US11248261B2 - RhD gene allele associated with a weak D phenotype and its uses - Google Patents

RhD gene allele associated with a weak D phenotype and its uses Download PDF

Info

Publication number
US11248261B2
US11248261B2 US16/491,645 US201816491645A US11248261B2 US 11248261 B2 US11248261 B2 US 11248261B2 US 201816491645 A US201816491645 A US 201816491645A US 11248261 B2 US11248261 B2 US 11248261B2
Authority
US
United States
Prior art keywords
rhd
exon
seq
duplication
amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US16/491,645
Other versions
US20200291451A1 (en
Inventor
Yann Fichou
Swati KULKARNI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Etablissement Francais du Sang
Univerdite de Bretagne Occidentale
ICMR National Institute of Immunohaematology
Original Assignee
Etablissement Francais du Sang
Univerdite de Bretagne Occidentale
Institut National de la Sante et de la Recherche Medicale INSERM
ICMR National Institute of Immunohaematology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Etablissement Francais du Sang, Univerdite de Bretagne Occidentale, Institut National de la Sante et de la Recherche Medicale INSERM, ICMR National Institute of Immunohaematology filed Critical Etablissement Francais du Sang
Assigned to ETABLISSEMENT FRANCAIS DU SANG, UNIVERSITE DE BRETAGNE OCCIDENTALE (UBO), INSERM (Institut National de la Santé et de la Recherche Médicale), NATIONAL INSTITUTE OF IMMUNOHAEMATOLOGY reassignment ETABLISSEMENT FRANCAIS DU SANG ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FICHOU, Yann, KULKARNI, SWATI
Publication of US20200291451A1 publication Critical patent/US20200291451A1/en
Application granted granted Critical
Publication of US11248261B2 publication Critical patent/US11248261B2/en
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • the present invention relates to a novel allele of Rh D antigen contributing to the weak D phenotype, to methods and kits for detecting this Rh D antigen.
  • Rh system is the most complex and polymorphic system. It involves two paralogous genes, RHD and RHCE, each encoding a transmembrane protein (RhD and RhCE, respectively) expressed at the surface of erythroid cell lineage. These proteins express 54 antigens (www.isbtweb.org).
  • Antigen D carried by RhD, is the most immunogenic antigen and may induce alloimmunization (i.e. production of antibodies directed against an antigen) when introduced in a D-negative (D ⁇ ) individual with two major, potential risks:
  • Rh status is thus of major interest in Public Health. In routine it is determined by serological analyses with different panels of antibodies. Although these tests are relevant most of the time, ambiguity and/or discrepancy with different panels of antibodies may be observed in some circumstances. Then it is necessary to use molecular analysis to identify genetic variations and predict Rh status.
  • the present invention concerns a duplication of exon 3 of the RHD gene which is indicative of a weak D phenotype in a subject, in particular a subject from the Indian population. Then, the present invention relates to a method of genotyping, especially RHD genotyping, based on the determination of the presence of a duplication of exon 3 of the RHD gene, said duplication being indicative of a weak D phenotype.
  • the present invention relates to a method for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample comprising contacting a probe or a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and detecting a hybridization of the probe or an amplification product of the set of primers, the detection of said hybridization or said amplification product being respectively indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample, wherein a probe specific to the duplication of exon 3 of the RHD gene specifically hybridizes a portion of the RHD gene specific to the duplication of exon 3 comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof and; a set of primers specific to the duplication of exon 3 of the RHD gene produces an amplification product only
  • the present invention also relates to a method for determining RHD genotype or for detecting a weak D phenotype, comprising detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample according to the present invention, wherein the presence of a duplication of exon 3 of the RHD gene in the DNA sample is indicative of a weak D phenotype.
  • the probe or the amplification product has a sequence comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31 or the complementary sequence thereof, the probe or amplification product having at least 20 nucleotides in length.
  • the method comprises
  • the step b) is a multiplex amplification such as multiplex PCR or multiplex LPA (Ligation-dependent Probe Amplification).
  • the primer-dependent DNA amplification reaction is a PCR reaction, preferably multiplex PCR.
  • the method further comprises the detection of the presence of one or several exons of the RHD gene, in particular exon 5 and/or exon 10 of the RHD gene.
  • the present invention further relates to a kit for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype, wherein the kit comprises a probe or a set of primers specific to the duplication of exon 3 of the RHD gene in a DNA sample, wherein a probe specific to the duplication of exon 3 of the RHD gene specifically hybridizes a portion of the RHD gene specific to the duplication of exon 3 comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof and; a set of primers specific to the duplication of exon 3 of the RHD gene produces an amplification product only when a duplication of exon 3 is present.
  • the specific set of primers comprises a forward primer in partial intron 3 located upstream of the breakpoint, especially of SEQ ID NO: 30, and a reverse primer in the Exon2/intron2 region of the duplicated region located downstream of the breakpoint, especially positions 1-5891 of SEQ ID NO: 34.
  • the specific set of primers comprises
  • the set of primers may include:
  • the set of primers may include:
  • the kit may further comprise one or several elements selected in the group consisting of:
  • the kit comprises the following primers:
  • the present invention relates to the use of a kit according to the present invention for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype.
  • the present invention relates to an isolated or recombinant nucleic acid comprising or consisting of a sequence SEQ ID NO: 35.
  • FIG. 1 RHD exon 3 is duplicated in some Indian weak D individuals.
  • Typical RHD QMPSF profiles obtained with (A) a hemizygous, wild-type RHD calibrator (Rh C/c, E/e phenotype: Ccee); (B) a hemizygous (exon 3 duplication) sample (Ccee); and (C) a homozygous (exon 3 duplication) sample (CCee).
  • Arrowheads indicate copy number variation (CNV) of exon 3 in the samples; e1 to e10: RHD exons 1 to 10.
  • FIG. 2 The novel variant RHD allele including duplication of exon 3 impairs cellular splicing.
  • A RT-PCR products were generated by targeting RHD exons 2 to 4 (RHD(2-4)), RHD exons 6 to 8 (RHD(6-8)), and ACTB. Products were loaded on a 2% agarose gel.
  • B RT-PCR products from RHD(2-4) amplification were extracted from the gel, subcloned into a commercial vector and sequenced.
  • FIG. 3 Customized QMPSF identified a >10-kb duplicated region in weak D individuals.
  • a novel QMPSF assay was designed by positioning additional markers (*) in introns 2 (i2a, and i2b) and 3 (i3a, i3b, and i3c).
  • B Typical QMPSF profiles obtained with a hemizygous, wild-type RHD calibrator (Rh C/c, E/e phenotype: Ccee) (top panel); and a hemizygous (exon 3 duplication) sample (Ccee).
  • Calibrator hemizygous, wild-type RHD control sample; sample: weak D, hemizygous exon 3 duplication sample. Arrowheads indicate copy number variation of markers; e2, e4, e7: RHD exons 2, 4 and 7, respectively.
  • FIG. 4 The novel, Indian weak D allele involves duplication of a ⁇ 12-kb fragment inserted within RHD intron 3.
  • A Schematic representation of primer positions for PCR amplifications to characterize the duplicated region.
  • B Three PCR primer sets (supplemental Table SI) were used to amplify specific markers: (1) PCR amplification with RHD_e2 (forward)/RHD_i2a (reverse) primers is specific to C-positive samples and is ⁇ 1 kb in length in all positive lanes (top gel); (2) PCR amplification with RHD_i3b (forward)/RHD_i3c (reverse) primers is specific to D-positive samples, including exon 3 duplication samples and is ⁇ 3 kb in length in all positive lanes; and (3) PCR amplification with RHD_i3b (forward)/RHD_i2a (reverse) primers is only specific to exon 3 duplication samples and is ⁇ 2 kb in length in all positive lanes.
  • NTC no template control
  • D ⁇ (cc) homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee);
  • D ⁇ (Cc) homozygous whole RHD gene deletion control sample (Ccee);
  • D+ (WT) hemizygous wild-type RHD control sample (Ccee);
  • bp base pairs;
  • RHD-004, RHD-009, and RHD-030 exon 3 duplication samples (Ccee).
  • e2, e3, and e4 RHD exons 2, 3, and 4, respectively;
  • kb kilobases.
  • FIG. 5 The novel, Indian weak D allele involves duplication of a ⁇ 12-kb fragment inserted within RHD intron 3.
  • A A unique, 407-bp PCR product corresponding to a specific breakpoint was identified and sequenced in exon 3 duplication samples (RHD-004, RHD-009, and RHD-030).
  • B Schematic representations of the genomic RHD locus ranging from exon 2 to exon 4 (top panel) and the ⁇ 12-kb duplicated region (in red), as characterized by QMPSF and sequencing (bottom panel).
  • NTC no template control
  • D ⁇ (cc) homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee);
  • D ⁇ (Cc) homozygous whole RHD gene deletion control sample (Ccee);
  • D+(WT) hemizygous wild-type RHD control sample (Ccee);
  • bp base pairs.
  • Exon 2 sequence is underlined; arrows: RHD_i3ex3dup_F/RHD_i2ex3dup_R PCR primers; *: QMPSF markers.
  • FIG. 6 Indian-specific, multiplex PCR RHD genotyping assay for routine analysis. Typical 1.5% agarose gel profile obtained by multiplex PCR amplification.
  • NTC no template control
  • D ⁇ (cc) homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee);
  • D ⁇ (Cc) homozygous whole RHD gene deletion control sample (Ccee);
  • D+(WT) hemizygous wild-type RHD control sample (Ccee);
  • RHD-004, RHD-009, and RHD-030 exon 3 duplication samples;
  • RHD-048, RHD-049 and RHD-221 other “partial” D alleles.
  • cc and Cc phenotype RhCc.
  • GAPDH 97 base pairs (bp); RHD exon 10: 344 bp; RHD exon 3 dup: 407 bp; RHD exon 5: 605 bp.
  • this novel RHD allele is the main cause of weak D phenotype in the Indian population.
  • the RHD gene encodes the Rh D antigen. This gene is referenced in the following public databases: UniProt #Q02161, GeneCards #RHD, Gene ID #6007, and HGNC #10009. “RHD” refers to Rhesus D or Rhesus D antigen.
  • a Weak D phenotype is a group of RhD + phenotypes with a reduced expression of Rh D antigen on the red blood cells' surface.
  • Breakpoint refers to the junction between the partial intron 3 in 5′ with the partial exon 2 in 3′ when a duplication of exon 3 in the RHD gene is present.
  • the position of Breakpoint could defined as:
  • partial intron 3 is intended to refer to the part of intron 3 located before the Breakpoint.
  • a sequence of partial intron 3 is shown in SEQ ID NO: 30.
  • Exon2/intron2 region of the duplicated region is intended to refer to the part of exon 2 and the intron 2 which is duplicated.
  • a sequence of Exon2/intron2 region of the duplicated region is shown in SEQ ID NO: 34 in positions 1-5891.
  • duplicated region is intended to refer to the part of exon 2, intron 2, exon 3 and intron 3 which is duplicated.
  • a sequence of the duplicated region is shown in SEQ ID NO: 34.
  • gene refers to a description of the alleles of a gene or a plurality of genes contained in an individual or in a sample from said individual.
  • DNA sample refers to a sample containing human genomic DNA obtained from a subject.
  • the term “subject” refers to a human, including adult, in particular a woman, a child and a human at the prenatal stage in particular a foetus.
  • the subject has been classified as Rhesus D ⁇ by a classical assay for determining the Rhesus D status, e.g., assays using antibodies directed against Rhesus D antigen, in particular by agglutination reaction.
  • the term “primer” refers to a synthetically or biologically produced single-stranded oligonucleotide that is extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule.
  • Nucleic acid amplification often is based on nucleic acid synthesis by a nucleic acid polymerase or reverse transcriptase. Many such polymerases or reverse transcriptases require the presence of a primer that may be extended to initiate such nucleic acid synthesis.
  • a primer is typically 11 bases or longer; most preferably, a primer is 17 bases or longer, although shorter or longer primers may be used depending on the need.
  • the oligonucleotides disclosed herein may be used as one or more primers in various extension, synthesis, or amplification reactions.
  • a PCR reaction employs a pair of amplification primers including an “upstream” or “forward” primer and a “downstream” or “reverse” primer, which delimit a region of the RNA or DNA to be amplified.
  • complementarity and “complementary” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another.
  • Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions.
  • Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G).
  • 100 percent complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region.
  • probe refers to synthetic or biologically produced nucleic acids (DNA or RNA) which, by design or selection, contain specific nucleotide sequences that allow them to hybridize, under defined stringencies, specifically (i.e., preferentially) to target nucleic acid sequences.
  • labeled probe or “labeled primer” refers to a nucleic acid, especially single-stranded nucleic acid, conjugated to a compound that produces a detectable signal.
  • Suitable labels include, but are not limited to, radioactive molecule, fluorescent molecule, mass label, antibody, antibody fragment, hapten, carbohydrate, biotin, derivative of biotin, phosphorescent moiety, luminescent moiety, electrochemiluminescent moiety, chromatic moiety, and moiety having a detectable electron spin resonance, electrical capacitance, dielectric constant and electrical conductivity.
  • the terms “amplification”, “nucleic acid amplification”, or “amplifying” refer to the production of multiple copies of a nucleic acid template, or the production of multiple nucleic acid sequence copies that are complementary to the nucleic acid template.
  • the terms may also refer to extending a nucleic acid template (e.g., by polymerization).
  • the amplification reaction may be a polymerase-mediated extension reaction such as, for example, a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • any of the known amplification reactions may be suitable for use as described herein.
  • amplification reactions contemplated include both polymerase-mediated amplification reactions (such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)), as well as ligase-mediated amplification reactions (such as ligase detection reaction (LDR), ligase chain reaction (LCR), and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR.
  • polymerase-mediated amplification reactions such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)
  • ligase-mediated amplification reactions such as ligase detection reaction (LDR), ligase chain reaction (LCR), and gap-versions of each
  • LDR ligase detection reaction
  • LCR ligase chain reaction
  • LCR ligase chain reaction
  • amplification reaction mixture and/or “master mix” may refer to an aqueous solution comprising the various (some or all) reagents used to amplify a target nucleic acid. Such reactions may also be performed using solid supports (e.g., an array). The reactions may also be performed in single or multiplex format as desired by the user. These reactions typically include enzymes, aqueous buffers, salts, amplification primers, target nucleic acid, and nucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture.
  • the method used to amplify the target nucleic acid may be any available to one of skill in the art.
  • any in vitro means for multiplying the copies of a target sequence of nucleic acid may be utilized. These include linear, logarithmic, and/or any other amplification method. While this disclosure may generally discuss PCR as the nucleic acid amplification reaction, other types of nucleic acid amplification reactions are also contemplated, including both polymerase-mediated amplification reactions (such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)), as well as ligase-mediated amplification reactions (such as ligase detection reaction (LDR), ligase chain reaction (LCR), and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR.
  • polymerase-mediated amplification reactions such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)
  • PCR polymerase chain reaction
  • DNA polymerase refers to an enzyme that is essential for elongation of amplification primers in nucleic acid templates.
  • the skilled person may easily choose a convenient polymerase enzyme based on its characteristics such as efficiency, processivity or fidelity.
  • the polymerase is a high-fidelity and heat-stable polymerase.
  • amplicon or “amplification product” as used herein refers to a fragment of DNA spanned within a pair of amplification primers, this fragment being amplified exponentially by a DNA polymerase.
  • An amplicon can be single-stranded or double-stranded.
  • sequence identity refers to the number (%) of matches (identical amino acid residues) in positions from an alignment of two polypeptide sequences.
  • sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps.
  • sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g.
  • a sequence at least x % identical to a reference sequence it is intended that the sequence is identical to the reference sequence or differs from the reference sequence by up to 100 ⁇ x nucleotide alterations per each 100 nucleotides of the reference sequence.
  • low stringency refers to conditions of hybridization.
  • Suitable experimental conditions for determining hybridization between a nucleotide probe and a homologous DNA or RNA sequence involves presoaking of the filter containing the DNA fragments or RNA to hybridize in 5 ⁇ SSC (Sodium chloride/Sodium citrate for 10 min, and prehybridization of the filter in a solution of 5 ⁇ SSC, 5 ⁇ Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml of denatured sonicated salmon sperm DNA, followed by hybridization in the same solution containing a concentration of 10 ng/ml of a random-primed 32 P-dCTP-labeled (specific activity >1 ⁇ 10 9 cpm/ ⁇ g) probe for 12 hours at ca.
  • 5 ⁇ SSC Sodium chloride/Sodium citrate for 10 min
  • the filter is then washed twice for 30 minutes in 2 ⁇ SSC, 0.5% SDS and at least 55° C. (low stringency), more preferably at least 60° C. (medium stringency), still more preferably at least 65° C. (medium/high stringency), even more preferably at least 70° C. (high stringency), and even more preferably at least 75° C. (very high stringency).
  • the methods of the invention are in vitro methods.
  • the present invention relates to a method for testing the presence of a duplication of exon 3 in the RHD gene. Accordingly, the present invention relates to a method for detecting a weak D phenotype and the method comprises testing the presence of a duplication of exon 3 in the RHD gene. More generally, the present invention relates to a method for RHD genotyping, the method comprises testing the presence of a duplication of exon 3 in the RHD gene. Indeed, as discussed before, a duplication of exon 3 in the RHD gene is indicative of a weak D phenotype and a weak D phenotype is generally classified as a Rhesus D + status.
  • the present invention further relates to a kit comprising means for detecting the presence of a duplication of exon 3 in the RHD gene and the use of the kit for testing the presence of a duplication of exon 3 in the RHD gene, for detecting a weak D phenotype or for RHD genotyping.
  • the presence of a duplication of exon 3 in the RHD gene can be detected by any suitable means available to the person skilled in the art.
  • the suitable means can be a probe specific to the duplication of exon 3 in the RHD gene, a set of primers specific to the duplication of exon 3 in the RHD gene or a combination thereof.
  • the method may comprise contacting a probe or a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and detecting a hybridization of the probe or an amplification product of the set of primers, the detection of said hybridization or said amplification product being respectively indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample.
  • the DNA sample is prepared from a biological sample, preferably a sample comprising erythroid tissue.
  • the biological sample can be whole blood, plasma, serum, urine, cervical mucus, amniotic fluid or sample, or chorionic villus sample.
  • the sample is from human origin.
  • the biological sample is whole blood, plasma, or serum.
  • the sample can be a maternal sample or a foetal sample.
  • the sample may also provide from a sample of a blood bank, in particular from a sample from blood unit.
  • the sample is from an individual with is Indian (Indian population) or has an individual of Indian descent.
  • an individual of Indian descent refers to people who have a have ancestors from the geographic region India and surrounding areas including, but not limited to, India, Pakistan, Nepal and Bangladesh.
  • at least one ancestor is from India or surrounding areas.
  • Indian population may further include India, Pakistan, Nepal and Bangladesh.
  • the sample comes from an individual, a blood bank sample or immunohematology laboratories which has been shown weaker or discrepant results by a classical assay for determining the Rhesus D status, e.g., assays using antibodies directed against Rhesus D antigen, in particular by agglutination reaction with a panel of monoclonal anti-D reagents.
  • the present invention relates to a method comprising a) contacting a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and an amplification reaction mixture in conditions suitable for amplification; and b) detecting an amplification product of the set of primers, the detection of said amplification product respectively being indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample.
  • step a) is an amplification step.
  • a set of primers is a pair of primers.
  • the set or pair of primers is specific to portion of the RHD gene that flanks the breakpoint, in particular suitable for producing an amplification product only when a duplication of exon 3 is present.
  • the specific set of primers comprises a forward primer in the RHD gene upstream of the breakpoint, and a reverse primer in the RHD gene downstream of the breakpoint. More specifically, the specific set of primers comprises a forward primer in the intron 3 upstream of the breakpoint, and a reverse primer in intron 2 downstream of the breakpoint.
  • a sequence of the intron 3 upstream of the breakpoint is described in SEQ ID NO: 30 and a sequence of the exon 2 and intron 2 downstream of the breakpoint is described in SEQ ID NO: 34, especially positions 1-5891 of SEQ ID NO: 34.
  • the set or pair of primers is designed so as the amplification product has a sequence comprising at least 5, 6, 7, 8, 9, 10, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% identity with SEQ ID NO: 31 or a complementary sequence thereof.
  • the set or pair of primers is designed such as the amplification product has an appropriate length, in particular appropriate to the method used for detecting the presence of the amplification product.
  • the size of the amplification product can be from 20 bp in length to one or several kbp, preferably from 50 bp to 1000 bp, more preferably from 100 bp to 600 bp.
  • the set of primers comprises a primer (e.g., a forward primer) specific to a portion of the partial intron 3 located within 1000 bp upstream of the breakpoint, preferably within 500 bp upstream of the breakpoint, and more preferably within 200 bp upstream of the breakpoint; and a primer (e.g., a reverse primer) specific to a portion of the Exon2/intron2 region of the duplicated region located within 1000 bp downstream of the breakpoint, preferably with 500 bp downstream of the breakpoint, and more preferably within 200 bp downstream of the breakpoint.
  • a primer e.g., a forward primer
  • a primer e.g., a reverse primer
  • the primer can, for example, be about 18 to about 30 nucleotides, or about 20 to about 50 nucleotides, in length.
  • the primer may be from 15, 16, 17, 18, 19 or 20 nucleotides to 22, 25, 28, 30, 35 or 50 nucleotides in length.
  • the set of primers includes:
  • the set of primers includes:
  • the set of primers includes:
  • the set of primers includes:
  • the set of primers includes:
  • the method may further comprise amplification of a control or reference gene, in particular in order to have a positive control for the amplification reaction.
  • the control or reference gene can be for instance GADPH, ACTB or RASSF1A.
  • step a) may further comprise contacting the DNA sample with a set of primers targeting the control or reference gene.
  • a pair of primers targeting the GAPDH gene is disclosed in SEQ ID NOs: 7 and 8 and a pair of primers targeting the ACTB gene is disclosed in SEQ ID NOs: 40 and 41.
  • the method may also further comprise the detection of one or several exons of RHD gene or the detection of one or several mutations or SNPs of interest of the RHD gene.
  • step a) may further comprise contacting the DNA sample with a set of primers targeting one or several exons of RHD gene or targeting one or several mutations or SNPs of interest of the RHD gene.
  • at least one of exon 4, exon 5, exon 7, or exon 10 is further detected by amplification.
  • at least two exons of the RHD gene are detected by amplification.
  • at least three exons of the RHD gene are detected by amplification.
  • exons 4 and 5; exons 4 and 7; exons 4 and 10; exons 5 and 7; exons 5 and 10; or exons 7 and 10 may be used.
  • detection of exons 4, 5, and 7; exons 4, 5, and 10; exons 5, 7, and 10, or exons 4, 7, and 10 may be used.
  • exons 4, 5, 7, and 10 are detected.
  • the person skilled in the art can easily design appropriate primers. For instance, such primers are disclosed in WO2010/009440 or WO2015/001056 (hereby incorporated herein by reference in their entirety).
  • the method further comprises the detection of exon 5 and/or exon 10 of the RHD gene, preferably of exon 5 and exon 10.
  • detection of the presence of exons 5 and 10 would be indicative of a Rhesus D+; detection of the presence of exon 10 but not exon 5 would be indicative of a Rhesus D+ but partial; and the absence of exons a Rhesus D ⁇ .
  • the present invention by detection of the presence of exon 3 duplication, could allow the identification of weak D phenotype.
  • step a) may further comprise contacting the DNA sample with a set of primers targeting the exon 5 and/or exon 10, preferably a set of primers targeting the exon 5 and a set of primers targeting the exon 10.
  • a pair of primers targeting exon 5 is disclosed in SEQ ID NOs: 1 and 2.
  • a pair of primers targeting exon 10 is disclosed in SEQ ID NOs: 5 and 6.
  • Other suitable pair of primers can be designed and used.
  • the amplification step is carried out by a PCR reaction, in particular in a multiplex PCR reaction.
  • amplification techniques comprise at least one cycle of amplification, for example, but not limited to, the steps of: denaturing a double-stranded nucleic acid to separate the component strands; hybridizing a primer to a target flanking sequence or a primer-binding site of an amplicon (or complements of either, as appropriate); and synthesizing a strand of nucleotides in a template-dependent manner using a DNA polymerase.
  • the cycle may or may not be repeated.
  • a cycle of amplification comprises a multiplicity of amplification cycles, for example, but not limited to 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or more than 45 cycles of amplification.
  • an amplification reaction comprises multiplex amplification, in which a multiplicity of different target nucleic acids and/or a multiplicity of different amplification product species are simultaneously amplified using a multiplicity of different primer sets.
  • the amplification steps of the control or reference gene and/or of one or several exons of the RHD gene are carried out concurrently with the amplification step of the duplication of exon 3 of the RHD gene, preferably by a multiplex amplification.
  • the amplification steps of the control or reference gene and/or of one or several exons of the RHD gene are carried out separately from the amplification step of the duplication of exon 3 of the RHD gene, preferably by a multiplex amplification, in particular in distinct reaction vessels.
  • the method may comprise a) contacting a first set of primers specific to the duplication of exon 3 of the RHD gene, a second set of primers specific to exon 5 of the RHD gene and a third set of primers specific to exon 10 of the RHD gene with the DNA sample and an amplification reaction mixture in conditions suitable for amplification; and b) detecting an amplification product of each set of primers.
  • the detection of the presence of amplification products by the first, second and third set of primers is indicative of the presence of a weak D phenotype; the detection of the presence of amplification products by the second and third sets of primers and the absence of an amplification product by the first set of primers is indicative of the presence of a Rhesus D+ phenotype; the detection of the amplification product by the third set of primers and the absence of amplification products by the first and second sets of primers is indicative of the presence of a Rhesus D ⁇ phenotype; and/or the absence of amplification products by the first, second and third sets of primers is indicative of the presence of a Rhesus D ⁇ phenotype.
  • Exemplary methods for polymerizing and/or amplifying nucleic acids include, for example, polymerase-mediated extension reactions.
  • the polymerase-mediated extension reaction can be the polymerase chain reaction (PCR).
  • the nucleic acid amplification reaction is a multiplex reaction.
  • exemplary methods for polymerizing and/or amplifying and detecting nucleic acids suitable for use as described herein are commercially available as TaqMan® (see, e.g., U.S. Pat. Nos.
  • the amplification reaction mixture comprises a heat-stable DNA polymerase and an appropriate buffer (typically provided with the DNA polymerase), a set of amplification primers and dNTPs.
  • the DNA polymerase is a high-fidelity DNA polymerase, i.e. with an error rate less than 10 ⁇ 5 , more preferably less than 10 ⁇ 6 .
  • DNA polymerases examples include, but are not limited to, Pyrococcus furiosus (Pfu) DNA polymerase (Stratagene), PhusionTM DNA Polymerase (New England Biolabs), Platinum® Taq DNA Polymerase High Fidelity (Life Technologies), PfuUltraTM (Stratagene), or MyFiTM DNA polymerase (Bioline).
  • Pfu Pyrococcus furiosus
  • PhusionTM DNA Polymerase New England Biolabs
  • Platinum® Taq DNA Polymerase High Fidelity Life Technologies
  • PfuUltraTM Stratagene
  • MyFiTM DNA polymerase Bioline
  • the amplification products can be detected by any suitable method well-known by the person skilled in the art.
  • the amplification products can be detected by an electrophoresis including gel electrophoresis and capillary electrophoresis, mass spectrometry, hybridization with a probe specific to the amplification products, including microarray hybridization or solid support hybridization, and sequencing.
  • the amplification products are detected by an electrophoresis including gel electrophoresis.
  • TaqMan® assays are typically carried out by performing nucleic acid amplification on a target polynucleotide using a nucleic acid polymerase having 5′-to-3′ nuclease activity, a primer capable of hybridizing to said target polynucleotide, and an oligonucleotide probe capable of hybridizing to said target polynucleotide 3′ relative to said primer.
  • the oligonucleotide probe typically includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of said reporter molecule.
  • the detectable label and quencher molecule are part of a single probe.
  • the polymerase digests the probe to separate the detectable label from the quencher molecule.
  • the detectable label e.g., fluorescence
  • detection of the label corresponds to the occurrence of nucleic acid amplification (e.g., the higher the signal the greater the amount of amplification).
  • Variations of TaqMan® assays e.g., LNATM spiked TaqMan® assay are known in the art and would be suitable for use in the methods described herein.
  • the probe typically includes two complementary oligonucleotides of different lengths where one includes a detectable label and the other includes a quencher molecule. When not bound to a target nucleic acid, the quencher suppresses the signal from the detectable label. The probe becomes detectable upon displacement hybridization with a target nucleic acid. Multiple probes may be used, each containing different detectable labels, such that multiple target nucleic acids may be queried in a single reaction.
  • molecular beacons are single-stranded hairpin shaped oligonucleotide probes. In the presence of the target sequence, the probe unfolds, binds and emits a signal (e.g., fluoresces).
  • a molecular beacon typically includes at least four components: 1) the “loop”, an 18-30 nucleotide region which is complementary to the target sequence; 2) two 5-7 nucleotide “stems” found on either end of the loop and being complementary to one another; 3) at the 5′ end, a detectable label; and 4) at the 3′ end, a quencher moiety that prevents the detectable label from emitting a single when the probe is in the closed loop shape (e.g., not bound to a target nucleic acid).
  • the “stem” portion of the beacon separates out resulting in the probe hybridizing to the target.
  • Other types of molecular beacons are also known and may be suitable for use in the methods described herein.
  • Molecular beacons may be used in a variety of assay systems.
  • One such system is nucleic acid sequence-based amplification (NASBA ⁇ ®>), a single step isothermal process for polymerizing and/or amplifying RNA to double stranded DNA without temperature cycling.
  • a NASBA reaction typically requires avian myeloblastosis virus (AMV), reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers.
  • AMV avian myeloblastosis virus
  • RT reverse transcriptase
  • T7 RNA polymerase T7 RNA polymerase
  • RNase H reverse transcriptase
  • oligonucleotide primers two oligonucleotide primers.
  • the amplified target nucleic acid may be detected using a molecular beacon.
  • Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
  • ScorpionsTM primers are bi-functional molecules in which a primer is covalently linked to the probe, along with a detectable label (e.g., a fluorophore) and a non-detectable quencher moiety that quenches the fluorescence of the detectable label.
  • a detectable label e.g., a fluorophore
  • quencher moiety that quenches the fluorescence of the detectable label.
  • the detectable label and the quencher separate which leads to an increase in signal emitted from the detectable label.
  • a primer used in the amplification reaction includes a probe element at the 5′ end along with a “PCR blocker” element (e.g., a hexaethylene glycol (HEG) monomer (Whitcombe, et al. Nat. Biotech. 17: 804-807 (1999)) at the start of the hairpin loop.
  • the probe typically includes a self-complementary stem sequence with a detectable label at one end and a quencher at the other.
  • the primer hybridizes to the target and extension occurs due to the action of polymerase.
  • the ScorpionsTM system may be used to examine and identify point mutations using multiple probes that may be differently tagged to distinguish between the probes.
  • the newly synthesized target region will be attached to the same strand as the probe.
  • the probe and the target hybridize.
  • the hairpin sequence then hybridizes to a part of the newly produced PCR product. This results in the separation of the detectable label from the quencher and causes emission of the signal.
  • Other uses for such labeled probes are known in the art and would be suitable for use in the methods described herein.
  • the method for amplifying and detecting can be selected from quantitative multiplex PCT of short fluorescent fragments (QMPSF); Multiplex Ligation-dependent Probe Amplification (MLPA) and PCR in Real Time.
  • QMPSF quantitative multiplex PCT of short fluorescent fragments
  • MLPA Multiplex Ligation-dependent Probe Amplification
  • the present invention relates to a probe suitable for detecting a duplication of exon in the RHD gene. Accordingly, the present invention relates to a probe or an oligonucleotide specifically hybridizing a portion of the RHD gene specific to the duplication of exon 3 of the RHD gene, more particularly a portion comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof.
  • the probe is a nucleic acid including the breakpoint between intron 3 and exon 2 as shown in FIG. 5 (SEQ ID NO: 31 between position 26 and 27).
  • the probe comprise at least 5, 6, 7, 8, 9, 10, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof.
  • the probe can be labeled.
  • the probe may comprise a fluorescent molecule, e.g., at its 5′ and 3′.
  • the probe may further comprise a quencher molecule, in particular suitable for quenching the fluorescent molecule.
  • the means suitable for detecting a duplication of exon in the RHD gene combines a probe and a set of primers.
  • the present invention relates to an isolated, synthetic or recombinant nucleic acid comprising or consisting of a sequence comprising at least 10, 11, 12, 13, 14, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, or a sequence having at least 80, 85, 90 or 95% of identity therewith or a complementary sequence thereto. It also relates to an isolated, synthetic or recombinant nucleic acid comprising or consisting of a sequence of SEQ ID NO: 31 or a sequence having at least 80, 85, 90 or 95% of identity therewith or a complementary sequence thereto. In one embodiment, the nucleic acid may comprise or consist of a sequence of SEQ ID NO: 35.
  • the nucleic acid may be at least 20, 25, 30, 40, 50, 75 or 100 bp in length.
  • the nucleic acid may be for instance between 30 and 1000 bp in length, preferably between 50 and 500 bp.
  • Said nucleic acid can be a probe or an amplification product.
  • Said nucleic acid may comprise a label.
  • the label can be a fluorescent label, a sequence tag (heterologous to the RHD gene) and the like.
  • Said nucleic acid may comprise a fluorescent molecule and a quencher, in particular suitable for quenching the fluorescent molecule.
  • the present invention relates to an isolated or recombinant nucleic acid carrying a duplication of exon 3 of the RHD gene.
  • it relates to a nucleic acid encoding a rhesus D antigen and carrying a duplication of exon 3 of the RHD gene.
  • the nucleic acid comprises the duplicated region of SEQ ID NO: 34 or a sequence having at least 90, 95, 98 or 99% of identity with SEQ ID NO: 34.
  • the present invention also relates to a kit.
  • the kit is suitable for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype, wherein the kit comprises means suitable for specifically detecting a duplication of exon 3 of the RHD gene in a DNA sample.
  • the means can be a probe or a set of primers specific to the duplication of exon 3 of the RHD gene in the DNA sample or a combination thereof.
  • the kit may comprise any primer, set of primers or probe as disclosed above.
  • the kit may comprise
  • kit may comprise:
  • the kit may further comprise one or several elements selected in the group consisting of:
  • the kit comprises the following primers:
  • the kit may also comprise a leaflet.
  • the present invention further relates to the use of a kit for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype.
  • RHD QMPSF which is more specifically dedicated to the identification of exon CNVs (Fichou et al, 2013 , Transfusion, 53(11 suppl 2), 2974-2982).
  • a common profile consisting of the RHD gene at the hemizygous state with an additional exon 3 was found in 26/36 samples by RHD QMPSF ( FIG. 1 ).
  • RHCE-D(3)-CE hybrid gene could be suspected from this result at the CE locus, samples were subsequently analyzed by RHCE QMPSF. This latter method indicated a wild-type pattern with two RHCE copies in all samples.
  • RNA of wild-type, RHD-negative and exon 3 duplication samples were extracted and analyzed by RT-PCR with primers targeting exons 2 and 4 specifically.
  • a single product composed by exons 2, 3, and 4 was found in the wild-type sample, several products were observed in the variant sample ( FIG. 2 ).
  • Subsequent sequencing revealed different combinations, including more importantly one wild-type product, suggesting that a full RhD protein may be biosynthesized; and another major product composed successively by exons 2 and 3; an additional, full-length exon 3; and finally exon 4.
  • the inventors designed a novel QMPSF assay to quantify several markers from exon 2 to exon 4 in 30 samples characterized as carrying an additional exon 3 by QMPSF ( FIG. 3 ).
  • a common genomic region spanning >10-kb was found to be duplicated.
  • a series of PCR amplifications using QMPSF primers was carried out. While normal PCR amplifications were observed in intron 2 and intron 3, an additional, ⁇ 2-kb PCR product was shown to be specifically amplified in exon 3 duplication samples with forward and reverse primers located within intron 3 and intron 2, respectively ( FIG. 4 ).
  • Other PCR primers were then designed to amplify a specific marker with minimal length.
  • Indian-specific, RHD gene variant genotyping assay is based on the multiplex Polymerase Chain Reaction (PCR) principle.
  • PCR Polymerase Chain Reaction
  • Several PCR primers are mixed together for the specific amplification of four human genome targets.
  • Targets are: 1) GAPDH; 2) RHD exon 10; 3) RHD exon 5; and 4) a specific RHD gene region of a novel weak D allele (“RHD duplication exon 3”) specifically identified in the Indian population.
  • This primer pool is combined with a commercial PCR master mix, including thermostable DNA polymerase and genomic DNA, for PCR amplification of targets in a thermal cycler in standard conditions.
  • PCR products are loaded onto an agarose gel for visualization and sizing. Samples exhibiting a specific “RHD duplication exon 3” band carry the novel variant D allele and may be considered as “wild-type” (i.e. D+).
  • This genotyping assay was designed to simplify RHD genotyping in the Indian population. After characterizing the novel “RHD duplication exon 3” allele, an assay was designed for the rapid screening of this allele. This test is based on the Polymerase Chain Reaction (PCR) principle, which may be easily implemented in a molecular biology laboratory.
  • PCR Polymerase Chain Reaction
  • Reagents for carrying out this test are: 1/ Commercial 2 ⁇ PCR Master Mix, including thermostable DNA polymerase; and 2/ 2 ⁇ Primer Pool. Reagents are mixed together (V/V). Genomic DNA is added to this mixture prior to PCR amplification. Experimental PCR conditions are typically those described by the PCR Master Mix manufacturer, with a 60° C. annealing temperature as described above.
  • PCR amplification products are loaded onto an agarose gel for sizing specific bands ( FIG. 6 ) and genotype interpretation by using the interpretation guide (Table 2).
  • This assay may be used to genotype samples, and more specifically to identify the most prevalent weak D variant allele in the Indian population ( ⁇ 60% samples presenting with a weak D phenotype) in ⁇ 2 hours only after genomic DNA extraction.
  • Test cost is supposed to be less than 1 f (reagent/test). Only thermal cycler and gel electrophoresis unit are necessary to carry out the test. Thus it is a simple, easy-handling cost-effective genotyping assay.
  • this test may be used to identify the molecular basis of D-negative phenotype (i.e. whole RHD gene deletion vs nonfunctional RHD allele), because of the presence of two RHD-specific markers (exon 5 and exon 10).
  • RHD gene exons were first amplified by multiplex PCR and sequenced as previously described (Fichou et al., 2013, Transfusion, 53, 1821-1828). Alternatively copy number variations (CNVs) of RHD exons were analyzed by RHD QMPSF for exon quantitation (Fichou et al, 2013b). RHCE QMPSF was carried out when a hybrid RHD-CE-D gene was suspected.
  • *U refers to as the 20-mer, universal primer sequence 5′-GTCGTAGTCGACGACCGTTA-3′ (SEQ ID NO: 9).
  • ⁇ H refers to as the 5′-GTTTCTT-3′ nucleotide heptamer.
  • PCR primers are mixed at a 2 ⁇ concentration to amplify four targets: GAPDH, RHD exon 3 duplication marker, RHD exons 5 and 10 markers (Table 1).
  • PCR primer pool was mixed with 1 ⁇ HotStarTaq Master Mix (Qiagen) and 1 ⁇ L genomic DNA (20-100 ng/ ⁇ L).
  • PCR conditions were: an initial denaturation step at 95° C. for 15 min, followed by 40 cycles of denaturation at 95° C. for 30 sec, annealing at 60° C. for 30 sec, extension at 72° C. for 30 sec; and a final extension step at 72° C. for 10 min.
  • PCR products were loaded on a 1.5% agarose gel for visualization.
  • Breakpoint was PCR-amplified and sequenced with primers RHD_i3ex3dup_F and RHD_i2ex3dup_R in standard conditions.
  • PCR amplifications were carried out with HotStarTaq Master Mix Kit (Qiagen, Courtaboeuf, France) in a 10 ⁇ L final volume with 1 ⁇ HotStarTaq Master Mix, 0.4 ⁇ M of both forward and reverse primers, and 1 ⁇ L genomic DNA solution (20-100 ng/ ⁇ L) as a template.
  • PCR conditions were: an initial denaturation step at 95° C. for 15 min, followed by 40 cycles of denaturation at 95° C. for 30 sec, annealing at 60° C. for 30 sec, extension at 72° C. for 30 sec; and a final extension step at 72° C. for 10 min.
  • PCR products were loaded on an agarose gel and treated by USB® ExoSAP-IT® PCR cleanup reagent (Affymetrix, purchased from Ozyme, St-Quentin-en-Yvelines, France) prior to direct sequencing with PCR primers as previously described (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982).
  • USB® ExoSAP-IT® PCR cleanup reagent Affymetrix, purchased from Ozyme, St-Quentin-en-Yvelines, France
  • Revert Aid First Strand cDNA synthesis kit Thermo Fisher Scientific Inc., USA
  • RHD exons 2 to 4 forward: 5′-CTTGGGCTTCCTCACCTC G A G -3′ (SEQ ID NO: 36); reverse: 5′-CGAACACGTAGA T GTGC A TCA T -3′ (SEQ ID NO: 37)
  • RHD-positive control i.e. RHD exons 6 to 8
  • reverse: 5′-ATCATGCCATTGCCG GCT -3′ reference gene
  • ACTB forward: 5′-TCTCCATGTCGTCCCAGTTG-3′ (SEQ ID NO: 40); reverse: 5′-AGTCTTCCCCTCCATCGTTG-3′ (SEQ ID NO: 41)
  • PCRs RHD-specific nucleotides are underlined.
  • PCR amplifications were carried out with HotStarTaq Master Mix Kit (Qiagen, Courtaboeuf, France) in a 10 ⁇ L final volume with 1 ⁇ HotStarTaq Master Mix, 0.4 ⁇ M of both forward and reverse primers, and 1 ⁇ L cDNA solution as a template.
  • HotStarTaq Master Mix Kit Qiagen, Courtaboeuf, France
  • PCR products were loaded on an agarose gel, gel-purified with QIAquick Gel Extraction Kit (Qiagen), and subcloned into the pCRTM 4-TOPO® Vector by using the TOPO® TA Cloning® Kit for Sequencing (Thermo Fisher Scientific, Courtaboeuf, France) according to the manufacturer's instructions. Cloning products were transformed into One Shot® TOP10 Chemically Competent E. coli (Thermo Fisher Scientific) and directly sequenced by T7 and T3 primers in conditions previously described (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the identification of a novel allele of the RHD gene associated with a weak D phenotype and the kits and methods for detecting this allele.

Description

CROSS-REFERENCE TO RELATED APPLICATION
This application is the U.S. national stage application of International Patent Application No. PCT/EP2018/055529, filed Mar. 7, 2018.
The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Aug. 13, 2019 and is 31 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
The present invention relates to a novel allele of Rh D antigen contributing to the weak D phenotype, to methods and kits for detecting this Rh D antigen.
BACKGROUND OF THE INVENTION
Among the 36 human blood group systems reported so far and officially acknowledged by the International Society of Blood Transfusion (ISBT, www.isbtweb.org), Rh system is the most complex and polymorphic system. It involves two paralogous genes, RHD and RHCE, each encoding a transmembrane protein (RhD and RhCE, respectively) expressed at the surface of erythroid cell lineage. These proteins express 54 antigens (www.isbtweb.org). Antigen D, carried by RhD, is the most immunogenic antigen and may induce alloimmunization (i.e. production of antibodies directed against an antigen) when introduced in a D-negative (D−) individual with two major, potential risks:
    • Hemolytic transfusion reaction (HTR), with severe clinical outcomes, may occur in an alloimmunized D− recipient transfused with a D+ red blood cell unit;
    • Hemolytic disease of the fetus and newborn (HDFN) may occur in an alloimmunized D− pregnant woman with a D+ fetus with potential dramatic consequences.
Rh status is thus of major interest in Public Health. In routine it is determined by serological analyses with different panels of antibodies. Although these tests are relevant most of the time, ambiguity and/or discrepancy with different panels of antibodies may be observed in some circumstances. Then it is necessary to use molecular analysis to identify genetic variations and predict Rh status.
Since RHD and RHCE genes were both discovered in the early nineties, more than 300 different alleles have been reported in the literature (www.rhesusbase.info/), involving different molecular mechanisms: single-nucleotide variations, short insertions/deletions, rearrangements and microdeletions. These variants, which are typically distributed in an ethnicity-dependent manner, induce a large phenotypic variability including quantitative and/or qualitative modification(s) of antigen expression. This variability is characterized serologically by ambiguity/discrepancy as indicated above.
Identification/knowledge of the specific molecular bases of RHD variability in populations is thus of the main interest for 1/ the implementation of the genotyping strategy and 2/ the management of transfusions in patients/pregnant women. Indeed depending on their genotype, donors/patients are considered as D− or D+ and thus managed differently.
Many studies dealing with identification and characterization of many specific variants in Caucasians, Africans and Asians have been published. To date the global distribution of variants is well known in each population, although numerous others are likely to be found in the future.
Conversely, populations of other origins, such as Indians, have not been documented in terms of molecular genetics, while several phenotype studies have reported the incidence of RhD-negative individuals in Northern India (6.6%), Delhi (6.3%) and Mumbai (3-7.5%), but also weak D (˜0.2%) (Kumar et al, 2005, Med J Armed Forces India, 61, 348-350) and partial D (>0.15%) antigen carriers. Phenotypic data in terms of D antigen density and their distribution in different castes and tribes of the Indian population in the Mumbai region have also been provided.
The proper identification of weak D subjects in Indian population is clinically relevant. Therefore, development of an Indian-specific genotyping strategy at the laboratory level may have major consequences, in particular for the clinical management of transfusions and pregnancies at risk in India.
SUMMARY OF THE INVENTION
The present invention concerns a duplication of exon 3 of the RHD gene which is indicative of a weak D phenotype in a subject, in particular a subject from the Indian population. Then, the present invention relates to a method of genotyping, especially RHD genotyping, based on the determination of the presence of a duplication of exon 3 of the RHD gene, said duplication being indicative of a weak D phenotype.
Accordingly, the present invention relates to a method for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample comprising contacting a probe or a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and detecting a hybridization of the probe or an amplification product of the set of primers, the detection of said hybridization or said amplification product being respectively indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample, wherein a probe specific to the duplication of exon 3 of the RHD gene specifically hybridizes a portion of the RHD gene specific to the duplication of exon 3 comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof and; a set of primers specific to the duplication of exon 3 of the RHD gene produces an amplification product only when a duplication of exon 3 is present.
The present invention also relates to a method for determining RHD genotype or for detecting a weak D phenotype, comprising detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample according to the present invention, wherein the presence of a duplication of exon 3 of the RHD gene in the DNA sample is indicative of a weak D phenotype.
Preferably, the probe or the amplification product has a sequence comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31 or the complementary sequence thereof, the probe or amplification product having at least 20 nucleotides in length.
In one embodiment, the method comprises
    • a) contacting a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and an amplification reaction mixture;
    • b) producing the amplification product using a primer-dependent DNA amplification reaction; and
    • c) detecting the amplification product, the detection of said amplification product being indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample.
Optionally, the step b) is a multiplex amplification such as multiplex PCR or multiplex LPA (Ligation-dependent Probe Amplification).
More particularly, the primer-dependent DNA amplification reaction is a PCR reaction, preferably multiplex PCR.
Optionally, the method further comprises the detection of the presence of one or several exons of the RHD gene, in particular exon 5 and/or exon 10 of the RHD gene.
The present invention further relates to a kit for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype, wherein the kit comprises a probe or a set of primers specific to the duplication of exon 3 of the RHD gene in a DNA sample, wherein a probe specific to the duplication of exon 3 of the RHD gene specifically hybridizes a portion of the RHD gene specific to the duplication of exon 3 comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof and; a set of primers specific to the duplication of exon 3 of the RHD gene produces an amplification product only when a duplication of exon 3 is present.
In one embodiment of the methods or kit, the specific set of primers comprises a forward primer in partial intron 3 located upstream of the breakpoint, especially of SEQ ID NO: 30, and a reverse primer in the Exon2/intron2 region of the duplicated region located downstream of the breakpoint, especially positions 1-5891 of SEQ ID NO: 34.
More specifically, the specific set of primers comprises
    • a forward primer in partial intron 3 located within 1000 bp upstream of the breakpoint, preferably within 500 bp upstream of the breakpoint, and more preferably within 200 bp upstream of the breakpoint; and
    • a reverse primer in the Exon2/intron2 region of the duplicated region located within 1000 bp downstream of the breakpoint, preferably with 500 bp downstream of the breakpoint, and more preferably within 200 bp downstream of the breakpoint.
For instance, the set of primers may include:
    • a forward primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC
(SEQ ID NO: 20)
CTCATCTGGCACAACTCAGCG
and
(SEQ ID NO: 22)
GGCTGACATCATCAGTGACCAAGA
and
    • a reverse primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG
(SEQ ID NO: 17)
TTCTTAGCATTTCACACAAATGCATG
(SEQ ID NO: 19)
GATCACCTGAACCCAGTGAGGT.
More specifically, the set of primers may include:
    • a forward primer comprising, or consisting of, a sequence
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC;
and
    • a reverse primer comprising, or consisting of, a sequence
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG.
The kit may further comprise one or several elements selected in the group consisting of:
    • a set of primer or a probe specific to exon 5 of the RHD gene;
    • a set of primer or a probe specific to exon 10 of the RHD gene; and
    • an amplification reaction mixture.
For instance, the kit comprises the following primers:
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 1)
ATACCTTTGAATTAAGCACTTCACAGAG;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 2)
ACTGTGACCACCCAGCATTCTA;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 5)
AGGCTGTTTCAAGAGATCAAGCCA;

and
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 6)
GATGTTGTTATGTGGTACATGGCTG.
The present invention relates to the use of a kit according to the present invention for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype.
Finally, the present invention relates to an isolated or recombinant nucleic acid comprising or consisting of a sequence SEQ ID NO: 35.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1. RHD exon 3 is duplicated in some Indian weak D individuals. Typical RHD QMPSF profiles obtained with (A) a hemizygous, wild-type RHD calibrator (Rh C/c, E/e phenotype: Ccee); (B) a hemizygous (exon 3 duplication) sample (Ccee); and (C) a homozygous (exon 3 duplication) sample (CCee). Arrowheads indicate copy number variation (CNV) of exon 3 in the samples; e1 to e10: RHD exons 1 to 10.
FIG. 2. The novel variant RHD allele including duplication of exon 3 impairs cellular splicing. (A) RT-PCR products were generated by targeting RHD exons 2 to 4 (RHD(2-4)), RHD exons 6 to 8 (RHD(6-8)), and ACTB. Products were loaded on a 2% agarose gel. (B) RT-PCR products from RHD(2-4) amplification were extracted from the gel, subcloned into a commercial vector and sequenced. Four products were found from an exon 3 duplication sample: (1) exon 2-exon 3-exon 3-exon 4; (2) exon 2-exon 3-exon 3-exon 4 deleted from the first four base pairs; (3) exon 2-exon 3-exon 4, identical to what observed in a wild-type sample; and (4) exon 2-exon 3-exon 4 deleted from the first four base pairs.
FIG. 3. Customized QMPSF identified a >10-kb duplicated region in weak D individuals. (A) A novel QMPSF assay was designed by positioning additional markers (*) in introns 2 (i2a, and i2b) and 3 (i3a, i3b, and i3c). (B) Typical QMPSF profiles obtained with a hemizygous, wild-type RHD calibrator (Rh C/c, E/e phenotype: Ccee) (top panel); and a hemizygous (exon 3 duplication) sample (Ccee). Calibrator: hemizygous, wild-type RHD control sample; sample: weak D, hemizygous exon 3 duplication sample. Arrowheads indicate copy number variation of markers; e2, e4, e7: RHD exons 2, 4 and 7, respectively.
FIG. 4. The novel, Indian weak D allele involves duplication of a ˜12-kb fragment inserted within RHD intron 3. (A) Schematic representation of primer positions for PCR amplifications to characterize the duplicated region. (B) Three PCR primer sets (supplemental Table SI) were used to amplify specific markers: (1) PCR amplification with RHD_e2 (forward)/RHD_i2a (reverse) primers is specific to C-positive samples and is ˜1 kb in length in all positive lanes (top gel); (2) PCR amplification with RHD_i3b (forward)/RHD_i3c (reverse) primers is specific to D-positive samples, including exon 3 duplication samples and is ˜3 kb in length in all positive lanes; and (3) PCR amplification with RHD_i3b (forward)/RHD_i2a (reverse) primers is only specific to exon 3 duplication samples and is ˜2 kb in length in all positive lanes. NTC: no template control D− (cc): homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee); D− (Cc): homozygous whole RHD gene deletion control sample (Ccee); D+ (WT): hemizygous wild-type RHD control sample (Ccee); bp: base pairs; RHD-004, RHD-009, and RHD-030: exon 3 duplication samples (Ccee). e2, e3, and e4: RHD exons 2, 3, and 4, respectively; kb: kilobases.
FIG. 5. The novel, Indian weak D allele involves duplication of a ˜12-kb fragment inserted within RHD intron 3. (A) A unique, 407-bp PCR product corresponding to a specific breakpoint was identified and sequenced in exon 3 duplication samples (RHD-004, RHD-009, and RHD-030). (B) Schematic representations of the genomic RHD locus ranging from exon 2 to exon 4 (top panel) and the ˜12-kb duplicated region (in red), as characterized by QMPSF and sequencing (bottom panel). NTC: no template control; D− (cc): homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee); D− (Cc): homozygous whole RHD gene deletion control sample (Ccee); D+(WT): hemizygous wild-type RHD control sample (Ccee); bp: base pairs. Exon 2 sequence is underlined; arrows: RHD_i3ex3dup_F/RHD_i2ex3dup_R PCR primers; *: QMPSF markers.
FIG. 6. Indian-specific, multiplex PCR RHD genotyping assay for routine analysis. Typical 1.5% agarose gel profile obtained by multiplex PCR amplification. NTC: no template control; D− (cc): homozygous whole RHD gene deletion control sample (Rh C/c, E/e phenotype: ccee); D− (Cc): homozygous whole RHD gene deletion control sample (Ccee); D+(WT): hemizygous wild-type RHD control sample (Ccee); RHD-004, RHD-009, and RHD-030: exon 3 duplication samples; RHD-048, RHD-049 and RHD-221: other “partial” D alleles. cc and Cc: phenotype RhCc. GAPDH: 97 base pairs (bp); RHD exon 10: 344 bp; RHD exon 3 dup: 407 bp; RHD exon 5: 605 bp.
DETAILED DESCRIPTION OF THE INVENTION
In the course of a collaborative project, which aim was to analyze RHD gene variants in weak D Indians, a novel RHD allele characterized by an original mutational mechanism, “RHD exon 3 duplication”, was identified by the inventors. This population-specific variant allele has been found in ˜60% samples presenting with a weak D phenotype, namely 0.2% of the whole Indian population. From a phenotypic point of view, people harboring this allele may be considered as D+.
According, this novel RHD allele is the main cause of weak D phenotype in the Indian population.
Definitions
The RHD gene encodes the Rh D antigen. This gene is referenced in the following public databases: UniProt #Q02161, GeneCards #RHD, Gene ID #6007, and HGNC #10009. “RHD” refers to Rhesus D or Rhesus D antigen.
A Weak D phenotype is a group of RhD+ phenotypes with a reduced expression of Rh D antigen on the red blood cells' surface.
“Breakpoint” refers to the junction between the partial intron 3 in 5′ with the partial exon 2 in 3′ when a duplication of exon 3 in the RHD gene is present. In particular, the position of Breakpoint could defined as:
    • in position following the position 5990 of intron 3 of the RHD gene, at the end of partial intron 3 as shown in SEQ ID NO: 30; and/or
    • between positions 26 and 27 in SEQ ID NO: 31, showing the junction sequence between the partial intron 3 in 5′ with the partial exon 2 in 3′ of the RHD gene; and/or
    • in position before the duplicated region the RHD gene, before the partial exon 2, before the position 1 of SEQ ID NO: 34.
By “partial intron 3” is intended to refer to the part of intron 3 located before the Breakpoint. A sequence of partial intron 3 is shown in SEQ ID NO: 30.
By “Exon2/intron2 region of the duplicated region” is intended to refer to the part of exon 2 and the intron 2 which is duplicated. A sequence of Exon2/intron2 region of the duplicated region is shown in SEQ ID NO: 34 in positions 1-5891.
By “duplicated region” is intended to refer to the part of exon 2, intron 2, exon 3 and intron 3 which is duplicated. A sequence of the duplicated region is shown in SEQ ID NO: 34.
The term “genotype” as used herein, refers to a description of the alleles of a gene or a plurality of genes contained in an individual or in a sample from said individual.
The term “DNA sample” refers to a sample containing human genomic DNA obtained from a subject.
As used herein, the term “subject” refers to a human, including adult, in particular a woman, a child and a human at the prenatal stage in particular a foetus. In a particular aspect, the subject has been classified as Rhesus D− by a classical assay for determining the Rhesus D status, e.g., assays using antibodies directed against Rhesus D antigen, in particular by agglutination reaction.
As used herein, the term “primer” refers to a synthetically or biologically produced single-stranded oligonucleotide that is extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule. Nucleic acid amplification often is based on nucleic acid synthesis by a nucleic acid polymerase or reverse transcriptase. Many such polymerases or reverse transcriptases require the presence of a primer that may be extended to initiate such nucleic acid synthesis. A primer is typically 11 bases or longer; most preferably, a primer is 17 bases or longer, although shorter or longer primers may be used depending on the need. As will be appreciated by those skilled in the art, the oligonucleotides disclosed herein may be used as one or more primers in various extension, synthesis, or amplification reactions.
Typically, a PCR reaction employs a pair of amplification primers including an “upstream” or “forward” primer and a “downstream” or “reverse” primer, which delimit a region of the RNA or DNA to be amplified.
The terms “complementarity” and “complementary” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100 percent complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region.
As used herein, the term “probe” refers to synthetic or biologically produced nucleic acids (DNA or RNA) which, by design or selection, contain specific nucleotide sequences that allow them to hybridize, under defined stringencies, specifically (i.e., preferentially) to target nucleic acid sequences.
A “labeled probe” or “labeled primer” refers to a nucleic acid, especially single-stranded nucleic acid, conjugated to a compound that produces a detectable signal. Suitable labels include, but are not limited to, radioactive molecule, fluorescent molecule, mass label, antibody, antibody fragment, hapten, carbohydrate, biotin, derivative of biotin, phosphorescent moiety, luminescent moiety, electrochemiluminescent moiety, chromatic moiety, and moiety having a detectable electron spin resonance, electrical capacitance, dielectric constant and electrical conductivity.
As used herein, the terms “amplification”, “nucleic acid amplification”, or “amplifying” refer to the production of multiple copies of a nucleic acid template, or the production of multiple nucleic acid sequence copies that are complementary to the nucleic acid template. The terms (including the term “polymerizing”) may also refer to extending a nucleic acid template (e.g., by polymerization). The amplification reaction may be a polymerase-mediated extension reaction such as, for example, a polymerase chain reaction (PCR). However, any of the known amplification reactions may be suitable for use as described herein. For instance, other types of amplification reactions contemplated include both polymerase-mediated amplification reactions (such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)), as well as ligase-mediated amplification reactions (such as ligase detection reaction (LDR), ligase chain reaction (LCR), and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR. The term “amplifying” that typically refers to an “exponential” increase in target nucleic acid may be used herein to describe both linear and exponential increases in the numbers of a select target sequence of nucleic acid.
The term “amplification reaction mixture” and/or “master mix” may refer to an aqueous solution comprising the various (some or all) reagents used to amplify a target nucleic acid. Such reactions may also be performed using solid supports (e.g., an array). The reactions may also be performed in single or multiplex format as desired by the user. These reactions typically include enzymes, aqueous buffers, salts, amplification primers, target nucleic acid, and nucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture. The method used to amplify the target nucleic acid may be any available to one of skill in the art. Any in vitro means for multiplying the copies of a target sequence of nucleic acid may be utilized. These include linear, logarithmic, and/or any other amplification method. While this disclosure may generally discuss PCR as the nucleic acid amplification reaction, other types of nucleic acid amplification reactions are also contemplated, including both polymerase-mediated amplification reactions (such as helicase-dependent amplification (HDA), recombinase-polymerase amplification (RPA), and rolling circle amplification (RCA)), as well as ligase-mediated amplification reactions (such as ligase detection reaction (LDR), ligase chain reaction (LCR), and gap-versions of each), and combinations of nucleic acid amplification reactions such as LDR and PCR.
The term “polymerase chain reaction” or “PCR” as used herein refers to a method for amplifying a DNA sequence using a heat-stable DNA polymerase and a set of amplification primers in a cyclical reaction where the annealing of primers, synthesis of progeny strand DNA and denaturation of the duplexes, are each conducted at different temperatures. Because the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation and dissociation produce rapid amplification of the target sequence.
As used herein, the term “DNA polymerase” refers to an enzyme that is essential for elongation of amplification primers in nucleic acid templates. The skilled person may easily choose a convenient polymerase enzyme based on its characteristics such as efficiency, processivity or fidelity. Preferably, the polymerase is a high-fidelity and heat-stable polymerase.
The term “amplicon” or “amplification product” as used herein refers to a fragment of DNA spanned within a pair of amplification primers, this fragment being amplified exponentially by a DNA polymerase. An amplicon can be single-stranded or double-stranded.
As used herein, the term “identity” refers to the number (%) of matches (identical amino acid residues) in positions from an alignment of two polypeptide sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http://blast.ncbi.nlm.nih.gov/ or http://www.ebi.ac.uk/Tools/emboss/). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. By “a sequence at least x % identical to a reference sequence”, it is intended that the sequence is identical to the reference sequence or differs from the reference sequence by up to 100−x nucleotide alterations per each 100 nucleotides of the reference sequence.
The terms “low stringency”, “medium stringency”, “medium/high stringency”, “high stringency” and “very high stringency” refer to conditions of hybridization. Suitable experimental conditions for determining hybridization between a nucleotide probe and a homologous DNA or RNA sequence involves presoaking of the filter containing the DNA fragments or RNA to hybridize in 5×SSC (Sodium chloride/Sodium citrate for 10 min, and prehybridization of the filter in a solution of 5×SSC, 5×Denhardt's solution, 0.5% SDS and 100 μg/ml of denatured sonicated salmon sperm DNA, followed by hybridization in the same solution containing a concentration of 10 ng/ml of a random-primed 32P-dCTP-labeled (specific activity >1×109 cpm/μg) probe for 12 hours at ca. 45° C. (Feinberg and Vogelstein, 1983). For various stringency conditions the filter is then washed twice for 30 minutes in 2×SSC, 0.5% SDS and at least 55° C. (low stringency), more preferably at least 60° C. (medium stringency), still more preferably at least 65° C. (medium/high stringency), even more preferably at least 70° C. (high stringency), and even more preferably at least 75° C. (very high stringency).
Preferably, the methods of the invention are in vitro methods.
The present invention relates to a method for testing the presence of a duplication of exon 3 in the RHD gene. Accordingly, the present invention relates to a method for detecting a weak D phenotype and the method comprises testing the presence of a duplication of exon 3 in the RHD gene. More generally, the present invention relates to a method for RHD genotyping, the method comprises testing the presence of a duplication of exon 3 in the RHD gene. Indeed, as discussed before, a duplication of exon 3 in the RHD gene is indicative of a weak D phenotype and a weak D phenotype is generally classified as a Rhesus D+ status.
The present invention further relates to a kit comprising means for detecting the presence of a duplication of exon 3 in the RHD gene and the use of the kit for testing the presence of a duplication of exon 3 in the RHD gene, for detecting a weak D phenotype or for RHD genotyping.
The presence of a duplication of exon 3 in the RHD gene can be detected by any suitable means available to the person skilled in the art. In particular, the suitable means can be a probe specific to the duplication of exon 3 in the RHD gene, a set of primers specific to the duplication of exon 3 in the RHD gene or a combination thereof.
For instance, the method may comprise contacting a probe or a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and detecting a hybridization of the probe or an amplification product of the set of primers, the detection of said hybridization or said amplification product being respectively indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample.
The DNA sample is prepared from a biological sample, preferably a sample comprising erythroid tissue. The biological sample can be whole blood, plasma, serum, urine, cervical mucus, amniotic fluid or sample, or chorionic villus sample. The sample is from human origin. In a preferred embodiment, the biological sample is whole blood, plasma, or serum. In particular, the sample can be a maternal sample or a foetal sample. The sample may also provide from a sample of a blood bank, in particular from a sample from blood unit. In a particular embodiment, the sample is from an individual with is Indian (Indian population) or has an individual of Indian descent. As used herein, “an individual of Indian descent” refers to people who have a have ancestors from the geographic region India and surrounding areas including, but not limited to, India, Pakistan, Nepal and Bangladesh. Preferably, at least one ancestor is from India or surrounding areas. Indian population may further include India, Pakistan, Nepal and Bangladesh. In a particular embodiment, the sample comes from an individual, a blood bank sample or immunohematology laboratories which has been shown weaker or discrepant results by a classical assay for determining the Rhesus D status, e.g., assays using antibodies directed against Rhesus D antigen, in particular by agglutination reaction with a panel of monoclonal anti-D reagents.
The methods for preparing or extracting a DNA sample from a biological sample are well-known in the art.
In a first embodiment, the present invention relates to a method comprising a) contacting a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and an amplification reaction mixture in conditions suitable for amplification; and b) detecting an amplification product of the set of primers, the detection of said amplification product respectively being indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample. Accordingly, step a) is an amplification step.
In a specific embodiment, a set of primers is a pair of primers.
The set or pair of primers is specific to portion of the RHD gene that flanks the breakpoint, in particular suitable for producing an amplification product only when a duplication of exon 3 is present. In a preferred embodiment, the specific set of primers comprises a forward primer in the RHD gene upstream of the breakpoint, and a reverse primer in the RHD gene downstream of the breakpoint. More specifically, the specific set of primers comprises a forward primer in the intron 3 upstream of the breakpoint, and a reverse primer in intron 2 downstream of the breakpoint. A sequence of the intron 3 upstream of the breakpoint is described in SEQ ID NO: 30 and a sequence of the exon 2 and intron 2 downstream of the breakpoint is described in SEQ ID NO: 34, especially positions 1-5891 of SEQ ID NO: 34.
The set or pair of primers is designed so as the amplification product has a sequence comprising at least 5, 6, 7, 8, 9, 10, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% identity with SEQ ID NO: 31 or a complementary sequence thereof. In addition, the set or pair of primers is designed such as the amplification product has an appropriate length, in particular appropriate to the method used for detecting the presence of the amplification product. The size of the amplification product can be from 20 bp in length to one or several kbp, preferably from 50 bp to 1000 bp, more preferably from 100 bp to 600 bp.
In one embodiment, the set of primers comprises a primer (e.g., a forward primer) specific to a portion of the partial intron 3 located within 1000 bp upstream of the breakpoint, preferably within 500 bp upstream of the breakpoint, and more preferably within 200 bp upstream of the breakpoint; and a primer (e.g., a reverse primer) specific to a portion of the Exon2/intron2 region of the duplicated region located within 1000 bp downstream of the breakpoint, preferably with 500 bp downstream of the breakpoint, and more preferably within 200 bp downstream of the breakpoint.
The primer can, for example, be about 18 to about 30 nucleotides, or about 20 to about 50 nucleotides, in length. For example the primer may be from 15, 16, 17, 18, 19 or 20 nucleotides to 22, 25, 28, 30, 35 or 50 nucleotides in length.
In one embodiment, the set of primers includes:
    • a forward primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC
(SEQ ID NO: 20)
CTCATCTGGCACAACTCAGCG
(SEQ ID NO: 22)
GGCTGACATCATCAGTGACCAAGA

and
a sequence having at least 90 or 95% identity with one sequence of SEQ ID NOs: 3, 20 and 22;
and/or
    • a reverse primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG
(SEQ ID NO: 17)
TTCTTAGCATTTCACACAAATGCATG
(SEQ ID NO: 19)
GATCACCTGAACCCAGTGAGGT

and
a sequence having at least 90 or 95% identity with one sequence of SEQ ID NOs: 4, 19 and 19.
In a particular embodiment, the set of primers includes:
    • a forward primer consisting of a sequence selecting from the group consisting of SEQ ID NO: 3, SEQ ID NO: 20 and SEQ ID NO: 22 and a sequence having at least 90 or 95% identity with one sequence of SEQ ID NOs: 3, 20 and 22; and/or
    • a reverse primer consisting of a sequence selecting from the group consisting of: SEQ ID NO: 4, SEQ ID NO: 17 and SEQ ID NO: 19 and a sequence having at least 90 or 95% identity with one sequence of SEQ ID NOs: 4, 17 and 19.
In a specific embodiment, the set of primers includes:
    • a forward primer comprising, or consisting of, a sequence of SEQ ID NO: 3;
and/or
    • a reverse primer comprising, or consisting of, a sequence of SEQ ID NO: 4.
In a more specific embodiment, the set of primers includes:
    • a forward primer consisting of a sequence of SEQ ID NO: 3;
and/or
    • a reverse primer consisting of a sequence of SEQ ID NO: 4.
In a preferred embodiment, the set of primers includes:
    • a forward primer consisting of a sequence of SEQ ID NO: 3; and
    • a reverse primer consisting of a sequence of SEQ ID NO: 4.
In addition, the method may further comprise amplification of a control or reference gene, in particular in order to have a positive control for the amplification reaction. The control or reference gene can be for instance GADPH, ACTB or RASSF1A. Accordingly, step a) may further comprise contacting the DNA sample with a set of primers targeting the control or reference gene. For instance, a pair of primers targeting the GAPDH gene is disclosed in SEQ ID NOs: 7 and 8 and a pair of primers targeting the ACTB gene is disclosed in SEQ ID NOs: 40 and 41.
The method may also further comprise the detection of one or several exons of RHD gene or the detection of one or several mutations or SNPs of interest of the RHD gene. Accordingly, step a) may further comprise contacting the DNA sample with a set of primers targeting one or several exons of RHD gene or targeting one or several mutations or SNPs of interest of the RHD gene. Preferably, at least one of exon 4, exon 5, exon 7, or exon 10 is further detected by amplification. In some embodiments, at least two exons of the RHD gene are detected by amplification. In other embodiments, at least three exons of the RHD gene are detected by amplification. Detection of all possible combinations of each of the preferred exons are contemplated by the methods of the invention. For example, detection of exons 4 and 5; exons 4 and 7; exons 4 and 10; exons 5 and 7; exons 5 and 10; or exons 7 and 10 may be used. Similarly, detection of exons 4, 5, and 7; exons 4, 5, and 10; exons 5, 7, and 10, or exons 4, 7, and 10 may be used. In another embodiment, exons 4, 5, 7, and 10 are detected. The person skilled in the art can easily design appropriate primers. For instance, such primers are disclosed in WO2010/009440 or WO2015/001056 (hereby incorporated herein by reference in their entirety).
In particular, the method further comprises the detection of exon 5 and/or exon 10 of the RHD gene, preferably of exon 5 and exon 10. Indeed, detection of the presence of exons 5 and 10 would be indicative of a Rhesus D+; detection of the presence of exon 10 but not exon 5 would be indicative of a Rhesus D+ but partial; and the absence of exons a Rhesus D−. In a context of a Rhesus D+(detected presence of exons 5 and 10), the present invention, by detection of the presence of exon 3 duplication, could allow the identification of weak D phenotype.
Preferably, the detection is carried out by an amplification step followed by a step of detecting the amplification product. Accordingly, step a) may further comprise contacting the DNA sample with a set of primers targeting the exon 5 and/or exon 10, preferably a set of primers targeting the exon 5 and a set of primers targeting the exon 10. For instance, a pair of primers targeting exon 5 is disclosed in SEQ ID NOs: 1 and 2. Similarly, a pair of primers targeting exon 10 is disclosed in SEQ ID NOs: 5 and 6. Other suitable pair of primers can be designed and used.
In a preferred embodiment, the amplification step is carried out by a PCR reaction, in particular in a multiplex PCR reaction.
In certain embodiments, amplification techniques comprise at least one cycle of amplification, for example, but not limited to, the steps of: denaturing a double-stranded nucleic acid to separate the component strands; hybridizing a primer to a target flanking sequence or a primer-binding site of an amplicon (or complements of either, as appropriate); and synthesizing a strand of nucleotides in a template-dependent manner using a DNA polymerase. The cycle may or may not be repeated. In certain embodiments, a cycle of amplification comprises a multiplicity of amplification cycles, for example, but not limited to 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or more than 45 cycles of amplification.
In certain embodiments, an amplification reaction comprises multiplex amplification, in which a multiplicity of different target nucleic acids and/or a multiplicity of different amplification product species are simultaneously amplified using a multiplicity of different primer sets.
In one embodiment, the amplification steps of the control or reference gene and/or of one or several exons of the RHD gene are carried out concurrently with the amplification step of the duplication of exon 3 of the RHD gene, preferably by a multiplex amplification. In an alternative embodiment, the amplification steps of the control or reference gene and/or of one or several exons of the RHD gene are carried out separately from the amplification step of the duplication of exon 3 of the RHD gene, preferably by a multiplex amplification, in particular in distinct reaction vessels.
In a specific embodiment, the method may comprise a) contacting a first set of primers specific to the duplication of exon 3 of the RHD gene, a second set of primers specific to exon 5 of the RHD gene and a third set of primers specific to exon 10 of the RHD gene with the DNA sample and an amplification reaction mixture in conditions suitable for amplification; and b) detecting an amplification product of each set of primers. In particular, the detection of the presence of amplification products by the first, second and third set of primers is indicative of the presence of a weak D phenotype; the detection of the presence of amplification products by the second and third sets of primers and the absence of an amplification product by the first set of primers is indicative of the presence of a Rhesus D+ phenotype; the detection of the amplification product by the third set of primers and the absence of amplification products by the first and second sets of primers is indicative of the presence of a Rhesus D− phenotype; and/or the absence of amplification products by the first, second and third sets of primers is indicative of the presence of a Rhesus D− phenotype.
Exemplary methods for polymerizing and/or amplifying nucleic acids include, for example, polymerase-mediated extension reactions. For instance, the polymerase-mediated extension reaction can be the polymerase chain reaction (PCR). In other embodiments, the nucleic acid amplification reaction is a multiplex reaction. For instance, exemplary methods for polymerizing and/or amplifying and detecting nucleic acids suitable for use as described herein are commercially available as TaqMan® (see, e.g., U.S. Pat. Nos. 4,889,818; 5,079,352; 5,210,015; 5,436,134; 5,487,972; 5,658,751; 5,210,015; 5,487,972; 5,538,848; 5,618,711; 5,677,152; 5,723,591; 5,773,258; 5,789,224; 5,801,155; 5,804,375; 5,876,930; 5,994,056; 6,030,787; 6,084,102; 6,127,155; 6,171,785; 6,214,979; 6,258,569; 6,814,934; 6,821,727; 7,141,377; and/or 7,445,900, all of which are hereby incorporated herein by reference in their entirety).
In a particular embodiment, the amplification reaction mixture comprises a heat-stable DNA polymerase and an appropriate buffer (typically provided with the DNA polymerase), a set of amplification primers and dNTPs. Preferably the DNA polymerase is a high-fidelity DNA polymerase, i.e. with an error rate less than 10−5, more preferably less than 10−6. Examples of suitable available DNA polymerases include, but are not limited to, Pyrococcus furiosus (Pfu) DNA polymerase (Stratagene), Phusion™ DNA Polymerase (New England Biolabs), Platinum® Taq DNA Polymerase High Fidelity (Life Technologies), PfuUltra™ (Stratagene), or MyFi™ DNA polymerase (Bioline).
The amplification products can be detected by any suitable method well-known by the person skilled in the art. For instance, the amplification products can be detected by an electrophoresis including gel electrophoresis and capillary electrophoresis, mass spectrometry, hybridization with a probe specific to the amplification products, including microarray hybridization or solid support hybridization, and sequencing. In one preferred embodiment, the amplification products are detected by an electrophoresis including gel electrophoresis.
Several methods are now available to the person skilled in the art for carrying out amplification and detecting amplification products.
For instance, TaqMan® assays are typically carried out by performing nucleic acid amplification on a target polynucleotide using a nucleic acid polymerase having 5′-to-3′ nuclease activity, a primer capable of hybridizing to said target polynucleotide, and an oligonucleotide probe capable of hybridizing to said target polynucleotide 3′ relative to said primer. The oligonucleotide probe typically includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of said reporter molecule. Typically, the detectable label and quencher molecule are part of a single probe. As amplification proceeds, the polymerase digests the probe to separate the detectable label from the quencher molecule. The detectable label (e.g., fluorescence) is monitored during the reaction, where detection of the label corresponds to the occurrence of nucleic acid amplification (e.g., the higher the signal the greater the amount of amplification). Variations of TaqMan® assays (e.g., LNA™ spiked TaqMan® assay) are known in the art and would be suitable for use in the methods described herein.
Another exemplary system suitable for use as described herein utilizes double-stranded probes in displacement hybridization methods (see, e.g., Morrison et al. Anal. Biochem., 18:231-244 (1989); and/or Li, et al. Nucleic Acids Res., 30(2,e5) (2002)). In such methods, the probe typically includes two complementary oligonucleotides of different lengths where one includes a detectable label and the other includes a quencher molecule. When not bound to a target nucleic acid, the quencher suppresses the signal from the detectable label. The probe becomes detectable upon displacement hybridization with a target nucleic acid. Multiple probes may be used, each containing different detectable labels, such that multiple target nucleic acids may be queried in a single reaction.
Additional exemplary methods for polymerizing and/or amplifying and detecting target nucleic acids suitable for use as described herein involve “molecular beacons”, which are single-stranded hairpin shaped oligonucleotide probes. In the presence of the target sequence, the probe unfolds, binds and emits a signal (e.g., fluoresces). A molecular beacon typically includes at least four components: 1) the “loop”, an 18-30 nucleotide region which is complementary to the target sequence; 2) two 5-7 nucleotide “stems” found on either end of the loop and being complementary to one another; 3) at the 5′ end, a detectable label; and 4) at the 3′ end, a quencher moiety that prevents the detectable label from emitting a single when the probe is in the closed loop shape (e.g., not bound to a target nucleic acid). Thus, in the presence of a complementary target, the “stem” portion of the beacon separates out resulting in the probe hybridizing to the target. Other types of molecular beacons are also known and may be suitable for use in the methods described herein. Molecular beacons may be used in a variety of assay systems. One such system is nucleic acid sequence-based amplification (NASBA<®>), a single step isothermal process for polymerizing and/or amplifying RNA to double stranded DNA without temperature cycling. A NASBA reaction typically requires avian myeloblastosis virus (AMV), reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers. After amplification, the amplified target nucleic acid may be detected using a molecular beacon. Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein.
The Scorpions™ system is another exemplary assay format that may be used in the methods described herein. Scorpions™ primers are bi-functional molecules in which a primer is covalently linked to the probe, along with a detectable label (e.g., a fluorophore) and a non-detectable quencher moiety that quenches the fluorescence of the detectable label. In the presence of a target nucleic acid, the detectable label and the quencher separate which leads to an increase in signal emitted from the detectable label. Typically, a primer used in the amplification reaction includes a probe element at the 5′ end along with a “PCR blocker” element (e.g., a hexaethylene glycol (HEG) monomer (Whitcombe, et al. Nat. Biotech. 17: 804-807 (1999)) at the start of the hairpin loop. The probe typically includes a self-complementary stem sequence with a detectable label at one end and a quencher at the other. In the initial amplification cycles (e.g., PCR), the primer hybridizes to the target and extension occurs due to the action of polymerase. The Scorpions™ system may be used to examine and identify point mutations using multiple probes that may be differently tagged to distinguish between the probes. Using PCR as an example, after one extension cycle is complete, the newly synthesized target region will be attached to the same strand as the probe. Following the second cycle of denaturation and annealing, the probe and the target hybridize. The hairpin sequence then hybridizes to a part of the newly produced PCR product. This results in the separation of the detectable label from the quencher and causes emission of the signal. Other uses for such labeled probes are known in the art and would be suitable for use in the methods described herein.
In specific embodiment, the method for amplifying and detecting can be selected from quantitative multiplex PCT of short fluorescent fragments (QMPSF); Multiplex Ligation-dependent Probe Amplification (MLPA) and PCR in Real Time.
In one embodiment, the present invention relates to a probe suitable for detecting a duplication of exon in the RHD gene. Accordingly, the present invention relates to a probe or an oligonucleotide specifically hybridizing a portion of the RHD gene specific to the duplication of exon 3 of the RHD gene, more particularly a portion comprising at least 5, 6, 7, 8, 9 or 10 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof.
The probe is a nucleic acid including the breakpoint between intron 3 and exon 2 as shown in FIG. 5 (SEQ ID NO: 31 between position 26 and 27). Preferably, the probe comprise at least 5, 6, 7, 8, 9, 10, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, a sequence having at least 90, 95 or 99% of identity with SEQ ID NO: 31 or a complementary sequence thereof.
The probe can be labeled. In particular, the probe may comprise a fluorescent molecule, e.g., at its 5′ and 3′. Optionally, the probe may further comprise a quencher molecule, in particular suitable for quenching the fluorescent molecule.
In one embodiment, the means suitable for detecting a duplication of exon in the RHD gene combines a probe and a set of primers.
The present invention relates to an isolated, synthetic or recombinant nucleic acid comprising or consisting of a sequence comprising at least 10, 11, 12, 13, 14, 15, 20 or 25 nucleotides upstream and downstream of the breakpoint of SEQ ID NO: 31, or a sequence having at least 80, 85, 90 or 95% of identity therewith or a complementary sequence thereto. It also relates to an isolated, synthetic or recombinant nucleic acid comprising or consisting of a sequence of SEQ ID NO: 31 or a sequence having at least 80, 85, 90 or 95% of identity therewith or a complementary sequence thereto. In one embodiment, the nucleic acid may comprise or consist of a sequence of SEQ ID NO: 35. The nucleic acid may be at least 20, 25, 30, 40, 50, 75 or 100 bp in length. The nucleic acid may be for instance between 30 and 1000 bp in length, preferably between 50 and 500 bp. Said nucleic acid can be a probe or an amplification product. Said nucleic acid may comprise a label. The label can be a fluorescent label, a sequence tag (heterologous to the RHD gene) and the like. Said nucleic acid may comprise a fluorescent molecule and a quencher, in particular suitable for quenching the fluorescent molecule.
The present invention relates to an isolated or recombinant nucleic acid carrying a duplication of exon 3 of the RHD gene. In particular, it relates to a nucleic acid encoding a rhesus D antigen and carrying a duplication of exon 3 of the RHD gene. In one embodiment, the nucleic acid comprises the duplicated region of SEQ ID NO: 34 or a sequence having at least 90, 95, 98 or 99% of identity with SEQ ID NO: 34.
The present invention also relates to a kit. The kit is suitable for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype, wherein the kit comprises means suitable for specifically detecting a duplication of exon 3 of the RHD gene in a DNA sample. Preferably, the means can be a probe or a set of primers specific to the duplication of exon 3 of the RHD gene in the DNA sample or a combination thereof.
The kit may comprise any primer, set of primers or probe as disclosed above.
In a specific embodiment, the kit may comprise
    • a forward primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC
(SEQ ID NO: 20)
CTCATCTGGCACAACTCAGCG
and
(SEQ ID NO: 22)
GGCTGACATCATCAGTGACCAAGA
and
    • a reverse primer comprising, or consisting of, a sequence selecting from the group consisting of:
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG
(SEQ ID NO: 17)
TTCTTAGCATTTCACACAAATGCATG
(SEQ ID NO: 19)
GATCACCTGAACCCAGTGAGGT.
More specifically, the kit may comprise:
    • a forward primer comprising, or consisting of, a sequence
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC;
and
    • a reverse primer comprising, or consisting of, a sequence
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG.
The kit may further comprise one or several elements selected in the group consisting of:
    • a set of primer or a probe specific to exon 5 of the RHD gene;
    • a set of primer or a probe specific to exon 10 of the RHD gene; and
    • an amplification reaction mixture.
In a specific and preferred embodiment, the kit comprises the following primers:
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 3)
ACGTGTTGAGGGCATGACCTC;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 4)
GCCTGGATTCCTTGTGATACACG;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 1)
ATACCTTTGAATTAAGCACTTCACAGAG;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 2)
ACTGTGACCACCCAGCATTCTA;
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 5)
AGGCTGTTTCAAGAGATCAAGCCA;

and
    • a primer comprising, or consisting of, a sequence
(SEQ ID NO: 6)
GATGTTGTTATGTGGTACATGGCTG.
The kit may also comprise a leaflet.
The present invention further relates to the use of a kit for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample, for determining RHD genotype or for detecting a weak D phenotype.
EXAMPLES Example 1: Novel “RHD Duplication Exon 3” Allele
Although variability of Rh expression has been documented in the large Indian population, genetic studies have not been carried out so far. Then the inventors sought to characterize the molecular bases of weak D expression in Indians. To this aim, a subset of samples presenting with a weak D phenotype by serological analyses (n=223) was genotyped in the RHD gene by conventional molecular approaches. While referenced and novel single nucleotide variations were found, a novel ˜12-kilobase duplication event, including exon 3, was identified predominantly in weak D samples (130/223, 58.3%) and characterized at the molecular level. Further functional analyses showed that this genetic variation results in the expression of several transcripts, including a wild-type product. These results suggest that this allele quantitatively affects the expression of the normal transcript, and then subsequently the expression of the normal RhD protein, finally resulting in a weak D phenotype. Overall the present data describe a novel, major weak D allele in the Indian population that may be easily identified in routine by implementing an “Indian-specific, RHD genotyping assay” designed by the inventors.
A Novel Duplication is the Predominant Weak D Allele in Indians
As the inventors initially had no clue about the molecular variants in 223 samples, they first tested the Tm-shift screening assay for genotyping carrying weak D type 1 and/or weak D type 3 alleles in a subset of C+ samples (n=36) (Fichou et al., 2013, Transfusion, 53, 1821-1828). No variant allele was identified by this method. All ten RHD exons were then directly sequenced in these samples. To the inventors surprise, single nucleotide variations were found in only 3/36 (8.3%) samples, suggesting that this mutational mechanism is not so common in the Indian population.
The inventors then thought to genotype the samples by another method that has proven its potency in such a context, i.e. RHD QMPSF, which is more specifically dedicated to the identification of exon CNVs (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982). A common profile consisting of the RHD gene at the hemizygous state with an additional exon 3 was found in 26/36 samples by RHD QMPSF (FIG. 1). As a hybrid RHCE-D(3)-CE hybrid gene could be suspected from this result at the CE locus, samples were subsequently analyzed by RHCE QMPSF. This latter method indicated a wild-type pattern with two RHCE copies in all samples. These results suggest that 1) 26 samples of the subset share a common novel allele including two copies of RHD exon 3, and 2) RHD QMPSF is currently the most efficient genotyping method available in our laboratory for RHD screening in this population.
All samples were then primarily genotyped by this latter method. Overall 130/223 (58.3%) samples, including three homozygous samples, showed the specific exon 3 duplication profile, suggesting that this allele is the most common genetic defect resulting in the expression of a weak D phenotype in the Indian population. As all hemizygous and homozygous samples are Ccee and CCee, respectively, the inventors conclude that exon 3 duplication allele is in cis with a RHCE*Ce (or RHCE*02) allele.
Exon 3 Duplication is a Splicing Variant that Affects Quantitatively the Expression of D Antigen
To get insights into the mechanism involved in the expression of a weak D phenotype due to exon 3 duplication, the inventors sought to characterize the functional consequences of this allele. Total RNA of wild-type, RHD-negative and exon 3 duplication samples were extracted and analyzed by RT-PCR with primers targeting exons 2 and 4 specifically. Interestingly, while a single product composed by exons 2, 3, and 4 was found in the wild-type sample, several products were observed in the variant sample (FIG. 2). Subsequent sequencing revealed different combinations, including more importantly one wild-type product, suggesting that a full RhD protein may be biosynthesized; and another major product composed successively by exons 2 and 3; an additional, full-length exon 3; and finally exon 4. This latter result provides important information about both the genomic rearrangement and the functional mechanism involved in the expression of a weak D phenotype. Indeed it respectively suggests that 1) an additional exon 3 is located between exons 2 and 4 in the same orientation; and 2) although splicing is severely altered and production of wild-type transcript decreases, a wild-type RhD protein may be generated at a low level in agreement with the expression of a weak D phenotype.
To characterize the duplication event at the genomic level, the inventors designed a novel QMPSF assay to quantify several markers from exon 2 to exon 4 in 30 samples characterized as carrying an additional exon 3 by QMPSF (FIG. 3). A common genomic region spanning >10-kb was found to be duplicated. To identify the breakpoint(s), a series of PCR amplifications using QMPSF primers was carried out. While normal PCR amplifications were observed in intron 2 and intron 3, an additional, ˜2-kb PCR product was shown to be specifically amplified in exon 3 duplication samples with forward and reverse primers located within intron 3 and intron 2, respectively (FIG. 4). Other PCR primers were then designed to amplify a specific marker with minimal length. Finally a 407-bp fragment could be amplified and strictly showed the same sequence in 90 samples, including the 3′-end region of exon 2 (FIG. 5), suggesting a single mutational event. Overall the duplicated region was shown to be ˜12 kb in length, ranging from exon 2 to intron 3, and is inserted within intron 3 (FIG. 6).
Example 2: Genotyping Assay
Indian-specific, RHD gene variant genotyping assay is based on the multiplex Polymerase Chain Reaction (PCR) principle. Several PCR primers are mixed together for the specific amplification of four human genome targets. Targets are: 1) GAPDH; 2) RHD exon 10; 3) RHD exon 5; and 4) a specific RHD gene region of a novel weak D allele (“RHD duplication exon 3”) specifically identified in the Indian population. This primer pool is combined with a commercial PCR master mix, including thermostable DNA polymerase and genomic DNA, for PCR amplification of targets in a thermal cycler in standard conditions. PCR products are loaded onto an agarose gel for visualization and sizing. Samples exhibiting a specific “RHD duplication exon 3” band carry the novel variant D allele and may be considered as “wild-type” (i.e. D+).
This genotyping assay was designed to simplify RHD genotyping in the Indian population. After characterizing the novel “RHD duplication exon 3” allele, an assay was designed for the rapid screening of this allele. This test is based on the Polymerase Chain Reaction (PCR) principle, which may be easily implemented in a molecular biology laboratory.
Four targets were selected for the test:
    • 1) GAPDH gene (amplification positive control);
    • 2) RHD exon 10 (positive when RHD is present);
    • 3) RHD exon 5 (positive with wild-type RHD allele; negative with many RHD variant alleles of clinical interest);
    • 4) Specific domain within a novel weak D allele (“RHD duplication exon 3”) specifically identified in the Indian population.
Several experimental conditions were tested with different primer concentrations. Finally, a primer pool (concentration 2×) was prepared (Table 1) and tested successfully (FIG. 6). This primer mix is the key-component of the genotyping assay.
TABLE 1
Primer sequences and concentrations in the 2X Primer Pool (C2X).
Primers
Size C2X
Target (bp) SEQ ID NO: Sequence (5′→3′) (μM)
RHD exon 5 605 1 ATACCTTTGAATTAAGCACTTCACAGAG 1.2
2 ACTGTGACCACCCAGCATTCTA 1.2
RHD exon 3 dup 407 3 ACGTGTTGAGGGCATGACCTC 0.4
4 GCCTGGATTCCTTGTGATACACG 0.4
RHD exon 10 344 5 AGGCTGTTTCAAGAGATCAAGCCA 0.4
6 GATGTTGTTATGTGGTACATGGCTG 0.4
GAPDH  97 7 CCCCACACACATGCACTTACC 0.6
8 CCTAGTCCCAGGGCTTTGATT 0.6
Reagents for carrying out this test are: 1/ Commercial 2×PCR Master Mix, including thermostable DNA polymerase; and 2/ 2× Primer Pool. Reagents are mixed together (V/V). Genomic DNA is added to this mixture prior to PCR amplification. Experimental PCR conditions are typically those described by the PCR Master Mix manufacturer, with a 60° C. annealing temperature as described above.
PCR amplification products are loaded onto an agarose gel for sizing specific bands (FIG. 6) and genotype interpretation by using the interpretation guide (Table 2).
TABLE 2
Interpretation guide of the genotyping assay.
RHD RHD RHD
GAPDH exon
3 dup exon 5 exon 10 Results
Re-test
+ D negative
+ + D negative/partial D*
+ + + D positive*
+ + + + D positive/weak D
+: amplification;
−: no amplification. Other combinations are theoretically possible, but have not been tested.
*Other genotyping methods (Sanger sequencing, microarray . . .) may be necessary to characterize genotype accurately.
This assay may be used to genotype samples, and more specifically to identify the most prevalent weak D variant allele in the Indian population (˜60% samples presenting with a weak D phenotype) in ˜2 hours only after genomic DNA extraction. Test cost is supposed to be less than 1 f (reagent/test). Only thermal cycler and gel electrophoresis unit are necessary to carry out the test. Thus it is a simple, easy-handling cost-effective genotyping assay.
Moreover, this test may be used to identify the molecular basis of D-negative phenotype (i.e. whole RHD gene deletion vs nonfunctional RHD allele), because of the presence of two RHD-specific markers (exon 5 and exon 10).
Materials and Methods
RHD Genotyping and Mapping of the Duplicated Region
RHD gene exons were first amplified by multiplex PCR and sequenced as previously described (Fichou et al., 2013, Transfusion, 53, 1821-1828). Alternatively copy number variations (CNVs) of RHD exons were analyzed by RHD QMPSF for exon quantitation (Fichou et al, 2013b). RHCE QMPSF was carried out when a hybrid RHD-CE-D gene was suspected.
To delineate the duplicated region another QMPSF assay based on universal fluorescent labeling was designed as previously described (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982). Additionally to the reference markers in HFE and F9, as well as RHD-specific markers in RHD exons 2, 4, and 7, five other primer sets were designed with PrimerQuest Tool (www.eu.idtdna.com/primerquest/home/index/) with default parameters to amplify markers in introns 2 (n=2; RHD_i2a and RHD_i2b) and 3 (n=3; RHD_i3a, RHD_i3b and RHD_i3c) (Table 3). PCR amplification conditions and analysis methods were as described before (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982).
TABLE 3
QMPSF primers and conditions for mapping the duplicated region.
Primer
concentration
Size forward/reverse
Marker Forward primer* (5′→3′) Reverse primer (5′→3′) (bp) (nM)
HFE U-AGCAGGACCTTGGTCTTTCCTT H-ACCCTTGCTGTGGTTGTGAT 254 2/200
SEQ ID NO: 10 SEQ ID NO: 11
F9 U-ACCATGACATTGCCCTTCTGGA H-AGACATGTGGCTCGGTCAACAA 238 2/200
SEQ ID NO: 12 SEQ ID NO: 13
RHD_e2 U-CTTGGGCTTCCTCACCTCGAG H-TGTGATGACCACCTTCCCAGA 172 1/100
SEQ ID NO: 14 SEQ ID NO: 15
RHD_i2a U- H- 123 1/100
AGCCCCCTAATGCTGCTAGACAAT TTCTTAGCATTTCACACAAATGCATG
SEQ ID NO: 16 SEQ ID NO: 17
RHD_i2b U- H-GATCACCTGAACCCAGTGAGGT 143 4/400
CACTGTGTCCAGCCTAAAACTGTT SEQ ID NO: 19
SEQ ID NO: 18
RHD_i3a U-CTCATCTGGCACAACTCAGCG H-CCAGATCTATCCCACCCCAACA 100 2/200
SEQ ID NO: 20 SEQ ID NO: 21
RHD_i3b U- H-  97 2/200
GGCTGACATCATCAGTGACCAAGA CATCACACTCTCCCTTTCTTGCTGT
SEQ ID NO: 22 SEQ ID NO: 23
RHD_i3c U- H-TAAGAACTGAAAAGCGGGCTTGT 107 2/200
AATCCCCAAGTGTTCTTCCTGAAC SEQ ID NO: 25
SEQ ID NO: 24
RHD_e4 U- H-CCATTCTGCTCAGCCCAAGTAG 221 3/300
ACTACCACATGAACATGATGCACA SEQ ID NO: 27
SEQ ID NO: 26
RHD_e7 U-ACAGCTCCATCATGGGCTACAA H-CCAAGGTAGGGGCTGGACAG 301 4/400
SEQ ID NO: 28 SEQ ID NO: 29
RHD-specific nucleotides are underlined; bp: base pairs.
*U refers to as the 20-mer, universal primer sequence 5′-GTCGTAGTCGACGACCGTTA-3′ (SEQ ID NO: 9).
H refers to as the 5′-GTTTCTT-3′ nucleotide heptamer.
Indian-Specific RHD Genotyping Assay
PCR primers are mixed at a 2× concentration to amplify four targets: GAPDH, RHD exon 3 duplication marker, RHD exons 5 and 10 markers (Table 1). PCR primer pool was mixed with 1× HotStarTaq Master Mix (Qiagen) and 1 μL genomic DNA (20-100 ng/μL). PCR conditions were: an initial denaturation step at 95° C. for 15 min, followed by 40 cycles of denaturation at 95° C. for 30 sec, annealing at 60° C. for 30 sec, extension at 72° C. for 30 sec; and a final extension step at 72° C. for 10 min. PCR products were loaded on a 1.5% agarose gel for visualization.
Breakpoint Mapping
Breakpoint was PCR-amplified and sequenced with primers RHD_i3ex3dup_F and RHD_i2ex3dup_R in standard conditions.
To characterize the duplicated region, three PCR amplifications were carried out. Primer sets were RHD_e2 (forward)/RHD_i2a (reverse); RHD_i3b (forward)/RHD_i3c (reverse); and RHD_i3b (forward)/RHD_i2a (reverse) (Table 3). Breakpoint was finally PCR-amplified with primers RHD_i3ex3dup_F (5′-ACGTGTTGAGGGCATGACCTC-3′ SEQ ID NO: 3) and RHD_i2ex3dup_R (5′-GCCTGGATTCCTTGTGATACACG-3′ SEQ ID NO: 4) (RHD-specific nucleotides are underlined). All PCR amplifications were carried out with HotStarTaq Master Mix Kit (Qiagen, Courtaboeuf, France) in a 10 μL final volume with 1× HotStarTaq Master Mix, 0.4 μM of both forward and reverse primers, and 1 μL genomic DNA solution (20-100 ng/μL) as a template. PCR conditions were: an initial denaturation step at 95° C. for 15 min, followed by 40 cycles of denaturation at 95° C. for 30 sec, annealing at 60° C. for 30 sec, extension at 72° C. for 30 sec; and a final extension step at 72° C. for 10 min.
PCR products were loaded on an agarose gel and treated by USB® ExoSAP-IT® PCR cleanup reagent (Affymetrix, purchased from Ozyme, St-Quentin-en-Yvelines, France) prior to direct sequencing with PCR primers as previously described (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982).
Reverse-Transcription (RT)-PCR and Sequencing
Total RNA was extracted from fresh whole blood by using Trizol-based RNA extraction method. Total RNA was reverse-transcribed with Revert Aid First Strand cDNA synthesis kit (Thermo Fisher Scientific Inc., USA) to generate complementary DNA (cDNA) stored at −20° C. until further processing.
One target, i.e. RHD exons 2 to 4 (forward: 5′-CTTGGGCTTCCTCACCTCGAG-3′ (SEQ ID NO: 36); reverse: 5′-CGAACACGTAGATGTGCATCAT-3′ (SEQ ID NO: 37)), one RHD-positive control, i.e. RHD exons 6 to 8 (forward: 5′-GAGCCAAGTACCTGCCGGG-3′ (SEQ ID NO: 38); reverse: 5′-ATCATGCCATTGCCGGCT-3′ (SEQ ID NO: 39)) and one reference gene, i.e. ACTB (forward: 5′-TCTCCATGTCGTCCCAGTTG-3′ (SEQ ID NO: 40); reverse: 5′-AGTCTTCCCCTCCATCGTTG-3′ (SEQ ID NO: 41)) were amplified by PCRs (RHD-specific nucleotides are underlined). PCR amplifications were carried out with HotStarTaq Master Mix Kit (Qiagen, Courtaboeuf, France) in a 10 μL final volume with 1× HotStarTaq Master Mix, 0.4 μM of both forward and reverse primers, and 1 μL cDNA solution as a template. PCR conditions were as describe above.
PCR products were loaded on an agarose gel, gel-purified with QIAquick Gel Extraction Kit (Qiagen), and subcloned into the pCR™ 4-TOPO® Vector by using the TOPO® TA Cloning® Kit for Sequencing (Thermo Fisher Scientific, Courtaboeuf, France) according to the manufacturer's instructions. Cloning products were transformed into One Shot® TOP10 Chemically Competent E. coli (Thermo Fisher Scientific) and directly sequenced by T7 and T3 primers in conditions previously described (Fichou et al, 2013, Transfusion, 53(11 suppl 2), 2974-2982).

Claims (10)

The invention claimed is:
1. A method for detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample comprising:
contacting a probe or a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample, and
detecting a hybridization of the probe or an amplification product of the set of primers,
wherein the detection of said hybridization or said amplification product is indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample,
wherein the probe is specific to the duplication of exon 3 of the RHD gene and specifically hybridizes to a portion of the RHD gene specific to the duplication of exon 3 comprising at least 5 nucleotides upstream of the breakpoint in SEQ ID NO: 31 and comprising at least 5 nucleotides downstream of the breakpoint in SEQ ID NO: 31, or the complement thereof; and
wherein the set of primers specific to the duplication of exon 3 of the RHD gene comprises a forward primer specific to the partial intron 3 located upstream of the breakpoint in SEQ ID NO: 31 and a reverse primer specific to the Exon2/intron2 region of the duplicated region located downstream of the breakpoint in SEQ ID NO: 31.
2. The method according to claim 1, wherein the probe or the amplification product has a sequence comprising at least 5 nucleotides upstream and at least 5 nucleotides downstream of the breakpoint of SEQ ID NO: 31 or the complement thereof, the probe or amplification product having at least 20 nucleotides in length.
3. The method according to claim 1, wherein the method comprises:
a) contacting a set of primers specific to the duplication of exon 3 of the RHD gene with the DNA sample and an amplification reaction mixture;
b) producing the amplification product using a primer-dependent DNA amplification reaction; and
c) detecting the amplification product, the detection of said amplification product being indicative of the presence of a duplication of exon 3 of the RHD gene in the DNA sample.
4. The method according to claim 3, wherein the step b) is a multiplex amplification.
5. The method according to claim 3, wherein the primer-dependent DNA amplification reaction is a PCR reaction.
6. The method according to claim 1, wherein the method further comprises the detection of the presence of one or several exons of the RHD gene.
7. The method according to claim 1, wherein the set of primers comprises:
a forward primer specific to a sequence of the partial intron 3 located within 1000 bp upstream of the breakpoint in SEQ ID NO: 31; and
a reverse primer specific to a sequence of the Exon2/intron2 region of the duplicated region located within 1000 bp downstream of the breakpoint in SEQ ID NO: 31.
8. The method according to claim 1, wherein the set of primers includes:
a forward primer comprising, or consisting of, a sequence selected from the group consisting of:
(SEQ ID NO: 3) ACGTGTTGAGGGCATGACCTC; (SEQ ID NO: 20) CTCATCTGGCACAACTCAGCG; and (SEQ ID NO: 22) GGCTGACATCATCAGTGACCAAGA;
and
a reverse primer comprising, or consisting of, a sequence selected from the group consisting of:
(SEQ ID NO: 4) GCCTGGATTCCTTGTGATACACG; (SEQ ID NO: 17) TTCTTAGCATTTCACACAAATGCATG; and (SEQ ID NO: 19) GATCACCTGAACCCAGTGAGGT.
9. The method according to claim 8, wherein the set of primers includes:
a forward primer comprising, or consisting of, a sequence
(SEQ ID NO: 3) ACGTGTTGAGGGCATGACCTC;
and
a reverse primer comprising, or consisting of, a sequence
(SEQ ID NO: 4) GCCTGGATTCCTTGTGATACACG.
10. A method for determining RHD genotype or for detecting a weak D phenotype, comprising detecting the presence of a duplication of exon 3 of the RHD gene in a DNA sample according to claim 1, wherein the presence of a duplication of exon 3 of the RHD gene in the DNA sample is indicative of a weak D phenotype.
US16/491,645 2017-03-08 2018-03-07 RhD gene allele associated with a weak D phenotype and its uses Expired - Fee Related US11248261B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP17305246.5 2017-03-08
EP17305246 2017-03-08
EP17305246 2017-03-08
PCT/EP2018/055529 WO2018162516A1 (en) 2017-03-08 2018-03-07 Rhd gene allele associated with a weak d phenotype and its uses

Publications (2)

Publication Number Publication Date
US20200291451A1 US20200291451A1 (en) 2020-09-17
US11248261B2 true US11248261B2 (en) 2022-02-15

Family

ID=58358523

Family Applications (1)

Application Number Title Priority Date Filing Date
US16/491,645 Expired - Fee Related US11248261B2 (en) 2017-03-08 2018-03-07 RhD gene allele associated with a weak D phenotype and its uses

Country Status (5)

Country Link
US (1) US11248261B2 (en)
EP (1) EP3592860B1 (en)
CA (1) CA3053875A1 (en)
WO (1) WO2018162516A1 (en)
ZA (1) ZA201905861B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111304211B (en) * 2020-03-10 2020-12-01 无锡市第五人民医院 RHD-T268A mutant and its detection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008151110A2 (en) * 2007-06-01 2008-12-11 The University Of North Carolina At Chapel Hill Molecular diagnosis and typing of lung cancer variants
WO2012171990A1 (en) 2011-06-17 2012-12-20 Progenika Biopharma, S.A. Discrimination of blood type variants

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618711A (en) 1986-08-22 1997-04-08 Hoffmann-La Roche Inc. Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase
US6127155A (en) 1986-08-22 2000-10-03 Roche Molecular Systems, Inc. Stabilized thermostable nucleic acid polymerase compositions containing non-ionic polymeric detergents
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US5079352A (en) 1986-08-22 1992-01-07 Cetus Corporation Purified thermostable enzyme
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5994056A (en) 1991-05-02 1999-11-30 Roche Molecular Systems, Inc. Homogeneous methods for nucleic acid amplification and detection
US5436134A (en) 1993-04-13 1995-07-25 Molecular Probes, Inc. Cyclic-substituted unsymmetrical cyanine dyes
US5658751A (en) 1993-04-13 1997-08-19 Molecular Probes, Inc. Substituted unsymmetrical cyanine dyes with selected permeability
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
US6821727B1 (en) 1993-11-15 2004-11-23 Applera Corporation Hybridization assay using self-quenching fluorescence probe
US5801155A (en) 1995-04-03 1998-09-01 Epoch Pharmaceuticals, Inc. Covalently linked oligonucleotide minor grove binder conjugates
US5773258A (en) 1995-08-25 1998-06-30 Roche Molecular Systems, Inc. Nucleic acid amplification using a reversibly inactivated thermostable enzyme
US20110262916A1 (en) 2008-07-18 2011-10-27 Wen-Hua Fan Non-invasive fetal rhd genotyping from maternal whole blood
FR3008096B1 (en) 2013-07-03 2015-08-14 Gregory Raux KIT AND METHOD FOR IN VITRO DETECTION OF RHESUS D

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008151110A2 (en) * 2007-06-01 2008-12-11 The University Of North Carolina At Chapel Hill Molecular diagnosis and typing of lung cancer variants
WO2012171990A1 (en) 2011-06-17 2012-12-20 Progenika Biopharma, S.A. Discrimination of blood type variants

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Flegel et al. Molecular Biology of partial D and weak D: Implications for Blood Bank Practice (2002) Clin. Lab. 48:53-59. (Year: 2002). *
Wagner et al. Molecular Basis of Weak D Phenotypes (1999) Blood vol. 93, No. 1 pp. 385-393. (Year: 1999). *
Wagner et al. The Rhesus Site (2014) Transf Med Hemother 5:357-363. (Year: 2014). *
Written Opinion in International Application No. PCT/EP2018/055529, dated May 16, 2018, pp. 1-6.

Also Published As

Publication number Publication date
US20200291451A1 (en) 2020-09-17
ZA201905861B (en) 2022-05-25
WO2018162516A1 (en) 2018-09-13
EP3592860B1 (en) 2021-11-03
CA3053875A1 (en) 2018-09-13
EP3592860A1 (en) 2020-01-15

Similar Documents

Publication Publication Date Title
US20220073909A1 (en) Methods and compositions for rapid nucleic library preparation
US9404150B2 (en) Methods and compositions for universal size-specific PCR
US20120214160A1 (en) Methods, compositions, and kits for detecting rare cells
EP3455375B1 (en) Detection of met exon 14 deletions
US12404556B2 (en) Compositions and methods for detecting circulating tumor DNA
JP2015512655A (en) Detection and quantification of sample contamination in immune repertoire analysis
CN111670254B (en) Improved detection of microsatellite instability
US10975440B2 (en) Experimentally validated sets of gene specific primers for use in multiplex applications
KR101890350B1 (en) SNP maker for predicting meat quality of pig and use thereof
KR102807365B1 (en) SNP marker set and method to identify Yellow-brown Korean Native Chicken population
KR102807363B1 (en) SNP marker set and method to identify Korean black cornish population
US11655510B2 (en) Experimentally validated sets of gene specific primers for use in multiplex applications
TWI567202B (en) Method and kit for determination of alcohol metabolizing genes
EP3592860B1 (en) Rhd gene allele associated with a weak d phenotype and its uses
JP2011500062A (en) Detection of blood group genes
CN105899675B (en) major histocompatibility complex single nucleotide polymorphism
CN114645077B (en) A method and kit for detecting the presence or proportion of a donor in a recipient sample
KR102001528B1 (en) Gene marker for discrimination of Korean Native pig and use thereof
KR102807347B1 (en) SNP marker set and method to identify Red-brown Korean Native Chicken population
KR102779173B1 (en) Discrimination method for identification and sex of goats using microsatellite DNA
KR20190041798A (en) Composition for discrimination of sex and breed for cattle, and discriminating method using the same
Jackson et al. in Hematopathology

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: ETABLISSEMENT FRANCAIS DU SANG, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FICHOU, YANN;KULKARNI, SWATI;REEL/FRAME:052449/0310

Effective date: 20200121

Owner name: NATIONAL INSTITUTE OF IMMUNOHAEMATOLOGY, INDIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FICHOU, YANN;KULKARNI, SWATI;REEL/FRAME:052449/0310

Effective date: 20200121

Owner name: UNIVERSITE DE BRETAGNE OCCIDENTALE (UBO), FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FICHOU, YANN;KULKARNI, SWATI;REEL/FRAME:052449/0310

Effective date: 20200121

Owner name: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE), FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FICHOU, YANN;KULKARNI, SWATI;REEL/FRAME:052449/0310

Effective date: 20200121

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: AWAITING TC RESP., ISSUE FEE NOT PAID

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20260215