TWI836364B - Lentivirus packaging system and the method of using the same for improving lentivirus production in a host cell - Google Patents

Abstract

The present invention provides a lentivirus packaging system, which comprises: a transfer plasmid comprising a nucleic acid sequence encoding TAR-reserved- chimeric 5’ long terminal repeat (LTR); at least one packaging plasmid comprising a nucleotide sequence encoding TAR RNA binding protein gene, a nucleotide e sequence of revgene, a nucleotide sequence of gaggene, and a nucleotide sequence of polgene; and an envelope plasmid. Due to the expression of TAR RNA binding protein gene by the plasmids, the produced lentivirus have higher virus titer and can improve the transduction rate and the gene delivery efficiency during cell transduction. The present invention further provides a method of improving lentivirus production in a host cell, which comprises using the aforementioned lentivirus packaging system to transfect the host cell. The method can further reduce the cost of making a gene-modified cell.

Description

Lentiviral packaging system and method for using the same to increase lentiviral production in host cells

The present invention relates to a lentiviral packaging system, in particular to a lentiviral packaging of a plasmid containing a nucleotide sequence of a gene encoding a TAR RNA binding protein and a plasmid containing a nucleotide sequence of a TAR chimeric 5' LTR. system.

Lentivirus is a type of retrovirus that is widely used to deliver target genes to hard-to-transfect cells, such as primary T cells. Unlike other retroviruses, lentivirus can be transduced into both dividing and non-dividing cells. And if used in combination with VSV-G protein, it can infect cells of different origins. In addition, the RNA genome capacity of lentivirus is about 10 Kb, so it can be used to deliver larger or more complex gene sequences. Because of these advantages, lentivirus is widely used in clinical treatment.

Lentivirus preparation usually involves co-transfection of 293T cells with a transfer plasmid containing the target gene and other plasmids containing the viral genes required for lentiviral packaging. After plasmid transfection, lentiviral particles containing the sequence of the target gene are released into the culture medium. The culture medium is then collected, further concentrated, and stored at -80°C at the concentration to be used.

Lentiviral packaging systems have continued to develop over the past few decades. The first generation of lentiviral packaging systems consisted of three plasmids: a transfer plasmid, an envelope plasmid, and a plasmid containing essential HIV-1 viral genes ( gag , pol , tat , and rev ) and some accessory genes ( vif , vpu , vpr , and nef ). The gag gene of the virus encodes many viral capsid proteins; the pol gene encodes the reverse transcriptase, integrase, and protease that are useful for viral packaging and infection. Since the aforementioned four accessory genes are not necessary for viral packaging or infection of target cells, the second generation of lentiviral packaging systems will remove the aforementioned four accessory genes. In the first and second generation viral packaging systems, the transcription of the viral genome containing the target gene on the transfer plasmid is driven by the 5' LTR (long terminal repeat) and TAT protein as a promoter, wherein the TAT protein is a transcriptional activating regulatory protein that can bind to the TAR (trans-activation response) sequence in the LTR.

In the third-generation lentivirus packaging system, in order to further increase the safety of lentivirus, especially to avoid the development of lentivirus replication ability, the LTR flanking both ends of the target gene are modified and the rev gene is moved. to the fourth plastid to further reduce the chance of genetic recombination. The modified LTR no longer has promoter activity, and the transcription of the viral genome sequence on the transferred plasmid is replaced by the Rous sarcoma virus promoter (RSV promoter) added in front of the modified 5' LTR. ) or driven by cytomegalovirus promoter (CMV promoter). In this case, the tat gene is useless, so it was removed in the third-generation lentiviral packaging system to increase the infection efficiency of the lentiviral packaging system by reducing the gene.

However, compared with the second-generation lentiviral packaging system, the third-generation lentiviral packaging system has improved safety but sacrificed the yield of lentivirus. Therefore, there is an urgent need for a lentiviral packaging system that can improve the efficiency of virus production.

In order to overcome the shortcomings of the prior art, the purpose of the present invention is to increase the yield of lentivirus produced by the lentivirus packaging system without compromising safety.

To achieve the above-mentioned purpose of the invention, the present invention provides a lentiviral packaging system, which comprises: a transfer plasmid, which comprises a nucleotide sequence of a TAR chimeric 5' LTR (trans-activation response element-reserved chimeric 5' long terminal repeat); at least one packaging plasmid, which comprises a nucleotide sequence of a gene encoding a TAR RNA binding protein, a nucleotide sequence of a rev gene, a nucleotide sequence of a gag gene and a nucleotide sequence of a pol gene; and an envelope plasmid.

By adding a plasmid containing a nucleotide sequence encoding a gene encoding a TAR RNA binding protein to the third-generation lentivirus packaging system, the present invention can improve the yield and virus titer of the produced lentivirus, especially the viral titer. Functional titer, and can also improve the gene delivery efficiency of the produced lentivirus during transduction.

Preferably, the nucleotide sequence of the gene encoding the TAR RNA binding protein is the nucleotide sequence of the tat gene.

Preferably, the nucleotide sequence of the tat gene includes the nucleotide sequence shown in SEQ ID NO: 1. It is at least part of the gene encoding TAR RNA binding protein, and because the nucleotide sequence shown in SEQ ID NO: 1 does not contain introns, it is the same as the nucleoside of the tat gene commonly used in second-generation lentiviral packaging systems. The acid sequence is different and can have a smaller plastid size.

Preferably, the nucleotide sequence of TAR in the nucleotide sequence of the TAR chimeric 5' LTR comprises the nucleotide sequence shown in SEQ ID NO: 2.

Preferably, the nucleotide sequence of the TAR chimeric 5' LTR has its U3 of the 5' LTR destroyed and replaced by a CMV or RSV promoter. This makes it difficult for the virus to replicate and improves safety. The TAR chimeric 5' LTR nucleotide sequence is the same as that of the third generation lentiviral packaging system. In one embodiment of the present invention, the RSV promoter is used as the promoter.

Preferably, the number of the at least one packaging plasmid is equal to the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleoside of the pol gene. The number of acid sequences, for example: when the number of the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene is each 1. When there are four in total, the number of plastids is also four, that is, the at least one packaging plastid system is the first packaging plastid, the second packaging plastid, the third packaging plastid and the fourth packaging plastid, And the first packaging plastid includes the nucleotide sequence of the gene encoding the TAR RNA binding protein, the second packaging plastid includes the nucleotide sequence of the rev gene, and the third packaging plastid includes the gag gene. The nucleotide sequence and the four-package plasmid contain the nucleotide sequence of the pol gene. Preferably, each packaging plasmid has a sequence.

Preferably, the at least one packaging plasmid system is a first packaging plasmid and a second packaging plasmid, and the first packaging plasmid includes the nucleotide sequence of the gene encoding TAR RNA binding protein, One of the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene, and the second packaging plastid includes the nucleotides of the gene encoding the TAR RNA binding protein. sequence, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene. For example: the first packaging plastid includes the nucleotide sequence of the gene encoding TAR RNA binding protein, and the second packaging plastid includes the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the pol gene. nucleotide sequence. Alternatively, the first packaging plastid includes the nucleotide sequence of the rev gene, and the second packaging plastid includes the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the gag gene, and the pol gene. nucleotide sequence.

Preferably, the at least one packaging plasmid is a first packaging plasmid and a second packaging plasmid, and the first packaging plasmid comprises two of the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene, and the second packaging plasmid comprises the rest of the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. And the nucleotide sequences contained in the first packaging plasmid and the second packaging plasmid are different from each other. For example: the first packaging plasmid comprises the nucleotide sequence of the gene encoding the TAR RNA binding protein and the nucleotide sequence of the rev gene; and the second packaging plasmid comprises the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene. Or the first packaging plasmid comprises the nucleotide sequence of the gene encoding the TAR RNA binding protein and the nucleotide sequence of the gag gene; and the second packaging plasmid comprises the nucleotide sequence of the rev gene and the nucleotide sequence of the pol gene. Alternatively, the first packaging plasmid comprises the nucleotide sequence of the gene encoding the TAR RNA binding protein and the nucleotide sequence of the pol gene; and the second packaging plasmid comprises the nucleotide sequence of the rev gene and the nucleotide sequence of the gag gene.

Preferably, the at least one packaging plasmid system is a first packaging plasmid, a second packaging plasmid and a third packaging plasmid, and the first packaging plasmid includes the encoding TAR RNA binding protein. Two of the nucleotide sequence of the gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene, and the second packaging plasmid and the third packaging plasmid The entities respectively include any of the remaining nucleotide sequence of the gene encoding the TAR RNA-binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. Furthermore, the first packaging plastid, the second packaging plastid and the third packaging plastid each contain different nucleotide sequences. In one embodiment, the first packaging plastid includes the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene; and the second packaging plastid includes the nucleotide sequence encoding the TAR RNA binding protein. The nucleotide sequence of the gene; and the third packaging plastid contains the nucleotide sequence of the rev gene. In this implementation, not only will the lentivirus output not be reduced due to the increase in the number of plastids during co-transfection, but the lentivirus output produced can be compared with the third-generation lentivirus packaging system with a smaller number of plastids. The lentivirus produced is high.

Preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 3 to 12: 3 to 7: 1 to 4: 1 to 4: 1 to 6, and more preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 5 to 11: 4 to 7: 2 to 3: 1 to 2: 2 to 4. At this ratio, more lentivirus can be produced. More preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 5: 5: 2: 2: 4. At this ratio, more lentivirus can be produced. Even more preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 10: 6: 3: 1: 3. At this ratio, more lentivirus can be produced.

Preferably, the enveloped plastid contains the nucleotide sequence of the gene encoding vesicular stomatitis virus glycoprotein (VSV-G) or the baboon endogenous virus envelope (baboon endogenous virus envelope) The nucleotide sequence of the gene contributes to the formation of the envelope and increases the infectivity of the produced virus and the types of cells it can infect.

Preferably, the lentiviral packaging system further comprises at least one or more plasmids comprising the nucleotide sequence of the vpu gene, the nucleotide sequence of the nef gene, the nucleotide sequence of the vif gene, and the nucleotide sequence of the vpr gene.

Preferably, the transfer plasmid may further contain a target gene to be delivered.

Preferably, the target gene to be delivered comprises a nucleotide sequence encoding an anti-CD19 receptor, and the anti-CD19 receptor is a receptor that specifically binds to the CD19 antigen.

According to the present invention, the anti-CD19 receptor system is such as Porter, David L., et al. "Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia." N engl j Med 365 (2011): 725-733 The nucleotide of CD19 receptor-BBz, which is the co-stimulatory 4-1BB and CD3ζ in the endodomain. It can be further used to prepare chimeric antigen receptor (Chimeric antigen receptor, CAR) cells for treating cancer. In one embodiment of the present invention, the nucleotide sequence encoding anti-CD19 receptor is a nucleotide sequence encoding anti-CD19 receptor-BBz, that is, anti-CD19 receptor-BBz (hereinafter referred to as CD19-BBz). ) nucleotide sequence.

The present invention also provides a lentivirus, which is prepared by the aforementioned lentivirus packaging system. Compared with the third generation lentivirus packaging system, the prepared lentivirus has more TAT protein in the virus particles, and has higher transduction efficiency after testing compared with the third generation lentivirus packaging system.

The present invention further provides an isolated cell, which is obtained by transducing genes into nucleated cells via lentivirus as mentioned above. Preferably, the nucleated cells comprise isolated T cells, natural killer cells, natural killer T cells, or adipose stem cells, so the isolated cells can be further used to prepare chimeric antigen receptors for treating cancer. Somatic cells, that is, the present invention also provides a use of the aforementioned isolated cells, which is used to prepare drugs for treating cancer. The present invention further provides a method for increasing the lentivirus production of a host cell, which includes transfecting the host cell using the aforementioned lentivirus packaging system.

Preferably, the host cell comprises a mammalian cell.

Preferably, the mammalian cell comprises human embryonic kidney cell (HEK293) or 293T cell (HEK293T), wherein 293T cell is HEK 293 cell transformed with T-antigen gene of SV40 virus.

In one embodiment, the host cell is a 293T cell.

In one embodiment, the host cell is a 293T cell with pkr gene knockout. The lentiviral packaging system of the present invention uses 293T cells with pkr gene knockout to produce lentivirus, which can effectively increase the virus titer of the produced lentivirus.

The lentivirus packaging system of the present invention can increase the viral titer of the produced lentivirus, and can also increase the transduction rate and gene delivery efficiency when used for T cell transduction. Therefore, the problem of increasing the transduction volume and reducing the transduction efficiency due to low virus titer, which affects the quality of T cells, can be avoided. And due to the high titer of the virus, the volume of lentivirus required for transduction is low, which can reduce the production of lentivirus for gene delivery applications (such as the production of chimeric antigen receptor cells (CAR-T) for the treatment of cancer). )the cost of.

The technical means adopted by the present invention to achieve the intended invention purpose will be further described below with reference to the drawings and the preparation examples and experimental examples of the present invention.

Preparation Example 1: Construction of packaging plasmid containing gene encoding TAR RNA binding protein

First, the pAll-Cas9-B2M_1-DP plasmid (the B2M gRNA DNA fragment was inserted into the pAll-Cas9.Ppuro plasmid digested by BsmBI and purchased from the RNAi Core of Academia Sinica, product number C6-8-67 to obtain pAll- Cas9-B2M plasmid, which was obtained by deleting the anti-puromycin gene expression cassette by PCR amplification and SacII digestion). The DNA fragment containing the CMV promoter digested by PspXI/AgeI enzyme was ligated to the DNA fragment digested by XmaI/SalI enzyme. The tangentialized yTA-empty (part of the WPRE fragment was amplified from the pAll-Cas9.Ppuro plasmid by PCR and inserted into the yTA vector purchased from Yisheng Company (T&A ^TM Cloning Kit, FYC001-20P) by TA cloning. , YEASTERN BIOTECH) yTA-WPRE_P obtained by digesting the yTA-WPRE_P plasmid with SacII to remove the sequence between the two SacII cut points) vector (which has the basic elements of a conventional expression vector: Ampr, Ampr promoter and ori) to prepare yTA-CMV plasmid. The gene encoding the TAR RNA binding protein used in this preparation example is the nucleotide sequence of the tat gene without introns, as shown in SEQ ID NO: 1, which was obtained through the pCMVdeltaR8.91 plasmid (purchased from RNAi, Academia Sinica After amplification of Core), it was digested by NheI/BsrGI and inserted into the linearized yTA-CMV plasmid digested by NheI/BsrGI to obtain the yTA-CMV- tat expression plasmid shown in Figure 1, with 3749 bases. base pair.

Preparation Example 2: Construction of transfer plasmid containing CD19-BBz

The pLAS5w.Ppuro plasmid (purchased from RNAi Core, Academia Sinica, product number C6-8-39) containing the nucleotide sequence of the TAR chimeric 5' LTR and driven by the RSV promoter was removed from the hPGK promoter and the PAC gene (commissioned by GenScript) to obtain the pLAS5w plasmid. The nucleotide sequence encoding CD19-BBz was then cut from Lenti-EF1a-CD19 plasmid (commissioned by Creative Biolabs) with BstBI and NheI and inserted into the aforementioned pLAS5w plasmid, wherein the nucleotide sequence of TAR contained in the TAR chimeric 5' LTR is shown in SEQ ID NO: 2.

Experimental Example 1: Preparation of Lentivirus

293T cells were seeded at a density of 1.5 x 10 ⁷ cells/mL in T875 culture flasks (large scale) and 1 x 10 ⁶ cells/mL in 10 cm culture dishes (small scale) in DMEM (Dulbecco's Modified Eagle Medium, 11965-092, Gibco) containing 10% fetal bovine serum at 37°C and 5% carbon dioxide for three days. The second generation lentiviral packaging system (Comparative Example 1) and the third generation lentiviral packaging system (Comparative Example 2) in Table 1 were transfected using the transfection reagent PolyJet (SignaGen Laboratories) according to the operating manual. and the lentiviral packaging system of the present invention (including Example 1 and Example 2, the difference between the two examples is that the ratio of each packaging plasmid is different). The plasmid composition is co-transfected into 293T cells in DMEM culture medium containing 10% fetal bovine serum to prepare lentiviruses having the target gene CD19-BBz to be delivered in a small scale (10 cm culture dish) or a large scale (T875 culture bottle) (Example 2 of the lentiviral packaging system of the present invention is only for small-scale preparation of lentiviruses), wherein the second-generation lentiviral packaging system of Comparative Example 1 (purchased from Academia Sinica) and the third-generation lentiviral packaging system of Comparative Example 2 (purchased from Aldevron) are known technologies. The next day, Opti-MEM (51985-034, Gibco) was used to replace the original DMEM medium containing 10% fetal bovine serum. After 24 hours, the first supernatant containing lentiviral particles was collected, and Opti-MEM medium was added for another 24 hours to collect the second supernatant containing lentiviral particles. After completing all the collection procedures, all the supernatants containing lentiviral particles were mixed together and concentrated 100 times using Lenti-X concentration reagent (Takara Bio), that is, the volume of the supernatant containing lentiviral particles was reduced to 1/100 of the original volume, and 100-fold concentrated lentivirus was obtained.

Table 1. Plasmid composition of packaging system for lentiviral preparation Packaging system Plasma 10 cm culture dish (small scale) T875 Culture Bottle (Large Scale) Added amount (μg) Total amount (μg) Added amount (μg) Added amount (μg) Second-generation lentiviral packaging system (Comparison example 1) The transfer plasmid containing CD19-BBz as described in Example 2 was prepared (driven by RSV promoter, and as shown in Figure 2A, the LTR in the figure is divided into three regions: U3, R and U5. Among them, the R region is embedded with TAR (i.e., contains TAR sequence), and ∆U3 refers to the damaged U3 region) 2.5 5 N/A N/A pCMV deltaR8.91 (purchased from Academia Sinica) 2.25 N/A N/A pMD.G (purchased from Academia Sinica) 0.25 N/A N/A Third-generation lentiviral packaging system (Comparison example 2) The transfer plasmid containing CD19-BBz as described in Example 2 was prepared (driven by RSV promoter, and as shown in Figure 2A, the LTR in the figure is divided into three regions: U3, R and U5. Among them, the R region is embedded with TAR (i.e., contains TAR sequence), and ∆U3 refers to the damaged U3 region) 2.5 8 50 160 Plasmid containing the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene (driven by the CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 2.5 50 Plasmid containing the nucleotide sequence of the rev gene (driven by the OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 1 20 Envelope plasmid containing the nucleotide sequence encoding the gene for VSV-G (driven by the PGK/CMV Fusion promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 2 40 Example 1 - Lentiviral packaging system of the present invention (as shown in FIG. 2B ) The transfer plasmid containing CD19-BBz as described in Example 2 was prepared (driven by RSV promoter, and as shown in Figure 2A, the LTR in the figure is divided into three regions: U3, R and U5. Among them, the R region is embedded with TAR (i.e., contains TAR sequence), and ∆U3 refers to the damaged U3 region) 2.5 9 50 180 Plasmid containing the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene (driven by the CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 2.5 50 Plasmid containing the nucleotide sequence of the rev gene (driven by the OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 1 20 Envelope plasmid containing the nucleotide sequence encoding the gene for VSV-G (driven by the PGK/CMV Fusion promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 2 40 Preparation of yTA-CMV-tat plasmid of Example 1 (driven by CMV promoter) 1 20 Example 2 - Lentiviral packaging system of the present invention The transfer plasmid containing CD19-BBz as described in Example 2 was prepared (driven by RSV promoter, and as shown in Figure 2A, the LTR in the figure is divided into three regions: U3, R and U5. Among them, the R region is embedded with TAR (i.e., contains TAR sequence), and ∆U3 refers to the damaged U3 region) 4 9.2 N/A N/A Plasmid containing the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene (driven by the CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 2.4 N/A N/A Plasmid containing the nucleotide sequence of the rev gene (driven by the OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 1.2 N/A N/A Envelope plasmid containing the nucleotide sequence encoding the gene for VSV-G (driven by the PGK/CMV fusion promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin version) 0.4 N/A N/A Preparation of yTA-CMV-tat plasmid of Example 1 (driven by CMV promoter) 1.2 N/A N/A

The lentivirus prepared in Experimental Example 1 was tested for viral titer. Specifically, the viral titer was determined by transducing (transducing) each lentivirus sample in Experimental Example 1 into Jurkat cells with a 3-fold serial dilution (3-fold to 6561-fold). First, 50 μL of the lentivirus sample was added to 100 μL of X-Vivo15 medium and serially diluted 3-fold. This dilution step was repeated until the dilution was 6561-fold, and multiple sets of serially diluted lentivirus samples were obtained. Then, 50 μL of each serially diluted lentiviral sample was added to RPMI 1640 (11875-085, Gibco) medium containing 10% fetal bovine serum in a 96-well plate (U-bottom) incubated with 4×10 ⁴ /100 μL/well Jurkat cells (day 0), and then on day 2, 100 μL of fresh RPMI 1640 medium containing 10% fetal bovine serum was added to each well. After incubation in an incubator for another 24 hours, the transduction efficiency of the virus was measured by detecting CD19-BBz using antibodies such as biotin-conjugated goat anti-mouse IgG F(ab)2 fragment (JacksonImmunoResearch) and Streptavidin-PE (Invitrogen), and analyzing the expression of the target protein using flow cytometry. The effective virus titer was calculated using the following formula: Virus titer (TU/ml) = (% cells expressing CD19-BBz/100) × 4 × 10 ⁴ × 20 × dilution factor

Among them, when the lentiviral sample prepared by the lentiviral packaging system of the present invention in Example 2 was used with a dilution multiple of 729 times, the expression ratio of cells expressing CD19-BBz was 16.09%, and the viral titer was obtained to be 9.38×10 ⁷ transducing units (TU)/ml, and the dilution multiple was selected by using the first dilution multiple with an expression percentage lower than 20%, and the titer was calculated based on the value of the sample with this dilution multiple. And the viral titer of the lentiviral sample prepared in Example 2 was better than that of the lentiviral sample prepared in Example 1. In addition, as shown in FIG3 , the CD19-BBz lentivirus produced by the lentiviral packaging system of the present invention in Example 1 has a significantly higher viral titer than that produced by the third-generation lentiviral packaging system, whether in large or small scale. In small scale, it is about 3.48 times higher than that produced by the third-generation lentiviral packaging system (Comparative Example 2), and in large scale, it is about 4.16 times higher than that produced by the third-generation lentiviral packaging system (Comparative Example 2). The viral titer is further multiplied by the viral volume to obtain the viral yield. Since the final viral volume produced in each embodiment and comparative example is the same, the increase in yield or viral titer is the same. That is, in the case of small scale, the yield of CD19-BBz lentivirus produced by the lentiviral packaging system of the present invention in Example 1 is 3.48 times the yield of the third-generation lentiviral packaging system (Comparative Example 2); in the case of large scale, the yield of CD19-BBz lentivirus in Example 1 of the lentiviral packaging system of the present invention in Example 1 is also 4.16 times that of the third-generation lentiviral packaging system (Comparative Example 2), which is significantly better than the lentiviral yield using the third-generation lentiviral packaging system (Comparative Example 2). Therefore, the yield of lentivirus using the lentiviral packaging system of the present invention is significantly better than that using the third-generation lentiviral packaging system (Comparative Example 2) whether it is in large scale or small scale, because the TAT protein is expressed at the same time, it does help to produce lentivirus.

Preparation Example 3: Preparation of pkr gene-depleted 293T cells

Two parts of complementary primers were combined to prepare a 24-base pair PKR guide RNA (guide RNA; gRNA), and connected to the linearized Cas9-T2A-eGFP-DP plasmid digested by BsmBI to obtain Cas9-PKR- T2A-eGFP-DP post-plastid. Utilizing gRNA targeting pkr genomic sequence: GCAACCUACCUCCUAUCAUG (SEQ ID NO: 3 ) and protein kinase R [Protein kinase R; pkr , also known as Eukaryotic translation initiation factor 2 -alpha kinase 2; eIF2AK2)] genes were combined to prepare pkr gene-deleted 293T cells using Cas 9 gene editing and DNA double-strand cutting technology. Specifically, the aforementioned Cas9-PKR-T2A-eGFP-DP plasmid containing gRNA was transfected into 293T cells using the calcium phosphate method, and the transfected 293T cells were diluted to 0.5 cells/well in a 96-well plate. , confirmed by Western blot method. Among them, the Western blot method lyses 293T cells with RIPA lysis buffer to collect cell lysate. Then analyze the total protein of the cell lysate, use rabbit anti-PKR polyclonal antibody (GTX132826, GeneTex) to detect the expression of PKR protein, and use the housekeeping gene GAPDH as an internal control, and select the 293T cell line in a 96-well plate: The gene editing results of #1, #4, #12, #17, #20, #23, and #26 are shown in Figure 4. It can be seen that the 293T cell line #12 has successfully deleted the pkr gene and will be used in experimental cases. 2 Prepare lentivirus.

Experimental Example 2: Preparation of Lentivirus Using 293T Cells with pkr Gene Knockout

The method of Experimental Example 2 is similar to that of Experimental Example 1. The difference is that this experimental example uses the third-generation lentiviral packaging system (Comparative Example 2) and the plastid composition of the lentiviral packaging system of the present invention in Example 1 to transfect The reagent PolyJet (SignaGen Laboratories) was used according to the operation manual to co-transfect the pkr gene-deleted 293T cells (#12 293T cell line) confirmed by Western blotting method in Preparation Example 3 on a small scale (10 cm culture dish). The third-generation lentiviral packaging system (Comparative Example 2) and the lentiviral packaging system of the present invention according to Example 1 were tested according to the virus titer testing steps in Preparation Example 2. The titer of the virus, the results are shown in Figure 5. On a small scale, the titer of the lentivirus prepared from 293T cells depleted of the pkr gene using the plastid composition of the lentivirus packaging system of the present invention in Example 1 is about the third The generation lentivirus packaging system (Comparative Example 2) produced 22.2 times the lentivirus titer produced by pkr gene-deleted 293T cells. Therefore, the lentivirus packaging system of the present invention can indeed significantly improve the titer of the lentivirus produced by using pkr gene-deleted 293T cells for lentivirus preparation.

Experimental Example 3: Infectivity Test - Primary T Cell Transduction

Peripheral blood mononuclear cells (PBMC) from healthy donors were treated with Ficoll (GE), and then purified and activated primary T cells using CD3/CD28 Expander Beads (ThermoFisher). The next day, the second and third generation lentiviruses prepared in Experimental Example 1 and the lentivirus packaging system of the present invention in Example 1 were transduced into the purified primary T cells (the first day of transduction). In short, 1 ml of a total of 1x10 ⁶ primary T cells and the lentivirus prepared in Experimental Example 1 (according to MOI (Multiplicity of Infection) 1, MOI 3 and MOI 5) were co-cultured. Two days after lentiviral transduction, the CD3/CD28 microbeads were removed. Finally, on the sixth day after lentiviral transduction, flow cytometry was used to detect the expression of the target gene - CD19-BBz in T cells. Specifically, 1x10 ⁵ primary T cells were suspended in 100 μL staining solution (the staining solution was a PBS solution containing 1% FCS (Fetal Calf Serum)), and then the primary antibody (Biotin-conjugated goat anti mouse IgG F(ab)2) was added and incubated at room temperature for 20 minutes. The primary T cells were washed twice with 1 mL staining solution, and then the primary T cell pellet was suspended again in a staining solution containing Streptavidin-PE (total volume 100 μL) and incubated at room temperature for 20 minutes. The primary T cells were washed twice with 1 mL staining solution, and finally the primary T cells were suspended in an appropriate amount of staining solution for flow cytometric analysis.

The experimental results are shown in Figures 6A-6C. In Figure 6A, the CD19-BBz expression rate of T cells transduced by the lentivirus produced by the lentivirus packaging system of the present invention at MOI 1, MOI 3 and MOI 5 in Example 1 is higher than that of T cells transduced by the lentivirus produced by the second and third generation lentivirus packaging systems. Therefore, compared with the second and third generation lentivirus packaging systems, the lentivirus produced by the lentivirus packaging system of the present invention has the best transduction rate, transduction efficiency and gene delivery effect. In FIG6B , the lentivirus produced by the lentivirus packaging system of the present invention in Example 1 was used to transduce T cells at MOI 1, MOI 3, and MOI 5, and the expression of CD19-BBz in T cells was detected by fluorescence-labeled antibodies. The average fluorescence intensity of each cell was higher than that of T cells transduced by lentivirus produced by the second-generation and third-generation lentivirus packaging systems. As shown in FIG6C , since the transduction rate and average fluorescence intensity of T cells transduced by the lentivirus produced by the lentivirus packaging system of the present invention in Example 1 were better than those of the second-generation lentivirus packaging system, which was about 1.2 times that of the second-generation lentivirus packaging system, the lentivirus packaging system of the present invention can enhance the activity of the produced lentivirus.

Therefore, the lentivirus packaging system of the present invention can significantly increase the yield and activity of lentivirus, effectively improve the efficiency of gene delivery when genetically modifying cells, thereby reducing the cost of genetically modified cells, and utilize pkr gene-deleted 293T cells for production The lentivirus can enhance the efficiency of the lentivirus produced.

The above descriptions are only preferred embodiments of the present invention, and do not limit the present invention in any form. Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone familiar with the art Personnel, without departing from the scope of the technical solution of the present invention, may use the technical content disclosed above to make some changes or modifications to equivalent embodiments with equivalent changes. However, any content that does not depart from the technical solution of the present invention, according to the present invention Technical Essence Any simple modifications, equivalent changes and modifications made to the above embodiments still fall within the scope of the technical solution of the present invention.

without

Figure 1 is a schematic diagram of the yTA-CMV- tat expression vector described in the present invention. Figure 2A is a schematic diagram of the transfer plasmid containing TAR chimeric 5'-LTR of the lentiviral packaging system of Example 1. Figure 2B is a schematic diagram of the plasmid composition of the lentiviral packaging system of Example 1. Figure 3 shows the viral titer multiples of the lentivirus produced by the lentiviral packaging system of the present invention in large-scale and small-scale compared with the third-generation lentiviral packaging system. Figure 4 is the expression level of PKR protein in each cell line tested by Western blotting in Preparation Example 3. Figure 5 shows the viral titer multiples of the lentivirus produced by 293T cells with pkr gene knockout in the lentiviral packaging system of the present invention in small-scale compared with the third-generation lentiviral packaging system. FIG6A shows the transduction rate of lentivirus produced by the second generation, third generation and lentivirus packaging systems of the present invention. FIG6B shows the average fluorescence intensity of T cells after lentivirus transduction produced by the second generation, third generation and lentivirus packaging systems of the present invention. FIG6C shows the transduction rate of lentivirus produced by the lentivirus packaging system of the present invention and the multiple of the average fluorescence intensity of T cells after transduction compared with the second generation lentivirus packaging system.

without

          Sequence Listing
<![CDATA[<110> PELL BIO-MED TECHNOLOGY CO., LTD]]>
<![CDATA[<120> Lentiviral packaging system and method for increasing lentiviral production in host cells using the same]]>
<![CDATA[<160> 3 ]]>
<![CDATA[<170> PatentIn Version 3.5]]>
<![CDATA[<210> 1]]>
<![CDATA[<211> 261]]>
<![CDATA[<212> DNA]]>
<![CDATA[<213> Artificial sequence]]>
<![CDATA[<220>]]>
<![CDATA[<223> Nucleotide sequence of tat gene without introns]]>
<![CDATA[<400> 1]]>
atggagccag tagatcctag actagagccc tggaagcatc caggaagtca gcctaaaact 60
gcttgtacca attgctattg taaaaagtgt tgctttcatt gccaagtttg tttcatgaca 120
aaagccttag gcatctccta tggcaggaag aagcggagac agcgacgaag agctcatcag 180
aacagtcaga ctcatcaagc ttctctatca aagcagccca cctcccaacc ccgaggggac 240
ccgacaggcc cgaaggaata a 261
<![CDATA[<210> 2]]>
<![CDATA[<211> 57]]>
<![CDATA[<212> DNA]]>
<![CDATA[<213> Artificial sequence]]>
<![CDATA[<220>]]>
<![CDATA[<223> Nucleotide sequence of TAR in nucleotide sequence of TAR chimeric 5'LTR]]>
<![CDATA[<400> 2]]>
ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gagaacc 57
<![CDATA[<210> 3]]>
<![CDATA[<211> 20]]>
<![CDATA[<212> RNA]]>
<![CDATA[<213> Artificial sequence]]>
<![CDATA[<220>]]>
<![CDATA[<223> gRNA targeting pkr gene sequence]]>
<![CDATA[<400> 3]]>
gcaaccuacc uccuaucaug 20

      

Claims (13)

A lentiviral packaging system comprises: a transfer plasmid comprising a nucleotide sequence of a TAR chimeric 5'LTR (trans-activation response element-reserved chimeric 5'long terminal repeat) and a nucleotide sequence of a 3'LTR, wherein the U3 region in the nucleotide sequence of the TAR chimeric 5'LTR and the nucleotide sequence of the 3'LTR is destroyed; at least one packaging plasmid comprising a nucleotide sequence of a gene encoding a TAR RNA binding protein, a nucleotide sequence of a rev gene, a nucleotide sequence of a gag gene and a nucleotide sequence of a pol gene, wherein the nucleotide sequence of the gene encoding the TAR RNA binding protein is the nucleotide sequence of the tat gene; and an envelope plasmid. The lentivirus packaging system of claim 1, wherein the at least one packaging plasmid system is a first packaging plasmid and a second packaging plasmid, and the first packaging plasmid includes the encoding TAR RNA Two of the nucleotide sequence of the gene of the binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene, and the second packaging plasmid includes the coding The rest of the nucleotide sequence of the TAR RNA-binding protein gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. The lentivirus packaging system according to claim 1, wherein the at least one packaging plasmid system is a first packaging plasmid, a second packaging plasmid, a third packaging plasmid and a fourth packaging plasmid, And the first packaging plastid includes the nucleotide sequence of the gene encoding the TAR RNA binding protein, the second packaging plastid includes the nucleotide sequence of the rev gene, and the third packaging plastid includes the gag gene. The nucleotide sequence, and the fourth packaging plastid respectively includes the nucleotide sequence of the pol gene. The lentivirus packaging system according to claim 1, wherein the at least one packaging plasmid system is a first packaging plasmid, a second packaging plasmid and a third packaging plasmid, and the first packaging plasmid The entity includes two of the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene, and the second The packaging plastid and the third packaging plastid respectively comprise the nucleotide sequence of the gene encoding the TAR RNA binding protein, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene. any of the remaining sequences, and the first packaging plastid, the second packaging plastid and the third packaging plastid contain different nucleotide sequences. The lentivirus packaging system according to claim 4, wherein the first packaging plastid includes the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene; the second packaging plastid includes The nucleotide sequence of the gene encoding TAR RNA binding protein; and the third packaging plastid includes the nucleotide sequence of the rev gene. The lentivirus packaging system according to claim 5, wherein the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 3 to 12: 3 to 7: 1 to 4: 1 to 4: 1 to 6. The lentivirus packaging system according to claim 1, wherein the nucleotide sequence of the tat gene includes the sequence shown in SEQ ID NO: 1. The lentivirus packaging system according to claim 1, wherein the enveloped plasmid contains a gene encoding vesicular stomatitis virus glycoprotein (VSV-G). The nucleotide sequence of the gene or the gene of the baboon endogenous virus envelope. The lentivirus packaging system according to claim 1, wherein the nucleotide sequence of TAR in the nucleotide sequence of the TAR chimeric 5'LTR includes the nucleotide sequence shown in SEQ ID NO: 2 . A method for improving the lentivirus production of a host cell, which includes using the lentivirus packaging system as described in any one of claims 1 to 9 to transfect the host cell, wherein the host cell is 293T with pkr gene deleted cells. A method for increasing the yield of lentivirus in host cells, comprising transfecting the host cells using a lentivirus packaging system as described in any one of claims 1 to 9. A method for increasing the yield of lentivirus in host cells as described in claim 11, wherein the host cells include mammalian cells. A method for increasing the yield of lentivirus in host cells as described in claim 12, wherein the mammalian cells include human embryonic kidney cells (HEK293) or 293T cells (HEK293T).

Images