TWI850037B - LincRNA-p21 AND USE THEREOF - Google Patents

Abstract

The present invention provides a composition for treating cancer comprising a DDB2 inhibitor and a chemotherapeutic agent, in which the DDB2 inhibitor comprises three RNA fragments from lincRNA-p21. In addition, the DDB2 inhibitor enhances the chemosensitivity of the cancer to the chemotherapeutic agent for treating cancers that do not respond to chemotherapy.

Description

LincRNA-p21 and its uses

The present invention relates to a composition for treating cancer, wherein the composition comprises three RNA sequence fragments from lincRNA-p21 and a chemotherapeutic agent. In particular, the three RNA sequence fragments of lincRNA-p21 with DDB2 targeting activity can increase the sensitivity of multiple cancers to chemotherapeutic agents.

The DNA damage response (DDR) induced by chemotherapy treatment activates p53 to transcriptionally regulate gene expression, which can determine the fate of cells toward aging, cell cycle progression, apoptosis, or DNA repair. High DNA repair activity in cancer cells through nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR), or non-homologous end joining (NHEJ) contributes to the development of chemotherapy resistance. Targeting various DDR or DNA repair components has been regarded as a promising strategy for cancer treatment. BRCA1/2 mutant tumors are highly sensitive to inhibition of poly(ADP-ribose) polymerase (PARP), leading to the success of PARP inhibitors in clinical treatment. Therefore, achieving additive lethality by co-targeting various DNA repair/DDR pathways provides a paradigm for the development of novel and potential clinical strategies.

In the DNA repair mechanism, NER plays a key role in the removal of DNA damage induced by cisplatin or doxorubicin. Under chemotherapy stimulation, damaged DNA-binding protein 2 (DDB2) is upregulated due to the activation of p53 to become the first protein to recognize damaged DNA. Subsequently, DNA-bound DDB2 is polyubiquitinated and degraded by the proteasome, and the damaged DNA site is transferred to the second recognition protein XPC to further recruit other DNA repair proteins involved in NER. DDB2 expression is induced by DNA damaging agents (including doxorubicin) and leads to chemoresistance. Mutations or defects in DDB2 reduce the recognition of damaged DNA and the recruitment of NER-related proteins, leading to a failure of DNA repair. In addition, PARP1 has also been reported to promote NER efficacy by interacting to stabilize DDB2 protein expression. Inhibition of DDB2 can disrupt the stability of Rad51 to increase the cell sensitivity of triple-negative breast cancer to PARP inhibitors, indicating that DDB2 also has an additional role to regulate HR. In addition to DNA repair, DDB2 activity also occurs at several stages of tumor progression, including cancer cell proliferation, survival, epithelial-mesenchymal transition, migration and invasion, and the formation of cancer stem cells. Therefore, targeting DDB2 is a potential strategy to improve chemotherapy chemosensitivity and increase the anticancer activity of PARP inhibitors. However, there are currently no DDB2 inhibitors or modulators available for cancer treatment.

Although nucleic acid therapy can also be applied to cancer treatment, the stability, delivery efficiency and structure of RNA remain a problem, and RNA therapy still lags behind other therapies in terms of cancer treatment strategies.

Since most long non-coding RNAs (lncRNAs) are at least 200 nt in length, it is quite difficult to use lncRNA as a therapeutic strategy for RNA therapy. Therefore, lncRNA has received little attention and application in clinical practice, and most lncRNAs are considered disease markers rather than therapeutic drugs.

The present invention has demonstrated a negative correlation between lincRNA-p21 and DDB2 in different subtypes of breast cancer cell lines and clinical samples expressing mutp53. Increased lincRNA-p21 enhances the polyubiquitination and proteasomal degradation of DDB2 by serving as a scaffold for the Cul-4/DDB1/DDB2 E3 conjugase complex. LincRNA-p21 downregulation of DDB2 has been shown to inhibit DNA repair. More importantly, three essential sequence fragments of lincRNA-p21, including 5'-CUUGU-GUCCCCUUCCCACAG-3'(671nt-690nt; #3)(SEQ ID NO: 1); 5'-CAGGGAACCCCUUCAAUCCC-3'(875nt-894nt; #4)(SEQ ID NO: 2); and 5'-UGGGAGCCCCCUUCCUAAAA-3'(2,158nt-2,177nt; #9)(SEQ ID NO: 3), have been verified in different binding experiments to directly interact with and inhibit DDB2 protein. Calculation of structural binding capacity also revealed that the short sequence fragments of lincRNA-p21 would affect the stability of DDB2 and the possibility of DNA repair. The experiment found that the combined treatment of lincRNA-p21 short sequence fragments or exosomes containing lincRNA-p21 short sequence fragments can enhance chemotherapy-induced cytotoxicity in cancer cells.

LincRNA-p21 short sequence fragments, which can function as lncRNA-based DDB2 inhibitors using exosomes as a delivery system, show the potential to enhance chemotherapy sensitivity and may benefit patients with breast cancer or other cancer types that are unresponsive to chemotherapy.

As used herein, the term "a" or "an" is used to describe elements and components of the present invention. This is done only for convenience and to give a general sense of the present invention. This description should be understood to include one or at least one, and the singular also includes the plural, unless it is obvious that there is another meaning.

The term "or" as used herein may mean "and/or".

The present invention provides a nucleic acid molecule comprising a long intergenic non-coding RNA-p21 (lincRNA-p21) sequence, wherein the lincRNA-p21 sequence is selected from the group consisting of CUUGUGUCCCCUUCCCACAG (SEQ ID NO: 1), CAGGGAACCCCUUCAAUCCC (SEQ ID NO: 2) and UGGGAGCCCCCUUCCUAAAA (SEQ ID NO: 3).

The present invention also provides a composition comprising a lincRNA-p21 sequence, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

In addition, the present invention further provides a method for treating cancer, comprising administering a composition to an individual suffering from cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

The present invention provides a composition for preparing a drug for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

The present invention also provides a composition for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

The term "individual" as used herein refers to an animal, particularly a mammal. In a preferred embodiment, the individual is a human.

Damaged DNA binding protein 2 (DDB2) is an important protein that recognizes DNA damage to activate DNA repair and make cancer cells resistant to chemotherapy. In the present invention, three short sequence fragments from lincRNA-p21 interfere with the DNA damage repair pathway. In addition, the sequence fragments of lincRNA-p21 can inhibit DNA repair performed by DDB2, thereby enhancing the anti-cancer effect of chemotherapy. Therefore, the sequence fragments of lincRNA-p21 inhibit the expression of DDB2 to reverse or reduce the resistance of cancer cells to chemotherapy and/or enhance the sensitivity of cancer cells to chemotherapy. In one embodiment, the sequence fragment of lincRNA-p21 enhances the sensitivity of the cancer to the chemotherapy agent by inhibiting the expression of DDB2. Therefore, DDB2 can be identified as a therapeutic target for cancer. In one embodiment, the cancer comprises a cancer with high expression of DDB2. In the present invention, the cancer with high expression of DDB2 refers to a cancer in which the expression of DDB2 in tumor tissue is more than 1.5 times higher than that in normal tissue. In another embodiment, the cancer has a poor response or resistance to the chemotherapy agent. In a preferred embodiment, the cancer with high expression of DDB2 has a poor response or resistance to the chemotherapy agent.

In some aspects, the chemotherapeutic agent is an anticancer drug. In a specific embodiment, the cancer is a drug-resistant cancer. Therefore, the cancer is resistant to the chemotherapeutic agent. In the present invention, a method is provided to reduce the drug resistance of a chemotherapeutic agent used to treat cancer, comprising administering a composition to a drug-resistant cancer individual, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The lincRNA-p21 sequence can reverse or reduce the resistance of cancer cells to chemotherapeutic agents and/or enhance the sensitivity of cancer cells to chemotherapeutic agents.

The term "treatment" includes but is not limited to reducing, inhibiting or limiting the growth of cancer cells, reducing, inhibiting or limiting the metastasis of cancer cells or the invasion and metastasis of cancer cells, or reducing, inhibiting or limiting one or more symptoms of cancer or its metastasis.

In one embodiment, the cancer includes breast cancer, liver cancer, cholangiocarcinoma, lung cancer, colon cancer, head and neck squamous cell carcinoma, stomach adenocarcinoma and esophageal carcinoma. In a preferred embodiment, the cancer includes breast cancer and liver cancer. In a more preferred embodiment, the cancer includes breast cancer.

In another embodiment, the cancer cell has a p53 mutation. In a preferred embodiment, the breast cancer cell has a p53 mutation. In a more preferred embodiment, the breast cancer cell is estrogen receptor (ER) positive and has a p53 mutation.

In one embodiment, the breast cancer is poorly responsive or resistant to the chemotherapy agent.

As used herein, the chemotherapeutic agent is a compound that can inhibit the growth of cancer cells or tumors. It should be understood that one or more chemotherapeutic agents can be used in any of the methods provided herein. For example, two or more chemotherapeutic agents, three or more chemotherapeutic agents, four or more chemotherapeutic agents, etc. can be used in the methods provided herein. Exemplary chemotherapeutic agents include, but are not limited to, anticancer compounds such as cyclophosphamide, doxorubicin, 5-fluorouracil, docetaxel, paclitaxel, methotrexate, epirubicin, cisplatin, carboplatin, vinorelbine, capecitabine, gemcitabine, mitoxantrone, isabepilone, eribulin, carmustine, nitrogen mustard, sulfur mustard, platinum tetranitrate, and the like. tetranitrate), vinblastine, etoposide, camptothecin, topoisomerase inhibitors, and derivatives thereof, or one or more combinations thereof. In a specific embodiment, the chemotherapeutic agent comprises carboplatin, cisplatin or doxorubicin.

In certain aspects, the sequence fragment of lincRNA-p21 can effectively enhance the therapeutic effect of the chemotherapeutic agent. As used herein, the term "enhancing the therapeutic effect" includes any of a number of subjective or objective conditions that show a beneficial response or improvement in the condition treated as discussed herein. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes reversing or reducing cancer cell resistance and/or enhancing the sensitivity of resistant cancer to chemotherapeutic treatment. In addition, for example, enhancing the therapeutic effect of a chemotherapeutic agent includes changing resistant cancer cells so that the cells do not develop resistance to the chemotherapeutic agent. In addition, for example, enhancing the therapeutic effect of a chemotherapeutic agent includes additionally or synergistically improving or increasing the activity of the chemotherapeutic agent.

In the present invention, the composition comprises one or more lincRNA-p21 sequence fragments and one or more chemotherapeutic agents. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. The term "carrier" refers to a compound, composition, substance or structure that helps or promotes the preparation, storage, administration, delivery, effectiveness, selectivity or any other characteristics of a compound or composition when combined with a compound or composition to achieve its intended use or purpose. In other embodiments, the pharmaceutically acceptable carrier comprises a liposome, a nanoparticle, an exosome, a micelle, a polymeric matrix or a gel matrix. In the present invention, the sequence fragment of lincRNA- p21 is contained in liposomes, nanoparticles, exosomes, micelles, polymer matrices or gel matrices, and forms a complex with liposomes, nanoparticles, exosomes, micelles, polymer matrices or gel matrices. In a specific embodiment, the pharmaceutically acceptable carrier comprises liposomes or exosomes.

In the present invention, the sequence fragment of lincRNA-p21 can be loaded into the exosome. In another specific embodiment, the pharmaceutically acceptable carrier comprises exosomes, wherein the exosomes comprise the sequence fragment of lincRNA-p21. The exosomes containing the sequence fragment of lincRNA-p21 are prepared for the treatment of cancer. In addition, the exosomes can be combined with anti-human leukocyte antigen G (HLAG) antibodies to form anti-HLAG exosomes. Since HLAG is highly expressed in many cancers, the use of anti-HLAG antibodies is to increase the delivery efficiency of the exosomes containing the sequence fragment of lincRNA-p21 and the chemotherapy agent to cancer cells. In a specific embodiment, the composition further comprises a targeting molecule for binding to a biomarker on cancer cells. In a preferred embodiment, the targeting molecule comprises an anti-HLAG antibody. Therefore, the anti-HLAG antibody can bind to the sequence fragment of the lincRNA-p21 or the exosome to form a therapeutic complex for treating cancer.

In the methods provided herein, the sequence fragment of lincRNA-p21 can be administered before, simultaneously with, or after the chemotherapy is administered to the individual. In addition, the composition of the present invention can be administered by any of a variety of routes, including: by injection (e.g., subcutaneous, intramuscular, intravenous, intraarterial, intraperitoneal), by continuous intravenous infusion, transdermal, subcutaneous, transdermal, oral (e.g., tablets, pills, liquid medicine, edible film strips), implanted osmotic pumps, suppositories, or aerosol sprays. Administration routes include, but are not limited to, topical, intradermal, intrathecal, intralesional, intratumoral, intravesical, intravaginal, intraocular, intrarectal, intravesical, intrapulmonary, intracranial, intraventricular, intraspinal, dermal, subcutaneous, intraarticular, placement in body cavities, nasal inhalation, pulmonary inhalation, skin compression, and electroporation. Administration may be systemic or local. Pharmaceutical compositions may be delivered locally to the area in need of treatment, such as by topical application or local injection. Multiple administrations and/or doses may also be used.

In the present invention, a therapeutically effective amount of a composition containing a sequence fragment of lincRNA-p21 and a chemotherapeutic agent is administered to the individual. The term "therapeutically effective amount" is defined as any amount required to produce a physiological response. The dosage range administered is a dosage range that is large enough to produce the desired effect, in which one or more symptoms of the disease or disorder are affected (e.g., alleviated or delayed). The dosage should not be so large as to cause significant adverse side effects, such as unwanted cross-reactions, allergic reactions, etc.

The dosage of the sequence fragment of lincRNA-p21 or the chemotherapeutic agent is generally in the range of about 0.0001, 0.001 or 0.01 mg/kg/day to about 1000 mg/kg/day, but may be higher or lower, depending on, among other factors, the activity of the composition, its bioavailability, the mode of administration, and the various factors discussed above. The dosage and interval can be adjusted individually to provide local and/or systemic concentrations of exosomes sufficient to maintain a therapeutic or preventive effect. For example, the composition may be administered once a week, several times a week (e.g., every other day), once a day, or several times a day, depending on, among other things, the mode of administration, the specific indication being treated, and the judgment of the prescribing physician. A skilled technician will be able to optimize the effective local dosage without undue experimentation. In one embodiment, the therapeutically effective amount of the composition ranges from 0.01 to 100 mg/kg body weight. In a preferred embodiment, the therapeutically effective amount of the composition ranges from 0.1 to 50 mg/kg body weight. In a more preferred embodiment, the therapeutically effective amount of the composition ranges from 1 to 10 mg/kg body weight.

Therefore, chemotherapy resistance is the main problem faced by various cancers in clinical treatment. Among them, DNA repair induced by DDB2 protein is one of the main reasons why cancer cells are insensitive to chemotherapy. The present invention mainly discovered that lincRNA-p21 can directly bind to DDB2 and cause its degradation; therefore, lincRNA-p21 can be used as the first DDB2 inhibitor, which can improve the effects of clinical chemotherapy drugs such as carboplatin, cisplatin, and doxorubicin.

More importantly, three basic short sequences required for lincRNA-p21 to bind to the DDB2 protein were found using different experimental modes. Computer predictions and calculations showed that these three lincRNA-p21 short sequences can bind to the region of DDB2, which interacts with the DDB1 protein. The molecular interface between them stabilizes the formation of the Cul-4/DDB1/DDB2 complex. Without the need for full-length lincRNA-p21, these three sequences can still directly bind to the DDB2 protein, promote the proteolysis of DDB2, and increase the sensitivity of cancer cells to chemotherapeutic drugs. Because the length of lincRNA-p21 exceeds 3,000 nucleotides; if the full-length lincRNA-p21 is used as an RNA treatment strategy, it is quite difficult for the synthesis, delivery and stability of the product. Another important breakthrough of this invention is that it proves that only three lincRNA-p21 short sequence fragments with a length of about 20 nucleotides can directly bind to DDB2, and the mechanism of action can be analyzed through molecular biology and molecular simulation. It can achieve the functions of degrading DDB2 protein, inhibiting DNA repair, and enhancing chemotherapy sensitivity.

More importantly, the present invention uses exosomes to encapsulate three lincRNA-p21 short sequences (exoLinc-p21s) and uses them with the chemotherapy drug adriamycin as a drug delivery model, proving that exoLinc-p21s can enhance the toxicity and growth inhibition of the chemotherapy drug adriamycin in cancer cells. In addition, anti-HLAG exosomes are further used as an RNA delivery system to identify cancer cells, and the anti-HLAG antibodies loaded on the exosomes can improve the delivery efficiency of exoLinc-p21s and chemotherapy drugs to cancer cells. The results showed that anti-HLAG exosomes can not only promote exoLinc-p21s-induced DDB2 proteolysis and tumor cell toxicity, but also improve the efficiency of delivery to tumors to increase sensitivity to chemotherapy drugs.

In summary, the three short sequences of lincRNA-p21 (Line-p21s) required for binding to DDB2 were identified and developed as the first DDB2 inhibitors, which have the advantages of low synthesis cost, high stability and high delivery efficiency compared with full-length lincRNA-p21. In molecular simulation analysis, Line-p21s have been shown to stabilize the molecular interface between DDB2 and DDB1 proteins and have been shown to directly bind to DDB2 proteins for proteasomal degradation. By targeting HLAG-expressing cancers using exosomes with α-HLAG antibodies as a delivery system, exosome Line-p21s (exoLinc-p21s) packaged with chemotherapeutics have been shown to enhance the cytotoxic and growth-inhibitory effects of adriamycin on cancer cells in cell lines and animal models. As a first-of-its-kind DDB2 inhibitor, exoLinc-p21s has the potential to be developed as a novel RNA-based chemosensitizer that could benefit patients with various cancer types.

Figure 1 shows that the expression of lincRNA-p21 is negatively correlated with cancer stage, tumor size, and ERα status. Figures 1A and 1B show that the expression of lincRNA-p21 quantified by in situ hybridization (ISH) is higher in early stages (stage IIA, n=12; stage IIB, n=12) than in late stages (stage IIIA, n=8; stage IIIB, n=8) of human breast cancer tumors (Figure 1A), and is negatively correlated with tumor size (Figure 1B). Figure 1C shows that the expression of lincRNA-p21 quantified by ISH in human breast cancer tumors with ERα negative (n=27) is higher than that with ERα positive (n=13). The points indicated by arrows are the average amount of lincRNA-p21 expression signals in each nucleus. Welch two-sample t test: *p<0.05, **p<0.01, ***p<0.001.

Figure 2 shows that higher lincRNA-p21 is expressed in smaller tumor size, ERα-negative breast cancer, and early-stage tumors, and contributes to breast cancer sensitivity to chemotherapy. Figure 2A is a timeline graph of the treatment of Tet-On-LincRNA-p21 in a tumor xenograft mouse model (arrow: starting point of 0.2 mg/mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T-47D human breast cancer xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data represent three independent experiments in each group and are expressed as mean ± standard deviation. Student's t test was used to compare with the control group, *p<0.05;**p<0.01;***p<0.001. Figures 2B, 2C, and 2D show that the expression of lincRNA-p21 induced by platinum (50μM) in vitro was negatively correlated with the disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) than in ERα-positive (n=47) human breast cancer primary culture tissues (Figure 2D). Welch two-sample t test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that the induction of lincRNA-p21 expression is negatively correlated with the IC ₅₀ of the chemotherapy response in breast cancer cell lines. Figures 2F and 2G show that the ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered the extent of T-47D cancer cell apoptosis induced by calreticulum in flow cytometry (FACS) assays. Figure 2H shows that silencing lincRNA-p21 in MDA-MB-231 cancer cells reduced the expression of calreticulum-induced apoptosis markers. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs can suppress the chemosensitization effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as demonstrated by the degree of apoptotic death induction measured by FACS assay. The data in Figures 2F, 2G, 2I, and 2J represent at least three experiments and are shown as mean ± SD. *p<0.05;**p<0.01;***p<0.001 compared with the control group using Student's t test.

Figure 3 shows that lincRNA-p21 is a mediator regulating ERα-related chemoresistance. Figures 3A and 3B show the raw data of Figures 2I and 2J in FACS assay. The data represent at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 compared with the control group, using Student’s t test.

Figure 4 shows that lincRNA-p21 can reduce DNA repair and is negatively correlated with DDB2 expression. Figure 4A shows that silencing lincRNA-p21 can reduce the formation of cis-platinum (50μM)-induced cis-platinum-DNA adducts (Pt-(GpG) purine dimers) in MDA-MB-231 cancer cells in an immunofluorescence staining assay in a time-dependent manner. Immunofluorescence staining images were quantified using ImageJ analysis. Figure 4B shows a network diagram of protein-coding genes associated with ERα positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that the DDB2 expression in ERα-positive human breast cancer tissues analyzed in the GSE18908 dataset was higher than that in ERα-negative human breast cancer tissues. Welch two-sample t test: *p<0.05; **p<0.01; ***p<0.001. Figure 4D shows that in Kaplan-Meier survival analysis, ERα-positive breast cancer patients receiving neoadjuvant chemotherapy had a poor overall survival (OS, n=187) and had higher DDB2 expression. Figures 4E and 4F show that DDB2 mRNA expression induced by platinum (50 μM) in vitro was higher in ERα-positive (n=47) than in ERα-negative (n=14) human breast cancer primary culture tissues (Figure 4E), Welch two-sample t test: *p<0.05; **p<0.01; ***p<0.001, and was positively correlated with tumor size (n=61) (Figure 4F). Figure 4G shows the extent of induction of lincRNA-p21 and DDB2 in neoadjuvant patients with chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction). Figures 4H and 4I show that chemotherapy-induced protein dynamics (Figure 4H) and DDB2 chromatin binding activity (Figure 4I) are higher in ERα-positive breast cancer cell lines than in ERα-negative breast cancer cell lines. Figure 4J shows that In Western blot analysis, silencing of DDB2 using two independent shRNAs enhanced the expression of platinum-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right)-dependent manner. Figure 4K shows that silencing of DDB2 enhanced platinum-induced apoptosis in T-47D cancer cells in the FASC assay. Data represent at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 compared with the control group using Student’s t test.

Figure 5 shows that DDB2 contributes to DNA repair functions associated with chemotherapy resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast cancer tumors in KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis. Figure 5B shows that in Kaplan-Meier survival analysis, ERα-positive/mutp53 breast cancer patients receiving neoadjuvant chemotherapy showed a correlation between higher DDB2 expression and worse overall survival (OS, n=76) compared with ERα-negative/mutp53 breast cancer patients. Figure 5C shows a box plot of DDB2 expression in various cancer types analyzed from the pan-cancer database GEPIA. Figure 5D shows that the DNA repair function in response to cisplatin (50 μM) in T-47D and MDA-MB-231 cancer cells was examined in a time-dependent manner using an anti-cisplatin modified DNA antibody in an immunofluorescence staining assay. The immunofluorescence staining images were quantified using ImageJ analysis. Figure 5E shows that chemotherapy induces the expression of DDB2 in ERα-positive but not ERα-negative breast cancer cells.

Figure 6 shows that lincRNA-p21 may target DDB2 and interfere with its nuclear import to achieve chemosensitization. Figures 6A and 6B show the accumulation of nuclear translocated protein (Figure 6A) and chromatin-bound (Triton-resistant) lysates (Figure 6B) induced by carboplatin (50μM) and doxorubicin (0.5μM) in ERα-positive breast cancer cell lines, but not ERα-negative breast cancer cell lines.

Figure 7 shows that lincRNA-p21 downregulates DDB2 expression by enhancing the formation of the Cul-4/DDB1/DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induced the expression of lincRNA-p21 in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cells (upper and right panels). In contrast, these chemotherapeutic drugs induced DDB2 mRNA levels in ERα-positive breast cancer cells (lower and left panels). Figure 7B shows that in ERα-negative MDA-MB-231 cancer cells (right), calpain induced nuclear translocation of lincRNA-p21 in a time-dependent manner, but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that in qRT-PCR analysis, ectopic expression (left) and silencing (right) of lincRNA-p21 did not affect the level of DDB2 mRNA in T-47D and MDA-MB-231 cancer cells. Figure 7D also shows that the level of DDB2 mRNA in T-47D#Tet-On-LincRNA-p21 cancer cells was not changed by induction of lincRNA-p21. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data of Figure 8D in Western blot assay. Figure 7G shows that lincRNA-p21 induced by doxorubicin (0.5 μM) can bind to DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells, as verified by RNA-IP in vivo experiments. Figure 7H shows that in vitro treatment with RNase A reduces the formation of platinum-induced DDB2 complexes with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that silencing lincRNA-p21 in the presence of MG132 reduces the binding and complex formation of DDB2 protein with Cul-4 and DDB1 induced by platinum (50μM). Figure 7J shows that DDB2 in T-47D cancer cell lysates treated with platinum can be pulled down by different fragments of biotinylated lincRNA-p21 in vitro. The dot plots reveal that the input of biotinylated RNA is equal. Figure 7K shows that lincRNA-p21 induced by platinum (50μM) binds to DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis using RNase A in vivo experiments. The data in Figures 7A, 7C, 7D, 7G, and 7K represent three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 compared with the control group using Student’s t test.

Figure 8 shows that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by serving as a scaffold for the Cul-4/DDB1/DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that silencing of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is inhibited by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25μM). The levels of DDB2 protein examined in Western blot analysis were quantified using ImageJ and normalized using α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases the polyubiquitination of DDB2 in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP in vivo experiments, platinum (50 μM)-induced DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) can bind to lincRNA-p21 in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that silencing of lincRNA-p21 reduces the formation of DDB2 complexes with DDB1 and Cul-4 induced by carboplatin in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 can be pulled down by biotinylated lincRNA-p21 in vitro, but not by HOTAIR or α-tubulin mRNA, in carboplatin-treated T-47D cancer cell lysates. The dot plots show equal input of biotinylated RNA. hnRNP-K serves as a positive control for lincRNA-p21 interacting proteins. Figure 8K shows the diagram of biotinylated lincRNA-p21 deleted fragments used for RNA pull-down experiments and primer sets for different regions used for RNA-IP experiments. Figure 8L shows that DDB2 was pulled down by different deletion fragments of biotinylated lincRNA-p21 in vitro experiments in lysates from T-47D cancer cells treated with platinum. The dot plot shows that the input of biotinylated RNA is equal. Figure 8M shows that platinum (50μM)-induced DDB2 in T-47D cancer cells binds to specific regions of lincRNA-p21 after digestion with RNase A through RNA-IP in vivo assay. The data in Figures 8G, 8H, and 8M represent at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 are compared with the control group, using Student’s t test. Figure 8N shows the predicted secondary structure of lincRNA-p21 (ViennaRNA Web Server) and the sequence inferred to bind to DDB2.

Figure 9 shows that three lincRNA-p21 short sequences #3, #4 and #9 bind to DDB2 protein in vitro. Figures 9A-9D show that DDB2 protein from T-47D cancer cell lysates treated with carbendazim was used for in vitro pull-down experiments with single (Figures 9A and 9B) or complex (Figures 9C and 9D) missing biotinylated lincRNA-p21 mutants. The dot plots show that the input of biotinylated RNA is equal. Figure 9E shows the dose-dependent binding activity of lincRNA-p21 short sequences #3, #4 and #9 with recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct value of the pure lincRNA-p21 short sequence measured by concentration gradient as a standard curve. Figure 9G shows that the transfection efficiency of lincRNA-p21 short sequences #3, #4 and #9 into T-47D cancer cells is the same at different concentrations. Figure 9H shows that co-treatment with a combination of three lincRNA-p21 short sequences significantly enhances cell toxicity in the presence of carboplatin, cisplatin and adriamycin. Data represent three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 are compared with the control group, using Student’s t test. Figure 9I shows that treatment with MG132 can reverse the inhibitory effect.

Figure 10 shows the effects of lincRNA-p21 short sequences #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with three lincRNA-p21 short sequences alone increased cytotoxicity in the case of cisplatin treatment alone, but had no effect on cisplatin and adriamycin. Data represent three experiments and are shown as mean ± standard deviation. *p<0.05; **p<0.01; ***p<0.001 are compared with the control group, using Student’s t test. Figure 10B shows that the combined treatment of three lincRNA-p21 short sequence combinations can inhibit the protein expression of DDB2. Figure 10C shows the original data of Figure 9I.

Figure 11 shows the 3D structure modeling of the lincRNA-p21 short sequence binding to the N-terminal α-helix of DDB2 through molecular docking. Figure 11A shows the 3D structures of three lincRNA-p21 short sequences calculated and predicted by six RNAComposer databases (CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstruct, and ContextFold). Figure 11B shows 2000 configurations (poses) generated by the ZDOCK docking mode in BIOVIA Discovery Studio, which produces one configuration every 6 degrees. The marked points represent potential configurations between the two macromolecules, and the points indicated by the arrows are the lincRNA-p21 short sequences selected for the highest potential interaction with DDB2. Figure 11C shows the potential conformation cluster around the N-terminal α-helix of DDB2. Figure 11D shows the 3D structural model of three lincRNA-p21 short sequences coiled around the α-helix of DDB2, whose α-helix is responsible for interacting with DDB1. Figure 11E shows the interaction site between the lincRNA-p21 short sequence and DDB2 in the 3D structure.

Figure 12 shows the position of the lincRNA-p21 short sequence and DDB2 complexed by molecular docking calculation. Figures 12A-12E show the docking analysis results from other databases, and the marked points are potential configurations selected between the two macromolecules. Figures 12F-12H show the most potential configuration predictions between the lincRNA-p21 short sequence and DDB2 in other databases. In Figure 12F, the cyan configuration comes from 5 databases (pose 22), and the pink configuration comes from contextFold (pose 27). In Figure 12G, the cyan configuration comes from 4 databases (pose 19), the pink configuration comes from contextFold (pose 2), and the yellow configuration comes from RNAstructure (pose 1). In Figure 12H, the cyan configuration comes from 4 databases (pose 8), the pink configuration comes from contextFold (pose 40), and the yellow configuration comes from RNAstructure (pose 8).

Figure 13 shows that exosome-encapsulated lincRNA-p21 short sequences #3, #4, and #9 (exoLinc-p21s) can enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles photographed by TEM. Figures 13B-13F show that three lincRNA-p21 short sequences (#3+#4+#9) are encapsulated by exosomes (exoLinc-p21s), which, as exosome-based therapy, have been shown to inhibit DNA repair function (Figure 13B), DDB2 protein function (Figure 13C), growth function (Figure 13D), cytotoxicity enhancement effect (Figure 13E), and inhibit tumor size in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect of exoLinc-p21s with or without anti-HLAG antibody loading (Figure 13G) and DDB2 protein inhibitory function (Figure 13H). The data in Figures 13D, 13E, and 13G represent at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 compared with the control group, using Student’s t test.

Figure 14 shows the delivery efficiency of exosomes with and without anti-HLAG antibodies. Figure 14A shows the colony area and average colony size in the growth inhibition function of exoLinc-p21s. Figure 14B shows the delivery efficiency of exosomes with and without anti-HLAG antibodies in a time-dependent manner as measured by immunofluorescence staining.

The present invention may be implemented in many different forms and should not be construed as limited to the embodiments described herein. The described embodiments should not be used to limit the scope of the invention described in the patent application.

Materials and methods

Clinical specimens

With informed consent, breast cancer tissue samples from 61 patients with different breast cancer subtypes were collected from the National Chung Shan Medical University Hospital, Taichung, Taiwan. The samples were collected without screening for all breast cancer subtypes and were used under the approval of the Human Research Ethics Review Committee of the National Chung Shan Medical University Hospital, Taichung, Taiwan (CS2-18150). Tissues were homogenized and cultured with or without platinum for 5 days. RNA and protein lysates were then prepared using TRIzol ^™ reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).

Tissue microarray and in situ hybridization experiments

Breast cancer tissue microarrays were purchased from SuperBioChips Laboratories (Seoul, South Korea), and in situ hybridization experiments were performed to detect lincRNA-p21. Tissue microarray samples included 40 patients with different breast cancer subtypes. The RNAscope lincRNA-p21 (TP53COR1) probe used for in situ hybridization assays was designed and purchased from Advanced Cell Diagnostics, Inc., (Newark, CA, USA). The present invention used RNAscope 2.5 HD Test Kit-BROWN and screened the signal of lincRNA-p21 in breast cancer tissues according to the manufacturer's step guidelines. The signal expressed by lincRNA-p21 was quantified using Fiji ImageJ and normalized to the nucleus to calculate the area and percentage of probe quantity.

Cell culture

Breast cancer cell lines MCF7 (RRID: CVCL_0031), T-47D (RRID: CVCL_0553), BT-474 (RRID: CVCL_0179), SK-BR-3 (RRID: CVCL_0033), MDA-MB-468 (RRID: CVCL_0419) and MDA-MB-231 (RRID: CVCL_0062), and liver cancer cell line HepG2 (RRID: CVCL_0027) were cultured in Dulbecco's Modified Eagle Medium containing Nutrient Mixture F-12 (DMEM/F12, HyClone ^™ ) (Thermo Fisher Scientific Inc., Waltham, MA, USA), 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) and HyClone ^™ penicillin-streptomycin solution. All cell lines were purchased from American Type Culture Collection (ATCC) and cultured at 37°C in a humidified incubator with 5% CO ₂ and checked for mycoplasma contamination using the MycoAlert ^™ Mycoplasma Detection Kit (LT07-318, Thermo Fisher Scientific Inc., Waltham, MA, USA).

Inhibitors and reagents

Carboplatin (41575-94-4), (Z)-4-hydroxy Tamoxifen (68047-06-3), cycloheximide (CHX, 66-81-9), (S)-MG132 (133407-82-6) and tetracycline (hydrochloride, 64-75-5) were purchased from Cayman Chemical (Michigan, USA). Cis-diammineplatinum (II), P4394, and doxorubicin hydrochloride (Sigma-Aldrich, D1515) were purchased from Merck KGaA (Darmstadt, Germany). Clarity ^™ western enhanced chemiluminescence (ECL) substrate was purchased from Bio-Rad Laboratories, Inc., (Hercules, CA, USA).

antibody

Anti-DDB2 antibody (#5416, RRID: AB_10694497), anti-Ac-p53 antibody (K382, #2525S, RRID: AB_330083), anti-p-ERα antibody (Ser118, #2511), anti-HA-Tag antibody (#3724, RRID: AB_1549585), anti-PARP antibody (#9542, RRID: AB_2160739) and anti-histone H3 antibody (#9715, RRID: AB_331563) were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). Anti-DDB1 antibody (sc-25367, RRID: AB_639050), anti-Cul-4 antibody (sc-377188), anti-hnRNP-K antibody (sc-28380), anti-p53 antibody (sc-126, RRID: AB_628082), and anti-ERα antibody (sc-8002, RRID: AB_627558) were purchased from Santa Cruz Biotechnology, Inc., (CA, USA). Anti-ubiquitin antibody (P4D1-A11), anti-p21WAF1 antibody (Calbiochem, OP64, RRID: AB_2335868), anti-α-tubulin antibody (T5168, RRID: AB_477579) and anti-β-actin antibody (A2228, RRID: AB_476697) were purchased from Merck KGaA (Darmstadt, Germany). Anti-Caspase 3 antibody (Imgenex IMG-144A, RRID: AB_316677) was purchased from Novus Biologicals, LLC., (Centennial, CO, USA). Anti-p-histone H2AX antibody (Ser139, AF2288, RRID: AB_2114989) was purchased from R&D Systems Inc., (Minneapolis, MN, USA).

Western blot analysis

The total protein lysate concentration was determined using the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in which 30 μg of protein lysate was heated at 95°C for 5 min in sample buffer. Denatured proteins were separated in SDS-PAGE using electrophoresis buffer and transferred to PVDF membranes (0.45 μM, Millipore, Merck KGaA, Darmstadt, Germany) or NC membranes (0.22 μM, Amersh ^™ , GE Healthcare Life Science, Pittsburgh, PA, USA) in transfer buffer. The transferred membranes were covered with TBST buffer with 5% milk or BSA and stained with the indicated primary antibodies overnight at 4°C, followed by incubation with HRP-conjugated secondary antibodies. ECL signals were detected using the ChemiDoc ^™ Touch Imaging System (Bio-Rad).

RNA extraction and RT-PCR

After the designated experimental treatments, cells were washed three times with ice-cold PBS and lysed with TRIzol ^™ reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). Total RNA was isolated by adding 0.2 mL of chloroform per 1 mL of TRIzol ^™ reagent, followed by centrifugation at 12,000 g for 15 min to separate the aqueous, interphase, and organic phases. Next, RNA in the aqueous phase was precipitated by mixing with 0.25-0.5 mL of isopropanol and centrifuged at 12,000 g for 15 min. After removing the supernatant, the gel precipitate was washed twice with 1 mL of 75% ethanol, air-dried, and dissolved in DEPC-treated water. Reverse transcription polymerase chain reaction (RT-PCR) was performed using 1 μg of total RNA, Invitrogen ^™ M-MLV reverse transcriptase (Thermo Fisher Scientific Inc., Waltham, MA, USA), random hexamer, dNTP, 5X M-MLV buffer and DTT.

Quantitative real-time PCR

qRT-PCR, using 2X KAPA SYBR FAST qPCR Master Mix kit (Kapa Biosystems, Wilmington, MA, USA) with specific primers to detect the expression of target genes. Threshold cycle or Ct value was analyzed using LightCycler 480 Real-time PCR System (Roche Molecular Systems, Inc., Pleasanton, CA, USA) or Applied Biosystems ^™ QuantStudio ^™ 5 Real-time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA). ddCt was calculated by normalization using housekeeping gene as reference.

RNA immunoprecipitation (RNA-IP) assay

Cells were fixed with 1% formaldehyde and neutralized with 1 M glycine, washed twice with ice-cold PBS, then scraped and shaken with lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM DTT, cOmplete ^™ protease inhibitor cocktail (1 tablet of protease inhibitor for 10 mL of cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA) and 200 U/mL RNaseOUT ^™ (Thermo Fisher Scientific Inc., Waltham, MA, USA)). After three freeze-thaw cycles on ice, the lysate was centrifuged at 14,000 rpm for 30 minutes, and the supernatant was collected for immunoprecipitation. Agarose protein A/G was pre-coated for 1 hour, then mixed with antibodies in NT2 buffer (50mM Tris-HCl pH7.5, 150mM NaCl, 1mM MgCl ₂ and 0.5% NP-40) and incubated overnight. Then, the membranes were washed three times with NT2 buffer and incubated with lysis NT2 buffer (1mM DTT, 200U/mL RNaseOUT ^TM and 20mM EDTA) and rotated overnight. The immunocomplexes were washed three times and reverse crosslinked in 100μL NT2 buffer at 70°C for 5 hours. Finally, samples were incubated with 0.25 mg/mL Sigma-Aldrich proteinase K (Merck KGaA, Darmstadt, Germany) at 55°C for 30 min and lysed with TRIzol ^™ reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) for RNA extraction and qRT-PCR.

Preparation of biotinylated RNA for in vitro transcription

To examine the interaction of RNA with target proteins (including DDB1, DDB2, Cul-4 and hnRNP-K) in vitro, biotinylated RNAs were prepared using Invitrogen ^™ T7 RNA polymerase (Thermo Fisher Scientific Inc., Waltham, MA, USA) and Biotin RNA Labeling Mix (Roche Molecular Systems, Inc., Pleasanton, CA, USA) for biotin pull-down assays. Biotinylated lincRNA-p21, HOTAIR and tubulin RNA were generated by using their DNA templates synthesized using a primer set containing T7 in PCR.

Biotin pull-down assay

For in vitro pull-down assays, 3 μg of biotinylated RNA was heated to 90°C for 2 min and reconstituted in structure buffer (10 mM Tris-HCl pH 7.0, 0.1 M KCl, and 10 mM MgCl ₂ ) at room temperature for 20 min. Cells (2×10 ⁷ ) were treated with or without chemotherapy and then disrupted in nuclear isolation buffer (1.28 M sucrose, 40 mM Tris-HCl pH 7.5, 20 mM MgCl ₂ , and 4% Triton X-100). Nuclear pellets were hybridized to fold DNA or RNA in RIP buffer (150 mM KCl, 25 mM Tris-HCl pH 7.4, 0.5 mM DTT, 0.5% NP-40, 1 mM PMSF, and cOmplete ^™ protease inhibitor cocktail (1 tablet of protease inhibitor for 10 mL of cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA)) for one hour, and RNA-protein complexes were then pulled down using Novagen streptavidin agarose beads (Novagen Corporation, San Diego, CA, USA) and analyzed by Western blotting.

Separation of nuclear and cytoplasmic RNA

Cells were washed twice with TD buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na ₂ HPO ₄ and 25 mM Tris-HCl pH 7.4) before being scraped with TD buffer and then centrifuged at maximum speed for 30 seconds at room temperature. The precipitate was washed with 200 μL TD buffer, and was dispersed with 100 μL Vanadyl Ribonucleoside Complex buffer (20 mM VRC; S1402S, New England BioLabs Inc., Ipswich, MA, USA, 10 mM Tris-HCl, 0.14 M NaCl, 1.5 mM MgCl ₂ , 1 mM DTT, and TD buffer containing 0.5% NP-40, pH 8.6), shaken for 10 seconds, and then placed on ice for 5 minutes. The supernatant was transferred to a new eppendorf centrifuge tube and lysed with TRIzol ^™ reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) to isolate cytoplasmic RNA. The cells were shaken again and centrifuged at maximum speed for 30 seconds. To isolate nuclear RNA, the pellet was washed with 200 μL 0.5% NP-40/TD buffer, disrupted with 100 μL 0.5% NP-40/TD buffer, and then lysed with Invitrogen TRIzol ^™ reagent.

Triton extraction determination

After platinum treatment, cells were lysed with Triton extraction buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl ₂ , 10 mM PIPES pH 6.8, 1 mM EGTA pH 6.8, 0.2% Triton X-100, supplemented with 1 mM NaVO ₄ , 1 mM PMSF, 10 mM NaF, and 1 ng/mL aprotinin) at 4°C for 30 min. The supernatant was collected as the Triton extractable fraction (chromatin-free protein), and the precipitate was collected as the Triton-resistant fraction (chromatin-bound protein), washed twice with Triton extraction buffer, and then further lysed with NETN buffer (20mM Tris-HCl pH8.0, 150mM NaCl, 1mM EDTA, 0.5% NP-40, 1mM NaVO ₄ , 1mM PMSF, 10mM NaF and 1ng/mL aprotinin). The two fractions were used to examine the free form and DNA-bound form of DDB2, respectively.

Cell survival assay protocol

MTT assay was used to detect cell survival. Cells (5×10 ³ ) grown in 96-well plates were treated with different concentrations of the indicated chemotherapeutic drugs for 48 or 72 h. The medium was then replaced with serum-free medium containing 5X Sigma-Aldrich MTT solution (Merck KGaA, Darmstadt, Germany) and cultured for 2.5 h. Finally, cells were lysed with DMSO and the optical density (OD) at 570 nm was measured by ELISA analyzer.

Quantification of cis-platinum adducts in nuclear DNA by immunocytological assay

The effects of lincRNA-p21 and DDB2 on DNA repair were investigated by detecting cis-platinum adducts in immunofluorescence staining with anti-cis-platinum-modified DNA antibodies. After inducing DNA damage with cis-platinum (50 μM) for the indicated time, cells were fixed with 4% paraformaldehyde and washed with PBS before covering with 1% Triton X-100 for 5-7 minutes at room temperature. Cells were then covered with PBS containing 1% BSA for one hour at room temperature and stained with anti-cis-platinum-modified DNA antibodies (Abcam, plc., Cambridge, UK) for one hour at room temperature in the dark. They were then stained again with secondary antibodies, goat anti-rat IgG H&L (Abcam, plc., Cambridge, UK), for several hours at room temperature in the dark. Finally, cells were mounted with DAPI mounting medium (Thermo Fisher Scientific Inc., Waltham, MA, USA) and the staining was observed under a fluorescence microscope (Leica DMIL LED, Leica Microsystems, Wetzlar, Germany). The signal of cis-platinum adducts was quantified using ImageJ software and normalized to the nuclear DAPI signal.

Macromolecular docking

The schematic diagram of DDB2 (4E54) was found in the protein data bank (PDB). The 3D structures of short lincRNA-p21#3, #4 and #9 were predicted and created by the RNAcomposer database and further docked with DDB2 using the ZDOCK docking mode using BIOVIA Discovery Studio software (RRID: SCR_015651). The docking results were presented as 3D structures using BIOVIA Discovery Studio and PyMoL software (RRID: SCR_000305).

Xenotransplantation mouse model

A breast cancer xenograft mouse model was used to validate the growth effect of lincRNA-p21 through the Tet-On system and the synergistic effect between exoLinc-p21s and exoDox. T-47D breast cancer cells were injected into the mammary fat pad of five-week-old female BALB/c nude mice, which had been subcutaneously implanted with 0.7 mg 60-day release 17β-estradiol (Innovative Research of America) pellets 3 days before subcutaneous inoculation. After one month of tumor growth in mice, the inhibitory effect of exoScramble, exoLinc-p21s, and combined treatment with exoDox on tumor growth was confirmed. During the treatment period, the activity of mice was monitored and the survival curves among the four treatment groups were calculated; the tumor diameter was measured continuously with a caliper, and the tumor volume was calculated using the formula: volume = length x width ² /2.

Statistical analysis

3。p值以雙尾檢定計算，統計顯著差異定義為p<0.05。所有統計分析均使用SigmaPlot 10.0、GraphPad Prism 8或SPSS 21軟體進行。 The Student's t test or Welch's two-sample t test was used to analyze the differences between two categorical variables, and the one-way analysis of variance was used to analyze the differences between more than two categorical variables. The results are expressed as mean ± standard deviation, n

3. p values were calculated by two-tailed test, and statistically significant differences were defined as p < 0.05. All statistical analyses were performed using SigmaPlot 10.0, GraphPad Prism 8, or SPSS 21 software.

result

LincRNA-p21 inhibits ERα/DDB2-related DNA repair and chemotherapy resistance

The role of lincRNA-p21 in regulating DDB2-mediated DNA repair and chemoresistance remains unclear. The basal level of lincRNA-p21 is relatively high in early-stage (Figures 1A and 1B), smaller-sized (Figure 1B), and ERα-negative (Figure 1C) breast tumors. Induction of lincRNA-p21 by a tetracycline-induced expression system in ERα-positive T-47D breast cancer cells inhibited tumor growth in a xenograft mouse model (Figure 2A), revealing its tumor suppressive role in breast cancer. To test the therapeutic effect response of CAR-T in vitro, the induction of lincRNA-p21 in primary cultured human breast cancer tumor tissues decreased with advanced stage (Figure 2B), tumor size (Figure 2C), and ERα-positive status (Figure 2D). These clinical observations suggest that lincRNA-p21 plays a key role in determining the chemotherapy sensitivity of breast cancer patients. In fact, the level of chemotherapy-induced lincRNA-p21 in various cell lines was negatively correlated with its IC ₅₀ for the corresponding chemotherapeutic agent (Figure 2E). Overexpression of lincRNA-p21 increased CAR-T-induced apoptosis in ERα-positive T-47D cancer cells (Figure 2F). In contrast, silencing of lincRNA-p21 expression in ERα-negative MDA-MB-231 cancer cells resulted in reduced apoptosis (Fig. 2G) and cleavage of PARP and apoptotic proteinase 3 in response to carboxylation (Fig. 2H). In addition, silencing of lincRNA-p21 also attenuated the sensitization of carboxylation-induced apoptosis by nolvadex (Fig. 2I and Fig. 3A) and ERα shRNA (Fig. 2J and Fig. 3B). Therefore, overexpression of lincRNA-p21 may overcome ERα-related chemoresistance.

To further demonstrate the inhibitory effect of lincRNA-p21 on DNA repair in chemosensitization, cis-Pb-DNA adducts were examined in immunocytological assays using anti-cis-Pb-modified DNA antibodies. The results showed that silencing lincRNA-p21 by shRNA inhibited the induction of cis-Pb-DNA adducts in cis-Pb-treated MDA-MB-231 cancer cells (Figure 4A), indicating that lincRNA-p21 can increase chemosensitivity by inhibiting DNA repair. To confirm the mechanism by which lincRNA- p21 reduces ERα-mediated DNA repair, the GSE18908 dataset was used to analyze the global expression of different genes between human ERα-positive and negative breast cancers. Among the ERα-related pathways analyzed by KEGG pathways (Figure 5A), nucleotide excision repair (NER) and p53 signaling pathways (two key pathways regulating DNA repair and chemosensitivity) were upregulated in response to ERα expression. STRING network further revealed that the expression of DDB2 (a known NER-targeted p53 downstream factor) was enriched in ERα-positive breast cancer (Figure 4B) and may be involved in the chemosensitivity and DNA repair functions regulated by the ERα/lincRNA-p21 axis. In addition, the level of DDB2 was statistically higher in ER-positive breast cancer tissues (Figure 4C). More importantly, Kaplan-Meier plot analysis revealed an association between higher DDB2 expression and poor overall survival in all breast cancer patients (Figure 4D), even in patients who received neoadjuvant chemotherapy and had p53 mutation status (Figure 5B). In addition, DDB2 was highly expressed in several different cancer types, such as lung cancer (LUSC), liver cancer (LIHC), cholangiocarcinoma (CHOL), colorectal cancer (COAD), head and neck squamous cell carcinoma (HNSC), gastric cancer (STAD), and esophageal cancer (ESCA) (Figure 5C). In vitro induction of DDB2 protein expression by kaplan-Meier was also significantly higher in ERα-positive tumor tissues than in ERα-negative tumor tissues (Figure 4E) and correlated with tumor size (Figure 4F). Furthermore, in vitro treatment with platinum inducing breast cancer tumors from patients with higher lincRNA-p21 but lower DDB2 was associated with their better clinical response to adjuvant chemotherapy (Figure 4G), suggesting that lincRNA-p21 may negatively regulate DDB2 expression to inhibit NER function in breast cancer patients in vivo, which is associated with chemotherapy sensitivity.

The present invention then investigated the involvement of DDB2-related NER in ERα-related chemotherapeutic resistance. In ER-negative/chemosensitive MDA-MB-231 and ER-positive/chemoresistant T-47D cancer cells, cis-platinum-DNA adducts were induced within 2 hours of treatment with cis-platinum, and these DNA damages persisted for more than 18 hours in MDA-MB-231 cancer cells, but disappeared rapidly in T-47D cancer cells (Figure 5D). Both carboplatin (Fig. 4H and 5E) and doxorubicin (Fig. 5E) increased the expression of DDB2 in ERα-positive (T-47D and BT-474) breast cancer cell lines, but not in ERα-negative (MDA-MB-231 and SK-BR-3) breast cancer cell lines. DDB2 can recognize and bind to damaged DNA sites in the nucleus to serve as an important initiator for further recruitment of other regulators involved in NER, followed by proteasome degradation to form DNA repair complexes. Therefore, chemotherapy-induced nuclear translocation (Fig. 6A) and chromatin binding activity of DDB2 (Fig. 4I and 6B) were also found in ERα-positive cancer cell lines, but not in ERα-negative cancer cell lines. Furthermore, silencing DDB2 expression increased PARP or apoptotic proteinase 3 cleavage in a dose- and time-dependent manner (Figure 4J) and sensitized ERα-positive cancer cells to calpain and induced apoptosis (Figure 4K). Taken together, these results indicate that DDB2 is a key NER initiator mediating ERα-associated chemoresistance and can be targeted by lincRNA-p21.

LincRNA-p21 as a scaffold for the Cul-4 E3 conjugase complex for proteasomal degradation of DDB2

Treatment with carboplatin or doxorubicin increased lincRNA-p21 expression in a time-dependent manner in chemotherapy-sensitive MDA-MB-231 cancer cells, but not in chemotherapy-resistant T-47D cancer cells, and negatively correlated with chemotherapy-induced DDB2 mRNA expression (Figure 7A). Carboplatin also increased the nuclear accumulation of lincRNA-p21 in MDA-MB-231 cancer cells, but not in T-47D cancer cells (Figure 7B), and negatively correlated with the nuclear translocation of DDB2 (Figure 6A). Therefore, the present invention next investigated whether lincRNA-p21 regulates DDB2 expression and its potential molecular mechanism. Interestingly, DDB2 protein levels were dose-dependently suppressed by lincRNA-p21 overexpression in T-47D cancer cells (Fig. 8A) and enhanced by silencing lincRNA-p21 in MDA-MB-231 cancer cells (Fig. 8B), but did not affect its mRNA level (Fig. 7C). Similarly, lincRNA-p21 induced by the Tet-On control system also suppressed DDB2 protein but not RNA levels (Figs. 7D and 8C), implying that lincRNA-p21 posttranscriptionally downregulates DDB2. The proteasome inhibitor MG132 enhanced DDB2 expression in lincRNA-p21-enriched MDA-MB-231 cancer cells (Fig. 7E). In the presence of cycloheximide (CHX), overexpression of lincRNA-p21 reduced DDB2 protein stability (Figures 7F and 8D), while MG132 restored DDB2 protein stability (Figure 8E), suggesting that lincRNA-p21 is involved in regulating DDB2 proteasomal degradation. Overexpression of lincRNA-p21 enhanced the polyubiquitination of DDB2 in T-47D cancer cells (Figure 8F). The role of lincRNA-p21 in regulating the formation of the complex between DDB2 and its E3 conjugase Cul-4 and the adaptor protein DDB1 was then confirmed. In RNA-IP assays, physical interactions between lincRNA-p21 and DDB2 were observed in ERα-negative but not ERα-positive breast cancer cells in response to carboplatin (Fig. 8G) and adriamycin (Fig. 7G). Carboplatin (Fig. 8H) and adriamycin (Fig. 7G) also strongly increased the binding of lincRNA-p21 to DDB1, but only modestly increased its binding to Cul-4 in vivo. The interaction of DDB2 with the DDB1 and Cul-4 complexes was weakened in vitro by RNase A treatment (Fig. 7H), and anti-DDB2 (Fig. 8I), anti-DDB1, and anti-Cul-4 (Fig. 7I) immune complexes were disrupted by silencing lincRNA-p21 in vivo. Subsequently, the specific interactions of lincRNA-p21 with DDB2, DDB1, and Cul-4 in vitro were also confirmed in RNA pull-down assays using biotinylated oligonucleotides (Figure 8J). Taken together, these data indicate that lincRNA-p21 can directly bind to DDB2/DDB1/Cul-4 and serve as a scaffold for E3 complex formation.

To examine the specific and essential regions of lincRNA-p21 for binding to DDB2, the present invention then synthesized different fragments (S1: exon 1, S2: intron, S3: exon 2) (Figure 7J) or deletion fragments (F1-F8) (Figure 8K) of lincRNA-p21 to analyze their binding activity to DDB2. In the in vitro RNA pull-down experiment, S1 and F3-F8 showed stronger binding potency to DDB2, suggesting that the region of 526-926nt is essential for DDB2 binding activity. In RNA-IP analysis, RNA pulled down from anti-DDB2 immunoprecipitates was digested in vitro with or without RNase A, and then RT-qPCR was performed using each primer set to amplify different regions (P1-P10) as shown in Figure 8K. LincRNA-p21 is resistant to RNase A digestion in the P3, P4, P6, P7, and P9 regions, which may be protected by binding to DDB2, further revealing the potential DDB2 binding region in in vivo experiments (Figure 8M). Interestingly, the binding regions of lincRNA-p21 for DDB1 and Cul-4 are similar to those of DDB2 (Figure 7K). According to the literature, DDB2 is a transcription factor that has binding affinity to specific common sequences on the promoters of its target genes. It is worth noting that this common sequence can be found in the P3, P4, and P9 regions of lincRNA-p21 and folded into secondary structures (P3, P4, and P9), which means that these three sequences are potential binding sites for DDB2 (Figure 8N). These results suggest that two regions of lincRNA-p21 sequences #3, #4, and #9 (527 to 926 nt and 2099 to 2287 nt) are required for interaction with DDB2.

Potential lincRNA-p21 short sequences as chemotherapy-sensitizing DDB2 inhibitors

To demonstrate the necessity of lincRNA-p21 sequences (P3, P4, and P9) for interaction with DDB2 in vitro, the essential sequences marked with asterisks in Figures 9A and 9C were deleted. The level of DDB2 protein pulled down by the biotinylated lincRNA-p21 full-length probe was slightly attenuated by the individual deletion of P3, P4, or P9 (Del 1, Del 2, or Del 3) (Figure 9B) and was almost abolished by the combined mutation of all three sequences (Del 1+2+3) (Figure 9D). In addition, the synthetic RNA oligonucleotides corresponding to these DDB2 binding sequences (#3, #4 and #9) in lincRNA-p21 showed strong binding activity with recombinant DDB2 protein in a dose-dependent manner, with KD values of ^10-9 to ^10-8 M in SPR analysis (Figure 9E). The expression levels of the synthesized lincRNA-p21 short sequence and the Scramble control group were verified in vitro in a dose-dependent manner (Figure 9F). Next, the present invention transiently transfected the lincRNA-p21 short sequence into T-47D cancer cells and detected the delivery efficiency by qRT-PCR analysis (Figure 9G). Compared with Scramble, although a single lincRNA-p21 short sequence (single #3, #4 or #9) showed only a small chemosensitization effect (Figure 10A), a mixture of three lincRNA-p21 short sequences (#3+#4+#9) (Linc-p21s) enhanced the chemosensitivity of ER-positive/chemoresistant T-47D cancer cells to platinum drugs and doxorubicin in a dose-dependent manner (Figure 9H). In addition, the DDB2 targeting effect of Linc-p21s was confirmed by the downregulation of DDB2 protein expression after 24 hours of treatment (Figure 10B), which was prevented by MG132 pretreatment (Figures 9I and 10C).

To further explore the potential configurations between the three lincRNA-p21 short sequences and DDB2 in computer simulation ( in silico ), RNAComposer, which contains six databases including CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstruct and ContextFold, was used to predict the 3D structure of the lincRNA-p21 short sequence (Linc-p21s). Interestingly, at least four databases (CentroidFold, CONTRAfold, IPknot and RNAfold) predicted the same structural configuration (Figure 11A), which was further used for molecular docking analysis with DDB2 protein (PDB: 4E54). Macromolecular docking was calculated using the ZDOCK docking program, and potential configurations of lincRNA-p21 short sequences binding to DDB2 with lower Z-rank scores and higher Z-dock scores from different prediction databases were screened (Figures 11B and 12A-12E). Then, these potential configurations were divided into different clusters (Figure 11C), with different interaction models and presented in similar binding regions. In addition, the most potential configuration was selected from the largest cluster with the best Z-rank and Z-dock score to represent the interaction between the lincRNA-p21 short sequence and DDB2 (Figures 11D and 12F-12H). The interaction site and distance between the lincRNA-p21 short sequence and DDB2 were also calculated (Figure 11E). In the 3D structure, the core nucleotides of the lincRNA-p21 short sequence (C8, C9, C10, C11, U12, and U13) interact with the most likely DDB2 amino acids (Lys-35, Pro-44, Cys-48, Cys-52, and Leu-53) or other DDB2 amino acids through hydrogen bonds and Pi-alkyl groups (Figure 11E). In the complex structure, all three lincRNA-p21 short sequences are coiled around the α-helix at the N-terminus of DDB2. This segment is very important and is responsible for interacting with DDB1 to connect the E3 conjugating enzyme Cul-4 (Figure 11D). It is quite reasonable that the entanglement of the short lincRNA-p21 sequence with DDB2 can stabilize the formation of the DDB2/DDB1/Cul-4 E3 conjugase complex and enhance DDB2 polyubiquitination and degradation.

The short sequence of lincRNAp21 encapsulated with chemotherapy in exosomes showed effective chemotherapy sensitization effect

In the development of RNA-based therapeutic strategies, the in vivo delivery efficiency, tumor targeting specificity, and stability of Linc-p21s are crucial for cancer patients. To improve the delivery efficiency of Linc-p21s in the human body, exosomes were used as a delivery system for this therapeutic strategy. Transmission electron microscopy (TEM) analysis showed that there was no difference in size and shape between empty exosomes and exosomes encapsulating lincRNAp21 (Figure 13A). To verify the function of exosome-encapsulated Linc-p21s (exoLinc-p21s) in DNA repair, a cis-Pb-DNA adduct assay was performed and demonstrated that exoLinc-p21s extended the existence of cis-Pb-DNA adducts from 3 hours to 24 hours, suggesting that exoLinc-p21s can improve chemosensitivity by reducing DNA repair (Figure 13B). In exosomes encapsulated or not encapsulated with doxorubicin (exoDox), the ability of exoLinc-p21s to inhibit doxorubicin-induced DDB2 expression was confirmed by Western blot analysis (Figure 13C). In addition, in colony formation assays, exoLinc-p21s reduced the growth of T-47D breast cancer cells and HepG2 (high DDB2 expression) liver cancer cells (Figures 13D and 14A), and similar to the results of the transient transfection system, exoLinc-p21s containing 1 ng of short Linc-p21s could synergize the cytotoxicity of doxorubicin (Figure 13E). In a xenograft mouse model, Exo-Linc-p21s also enhanced the in vivo antitumor activity of doxorubicin (Figure 13F). To enhance the tumor targeting specificity of exoLinc-p21s, anti-HLAG (highly expressed in most tumors) antibodies were engineered onto the surface of exoLinc-p21s to increase tumor specificity. Indeed, exoLinc-p21 with anti-HLAG antibodies did have earlier and longer accumulation in T-47D cancer cells (Figure 14B). Importantly, anti-HLAG antibody-engineered exoLinc-p21 exhibited better cytotoxicity than exoLinc-p21 without anti-HLAG antibodies (Figure 13G) and had stronger inhibition of DDB2 protein expression (Figure 13H).

In summary, the data of the present invention demonstrate that the short lincRNAp21 sequence (exoLinc-p21s) encapsulated with chemotherapy in exosomes can effectively target DDB2 protein to inhibit the chemotherapy-sensitized DNA repair function, which may be a potential novel RNA-based DDB2 inhibitor for enhancing the chemotherapy sensitivity of patients with various DDB2-expressing tumors.

Those skilled in the art will regard the foregoing overview as a description of methods for communicating hosted application information. Those skilled in the art will recognize that these are merely illustrative and that many equivalents are possible.

TWI850037B_112128204_SEQL.xml

Claims (14)

A composition comprising a sequence of a long non-coding RNA-p21 (lincRNA-p21), wherein the sequence of the lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. A composition for preparing a drug for treating cancer, wherein the composition comprises a sequence of a long non-coding RNA-p21 (lincRNA-p21) and a chemotherapeutic agent, wherein the sequence of the lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The use as described in claim 2, wherein the sequence of the lincRNA-p21 enhances the sensitivity of the cancer to the chemotherapy agent by inhibiting the expression of DDB2. The use as described in claim 2, wherein the cancer comprises a cancer with high expression of DDB2. The use as described in claim 2, wherein the cancer has a poor response or resistance to chemotherapy. The use as described in claim 2, wherein the cancer includes breast cancer and liver cancer. The use as described in claim 6, wherein the breast cancer cells have a p53 mutation. The use as described in claim 7, wherein the breast cancer cells are estrogen receptor positive and have p53 mutation. The use as described in claim 2, wherein the chemotherapeutic agent comprises carboplatin, cisplatin or doxorubicin. The use as described in claim 2, wherein the composition further comprises a pharmaceutically acceptable carrier. The use as described in claim 10, wherein the pharmaceutically acceptable carrier comprises a liposome, a nanoparticle, an exosome, a micelle, a polymeric matrix or a gel matrix. The use as described in claim 11, wherein the sequence of the lincRNA-p21 is contained in the exosome. The use as described in claim 2, wherein the composition further comprises a targeting molecule for binding to a biomarker on cancer cells. The use as described in claim 13, wherein the targeting molecule comprises an anti-HLAG antibody.

Images