expression analysis," Genomics 2003, 82, 491-497.
Report on the Filing or Determination of an Action Regarding a Patent or Trademark filed Nov. 15, 2018 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Restriction Requirement dated Dec. 27, 2021 in U.S. Appl. No. 16/747,737.
Restriction Requirement dated Jun. 19, 2019 in U.S. Appl. No. 15/596,364.
Restriction Requirement dated Jun. 4, 2021 in U.S. Appl. No. 16/551,620.
Restriction Requirement dated Mar. 15, 2016 in U.S. Appl. No. 14/381,488.
Restriction Requirement dated Mar. 17, 2016 in U.S. Appl. No. 14/472,363.
Restriction Requirement dated Mar. 29, 2019 in U.S. Appl. No. 15/715,028.
Restriction Requirement dated May 28, 2021 in U.S. Appl. No. 16/781,814.
Restriction Requirement dated May 5, 2021 in U.S. Appl. No. 16/400,886.
Restriction Requirement dated Sep. 20, 2019 in U.S. Appl. No. 15/875,816.
Restriction Requirement dated Sep. 20, 2021 in U.S. Appl. No. 16/525,054.
Rhee et al., "Simultaneous detection of mRNA and protein stem cell markers in live cells," BMC Biotechnology 2009, 9(30), 1-10.
Roche Diagnostics GmbH, "Genome Sequencer 20 System: First to the Finish," 2006, 1-40.
Rule 7.1 Disclosure Statement dated Nov. 15, 2018 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 1 pp.
S.H.KO, "An ‘equalized cDNA library’ by the reassociation of short double-stranded cDNAs," Nucleic Acids Res. 1990, 18(19), 5705-5711.
Sah et al., "Complete Genome Sequence of a 2019 Novel Coronavirus (SARS-CoV-2) Strain Isolated in Nepal," Microbiol Resour Announc. 2020, 9(11), e00169-20, 3 pp.
Sano et al., "Immuno-PCR: Very Sensitive Antigen Detection by Means of Specific Antibody—DNA Conjugates," Science 1992, 258, 120-122.
Sasagawa et al., "Quartz-Seq: a highly reproducible and sensitive single-cell RNA sequencing method, reveals non-genetic gene-expression heterogeneity," Genome Biology 2013, 14, R31.
Sasuga et al., Single-cell chemical lysis method for analyses of intracellular molecules using an array of picoliter-scale microwells, Anal Chem 2008, 80(23), 9141-9149.
Satija et al., Spatial reconstruction of single-cell gene expression data, Nature Biotechnology 2015, 33(5), 495-508.
Scheduling Order pursuant to Local Rule 16.1(b), filed May 7, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 10 pp.
Scheduling Order Signed by Judge Andrews, dated May 8, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 10 pp.
Schmitt et al., "Detection of ultra-rare mutations by next-generation sequencing," Proc Natl Acad Sci 2012, 109(36), 1-6.
Schouten et al., "Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification," Nucleic Acids Research 2002, 30(12), e57.
Search and Examination Report dated Aug. 26, 2015 in United Kingdom Patent Application No. 1511591.8.
Search Report and Written Opinion dated Aug. 26, 2020 in Singapore Patent Application No. 10201806890V.
Search Report and Written Opinion dated Jan. 26, 2016 in Singapore patent application No. 1120140527W.
Sebat et al., "Large-Scale Number Polymorphism in the Human Genome," Science 2004, 305, 525-528.
Shahi et al., "Abseq: ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding," Scientific Reports 2017, 7(44447), 1-10.
Shalek et al., "Single-cell transcriptomics reveals bimodality in expression and splicing in immune cells," Nature 2013, 498(7453), 236-240.
Shapiro et al., "Single-cell sequencing-based technologies will revolutionize whole-organism science," Nature Reviews Genetics 2013, 14, 618-629.
Shendure et al., "Next-generation DNA sequencing," Nature Biotechnology 2008, 26(10), 1135-1145.
Shiroguchi et al., "Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes," Proc Natl Acad Sci 2012, 109(4):1347-1352.
Shoemaker et al., "Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy," Nature Genetics 1996, 14, 450-456.
Shortreed et al., "A thermodynamic approach to designing structure-free combinatorial DNA word sets," Nucleic Acids Res. 2005, 33(15), 4965-4977.
Shum et al., "Quantitation of mRNA Transcripts and Proteins Using the BD Rhapsody™ Single-Cell Analysis System," Adv Exp Med Biol. 2019, 1129, 63-79.
Simpson et al., "Number variant detection in inbred strains from short read sequence data," Bioinformatics 2010, 26(4), 565-567.
Smith et al., "Highly-multiplexed barcode sequencing: an efficient method for parallel analysis of pooled samples," Nucleic Acids Research 2010, 38(13), e142, 1-7.
Soares et al., "Construction and characterization of a normalized cDNA library," Proc. Natl., Acad. Sci. 1994, 91, 9228-9232.
Sogin et al., "Microbial diversity in the deep sea and the underexplored "rare biosphere"," PNAS 2008, 103(32), 12115-12120.
Sommer et al., "Minimal homology requirements for PCR primers," Nucleic Acids Research 1989, 17(16), 6749.
Song et al., "Design rules for size-based cell sorting and sheathless cell focusing by hydrophoresis," Journal of Chromatography A 2013, 1302, 191-196.
Song et al., DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells, Cold Spring Harb Protoc 2010, 2, in 13 pages.
Sos et al., "Characterization of chromatin accessibility with a transposome hypersensitive sites sequencing (THS-seq) assay," Genome Biology 2016, 17(20), in 15 pages.
Soumillon et al., "Characterization of directed differentiation by high-throughput single-cell RNA-Seq," bioRxiv 2014, 1-13.
Speicher et al., "The new cytogenetics: blurring the boundaries with molecular biology," Nature Reviews Genetics 2005, 6(10), 782-792.
Statement of Opposition dated Jul. 21, 2016 by Vossius & Partner filed against European Patent No. EP2414548B1.
Statement of Opposition filed against European Patent No. EP2414548B1 dated Jul. 26, 2016.
Statement of Opposition of Strawman Limited filed against European Patent No. EP2414548B1 dated Jul. 19, 2016.
Statement regarding Third-Party Submission filed on Jun. 6, 2018 for U.S. Appl. No. 15/847,752.
Stipulated Protective Order Pursuant to Rule 26(c) of the Federal Rules of Civil Procedure, dated Jun. 21, 2019 in the USDC for the District of Delaware, C.A. 18-1800 (RGA), 26 pp.
Stipulation and Order to Extend Time to File Opposition to Motion to Dismiss, and Reply in Support of the Motion, dated Jan. 28, 2019 in the USDC for the District of Delaware, C.A. 18-1800-RGA, 2 pp.
Stoeckius et al., "Cell Hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics," Genome Biology 2018, 19(224), 1-12.
Stoeckius et al., "Large-scale simultaneous measurement of epitopes and transcriptomes in single cells," Nature Methods 2017, 14(9), 865-868.
Stratagene 1988 Catalog, Gene Characterization Kits, 39.
Subkhankulova et al., "Comparative evaluation of linear and exponential amplification techniques for expression profiling at the single cell level," Genome Biology 2006, 7(3), 1-16.
Submission dated Jan. 15, 2018 in preparation for upcoming oral proceedings in opposition against European Patent No. EP2414548B1.
Summons in a Civil Action to Defendant 10X Genomics, Inc. filed Nov. 16, 2018 in the USDC for the District of Delaware, Civil Action No. 18-1800, 2 pp.
Summons to Attend Oral Proceedings dated Nov. 16, 2020 in European Patent Application No. 17202409.3.
Sun et al., "Ultra-deep profiling of alternatively spliced Drosophila Dscam isoforms by circularization-assisted multi-segment sequencing," EMBO J. 2013, 32(14), 2029-2038.
Takahashi et al., "Novel technique of quantitative nested real-time PCR assay for mycobacterium tuberculosis DNA," Journal of Clinical Microbiology 2006, 44, 1029-1039.
Takara Bio, "SMARTer Human BCR IgG IgM H/K/L Profiling Kit User Manual," Takara Bio USA Inc. 2019, 1-22.
Tan et al., "Genome-wide comparison of DNA hydroxymethylation in mouse embryonic stem cells and neural progenitor cells by a new comparative hMeDIP-seq method," Nucleic Acids Res. 2013, 41(7), e84, 1-12.
Tang et al., "RNA-Seq analysis to capture the transcriptome landscape of a single cell," Nature Protocols 2010, 5(3), 516-535.
Taudien et al., "Haplotyping and number estimation of the highly polymorphic human beta-defensin locus on 8p23 by 454 amplicon sequencing," BMC Genomics 2010, 11, 252, 1-14.
The Tibbs Times, UNC bioscience newsletter, Apr. 2010, 1-17.
Third-Party Submission filed on May 21, 2018 for U.S. Appl. No. 15/847,752.
Tomaz et al., "Differential methylation as a cause of allele dropout at the imprinted GNAS locus," Genet Test Mol Biomarkers 2010, 14(4), 455-460.
TotalSeq™-A0251 anti-human Hashtag 1 Antibody, BioLegend®, Jul. 2018, 1-10.
Treutlein et al., Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq, Nature 2014, 509, 371-375.
Trzupek et al., "Discovery of CD8O and CD86 as recent activation markers on regulatory T cells by protein-RNA single-cell analysis", Genome Medicine 2020, 12(1), in 22 pages.
Ullal et al., "Cancer cell profiling by barcoding allows multiplexed protein analysis in fine needle aspirates," Sci Transl Med. 2014, 6(219), 22 pp.
Unopposed Motion to Extend Time for Defendant's Response, dated Dec. 4, 2018 in the USDC for the District of Delaware, C.A. 18-1800-(RGA), 2 pp.
Vandesompele et al., "Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes," Genome Biology 2002, 3(7), 1-12.
Velculescu et al., "Characterization of the Yeast Transcriptome," Cell 1997, 88, 243-251.
Velculescu et al., "Serial Analysis of Gene Expression," Science 1995, 270(5235), 484-487.
Vestheim et al., "Application of Blocking Oligonucleotides to Improve Signal-to-Noise Ratio in a PCR," Methods in Molecular Biology 2011, 687, 265-274.
Vogelstein et al., "Digital PCR," Proc. Natl. Acad. Sci. 1999, 96, 9236-9241.
Vollbrecht et al., "Validation and comparison of two NGS assays for the detection of EGFR T790M resistance mutation in liquid biopsies of NSCLC patients," Oncotarget 2018, 9(26), 18529-18539.
Walker et al., "Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system," Proc Natl Acad Sci 1992, 89, 392-396.
Walsh et al., "Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing," Proc Natl Acad Sci 2010, 107(28), 12629-12633.
Wang et al., "Advances and applications of single-cell sequencing technologies," Molecular Cell 2015, 58, 598-609.
Wang et al., "Combining Gold Nanoparticles with Real-Time Immuno-PCR for Analysis of HIV p24 Antigens," Proceedings of ICBBE 2007, 1198-1201.
Wang et al., "iCLIP predicts the dual splicing effects of TIA-RNA interactions," PLoS Biol 2010, 8(10), e1000530, 1-16.
Wang et al., "RNA-Seq: a revolutionary tool for transcriptomics," Nature Reviews Genetics 2009, 10(1), 57-63.
Wang et al., "Tagmentation-based whole-genome bisulfite sequencing," Nature Protocols 2013, 8(10), 2022-2032.
Warren et al., "Transcription factor profiling in individual hematopoietic progenitors by digital RT-PCR," PNAS 2006, 103(47), 17807-17812.
Weber et al., "A real-time polymerase chain reaction assay for quantification of allele ratios and correction of amplification bias," Anal Biochem. 2003, 320, 252-258.
Weibrecht et al., "Proximity ligation assays: a recent addition to the proteomics toolbox," Expert Rev. Proteomics 2010, 7(3), 401-409.
Weiner et al., "Kits and their unique role in molecular biology: a brief retrospective," BioTechniques 2008, 44(5), 701-704.
White et al., "High-throughput microfluidic single-cell RT-qPCR," PNAS 2011, 108(34), 13999-14004.
Wittes et al., "Searching for Evidence of Altered Gene Expression: a Comment on Statistical Analysis of Microarray Data," Journal of the National Cancer Institute 1999, 91 (5), 400-401.
Wodicka et al., "Genome-wide expression monitoring in Saccharomyces cerevisiae," Nature Biotechnology 1997, 15, 1359-1367.
Wojdacz et al., "Primer design versus PCR bias in methylation independent PCR amplifications," Epigenetics 2009, 4(4), 231-234.
Wood et al., "Using next-generation sequencing for high resolution multiplex analysis of number variation from nanogram quantities of DNA from formalin-fixed paraffin-embedded specimens," Nucleic Acids Res. 2010, 38(14), 1-14.
Written Submission of Publications dated Jun. 14, 2018 in Japanese Patent Application No. 2016-537867.
Wu et al., "Quantitative assessment of single-cell RNA-sequencing methods," Nat Methods 2014, 11(1), 41-46.
Yandell et al., "A probabilistic disease-gene finder for personal genomes," Genome Res. 2011, 21 (9), 1529-1542.
Yang & Zhao, "Quantitative Analysis of Nonoxynol-9 in Blood," Contraception 1991, 43(2), 161-166.
Ye et al., Fluorescent microsphere-based readout technology for multiplexed human single nucleotide polymorphism analysis and bacterial identification, Human Mutation 2001, 17(4), 305-316.
Yoon et al., Sensitive and accurate detection of number variants using read depth of coverage, Genome Res. 2009, 19, 1586-1592.
Zagordi et al., "Error correction of next-generation sequencing data and reliable estimation of HIV quasispecies," Nucleic Acids Research 2010, 38(21), 7400-7409.
Zeberg et al., "The major genetic risk factor for severe COVID-19 is inherited from Neanderthals," Nature 2020, 587(7835), 1-13.
Zhang et al., "DNA-based hybridization chain reaction for amplified bioelectronic signal and ultrasensitive detection of proteins," Anal Chem. 2012, 84, 5392-5399.
Zhang et al., "Immunoaffinity Purification of Plasma Membrane with Secondary Antibody Superparamagnetic Beads," Journal of Proteome 2006, 6, 34-43.
Zhang et al., "The impact of next-generation sequencing on genomics," J Genet Genomics 2011, 38(3), 95-109.
Zhao et al., "Homozygous Deletions and Chromosome Amplifications in Human Lung Carcinomas Revealed by Single Nucleotide Polymorphism Array Analysis," Cancer Research 2005, 65(13), 5561-5570.
Zhao et al., "Methylated DNA Immunoprecipitation and High-Throughput Sequencing (MeDIP-seq) Using Low Amounts of Genomic DNA," Cellular Reprogramming 2014, 16(3), in 20 pages.
Zheng et al., "Haplotyping germline and cancer genomes with high-throughput linked-read sequencing," Nature Biotechnology 2016, 34(3), 303-311.
Zhou et al., "Counting alleles reveals a connection between chromosome 18q loss and vascular invasion," Nature Biotechnology 2001, 19, 78-81.
Zhou et al., "Photocleavable Peptide-Oligonucleotide Conjugates for Protein Kinase Assays by MALDI-TOF MS," Mol. BioSyst. 2012, 8, 2395-2404.
Zhu et al., "Reverse Transcriptase Template Switching: A SMART Approach for Full-Length cDNA Library Construction," BioTechniques 2001, 30(4), 892-897.

Also Published As

Publication number Publication date
US20170342465A1 (en) 2017-11-30
US20190119726A1 (en) 2019-04-25
US20230193372A1 (en) 2023-06-22
US20250277261A1 (en) 2025-09-04
US10202641B2 (en) 2019-02-12
US12331351B2 (en) 2025-06-17

Similar Documents

Publication Publication Date Title
US12331351B2 (en) Error correction in amplification of samples
US20220348904A1 (en) Molecular barcoding on opposite transcript ends
US12421548B2 (en) High throughput multiomics sample analysis
US12391940B2 (en) Single cell assay for transposase-accessible chromatin
US20230109336A1 (en) Selective extension in single cell whole transcriptome analysis
US20220333185A1 (en) Methods and compositions for whole transcriptome amplification
US20220010362A1 (en) cDNA SPIKE-IN CONTROL FOR SINGLE CELL ANALYSIS
US20200040379A1 (en) Nuclei barcoding and capture in single cells
US10722880B2 (en) Hydrophilic coating of fluidic channels
EP4628595A2 (en) Methods for cell label classification
US11946095B2 (en) Particles associated with oligonucleotides
US20200157600A1 (en) Methods and compositions for whole transcriptome amplification

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

AS Assignment

Owner name: CELLULAR RESEARCH, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SHUM, ELEEN;REEL/FRAME:053643/0411

Effective date: 20170616

AS Assignment

Owner name: CELLULAR RESEARCH, INC., CALIFORNIA

Free format text: MERGER;ASSIGNOR:TUCSON ACQUISITION CORP.;REEL/FRAME:054037/0614

Effective date: 20150825

Owner name: BECTON, DICKINSON AND COMPANY, NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CELLULAR RESEARCH, INC.;REEL/FRAME:054111/0091

Effective date: 20201005

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE