CN115247190A

CN115247190A - Lentiviral packaging system, lentivirus prepared by same, cell transduced by same and application thereof

Info

Publication number: CN115247190A
Application number: CN202110465505.5A
Authority: CN
Inventors: 林韦齐; 周思妤; 杨曜诚; 林建廷; 林成龙
Original assignee: Peier Biotech Pharmaceutical Co ltd
Current assignee: Peier Biotech Pharmaceutical Co ltd
Priority date: 2021-04-28
Filing date: 2021-04-28
Publication date: 2022-10-28
Anticipated expiration: 2041-04-28
Also published as: CN115247190B

Abstract

The invention provides a lentivirus packaging system, a lentivirus prepared by the same, a cell transduced by the lentivirus and application of the cell transduced by the lentivirus. A lentivirus packaging system comprising: a transfer plasmid comprising the nucleotide sequence of TAR chimeric 5' ltr; at least one packaging plasmid comprising a nucleotide sequence of a gene encoding a TAR RNA-binding protein, a nucleotide sequence of a rev gene, a nucleotide sequence of a gag gene, and a nucleotide sequence of a pol gene; and an envelope plasmid. The invention can express TAR RNA binding protein gene because of containing the open plasmid, so that the produced lentivirus has higher virus titer, and the transduction rate and the gene transfer efficiency can be improved when the produced lentivirus is used for cell transduction. The present invention further provides a method for increasing the lentivirus yield of a host cell, comprising transfecting said host cell with the aforementioned lentivirus packaging system, and further reducing the cost of manufacturing genetically modified cells.

Description

Lentiviral packaging system, lentivirus prepared by same, cell transduced by lentivirus and application of lentivirus

Technical Field

The invention relates to a lentivirus packaging system, in particular to a lentivirus packaging system of a plasmid containing a nucleotide sequence of a gene coding TAR RNA binding protein and a plasmid containing a nucleotide sequence of TAR chimeric 5' LTR.

Background

Lentivirus (lentivirus) is a retrovirus widely used to deliver genes of interest to cells that are difficult to transfect (hard-to-transfect), for example: primary T cells. Lentiviruses can be transduced into dividing (differentiating) and non-dividing (non-differentiating) cells, unlike other retroviruses. And if used in combination with VSV-G protein, can infect cells of different origin. In addition, lentiviruses have an RNA genome capacity of about 10Kb and can be used to deliver larger or more complex gene sequences. Lentiviruses are widely used in clinical therapy because of their advantages.

Lentiviruses are typically prepared by co-transfecting 293T cells with a transfer plasmid containing the gene of interest and other plasmids containing the viral genes required for packaging of the lentivirus. After plasmid transfection, lentiviral particles containing the gene sequence of interest will be released into the culture medium. Next, the medium was harvested, further concentrated, prepared to a ready-to-use concentration and stored at-80 ℃.

Lentiviral packaging systems have continued to evolve over the past decades, with the first generation of lentiviral packaging systems comprising three plasmids, a transfer plasmid, an envelope plasmid, and a plasmid containing the necessary HIV-1 viral genes (gag, pol, tat and rev) and some accessory genes (vif, vpu, vpr and nef). Wherein the gag gene of the virus encodes a plurality of viral capsid proteins; the pol gene encodes reverse transcriptase, chimeric enzyme (integrase) and protease for viral packaging and infection. Since the four accessory genes are not essential for viral packaging or for infecting target cells, the second generation lentiviral packaging systems remove the four accessory genes. In the first and second generation viral packaging systems, transcription of the viral genome containing the target gene on the transfer plasmid is driven by 5' LTR (long terminal repeat) as a promoter and TAT protein, which is a transcription-activation regulatory protein (TAR) sequence that can bind to LTR.

In the third generation of lentivirus packaging system, to further increase the safety of lentiviruses, especially to avoid the development of replication ability of lentiviruses, LTRs surrounding (flank) both ends of the target gene are modified and the rev gene is transferred to a fourth plasmid, further reducing the chance of gene recombination. While the modified LTR no longer has promoter activity, transcription of the viral genome sequence on the transfer plasmid is driven by either the Rous sarcoma virus promoter (RSV promoter) or the cytomegalovirus promoter (CMV promoter) added before the modified 5' LTR. In this case, the tat gene is useless and is therefore removed in the third generation lentiviral packaging system, increasing the infection efficiency of the lentiviral packaging system by reducing the gene.

However, third generation lentiviral packaging systems, while providing increased safety, sacrifice lentivirus yield over second generation lentiviral packaging systems. There is therefore a need for a lentiviral packaging system that increases the efficiency of virus production.

Disclosure of Invention

To overcome the disadvantages of the prior art, the present invention aims to increase the yield of lentiviruses produced by a lentivirus packaging system without compromising safety.

To achieve the above object, the present invention provides a lentivirus packaging system (packaging system) comprising: a transfer (transfer) plasmid comprising the nucleotide sequence of TAR chimeric 5'LTR (trans-activation-responded chimeric 5' long terminal repeat); at least one packaging plasmid comprising a nucleotide sequence encoding a TAR RNA binding protein (TAR RNA binding protein) gene, a nucleotide sequence of a rev gene, a nucleotide sequence of a gag gene, and a nucleotide sequence of a pol gene; and an envelope (envelope) plasmid.

The present invention can increase the yield and virus titer of the produced lentivirus, especially the functional titer (functional titer) of the virus, and also can increase the gene transfer efficiency of the produced lentivirus during transduction by adding the plasmid containing the nucleotide sequence of the TAR RNA binding protein gene into the third generation lentivirus packaging system.

Preferably, the nucleotide sequence of the gene encoding TAR RNA binding protein is the nucleotide sequence of the tat gene.

Preferably, the nucleotide sequence of the tat gene comprises the nucleotide sequence as set forth in SEQ ID NO: 1. It is at least a part of the gene encoding the TAR RNA binding protein and because of the amino acid sequence of SEQ ID NO:1, does not contain an intron, and can have a smaller plasmid size unlike the nucleotide sequence of the tat gene which is commonly used in the second generation lentiviral packaging system.

Preferably, the nucleotide sequence of TAR in the nucleotide sequence of TAR chimeric 5' LTR comprises the nucleotide sequence shown in SEQ ID NO:2 under the condition of high nucleotide sequence.

Preferably, the nucleotide sequence of TAR chimeric 5'LTR, U3 of its 5' LTR is disrupted and driven by CMV or RSV promoter instead. So that the virus cannot be sufficiently replicated, and the encoding TAR chimeric 5' LTR is the same as the third generation lentivirus packaging system, thereby improving the safety. In one embodiment of the invention, the RSV promoter is used to drive.

Preferably, the number of the at least one packaging plasmid is equal to the number of the nucleotide sequence of the gene encoding TAR RNA binding protein, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene and the nucleotide sequence of pol gene, such as: when the number of the nucleotide sequence encoding TAR RNA-binding protein gene, the nucleotide sequence rev gene, the nucleotide sequence gag gene and the nucleotide sequence pol gene is one, and four, the number of plasmids is also four, that is, the at least one packaging plasmid is a first packaging plasmid, a second packaging plasmid, a third packaging plasmid and a fourth packaging plasmid, and the first packaging plasmid comprises the nucleotide sequence encoding TAR RNA-binding protein gene, the second packaging plasmid comprises the nucleotide sequence rev gene, the third packaging plasmid comprises the nucleotide sequence gag gene and the fourth packaging plasmid comprises the nucleotide sequence pol gene. Preferably, each of the packaging plasmids has a sequence.

Preferably, the at least one packaging plasmid is a first packaging plasmid and a second packaging plasmid, and the first packaging plasmid comprises one of the nucleotide sequence encoding the TAR RNA binding protein gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene, and the second packaging plasmid comprises the remaining of the nucleotide sequence encoding the TAR RNA binding protein gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. For example: the first packaging plasmid comprises the nucleotide sequence of the gene encoding TAR RNA binding protein, and the second packaging plasmid comprises the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. Or the first packaging plasmid comprises the nucleotide sequence of the rev gene, and the second packaging plasmid comprises the nucleotide sequence of the TAR RNA binding protein encoding gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene.

Preferably, the at least one packaging plasmid is a first packaging plasmid and a second packaging plasmid, and the first packaging plasmid comprises both of the nucleotide sequence encoding the TAR RNA binding protein gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene, and the second packaging plasmid comprises the remaining of the nucleotide sequence encoding the TAR RNA binding protein gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene, and the nucleotide sequence of the pol gene. And the nucleotide sequences contained in the first packaging plasmid and the second packaging plasmid are different respectively. For example: the first packaging plasmid comprises the nucleotide sequence of the TAR RNA binding protein encoding gene and the nucleotide sequence of the rev gene; and the second packaging plasmid comprises the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene. Or said first packaging plasmid comprises the nucleotide sequence of said gene encoding TAR RNA binding protein and the nucleotide sequence of said gag gene; and the second packaging plasmid comprises the nucleotide sequence of the rev gene and the nucleotide sequence of the pol gene. Or the first packaging plasmid comprises the nucleotide sequence of the TAR RNA binding protein encoding gene and the nucleotide sequence of the pol gene; and the second packaging plasmid comprises the nucleotide sequence of the rev gene and the nucleotide sequence of the gag gene.

Preferably, the at least one packaging plasmid is a first packaging plasmid, a second packaging plasmid, and a third packaging plasmid, and the first packaging plasmid comprises two of the nucleotide sequence encoding TAR RNA-binding protein gene, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene, and the nucleotide sequence of pol gene, while the second packaging plasmid and the third packaging plasmid respectively comprise any of the remaining of the nucleotide sequence encoding TAR RNA-binding protein gene, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene, and the nucleotide sequence of pol gene. And the nucleotide sequences contained in the first packaging plasmid, the second packaging plasmid and the third packaging plasmid are different from each other. In one embodiment, the first packaging plasmid comprises the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene; and said second packaging plasmid comprises said nucleotide sequence encoding a TAR RNA-binding protein gene; and said third packaging plasmid comprises the nucleotide sequence of said rev gene. In this embodiment, not only does the decrease in lentivirus production due to the increase in plasmid number during co-transfection, but also the production of lentivirus is higher than that of the lentivirus produced by the third generation lentivirus packaging system with less plasmid number.

Preferably, the weight ratio of the transfer plasmid to the first, second, third and envelope plasmids is 3 to 12:3 to 7:1 to 4:1 to 4:1 to 6, preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 5 to 11:4 to 7:2 to 3:1 to 2:2 to 4. At this ratio, more lentiviruses can be produced. More preferably, the weight ratio of the transfer plasmid to the first, second, third and envelope plasmids is 5:5:2:2:4. at this ratio, more lentiviruses can be produced. Still more preferably, the weight ratio of the transfer plasmid to the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 10:6:3:1:3. at this ratio, more lentiviruses can be produced.

Preferably, the envelope plasmid comprises a nucleotide sequence of a gene encoding vesicular stomatitis virus glycoprotein (VSV-G) or a nucleotide sequence of a gene encoding baboon endogenous virus envelope (baboon endogenous virus envelope), to facilitate envelope formation and increase the infectivity of the resulting virus and the number of cells that can be infected.

Preferably, the lentiviral packaging system further comprises at least one or more plasmids comprising the nucleotide sequence of the vpu gene, the nucleotide sequence of the nef gene, the nucleotide sequence of the vif gene, the nucleotide sequence of the vpr gene.

Preferably, the transfer plasmid may further comprise a target gene to be delivered.

Preferably, the target gene to be delivered comprises a nucleotide sequence encoding an anti-CD 19 receptor, which is a receptor that specifically binds to the CD19 antigen.

According to the present invention, the anti-CD 19 receptor is a nucleotide of anti-CD 19 receptor-BBz as in Porter, david L, et al, "polymeric anti-receptor-modified T cells in cyclic lymphoma leukamia," N engl j Med 365 (2011): 725-733, and BBz is CD3 ζ of co-stimulatory 4-1BB and intracellular domain (endodomain). And can be further used for preparing Chimeric Antigen Receptor (CAR) cells for treating cancer. In one aspect of the present invention, the nucleotide sequence encoding anti-CD 19 receptor is included by using a nucleotide sequence encoding anti-CD 19 receptor-BBz, i.e., a nucleotide sequence encoding anti-CD 19 receptor-BBz (hereinafter, abbreviated as CD 19-BBz).

The invention further provides a lentivirus prepared by the lentivirus packaging system. Compared with a third generation lentivirus packaging system, the prepared lentivirus has the advantages that TAT proteins are added in virus particles, and the prepared lentivirus has higher transduction efficiency compared with the third generation lentivirus packaging system after being tested.

The present invention further provides an isolated cell obtained by transducing a gene into a nucleated cell with a lentivirus as described above. Preferably, the nucleated cells comprise isolated T cells, natural killer T cells, or adipose stem cells, and thus the isolated cells can be further used for preparing chimeric antigen receptor cells for treating cancer, i.e., the present invention further provides a use of the aforementioned isolated cells for preparing a medicament for treating cancer. The invention further provides a method for increasing the production of lentiviruses by a host cell, comprising transfecting said host cell with the aforementioned lentivirus packaging system.

Preferably, the host cell comprises a mammalian cell.

Preferably, the mammalian cell comprises a human embryonic kidney cell (HEK 293) or 293T cell (HEK 293T), wherein the 293T cell is a cell obtained by revamping the T-antigen gene of SV40 virus to HEK 293.

In one embodiment, the host cell is a 293T cell.

In one embodiment, the host cell is a pkr knockout 293T cell. The lentivirus packaging system of the invention uses 293T cells with pkr gene knockout to produce lentivirus, and can really improve the virus titer of the produced lentivirus.

The lentivirus packaging system can improve the virus titer of the produced lentivirus, and can also improve the transduction rate and the gene transfer efficiency when used for T cell transduction. Therefore, the problem that the T cell quality is influenced by the increase of the transduction volume and the reduction of the transduction efficiency caused by the low virus titer can be avoided. And because of the high viral potency, the volume of lentivirus required for transduction is low, thus reducing the cost of producing lentiviruses for gene delivery applications, such as the manufacture of chimeric antigen receptor cells (CAR-T) for the treatment of cancer.

Drawings

FIG. 1 is a schematic diagram of the yTA-CMV-tat expression vector of the present invention.

FIG. 2A is a schematic diagram of the lentiviral packaging system of example 1 containing a TAR chimeric 5' -LTR transfer plasmid.

FIG. 2B is a schematic of the plasmid composition of the lentiviral packaging system of example 1.

FIG. 3 is a graph showing the fold of viral titer of lentiviruses produced at large and small scale by the lentivirus packaging system of the present invention compared to a third generation lentivirus packaging system.

FIG. 4 shows the expression level of PKR protein in each cell line tested by Western blotting in preparation example 3.

FIG. 5 is a graph showing the fold of viral titer of lentiviruses produced by the lentiviral packaging system of the present invention on a small scale using pkr knockout 293T cells as compared to a third generation lentiviral packaging system.

FIG. 6A is a graph showing transduction rates of lentiviruses produced by second generation, third generation and the lentivirus packaging system of the present invention.

FIG. 6B is a graph showing the mean fluorescence intensity of T cells after transduction by lentiviruses produced by second generation, third generation and the lentivirus packaging system of the present invention.

FIG. 6C is a graph of the transduction rate of lentiviruses produced by the lentiviral packaging system of the present invention compared to a second generation lentiviral packaging system and the fold of the mean fluorescence intensity of transduced T cells.

Detailed Description

The technical means adopted by the invention to achieve the predetermined purpose of the invention will be further described below by combining the drawings and preparation examples and experimental examples of the invention.

Preparation example 1: construction of a packaging plasmid containing a Gene encoding TAR RNA-binding protein

First, a DNA fragment containing CMV promoter after digestion with PspXI/AgeI was ligated to a yTA-empty linearized by XmaI/I (a partial WPRE fragment was amplified from the pAll-Casll-9. Ppuro plasmid by PCR and introduced to a yTA vector purchased from Yisheng corporation) (T.sub.T.sub.T.sub.A.sub.A.sub.B.sub.9-B.sub.2M _1-DP plasmid (B.sub.2M gRNA DNA fragment was introduced to BsmBI digested pAll-Cas Core purchased from Miyao, product number C6-8-67 to obtain pAll-Cas.sub.9-Ppuro plasmid), and then an anti-puromycin gene expression cassette was deleted by PCR amplification and SacII digestion)&A ^TM yTA-WPRE _ P obtained from Cloning Kit, FYC001-20p, yeasten BIOTECH) and obtained by digesting the yTA-WPRE _ P plasmid using SacII to remove the sequence located between the two SacII cleavage points) vector (having thereon conventional expression vector essential components: ampr, ampr promoter and ori) to obtain a yTA-CMV plasmid. The gene encoding TAR RNA-binding protein used in this preparation example is the nucleotide sequence of the tat gene without introns, as shown in SEQ ID NO: shown in FIG. 1 is a yTA-CMV-tat expression plasmid having 3749 base pairs, which is obtained by amplifying pCMVdeltaR8.91 plasmid (purchased from RNAi Core, ministry of China), cleaving with NheI/BsrGI, and inserting the yTA-CMV plasmid linearized by NheI/BsrGI cleavage.

Preparation example 2: construction of a transfer plasmid containing CD19-BBz

The plasmid pLAS5w.Ppuro (available from Mitsui corporation, RNAi Core, inc., under the trade designation C6-8-39) containing the nucleotide sequence of TAR chimeric 5'LTR and driven by RSV promoter was digested with BstBI and NheI from Lenti-EF1a-CD19 plasmid (available from Creative Biolabs) to obtain the pLAS5w plasmid, and the nucleotide sequence encoding CD19-BBz was digested with BstBI and NheI from Lenti-EF1a-CD19 plasmid, wherein the nucleotide sequence of TAR contained in TAR chimeric 5' LTR was represented by SEQ ID NO:2, respectively.

Experimental example 1: preparation of lentiviruses

293T cells at 1.5X 10 per milliliter (mL) ⁷ Cell density was seeded in T875 flasks (Large Scale) at 1X 10 cells/ml ⁶ Cell density was plated on 10 cm dishes (small scale) in DMEM (Dul) with 10% fetal bovine serumAfter culturing becco's Modified Eagle Medium,11965-092, gibco) for three days at 37 ℃ using transfection reagent PolyJet (signalgen Laboratories), the second generation lentivirus packaging system (comparative example 1), the third generation lentivirus packaging system (comparative example 2) and the lentivirus packaging system of the present invention (comprising example 1 and example 2, differing only in the ratio of each packaging plasmid) in table 1 were co-transfected into 293T cells in DMEM Medium containing 10% fetal bovine serum in accordance with the manual method to prepare lentiviruses having the target gene CD19-BBz to be delivered (example 2 of the lentivirus packaging system of the present invention was prepared only in small scale) or in large scale (T875 bottle), respectively, wherein the second generation lentivirus packaging system of comparative example 1 (purchased from ministerial institute) and the third generation lentivirus packaging system of comparative example 2 (purchased from conventional lentiron) were purchased. On the next day, the DMEM medium containing 10% fetal bovine serum was replaced with Opti-MEM (51985-034, gibco), the supernatant containing the lentiviral particles was collected for the first time after 24 hours, the Opti-MEM medium was added and cultured for 24 hours, and the supernatant containing the lentiviral particles was collected for the second time, all the supernatants were mixed together and concentrated 100-fold using Lenti-X concentration reagent (Takara Bio), i.e., the volume of the supernatant containing the lentiviral particles was reduced to 1/100 of the original volume, to obtain 100-fold concentrated lentiviruses.

TABLE 1 plasmid composition of packaging systems for lentivirus preparation

The lentiviruses prepared in Experimental example 1 were tested for viral titer, specifically, viral titer was transduced (transducing) to J in each lentivirus sample of Experimental example 1 diluted in 3-fold sequence (3-fold to 6561-fold)The assay was performed on ukat cells. First, 50 μ L of lentiviral samples were added to 100 μ L of X-Vivo15 medium and subjected to 3-fold serial dilution, and this dilution step was repeated until 6561-fold dilution, yielding multiple sets of serial diluted lentiviral samples. Next, 50. Mu.L of each of the serially diluted lentivirus samples was added to a 96-well plate (U-bottom) and cultured in 4X 10 ⁴ 100 μ L/well of Jurkat cells in RPMI1640 medium (11875-085, gibco) containing 10% fetal bovine serum (day 0), followed by addition of 100 μ L of fresh RPMI1640 medium containing 10% fetal bovine serum at day 2 in each well. After further incubation in the incubator for 24 hours, CD19-BBz was detected using antibodies to biotin-conjugated coat anti-mouse IgG F (ab) 2fragment (Jackson ImmunoResearch) and Streptavidin-PE (Invitrogen), and the transduction potency of the virus was measured by analyzing the expression level of the target protein using a flow cytometer. And calculating the effective virus titer by the following formula:

viral titer (TU/ml) = (% cells expressing CD 19-BBz/100). Times.4X 10 ⁴ X 20 x dilution factor

Among them, the lentivirus sample prepared by using the lentivirus packaging system of the present invention of example 2 diluted 729 times gave a virus titer of 9.38X 10, in which the expression ratio of cells expressing CD19-BBz was 16.09% ⁷ Transduction Units (TU)/ml and the dilution selected is the dilution at which the first percentage of expression is less than 20% and the value of this dilution sample is used to calculate the titer. And the virus titer of the lentivirus sample prepared in example 2 was superior to that of the lentivirus sample prepared in example 1. Furthermore, as shown in FIG. 3, the viral titer of the CD19-BBz lentivirus produced using the lentivirus packaging system of the present invention of example 1, whether on a large scale or a small scale, is significantly superior to that produced using the third generation lentivirus packaging system, in the small scale about 3.48 times the lentivirus titer produced using the third generation lentivirus packaging system (comparative example 2), and in the large scale about 4.16 times the lentivirus titer produced using the third generation lentivirus packaging system (comparative example 2). And further multiplying the virus titer by the virus volume to obtain the virus yield, since the final production was obtained in each example and comparative exampleThe same volume of virus is produced, so the magnitude of the increase in yield or virus titer is the same. That is, in the case of a small scale, the yield of CD19-BBz lentivirus produced using the lentivirus packaging system of the present invention of example 1 was 3.48 times the yield using the third generation lentivirus packaging system (comparative example 2); on a large scale, the production of the CD19-BBz lentivirus of example 1 was also 4.16 times that of the third generation lentivirus packaging system (comparative example 2) using the lentivirus packaging system of the present invention of example 1, which is significantly better than the lentivirus production using the third generation lentivirus packaging system (comparative example 2). Thus, the production of lentiviruses using the lentivirus packaging system of the present invention, whether large or small, is significantly better than using the third generation of the lentivirus packaging system (comparative example 2), since simultaneous expression of the TAT protein does contribute to the production of lentiviruses.

Preparation example 3: preparation of pkr Gene-deleted 293T cells

Two part complementary primers were bonded to prepare 24 base pair PKR guide RNAs (guide RNAs; grnas) and ligated to the linearized Cas9-T2A-eGFP-DP plasmid with BsmBI to obtain the Cas9-PKR-T2A-eGFP-DP plasmid. Using gRNA targeting pkr gene sequence (gRNA targeting pkr genomic sequence): GCAACCUACCUCCUAUCAUG (SEQ ID NO: 3) and Protein kinase R [ Protein kinase R; combination of pkr, also known as Eukaryotic translation initiation factor 2 (eukarotic translation initiation factor 2-alpha kinase 2) gene, pkr knockout 293T cells were prepared using Cas9 gene editing, DNA double strand excision technology. Specifically, the Cas9-PKR-T2A-eGFP-DP plasmid containing the gRNA was transfected into 293T cells by the calcium phosphate method, and the transfected 293T cells were diluted to 0.5 cell/well in a 96-well plate and confirmed by the western blot method. Among them, western blotting is a method in which 293T cells are lysed with RIPA lysis buffer (RIPA lysis buffer) to collect cell lysates. The cell lysates were then analyzed for total protein, PKR protein expression was detected using the rabbitanti-PKR polyclonal antibody (GTX 132826, geneTex), and housekeeping gene GAPDH was used as an internal control, and 293T cell lines in 96-well plates were selected: the results of gene editing for #1, #4, #12, #17, #20, #23, #26 are shown in FIG. 4, and it can be seen that the pkr gene was successfully deleted from the 293T cell line for #12, which was used for the lentivirus preparation in Experimental example 2.

Experimental example 2: lentivirus preparation by using pkr gene-knocked 293T cell

Experimental example 2 the procedure was similar to that of Experimental example 1, except that in this experimental example, the third generation lentiviral packaging system (comparative example 2) and the plasmid composition of the lentiviral packaging system of the present invention of example 1 were co-transfected with the transfection reagent Polyjet (Signagen Laboratories) in accordance with the instruction manual on a small scale (10 cm dish) into the pkr gene-knocked 293T cells of preparation 3 (# 12 293T cell line). The titer of lentiviruses produced by pkr-knocked 293T cells from the third generation lentivirus packaging system (comparative example 2) and the plasmid composition of the lentivirus packaging system of the present invention of example 1 was tested as in the virus titer test procedure of preparation example 2, and the results are shown in fig. 5, and the titer of lentiviruses produced by pkr-knocked 293T cells using the plasmid composition of the lentivirus packaging system of the present invention of example 1 in a small scale was about 22.2 times the titer of lentiviruses produced by pkr-knocked 293T cells produced from the third generation lentivirus packaging system (comparative example 2). Therefore, the lentivirus packaging system of the invention can obviously improve the titer of the produced lentivirus by carrying out lentivirus preparation by using the 293T cell with the pkr gene knockout.

Experimental example 3: infectivity assay-primary T cell transduction

Peripheral Blood Mononuclear Cells (PBMC) from healthy donors were treated with Ficoll (GE), purified with CD3/CD28 expanded Beads (ThermoFisher) and activated primary T cells. The following day, lentiviruses prepared on a small scale using the lentivirus packaging system of the present invention of second generation, third generation in Experimental example 1 and example 1 were transduced into the aforementioned purified primary T cells (for the first day of transduction), briefly, 1ml of total 1X 10 ⁶ Primary T cells were co-cultured with lentiviruses prepared in Experimental example 1 (according to MOI (fertility of Infection) 1, MOI 3 and MOI 5). And two days after lentivirus transduction the CD3/CD28 microbeads were removed, and finally, the lentiviruses were removedThe sixth day of virus transduction the expression level of the target gene, CD19-BBz, in T cells was examined by flow cytometry. Specifically, 1 × 10 ⁵ After suspending the primary T cells in 100. Mu.L of a staining solution (the staining solution is a PBS solution containing 1% FCS (Fetal Calf Serum)), the primary T cells were allowed to stand at room temperature for 20 minutes by adding a first antibody (Biotin-conjugated goat anti mouse IgG F (ab) 2), the primary T cells were washed twice with 1mL of the staining solution, the primary T cell particles were again suspended in a staining solution containing Streptavidin-PE (total volume 100. Mu.L), allowed to stand at room temperature for 20 minutes, the primary T cells were again washed twice with 1mL of the staining solution, and then the primary T cells were finally suspended in an appropriate amount of the staining solution for flow cytometry analysis.

As shown in FIGS. 6A-6C, in FIG. 6A, the expression rates of CD19-BBz were higher in T cells transduced with the lentiviruses produced by the lentivirus packaging system of the present invention of example 1 at MOI 1, MOI 3 and MOI 5 than in T cells transduced with the lentiviruses produced by the second and third generation lentivirus packaging systems. Therefore, the lentivirus packaging system of the present invention can produce lentiviruses with optimal transduction rate, transduction efficiency and gene delivery efficiency compared to the second and third generation lentivirus packaging systems. In FIG. 6B, the lentiviruses produced by the lentivirus packaging system of the present invention of example 1 transduced T cells at MOI 1, MOI 3 and MOI 5, and the expression of T cell CD19-BBz was detected by using fluorescence-labeled antibodies, each cell having a higher mean fluorescence intensity than the T cells transduced by the lentiviruses produced by the second and third generation lentivirus packaging systems. And as shown in fig. 6C, the lentivirus packaging system of the present invention can increase the activity of the produced lentivirus because the transduction rate and the average fluorescence intensity of the lentivirus transduced T cells produced by the lentivirus packaging system of the present invention of example 1 are superior to those of the second generation lentivirus packaging system, which is about 1.2 times that of the second generation lentivirus packaging system.

Therefore, the lentivirus packaging system can obviously increase the yield and activity of lentivirus, can effectively improve the efficiency of gene transfer when cells are genetically modified, further can reduce the cost of genetically modified cells, and can better enhance the efficiency of the produced lentivirus by using the lentivirus produced by 293T with the pkr gene knockout.

Although the present invention has been described with reference to a preferred embodiment, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Peterson technology pharmaceutical products, ltd

<120> lentivirus packaging system, lentivirus prepared by same, cell transduced by lentivirus and application of cell

<130> GAI21TW2878

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 261

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of tat gene without intron

<400> 1

atggagccag tagatcctag actagagccc tggaagcatc caggaagtca gcctaaaact 60

gcttgtacca attgctattg taaaaagtgt tgctttcatt gccaagtttg tttcatgaca 120

aaagccttag gcatctccta tggcaggaag aagcggagac agcgacgaag agctcatcag 180

aacagtcaga ctcatcaagc ttctctatca aagcagccca cctcccaacc ccgaggggac 240

ccgacaggcc cgaaggaata a 261

<210> 2

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of TAR in nucleotide sequence of TAR chimeric 5' LTR

<400> 2

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gagaacc 57

<210> 3

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> gRNA targeting pkr Gene sequence

<400> 3

gcaaccuacc uccuaucaug 20

Claims

1. A lentiviral packaging system, comprising:

a transfer (transfer) plasmid comprising the nucleotide sequence of TAR chimeric 5'LTR (trans-activation-responded chimeric 5' long terminal repeat);

at least one packaging plasmid comprising a nucleotide sequence encoding a TAR RNA binding protein (TAR RNA binding protein) gene, a nucleotide sequence of a rev gene, a nucleotide sequence of a gag gene, and a nucleotide sequence of a pol gene;

and an envelope (envelope) plasmid.

2. The lentiviral packaging system of claim 1, wherein the at least one packaging plasmid is a first packaging plasmid and a second packaging plasmid, and

the first packaging plasmid comprises two of the nucleotide sequence of the TAR RNA binding protein encoding gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene,

and the second packaging plasmid comprises the rest of the nucleotide sequence of the TAR RNA binding protein encoding gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene.

3. The lentiviral packaging system of claim 1, wherein the at least one packaging plasmid is a first packaging plasmid, a second packaging plasmid, a third packaging plasmid, and a fourth packaging plasmid, and

the first packaging plasmid comprises the nucleotide sequence of the TAR RNA binding protein encoding gene,

The second packaging plasmid contains the nucleotide sequence of rev gene,

The third packaging plasmid comprises a nucleotide sequence of gag gene, and

the fourth packaging plasmid comprises the nucleotide sequence of the pol gene.

4. The lentiviral packaging system of claim 1, wherein the at least one packaging plasmid is a first packaging plasmid, a second packaging plasmid, and a third packaging plasmid, and

the first packaging plasmid comprises both of the nucleotide sequence of the gene encoding TAR RNA binding protein, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene and the nucleotide sequence of pol gene,

and the second packaging plasmid and the third packaging plasmid respectively comprise the nucleotide sequence of the TAR RNA binding protein encoding gene, the nucleotide sequence of the rev gene, the nucleotide sequence of the gag gene and the nucleotide sequence of the pol gene.

5. The lentiviral packaging system of claim 4, wherein,

said first packaging plasmid comprises the nucleotide sequence of said gag gene and the nucleotide sequence of said pol gene;

the second packaging plasmid comprises the nucleotide sequence encoding the TAR RNA-binding protein gene; and is

The third packaging plasmid comprises the nucleotide sequence of the rev gene.

6. The lentiviral packaging system of claim 5, wherein the weight ratio of the transfer plasmid to the first, second, third and envelope plasmids is from 3 to 12:3 to 7:1 to 4:1 to 4:1 to 6.

7. The lentiviral packaging system of any one of claims 1 to 6, wherein the nucleotide sequence encoding the TAR RNA binding protein gene is a nucleotide sequence of a tat gene.

8. The lentiviral packaging system of claim 7, wherein the nucleotide sequence of the tat gene comprises the nucleotide sequence set forth in SEQ ID NO:1, or a fragment thereof.

9. The lentiviral packaging system of claim 1, wherein the envelope plasmid comprises a nucleotide sequence of a gene encoding a vesicular stomatis virus glycoprotein (VSV-G) or a nucleotide sequence of a gene encoding a baboon endogenous virus envelope (babon endogenesis virus envelope).

10. The lentiviral packaging system of claim 1, wherein the nucleotide sequence of TAR in the nucleotide sequence of TAR chimeric 5' LTR comprises the nucleotide sequence set forth as SEQ ID NO:2 under the condition of high nucleotide sequence.

11. A lentivirus prepared from the lentivirus packaging system of any one of claims 1 to 10.

12. An isolated cell obtained by transducing a gene into an isolated nucleated cell by the lentivirus of claim 11.

13. The isolated cell of claim 12, wherein the nucleated cell is a T cell, a NK T cell, an adipose stem cell.

14. A method of increasing lentivirus production in a host cell, comprising transfecting the host cell with the lentivirus packaging system of any one of claims 1 to 10, wherein the host cell is a pkr knockout 293T cell.

15. A method of increasing the lentivirus yield of a host cell, comprising transfecting the host cell with the lentivirus packaging system of any one of claims 1 to 10.

16. The method of claim 15, wherein the host cell comprises a mammalian cell.

17. The method of claim 16, wherein said mammalian cell comprises a human embryonic kidney cell (HEK 293) or 293T cell (HEK 293T).

18. Use of the isolated cell of claim 13 for the preparation of a medicament for the treatment of cancer.