TWI813039B - System for analyzing analyte and method for analyzing analytes using the same - Google Patents

Abstract

The present invention provides a system for detecting analyte and an analyte detection method using the same. The system for detecting analyte includes a fixed component and an adapter reversibly combined with the fixed component. The adapter Having a base sequence represented by any one of SEQ ID NO: 1 to SEQ ID NO: 11.

Description

Detection system for analyte and detection method for analyte using same

The present invention relates to a detection system for an analyte and a detection method for the analyte using the same.

Recently, with the increase in AI and automation technology, there has been a demand for detection technology of chemical substances. Chemical substances such as bisphenols are strictly regulated as environmentally harmful substances.

Among various methods for detecting environmental hazardous substances, methods using aptamers have attracted much attention. Aptamers are composed of single-stranded base sequences and can detect environmental harmful substances by specifically binding to environmental harmful substances. The aptamer can detect even trace amounts of environmentally hazardous substances, resulting in excellent detection limits. In the past detection methods using aptamers, only one aptamer must be used, so only the sandwich method commonly used in detection can be used. Therefore, indirect methods must be used to detect aptamers that specifically bind to environmentally harmful substances, and there is a problem of very low detection sensitivity and specificity.

According to Korean Patent Publication No. 10-1971449, a single-stranded DNA aptamer (aptamer) that specifically binds to phthalates is described.

The object of the present invention is to provide a detection system and method that can detect the sample in its original state without fixing the analyte on a support or the like, thereby improving the analytical sensitivity and specificity.

One aspect of the invention is a detection system for analyzing substances. 1. The detection system for analyzing substances includes a fixed component and an aptamer reversibly bound to the fixed component. The aptamer has a sequence number ranging from SEQ ID NO: 1 to 11 (SEQ ID NO: A base sequence represented by any one of 11). 2. In 1, the fixing member may include more than one of graphene, graphene oxide, reduced graphene oxide (rGO) and magnetic beads. 3. In 1-2, the analyte may include bisphenols. 4. In 1-3, the presence of the analyte can be confirmed by the presence or increase of a luminescent signal.

Another aspect of the invention is a method for detecting analytical substances. 5. The method for detecting an analyte includes the step of using the detection system for an analyte of the present invention. 6. In 5, the analyte detection method may include the following steps: preparing a system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part and an absorption part, which will allow reversible binding to A sample processing solution obtained by contacting the adapter of the fixing member with an analyte detection sample is injected into the injection part. 7. In 5-6, the analyte detection method may include the following steps: preparing a system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part and an absorption part, in which the analyte The dependent selection separation part includes a combination of the fixing component and the adapter, and an analyte detection sample is injected into the injection part.

The present invention provides a detection system and method that can detect a sample in its original state without fixing an analyte to a support or the like, thereby improving analytical sensitivity and foreign matter properties.

In this specification, "sample" is in a liquid or solid state and may mean biological source samples derived from various animals including humans, chemical source samples derived from various chemicals, and samples derived from water, soil and Environmental supply source samples from various environments such as air. The sample can be applied to the detection system of the present invention immediately after being obtained from the source, or can be applied to the detection system of the present invention for analyzing substances through pretreatment after being obtained.

The biological supply source sample may include proteins such as antibodies, antigens, etc.

The chemical supply sample may include bisphenols, phthalates, etc. The bisphenols may include bisphenol A (BPA) and the like. The phthalate esters refer to substituted or unsubstituted phthalates, and the phthalate esters may include diethylhexyl phthalate (DEHP), benzyl phthalate butyl ester (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP), but is not limited to these.

In this specification, "luminescent substance" may include quantum dots, fluorescent substances, phosphorescent substances, etc. The presence of the analyte can be confirmed by the presence or increase of a luminescent signal.

In this specification, "quantum dots" are semiconductor nanoparticles and may mean particles that have the property of emitting different light depending on the particle size due to the quantum isolation effect.

The following describes a system for detecting an analyte according to an embodiment of the present invention.

The system for detecting analytes of the present invention includes a fixed component and an aptamer reversibly combined with the fixed component. The aptamer has a sequence number ranging from SEQ ID NO: 1 to 11 (SEQ ID NO. : The base sequence represented by any one of 11).

SEQ ID NO: 1 to SEQ ID NO: 11 can reversibly bind to the immobilizing member and can specifically bind to the analyte. SEQ ID NO: 1 to SEQ ID NO: 11 are designed to be dissociable from the immobilizing member after specifically binding to the analyte. Therefore, the system of the present invention can use any method to detect the sample in its original state without fixing the analyte on a support or the like, thereby improving the analysis sensitivity and foreign matter resistance. In addition, the system of the present invention uses only one aptamer to determine whether there is an aptamer dissociated from the analyte, thereby making it easier to detect the analyte. In addition, Sequence Number 1 (SEQ ID NO: 1) to Sequence Number 11 (SEQ ID NO: 11) can bind to bisphenols, especially bisphenol A, with high specificity, which can improve the analysis of bisphenols. Sensitivity and foreign body resistance.

In a specific example, the reversible bonding may include hydrogen bonding, van der Waals attraction, stacking bonding between aromatic functional groups, etc., but is not limited thereto.

In a specific example, the type of the fixing member is not limited as long as it can reversibly couple serial numbers 1 to 11. For example, the fixing member may include one or more of graphene, graphene oxide, reduced graphene oxide (rGO), magnetic beads, etc., but is not limited thereto. In particular, reduced graphene oxide can be combined with Sequence Number 1 (SEQ ID NO: 1) to Sequence Number 11 (SEQ ID NO: 11) through π-π irreversible covalent bonds, and is adapted when there is an analyte. When the aptamer is dissociated, the degree of dissociation of the aptamer from the fixed component is increased, thereby improving the analytical sensitivity and foreign body resistance of the analyte.

When an analyte is present in the sample, the aptamer is bound to the analyte and then dissociated from the fixed component. Furthermore, by analyzing the dissociated aptamer, the presence and content of the analyte in the sample can be analyzed. The dissociated aptamer can be obtained with the help of analytical kits, diagnostic kits and other kits, including PCR such as lateral flow assay (LFA) and QPCR (quantitative real time polymerase chain reaction). (polymerase chain reaction), ELISA (enzyme linked lmmunosorbent assay: enzyme-linked immunosorbent assay), biosensors, etc. for analysis.

The following describes an analyte detection system based on lateral flow analysis with reference to Figure 1 .

Referring to FIG. 1 , a system for detecting an analyte may be provided with an injection part 100 , an analyte-dependent selective separation part 200 , an analyte detection part 300 and an absorption part 400 .

The injection part 100, the analyte-dependent selective separation part 200, the analyte detection part 300, and the absorption part 400 may be connected integrally. The solution obtained by bringing the adapter reversibly bonded to the fixing member into contact with the analyte detection sample can be injected into the injection part 100 . Hereinafter, the solution obtained by bringing the aptamer reversibly bound to the fixing member into contact with the analyte detection sample is named "sample processing solution".

The sample processing liquid injected into the injection part 100 moves through the analyte-dependent selective separation part 200, the analyte detection part 300, and the absorption part 400 in order, and analysis can be performed. This movement can be performed by the liquid contained in the sample processing liquid or the developing reagent contained in the injecting part 100 , the analyte-dependent selective separation part 200 , the analyte detecting part 300 , and the absorbing part 400 .

The injection part 100, the analyte-dependent selective separation part 200, the analyte detection part 300, and the absorption part 400 may be formed of the same or different materials. For example, the substance is a substance that can form a porous film, and may include at least one of nylon, polyester, cellulose, polystyrene, polyvinylidene fluoride, cellulose acetate, polyurethane, glass fiber, and nitrocellulose, But not limited to this.

Injection part

The injection part 100 is a part into which the sample processing liquid is injected. The sample processing liquid injected into the injection part 100 moves to the analyte-dependent selective separation part 200, and analysis can be performed.

In order to improve the detection reliability of the analyte, the injection part 100 may additionally include a filter part for removing impurities in the solution.

Analytical Substance Dependence Selective Separation Section

The analyte-dependent selective separation part 200 may include a combination of the first probe 212 and the luminescent substance 211 .

The first probe 212 has a base sequence that can complementary bind to at least a portion of the aptamer. Therefore, when the dissociated aptamer is present in the sample processing solution injected into the injection part, the first probe 212 can complementary bind to the aptamer, causing the hybrid of the first probe 212 and the aptamer to move to the analyte. Detection part 300.

The first probe 212 may not include a base sequence capable of complementary binding to at least a part of the second probe 313 present in the detection region 310 of the analyte detection unit 300 described below. Therefore, when there is no dissociated aptamer in the sample processing liquid injected into the injection part, even if the combination of the first probe 212 and the luminescent substance 211 moves to the detection area 310 in the analyte detection part 300, the first probe The combination of the needle 212 and the luminescent substance 211 is also not bound to the second probe 313, so the reliability of analysis can be improved.

The first probe 212 may include a base sequence capable of complementary binding to at least a part of the third probe 323 present in the control group region 320 in the analyte detection unit 300 described below. Therefore, the combined body of the first probe 212 and the luminescent substance 211 moves to the control group area 320 in the analyte detection section 300 without being affected by whether or not the dissociated aptamer is present in the sample treatment liquid injected into the injection section. , then the combination of the first probe 212 and the luminescent substance 211 is combined with the third probe 323 and emits light, thereby improving the reliability of analysis.

The first probe 212 can refer to the sequence of the aptamer, the sequence of the second probe, and the sequence of the third probe to design the base sequence using common methods known in the industry. For example, the first probe 212 may have the base sequence of SEQ ID NO: 12 (5'-GAACTGGCTGGCGGCTGATTTTTTTT-3').

The luminescent substance 211 is combined with the first probe 212, and when the aptamer is present in the sample processing solution injected into the injection part, a luminescent signal is displayed, so that the presence or absence of the aptamer in the solution can be confirmed. The higher the aptamer concentration, the more the luminescence signal increases, indicating a high concentration of the analyte in the sample.

The luminescent substance 211 may include quantum dots, fluorescent substances, phosphorescent substances, etc.

Quantum dots can include a core and a shell surrounding the core. A quantum dot can be composed of only a core and a shell, but it can also have a stable layer between the core and the shell, or it can also have a stable layer outside the shell, that is, facing the core, or it can also have a stable layer outside the shell. That is, it has a ligand (or ligand layer) facing the core. Ligand layer means the layer forming the space occupied by the ligand.

The core, the shell, and the stable layer may each include more than one type of compounds from Groups 12 to 16, Groups 13 to 15, and Groups 14 to 16.

Group 12-16 compounds may include more than one of the following: cadmium sulfide (CdS), cadmium selenide (CdSe), cadmium telluride (CdTe), zinc sulfide (ZnS), zinc selenide (ZnSe), zinc telluride (ZnTe), mercury sulfide (HgS), mercury selenide (HgSe), mercury telluride (HgTe), zinc oxide (ZnO), cadmium oxide (CdO), mercury oxide (HgO), cadmium selenide sulfide (CdSeS), selenium Cadmium telluride (CdSeTe), cadmium zinc sulfide (CdSTe), cadmium zinc sulfide (CdZnS), cadmium zinc selenide (CdZnSe), cadmium sulfur selenide (CdSSe), cadmium zinc telluride (CdZnTe), cadmium mercury sulfide ( CdHgS), cadmium mercury selenide (CdHgSe), cadmium mercury telluride (CdHgTe), selenium zinc sulfide (ZnSeS), selenium zinc telluride (ZnSeTe), sulfur zinc telluride (ZnSTe), selenium mercury sulfide (HgSeS), selenium Mercury telluride (HgSeTe), mercury sulfide telluride (HgSTe), mercury zinc sulfide (HgZnS), mercury zinc selenide (HgZnSe), cadmium zinc oxide (CdZnO), cadmium mercury oxide (CdHgO), zinc mercury oxide (ZnHgO) , zinc selenium oxide (ZnSeO), zinc tellurium oxide (ZnTeO), zinc sulfide oxide (ZnSO), cadmium selenium oxide (CdSeO), cadmium tellurium oxide (CdTeO), cadmium sulfide oxide (CdSO), mercury selenium oxide (HgSeO), Mercury tellurium oxide (HgTeO), mercury sulfide oxide (HgSO), cadmium zinc selenium sulfide (CdZnSeS), cadmium zinc selenium telluride (CdZnSeTe), cadmium zinc telluride sulfide (CdZnSTe), cadmium mercury selenium sulfide (CdHgSeS), telluride Cadmium mercury selenide (CdHgSeTe), cadmium mercury sulfide telluride (CdHgSTe), mercury zinc selenide sulfide (HgZnSeS), mercury zinc selenide telluride (HgZnSeTe), mercury zinc sulfide telluride (HgZnSTe), cadmium zinc selenium oxide (CdZnSeO), Cadmium zinc tellurium oxide (CdZnTeO), cadmium zinc oxysulfide (CdZnSO), cadmium mercury selenium oxide (CdHgSeO), cadmium mercury tellurium oxide (CdHgTeO), cadmium mercury oxysulfide (CdHgSO), zinc oxide mercury selenium (ZnHgSeO), zinc oxide Mercury tellurium (ZnHgTeO) and zinc mercury sulfide oxide (ZnHgSO).

Group 13-15 compounds may include more than one of the following: gallium phosphide (GaP), gallium arsenide (GaAs), gallium antimonide (GaSb), gallium nitride (GaN), aluminum phosphide (AlP), arsenic Aluminum (AlAs), aluminum antimonide (AlSb), aluminum nitride (AlN), indium phosphide (InP), indium arsenide (InAs), indium antimonide (InSb), indium nitride (InN), phosphorus arsenic Gallium chloride (GaPAs), gallium phosphorus antimonide (GaPSb), gallium phosphorus nitride (GaPN), gallium arsenic nitride (GaAsN), antimony gallium nitride (GaSbN), aluminum phosphorus arsenide (AlPAs), aluminum phosphorus antimonide (AlPSb), aluminum phosphorus nitride (AlPN), aluminum arsenic nitride (AlAsN), antimony aluminum nitride (AlSbN), indium phosphorus arsenide (InPAs), indium phosphorus antimonide (InPSb), indium phosphorus nitride (InPN) ), indium arsenic nitride (InAsN), antimony indium nitride (InSbN), aluminum gallium phosphide (AlGaP), aluminum gallium arsenide (AlGaAs), aluminum gallium antimonide (AlGaSb), aluminum gallium nitride (AlGaN), Aluminum arsenic nitride (AlAsN), aluminum antimony nitride (AlSbN), indium gallium phosphide (InGaP), indium gallium arsenide (InGaAs), indium gallium antimonide (InGaSb), indium gallium nitride (InGaN), arsenic nitrogen Indium (InAsN), antimony indium nitride (InSbN), aluminum indium phosphide (AlInP), aluminum indium arsenide (AlInAs), aluminum indium antimonide (AlInSb), aluminum indium nitride (AlInN), aluminum arsenic nitride (AlAsN), antimony aluminum nitride (AlSbN), aluminum phosphorus nitride (AlPN), gallium aluminum arsenide phosphorus (GaAlPAs), gallium aluminum phosphorus antimonide (GaAlPSb), gallium indium phosphorus arsenide (GaInPAs), gallium arsenide Indium aluminum (GaInAlAs), gallium aluminum phosphorus nitride (GaAlPN), gallium aluminum arsenic nitride (GaAlAsN), antimony gallium aluminum nitride (GaAlSbN), gallium indium phosphorus nitride (GaInPN), gallium indium arsenic nitride (GaInAsN) , Gallium indium aluminum nitride (GaInAlN), gallium antimony phosphorus nitride (GaSbPN), gallium arsenic phosphorus nitride (GaAsPN), gallium arsenic antimony nitride (GaAsSbN), gallium indium phosphorus antimonide (GaInPSb), gallium phosphorus nitride Indium (GaInPN), gallium indium antimony nitride (GaInSbN), gallium phosphorus antimony nitride (GaPSbN), indium aluminum phosphorus arsenide (InAlPAs), indium aluminum phosphorus nitride (InAlPN), indium phosphorus arsenic nitride (InPAsN), Indium antimony aluminum nitride (InAlSbN), indium phosphorus antimony nitride (InPSbN), indium arsenic antimony nitride (InAsSbN) and indium aluminum phosphorus antimony nitride (InAlPSb).

Group 14-16 compounds may include more than one of the following: tin oxide (SnO), tin sulfide (SnS), tin selenide (SnSe), tin telluride (SnTe), lead sulfide (PbS), lead selenide ( PbSe), lead telluride (PbTe), germanium oxide (GeO), germanium sulfide (GeS), germanium selenide (GeSe), germanium telluride (GeTe), selenium tin sulfide (SnSeS), selenium tin telluride (SnSeTe) , Tin sulfide telluride (SnSTe), Lead selenium sulfide (PbSeS), Lead selenium telluride (PbSeTe), Lead sulfide telluride (PbSTe), Lead tin sulfide (SnPbS), Lead tin selenide (SnPbSe), Tin telluride Lead (SnPbTe), tin oxysulfide (SnOS), tin selenide oxide (SnOSe), tin oxytelluride (SnOTe), germanium oxysulfide (GeOS), germanium oxyselenide (GeOSe), germanium oxytelluride (GeOTe) , lead sulfur tin selenide (SnPbSSe), lead selenium tin telluride (SnPbSeTe) and lead sulfur tin telluride (SnPbSTe).

The diameter of the core may be 1 nm to 6 nm, specifically 1.2 nm to 5 nm, more specifically 2 nm to 5 nm. Within the above range, two or more stabilizing layers may be included, which has the advantage of excellent optical efficiency of quantum dots.

The thickness of the shell may be 0.5nm to 10nm, specifically 0.5nm to 8nm, more specifically 0.5nm to 6nm. Within the above range, the stability of the quantum dots increases. The shell can include more than 2 shells.

The stabilizing layer may include one layer or two or more layers in the quantum dot. That is, a first stable layer may be included between the core and the shell, and a second stable layer may be included outside the shell. Alternatively, the core, the shell, and the outer layer of the shell may include a first stable layer and a second stable layer starting from the shell.

The ligand (ligand layer) may include at least one type of water-soluble ligand and fat-soluble ligand.

The fat-soluble ligand may include one or more of the following: tri-n-octylphosphine oxide, decylamine, didecylamine, tridecaamine, tetradecanamine, pentadecaamine, hexadecylamine, stearylamine, undecaamine, bisamine Octadecylamine, N,N-dimethyldecylamine, N,N-dimethyldodecylamine, N,N-dimethylhexadecylamine, N,N-dimethyltetradecane Amine, N,N-dimethyltridecylamine, N,N-dimethylundedecylamine, n-decylamine, N-methyloctadecylamine, didododecylamine, tridodecylamine, cyclodecylamine Diamine, N-methyldodecylamine, trioctylamine, lauric acid, palmitic acid, oleic acid, stearic acid, myristic acid, elaidic acid, arachidic acid, eicosanoic acid, eicosanoic acid , behenic acid, behenic acid, hexadecanoic acid, hexadecanoic acid, octadecanoic acid and cis-13-docosenoic acid.

The water-soluble ligand may include more than one of the following: silica, polyethylene glycol (PEG), mercaptopropionic acid (MPA), cysteamine, thioglycolic acid, mercapto-undecanol, 2-mercapto-ethanol, 1 -Thio-glycerol, deoxyribonucleic acid (DNA), mercapto-undecanoic acid, 1-mercapto-6-phenyl-hexane, 1,16-dimercapto-hexadecane, 18-mercapto-octadecyl Amine, tri-octylphosphine, 6-mercapto-hexane, 6-mercapto-hexanoic acid, 16-mercapto-hexadecanoic acid, 18-mercapto-octadecylamine, 6-mercapto-hexylamine, 8-hydroxy- Octylmercaptan, 1-thio-glycerol, thioglycolic acid, mercapto-undecanoic acid, hydroxamic acid, hydroxamic acid derivatives, ethylenediamine.

The average particle size of the quantum dots may be 6 to 30 nm, specifically 6 to 20 nm. Within this range, there can be an advantage that optical characteristics are excellent.

In quantum dots, the core can include cadmium and selenium. The shell and the stabilizing layer may each include more than one of cadmium, selenium, zinc, and sulfur. Preferably, the core, shell and stabilizing layer may each include cadmium. Preferably, the closer the quantum dots are to the core, the more the cadmium or selenium content (mol%) will increase.

Quantum dots can be prepared by a common method known to those with ordinary knowledge in the technical field to which the present invention belongs. For more details, please refer to the conventional technology related to quantum dots.

In a specific example, the quantum dots may be composed of CdSe and ZnS.

The first probe 212 is a single-stranded DNA base sequence, and the method of combining the first probe 212 with the luminescent substance 211 can be performed using a common method known to those with ordinary knowledge in the technical field to which the present invention belongs.

Analytical Substance Testing Department

The analyte detection unit 300 is a unit that detects the presence of an aptamer in the sample processing liquid moved from the analyte-dependent selective separation unit 200 .

That is, the analyte detection part 300 includes the second probe 313 that captures the aptamer, so that the presence of the dissociated aptamer in the sample processing liquid can be confirmed, which is performed in the detection area 310 . In addition, the analyte detection unit 300 ensures normal analysis by using the combination of the first probe 212 and the luminescent substance 211 moved from the analyte-dependent selective separation unit 200, thereby ensuring the reliability of the analysis. This is in the control group area. 320 execution.

A detection area 310 and a control area 320 may be formed in the analyte detection unit 300 . The sample processing liquid can be developed in the analyte detection unit 300 in the order of the detection area 310 and the control area 320 .

The detection area 310 can confirm whether the dissociated aptamer exists in the sample processing solution, and if there is a dissociated aptamer, its degree (eg concentration) can be confirmed based on signals such as luminescence and the size of the signal.

The detection area 310 may include a second probe 313 bound to the denatured substance 312.

The second probe 313 has a base sequence that can complementary bind to at least a portion of the dissociated aptamer. Therefore, when the dissociated aptamer is present in the sample processing liquid injected into the injection part, the second probe 313 can be complementary to the dissociated aptamer. The aptamer has been combined with the first probe 212 and the luminescent substance 211. Therefore, when the aptamer is present in the sample processing liquid injected into the injection part, whether there is a dissociated aptamer can be confirmed based on signals such as luminescence.

The second probe 313 does not have a base sequence capable of complementary binding to at least a portion of the first probe 212 . This improves the reliability of analysis when aptamers are not present in the sample processing solution.

The second probe 313 can refer to the sequence of the aptamer and the sequence of the first probe to design the base sequence using a common method known to those with ordinary knowledge in the technical field to which the present invention belongs. For example, the second probe 313 may have the base sequence of SEQ ID NO: 13 (5'-TTTTTTTTCTCTGTGGTGCTCTGGTC-3').

The denaturing substance 312 may include a substance that denatures the second probe 313 so as to fix the second probe 313 to the detection area 310 . The denatured substance 312 may include at least one of biotin (biotin), dinitrophenyl (dinitrophenyl: DNP), and digoxigenin (digoxigenin: DIG). Preferably, biotin may be included as a denaturing substance.

The second probe 313 and the denatured substance 312 can be fixed to the detection area 310 by means of the binding substance 311. Binding substance 311 may include a binding substance capable of binding to denaturing substance 312 . When the denatured substance is biotin, the binding substance may include at least one of avidin, streptavidin, and neutralizing avidin. When the denaturing substance is a dinitrophenyl group, the binding substance may include an anti-DNP antibody capable of selectively binding to the dinitrophenyl group. When the denaturing substance is digoxin, the binding substance may include an anti-DIG antibody capable of selectively binding to digoxin. The binding substance 311 does not have luminescent properties.

The control group area 320 is used to confirm that the sample processing liquid injected into the injection part 100 has moved to the control group area 320, and to notify that the analysis has been completed, which can improve the reliability of the analysis.

The control area 320 may include a third probe 323 bound to the denatured substance 322 .

The third probe 323 has a base sequence capable of complementary binding to at least a portion of the first probe 212 . Therefore, the sample processing liquid injected into the injection part moves through the detection area 310 and the control group 320, and the completion of the analysis can be notified through hybridization between the first probe 212 and the third probe 323. This hybridization can be notified by a signal such as luminescence emitted by the luminescent substance 211 bound to the first probe 212 .

The third probe 323 can refer to the sequence of the first probe and design the base sequence using a common method known to those with ordinary skill in the technical field of the present invention. For example, the third probe 323 may have the base sequence of SEQ ID NO: 14 (5'-AAAAAAAATCAGCCGCCAGCCAGTTC-3').

The denaturing substance 322 may include a substance that denatures the second probe 313 to fix the third probe 323 to the detection area 320 . The denatured substance 322 may include at least one of biotin (biotin), dinitrophenyl (dinitrophenyl: DNP), and digoxigenin (digoxigenin: DIG). Preferably, biotin may be included as a denaturing substance.

The third probe 323 and the denatured substance 322 can be fixed on the detection area 320 by means of the binding substance 321. Binding substance 321 may include a binding substance capable of binding to denaturing substance 322 . When the denatured substance is biotin, the binding substance may include at least one of avidin, streptavidin, and neutralizing avidin. When the denaturing substance is a dinitrophenyl group, the binding substance may include an anti-DNP antibody capable of selectively binding to the dinitrophenyl group. When the denaturing substance is digoxin, the binding substance may include an anti-DIG antibody capable of selectively binding to digoxin. The binding substance 321 does not have luminescent properties.

Absorption part

The absorbing part 400 is a part that additionally moves the sample processing liquid moved from the analyte detecting part 300 to complete analysis.

The operation of the analyte detection system in Fig. 1 will be described with reference to Fig. 2 .

Referring to Figure 2, (a) is a schematic diagram of the operation of the detection system when a solution 500 obtained by contacting a sample containing an analyte with an aptamer reversibly bonded to a fixing member is injected, and (b) is a schematic diagram of the operation of the detection system when a sample containing the analyte is injected. Schematic diagram of the operation of the detection system when the solution 600 obtained by contacting a sample with an aptamer reversibly bound to a fixed component. Solution 600 contains dissociated aptamer 610.

Referring to (a) of FIG. 2 , the solution 500 passes through the injection part 100 , moves through the analyte-dependent selective separation part 200 , the detection area 310 of the analyte detection part 300 , and the control area 320 in sequence, and finally passes through the absorption part. Part 400 moves.

The sample 500 does not contain dissociated aptamers, so the first probe 212 only binds to the third probe 323 in the control area 320, the detection area 310 does not emit light, and only the control area 320 emits light.

Referring to (b) of FIG. 2 , the solution 600 passes through the injection part 100 , moves through the analyte-dependent selective separation part 200 , the detection area 310 of the analyte detection part 300 , and the control area 320 in sequence, and finally passes through the absorption Part 400 moves.

The solution 600 contains an aptamer 610, so the first probe 212 is bound to the second probe 313 in the detection area 310 through the aptamer 610, and the first probe 212 is also bound to the third probe 323 in the control area 320. , emitting light in both the detection area 310 and the control area 320 .

Although not shown in FIGS. 1 and 2 , the analyte detection system may additionally include a light irradiation unit in order to emit light.

The following describes an analyte detection system according to another embodiment of the present invention with reference to FIG. 3 .

Referring to Figure 3, a system for analysis and detection includes a sample injection part 100', an analyte-dependent selective separation part 200', an analyte detection part 300', and an absorption part 400'.

In the system for detecting the analyte in Figure 3, the sample containing the analyte is not injected into the system, which is different from the system for detecting the analyte in Figure 1.

The sample injection part 100', the analyte-dependent selective separation part 200', the analyte detection part 300', and the sample absorption part 400' may be connected into one body. Thereby, the sample injected into the sample injection part 100' moves through the analyte-dependent selective separation part 200', the analyte detection part 300', and the sample absorption part 400' in sequence, thereby improving the reliability of analysis. This movement can be performed by means of the liquid contained in the sample or the developing reagent included in the sample injection part 100', the analyte-dependent selective separation part 200', the analyte detection part 300', and the sample absorption part 400'.

The sample injection part 100', the analyte-dependent selective separation part 200', the analyte detection part 300', and the sample absorption part 400' may be formed of the same or different materials. The content about this is the same as the detailed description above.

Sample injection part

The sample injection part 100' is a part where a sample containing an analyte is injected. The sample injected into the sample injection unit 100' moves to the analyte-dependent selective separation unit 200', and can be analyzed.

In order to improve the detection reliability of the analyte, the sample injection part 100' may additionally include a filter part for removing impurities in the sample.

Analytical Substance Dependence Selective Separation Section

The analyte-dependent selective separation unit 200' includes a fixing member 210 and a combination of an aptamer 610 and a luminescent substance 211.

The combination of the adapter 610 and the luminescent substance 211 is reversibly combined with the fixing member 210 using the adapter 610 as a medium. Here, "reversibly bonded" is the same as the above description.

The analyte-dependent selective separation unit 200' selectively detaches and attaches the combination of the adapter 610 and the luminescent substance 211 from the fixing member 210 according to the presence or absence of the analyte, thereby quickly confirming the presence and absence of the analyte. No, the number of steps can be reduced compared to previous detection systems. The presence or absence of the analyte can be confirmed by the analyte detection unit 300' based on the presence and increase of the luminescence signal.

The fixing member 210, the adapter 610 and the luminescent substance 211 are the same as those described above.

In the system for detecting an analyte of the present invention, the analyte-dependent selective separation unit determines whether the analyte is present in the sample. In the analyte-dependent selective separation unit 200', only aptamers that specifically bind to the analyte and sequences used in the control region exist. Therefore, the presence or absence of the analyte in the sample can be confirmed more accurately and quickly.

In addition to the combination of the adapter 610 and the luminescent substance 211, the combination of the luminescent substance 211 and the fourth probe 214 can be reversibly additionally bonded to the fixing member 210.

The fourth probe 214 does not specifically bind to the analyte. On the contrary, the fourth probe 214 ensures that the sample moves through the analyte-dependent selective separation part 200', the analyte detection part 300', and the sample absorption part 400', thereby improving the reliability of analysis. The fourth probe 214 may be included in the analyte-dependent selective separation part 200' in a state of being reversibly coupled to or separated from the fixing member 210.

Analytical Substance Testing Department

The analyte detection unit 300' can confirm the presence of the analyte based on the combination of the aptamer 610 and the luminescent substance 211 that moves from the analyte-dependent selective separation unit 200'. That is, the analyte detection unit 300' includes the fifth probe 314 that captures the aptamer 610 bound to the analyte, so that the presence of the analyte in the sample can be confirmed.

In addition, the analyte detection unit 300' ensures normal analysis by selecting a combination of the fourth probe 214 and the luminescent substance 211 of the analyte-dependent separation unit 200', thereby ensuring analysis reliability.

The analyte detection unit 300' is formed with a detection area 310' and a control area 320'. The detection area 310 notifies the presence and concentration of the analyte based on the presence of a luminescence signal derived from the combination of the aptamer 610 and the luminescent substance 211 or an increase in the luminescence signal compared to the control area 320'.

Due to the presence of the luminescence signal derived from the combination of the fourth probe 214 and the luminescent substance 211, the control area 320' notifies that the analysis is completed. For this reason, the control group area 320' is farther from the analyte-dependent selective separation unit 200' than the detection area 310'.

Detection region 310' includes a fifth probe 314 that can complementary bind to at least a portion of aptamer 610. Therefore, when an aptamer is present in the sample, the presence of the aptamer can be confirmed by the luminescence signal. The fifth probe 314 does not have a base sequence capable of complementary binding to at least a portion of the fourth probe 214 . As a result, analysis reliability can be improved.

The fifth probe 314 can refer to the sequences of the aptamer and the fourth probe, and design the base sequence using a common method known to those with ordinary skill in the technical field of the present invention.

The fifth probe 314 is fixed on the detection area 310' by means of the denatured substance 312 and the binding substance 311. The denatured substance 312 and the binding substance 311 are the same as those described above.

The control region 320' includes a sixth probe 324 capable of complementary binding to at least a portion of the fourth probe 214. The sixth probe 324 is fixed on the control group area 320' by means of the denatured substance 322 and the binding substance 321. The denatured substance 322 and the binding substance 321 are the same as those described above. The sixth probe 324 can refer to the sequence of the fourth probe to design a base sequence using a common method known to those with ordinary skill in the technical field of the present invention.

Sample absorption part

The sample absorbing section 400' is a section that completes analysis by additionally moving the sample moved from the analyte detecting section 300'.

The following describes a method for detecting an analyte according to an embodiment of the present invention.

The detection method of an analytical substance of the present invention includes the step of using the detection system for an analytical substance of the present invention.

Specifically, it may include the following steps: inject the sample to be analyzed for the presence of the analyte into the sample injection part of the system for analyzing the substance, place the system for analyzing the substance under predetermined conditions, irradiate the light irradiation unit, and confirm whether the luminescent substance is present glow.

The analyte detection method may include the following steps: preparing a system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part and an absorption part, so that the aptamer and the analyte can be reversibly combined with the fixed member The solution obtained by detecting the contact of the sample is injected into the injection part. This can be carried out according to the content described in the system for detecting an analyte. The same content described in Figure 1 can be applied to the injection part, the analyte-dependent selective separation part, the analyte detection part and the absorption part.

The analyte detection method may include the following steps: preparing a system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part, and an absorption part, the analyte-dependent selective separation part including the fixing member and the adapter A combination of components is used to inject the sample containing the analyte into the injection part. This can be carried out according to the content described in the system for detecting an analyte. The content described in Figure 3 can be similarly applied to the injection section, analyte-dependent selective separation section, analyte detection section, and absorption section.

The detection method of the analyte of the present invention utilizes complementary binding of various nucleic acid sequences such as aptamers. Therefore, after the sample is injected into the sample injection part, the detection system for analyzing the substance can be placed under predetermined conditions in order to facilitate complementary binding. This condition can be appropriately implemented according to a common method known to those of ordinary skill in the technical field to which the present invention belongs.

After placing the detection system for analyzing substances under predetermined conditions, the method of the present invention may further include the following steps: cleaning the sample injection part, the analyte-dependent selective separation part, the analyte detection part, and the analyte absorption part. The cleaning fluid may be of the usual types known to those skilled in the art to which the present invention belongs.

The structure and function of the present invention will be described in more detail below through the preferred embodiments of the present invention. However, these present preferred examples of the invention and are not to be construed as limiting the invention thereby in any sense.

Example 1: Discovery of aptamers for detection of analytes

Bisphenol A was selected as the analyte. In order to discover aptamers for bisphenol A immobilized on beads, a library was synthesized and purchased from IDTDNA. Preparation (1) Forward 5'-TCAGCCGCCAGCCAGTTC-3' (SEQ ID NO: 15), (2) Reverse 5'- CTCTGTGGTGCTCTGGTC-3' (SEQ ID NO: 16), as used Primers for amplifying the library. The buffer used for binding was a solution of 1X PBST pH7.5 supplemented with 5mM _MgCl2 and 1% EtOH. Eight rounds of SELEX (Sequential Exponential Enrichment Ligand System Evolution Technology) were conducted, and through base sequence analysis, Sequence Number 1 (SEQ ID NO: 1) to Sequence Number 11 (SEQ ID NO: 11) in Table 1 below were obtained. The base sequence of the aptamer. [Table 1] serial number Base sequence (5' → 3') Serial number 1 TCAGCCGCCAGCCAGTTCGGTGATGTGGATTTTTAACGTTGAGGAACCATTGTTATATTTAGCTGCCGA GACCAGAGCACCACAGAG Serial number 2 TCAGCGCCAGCCAGTTCGCTCCATTGCACAAAAGCGCTTTGTGACAGAGGTTGGTTG GACCAGAGCACCACAGAG Serial number 3 TCAGCGCCAGCCAGTTCTCCGAGCCAAGCGTCGGACGTGTGACGACCCTTAAGCGTA GACCAGAGCACCACAGAG Serial number 4 TCAGCCGCCAGCCAGTTCATCCCGAGCATGGTGTTGATGGACGCCCAATGCATTGCGT GACCAGAGCACCACAGAG Serial number 5 TCAGCGCCAGCCAGTTCAACCGCCCACACAACCCCTCACACCGGAAATAAAGACAG GACCAGAGCACCACAGAG Serial number 6 TCAGCCGCCAGCCAGTTCGAACCCAACCGGCCTAGAGAGTCCCTCTTTAGCCACTGA GACCAGAGCACCACAGAG Serial number 7 TCAGCGCCAGCCAGTTCAGCCGCGAGGCCAACTCTTTCTCATGAGCGGCACTGGGTG GACCAGAGCACCACAGAG Serial number 8 TCAGCCGCCAGCCAGTTCGGGTGCCAACTGGCCAATTTTGTAATACGAGCTGGCGGTT GACCAGAGCACCACAGAG Serial number 9 TCAGCCGCCAGCCAGTTCACCTCCATGCGACTACCCCCGTATATGTCGGCTCCGACTA GACCAGAGCACCACAGAG Serial number 10 TCAGCCGCCAGCCAGTTCAACTCCCCGGTGGCCATCCTTTATGTTCAACGGCGTATCT GACCAGAGCACCACAGAG Serial number 11 TCAGCCGCCAGCCAGTTCGCCAACGCACCAGACTCCGACAGATGACA GACCAGAGCACCACAGAG

Example 2: Verification of the binding ability of aptamer to bisphenol A (BPA)

To evaluate aptamer performance, binding force measurements were performed using QPCR method. Bisphenol S (BPS) and benzoic acid are used as compounds having a similar structure to bisphenol A (BPA).

The BPA aptamer at a concentration of 10 picomoles and the control aptamer were subjected to a 30-minute binding reaction with rGO 5ul at a concentration of 50 mg/ml in the binding buffer. Then, the unbound aptamer was washed three times with 100 ul buffer to remove, and through this process, the aptamer-rGO conjugate was formed. Add BPA, BPS, and benzoic acid at a concentration of 100 ppm and process for 30 minutes. The dissociated aptamer is centrifuged at 13,000 rpm for 20 minutes to collect the supernatant. The aptamer dissociated due to BPA binding was used QPCR (QPCR reaction buffer components: 0.2mM NTP, 1uM 5'primer, 1uM 3'primer, 1X SYBR GreenⅠ, 5mM MgCl ₂ , 1X PCR buffer, 0.125U/ul Taq polymerase) was quantified. The results are shown in Table 2 and Figure 4 below.

Comparative Example 1: Verification of the binding ability of aptamer to bisphenol A (BPA)

An aptamer having the base sequence of SEQ ID NO: 17 (5'-TCAGCCGCCAGCCAGTTC-N40-GACCAGAGCACCACAGAG-3') with a random base sequence was used as a control aptamer, in the same manner as in the Example The method verified the binding ability. [Table 2] BPA BPS benzoic acid Serial number 1 (Clon 1) 6×10 ²⁰ 8×10 ¹⁹ 5×10 ¹⁵ Serial number 2 (Clon 2) 2×10 ²⁰ 6×10 ¹⁹ 4×10 ¹⁶ Serial number 3 (Clon 3) 2×10 ²⁰ 5×10 ¹⁹ 3×10 ¹⁶ Serial number 4 (Clon 4) 1×10 ²⁰ 4×10 ¹⁹ 1×10 ¹⁶ Serial number 5 (Clon 5) 6×10 ¹⁹ 9×10 ¹⁸ 9×10 ¹⁵ Serial number 6 (Clon 6) 2×10 ²⁰ 5×10 ¹⁹ 2×10 ¹⁶ Serial number 7 (Clon 7) 1×10 ²¹ 2×10 ²⁰ 1×10 ¹⁷ Serial number 8 (Clon 8) 1×10 ²¹ 3×10 ²⁰ 1×10 ¹⁷ Serial number 9 (Clon 9) 1×10 ²⁰ 4×10 ¹⁹ 3×10 ¹⁶ Serial number 10 (Clon 10) 7×10 ¹⁹ 1×10 ¹⁹ 5×10 ¹⁶ Serial number 11 (Clon 11) 1×10 ²⁰ 2×10 ¹⁹ 1×10 ¹⁷ Serial No. 17 (Comparative Example 1) 2×10 ¹³ 2×10 ¹³ 1×10 ¹²

As shown in Table 2 and Figure 4, it was confirmed that the 11 aptamers of the present invention can detect bisphenol S and benzoic acid differentially.

The above examination has been made focusing on the preferred embodiments of the present invention. Those of ordinary skill in the technical field to which the present invention belongs will understand that the present invention may be embodied in a modified form within the scope that does not deviate from the essential characteristics of the present invention. Accordingly, the disclosed embodiments should be considered from an illustrative standpoint rather than a restrictive standpoint. The scope of the present invention is expressed in the patent application scope rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

100:Injection part

100’:Sample injection part

200, 200’: Analytical substance dependence selection and separation section

211: Luminous substance

212:First probe

214:The fourth probe

300, 300’: Analytical Substance Detection Department

310, 310’: detection area

311: Binding substances

312: Denatured substances

313:Second probe

314:The fifth probe

320, 320’: control area

321: Binding substances

322: Denatured substances

323: The third probe

324:The sixth probe

400, 400’: Absorption part

500, 600: solution

610:Adapter

Figure 1 is a cross-sectional view of an analyte detection system according to an embodiment of the present invention. Figure 2 is a schematic diagram of the operation of the analyte detection system of Figure 1. Figure 3 is a cross-sectional view of an analyte detection system according to another embodiment of the present invention. Figure 4 shows the binding force verification results of the aptamer.

100:Injection part

200: Analytical substance dependence selection and separation section

211: Luminous substance

212:First probe

300: Analytical Substance Testing Department

310:Detection area

311: Binding substances

312: Denatured substances

313:Second probe

320: Control area

321: Binding substances

322: Denatured substances

323: The third probe

400: Absorption Department

Claims (7)

A system for detecting analytes, which includes a fixed component and an aptamer reversibly bound to the fixed component, the aptamer having a base sequence represented by any one of Serial Number 1 to Serial Number 11 . The system for detecting analyte substances as described in item 1 of the patent application, wherein the fixed component includes at least one of graphene, graphene oxide, reduced graphene oxide and magnetic beads. The system for detecting analyte substances as described in item 1 of the patent application, wherein the analyte substances include bisphenols. A system for detecting an analyte as described in item 1 of the patent application, wherein the presence of the analyte is confirmed by the presence or increase of a luminescent signal. A method for detecting analyte substances, which uses the system for detecting analyte substances in any one of items 1 to 4 of the patent scope. The analytical substance detection method described in item 5 of the patent application scope, wherein the analytical substance detection method includes the following steps: Prepare a system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part and an absorption part, and obtain by contacting the aptamer reversibly combined with the fixed component and an analyte detection sample A sample treatment solution is injected into the injection part. The analytical substance detection method described in item 5 of the patent application scope, wherein the analytical substance detection method includes the following steps: A system provided with an injection part, an analyte-dependent selective separation part, an analyte detection part and an absorption part is prepared, and the analyte-dependent selective separation part includes a combination of the fixing member and the aptamer. , inject an analyte detection sample into the injection part.

Images