KR101759401B1 - DNA aptamer specifically binding to SPINK1 protein and Use thereof - Google Patents

Abstract

The present invention relates to a DNA aptamer capable of specifically binding to SPINK1 protein and uses thereof. The DNA aptamer of the present invention has a property of specifically binding to the SPINK1 protein which is a biomarker of liver cancer. Therefore, the DNA aptamer of the present invention can be used for the detection of SPINK1 protein. In addition, the DNA aptamer of the present invention has the stability and specificity to replace the immunological detection method of AFP which is currently used for the diagnosis of liver cancer, so that it can perform early diagnosis of liver cancer together with the existing diagnosis detection technique, The diagnosis system of the present invention has the effect of enabling rapid and economical diagnosis of liver cancer.

Description

A DNA aptamer specifically binding to a spike 1 protein and its use {DNA aptamer specifically binding to SPINK1 protein and Use thereof}

The present invention relates to a DNA aptamer that specifically binds to Serine protease inhibitor Kazal-type 1, SPINK1 protein and uses thereof.

Hepatocellular carcinoma is the fourth most common cancer death in the world, and Korea is the second leading cause of liver cancer mortality. According to the National Cancer Information Center, the death rate of domestic liver cancer in 2013 is 11,405 cases per year, accounting for 15.1% of all cancer deaths, followed by men cancer death rate 2nd, female cancer death rate 4, and liver cancer incidence rate 10.8% 4th place, and 3.7% of women, showing 6th place, showing higher mortality rate than incidence.

As of 2012, the number of cancer patients in Korea is so high that it accounts for 16,254 out of 224,177 cancer patients, and 22.6 deaths per 100,000 population per year are threatening the public health to such an extent that they die from liver cancer. According to the survival rate of major cancers in Korea National Cancer Center, the survival rate of liver cancer is 30.1% within 5 years after onset, but the survival rate is 15.6% within 10 years after onset, Prognosis management is known to be a very urgent disease.

This is because the mortality rate is higher than the incidence rate because the liver cancer does not have any specific symptoms indicating the onset of liver cancer at the onset of the disease. Hepatocellular carcinoma is rarely symptomatic until the disease is at a serious level. Symptoms that appear include fatigue, bloating, right upper quadrant or shoulder pain, nausea, appetite loss, abdominal bloating, weight loss, lethargy, fever, jaundice (yellowing of the eyes and skin) Because of the symptoms of liver disease, the probability of survival is low when the stage of the disease is already past the stage of liver transplantation or transplantation. In addition, 80% of patients with liver cancer begin with cirrhosis and die from complications. Therefore, the early diagnosis of liver cancer can greatly increase the survival rate of patients.

The major causes of liver cancer are known to be caused by environmental factors such as infections caused by hepatitis B and C viruses, aflatoxin which is a fungal toxin, alcohol consumption, smoking, obesity, oral contraceptive use, drinking water intake, and so on , Especially infections caused by hepatitis viruses, are reported to be direct causes of liver cancer.

Hepatitis B virus (HBV) and HCV (hepatitis C virus) are known to be the major cause of hepatitis virus. 80 ~ 90% of the hepatitis in Korea is caused by these two hepatitis viruses . Some people infected with hepatitis virus get acute hepatitis, and without treatment, progress to chronic hepatitis, 40% of them progress slowly to cirrhosis. Liver cirrhosis can be caused by various causes such as alcohol and fatty liver, and the whole liver cells are necrotized little by little. The reason why liver is hardened little by little is because hard fiber tissue is formed to fill the necrotic part, 20-25% are hurt by liver cancer and are threatened with life.

The hepatitis B virus is infected by blood, saliva, etc. through sexual contact and postnatal mucosa through the mucous membranes, and the hepatitis C virus also spreads through the blood and is infected by transfusion or drug abuse. Aflatoxin, one of the fungal toxins, has been reported to cause the mutation of p53, a tumor suppressor gene, to increase the likelihood of developing hepatocellular carcinoma when infected with hepatitis B virus. Alcohol-induced liver cancer is not known to cause direct liver damage, but it is known that fatty liver forms fatty liver and fatty liver leads to liver cirrhosis and liver cancer due to continuous alcohol consumption.

In addition, about 73-85% of patients with liver cancer are associated with complications such as liver cirrhosis and are very difficult to treat. In particular, hepatocellular carcinoma progresses without any specific subjective symptoms at the onset of the disease, and the average survival rate is as low as 30% or less at diagnosis. Early diagnosis is difficult and prognosis is poor.

The treatment methods and effects of liver cancer are determined by the extent of cancer, liver function and degree of liver cirrhosis. In order to determine the treatment of liver cancer, anatomical evaluation of the tumor and functional evaluation of the liver should be performed, and the best therapy is selected based on this evaluation. Hepatocellular carcinoma (TACE), alcohol injection (PEIT) and radiofrequency ablation (RFA) are the non-surgical treatments for hepatocellular carcinoma. In addition, chemotherapy, radiotherapy, hormone therapy, citron pretreatment, and immunotherapy have been tried as experimental treatments. The most obvious method for the treatment of liver cancer is resection. However, resection should be capable of resecting the size and location of the cancer, and sufficient residual liver function of the patient. In addition, cancer should not be spread in organs other than the liver. Therefore, resection has a disadvantage that it is a very limited technique that can be applied only to patients with liver cancer within 20%, and the liver transplantation method has a disadvantage that the survival rate is very high but it is difficult to obtain the donor. Non-surgical methods such as alcohol infusion (PEIT), radiofrequency ablation (RFA), carotid chemoembolization (TACE) and radiation therapy are the treatment modalities for early stage liver cancer patients and late stage stage liver cancer patients. Although it has a very high therapeutic effect, it is still difficult to utilize it actively because it has not been clearly established in the end-stage patients.

Thus, unlike other cancers, the best way to combat liver cancer that causes irreversible symptoms is to prevent disease through early detection. In Korea, ultrasonography, computed tomography (CT), magnetic resonance imaging (MRI), and hepatic angiography are performed to detect early detection of liver cancer in Korea. The biopsy diagnosis method that distinguishes hepatocellular carcinoma by securing the tissue directly from the liver or the above imaging methods has an advantage of accurately distinguishing liver cancer tumors, but requires expensive equipment and sample processing techniques, Or radiological diagnosis may cause adverse effects in long-term human body irradiation. Such imaging methods and liver biopsy techniques are not readily available in general hospitals, and techniques for diagnosing liver cancer with simple blood tests using tumor markers are readily available.

Currently, AFP (Alpha-fetoprotein) is the most widely used tumor marker for the diagnosis of liver cancer. AFP is a serum protein produced in the fetal liver and digestive organs, which rapidly decreases after birth and exists at a concentration of about 10 ng / ml in the blood. However, hepatitis, liver cirrhosis, hepatocellular carcinoma, and intrahepatic metastatic carcinoma have rapidly increased AFP levels in blood and are now widely used as diagnostic markers of liver cancer. However, AFP may nonspecifically increase in diseases such as acute or chronic hepatitis, fulminant hepatitis, and liver cirrhosis, and even in cases of blastomas or 5-10% of gastrointestinal cancers, The blood concentration is often not increased.

Therefore, it is necessary to develop new markers that can diagnose hepatocellular carcinoma more specifically and effectively than hepatocarcinoma marker AFP, and to develop early detection technology for liver cancer using this marker.

On the other hand, SPINK1 (Serine protease inhibitor Kazal-type 1) protein has been reported to inhibit serine protease, inhibit trypsin secretion in the pancreas, and inhibit cancer-associated trypsin.

Therefore, in the present invention, the possibility of using SPINK1 protein as a new marker for early diagnosis of liver cancer was confirmed, and in particular, a diagnostic technique for detecting SPINK1 using aptamer, which is a target substance detection factor, was developed.

Currently, enzyme-linked immunosorbent assays (ELISA) and immunochromatographic assays are the most widely used methods for measuring target protein levels in blood and samples. However, in order to utilize these techniques, it is necessary to develop an antibody capable of specifically binding to a target substance. However, antibody production and development are accompanied by animal experiments, and there are difficulties in free production, purification, and modification, and it is difficult to secure stability against ambient pH, temperature, etc. with protein. In addition, not only does it require much time and cost to produce antibodies, but it also has the disadvantage that it is very difficult to produce pure target antibodies because of the batch to batch variation. Therefore, there is an urgent need to develop an antibody substitute that can efficiently utilize a target substance for detection.

In order to solve and solve the problems of the conventional antibody-based target substance detection technique, the present invention uses an aptamer. The aptamer to be used in the present invention is a short-length oligomer and has a stable tertiary structure And has a specific binding force with the target substance. The aptamer is composed of DNA or RNA, which is more stable than an antibody composed of proteins, and has the advantage of being able to bind specifically to various target substances (proteins, peptides, metals, chemicals, etc.). In addition, since it can be manufactured using chemical synthesis technique, it can be mass-produced in a short time and at a low cost, and has an excellent advantage of continuously producing an aptamer having the same ability once production and production. In addition, it is highly stable in the surrounding pH and temperature, and it is highly evaluated that it can be used in a variety of fields such as environment and medical care, such as detection of a target substance and development of a disease diagnosis sensor.

In the present invention, aptamer showing high potential in various environmental and industrial fields as described above is used for diagnosing liver cancer using conventional antibodies, and a new SPINK1 antibody capable of replacing various tumor markers that have been used as conventional liver cancer biomarkers Was introduced as a biomarker and detected by aptamer technology, thereby completing the present invention.

Japanese Laid-Open Patent Application No. 2014-087335

Currently, methods for quantitatively and qualitatively measuring changes in the concentration of AFP (alpha-fetoprotein), a tumor marker in blood and samples, are used for early diagnosis of liver cancer. However, the diagnosis of AFP is not nonspecific even in diseases such as chronic hepatitis and liver cirrhosis can be diagnosed positively, and there is a problem that a bladder or 5 to 10% of gastrointestinal cancer may have a false positive reaction. Therefore, it is required to develop a diagnostic method that can detect liver cancer more specifically and efficiently than AFP, which is a current liver cancer marker, and to diagnose liver cancer by using it. In addition, there are various problems such as production cost and variation as an antibody-based technique in which an enzyme-linked immunosorbing method and an immunochromatography technique based on a conventional antibody are specifically bound to a target substance, and a new type of diagnostic technique is developed need.

Therefore, the present invention utilizes SPINK1 protein, which can be used for diagnosis and prognosis of liver cancer for early diagnosis of liver cancer, as a biomarker, and a new diagnostic technique as a detection method of SPINK1 protein using DNA aptamer Respectively.

Accordingly, an object of the present invention is to provide a DNA aptamer that specifically binds to SPINK1 protein.

Another object of the present invention is to provide a kit for detecting SPINK1 protein comprising the DNA aptamer of the present invention.

Another object of the present invention is to provide a microarray for detecting SPINK1 protein comprising the DNA aptamer of the present invention.

Another object of the present invention is to provide a composition for diagnosing cancer or prognosis of cancer showing an increase in SPINK1 protein expression comprising the DNA aptamer of the present invention.

Another object of the present invention is to provide a method for detecting SPINK1 protein, which comprises the step of performing a binding reaction with the DNA aptamer of the present invention.

It is another object of the present invention to provide a method for providing information for diagnosis or prognosis of cancer showing an increase in SPINK1 protein expression.

Furthermore, another object of the present invention is to provide a method for producing a DNA aptamer which specifically binds to SPINK1 protein.

Therefore, the present invention provides a DNA aptamer that specifically binds to SPINK1 protein having any one of the nucleotide sequences selected from SEQ ID NO: 1 to SEQ ID NO: 6.

In one embodiment of the present invention, the SPINK1 protein may be composed of the amino acid sequence shown in SEQ ID NO: 11.

The present invention also provides a kit for detecting SPINK1 protein comprising the DNA aptamer of the present invention.

The present invention also provides a microarray for detecting SPINK1 protein comprising the DNA aptamer of the present invention.

The present invention also provides a composition for diagnosing or prognosing a cancer showing an increase in SPINK1 protein expression comprising the DNA aptamer of the present invention.

In one embodiment of the present invention, the cancer may be liver cancer.

The present invention also provides a method for detecting a SPINK1 protein, comprising the step of performing a binding reaction with the DNA aptamer of the present invention.

The present invention also provides a method for providing information for diagnosis or prognosis of cancer showing an increase in SPINK1 protein expression, comprising the step of performing a binding reaction with the DNA aptamer of claim 1 to a biological sample obtained from a subject to provide.

In one embodiment of the present invention, the cancer may be liver cancer.

Further, the present invention provides a method for preparing a DNA aptamer pool, comprising: (a) preparing a DNA aptamer pool from a template DNA having an arbitrary nucleotide sequence by PCR; (b) making double-stranded DNA of said DNA aptamer pool into single-stranded DNA using a heat-cooling technique; (c) single-stranded DNA aptamers prepared by reacting the single-stranded DNA aptamers prepared in step (b) with GST-fused SPINK1 protein and then passing the reaction solution through a pre-activated nitrocellulose membrane filter to bind GST fusion SPINK1 protein Selecting a tamer; (d) performing a negative SELEX using a nitrocellulose membrane filter on the DNA aptamer selected in the step (c) to remove a nonspecific DNA aptamer for SPINK1 protein; And (e) determining the affinity of the selected single-stranded DNA aptamer to the SPINK1 protein to determine the optimal DNA aptamer that binds most specifically to the SPINK1 protein. The present invention provides a method for producing a DNA aptamer.

The present invention relates to a DNA aptamer that specifically binds to SPINK1 protein and uses thereof. The DNA aptamer of the present invention has a characteristic of specifically binding to the SPINK1 protein which is a new biomarker of liver cancer. Accordingly, the DNA aptamer specifically binding to SPINK1 protein of the present invention can be used for early diagnosis and prognosis of liver cancer by detecting SPINK1 protein in a sample of liver cancer patients. In addition, the DNA aptamer that specifically binds to the SPINK1 protein of the present invention can replace a conventional antibody used for diagnosis of various cancers, and can diagnose various intractable diseases as well as various cancers more quickly and economically It is expected.

FIG. 1 shows the result of amplification of random DNA aptamer using PCR technique and ssDNA recovered using heat-cooling technique and streptavidin by dsDNA prepared by PCR technique using 10% acrylamide gel electrophoresis As shown in Fig.
Lane M: 100 bp DNA marker
Lane 1: dsDNA amplified by PCR from DNA aptamer
Lane 2: ssDNA prepared by heat-cool method and straptavidin using dsDNA obtained by PCR technique
FIG. 2 shows a DNA aptamer or a DNA aptamer candidate that specifically binds to a SPECT1 protein that specifically binds to GST fusion SPINK1 protein recovered in each SELEX round performed to produce a DNA aptamer that specifically binds SPINK1 protein The ssDNA concentration was measured quantitatively using a Nanodrop spectrophotometer.
3A and 3B show a secondary structure of DNA aptamer candidate groups SPINK1-1 to SPINK1-6 that specifically bind to six SPINK1 proteins selected in the SELEX process for DNA aptamer binding specifically to SPINK1 protein Fig.
4 is a view showing a step of fixing SPINK1 to the surface of a CM5 sensor chip having a carboxyl group.
FIG. 5 is a schematic diagram of a method for detecting SPINK1 based on ELISA using a SPINK1 binding DNA aptamer. Panel [1] shows a schematic diagram of ELISA using SPINK1 binding DNA aptamer for detection of SPINK1, [2] is a schematic diagram of an ELISA method for detecting SPINK1 using a conventional antibody.
FIG. 6 is a schematic diagram of a SPINK1 detection kit as a liver cancer target factor using an aptamer that specifically binds to SPINK1 protein. FIG. A system for diagnosing SPINK1 by binding of a SPINK1 protein to a SPINK1 protein-binding aptamer in a sample when treated with a test kit in which an aptamer that specifically binds a SPINK1 protein to a patient suspected of being a liver cancer is immobilized Fig.

The present invention relates to a DNA aptamer specifically binding to SPINK1 protein and a use thereof. The SPINK1 protein can be utilized as a new biomarker that can complement the disadvantages of AFP protein widely used for the diagnosis of liver cancer, The DNA aptamer technology of the present invention can solve, supplement and replace the problems of existing antibody-based diagnostic techniques.

According to one aspect of the present invention, the present invention relates to a DNA aptamer (oligonucleotide) that specifically binds to SPINK1, a novel liver cancer marker protein. As used herein, the term " DNA aptamer " refers to a DNA nucleic acid molecule capable of binding with high affinity and specificity to a specific molecule. As used herein, the term " DNA aptamer " may be used interchangeably with " DNA oligonucleotide ". The term " oligonucleotide " as used herein generally refers to a nucleotide polymer having a length of less than about 200 bp, which may include DNA and RNA, preferably a DNA nucleic acid molecule. The nucleotide can be any substrate that can be introduced into the polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or by DNA or RNA polymerases or by synthetic reactions. If a modification to the nucleotide structure is present, such modification may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. The oligonucleotides can be further modified after synthesis, for example by binding with a label.

The DNA aptamers of the present invention are typically obtained by in vitro selection for binding of target molecules. Methods for selecting an aptamer that specifically binds to a target substance are well known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, polysaccharides can be suitable target molecules for separating aptamers that can specifically bind to each ligand . Screening of the aptamer can utilize in vivo or in vitro selection techniques known in the SELEX method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al., Science 249, 505-10, 1990 ). Specific methods for screening and manufacturing the aptamer are described in U.S. Patent 5,582,981, WO 00/20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and U.S. Patent 5,756,291, Are incorporated herein by reference.

The DNA aptamer specifically binding to the SPINK1 protein of the present invention is preferably an oligonucleotide having the nucleotide sequence disclosed in any one of SEQ ID NOS: 1 to 6. On the other hand, the DNA aptamers of the first to sixth sequences of the present invention are presumed to form the secondary structure shown in Figs. 3A and 3B.

The DNA aptamer that specifically binds to the SPINK1 protein of the present invention retains the property of binding to the SPINK1 protein and has a nucleotide sequence substantially identical to any one of the nucleotide sequences of SEQ ID NOS: Oligonucleotides having < RTI ID = 0.0 > nucleotides < / RTI >

The above-mentioned substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and using an algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 Hewgins and Sharp, Gene 73: 237-44 (1988), pp. 243-47 (1988); Hewlett-Packard et al. ; Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc Acids Res. 16: 10881-90 (1988); Huang et al., Comp. At least 90% identity, more preferably at least 95% identity, in the case of analysis of the aligned sequence, using the amino acid sequence as shown in Table 1 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 Identity, most preferably at least 98% identity to the nucleotide sequence of SEQ ID NO: 1.

The DNA aptamer specifically binding to SPINK1 protein of the present invention can be used to directly detect SPINK1 protein or to detect SPINK1 protein in a biological sample of a patient and can be used to diagnose liver cancer using the SPINK1 protein. The detection of SPINK1 protein of the present invention is based on a method of detecting a complex of SPINK1 protein with a DNA aptamer that specifically binds SPINK1 protein. In one embodiment of the present invention, a DNA aptamer that specifically binds to the SPINK1 protein of the present invention includes a fluorescent substance (for example, fulorescein, Cy3 or Cy5), a fluorescent substance Radioactive materials, or nucleotides labeled with a chemical such as biotin or modified with primary amines.

The DNA aptamer specifically binding to the SPINK1 protein of the present invention can detect SPINK1 using a microarray including a substrate on which a DNA aptamer is immobilized. As used herein, the term " microarray " refers to an array (array) in which dielectric material is attached at a high density to a specific region of a substrate. As used herein, the term " substrate " of a microarray refers to a support having suitable rigid or semi-rigid properties, such as glass, slides, filters, chips, wafers, fibers, tacky beads or non-magnetic beads, membranes, plates, polymers, microparticles, and capillaries. The DNA aptamers of the present invention are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, DNA oligonucleotides can be attached to glass surfaces modified to include epoxy compounds or aldehyde groups, and can also be bound by UV on polylysine coating surfaces. In addition, the DNA oligonucleotide may be bound to the substrate through an ethylene glycol oligomer and a diamine.

In the present invention, a composition for detecting SPINK1 protein may be provided in the form of a kit. In the present invention, the kit comprises the base sequence disclosed in any one of SEQ ID NOS: 1 to 6 or a DNA oligonucleotide having a nucleotide sequence having 90% or more identity with this sequence as an active ingredient. The kit according to the present invention may further include a manual or label for using the SPINK1 protein detection kit in the sample.

SPINK1 protein, on the other hand, has been reported to inhibit serine proteases, inhibit trypsin secretion in the pancreas, and inhibit cancer-associated trypsin. In the present invention, it was confirmed that SPINK1 protein can be used as a new biomarker for early diagnosis of liver cancer. Thus, it was confirmed that the present invention can diagnose liver cancer by using SPINK1 protein, and the amino acid sequence of SPINK1 protein of the present invention is sequence No. 11.

The present invention also provides a composition and method for the diagnosis of liver cancer and the detection of SPINK1 protein based on a DNA aptamer that specifically binds to SPINK1 protein. The detection of SPINK1 protein of the present invention is based on a method of detecting a complex of SPINK1 protein with a DNA aptamer that specifically binds SPINK1 protein. To facilitate detection of the complex, a DNA aptamer that specifically binds SPINK1 protein of the present invention is conjugated to a fluorescent material such as fulorescein Cy3 or Cy5, a radioactive substance or a chemical substance such as biotin biotin) or a nucleotide modified with a primary amine.

Detection and analysis of human SPINK1 protein in the sample can provide the possibility of liver cancer and can provide useful information for detection of liver cancer in the future. Specifically, SPINK1 has been reported to play a role in proliferating cancer cells as an autocrine growth factor. Therefore, DNA aptamers that bind specifically to SPINK1 protein can be used to detect the presence or amount of SPINK1 protein from a patient sample and to detect a liver cancer or to detect prognostic SPINK1.

The present invention also provides a method for detecting SPINK1 protein by binding a SPECT1 protein to a DNA aptamer that specifically binds SPINK1 protein of the present invention from a biological sample of a patient to provide information necessary for diagnosis of liver cancer to provide. The term " biological sample " may include blood, saliva, fluids, fluids, synovial fluid, mucus, cells, tissues, and other tissues and body fluids and includes cell culture supernatants, ruptured eukaryotic cells, , But is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: SPINK1 Gene Selection and GST Fusion Recombinant SPINK1 Protein Preparation

1-1. Selection of SPINK1 gene

In order to produce an aptamer for SPINK1 protein expressed in humans, an Abstinometer-specific aptamer was prepared by purchasing Abnova's GST-fused recombinant human SPINK1 protein (SPIK1 (Human) Recombinant Protein (P01)).

Example 2: Fabrication of a DNA aptamer

2-1. Random DNA library amplification using PCR technique

To construct a DNA aptamer that specifically binds to the SPINK1 protein, a 76 bp template DNA (5'-ATACCAGCTTATTCAATT (SEQ ID NO: 1)) containing 40 random sequences in a ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: -40-AGATAGTAAGTGCAATCT-3 '; SEQ ID NO: 7) and three primers capable of amplifying it by 76 bp were prepared from Bionyer [forward primer: 5'-ATACCAGCTTATTCAATT-3'5'-biotin-AGATTGCACTTACTATCT-3'(SEQ ID No. 10 sequence), biotinylated reverse primer: 5'-biotin-AGATTGCACTTACTATCT-3'. The PCR reaction composition for amplification of the 76 bp DNA library was 1 μl of template DNA, 5 μl of 10 × PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 25 μM of forward primer 2 , 2 μl of a 25 μM biotinylated reverse primer, 0.3 μl (1 unit / μl) of Ex Taq polymerase (Takara, Japan) and 35.7 μl of distilled water. The PCR reaction conditions were denatured at 95 ° C for 5 minutes, followed by 20 cycles of reaction at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Respectively. After the PCR reaction, 4 μl was taken and 2% agarose gel electrophoresis was performed to confirm whether the band appeared at 76 bp. The DNA library obtained by PCR was purified using a PCR purification kit (Qiagen, USA) and recovered using 50 μl of distilled water.

2-2. Production of ssDNA using heating-cooling technique

50 μl of distilled water was added to 50 μl of the DNA library recovered using the PCR technique and the PCR purification kit, and the volume was adjusted to 100 μl. Then, dsDNA was denatured with ssDNA using a heating-cooling technique ). Specifically, the dsDNA obtained using the PCR technique and the PCR purification kit was reacted at 85 ° C for 5 minutes to denature the dsDNA with ssDNA. After completion of the reaction, the reaction solution was cooled to 4 ° C to obtain ssDNA Respectively.

2-3. Screening and recovery of ssDNA

In order to remove biotin-bound ssDNA and primer from the ssDNA product obtained using the heating-cooling technique and to ensure pure ssDNA only in the forward direction, 100 μl of the reaction solution obtained in the above example was added with streptavidin 50 μl of streptavidin agarose resin (Thermo Scientific, USA) was added, and reacted at room temperature for 1 hour. The reaction solution was centrifuged at 4,000 rpm for 10 minutes using a centrifuge at 13,000 rpm and then only the supernatant was recovered and treated with the same volume of PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1) And centrifuged at 13,000 rpm for 15 minutes to collect only supernatant. To the supernatant, 1/100 volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70 ° C for 2 hours or more. After the reaction, only the ssDNA was recovered by centrifugation at 13,000 rpm for 20 minutes at 4 ° C. The recovered ssDNA was dried at 65 ° C and dissolved in 50 μl of distilled water. 10 [mu] l of the recovered ssDNA was taken, and 10% acrylamide gel was used to confirm whether or not an exact-sized band appeared as compared with dsDNA (see Fig. 1).

Example 3: Selection of DNA aptamers specifically binding to recombinant SPINK1 protein using SELEX technique

3-1. The composition of each solution used in SELEX

The solutions used for SELEX were Glutathione Sepharose 4B (GE Healthcare, USA) and the composition was as follows. Namely, 1 X aptamer selective solution (pH 7.3): 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 2 X aptamer selective solution (pH 7.3): 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, KH2PO4 washing solution (pH 7.3): 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, DNA aptamer elution solution (pH 8.0): 50 mM Tris-HCl, 10 mM reduced glutathione.

3-2. DNA aptamer structure construction for SELEX

50 μl of 2 × DNA aptamer screening solution was added to 50 μl of ssDNA prepared in Example 2-3, the reaction volume was adjusted to 100 μl, and the reaction volume was boiled at 85 ° C for 5 minutes to denature the sample. A stable three-dimensional structure of ssDNA aptamer was formed.

3-3. Glutathione Sepharose  4B tablets Kit  Used SPINK1  A protein that specifically binds to a protein DNA Of app tamer  Selection

15 μl (38.68 pmol) of the GST fusion SPINK1 protein purchased in Example 1 was adjusted to a total reaction volume of 100 μl with a 1 X aptamer screening solution, and then the ssDNA aptamer pool obtained in Example 3-2 386.8 pmol) at a ratio of 1:10 and reacted at 4 ° C for 24 hours. To use the Glutathione Sepharose 4B purification kit, 100 μl of Glutathione Sepharose 4B was centrifuged at 13,000 rpm for 10 minutes at 4 ° C to remove supernatant. 500 μl of 1 × aptamer selection solution was added and stirred at 4 ° C for 5 minutes After the reaction, the supernatant was removed by centrifugation at 13,000 rpm for 10 minutes at 4 ° C. After repeating the above procedure twice, the reaction mixture in which GST fusion protein SPINK1 and ssDNA aptamer paste were reacted was reacted with Glutathione Sepharose 4B at 4 ° C for 1 hour with stirring. Thereafter, the supernatant was removed by centrifugation at 13,000 rpm for 10 minutes at 4 ° C, and 500 μl of the washing solution was added thereto for 3 times to remove the ssDNA aptamer which was not bound to the GST fusion SPINK1 protein. To elute DNA aptamers specifically binding to GST fusion SPINK1 protein from Glutathione Sepharose 4B, 100 μl of DNA aptamer elution solution was added and reacted at 4 ° C for 10 minutes with stirring. After that, the reaction was performed at 13,000 rpm For 10 minutes to obtain an elution solution of the upper layer. The above procedure was repeated twice to obtain an elution solution of the upper layer. In order to remove the GST fusion SPINK1 protein from the binding between the GST fusion SPINK1 protein and the DNA aptamer specifically binding thereto, the same volume of the PCI solution was treated with the elution solution, followed by centrifugation at 13,000 rpm for 15 minutes at 4 ° C Only the supernatant was recovered. Then, to recover only the DNA aptamer that specifically binds to the GST fusion SPINK1 protein, 1/100 volume of tRNA and 3 volume of 100% ethanol were added to the recovered supernatant through the PCI method, and the mixture was incubated at -70 ° C for 2 hours The reaction mixture was subjected to centrifugation at 4 ° C and 13,000 rpm for 20 minutes. Thus, DNA aptamers specifically binding to SPINK1 protein could be recovered. The recovered DNA aptamers were dried at 65 ° C and dissolved in 50 μl of distilled water.

3-4. Non-specific DNA Aptamer  For removal Negative  Selection ( Negative selection )

In order to eliminate non-specific DNA aptamers selected by binding to GST residues other than SPINK1 protein, negative selection was performed to bind GST protein instead of SPINK1 protein between 5 and 6 times of SELEX. In the same manner as in 3-3, SELEX was performed for a total of 9 times. In order to obtain aptamer that more specifically binds SPINK1 protein, which is a target substance, by increasing the number of repeated SELEX binding conditions .

Example  4: GST  fusion SPINK1  Optimal to specifically bind protein DNA Aptamer  For screening SELEX  Round selection

4-1. Nano drop ( Nano Drop ) To confirm the affinity of each round

After completion of the SELEX 9 times, the concentration of ssDNA eluted in each round was quantified by Nano drop (Micro spectrophotometer) to quantitatively confirm the progress of SELEX and the affinity of eluted ssDNA aptamer in each round Respectively. As a result of measuring the ssDNA aptamer concentration in each round by using nano-drop, the concentration of 8 rounds was the highest at 170.1 ng / μl after negative selection, and the concentration of 9 rounds was 131.8 ng / The results showed that the optimum concentration of the aptamer pool that binds specifically to the GST fusion SPINK1 protein after the negative screening was 8 round pools (see FIG. 2).

4-2. real time( Real time ) PCR  Optimal Round Identification Using Technique

Real time PCR was performed to confirm the progress of SELEX progression and the affinity of eluted DNA aptamer quantitatively after completion of SELEX 9 times.

First, the ssDNA aptamers eluted in 6 rounds, 7 rounds, 8 rounds and 9 rounds after the initial DNA library and negative screening were amplified by PCR method, and ssDNA was secured using the heat-cooling technique. The ssDNA aptamer pools obtained at 6, 7, 8, and 9 rounds were prepared at the same concentration and reacted with the same concentration of GST fusion SPINK1 protein at 4 ° C for 24 hours or longer. The reaction mixture was reacted with Glutathione Sepharose 4B for 1 hour and then centrifuged at 13,000 rpm for 10 minutes at 4 ° C to remove supernatant. Then, the cells were washed three times with washing solution to remove ssDNA that did not bind to GST fusion SPINK1 protein, and reacted with an aptamer elution solution to recover a DNA aptamer bound to GST fusion SPINK1 protein. The same amount of PCI was treated with the recovered GST fusion SPINK1 protein-bound DNA aptamer to remove GST fusion SPINK1 protein. Then, 1/100 volume of tRNA of the recovered solution and 100% ethanol of 3 times volume were added to the solution at -70 ° C For 2 hours or more. The recovered DNA was dried at 85 ° C and dissolved in 50 μl of distilled water. Each of the obtained ssDNAs was diluted to 10 ⁰ and 10 ^{- 1} , respectively, and used as template DNA for real-time PCR. Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad, USA). Real-time PCR conditions were 95 ° C for 20 sec, 52 ° C for 20 sec, and 72 ° C for 20 min. The reaction was repeated for 40 cycles, followed by extension at 72 ° C for 5 minutes. Real-time PCR results could be obtained the results from the experiments with the samples diluted to 10 ^-1 to the template DNA. Real-time PCR Ct values were 10.48, 7.01, 6.86, and 11.05 in 6th, 7th, 8th and 9th rounds, respectively. It was confirmed that the ssDNA aptamers of 8 rounds were full of a higher concentration of aptamer than those of 7 rounds and 9 rounds, confirming that SELEX was no longer necessary (see Table 1). It was confirmed that this was also consistent with the results of the aptamer concentration measurement recovered in each round confirmed using nano drop. Through nano drop and real - time PCR results, it was confirmed that the 8 round Aptamer pool has the highest binding efficiency with GST fusion SPINK1 protein.

6R (1 X 10 ^-One ) 7R (1 X 10 ^-One ) 8R (1 X 10 ^-One ) 9R (1 X 10 ^-One ) C (t) 10.48 7.01 6.86 11.05 Efficiency (%) 68.4 71.8 74.9 61.2

Example  5: SPINK1  A protein that specifically binds to a protein DNA Aptamer  Secure candidate

5'-ATACCAGCTTATTCAATT-3 '(Sequence Listing 8 sequence) and reverse primer: 5' -ATCCAGCTTATTCAATT-3 '(SEQ ID NO: 8) were prepared for eight rounds of ssDNA aptamer pools that were found to have the highest affinity with GST fusion SPINK1 protein through nano drop and real- DsDNA was obtained by performing PCR using '-AGATTGCACTTACTATCT-3' (SEQ ID No. 9). The dsDNA thus obtained was cloned using a T-blunt cloning kit (SolGent, Korea). For cloning, 1 μl of T-vector (10 ng / μl), 4 μl of PCR product (20 ng / μl) and 1 μl of 6 × T-blunt buffer were mixed and reacted at 25 ° C for 5 minutes. 6 μl of the T-blunt cloning reaction mixture was mixed with 100 μl of DH5α, subjected to heat shock at 42 ° C. for 30 seconds, and then reacted on ice for 2 minutes. After adding 900 μl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO ₄ and 20 mM glucose) Lt; / RTI > Then, 200 μl of the culture was taken and cultured in LB containing ampicillin (50 μg / ml), kanamycin (50 μg / ml), X-gal (50 μg / ml) and IPTG After spreading on a LB plate and incubating at 37 ° C for 20 hours, only 50 white colonies were selected to determine the nucleotide sequence of each colony (Solgent, Korea). Sequence analysis revealed that SPINK1 We were able to obtain six SPINK1 protein-binding DNA aptamers with high affinity for proteins. Table 2 below shows the sequence of six SPINK1 protein-binding DNA aptamer candidates obtained using the SPINK1 protein-coupled DNA aptamer screening SELEX technique using Glutathione Sepharose 4B.

Clone name SEQ ID NO: Selected sequence Sequence size
( bp ) SPINK1-1 SEQ ID NO: 1 GCACGGAACTTGCCAATAGCGTGTATTGTGCTTACCCCCG 40 SPINK1-2 SEQ ID NO: 2 CGTGGAATAGTGGCTGAAGGAGGGAACTGACGCTGCTTGC 40 SPINK1-3 SEQ ID NO: 3 CCCGCGCGTACCTGGACCGAGATTCGGCTAGTGTGCCTGTG 41 SPINK1-4 SEQ ID NO: 4 GCCAACGTATTCTCTAGAGCGTGGTTCAATTAGCCGCGTG 40 SPINK1-5 SEQ ID NO: 5 GCCTTTCTTAGCCCGTGGATCACGTTAGGTAGCCCTCCGG 40 SPINK1-6 SEQ ID NO: 6 CGGGGGTGGGCATATACCGCTTGTTTGCCACATTCCACTG 40

Example  6: SPINK1  Protein binding DNA Aptamer  Decision of candidate groups

Structures of DNA aptamer candidates that specifically bind to SPINK1 protein could be imaged utilizing the DNA mfold program provided by the Rensselear polytechnic institute (see Figures 3A and 3B).

Example  7: SPR Using SPINK1  Protein and SPINK1  Combination Aptamer  Affinity testing between candidates

7-1. SPINK1  A protein that specifically binds to DNA Aptamer  The angle between candidates Affinity  For quantification SPINK1  Fabrication of protein coated sensor chip

In order to quantify the affinity between the SPINK1 protein and the aptamer candidate groups obtained in Example 5, the present inventors conducted a surface plasmon resonance (SPR) experiment using BIAcore 3000 (BIACORE) Respectively. To quantify the affinity between the SPINK1 protein and the aptamer candidate group, a sensor chip CM5 (GE Healthcare, UK) whose surface was coated with a carboxyl group was used. First, a mixed solution of 0.1 M N-hydroxysuccinimide (NHS) and 0.4 M N-ethyl-N '- (dimethylaminopropyl) carbodiimide (EDC) was flowed into the sensor chip CM5 at a rate of 5 μl / min for 10 minutes, Was activated with the better N-Hydroxy-succinimide ester (NHS-ester). To immobilize the SPINK1 protein on the surface of the NHS-ester-activated sensor chip CM5, SPINK1 protein solution dissolved in 10 mM sodium acetate (pH 4.5) buffer at a concentration of 60 μg / ml was added at a rate of 5 μl / min for 10 minutes Lt; RTI ID = 0.0 > SPINK1 < / RTI > protein. Then, 1 mM ethanolamine hydrochloride (pH 8.5) was flowed at a rate of 5 μl / min for 10 minutes to the sensor chip to which the GST fusion protein SPINK1 protein was immobilized, thereby inactivating the carboxyl reactors remaining on the surface of the sensor chip. This prevented other reagents and DNA aptamers from binding directly to the chip surface. After each experiment, the sensor chip was regenerated with 1 M NaCl, 50 mM NaOH. Rate variables were obtained and quantified by the BIA evaluation program (BIACORE).

7-2. SPINK1  Protein binding DNA Aptamer  Affinity measurement of candidates

SPINK1 protein-bound DNA aptamer candidates obtained to select the aptamer having the highest affinity with SPINK1 protein were added to HBS-EP buffer (GE Healthcare, UK) at concentrations of 300 nM, 500 nM, 700 nM and 1,000 nM And prepared. (300 nM, 500 nM, 700 nM, 1,000 nM) of SPINK1 binding to a sensor chip (channel 1) and a sensor chip (channel 2) to which a SPINK1 protein was immobilized The DNA aptamer candidates were injected to the SPINK1 protein And the affinity between the DNA aptamer candidate groups specifically binding thereto was quantified. Each SPINK1 protein with specific DNA app dissociation constant of Tamer candidates that bind to (K _D, dissociation) results obtained GST fusion protein binding DNA aptamer SPINK1 dissociation constant of the aptamer SPINK1_3 (K _D) of the candidates 2.53 X 10 ^-13 And the highest affinity value for the SPINK1 protein targeted by M (see Table 3).

Clone name K _D  (M) Clone name K _D  (M) SPINK1-1 1.36 x 10 ^-12 SPINK1-2 1.92 x 10 ^-12 SPINK1-3 2.53 x 10 ^-13 SPINK1-4 1.22 x 10 ^-11 SPINK1-5 4.90 x 10 ^-11 SPINK1-6 6.59 x 10 ^-12

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> DNA aptamer specifically binds to SPINK1 protein and Use          the <130> pn1511-322 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 1 gcacggaact tgccaatagc gtgtattgtg cttacccccg 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 2 cgtggaatag tggctgaagg agggaactga cgctgcttgc 40 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 3 cccgcgcgta cctggaccga gattcggcta gtgtgcctgt g 41 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 4 gccaacgtat tctctagagc gtggttcaat tagccgcgtg 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 5 gcctttctta gcccgtggat cacgttaggt agccctccgg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 6 cgggggtggg catataccgc ttgtttgcca cattccactg 40 <210> 7 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer <400> 7 ataccagctt attcaattnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnag 60 atagtaagtg caatct 76 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> template DNA <400> 8 ataccagctt attcaatt 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 agattgcact tactatct 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 agattgcact tactatct 18 <210> 11 <211> 101 <212> PRT <213> SPINK1 aminoacid sequence <400> 11 Met Lys Val Thr Gly Ile Phe Leu Leu Ser Ala Leu Ala Leu Leu Ser   1 5 10 15 Leu Ser Gly Asn Thr Gly Ala Asp Ser Leu Gly Arg Glu Ala Lys Cys              20 25 30 Tyr Asn Glu Leu Asn Gly Cys Thr Lys Ile Tyr Asp Pro Val Cys Gly          35 40 45 Thr Asp Gly Asn Thr Tyr Pro Asn Glu Cys Val Leu Cys Phe Glu Asn      50 55 60 Arg Lys Arg Gln Thr Ser Ile Leu Ile Gln Lys Ser Gly Pro Cys Leu  65 70 75 80 Glu Ser Arg Gly Pro Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu                  85 90 95 Asn Met His Thr Gly             100

Claims (10)

A DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 3, which specifically binds to the SPINK1 protein consisting of the amino acid sequence of SEQ ID NO: 11. delete A kit for detecting SPINK1 protein comprising the DNA aptamer of claim 1. A microarray for detecting SPINK1 protein comprising the DNA aptamer of claim 1.  A composition for diagnosing or prognosing a cancer showing an increase in SPINK1 protein expression comprising the DNA aptamer of claim 1. 6. The method of claim 5,
Wherein the cancer is liver cancer. A method for detecting a SPINK1 protein comprising the step of performing a binding reaction with the DNA aptamer of claim 1. A method for providing information for diagnosis or prognosis of cancer showing an increase in SPINK1 protein expression, comprising the step of performing a binding reaction with the DNA aptamer of claim 1 to a biological sample obtained from a subject. 9. The method of claim 8,
Wherein the cancer is liver cancer. delete

Images