TWI761308B - RNAi THERAPY FOR HEPATITIS B VIRUS INFECTION - Google Patents

Abstract

Described are compositions and methods for inhibition of Hepatitis B virus gene expression. RNA interference (RNAi) triggers and RNAi trigger conjugates for inhibiting the expression of Hepatitis B virus gene are described. Pharmaceutical compositions comprising one or more HBV RNAi triggers optionally with one or more additional therapeutics are also described. Delivery of the described HBV RNAi triggers to infected liver in vivo provides for inhibition of HBV gene expression and treatment.

Description

RNAi therapy for hepatitis B virus infection

Hepatitis B virus is a strictly hepatotropic virus containing double-stranded DNA. While DNA is the genetic material, the replication cycle involves a reverse transcription step that mimics pregenomic RNA into DNA. Hepatitis B virus is classified as a member of hepatitis viruses and belongs to the family Hepadnaviridae. The primary infection of an adult human with hepatitis B virus causes acute hepatitis with symptoms of organ inflammation, fever, jaundice, and increased hepatic transaminase in the blood. Those who are unable to overcome the viral infection suffer from chronic disease progression for many years, with an increased risk of developing cirrhosis or liver cancer. Chronic hepatitis is also caused by perinatal transmission from HBV-infected mothers to neonates.

After uptake by hepatocytes, the nucleocapsid is transferred to the nucleus and DNA is released. There, DNA strand synthesis was completed and the interstitial gap was repaired, resulting in a 3.2 kb covalently closed circular (ccc) supercoiled DNA. cccDNA served as the transcription template for the four major viral mRNAs, which were 3.5, 2.4, 2.1 and 0.7 kb in length. All mRNAs were 5'-capped and polyadenylated at the 3'-end. All four mRNAs have sequence overlap at the 3'-end.

The 3.5kb mRNA served as a template for the production of core protein and polymerase. Additionally, the same transcript acts as an intermediate in the replication of the current genome and allows the viral polymerase to initiate reverse transcription into DNA. Core proteins are required for nucleocapsid formation. In addition, sequence processing activities convert some core proteins into secretable e-antigens. The abundance of e-antigen in blood correlates with hepatitis B virus replication in the liver and serves as an important diagnostic marker for monitoring disease progression.

The 2.4 and 2.1kb mRNAs carry open reading frames pre-S1, pre-S2 and S, and these lines use Expression of large, medium and small surface antigens of viruses. The s antigen is associated with infectious, intact particles. In addition, blood from infected patients also contains non-infectious particles derived only from the s-antigen, without genomic DNA or polymerase. The function of these particles is not fully understood. Complete and sustained depletion of detectable s-antigen in the blood is considered a reliable indicator of hepatitis B virus clearance and thus a successful cure.

The 0.7kb mRNA encodes the X protein. This gene product is important for efficient transcription of viral genes and also acts as a transactivator for host gene expression. The latter activity appears to be important for hepatocyte transformation during liver cancer development.

Patients with detectable s-antigen, e-antigen, or viral DNA in their blood for more than 6 months were considered chronically infected. Nucleoside analogs that are inhibitors of reverse transcriptase activity are often the first treatment option for many patients. Lamivudine, Tenofovir, or Entecavir inhibit hepatitis B virus replication, sometimes to undetectable levels. Improvement in liver function and reduction in hepatitis were the most important benefits. However, only very few patients achieve complete and sustained remission after treatment ends. In addition, hepatitis B virus developed resistance with increasing duration of treatment. This is especially difficult for patients co-infected with hepatitis B and human immunodeficiency virus. Both viruses are sensitive to nucleoside analog drugs and may develop resistance at the same time.

A second treatment option is the administration of interferon-alpha. Here, patients received high-dose interferon-alpha over a 6-month period. Asian genotype B produced very poor response rates. Co-infection with hepatitis D or human immunodeficiency virus has been shown to render interferon-alpha therapy completely ineffective. Patients with severe liver damage and severe fibrotic conditions are not candidates for interferon-alpha therapy.

Despite significant advances in the field of hepatitis B virus therapy, there remains a need for agents that selectively and efficiently silence viral gene expression, block replication, and subsequently reduce viral load in chronically infected patients.

Described herein are hepatitis B viruses capable of selectively and efficiently reducing HBV expression (HBV) specific RNA interference (RNAi) trigger molecules (also known as RNAi agents, RNAi triggers, or triggers), and their role in mediating RNA interference to inhibit hepatitis B virus gene expression, especially in relation to hepatitis B virus Use in the expression of genes involved in replication or pathogenesis. Various RNAi triggers include at least one sense and antisense strands. The sense and antisense strands may be partially, substantially or completely complementary to each other. The RNAi trigger sense and antisense strands described herein can each be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be the same length or different lengths. The RNAi triggers described herein, when delivered to cells expressing HBV, inhibit the expression of one or more HBV genes in vivo. Examples of HBV RNAi trigger sense and antisense strands that can be used in HBV RNAi triggers are provided in Table 1A and Table 1B. Examples of HBV RNAi trigger duplexes are provided in Table 2.

The HBV RNAi trigger contains a sense strand (passenger strand) with a first sequence and an antisense strand (leader strand) with a second sequence. In some embodiments, the sense strand comprises a core sequence that is at least 90% identical to at least a portion of the hepatitis B virus mRNA. The antisense strand comprises a nucleotide sequence substantially complementary to at least a portion of the mRNA encoding the hepatitis B virus gene. In some embodiments, the complementary region is less than 30 nucleotides in length. In some embodiments, the length of the RNAi trigger duplex is in the range of about 16 to 30 nucleotides. In some embodiments, the length of the RNAi trigger duplex is in the range of about 15 to 25 nucleotides. In some embodiments, the duplex length of the HBV RNAi trigger is about 18, 19, 20, 21, 22, 23, or 24 nucleotides. Exemplary sequences are provided in Table 1A and Table 1B.

In some embodiments, the HBV RNAi trigger additionally comprises a targeting group. The targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the HBV RNAi trigger. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group comprises a hydrophobic group having 20 or more carbon atoms. In some embodiments, the hydrophobic group comprises Cholesterol or cholesterol-based. In some embodiments, the targeting group comprises a galactose trimer.

In some embodiments, the targeting group is linked to the trigger via a linker. Suitable linkers include, but are not limited to: -( _CH2 ) _n- , where n is 1-10 (in some embodiments, n=6, ie, C6 as used herein) and -(O-CH ₂ - _CH2 ) _n- or -( _CH2 - _CH2 -O) _n- , where n=1-10 (in some embodiments, n=3, ie, triethylene glycol (TEG)). Linkers, with or without targeting groups, can be attached to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Table 1A and Table IB.

In some embodiments, we describe a combination of at least two HBV RNAi triggers with different sequences. In some embodiments, two or more than two different HBV RNAi triggers are each linked to a targeting group. In some embodiments, two or more than two different HBV RNAi triggers are each linked to a cholesterol targeting group. In some embodiments, two or more than two different HBV RNAi triggers are each linked to a galactose trimer targeting group. In some embodiments, when two different triggers are used, the first trigger is linked to cholesterol and the second trigger is linked to the galactose trimer. In some embodiments, when two or more triggers are used, the two triggers are linked to their corresponding targeting groups using the same or similar linkers. In some embodiments, when two or more triggers are used, the two triggers are linked to their corresponding targeting groups using different linkers. In some embodiments, the first targeting group is linked to the first HBV RNAi trigger via a C6 linker and the second targeting group is linked to the second HBV RNAi trigger via a TEG linker. In some embodiments, both the first and second targeting groups consist of or consist of cholesterol or a cholesterol group. In some embodiments, both the first and second targeting groups consist of or consist of galactose trimers or galactose tetramers. The use of different linkers provides improved trigger differentiation and quantitative analysis.

In some embodiments, compositions for in vivo delivery of an HBV RNAi trigger to hepatocytes are described, comprising: an HBV RNAi trigger bound to a targeting group. In some embodiments, the targeting group is a galactose trimer or cholesterol.

In some embodiments, compositions are described for the in vivo delivery of HBV RNAi triggers to hepatocytes, comprising: a) reversible targeting of a masked melittin-like peptide (MLP) asialoglycoprotein receptor (ASGPr), the MLP delivery peptide (or simply delivery peptide), and b) conjugated to a hydrophobic group (RNA-conjugate) containing at least 20 carbon atoms, such as (but not limited to) cholesterol or cholesterol groups HBV RNAi triggers. The MLP delivery peptide and RNAi trigger-conjugate are synthesized separately and can be supplied in separate containers or a single container. In some embodiments, the HBV RNAi trigger is not bound to the delivery peptide.

In some embodiments, we describe compositions for inhibiting hepatitis B virus gene expression, comprising: a) MLP-( L - T ) _x , wherein -L - T has a composition consisting of -CO-C( _CH3 )=C( T )-COOH or -CO-C( T )=C( _CH3 )-COOH, where T comprises a targeting ligand with affinity for the asialoglycoprotein receptor, and x Greater than 80% of the number of primary amines in the MLP population, b) a first HBV RNAi trigger comprising an antisense strand and a sense strand, wherein the antisense strand comprises nucleotides of any of the antisense sequences provided in Table 1A 2-15, 2-19, 1-17, 1-21 or 1-26, and the sense strand comprises any of the corresponding sense sequences provided in Table IB covalently linked to a cholesterol group via a TEG group, and c) a second HBV RNAi trigger comprising an antisense strand and a sense strand, wherein the antisense strand comprises nucleotides 2-15, 2-19, 1- of any of the antisense sequences provided in Table 1A 17, 1-21 or 1-26, and the sense strand comprises any of the corresponding sense sequences provided in Table IB covalently linked to a cholesterol group via a C6 group. In some embodiments, any of the sense strand nucleotide sequences provided in Table IB can have a Chol-TEG or Chol-C6 5' or 3' modification.

In some embodiments, a pharmaceutically acceptable carrier or diluent containing one or more of the HBV RNAi triggers and an optional MLP delivery peptide is administered to the mammal. In some embodiments, the mammal is a human. In some embodiments, the RNAi trigger and delivery peptide are combined in solution prior to administration to the mammal. In some embodiments, the delivery peptide and the RNAi trigger are co-administered to the mammal in separate solutions. In some embodiments, the delivery peptide and the RNAi trigger are administered sequentially to the mammal. For sequential administration, the delivery peptide can be Administered prior to RNAi trigger administration. Alternatively, for sequential administration, the RNAi trigger can be administered prior to administration of the delivery peptide.

The use of hepatitis B virus RNAi triggers provides methods of therapeutic and/or prophylactic treatment of diseases/conditions associated with HBV infection. The HBV RNAi trigger mediates RNA interference to inhibit the expression of one or more genes necessary for the replication and/or pathogenesis of hepatitis B virus. In particular, HBV RNAi triggers inhibit viral polymerase, core protein, surface antigen, e antigen and/or X protein in cells, tissues or mammals. HBV RNAi triggers can be used to treat hepatitis B virus infection. HBV RNAi triggers can also be used to treat or prevent chronic liver disease/disorders, inflammation, fibrotic conditions, and proliferative disorders, such as cancer, associated with hepatitis B virus infection. In some embodiments, the sequence is at least 13 contiguous nucleotides in length. Such methods comprise administering an HBV RNAi trigger to a human or animal infected with HBV. Additionally, compositions for in vivo delivery of HBV RNAi triggers to hepatocytes are described.

In some embodiments, the HBV RNAi trigger is optionally combined with one or more additional (ie, second, third, etc.) therapeutic agents. The second therapeutic agent can be another HBV RNAi trigger (eg, an HBV RNAi trigger targeting a different sequence within the HBV genome). Additional therapeutic agents may also be small molecule drugs, antibodies, antibody fragments and/or vaccines. The HBV RNAi trigger, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

Pharmaceutical compositions comprising one or more HBV RNAi triggers can be administered in a variety of ways, depending on whether local or systemic treatment is desired. Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (eg, via an implanted device), and intraparenchymal administration.

The HBV RNAi triggers and/or compositions can be used in methods of therapeutically treating HBV infection or a disease or condition caused by HBV infection. Such methods comprise administering to an individual (eg, a human or animal individual) an HBV RNAi trigger as described herein.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as The same meaning is generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

Other objects, features and advantages will become apparent from the following [Embodiments] when taken in conjunction with the accompanying drawings.

Figure 1. Represents the chemical structure of the HBV RNAi trigger targeting group and linker group.

Figure 2. Represents the chemical structure of the HBV RNAi trigger targeting group and linker group.

Figure 3. Graphs illustrating (A) blood urea nitrogen (BUN) levels and (B) creatinine levels in primates treated with reversibly modified MLP delivery peptides and RNAi trigger-cholesterol conjugates.

Figure 4. Illustrates (A) aspartate transaminase (AST) content and (B) alanine transaminase in primates treated with reversibly modified MLP delivery peptides and RNAi trigger-cholesterol conjugates Schema of (ALT) content.

Figure 5. Shows the sera of pHBV mice following co-administration of 3 mg/kg MLP delivery peptide plus (A) 1.5 mg/kg AD01385 or 1.5 mg/kg AD01386 or (B) 1.5 mg/kg AD01385 + 1.5 mg/kg AD01386 Schema of HBV DNA.

Figure 6. Shows chimpanzees following co-administration of (A) 2 mg/kg MLP delivered peptides, 1 mg/kg AD0009 and 1 mg/kg AD0010; or (B) 2 mg/kg MLP delivered peptides, 1 mg/kg AD01386 and 1 mg/kg AD01385 Schema of serum HBsAg of 95A010.

Figure 7. HPLC chromatograms of (A) AM02312-AS, (B) AM02315-AS and (C) AM02312-AS+AM02315-AS.

Figure 8. (A) AM02316-SS(TEG), (B) AM02319-SS(TEG) and (C) HPLC chromatogram of AM02320-SS (C6).

Figure 9. HPLC Chromatography of (A) AM02323-SS(C6), (B) AM02320-SS(C6)+AM02323-SS(C6) and (C) AM02319-SS(TEG)+AM02316-SS(TEG) picture.

Figure 10. (A) AM02320-SS(C6)+AM02319(TEG), (B) AM02323-SS(C6)+AM02316-SS(TEG) and (C) AM02320-SS(C6)/AM02312-AS+AM02323 - HPLC chromatogram of SS(C6)/AM02315-AS.

Figure 11. (A) AM2316-SS(TEG)/AM02312-AS+AM02319-SS(TEG)/AM02315-AS, (B) AM02320-SS(C6)/AM02312-AS+AM02319-SS(TEG)/AM02315 - HPLC chromatograms of AS and (C)AM02316-SS(TEG)+AM02312-AS+AM02323-SS(C6)/AM02315-AS.

Described herein are RNAi triggers (referred to herein as HBV RNAi triggers) for inhibiting the expression of hepatitis B virus. Various HBV RNAi triggers contain sense and antisense strands. The sense and antisense strands are partially, substantially or completely complementary to each other. In some embodiments, the RNAi trigger sense and antisense strands described herein are independently 16 to 30 nucleotides in length. In some embodiments, the RNAi trigger sense and antisense strands described herein are independently 17 to 26 nucleotides in length. In some embodiments, the RNAi trigger sense and antisense strands described herein are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The sense and antisense strands can be the same length or they can be different lengths. In some embodiments, the sense strand is about 19 nucleotides long and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides long and the antisense strand is about 23 nucleotides long. In other embodiments, the sense and antisense strands are independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 26 nucleotides in length. Examples of nucleotide sequences used to form HBV RNAi trigger molecules are provided in Table 1A and Table 1B middle.

The HBV RNAi trigger contains a sense strand and an antisense strand, each of which contains a 16-23 nucleobase long core sequence. The antisense core sequence is 100% (complete) or at least 90% (substantially) complementary to the nucleotide sequence present in the HBV mRNA (sometimes referred to as the "target sequence"). The core sequence of the sense strand is 100% (complete) complementary or at least 90% (substantially) complementary to the sequence in the antisense strand, and thus the core sequence of the sense strand is the nucleotide sequence present in the HBV mRNA (target sequence) Complete agreement or at least 90% agreement. The sense strand core sequence can be the same length as the corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

The HBV RNAi trigger sense and antisense strands are usually joined to form a duplex. Within the complementary duplex region, the sense strand core sequence is at least 90% complementary or 100% complementary to the antisense core sequence. In some embodiments, the sense strand core sequence contains at least 16, at least 17, A sequence of at least 18, at least 19, at least 20, or at least 21 nucleotides (that is, at least 16 of the sense strand and antisense core sequence of the HBV RNAi trigger having at least 90% base pairing or 100% base pairing) , a region of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides.)

RNAi triggers include, but are not limited to: short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and endonuclease substrates (eg, US Pat. No. 8,084,599 No. 8,349,809 and 8,513,207). The RNAi triggers described herein, after delivery to cells expressing HBV genes, inhibit or block the expression of one or more HBV genes in vivo through the biological process of RNA interference (RNAi).

As used herein, the term "sequence" or "nucleotide sequence" refers to the sequence or sequence of nucleobases, nucleotides and/or nucleosides using standard nucleotide nomenclature and described herein The key for the modified nucleotide is described as a series of letters.

The sense and/or antisense strands may optionally and independently contain additional 1, 2, 3, 4, 5, or 6 nucleotides at the 3', 5', or 3' and 5' ends of the core sequence ( extension). The antisense strand extra nucleotides, if present, may or may not be complementary to the corresponding sequence in the HBV mRNA. The additional nucleotides in the sense strand, if present, may or may not be identical to the corresponding sequence in the HBV mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and/or 3' end of the sense core sequence and/or the antisense core sequence. The extension nucleotides on the sense strand may or may not be complementary to the nucleotides in the corresponding antisense strand (core sequence nucleotides or extension nucleotides). Conversely, extended nucleotides on the antisense strand may or may not be complementary to nucleotides in the corresponding sense strand (core sequence nucleotides or extended nucleotides). In some embodiments, both the sense and antisense strands of the RNAi trigger contain 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand base pair with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, the HBV RNAi trigger has an antisense strand containing a 3' extension and a sense strand containing a 5' extension.

The HBV RNAi triggers described herein are formed by bonding the antisense to the sense. In some embodiments, the HBV RNAi trigger antisense strand comprises the nucleotide sequence of any of the sequences in Table 1A. In some embodiments, the HBV RNAi trigger antisense strand comprises nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2- of any of the sequences in Table 1A 19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, Sequence 1-26 or 2-26. In some embodiments, the HBV RNAi trigger sense strand comprises the nucleotide sequence of any of the sequences in Table IB. In some embodiments, the HBV RNAi trigger sense strand comprises nucleotides 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1- of any of the sequences in Table IB 24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2- 24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7- Sequence of 24, 7-25, 7-25, 8-25, 8-26.

In some embodiments, the sense and antisense strands of the RNAi triggers described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi triggers described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi trigger form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi trigger form a blunt end. In some embodiments, both ends of the RNAi trigger form a blunt end. In some embodiments, both ends of the RNAi trigger are non-blunt ends. As used herein, blunt end refers to the end of a double-stranded trigger molecule where the terminal nucleotides of the two cohesive strands are complementary (forming complementary base pairs). In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi trigger form a flip end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi trigger form a flip end. In some embodiments, both ends of the RNAi trigger form flip ends. In some embodiments, both ends of the RNAi trigger are not flipped ends. As used herein, a flip end refers to the end of a double-stranded trigger molecule in which the terminal nucleotides of the two cohesive strands form a pair (ie, do not form an overhang), but are not complementary (ie, form a non-complementary pair) . As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi triggering molecule. Unpaired nucleotides can be on the sense or antisense strands, resulting in 3' or 5' overhangs. In some embodiments, the RNAi trigger molecule comprises: one blunt end and one folded end, one blunt end and one 5' overhang, one blunt end and one 3' overhang, one folded end and one 5' overhang , one cuffed end and one 3' overhang, two 5' overhangs, two 3' overhangs, one 5' overhang and one 3' overhang, two cuffed ends or two blunt ends.

Nucleotide bases (or nucleobases) are heterocyclic pyrimidine or purine compounds, which are components of all nucleic acids and include adenine (A), guanine (G), cytosine (C), thymine (T) and urine Pyrimidine (U). As used herein, "G", "g", "C", "c", "A", "a", "U", "u" and "T" each generally mean that each contains guanine, cytosine, adenine Purine, uracil and thymidine are used as nucleobases, nucleosides, nucleotides or nucleotide mimetics of bases. As also used herein, the term "nucleotide" may include modified nucleotides or nucleotide mimetics, abasic sites, or alternative substitution moieties.

As used herein, "modified nucleotides" are nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, the HBV RNAi trigger contains one or more modified nucleotides. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides are modified. Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimetics, abasic nucleotides (represented herein as X or Ab), 2'-modified nucleotides , 3' to 3' bond (inverted) nucleotides (denoted herein as invdN, invN, invn, invX), nucleotides containing unnatural bases, bridging nucleotides, peptide nucleic acids, 2' , 3'-open nucleotide mimetics (unlocked nucleobase analogs, denoted herein as N _UNA or NUNA), locked nucleotides (denoted herein as N _LNA or NLNA), 3'-O - Methoxy (2' internucleotide linkage) nucleotides (denoted herein as 3'-OMen), 2'-F-arabinonucleotides (denoted herein as NfANA or _NfANA ), Morpholinyl nucleotides, vinylphosphonate deoxyribonucleotides (represented herein as vpdN), and vinylphosphonate nucleotides (represented herein as vpN). 2'-modified nucleotides (that is, nucleotides in which the group at the 2' position of the five-membered sugar ring is not a hydroxyl group) include, but are not limited to, 2'-O methyl nucleotides (herein represented by the lowercase "n" in the nucleotide sequence), 2'-deoxy-2'-fluoronucleotides (represented herein as Nf, and also represented herein as 2'-fluoronucleotides ), 2'-deoxynucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-amino nucleotides and 2'-alkyl nucleotides. All positions of a given compound need not be uniformly modified. Conversely, more than one modification can be incorporated in a single HBV RNAi trigger or even in a single nucleotide thereof. HBV RNAi trigger sense and antisense strands can be synthesized and/or modified by methods known in the art. Modification of one nucleotide is independent of modification of another nucleotide.

Modified nucleotides also include nucleotides with modified nucleobases. Modified nucleobases include, but are not limited to, synthetic and natural nucleobases, 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2 -Aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypodermic Xanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil , 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5 - uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and Guanine, 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-nitrogen Guanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

In some embodiments, one or more nucleotides of the HBV RNAi trigger are linked by non-standard bonds or backbones (ie, modified internucleoside bonds or modified backbones). In some embodiments, the modified internucleoside linkage is a non-phosphate containing covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate, 5'-phosphorothioate groups (represented herein as a lower case "s" before a nucleotide, as in sN, sn, sNf or sdN), parachiral phosphorothioates, phosphorothioates, phosphorodithioates, phosphoric triesters, aminoalkyl-phosphotriesters, methyl and other alkylphosphonates ( Including 3'-alkylene phosphonates and chiral phosphonates), phosphonites, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), Thiocarbonyl amidophosphates, thiocarbonylalkyl-phosphonates, thiocarbonylalkylphosphotriesters, morpholinyl linkages and borane phosphates with normal 3'-5' linkages, these internucleoside linkages or 2'-5' linked analogs of the main chain and those internucleoside linkages or main chains of opposite polarity, where adjacent pairs of nucleoside units are 3'-5' to 5'-3' or 2'-5' to 5'-2' connection. In other embodiments, the modified internucleoside linkage or backbone does not have a phosphorus atom. Modified internucleoside linkages that do not have a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatoms and alkyl or cycloalkyl intersugar linkages, or one or more short Chain heteroatoms or heterocyclic intersugar bonds. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, thioethers, methylene and methylene backbones; carboxyl and thiocarbamyl backbones, methylene Carboxylic and thiocarbamoyl backbones, olefin-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbone; and other backbones with mixed N, O, S and _CH2 component parts.

In some embodiments, the HBV RNAi trigger contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside linkages. For example, in some embodiments, the sense strand of the HBV RNAi trigger may contain 1, 2, 3 or 4 phosphorothioate linkages; the antisense strand of the HBV RNAi trigger may contain 1, 2, 3 or 4 phosphorothioate linkages; or the sense and antisense strands can independently contain 1, 2, 3 or 4 phosphorothioate linkages.

In some embodiments, the chemically modified HBV RNAi trigger comprises a duplex having two strands, one or both of which may be chemically modified, wherein each strand is about 17 to about 29 nucleotides. In some embodiments, the HBV RNAi trigger comprises one or more modified nucleotides while maintaining the ability to mediate RNAi within a cell or reconstituted in vitro system. The HBV RNAi trigger can be modified, wherein the chemical modification comprises one or more (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) nucleotides. In some embodiments, the HBV RNAi trigger comprises modified nucleotides as a percentage of the total number of nucleotides present in the HBV RNAi trigger. Thus, an HBV RNAi trigger can generally comprise from about 5% to about 100% of nucleotide positions (eg, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% %, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotide positions) modified nucleotides. Modified nucleotides present in a given HBV RNAi trigger The actual percentage depends on the total number of nucleotides present in the HBV RNAi trigger. The percent modification can be counted in the sense strand, antisense strand, or the total number of nucleotides present in both the sense and antisense strands. Additionally, the actual percentage of modified nucleotides present in a given HBV RNAi trigger may also depend on the total number of purine and pyrimidine nucleotides present in the HBV RNAi trigger. For example, where all pyrimidine nucleotides and/or all purine nucleotides present in the HBV RNAi trigger are modified.

Representative HBV RNAi triggers are represented by the duplex ID numbers shown in Table 2. In some embodiments, the HBV RNAi trigger consists of any of the duplex ID numbers provided herein. In some embodiments, the HBV RNAi trigger comprises any of the duplex ID numbers provided herein. In some embodiments, the HBV RNAi trigger comprises the sense and antisense nucleotide sequences of any of the duplex ID numbers provided herein. In some embodiments, the HBV RNAi trigger comprises the sense and antisense nucleotide sequences and targeting groups and/or linking groups of any of the duplex ID numbers provided herein, wherein the targeting Groups and/or linking groups are covalently attached to the sense strand or the antisense strand. In some embodiments, the HBV RNAi trigger comprises modified nucleotide sequences of the sense and antisense strands of any of the duplex ID numbers provided herein. In some embodiments, the HBV RNAi trigger comprises modified nucleotide sequences and targeting and/or linking groups of the sense and antisense strands of any of the duplex ID numbers provided herein, wherein the targeting group and/or the linking group is covalently linked to the sense strand or the antisense strand.

In some embodiments, HBV RNAi triggers contain or bind to targeting groups, linking groups, delivery polymers, delivery vehicles, and/or other non-nucleotide groups. Targeting groups, linking groups, delivery polymers, delivery vehicles, and/or other non-nucleotide groups can be covalently attached to the 3' and/or 5' ends of any sense and/or antisense strand . In some embodiments, the HBV RNAi trigger comprises a targeting group, linker group, delivery polymer, delivery vehicle, or other non-nucleotide group attached to the 3' and/or 5' end of the sense strand. In some embodiments, targeting groups, linking groups, delivery polymers, delivery vehicles, or other non-nucleotide groups The group was ligated to the 5' end of the HBV RNAi trigger sense strand. In some embodiments, targeting groups, linking groups, delivery polymers, delivery vehicles, and/or other non-nucleotide groups are linked to the trigger either directly or indirectly via a linker/linking group. In some embodiments, targeting groups, linking groups, delivery polymers, delivery vehicles, and/or other non-nucleotide groups are attached to the RNAi trigger via a labile, cleavable, or reversible linkage or linker Righteous and/or Antisense.

Targeting groups can enhance the pharmacokinetic or biodistribution properties of the RNAi trigger or the conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some cases, binding of a targeting group to a cell or cellular receptor can initiate endocytosis. Targeting groups can be monovalent, bivalent, trivalent, tetravalent, or of higher value. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules .

Unmodified HBV RNAi trigger sense and antisense sequences are provided in Table 1A and Table 1B. In forming the HBV RNAi trigger, each nucleotide of each unmodified sequence listed in Table 1A and Table 1B can be a modified nucleotide. Non-limiting examples of antisense and sense strands containing modified nucleotides are also provided in Table 1A and Table 1B. In Table 1A and Table 1B, the following symbols are used to indicate modified nucleotides: N=2'-OH (unmodified) ribonucleotides (no capital letters indicated by f or d); n=2 '-O-methyl(2'-OMe) nucleotide; Nf=2'-deoxy-2'-fluoronucleotide (also known as 2'-fluoro-modified nucleotide); dN=2 '-deoxynucleotides (deoxynucleotides); N _UNA = 2', 3'-ring-opened nucleotide mimics (unlocked nucleobase analogs); NM = 2'-methoxyethyl Nucleotides (also shown as 2'-MOE);(invdN)=3'-3' linked (reverse) deoxyribonucleotides (3'-3' linked nucleotides); (invAb)= 3'-3' linked (inverted) abasic nucleotide (also shown as (invX)); x = abasic site; s = phosphorothioate linked nucleotide; p = phosphate; vp = nucleotide containing vinylphosphonate.

In some embodiments, the HBV RNAi trigger is prepared or provided in salt, mixed salt or free acid form.

As indicated in Table 1A and Table 1B, targeting and linking groups include, but are not limited to, (Chol-TEG), (Chol-C6), (Chol-ALNY), (NH2-C6), (C6 -SS-Alk-Me), (Alk-SS-C6), (C11-PEG3-NAG3), (NAG13), (NAG25), (Toc) and (TEG-biotin). In some embodiments, any of the HBV RNAi trigger sense strands listed in Table IB contain a 3' or 5' targeting group or linking group, or may not contain a 3' or 5' targeting group or The linking group, or may contain different 3' or 5' targeting or linking groups.

The structures of the targeting groups and linking groups indicated in Table IB linked to the RNAi triggers are shown below and in FIG. 1 and FIG. 2 . (RNAi triggers are indicated by RNA or triggers).

(Chol-TEG)-RNA, n=1-10, in some embodiments, n=2.

( _NH2 - _Cn )-RNA, n=1-10, in some embodiments, N=6(C6).

RNA-(C6-SS-Alk-Me) or ((Me-Alk-SS-C6)-RNA; (n=1-10), in some embodiments, n=4

(TEG-Biotin)

(C11-PEG3-NAG3)-trigger

(NAG13)-trigger

(NAG25)-trigger sub

In vivo delivery

Described herein are methods for the in vivo delivery of HBV RNAi triggers to mammalian hepatocytes. In some embodiments, delivery vehicles can be used. Delivery vehicles are compounds that improve the delivery of RNAi agents to cells. Delivery vehicles can be, but are not limited to: polymers, such as amphoteric polymers, membrane-active polymers; peptides, such as melittin or melittin-like peptides; reversibly modified polymers or peptides; or lipids. In some embodiments, the HBV RNAi trigger is linked to a targeting ligand comprising a galactose derivative. In some embodiments, the HBV RNAi trigger is linked to a targeting ligand comprising or consisting of galactose trimers. In some embodiments, an HBV RNAi trigger delivery system is described comprising a small delivery peptide MLP derived from melittin and one or more independently targeted HBV RNAi triggers.

In some embodiments, an RNAi trigger as described herein is linked to a galactose trimer. As used herein, galactose trimers comprise molecules with three or four terminal galactose derivatives. As used herein, the term galactose derivative includes galactose and galactose derivatives having an affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Galactose trimers contain three or four galactose derivatives, each attached to a central branch point via its C-1 carbon. In some embodiments, the galactose derivative is attached to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer (US Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39, pp. 1538-1546), such as (but not Restricted to): PEG spacer. In some embodiments, the PEG spacer is a PEG ₃ spacer. The branch point can be any small molecule that allows attachment of three to four galactose derivatives and additionally allows attachment of the branch point to the RNAi agent. Attachment of branch points to RNAi agents can occur via linkers or spacers. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer such as (but not limited to): a PEG spacer. In some embodiments, the PEG spacer is a PEG ₃ spacer (three ethylidene units). In other embodiments, the PEG spacer has 1 to 20 ethylidene units (PEG ₁ to PEG ₂₀ ). In some embodiments, the galactose derivative comprises N-acetylgalactosamine (GalNAc or NAG). Other carbohydrates with affinity for the asialoglycoprotein receptor can be selected from the list comprising: galactose, galactosamine, N-methyl-galactosamine, N-acetyl-galactosamine, N-acetyl-galactosamine -Propionyl-galactosamine, N-n-butyrylgalactosamine and N-isobutyrylgalactosamine. The affinity of a number of galactose derivatives for the asialoglycoprotein receptor has been studied (see eg: Iobst, ST and Drickamer, K. JBC 1996, 271 , 6686) or is readily determined using methods well known and commonly used in the art. Other common terms in the art for galactose trimers with three terminal galactose derivatives include triantennary galactose, trivalent galactose. Other common terms in the art for galactose trimers include galactose clusters. Triantennary galactose derivative clusters are known to bind to ASGPr with greater affinity than biantennary or monoantennary galactose derivative structures (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

In some embodiments, compositions are described comprising: MLP- ( L - M) _x plus NT , wherein N is an HBV RNAi trigger and T is a targeting group (comprising a group having 20 or more carbon atoms) a hydrophobic group such as cholesterol), the MLP is a melittin-like peptide as described herein, and the masking agent M contains an ASGPr coordination as described herein covalently linked to the MLP via a physiologically labile reversible bond L body. As used herein, MLP- ( L - M) _x is an MLP delivery peptide or delivery peptide. L cleavage restores the unmodified amine on the MLP . In some embodiments, the optional group Y is attached to the amine terminus, carboxy terminus or cysteine of the MLP. If present, Y may comprise: ASGPr ligand, polyethylene glycol (PEG), or ASGPr ligand-PEG. x is an integer greater than 1. In the unmodified state, MLPs are membrane active. However, the delivery peptide MLP- ( L - M) _x was not membrane active. MLP primary amines reversibly inhibit or inactivate the membrane activity of MLP by reversible modification of M-attached M. A sufficient percentage of MLP primary amines are modified to inhibit the membrane activity of the polymer and are ready for hepatocyte targeting. In some embodiments, the value of x is greater than 80%, greater than 90%, or greater than 95% of the number of primary amines on the MLP (as determined by the number of primary amines on the MLP in the absence of any masking agent). More specifically, the value of x is greater than 80% and up to 100% of the primary amine on the MLP . It should be noted that MLPs typically contain 3-5 primary amines (including the amine end (if unmodified) and typically 2-4 lysine residues). Thus, modifying a certain percentage of amines is intended to reflect a certain percentage of MLP amines in the modified MLP population. MLP population means a population of MLPs in a defined sample size as would be relevant to one of ordinary skill in the art, such as a population in a container, dose or manufacturing batch. In some embodiments, the MLP population is a collection of MLPs in a manufacturing batch. Following cleavage of the reversible bond L , the unmodified amine is restored, thereby returning the MLP to its unmodified membrane-active state. In some embodiments, the reversible bond is a pH labile bond, such as a disubstituted maleate bond. ASGPr-targeted reversibly masked membrane-active polymers (delivery peptides) MLP- ( L - M) _x and polynucleotide-conjugates T - N were synthesized or fabricated, respectively. Neither T nor N is covalently linked directly or indirectly to MLP , L or M. Electrostatic or hydrophobic association of polynucleotides or polynucleotide-conjugates with masked or unmasked polymers is not required for in vivo liver delivery of polynucleotides. The masked polymer and polynucleotide conjugates can be supplied in the same container or in separate containers. They may be combined, co-administered or administered sequentially prior to administration.

In some embodiments, ASGPr-targeted reversibly masked MLPs comprise MLPs that are reversibly modified by the reaction of a primary amine on the peptide with a masking agent containing an ASGPr ligand. like Cleavage of the modifying group restores the amine, and the amine is reversibly modified. Reversible modification of MLPs with the masking agents disclosed herein reversibly inhibits the membrane activity of MLPs. In the masked state, reversibly masked MLPs do not exhibit membrane disrupting activity. In some embodiments, greater than 80% or greater than 90% of the amines on the MLP are reversibly modified.

As used herein, MLPs are small amphiphilic membrane active peptides comprising from about 23 to about 32 amino acids derived from the naturally occurring melittin melittin. Naturally occurring melittin contains 26 amino acids and is predominantly hydrophobic at the amino terminus and predominantly hydrophilic (cationic) at the carboxy terminus. In some embodiments, the MLP is isolated from a biological source or is synthesized. Synthetic polymers are formulated or manufactured "by man" using chemical methods and are not produced by naturally occurring biological processes. As used herein, MLP encompasses naturally occurring melittins of the MLP family, which are found in, for example, the venom of the following species: Apis florea , Apis mellifera , Apis cerana , Apis cerana ( Apis dorsata ), Vespula maculifrons , Vespa magnifica , Vespa velutina , Polistes sp. HQL-2001 and Polistes hebraeus . As used herein, MLPs also encompass synthetic peptides with amino acid sequences identical or similar to naturally occurring MLPs. In particular, the MLP amino acid sequences encompass those amino acid sequences shown in Table 3. In addition to the amino acids that retain the inherent high membrane activity of melittin, 1-8 amino acids can be added to the amino or carboxyl terminus of the peptide. In particular, cysteine residues can be added to either the amino-terminus or the carboxyl-terminus. The list in Table 3 is not intended to be exhaustive, as other conservative amino acid substitutions are readily envisioned. Synthetic MLPs may contain naturally occurring L-amino acids or enantiomeric D-amino acids (inverso). The MLP amino acid sequence can also be retro. Retro MLPs can have L-type amino acids or D-type amino acids (retroinverso). Two MLPs can also be covalently linked to form MLP dimers. In addition to masking agents, MLPs can have modifying groups attached to the amino- or carboxy-terminus of the peptide that enhance tissue targeting or facilitate in vivo circulation. However, as used herein, MLP does not include chains or polymers that contain more than two covalently linked to each other or to another polymer or framework.

In some embodiments, the melittin-like peptide (MLP) comprises little honey bee melittin, western honey bee melittin, giant honey bee melittin, Chinese honey bee melittin, or derivatives thereof (including amino acid substitutions). In some embodiments, the MLP comprises the sequence: Xaa1- _Xaa2 -Xaa3 _- Ala- _{Xaa5 -} Leu-Xaa7 _- Val-Leu- _Xaa10 - _Xaa11 - _Xaa12 -Leu-Pro- _Xaa15 -Leu -Xaa ₁₇ -Xaa ₁₈ -Trp-Xaa ₂₀ -Xaa ₂₁ -Xaa ₂₂ -Xaa ₂₃ -Xaa ₂₄ -Xaa ₂₅ -Xaa ₂₆ , wherein: Xaa ₁ is leucine, D-leucine, isoleucine, norleucine, tyrosine, tryptophan, valine, alanine, dimethylglycine, glycine, histidine, phenylalanine or cysteine, Xaa ₂ is isoleucine , leucine, norleucine or valine, Xaa ₃ is glycine, leucine or valine, Xaa ₅ is isoleucine, leucine, norleucine or valine, Xaa ₇ is lysine, serine, asparagine, alanine, arginine or histidine, Xaa ₁₀ is alanine, threonine or leucine, Xaa ₁₁ is threonine or cysteine Amino acid, Xaa ₁₂ is glycine, leucine or tryptophan, Xaa ₁₅ is threonine or alanine, Xaa ₁₇ is isoleucine, leucine, norleucine or valine, Xaa ₁₈ is serine or cysteine, Xaa ₂₀ is isoleucine, leucine, norleucine or valine, Xaa ₂₁ is lysine or alanine, Xaa ₂₂ is asparagine or Arginine, Xaa ₂₃ is lysine or alanine, Xaa ₂₄ is arginine or lysine, Xaa ₂₅ is lysine, alanine or glutamic acid, Xaa ₂₆ is as appropriate and if present , is glutamic acid, cysteine, glutamic acid-NH ₂ or cysteine-NH ₂ ; and at least two of Xaa ₂₁ , Xaa ₂₃ and Xaa ₂₅ are lysine.

In some embodiments, the MLP comprises the sequence: Xaa1- _Xaa2 -Xaa3 _- Ala- _{Xaa5 -} Leu-Xaa7 _- Val-Leu- _Xaa10 - _Xaa11 - _Xaa12 -Leu-Pro- _Xaa15 -Leu -Xaa ₁₇ -Ser-Trp-Xaa ₂₀ -Lys-Xaa ₂₂ -Lys-Arg-Lys-Xaa ₂₆ , wherein: Xaa ₁ is leucine, D-leucine, norleucine or tyrosine, Xaa ₂ is isoleucine, leucine, norleucine or valine, Xaa ₃ is glycine, leucine or valine, Xaa ₅ is isoleucine, valine, leucine Or ortholeucine, Xaa ₇ is lysine, serine, asparagine, alanine, arginine or histidine, Xaa ₁₀ is alanine, threonine or leucine, Xaa ₁₁ is Threonine or cysteine, Xaa ₁₂ is glycine, leucine or tryptophan, Xaa ₁₅ is threonine or alanine, Xaa ₁₇ is isoleucine, leucine or norleucine , Xaa ₂₀ is isoleucine, leucine or norleucine, Xaa ₂₂ is asparagine or arginine, and Xaa ₂₆ is glutamic acid or cysteine.

In some embodiments, the MLP comprises the sequence: Xaa1- _{Xaa2 -} Gly-Ala-Xaa5 _- Leu-Lys-Val-Leu-Ala- _Xaa11 -Gly-Leu-Pro-Thr-Leu- _Xaa17 -Ser -Trp-Xaa ₂₀ -Lys-Xaa ₂₂ -Lys-Arg-Lys-Xaa ₂₆ , wherein: Xaa ₁ , Xaa ₂ , Xaa ₅ , Xaa ₁₇ and Xaa ₂₀ are independently isoleucine, leucine or normal white Amino acid, Xaa ₁₁ is threonine or cysteine, Xaa ₂₂ is asparagine or arginine, and Xaa ₂₆ is glutamine or cysteine.

Table 3. MLP amino acid sequences.

dMel = melittin peptide with D-amino acid

In some embodiments, the ASGPr ligand-containing masking agent has a neutral charge and includes an ASGPr ligand attached to a disubstituted maleic anhydride amine reactive group. In some embodiments, the ASGPr ligand has an affinity for ASGPr greater than or equal to galactose (a derivative of galactose). Galactose derivatives include (but are not limited to): galactosamine, N-acetylgalactosamine, lactose, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl Galactosamine, N-n-butyrylgalactosamine and N-isobutyryl-galactosamine.

其中R1包含去唾液酸醣蛋白受體(ASGPr)配位體且烷基可為(但不限於)甲基(-CH₃)、乙基(-CH₂CH₃)或丙基(-CH₂CH₂CH₃)。經取代之烷基順丁烯二酸酐之實例由2-丙酸-3-烷基順丁烯二酸酐衍生物組成。中性親水性2-丙酸-3-烷基順丁烯二酸酐衍生物由中性親水性基團經由2-丙酸-3-烷基順丁烯二酸酐γ-羧基附接至2-丙酸-3-烷基順丁烯二酸酐而形成：

In some embodiments, the masking agent comprises a neutral hydrophilic disubstituted alkyl maleic anhydride having the structure represented by:

wherein R1 comprises an asialoglycoprotein receptor (ASGPr) ligand and the alkyl group can be, but is not limited to, methyl (-CH ₃ ), ethyl (-CH ₂ CH ₃ ), or propyl (-CH ₂ ) CH ₂ CH ₃ ). Examples of substituted alkyl maleic anhydrides consist of 2-propionic acid-3-alkyl maleic anhydride derivatives. Neutral hydrophilic 2-propionic acid-3-alkyl maleic anhydride derivatives are attached to 2- Propionic acid-3-alkyl maleic anhydride forms:

where R1 contains a neutral ASGPr ligand and n=0 or 1. In some embodiments, the ASGPr ligand is attached to the anhydride via a short PEG linker.

In some embodiments, the galactose ligand is attached to the anhydride via a PEG linker, as illustrated by the following structure:

where n is an integer between 1 and 19.

Amines react with cyclic anhydrides to form amide acids.

Cleavage of amide acids to form amines and anhydrides is pH-dependent and greatly accelerated at acidic pH.

The membrane active polyamine can be bound to the masking agent in the presence of excess masking agent. Excess masking agent can be removed from the bound delivery peptide prior to administration of the delivery peptide.

ASGPr ligand

80%或

90%一級胺而經可逆掩蔽。 The targeting moiety or group enhances the pharmacokinetic or biodistribution properties of the conjugate to which it is attached to improve cell-specific distribution and cell-specific uptake of the conjugate. Galactose derivatives have been used to target molecules to hepatocytes in vivo by their binding to the asialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. As used herein, ASGPr ligands include galactose derivatives that have an affinity for ASGPr equal to or greater than galactose. ASGPr ligand binding to ASGPr facilitates cell-specific targeting of hepatocytes and endocytosis of molecules into hepatocytes. The ASGPr ligand may be selected from the group comprising: lactose, galactose, N-acetylgalactosamine (GalNAc), galactosamine, N-formylgalactosamine, N-acetyl-galactose amines, N-propionylgalactosamine, N-n-butyrylgalactosamine, and N-isobutyryl-galactosamine (Iobst, ST and Drickamer, K. JBC 1996, 271 , 6686). ASGPr ligands can be monomeric (eg, with a single galactosamine) or polymeric (eg, with multiple galactosamines). In some embodiments, the MLP is attached to the peptide via an ASGPr ligand masking agent

80% or

90% primary amine and reversibly masked.

RNAi trigger-hydrophobic group conjugates

We have found that binding of HBV RNAi triggers to hydrophobic groups such as cholesterol or cholesterol groups and co-administration of RNAi trigger conjugates with MLP delivery peptides results in efficient, functional delivery of HBV RNAi triggers to hepatocytes in vivo. In some embodiments, the HBV RNAi trigger is covalently bound to a hydrophobic group. Triggers can be synthesized or modified to contain reactive groups A . Targeting groups can also be synthesized or modified to contain reactive groups B . The reactive groups A and B are selected so that they can be linked via covalent bonds using methods known in the art. A hydrophobic group can be attached to the 3' or 5' end of the HBV RNAi trigger. In some embodiments, the hydrophobic group is attached to the sense or antisense strand of the RNAi trigger. In some embodiments, the hydrophobic group is attached to the sense strand of the RNAi trigger.

In some embodiments, hydrophobic groups suitable for use as polynucleotide targeting moieties can be selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aryne radicals, each of which may be linear, branched, or cyclic; cholesterol, cholesterol derivatives, sterols, steroids, and steroid derivatives. Hydrophobic targeting moieties are typically hydrocarbons, containing only carbon and hydrogen atoms. In some embodiments, the hydrophobic group can be, but is not limited to, cholesterol, dicholesterol, tocopherol, ditocopherol, didecyl, di(dodecyl), di(octadecyl), di (dodecyl), di(octadecyl), isoprenoids and cholamines. The attachment of the hydrophobic targeting group to the HBV RNAi trigger did not provide efficient and functional in vivo delivery of the HBV RNAi trigger in the absence of co-administration of the delivery peptide. Although siRNA-cholesterol conjugates have been reported by others to deliver siRNA (siRNA-cholesterol) to hepatocytes in vivo in the absence of any additional delivery vehicle, high concentrations of siRNA are required and the delivery efficacy is poor. When combined with the delivery peptides described herein, the delivery of RNAi triggers is greatly improved. By providing the HBV RNAi trigger-cholesterol and the delivery peptide, the efficacy of the HBV RNAi trigger was increased approximately 100-fold. In some embodiments, the targeting group is attached to the sense or antisense strand of the RNAi trigger. Substitutions or heterogens that allow hydrophobicity to be maintained Substances such as fluorine. The hydrophobic targeting group can be attached to the 3' or 5' end of the HBV RNAi trigger using methods known in the art. For HBV RNAi triggers with 2 strands, the hydrophobic group can be attached to either strand.

The hydrophobic group qualitatively indicates that the chemical moiety avoids water. Typically, such chemical groups are not water soluble and do not tend to form hydrogen bonds. Hydrophobic groups dissolve in fats, oils, lipids and non-polar solvents and have little to no ability to form hydrogen bonds. Hydrocarbons containing two (2) or more carbon atoms, certain substituted hydrocarbons, cholesterol and cholesterol derivatives are examples of hydrophobic groups and compounds. The hydrophobic group is usually a hydrocarbon containing only carbon and hydrogen atoms. In some embodiments, non-polar substitutions or non-polar heteroatoms are allowed to maintain hydrophobicity and include, for example, fluorine. The term includes aliphatic, aromatic, alkenyl, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups, each of which may be straight chain, branched chain or circular. The term hydrophobic group also includes: sterols, steroids, cholesterol and steroid and cholesterol derivatives. As used herein, a cholesterol group means a compound comprising cholesterol or a cholesterol derivative.

As used herein, a membrane-active peptide is a surface-active, amphoteric peptide capable of inducing one or more of the following effects on biological membranes: membrane alteration or disruption to allow non-membrane permeable molecules to enter cells or pass through membranes, membranes Pore formation, membrane splitting, or membrane disruption or dissolution. As used herein, a membrane or cell membrane comprises a lipid bilayer. Membrane alteration or disruption can be functionally defined by the activity of the peptide in at least one of the following assays: erythrocyte lysis (hemolysis), liposome leakage, liposome fusion, cell fusion, cell lysis, and endosomal release. Membrane active peptides that can cause cell membrane lysis are also called membrane lysis peptides. Peptides that preferentially cause endosomal or lysosomal disruption relative to the plasma membrane are considered endosomal lysis. The effects of membrane-active peptides on cell membranes can be transient. Membrane active peptides have affinity for membranes and cause denaturation or deformation of the bilayer structure.

The terms polynucleotide or nucleic acid or polynucleic acid are terms in the art referring to polymers containing at least two nucleotides. Nucleotides are the monomeric units of polynucleotide polymers. Polynucleotides with fewer than 120 monomeric units are often referred to as oligonucleotides. natural nucleic acid has Oxyribose-phosphate or ribose-phosphate backbone. Non-natural or synthetic polynucleotides are polynucleotides that polymerize in vitro or in cell-free systems and contain the same or similar bases, although they may contain types other than natural ribose or deoxyribose phosphate backbones main chain. Polynucleotides can be synthesized using any technique known in the art. Polynucleotide backbones known in the art include: PNAs (peptide nucleic acids), phosphorothioates, phosphorodiamidoesters, morpholine nucleic acids, and other variants of the phosphate backbones of natural nucleic acids. Bases include purines and pyrimidines, which additionally include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs. Synthetic derivatives of purines and pyrimidines include, but are not limited to, modifications to place new reactive groups on nucleotides such as, but not limited to, amines, alcohols, thiols, carboxylates and alkyl halides. The term base encompasses any known base analog of DNA and RNA. Polynucleotides may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination. Polynucleotides can be polymerized in vitro, which can be recombinant, contain chimeric sequences or derivatives of these groups. Polynucleotides can include capping groups at the 5'-end, the 3'-end, or both the 5' and 3' ends. The capping group can be, but is not limited to, an inverse deoxyabasic group, an inverse deoxythymidine, a thymidine, or a 3' glyceryl modification.

RNA interference (RNAi) triggers are molecules capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of transgenic genes in a sequence-specific manner by inducing RNA interference by interacting with the RNA interference pathway machinery of mammalian cells. The two main HBV RNAi triggers are small (or short) interfering RNAs (siRNAs) and microRNAs (miRNAs). The HBV RNAi trigger can be selected from the group comprising: siRNA, microRNA, double-stranded RNA (dsRNA), short hairpin RNA (shRNA), and expression cassettes encoding RNAs capable of inducing RNA interference. RNAi triggers contain double-stranded structures that typically contain 15-50 base pairs. In some embodiments, the RNAi trigger comprises a nucleotide sequence of 17-26 base pairs that is identical (completely complementary) or nearly identical (partially complementary) to a coding sequence in a target gene or RNA expressed in a cell share structure. RNAi triggers can have dinucleotide 3' overhangs. The RNAi trigger can consist of two polynucleotides bonded together or a single polynucleotide forming a hairpin structure. RNAi touch The hair contains a sense region and an antisense region. In some embodiments, the RNAi trigger is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense strand of the RNAi trigger and the second fragment comprises the nucleotide sequence of the sense region of the RNAi trigger Nucleotide sequence. In some embodiments, the sense strand is linked to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker. MicroRNAs (miRNAs) are small non-coding RNA gene products approximately 22 nucleotides in length that directly disrupt or translationally inhibit their mRNA targets. If the complementarity between the miRNA and the target mRNA is partial, translation of the target mRNA is inhibited. If complementation is exhaustive, the target mRNA is cleaved. For miRNA, the complex binds to a target site that is usually located in the 3'UTR of the mRNA and usually shares only partial homology with the microRNA. The "seed region," ie, an extension of approximately seven (7) contiguous nucleotides that form complete base pairing with its target at the 5' end of the miRNA, plays a key role in miRNA specificity. Binding of the RISC/miRNA complex to mRNA can lead to inhibition of protein translation or cleavage and degradation of mRNA. Recent data indicate that mRNA is preferentially cleaved if there is complete homology along the entire length of the miRNA and its target rather than displaying complete base pairing only in the seed region (Pillai et al. 2007).

HBV RNAi triggers can be chemically modified. Non-limiting examples of such chemical modifications include: phosphorothioate internucleotide linkages, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluororibonucleotides, 2'- - Incorporation of deoxyribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides and reverse deoxyabasic residues. These chemical modifications, when used in various polynucleotide constructs, were shown to retain polynucleotide activity in cells while simultaneously increasing the serum stability of these compounds. Chemically modified RNAi triggers also minimize the possibility of activating human interferon activity.

The term complementary refers to the ability of a polynucleotide to form hydrogen bonds with another polynucleotide sequence according to conventional Watson-Crick or other non-traditional types. With respect to polynucleotide molecules, the binding free energy of the polynucleotide molecule to its target (effector binding site) or complementary sequence is sufficient to allow the relevant function of the polynucleotide to continue, such as enzymatic mRNA cleavage or Translational inhibition. Determination of the binding free energy of nucleic acid molecules is well known in the art (Frier et al. 1986, Turner et al. 1987). The percent complementarity indicates the percentage of bases (eg, out of 10) in the linked strands of the first polynucleotide molecule that can form hydrogen bonds (eg, Watson-Crick base pairing) with the second polynucleotide sequence 5, 6, 7, 8, 9, 10 are 50%, 60%, 70%, 80%, 90% and 100% complementary). Complete complementarity means that all bases in contiguous strands of a polynucleotide sequence will hydrogen bond to the same number of contiguous bases of a second polynucleotide sequence.

Inhibiting, down-regulating or blocking gene expression means that gene expression, as measured by the amount of RNA transcribed from the gene or the amount of polypeptide, protein or protein subunit translated from the RNA, is reduced below that in the absence of blocking polynuclei Gene expression observed in the case of nucleotide-conjugates. In some embodiments, genes inhibited, down-regulated, or blocked with polynucleotides delivered by the compositions perform less than in the presence of a control inactive nucleic acid (nucleic acid with a missense sequence or a nucleic acid with an inactive mismatch) , or the amount observed in the absence of binding of the polynucleotide to the masked polymer.

In vivo administration

In pharmacology and toxicology, a route of administration is the route by which a drug, fluid, toxin or other substance comes into contact with the body. In general, methods of administering drugs and nucleic acids for the treatment of mammals are well known in the art and are applicable to the administration of such compositions. In some embodiments, the composition may be administered via any suitable route, such as, but not limited to, parenterally, in a formulation suitably adapted for that route. Thus, in some embodiments, the composition may be administered by, for example, intravenous, intramuscular, intradermal, subcutaneous, or intraperitoneal injection. In some embodiments, pharmaceutical compositions comprising pharmaceutically acceptable carriers or excipients are described.

Routes of parenteral administration include intravascular (intravenous, intraarterial), intramuscular, intraparenchymal, intradermal, subdermal, subcutaneous, intratumoral, intraperitoneal, intrathecal, intrathecal using a syringe and needle or catheter Submembranous, epidural and intralymphatic injection. Vascular in this context means Within the tubular structures called vessels that connect to tissues or organs in the body. Within the lumen of the tubular structure, bodily fluids flow to or from the body part. Examples of body fluids include blood, cerebrospinal fluid (CSF), lymph or bile. Examples of vessels include arteries, arterioles, capillaries, venules, sinusoids, veins, lymphatic vessels, bile ducts, and salivary or other exocrine glandular ducts. Intravascular routes include delivery via blood vessels such as arteries or veins. The circulatory system provides systemic distribution of medicines.

In some embodiments, the HBV RNAi trigger-targeting group conjugate is co-administered with the delivery peptide. Co-administration means that the HBV RNAi trigger and the delivery peptide are administered to the mammal such that both are present in the mammal at the same time. The HBV RNAi trigger-targeting group conjugate and delivery peptide can be administered simultaneously or they can be delivered sequentially. For simultaneous administration, it can be mixed prior to administration. For sequential administration, the HBV RNAi trigger-targeting group conjugate or delivery peptide can be administered first.

pharmaceutical composition

In some embodiments, at least one of the HBV RNAi triggers is used in the preparation of a pharmaceutical composition (ie, a medicament) for treating an individual who would benefit from a reduction or suppression of HBV expression. These pharmaceutical compositions are suitable for inhibiting the expression of HBV genes in cells, tissues or organisms. In some embodiments, the pharmaceutical compositions are used to treat individuals suffering from a disease or condition that would benefit from a reduction or suppression of HBV expression.

As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the HBV RNAi triggers and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are substances other than active pharmaceutical ingredients (APIs, therapeutic products, such as RNAi triggers) that have been duly assessed for safety and are intentionally included in drug delivery systems. The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. Excipients can be used to a) aid in processing the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptance of the API, c) aid in product identification, and/or d) during storage or any other attribute that enhances the overall safety, effectiveness of API delivery during use. Pharmaceutically acceptable excipients may or may not be inert substances.

Excipients include (but are not limited to): absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, binders, buffers, carriers, coatings, pigments, delivery enhancers, dextran , dextrose, diluent, disintegrant, emulsifier, bulking agent, filler, flavoring agent, gliding agent, humectant, lubricant, oil, polymer, preservative, physiological saline, salt, solvent , carbohydrates, suspending agents, sustained-release bases, sweeteners, thickeners, tonicity agents, vehicles, water-repellent agents and wetting agents.

The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (eg, antihistamines, diphenhydramine, etc.). It is also envisaged that cells, tissues or isolated organs expressing or comprising an RNAi trigger as defined herein can be used as a "pharmaceutical composition". As used herein, a "pharmacologically effective amount", "therapeutically effective amount" or simply "effective amount" refers to the amount of an RNAi trigger that produces a predetermined pharmacological, therapeutic or prophylactic result.

In some embodiments, the HBV RNAi trigger is combined with one or more additional therapeutic agents including, but not limited to: a second HBV RNAi trigger or other RNAi agents, small molecule drugs, antibodies, antibody fragments and/or vaccine.

The HBV RNAi triggers and pharmaceutical compositions comprising the HBV RNAi triggers disclosed herein can be packaged or included in a kit, container, package or dispenser. HBV RNAi triggers and pharmaceutical compositions comprising such HBV RNAi triggers can be packaged in prefilled syringes or vials.

treatment method

In some embodiments, the HBV RNAi triggers described herein are used to treat individuals infected with HBV. In some embodiments, the HBV RNAi trigger is used to treat at least one symptom in an individual infected with HBV. A therapeutically effective amount of any one or more of the RNAi triggers is administered to the individual.

In some embodiments, HBV RNAi triggers are used to treat or manage an individual infected with clinical manifestations of HBV. The individual is administered a therapeutically effective amount or an effective amount of one or more of the HBV RNAi triggers or HBV RNAi trigger-containing compositions described herein. In some embodiments, the methods comprise administering to an individual to be treated a composition comprising an HBV RNAi triggering molecule described herein.

As used herein, when referring to an HBV gene, the terms "silence", "reduce", "inhibit", "down-regulate" or "block gene expression" mean that when a cell, population of cells or tissue is treated with the HBV RNAi trigger Upon treatment, the expression of the gene is comparable to that of those that have been so treated or have not been The second cell, cell population or tissue so treated is reduced compared to or compared to the same cells, cell population or tissue prior to administration of the HBV RNAi trigger.

In some embodiments, the gene expression and/or mRNA content of the HBV gene in the subject administered the HBV RNAi trigger is reduced relative to the subject prior to administration of the HBV RNAi trigger or the subject not receiving the HBV RNAi trigger At least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%. The amount of gene expression and/or mRNA content of the individual is reduced in cells, cell populations and/or tissues of the individual. In some embodiments, the protein content of HBV in the subject who has been administered the HBV RNAi trigger is reduced by at least about 5%, 10% relative to the subject prior to administration of the HBV RNAi trigger or the subject not receiving the HBV RNAi trigger %, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%. The protein content of the individual is reduced in the individual's cells, cell populations, tissues, blood and/or other bodily fluids. The reduction in gene expression, mRNA or protein content can be assessed by any method known in the art. Reduction or reduction of HBV mRNA content and/or protein content is collectively referred to herein as reduction or reduction of HBV. Low or inhibit or reduce the performance of HBV.

"Introducing into a cell" when referring to an RNAi trigger means functionally delivering the RNAi trigger into the cell. Functional delivery means that the RNAi trigger is delivered to the cell and has the intended biological activity (eg, sequence-specific inhibition of gene expression).

The route of administration is the route by which the RNAi trigger is brought into contact with the body. In general, methods of administering drugs and nucleic acids for the treatment of individuals are well known in the art and can be applied to the administration of the compositions described herein. The compounds described herein can be administered via any suitable route in formulations suitably adapted for a particular route. Thus, the compounds described herein can be administered, for example, by intravenous, intramuscular, intradermal, subcutaneous or intraperitoneal injection.

example

Example 1. MLP synthesis. All MLPs were made using standard peptide synthesis techniques in the art. Suitable MLPs can be all L-amino acids, all D-amino acids (inverso). Regardless of the L or D form, the MLP sequence can be retro.

Example 2. Amino-terminal modification of MLP. Preparation of CKLK-MLP (cysteine-lysine-leucine-lysine-melitin-like peptide, 20 mg/ml), TCEP-HCl in _dH2O ((tris(2-carboxyethyl)phosphine)hydrogen chloride, 28.7mg/ml, 100mM) and MES-Na(2-(N-morpholinyl)ethanesulfonic acid sodium salt, 21.7mg/ml, 100mM) . In a 20 ml scintillation vial, CKLK-MLP (0.030 mmol, 5 ml) was reacted with 1.7 molar equivalents of TCEP-HCl (0.051 mmol, 0.51 ml) and kept stirring at room temperature for 30 minutes. Quantities of MES-Na (2 ml) and water (1.88 ml) were then added to yield a final concentration of 10 mg/ml MLP and 20 mM MES-Na. Check pH and adjust to pH 6.5-7. A solution of NAG-PEG2 _- Br (100 mg/ml) was prepared in _dH2O . NAG- _PEG2 -Br (4.75eq, 0.142mmol, 0.61ml) was added and the solution was kept stirring at room temperature for 48 hours.

Alternatively, in a 20 ml scintillation vial, Cys-MLP (0.006 mmol, 1 ml) was reacted with 1.7 molar equivalents of TCEP-HCl (0.010 mmol, 100 μl) and kept stirring at room temperature for 30 minutes. Quantities of MES-Na (400 μl) and water (390 μl) were added to yield a final concentration of 10 mg/ml MLP and 20 mM MES-Na. Check pH and adjust to pH 6.5-7. A solution of NAG- _PEG8 -maleimide (100 mg/ml) was prepared in _dH2O . NAG- _PEG8 -maleimide (2 eq, 0.012 mmol, 110 μl) was added and the solution was kept stirring at room temperature for 48 hours.

Samples were purified on a Luna 10μ C18 100Å 21.2×250mm column. Buffer A: _H2O 0.1% TFA and buffer B: MeCN, 10% isopropanol, 0.1% TFA. Flow rate 15ml/min, 35% A to 62.5% B in 20 minutes.

Other amino terminal modifications were made in a similar fashion. The carboxy-terminal modification was performed by substituting MLP with carboxy-terminal cysteine for MLP with amino-terminal cysteine.

Compounds for Modified Cys-MLP or MLP-Cys:

n is an integer from 1 to 120 (PEG molecular weight up to about 5 kDa)

Methods typical in the art are used during peptide synthesis to generate on-resin residues with acetyl, dimethyl, stearyl, myristyl and PEG amine or carboxy terminal modifications but no terminal cysteine residues base peptide.

Example 3. Synthesis of masking agent.

A. pH labile masking agent: steric stabilizer CDM-PEG and targeting group CDM-NAG (N-acetylgalactosamine) synthesis. To a solution of CDM (300 mg, 0.16 mmol) in 50 mL dichloromethane To this were added oxalyl chloride (2 g, 10 wt. eq.) and dimethylformamide (5 μl). The reaction was allowed to proceed overnight, after which excess oxalyl chloride and dichloromethane were removed by rotary evaporation to yield CDM acid chloride. The acid chloride was dissolved in 1 mL of dichloromethane. To this solution was added 1.1 molar equivalents of polyethylene glycol monomethyl ether (MW average 550) (for CDM-PEG) or (aminoethoxy)ethoxy-2-(acetamido) )-2-deoxy-β-D-galactopyranoside (i.e. aminobisethoxy-ethyl NAG) (for CDM-NAG) and pyridine (200 μl, 1.5 eq) in 10 mL dichloro Methane. The solution was then stirred for 1.5 hours. The solvent was then removed and the resulting solid was dissolved in 5 mL of water and purified using reverse phase HPLC using a 0.1% TFA water/acetonitrile gradient.

Universal disubstituted maleic anhydride masking agent

R1 contains a neutral ASGPr ligand. In some embodiments, the masking agent is uncharged.

R is methyl or ethyl, and n is an integer from 2 to 100. In some embodiments, the PEG contains There are 5 to 20 ethylidene units (n is an integer from 5 to 20). In some embodiments, the PEG contains 10-14 ethylidene units (n is an integer from 10 to 14). PEGs can be of variable length and have an average length of 5-20 or 10-14 ethylidene units. Alternatively, the PEG may be monodisperse, homogeneous or discrete; precisely having, for example, 11 or 13 ethylidene units.

n is an integer from 1 to 10. As indicated above, a PEG spacer can be located between the anhydride group and the ASGPr ligand. In some embodiments, the PEG spacer contains 1-10 ethylidene units.

Alternatively, an alkyl spacer can be used between the anhydride and N-acetylgalactosamine.

n is an integer from 0 to 6.

Other spacers or linkers can be used between the anhydride and N-acetyl-galactosamine. In some embodiments, hydrophilic spacers or linkers are used. In some embodiments, neutral spacers or linkers are used.

Example 4. Reversible modification/masking of MLP.

A. Modification with maleic anhydride based masking agent. Prior to modification, 5 x mg of disubstituted maleic anhydride masking agent (eg CDM-NAG) was lyophilized from 0.1% aqueous glacial acetic acid. To the dry disubstituted maleic anhydride masking agent was added a solution of x mg MLP in 0.2 x mL isotonic glucose and 10 x mg HEPES free base. After complete dissolution of the anhydride, the solution was incubated at room temperature for at least 30 minutes prior to administration to the animals. Reaction of the disubstituted maleic anhydride masking agent with the peptide yields:

where R is MLP and R1 comprises an ASGPr ligand (eg NAG). The anhydride carboxyl groups produced by the reaction between anhydrides and polymeric amines exhibit -1/20 the expected charge (Rozema et al. Bioconjugate Chemistry 2003). Thus, the membrane-active polymer is effectively neutralized rather than converted into a highly negatively charged polyanion.

In some embodiments, the masked MLP (MLP-(CDM-NAG)) is in a solution containing 125 mg MLP, 500 mg dextran 1K, 3.18 mg sodium carbonate, 588 mg sodium bicarbonate in 5 ml water. In some embodiments, MLP-(CDM-NAG) is lyophilized.

B. Modification with protease-cleavable masking agent. Amine-reactive p-nitrophenyl carbonate or N-hydroxyl at 1-10 mg/mL peptide by addition of 2-6 x mg of NAG-containing protease-cleavable substrate Succinimidyl carbonate derivatives masked 1 x mg of peptide and 10 x mg of HEPES base. The solution was then incubated at room temperature (RT) for at least 1 hour before injection into the animals.

Example 5. HBV RNAi trigger-targeting molecule conjugates.

(1) The RNAi trigger is combined with an alkyl group. The 5'-C10-NHS ester-modified RNAi trigger was prepared using the 5'-carboxy-modifier C10 amino acid ester from Glen Research (Virginia, USA). strand (NHSC10-RNAi trigger or COC9-RNAi trigger). The activated RNA, still attached to the solid support, was used for binding to the lipophilic amines listed in Table 1 below. 100 mg of sense CPG (loaded 60 μmol/g, 0.6 μmol RNA) were mixed with 0.25 mmol of the corresponding amine obtained from Sigma Aldrich Chemie GmbH (Taufkirchen, Germany) or Fluka (Sigma-Aldrich, Buchs, Switzerland).

Table 4. Lipophilic amines used to form hydrophobic group-RNAi trigger conjugates

The mixture was shaken at 40°C for 18 hours. RNA was cleaved from the solid support and deprotected with aqueous ammonium hydroxide ( _NH3 , 33%) at 45°C overnight. The 2'-protecting group was removed with TEA x 3HF for 3.5 hours at 65°C. by RP-HPLC (Resource RPC 3ml, buffer: A: 100mM TEAA/water, B: 100mM TEAA/95% _CH3CN , gradient: 3% B to 70% B in 15CV, except No. 7: in 15CV The crude oligoribonucleotides were purified using a gradient from 3% B to 100% B).

To generate RNAi triggers from RNA single strands, equimolar amounts of complementary sense and antisense strands were mixed in adhesion buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride) and heated at 80°C Cool to room temperature for 3 minutes and over a period of 3-4 hours. RNAi triggers against Factor VII mRNA were characterized by gel electrophoresis.

(2) HBV RNAi trigger conjugated to cholesterol - HBV RNAi trigger-cholesterol conjugates were synthesized using standard methods in the art. Cholesterol can be attached to the 5' or 3' end of the sense or antisense strand of the trigger. In some embodiments, attached to the 5' end of the sense strand of the trigger. Trigger-cholesterol can also be made after trigger synthesis using RNA strands containing reactive groups such as thiol, amine or carboxyl groups using standard methods in the art.

Example 6. In vivo administration of HBV RNAi trigger and delivery to hepatocytes. RNAi trigger and masked MLP were synthesized as described above. Six to eight week old mice (strain C57BL/6 or ICR, ~18-20 g each) were obtained from Harlan Sprague Dawley (Indianapolis IN). Mice were housed for at least 2 days prior to injection. Feeding was ad libitum with Harlan Teklad rodent chow (Harlan, Madison WI). 0.2 mL of delivery peptide solution and 0.2 mL of RNAi trigger conjugate were injected into the tail vein of mice. For simultaneous injection of the delivery peptide and the RNAi trigger, the RNAi trigger-conjugate was added to the modified peptide and the full amount was injected prior to injection. The composition is soluble and non-agglomerative under physiological conditions. The solution was injected into the tail vein by infusion. Modalities of injection into other vessels, such as retro-orbital injection, are presumed to be equally effective.

MLPs with the indicated sequences were reversibly modified with CDM-NAG (5x) as described above. The indicated amounts of MLP were then co-injected with the indicated amounts of ApoB RNAi trigger-cholesterol conjugates. The effect on ApoB content was determined as described above.

Example 7. In vivo reduction of hepatitis B virus (HBV) following delivery of HBV RNAi triggers with MLP delivery peptides.

A) pHBV model mice : On day -42, 6- to 8-week-old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were injected with MC-HBV1.3 in vivo by hydrodynamic tail vein injection Transient transfection (Yang PL et al. "Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection." PNAS USA 2002 Vol. 99 : pp. 13825-13830). MC-HBV1.3 is a plastid-derived microcircle containing the same terminally redundant human hepatitis B virus sequence HBV1.3 (GenBank Accession No. V01460) as in HBV1.3.32 transgenic mice (Guidotti LG et al. "High-level hepatitis B virus replication in transgenic mice. J Virol 1995 Vol. 69, pp. 6158-6169). Ringer's Solution containing 10 μg of MC-HBV1.3 was added to 10% of the animal's body weight. The total volume was injected into mice via the tail vein to generate a pHBV model of chronic HBV infection. The solution was injected via a 27-gauge needle within 5-7 seconds as previously described (Zhang G et al. "High levels of foreign gene expression in hepatocytes"). after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, pp. 1735-1737). On day -21 (three weeks post-transfection), hepatitis B surface antigen (HBsAg) HBsAg expression in serum was measured by ELISA and mice were grouped according to average HBsAg expression.

B) HBV RNAi trigger: Cholesterol-C6-RNAi trigger structure:

AD00009 and AD00010 were synthesized, purified, hybridized (sense and antisense) and combined at a 1:1 molar ratio. The combined RNAi trigger was used for all subsequent procedures.

Hepatitis B virus RNAi triggers are described in US Patent Publication US 2013-0005793 (US Patent 8,809,293), which is incorporated herein by reference.

C) MLP delivery peptide: CDM-NAG was added at 5:1 (w/w) ratio to 250 mM HEPES buffered water containing MLP, SEQ ID NO: 650 (G1L MLP, L-form) at room temperature and incubated for 30 minutes to generate MLP delivery peptides. The reaction mixture was adjusted to pH 9.0 with 4M NaOH. The extent of reaction was analyzed using 2,4,6-trinitrobenzene-sulfonic acid and was determined to be >95%. MLP delivery peptides were purified by tangential flow in 10 mM bicarbonate buffer pH 9.0 supplemented with 10% dextran (w/w). The final purified material was lyophilized.

D) Formation of HBV RNAi trigger delivery composition: 5 mg of lyophilized MLP delivery peptide was resuspended with 1 mL of water. The MLP delivery peptide was then combined with the HBV RNAi trigger at a 1:1 ratio (w/w) (~5.49:1 molar ratio). Isotonic glucose was added as needed to bring the volume of each injection to 200 μl.

In some embodiments, the concentration of the HBV RNAi trigger in the solution is 26 g/L, and the solution also contains 0.069 g/L sodium dihydrogen phosphate monohydrate and 0.071 g/L disodium hydrogen phosphate heptahydrate.

In some embodiments, a 4.8 ml injection solution contains 25.0 g/L HBV RNAi trigger, 25.0 g/L LMLP-(CDM-NAG), 0.066 g/L sodium dihydrogen phosphate monohydrate, 0.068 g/L dihydrogen phosphate dihydrate Sodium heptahydrate, 0.1g/L dextran 1K, 0.318g/L sodium carbonate and 0.588g/L sodium bicarbonate.

E) RNAi trigger delivery: On day 1, each mouse was then given a combination of 2, 4 or 8 mg/kg MLP delivery peptide + HBV RNAi trigger, isotonic glucose or 8 mg/kg MLP delivery peptide via tail vein 200 μl single IV administration.

F) Analysis: Serum HBsAg, serum HBV DNA or liver HBV RNA were measured at various times before and after MLP delivery peptide + HBV RNAi trigger, isotonic glucose or MLP delivery peptide alone administration. HBV expression was normalized to control mice injected with isotonic glucose.

i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot for 20 minutes at ambient temperature. Tubes were centrifuged at 8,000 xg for 3 minutes to separate serum and stored at 4°C.

ii) Serum Hepatitis B Surface Antigen (HBsAg) content: Serum was collected and diluted 10 to 2000-fold in PBS containing 5% skim milk powder. Secondary HBsAg standards diluted in skim milk solution were prepared from serum from ICR mice (Harlan Sprague Dawley) that had been transfected with 10 μg of HBsAg expressing plastid pRc/CMV-HBs (Aldevron, Fargo, ND). HBsAg content was determined using the GS HBsAg EIA 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, WA) as described by the manufacturer. Recombinant HBsAg protein ayw isoform was also diluted in PBS with skim milk and used as a primary standard (Aldevron).

To account for the non-treatment-related decrease in the expression of MC-HBV1.3, the expression of HBsAg in each animal was normalized relative to a control group of mice injected with isotonic glucose. First, the HBsAg content of each animal at a time point was divided by the animal's pre-treatment expression level (on day -1) to determine a "normalized to pre-treatment" expression ratio. Performance at a particular time point was then compared by dividing the "normalized to pre-treatment" ratio of individual animals by the average "normalized to pre-treatment" ratio of all mice in the isotonic glucose control group normalized to the control group.

iii) Serum HBV DNA content: Equal volumes of serum from mice in the panel were pooled into a final volume of 100 μL. DNA was isolated from serum samples using the QIAamp MinElute Virus Spin kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Sterile 0.9% saline was added to each sample to a final volume of 200 μL. Serum samples were added to tubes containing buffer and protease. Carrier RNA is added to aid in the isolation of small amounts of DNA. 1 ng of pHCR/UbC-SEAP plastid DNA (Wooddell CI et al., "Long-term RNA interference from optimized siRNA expression constructs in adult mice." Biochem Biophys Res Commun (2005) 334 , 117-127) was added as a recovery control. After incubation at 56°C for 15 minutes, the nucleic acids were precipitated from the lysate with ethanol and the entire solution was applied to the column. After washing, samples were eluted into buffer AVE in a volume of 50 [mu]L.

The number of copies of the HBV genome in DNA isolated from the serum of the pHBV mouse model was determined by qPCR. A six-log standard curve was formed using the plastid pSEAP-HBV353-777 encoding a short segment of the HBV genome within the S gene (bases 353-777 of Genbank accession V01460). Based on pHCR/UbC-SEAP detection, samples with DNA recovery less than 2 standard deviations from the mean were ignored. Primers based on TaqMan chemistry and probes with fluor/ZEN/IBFQ were used.

HBV primers: 5'-GCCGGACCTGCATGACTA-3' (SEQ IF NO: 740) and 5'-GGTACAGCAACAGGAGGGATACATA-3' (SEQ IF NO: 741)

HBV probe: 6-carboxyluciferin (FAM) labeled reporter: 5'-FAM/CTGCTCAAGGAACCTC-3' (SEQ IF NO: 742)

hHCR (HCR/UbC-SEAP) primer: 5'-CATGCCACCTCCAACATCCACTC-3' (SEQ IF NO: 743)

5-GGCATAGCCACTTACTGACGACTC-3' (SEQ IF NO: 744), hHCR probe 5'-FAM/TTGTCCTGGC/ZEN/GTGGTTTAGGTAGTGTGA/IBFQ-3' (SEQ IF NO: 745)

qPCR analysis was performed on a 7500Fast or StepOne Plus real-time PCR system (Life Technologies). To assess HBV DNA in serum, DNA was isolated from a pooled panel of serum samples by a duplicate purification step. The amount of HBV DNA and recovered control plastids was determined by qPCR reactions performed in triplicate. Probes for quantification of HBV and pHCR/UbC-SEAP were included in each reaction.

iv) HBV RNA analysis : At various times, mice were euthanized and livers were excised and placed in 50-mL conical tubes containing 12 ml of TRI Reagent RT (Molecular Research Center, Inc., Cincinnati, OH). Total RNA was isolated following the manufacturer's recommendations. Briefly, livers in TRI Reagent were homogenized for approximately 30 seconds using a Bio-Gen PRO200 tissue homogenizer (Pro Scientific, Inc., Oxford, CT). 1 ml of homogenate was added to 0.2 ml of chloroform, mixed and the phases were separated by centrifugation. 0.1 ml of the aqueous phase was removed, precipitated with isopropanol and centrifuged. The resulting pellets were washed with 75% ethanol and resuspended in 0.4-0.6 ml of nuclease-free water. Total RNA (50-500 ng) was reverse transcribed using a high capacity cDNA reverse transcription kit (Life Technologies, Grand Island, NY). The cDNA was then diluted 1:50 and 5' exonuclease chemistry was used with forward primer 5'-GCCGGACCTGCATGACTA-3' (SEQ IF NO:746), reverse primer 5'-GGTACAGCAACAGGAGGGATACATA-3' (SEQ IF NO: 747) and a 6-carboxyluciferin (FAM)-labeled reporter 5'-CTGCTCAAGGAACCTC-3' (SEQ IF NO: 748) for the detection of HBV was subjected to multiplex RT-qPCR.

The RT-qPCR probe bound to all HBV RNAs except for the Gene X transcript, which was expressed in barely detectable amounts. Therefore, the probe measures total HBV RNA. Gene expression analysis using HBV, mouse β-actin and gene expression master mix (Life Technologies, Grand Island, NY). Comparative _CT method using relative quantification (Livak KJ et al. "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T))" Method. Methods 2001 Vol. 25, pp. 402-408 p.) Analysis of gene expression data.

Total RNA from each animal was reverse transcribed to generate cDNA. cDNA was analyzed by duplicate qPCR reactions measuring HBV total RNA and endogenous control mouse β-actin mRNA in the same reaction.

△△ C _T = ( CT _target - CT _control ) _sample - ( CT _target - CT _control ) _reference

Relative performance of individuals = GEOMEAN of replicas

及

。 Low range and high range refer to

and

.

v) Quantification of RNAi triggers in tissues: the total leader, total full-length leader and 5' of HBV RNAi triggers AD00009 and AD00010 in liver were measured by fluorescent PNA probe hybridization and HPLC anion exchange chromatography at different times - Content of phosphorylated full-length leader strands. The leader strand is 5'-phosphorylated by endogenous cytoplasmic CLP1 kinase (Weitzer S et al. "The human RNA kinase hCLp1 is active on 3' transfer RNA exons and short interfering RNAs." Nature 2007 Vol. 447, Vol. 222 -227 pages). Fluorescently labeled sequence-specific peptide-nucleic acid (PNA) probes hybridized to the leader strand were added to homogenized liver tissue. Probe-leader hybridization was analyzed by HPLC anion exchange chromatography based on charge-separated guide strands.

Tissue was collected and immediately frozen in liquid nitrogen. While frozen, the tissue samples were comminuted. Dissolve up to 25 mg of frozen powder in 1 mL of diluted Affymetrix lysis solution (one part Affymetrix lysis solution, two parts nuclease-free water) containing 50 μg/ml proteinase K. Samples were sonicated with a microstick sonicator and incubated at 65°C for 30 minutes. If the sample required further dilution, further dilution was performed with Affymetrix lysis solution diluted as described above prior to the hybridization step. Serial dilutions of RNAi trigger substandards were also prepared in the diluted lysis solution.

RNAi trigger substandard: RD74

Sense ( _NH2C6 )CfuGfuAfgGfcAfuAfaAfuUfgGfuAf( _invdT ) (SEQ IF NO: 749)

Antisense pdTAfcCfaAfuUfuAfuGfcCfuAfcAfgdTsdT (SEQ IF NO:750)

RNAi trigger substandard: RD77

Sense ( _NH2C6 )AfcCfuCfuGfcCfuAfaUfcAfuCfuAf( _invdT ) (SEQ IF NO: 751)

Antisense pdTAfgAfuGfaUfuAfgGfcAfgAfgGfudTsdT (SEQ IF NO: 752)

n=2'-O-methyl, Nf=2'-fluoro, dN=deoxyribose, inv=inverse, s=phosphorothioate bond.

SDS was precipitated from standards and samples by adding 10 μl 3M KCl to 100 μl tissue sample solution. After 10 minutes of incubation on ice, samples were centrifuged at 2,700 xg for 15 minutes. The supernatant was used for quantification of RNAi triggers.

Sequence-specific peptide-nucleic acid (PNA) probes containing a fluorescent Atto 425 label at the N-terminus and attached to the PNA strand via two ethylene glycol linkers (OO= _PEG2 ; PNA Bio, Thousand Oaks, CA) were Antisense strands designed to bind to each HBV RNAi trigger.

Peptide-Nucleic Acid (PNA) Probes

For AD00009 Atto425-OO-CTGTAGGCATAAATT (SEQ IF NO: 753)

For AD00010 Atto425-OO-ACCTCTGCCTAATCA (SEQ IF NO: 754)

In a 96-well conical dish, to 55 μl of the diluted serum sample was added 143 μl of nuclease-free water, 11 μl of 200 mM Tris-HCl (pH 8) and 11 μl of 1 μM AD9 or AD10 PNA-probe solution. The pan was sealed and incubated in a thermal cycler at 95°C for 15 minutes. The temperature of the thermal cycler was lowered to 54°C and the samples were incubated for an additional 15 minutes. After incubation, samples were stored at 4°C until they were loaded on an autosampler for HPLC analysis.

HPLC analysis was performed using a Shimadzu HPLC system (Shimadzu Scientific Instruments, Columbia, MD) equipped with an LC-20AT pump, SIL-20AC autosampler, RF-10Axl fluorescence detector, and CTO-20Ac column oven. will come from the hybridization step The 96-well plate was loaded on the autosampler. A 100 μl injection volume was injected onto a DNAPac PA-100 4×250 mm analytical column (#DX043010; Fisher Scientific, Pittsburgh, PA) attached with a 4×50 mm guard column (#DXSP4016; Fisher Scientific, Pittsburgh, PA). The analysis was performed at a column oven temperature of 50°C with a flow rate of 1 ml/min. Gradient elution using mobile phase A (10 mM Tris-HCl (pH 7), 100 mM NaCl, 30% (v/v) acetonitrile) and mobile phase B (10 mM Tris-HCl (pH 7), 900 mM NaCl, 30% (v/v) v) Acetonitrile).

Fluorescence detection was set to excitation at 436 nm and emission at 484 nm, with medium gain set to 4. Concentrations of analytes eluted in the range of 7-10 minutes were calculated using a 12-point external standard calibration curve. Calibration curves were generated using PNA hybridized full-length phosphorylated RNAi triggers RD74 and RD77.

iv) Clinical chemistry: Clinical chemistry markers in mouse serum were measured using a COBAS Integra 400 (Roche Diagnostics, Indianapolis, IN) chemistry analyzer according to the manufacturer's instructions.

G) In vivo hepatitis B virus (HBV) blockade :

HBV DNA : Mice treated with 8 mg/kg MLP delivery peptide + HBV RNAi trigger developed maximal HBV DNA blockade on days 8 and 15. Total HBV DNA in serum was reduced 294-fold and 345-fold, respectively. At day 29, HBV DNA in mouse serum was still 13.5-fold lower than in untreated control mice. Mice treated with 4 mg/kg and 2 mg/kg MLP delivery peptide + HBV RNAi trigger, respectively, had a 91.8-fold and 6.5-fold reduction in total HBV DNA on day 8.

HBsAg in serum : Mice treated with 8 mg/kg MLP delivery peptide + HBV RNAi trigger showed maximal blockade on days 8 and 15. HBsAg in serum was reduced by 270-fold and 139-fold, respectively. On day 29, HBsAg in serum was 7.3-fold lower than in untreated control mice. Mice treated with 4 mg/kg and 2 mg/kg MLP delivery peptide + HBV RNAi trigger, respectively, had a 71.4-fold and 5.4-fold reduction in HBsAg in serum on day 8.

The duration of action of a single 8 mg/kg dose was at least 28 days. By day 22, HBsAg and HBV DNA were reduced by more than 95%. HBV DNA and HBsAg levels in the serum of mice injected with the MLP delivery peptide (without HBV RNAi trigger) remained comparable to mice that received a single injection of isotonic glucose (Table 7).

HBV RNA in liver : Mice treated with 8 mg/kg MLP delivery peptide + HBV RNAi trigger showed maximum blockade on day 8. Total HBV RNA in the liver was reduced by an average of 12.5-fold. On day 29, the total HBV RNA in the liver was 3.4-fold lower than the mean of the untreated control group. Mice treated with 4 mg/kg and 2 mg/kg MLP delivery peptide + HBV RNAi trigger, respectively, had a 5.8-fold and 1.6-fold reduction in total HBV DNA on day 8 (Table 7).

Quantification of RNAi triggers in tissues: Injection of 8 mg/kg MLP delivery peptide + HBV RNAi triggers into pHBV model mice produced approximately 80 ng/g HBV RNAi triggers in the cytoplasm of hepatocytes on day 8, as shown by approx. Demonstrated by 5' phosphorylation of 40 ng/g each of the full length AD00009 and AD00010 leader strands. The resulting pharmacokinetic effect on day 8 was a 93% blockade of total HBV RNA and a greater than 99% reduction in HBsAg and HBV DNA in serum. On day 22, almost all guide strands in the liver were 5' phosphorylated and full length (Table 7).

Clinical Chemistry : Liver and kidney function were assessed on day -1 (pre-injection) and day 2 (24 hours post-injection). There was no MLP delivery peptide + HBV RNAi trigger related changes in clinical chemistry, nor was there any evidence of toxicity with MLP delivery peptide + HBV RNAi trigger or MLP delivery peptide administration alone.

Example 8. Antiviral efficacy of RNAi in chronic HBV infection in chimpanzees. Administered by IV infusion to a single chimpanzee chronically infected with HBV genotype B (chimpanzee 4x0139; genotype B; viral load ~7 x ¹⁰⁹ GE/ml, 51.3-51.5 kg) MLP delivery peptide + HBV RNAi trigger (AD00009 and AD00010). Viral HBV DNA titers in this animal for the 2 years prior to this experiment ranged from ^4x109 to ^1.3x1010 genome equivalents/ml (baseline value for this study). Blood samples were taken at health check (day -7) and again just before dosing to serve as baseline samples (day 1). Health checks include physical examination, CBC and full blood chemistry. 2 mg/kg MLP delivery peptide + HBV RNAi trigger (20.6 ml 5 mg/ml MLP delivery peptide) was administered by IV push on day 1 over 3 minutes. 3 mg/kg MLP delivery peptide + HBV RNAi trigger (30.9 ml 5 mg/ml MLP delivery peptide) was administered by IV push on day 15 over 3 minutes. Blood samples were obtained on days 4, 8, 11, 15, 22, 29, 36, 43, 57, 64, 71, 78 and 85. Liver biopsies were obtained three times at health check, 29 days and 57 days. Animals were sedated for all procedures. Sedation was achieved by intramuscular administration of Telazol ^™ (2 mg/kg) and xylazine (100 mg) as fixatives for bleeding and dosing. At the end of the procedure, Yohimbine was used as a reversal agent for xylazine.

Analysis of Serum and Liver HBV DNA. HBV DNA levels in serum and liver biopsy samples (baseline and on days 29 and 57) were determined using TaqMan assays targeting core and X regions. Both assays should detect all genomes. DNA was purified from 100 μl serum or homogenized liver tissue using the Qiagen QiaAmp DNA Mini Kit (Cat. No. 51304) according to the manufacturer's protocol. DNA samples were analyzed by real-time PCR using TaqMan technology and primers and probes designed for the HBV core gene.

Forward primer, HBV core F 5' CGAGGCAGGTCCCCTAGAAG 3' (SEQ ID NO: 755); reverse primer, HBV core R 5' TGCGACGCGGYGATTG 3' (SEQ ID NO: 756); probe, HBV core probe 5' 6 -FAM/AGAACTCCCTCGCCTCGCAGACG-6-TAM 3' (SEQ ID NO: 757).

Liver DNA and RNA were also analyzed using primers and probes designed for the HBV X gene. Forward primer, HBV X F-CCGTCTGTGCCTTCTCATCTG (SEQ ID NO: 758)

Reverse primer, HBV X R-AGTCCAAGAGTYCTCTTATGYAAGACCTT (SEQ ID NO: 759)

Probe, HBV X 5' 6-FAM/CCGTGTGCACTTCGCTTCACCTCTGC-6-TAM 3' (SEQ ID NO: 760)

Standard curves ranging from 10 Ge to one million GE for each TaqMan assay were generated using plastids containing HBV DNA inserts. Samples were analyzed in TaqMan assays using an ABI 7500 sequence detector using the following cycle parameters: 50°C, 2 min/95°C, 10 min/45 cycles of 95°C, 15 sec/60°C, 1 min.

On day 29, liver HBV DNA levels were reduced 2.4-fold (core region PCR analysis) and 2.7-fold (X region PCR analysis) compared to baseline levels.

Serum HBV DNA levels dropped rapidly after the first dose, dropping 17-fold on day 4. Levels increased from 18.8-fold below baseline to 6.7-fold below baseline between days 8-15. exist Following the second dose on day 15, a decrease in viral DNA was observed, reaching a 35.9-fold decrease from baseline on day 22.

Serum HBsAg and HBeAg Analysis. HBsAg levels were determined using an ELISA kit from BioRad (GS HBsAg EIA 3.0). Quantification of surface antigen was determined by comparing OD to known surface antigen standards. HBeAg quantification was determined for all bleeds using an ELISA kit (ETI-EBK Plus) from DiaSorin.

HBsAg levels were significantly reduced, from a baseline level of 824 μg/ml to 151 μg/ml on day 29. By day 4 after the first dose of ARC 520, the values had decreased significantly (18% compared to baseline values). The equivalence continued to decline, to 53% (2.1-fold) of baseline by day 15, and reached a maximum decrease of 81% (5.2-fold) on day 29.

HBeAg serum levels were 136 ng/ml at baseline and dropped to 12.5 ng/ml (10.9-fold) on day 4 after the first injection of ARC 520. Levels rose to 46 ng/ml on day 15 (2.9-fold lower than baseline). After the second injection, the level dropped again to 28 ng/ml on day 22.

RT-PCR analysis of cytokines and chemokines. Determination of transcription of ISG15, CXCL11 (I-TAC), CXCL10 (IP-10), CXCL9 (Mig), interferon gamma (IFNγ) and GAPDH by quantitative RT-PCR substance content. Briefly, 200 ng of total cells from liver were analyzed by qRT-PCR analysis using primers and probes from ABI Assays-on-Demand ^™ and an ABI 7500 TaqMan Sequence Analyzer (Applied Biosystems/Ambion, Austin, TX). RNA. qRT-PCR was performed using reagents from the RNA UltraSense ^™ One-Step Quantitative RT-PCR System (Invitrogen Corporation, Carlsbad, CA) and the following cycle settings: 48°C, 30 minutes; 95°C, 10 minutes; and 95°C, 15 seconds; and 60°C, 1 minute, the latter two cycles 45 times. Liver biopsies were immediately placed in RNAlater® Stabilizing Reagent and processed as described by the manufacturer and RNA was extracted using RNA-Bee (Tel-Test, Inc Friendswood, TX) for total cellular RNA. Note that these genes were not substantially induced.

Cytokines and Chemokines Luminex Assays . Cytokines and Chemokines were performed using the Luminex 100 with the xMAP (Multiple Analyte Platform) system using the 39-plex Human Cytokine/Chemokine Kit (Millipore; Billerica, MA). monitoring. Standard dilutions of each cytokine were evaluated in each assay. Standard dilutions of each cytokine were evaluated in each run to provide quantification. Serum samples were assessed for the following cytokines/chemokines using the luminex method: EGF, Eotaxin, FGF-2, Flt-3 ligand, Fractalkine (CX3CL1), G- CSF, GM-CSF, GRO, IFNα2, IFNγ, IL-10, IL-12p40, IL-12p70, IL-13, IL-15, IL-17, IL-1α, IL-1β, IL-1 receptor antagonism IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, MCP-1 (CCL2), MCP-3 (CCL7 ), MDC (CCL22), MIP-1α (CCL3), MIP-1β (CCL4), sCD40L, sIL-2 receptor antagonist, TGFα, TNFα, TNFβ, VEGF. Similar to liver transcripts, substantially no changes in chemokines and cytokines were observed during therapy.

Clinicopathology. Blood chemistry was determined using a Unicel DxC 600 analyzer (Beckman Coulter, Inc., and Diagnostic Chemicals Ltd, Oxford, CT, USA). All blood chemistries have the following measurements: Na, K, Cl, Ca, _CO2 , phosphate, ALT, AST, GGT, LDH, direct bilirubin, total bilirubin, alkaline phosphatase, BUN, creatine, Creatine kinase, glucose, total protein, albumin, cholesterol, triglycerides. Values from uninfected animals from the same colony were used to determine normal ranges. Liver biopsies were obtained from anesthetized animals by standard procedures. Biopsy material was immediately divided into sections for histopathology and DNA and RNA analysis. Histopathological sections were processed to fix in 10% formalin in PBS, paraffin embedded and stained with hematoxylin and eosin. Sections for DNA analysis were snap frozen. Place sections for RNA analysis in RNAlater® Stabilizing Reagent.

Immunohistochemical staining of liver. Liver biopsies were fixed in buffered formalin, embedded in paraffin and sectioned at 4 microns. Sections were deparaffinized twice for 5 minutes in EZ-DeWax (BioGenex; HK 585-5K) and rinsed with water. Antigen retrieval was performed in citrate buffer (antigen retrieval solution; BioGenex; HK 086-9K) in a microwave autoclave for 15 minutes at 1000 watts and 15 minutes at 300 watts. Chilled sections were rinsed with water and PBS and treated sequentially with peroxidase inhibitor, universal module and avidin (all reagents from Pierce 36000 Immunotissue Peroxidase Detection Kit). Sections were sequentially incubated at room temperature for 1 hr with primary antibody diluted in universal blocking agent containing biotin blocking agent for 0.5 hr with biotin-labeled goat anti-mouse IgG and with avidin- Biotin complex (ABC) was incubated for 0.5 hours. Sections were developed with Immpact Nova Red peroxidase substrate (Vector, SK-4805; Burlingame CA), counterstained with Mayers (Lillie's) hematoxylin (DAKO, S3309), dehydrated and mounted in non-aqueous mounting medium ( Vector, VectaMount; H-5000). Rabbit anti-HBV cores were prepared from purified core particles expressed in baculovirus.

The majority of hepatocytes were positive for HBV core antigen, with strong staining of the cytoplasm and slightly staining of the nucleus. Decreased staining on day 29 was considered significant.

Example 9. Hepatitis B virus (HBV) reduction in vivo in a transgenic mouse model following delivery of HBV RNAi triggers using MLP delivery peptides.

A) Transgenic HBV model mice : Transgenic HBV1.3.32 mice contain a single 1.3 genome-length ayw virus strain (Genbank accession number V01460) with terminal redundancy integrated into mouse chromosomal DNA. copy. High-level hepatitis B virus replication in transgenic mice occurs in the liver of these mice (Guidotti LG et al. "High-level hepatitis B virus replication in transgenic mice." J Virol 1995 Vol. 69, pp. 6158-6169).

Mice were selected for the study based on HBeAg content in post-weaning serum. Mice were grouped so that the average HBeAg content in each group was similar. Student's t-test was used to ensure that there were no significant differences between either groups relative to the control siLuc group.

The MLP delivery peptide HBV RNAi trigger delivery composition (MLP delivery peptide + HBV RNAi trigger was prepared as described. AD00009, AD00010, RNAi trigger substandard RD74 and RNAi trigger substandard RD77 were prepared as described.

siLuc (firefly luciferase RNAi trigger)

Sensed stock Chol-uAuCfuUfaCfgCfuGfaGfuAfcUfuCfgAf(invdT) (SEQ ID NO: 761)

Antisense UfsCfgAfaGfuAfcUfcAfgCfgUfaAfgdTsdT (SEQ ID NO: 762)

B) HBV RNAi trigger delivery: 1.8-7.7 month old female HBV1.3.32 mice received a single IV injection on day 1 of 200 μl per 20 g body weight of 3 mg/kg or 6 mg/kg MLP delivery peptide + HBV RNAi trigger to the orbit in the posterior sinus. Control mice were injected with isotonic glucose or 6 mg/kg MLP to deliver the peptide + siLuc.

Serum collection: Mice were briefly anesthetized with 50% CO ₂ and blood samples were collected from the retro-orbital sinus using heparinized Natelson micro blood collection tubes (#02-668-10, Fisher Scientific, Pittsburgh, PA). Blood was transferred to a microcentrifuge tube and kept at ambient temperature for 60-120 minutes during collection. The samples were then centrifuged at 14,000 rpm for 10 minutes to separate the serum, which was then stored at -20°C.

C) HBcAg blockade: Qualitative assessment of HBV core antigen (HBcAg) distribution in the cytoplasm of hepatocytes by immunohistochemical staining of liver sections following MLP delivery peptide-mediated delivery of the HBV RNAi trigger. The presence of cytoplasmic HBcAg indicates that the protein is being efficiently expressed. Tissue samples were fixed in 10% zinc-buffered formalin, embedded in paraffin, sectioned (3 μm) and stained with hematoxylin (Chisari FV et al. "Expression of hepatitis B virus large envelope polypeptide inhibits hepatitis B surface antigen secretion in transgenic mice." J Virol 1986 Vol. 60, pp. 880-887). The intracellular distribution of HBcAg was assessed by a labeled avidin-biotin detection procedure (Guidotti LG et al. "Hepatitis B virus nucleocapsid particles do not cross the hepatocyte nuclear membrane in transgenic mice." J Virol 1994 p. 68 Vol, 5469-5475). Paraffin-embedded sections in PBS pH 7.4 were treated with 3% hydrogen peroxide for 10 minutes at 37°C and washed with PBS. After blocking sections with normal goat serum for 30 minutes at room temperature, rabbit anti-HBcAg (Dako North America, Inc., Carpinteria, CA) primary antiserum was administered at a 1:100 dilution for 60 minutes at 37°C. After washing with PBS, a 1:100 dilution of biotin-conjugated goat anti-rabbit immunoglobulin GF(ab9)2 (Sigma-Aldrich Co. LLC., St. Louis, MO) was administered at 37°C Secondary antiserum for 30 minutes. Antibody-coated sections were washed with PBS and treated with streptavidin-horseradish peroxidase conjugate (ExtrAvidin; Sigma-Aldrich Co. LLC., St. Louis, MO at a 1:600 dilution at 37°C). ) for 30 minutes, stained with 3-amino-9-ethylcarbazole (AEC; Shandon-Lipshaw, Pittsburgh, PA) and contrast stained with Mayer's hematoxylin, followed by mounting. The content and distribution of HBcAg in hepatocytes were assessed visually. On days 15 and 29 after injection of 6 mg/kg MLP delivery peptide + HBV RNAi trigger, cytoplasmic HBcAg was greatly reduced relative to nuclear HBcAg, indicating blocking of HBcAg expression.

D) HBeAg blockade: The effect of MLP delivery peptide-mediated HBV RNAi trigger delivery on HBV e antigen (HBeAg) was determined by ELISA. Serum was collected from mice on day -1 before injection, 6 hours after injection, and on days 3, 8, 15, 22 and 29. HBeAg analysis was performed using 2 μl of mouse serum using HBe enzyme-linked immunosorbent assay (ELISA) as described by the manufacturer (Epitope Diagnostics, San Diego, CA). Antigen content was determined in the linear range of the assay. The HBeAg levels of each animal at each time point were normalized to the pre-dose level on day -1. MLP delivery peptide + HBV RNAi trigger treatment group was compared with isotonic glucose group or siLuc group, respectively. Changes in HBeAg performance from day 3 to day 8 were assessed using paired t-tests.

For both doses, HBeAg levels were reduced by 85-88% (7-8 fold) on day 3 and approximately 71-73% on day 8. Animals treated with 6 mg/kg melittin delivery peptide + HBV RNAi trigger still had a -66% reduction in HBeAg on day 29. These transgenic mice are known to produce HBeAg in their kidneys. The level of circulating HBeAg originating from the kidneys is unknown.

E) HBV RNA blockade: HBV produces at least 6 mRNA species with lengths: 3.5 kilobases (kb) (2 types), 2.4 kb, 2.1 kb (2 types) and 0.7 kb. A 3.5kb mRNA encodes HBeAg. HBeAg is a secreted protein. Another 3.5kb mRNA is pregenomic RNA (pgRNA), which is translated to produce core protein (HBcAg) and polymerase. The pgRNA is reverse transcribed to generate virion DNA. The HBcAg protein monomers assemble to form the capsid surrounding the virion DNA. The 2.4kb and 2.1kb mRNAs encode the envelope (S) protein, also known as the S antigen (HBsAg). The HBsAg protein forms an envelope around the viral capsid (HBsAg was not measured because the transgene HBV1.3.32 produced antibodies against this protein.). The 0.7kb mRNA encodes the X protein and is generally not detectable in transgenic mice.

After mice were sacrificed, liver tissue was frozen in liquid nitrogen and stored at -70°C, followed by extraction of total RNA. RNA was isolated and the content of HBV transcripts was assessed and quantified by northern blotting and by quantitative real-time PCR (RT-qPCR) relative to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Northern analysis. RNA (northern) filter hybridization analysis was performed using 10 μg of total cellular RNA. The filters were probed ^with32P -labeled HBV (strain ayw ) genomic DNA to detect HBV sequences and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA to detect HBV used as an internal control. GAPDH transcript. The radioactive hybridization signals corresponding to the 3.5 kb HBV RNA and 2.1 kb RNA bands in the northern blots were normalized to the signal corresponding to the GAPDH mRNA band in the same animal. The 2.1 kb HBV RNA:GAPDH ratio for each animal was divided by the mean of this ratio in the combined control group, which consisted of 4 animals injected with isotonic glucose, to determine treatment-specific changes in 2.1 kb HBV RNA. and 4 mice treated with MLP delivery peptide + siLuc. 3.5kb HBV RNA was analyzed by the same method. In both cases, the error is shown as the standard deviation of the ratio. Statistical significance was determined by Student's two-tailed t-test. Results of RNA filter hybridization (northern blots) analysis of total cellular RNA from liver tissue are shown in Table 11. MLP delivery peptide + HBV RNAi trigger treatment reduced viral RNA content in liver. No effect on viral RNA content in the liver was observed in animals treated with isotonic glucose or MLP delivery peptide + siLuc.

Table 11. Transgenic genes after single dose MLP delivery peptide + HBV RNAi trigger treatment

^a The means of the treatment groups were compared against the combined means of the control group using a two-tailed unpaired t-test.

^b HBV RNA content normalized to the combined mean of the control group.

^a The means of the treatment groups were compared against the combined means of the control group using a two-tailed unpaired t-test.

^b HBV RNA content normalized to the combined mean of the control group.

RT-qPCR analysis. Quantitative PCR (RT-qPCR) followed by a reverse transcription step was used to measure the content of GAPDH and HBV 3.5kb transcript in HBV1.3.32 mouse liver RNA. After DNase I treatment, 1 μg of RNA was used for cDNA synthesis using TaqMan reverse transcription reagents (Life Technologies, Grand Island, NY), followed by qPCR quantification using SYBR Green and an Applied Biosystems 7300 real-time PCR system. Thermal cycling consisted of an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of denaturation (15 seconds at 95°C) and adhesion/extension (1 minute at 60°C). Relative HBV 3.5 kb RNA expression was estimated using the comparative CT (ΔCT) method, normalized to mouse GAPDH RNA. The PCR primers used were 5'-GCCCCTATCCTATCAACACTTCCGG-3' (SEQ ID NO: 763) (HBV 3.5kb RNA sense primer, coordinates 2,311 to 2,335), 5'-TTCGTCTGCGAGGCGAGGGA-3' (SEQ ID NO: 764) (HBV 3.5kb RNA antisense primer, coordinates 2401 to 2382), 5'-TCTGGAAAGCTGTGGCGTG-3' (SEQ ID NO:765) (mouse GAPDH sense primer) and 5'-CCAGTGAGCTTCCCGTTCAG-3' (SEQ ID NO:766) (mouse GAPDH antisense primer).

^a The means of the treatment groups were compared against the combined means of the control group using a two-tailed unpaired t-test.

^b HBV RNA content normalized to the combined mean of the control group.

F) HBV DNA replication intermediate block: After mice were sacrificed, liver tissue was frozen in liquid nitrogen and stored at -70°C prior to DNA extraction. DNA was isolated from liver and HBV replication intermediates were assessed by Southern blotting and quantified relative to the transgenic gene. Southern blot analysis of 20 μg of HindIII-digested total cellular DNA was performed ^using32P -labeled HBV (strain ayw ) genomic DNA. Relative content of HBV replication intermediates, relaxed circular DNA (HBV RC DNA) and single-stranded DNA (HBV SS DNA) relative to the content of HBV transgene (HBV transgene DNA) in the same animal after quantification by phosphorimager Normalized. The combined HBV RC and SS DNA:HBV Tg DNA signal for each animal was divided by the mean of this ratio in the combined control group, which was injected with 4 animals, to determine the treatment-specific changes in replication intermediates. It consisted of mice on isotonic glucose and 4 mice co-injected with MLP to deliver the peptide and siLuc. Southern blot analysis indicated that all groups treated with MLP delivery peptide + HBV RNAi trigger had reduced levels of HBV replication intermediates (Tables 14-16). Four weeks after a single injection of 6 mg/kg MLP delivery peptide + HBV RNAi trigger, HBV DNA replication intermediates remained largely inhibited. Replication intermediates were reduced by 98-99% (64-74-fold) at one and two weeks and 97% (29-fold) at four weeks.

G) Quantification of HBV RNAi trigger in liver: Quantification of the amount of HBV RNAi trigger leader in the liver of MLP delivery peptide + HBV RNAi trigger treated mice by hybridization with the fluorescent peptide nucleic acid (PNA) probe . The PNA hybridization method allowed quantification of the total amount of leader strand per weight of tissue, including metabolites of AD00009 and AD00010 (total, total full length, 5' phosphorylated full length and non-phosphorylated full length). The presence of the full-length 5' phosphorylated guide strand indicates efficient delivery of the RNAi trigger to the target cell cytoplasm.

H) Clinical chemistry: Serum for clinical chemistry and cytokine assessment was collected from each mouse on day -1 before injection and at 6hr and 48 hours after injection. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and Clinical chemical analysis of creatinine. Each assay requires 2-23 μL of serum, depending on the test. Clinical chemistry of all groups of animals was compared by one-way analysis of variance before and after injection. Values of individual groups before and after injection were compared using Bonferroni's Multiple Comparison Test. ALT, AST, BUN, or creatinine did not rise 48 hours after injection (Figures 3-4). Evaluation of a panel of 25 mouse cytokines using the MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel - Premixed 25 Plexus - Immunological Multiplex Assay (Cat. No. MCYTOMAG-70K-PMX, EMD Millipore Corporation, Billerica, MA) : Granulosphere Colony Stimulating Factor (G-CSF), Granulosphere Macrophage Colony Stimulating Factor (GM-CSF), Interferon γ (IFN-γ), Interleukin-1α (IL-1α), Interleukin- 1β (IL-1β), Interleukin-2 (IL-2), Interleukin-4 (IL-4), Interleukin-5 (IL-5), Interleukin-6 (IL-6) , interleukin-7 (IL-7), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-12 subunit p40 (IL-12p40), interleukin-12 Interleukin-12 subunit p70 (IL-12p70), interleukin-13 (IL-13), interleukin-15 (IL-15), interleukin-17 (IL-17), interferon γ-induced Protein-10 (IP-10), keratinocyte-derived cytokine (KC), monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1α (MIP-1α), macrophage Cellular inflammatory protein-1β (MIP-1β), macrophage inflammatory protein-2 (MIP2), factor regulating the expression and secretion of activated normal T cells (RANTES) and tumor necrosis factor alpha (TNF-α). Several cytokines were elevated by the procedure, but did not appear to be associated with MLP delivery peptide + HBV RNAi trigger treatment.

IL-6 levels were elevated in all groups 6 hours after injection. Elevations were higher in mice receiving 3 mg/kg MLP delivered peptide + HBV RNAi trigger and highest in mice receiving 6 mg/kg MLP delivered peptide + HBV RNAi trigger (upper upper limit of normal (up to 170 pg/ml) 8 times higher). On day 3, 48 hours after injection, IL-6 levels returned to normal.

KC levels were elevated at 6 hours, up to 40-fold higher than the upper limit of normal (103 pg/ml), but this elevation was similar in all treatment groups.

IP-10 levels rose less than 2-fold at 6 hours and in some samples at 48 hours. However, it was also elevated in the isotonic glucose control group.

MIP2 was normally undetectable in mouse serum, but increased in all groups after injection (mainly at 6 hours).

Although G-CSF content increased slightly (3-4 times the mean) 6 hours after injection, the group mean remained within the normal range.

TNF-[alpha] and MCP-1 were elevated in all groups at 6 hours, but were still well below the upper limit of normal.

The IL-7 content of one of the 12 mice injected with 6 mg/kg MLP to deliver the peptide + HBV RNAi trigger was approximately 3 times higher than the upper limit of normal at 6 hours: 80 pg/ml.

Assessment of liver or kidney toxicity showed minimal adverse effects. Liver or kidney clinical Chemical markers did not increase relative to pre-injection. Some cytokine elevations were observed prior to dosing and several were elevated due to the procedure and did not appear to be related to MLP delivery peptide + HBV RNAi trigger treatment.

Example 10. Hepatitis B virus (HBV) reduction in vivo following delivery of HBV RNAi triggers with MLP delivery peptides.

pHBV model mice : On day -28, 6- to 8-week-old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were injected with MC-HBV1.3 via hydrodynamic tail vein injection as described. Transient transfection in vivo.

MLP delivery peptide : CDM-NAG was added at 5:1 (w/w) ratio to 250 mM HEPES buffered water containing MLP, SEQ ID NO: 650 (G1L MLP, L-form) at room temperature and incubated for 30 minutes to generate MLP delivers peptides. The reaction mixture was adjusted to pH 9.0 with 4M NaOH. The extent of reaction was analyzed using 2,4,6-trinitrobenzene-sulfonic acid and was determined to be >95%. MLP delivery peptides were purified by tangential flow in 10 mM bicarbonate buffer pH 9.0 supplemented with 10% dextran (w/w). The final purified material was lyophilized.

Formulation of HBV RNAi trigger delivery composition : 5 mg of lyophilized MLP delivery peptide was resuspended with 1 mL of water. The MLP delivery peptides were then combined with various doses of HBV RNAi triggers (AD01385 or AD01386).

RNAi trigger delivery : On day 1, each mouse was administered 200 μl of saline containing MLP delivery peptide + HBV RNAi trigger per 20 grams of body weight via a single IV administration via the tail vein.

Analysis : Serum HBsAg and serum HBV DNA were measured at various time points before and after administration of MLP delivery peptide + HBV RNAi trigger. The serum HBsAg level of each animal at a time point was divided by the animal's pre-treatment level to determine the "normalized to pre-treatment" ratio of serum HBsAg. The serum HBV DNA level in each group at a time point was also divided by the pre-treatment level for that group to determine the "normalized to pre-treatment" ratio of serum HBV DNA. To account for the non-treatment-related decrease in MC-HBV1.3 or pHBV1.3 performance, the "normalized to pre-treatment" ratio of individual animals at one time point was then divided by the saline control group of all mice at Ratios "normalized to pre-treatment" were averaged at a time point to obtain ratios of serum HBsAg or HBV DNA "normalized to pre-treatment and controls".

Serum collection : Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot for 20 minutes at ambient temperature. Tubes were centrifuged at 8,000 xg for 3 minutes to separate serum and stored at 4°C.

Serum hepatitis B surface antigen (HBsAg) and serum HBV DNA levels were measured as described.

The results are also shown in Figure 5, showing almost 2 log blockade at day 8.

Example 11. Hepatitis B virus (HBV) viral protein HBsAg reduction in chronic HBV-infected chimpanzees following delivery of HBV RNAi triggers with MLP delivery peptides.

Chimpanzee: Animal 95A010 is a 19 year old female chimpanzee (date of birth 8/7/1995) exposed to HBV at birth weighing 66 kg. At the start of the study, he was HBeAg negative and anti-HBe positive, and had an HBV DNA titer of 3.7 x ¹⁰³ replicates/ml serum.

HBV RNAi trigger delivery composition was formulated : MLP delivery peptide, vial 1 contained MLP-(CDM-NAG) lyophilized at a concentration of 125 mg in sterile 10 mL glass vials. Active Pharmaceutical Ingredient (API), vial 2, contains an equimolar mixture of AD0009 and AD0010 in liquid form at a concentration of 26 mg/mL total RNAi trigger in 5.3 mL of phosphate buffer in sterile 10 mL glass vials. 4.8 mL of liquid from vial 2 was added to vial 1 and vortexed to dissolve. Regarding the active pharmaceutical ingredient, 5 mL of the resulting solution contained 125 mg/vial at a nominal concentration of 25 mg/mL. Prepare a sufficient number of paired vials for the indicated dose. For dosing at 2 mg/kg MLP delivery peptide + 1 mg/kg AD01385 + 1 mg/kg AD01386, MLP delivery peptide vial 1 was dissolved using a 26 mg/mL solution containing equimolar amounts of AD01385 and AD01386 in phosphate buffer.

RNAi trigger delivery : Chimpanzee 95A010 was infused with 2 mg/kg MLP delivery peptide (formulated as MLP delivery peptide) + 1 mg/kg AD0009 + 1 mg/mL AD0010 at an infusion rate of 10 mg/min for MLP delivery peptide. After HBsAg levels had returned to baseline following ARC-520 treatment, chimpanzee perfusion delivered peptides at 2 mg/kg MLP + 1 mg/kg AD01385 + 1 mg/kg AD01386.

Serum Hepatitis B Surface Antigen (HBsAg) Content : Serum was collected and diluted 104 to ¹⁰⁵ fold in PBS containing ⁵ % skim milk powder. In all other ways, the analysis is performed as described above.

Data : On day 15, HBsAg content was reduced by 50% after injection of 1 mg/kg AD0009 + AD0010 and 81% after injection of 1 mg/kg AD01385 + AD01386, in both cases using 2 mg/kg MLP to deliver the peptide (Fig. 6).

Example 12. Hepatitis B virus (HBV) reduction in vivo.

pHBV model mice : On day -35, 6- to 8-week-old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were transiently transfected with MC-HBV1.3 in vivo by hydrodynamic tail vein injection (Yang PL et al. "Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection." Proc Natl Acad Sci USA 2002 Vol. 99 : pp. 13825-13830). MC-HBV1.3 is a plasmid-derived microcircle containing the same terminally redundant human hepatitis B virus sequence HBV1.3 (GenBank Accession No. V01460) as in HBV1.3.32 transgenic mice (Guidotti LG et al. High-level hepatitis B virus replication in transgenic mice. J Virol 1995 Vol. 69, pp. 6158-6169). Ringer's solution containing 5 μg MC-HBV1.3 was administered via the tail vein in a total volume of 10% of the animal's body weight Injected into mice to generate a pHBV model of chronic HBV infection. The solution was injected via a 27-gauge needle within 5-7 seconds as previously described (Zhang G et al. "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, pp. 1735-1737). On day -7 (four weeks after transfection), hepatitis B surface antigen (HBsAg) HBsAg expression in serum was measured by ELISA and mice were grouped according to mean HBsAg expression.

RNAi trigger delivery : On day 1, each mouse was then given a single subcutaneous dose of 200 μl containing the HBV RNAi trigger and standard saline. The typical sites for injections between the skin and the muscle (ie, subcutaneous injections) are in the loose skin over the neck and shoulder area, but other sites with loose skin folds may also be used.

Analysis : Serum HBsAg, serum HBV DNA or liver HBV RNA were measured at various times before and after administration of HBV RNAi trigger or normal saline. HBV expression was normalized to control mice injected with normal saline.

i) Serum collection : Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot for 20 minutes at ambient temperature. Tubes were centrifuged at 8,000 xg for 3 minutes to separate serum and stored at 4°C.

ii) Serum Hepatitis B Surface Antigen (HBsAg) content : Serum was collected and diluted 10 to 2000-fold in PBS containing 5% skim milk powder. Secondary HBsAg standards diluted in skim milk solution were prepared from serum from ICR mice (Harlan Sprague Dawley) that had been transfected with 10 μg of the HBsAg expression plasmid pRc/CMV-HBs (Aldevron, Fargo, ND). HBsAg content was determined using the GS HBsAg EIA 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, WA) as described by the manufacturer. Recombinant HBsAg protein ayw isoform was also diluted in PBS with skim milk and used as a primary standard (Aldevron).

To account for the non-treatment-related decrease in MC-HBV1.3 expression, HBsAg expression in each animal was normalized relative to a control group of mice injected with standard saline. First, the HBsAg content of each animal at a time point was divided by the animal's pre-treatment expression level (on day -1) to determine a "normalized to pre-treatment" expression ratio. then by Performance at a particular time point relative to controls was calculated by dividing the "normalized to pre-treatment" ratio of individual animals by the average "normalized to pre-treatment" ratio of all mice in the normal saline control group Group normalization.

Example 13. Chromatographic analysis of HBV RNAi triggers. Clinical development requires quantification of active pharmaceutical ingredients (APIs) in pharmaceutical products. When the drug product is a mixture of two APIs, such as with the combination of AD01385 and AD01386, quantification requires clear analytical separation. For oligonucleotide APIs, clear analytical separation is difficult due to the compositional similarity of oligonucleotides of the same length. To facilitate chromatographic separation of the sense strands of the AD01385 and AD01386 mixture, a linker containing six carbons (C6) between cholesterol and oligonucleotide was incorporated in one strand and used in the other strand Triethylene oxide (TEG) linker. These linkers have different hydrophobicities, allowing for chromatographic resolution. The RNAi trigger sense strands were isolated by anion exchange chromatography using a Thermo Scicntific DNAPac PA-200 column using (10 mM NaHCO3 (pH 11.3)/50 mM NaBr/45% ACN): (10 mM NaHCO3 (pH 11.3) Gradient of 70:30 mixture of 11.3)/650 mM NaBr/45% ACN) to 100% 650 mM NaBr solution (see Figures 24-28). The resolution (R _s ) of the peak of the analyzed righteous strands is calculated as follows: R _s =(t _R2 -t _R1 )/((0.5*(w ₁ +w ₂ )) (1)

where t _R1 and t _R2 are the residence times of the two strands, and w ₁ and w ₂ are the peak widths at the baseline. Peaks were considered resolved if R _s >2. We calculated that a mixture of the sense strands and different arrangements of C6 and TEG linkers has the following resolution: TEG:TEG resolution _Rs = 0.44 (unresolved)

C6: C6 resolution R _s = 0.15 (unresolved)

C6: TEG resolution R _s =2.7 (resolved)

RNAi trigger sense strands with the same cholesterol targeting group bond (two C6 or two TEGs) were not resolved. In contrast, we were able to determine the concentration of the sense strand with the TEG and C6 linker from the mixture of the two due to well resolved chromatographic separation. The results shown in Table 23 and Figures 7-11 show that the two HBV RNAi triggers are better resolved when linked by two different linkers.

In some embodiments, the HBV RNAi triggers AD1385 and AD1386 are combined to form a therapeutic RNAi therapeutic for HBV infection.

<110> American Merchant Aero Hyde Madison & Co. Christine I Woodall David B Rozma David L Lewis Darren H Wakefield Lauren J Ametta

<120> RNAi therapy for hepatitis B virus infection

<130> 30635_WO1

<150> 62202253

<151> 2015-08-07

<160> 766

<210> 1

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 1

<210> 2

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 2

<210> 3

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 3

<210> 4

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 4

<210> 5

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-25

<223> Modified base="2'-hydroxynucleoside"

<400> 5

<210> 6

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-25

<223> Modified base="2'-hydroxynucleoside"

<400> 6

<210> 7

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-25

<223> Modified base="2'-hydroxynucleoside"

<400> 7

<210> 8

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 8

<210> 9

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 9

<210> 10

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 10

<210> 11

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 11

<210> 12

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 12

<210> 13

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 13

<210> 14

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 14

<210> 15

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 15

<210> 16

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 16

<210> 17

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 17

<210> 18

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 18

<210> 19

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 19

<210> 20

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 20

<210> 21

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 21

<210> 22

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 22

<210> 23

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 23

<210> 24

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 24

<210> 25

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 25

<210> 26

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 26

<210> 27

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 27

<210> 28

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 28

<210> 29

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2-19

<223> Modified base="2'-hydroxynucleoside"

<400> 29

<210> 30

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 30

<210> 31

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 31

<210> 32

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 32

<210> 33

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 33

<210> 34

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 34

<210> 35

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 35

<210> 36

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 36

<210> 37

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 37

<210> 38

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 38

<210> 39

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 39

<210> 40

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 40

<210> 41

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 41

<210> 42

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 42

<210> 43

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 43

<210> 44

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 44

<210> 45

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 45

<210> 46

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 46

<210> 47

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 47

<210> 48

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 48

<210> 49

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 49

<210> 50

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 50

<210> 51

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 51

<210> 52

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 52

<210> 53

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 53

<210> 54

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 54

<210> 55

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 55

<210> 56

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 56

<210> 57

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 57

<210> 58

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 58

<210> 59

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 59

<210> 60

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 60

<210> 61

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 61

<210> 62

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 62

<210> 63

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 63

<210> 64

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 64

<210> 65

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 65

<210> 66

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 66

<210> 67

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 67

<210> 68

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 68

<210> 69

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 69

<210> 70

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 70

<210> 71

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 71

<210> 72

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 72

<210> 73

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 73

<210> 74

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 74

<210> 75

<211> 23

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 75

<210> 76

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 76

<210> 77

<211> 23

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 77

<210> 78

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 78

<210> 79

<211> 23

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 79

<210> 80

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 80

<210> 81

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 1-15

<223> Modified base="2'-hydroxynucleoside"

<400> 81

<210> 82

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 82

<210> 83

<211> 23

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 83

<210> 84

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 84

<210> 85

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 85

<210> 86

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 86

<210> 87

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 87

<210> 88

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 88

<210> 89

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 89

<210> 90

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 90

<210> 91

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 91

<210> 92

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 92

<210> 93

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 1-15

<223> Modified base="2'-hydroxynucleoside"

<400> 93

<210> 94

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 1-15

<223> Modified base="2'-hydroxynucleoside"

<400> 94

<210> 95

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 95

<210> 96

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 96

<210> 97

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 97

<210> 98

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 98

<210> 99

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 99

<210> 100

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 100

<210> 101

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 101

<210> 102

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<400> 102

<210> 103

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 103

<210> 104

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 104

<210> 105

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 105

<210> 106

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19

<223> Modified base="2'-hydroxynucleoside"

<400> 106

<210> 107

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19

<223> Modified base="2'-hydroxynucleoside"

<400> 107

<210> 108

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19

<223> Modified base="2'-hydroxynucleoside"

<400> 108

<210> 109

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19

<223> Modified base="2'-hydroxynucleoside"

<400> 109

<210> 110

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 110

<210> 111

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 111

<210> 112

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 112

<210> 113

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 113

<210> 114

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 114

<210> 115

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 115

<210> 116

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 116

<210> 117

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 117

<210> 118

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 118

<210> 119

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 119

<210> 120

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 120

<210> 121

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 121

<210> 122

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 122

<210> 123

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 123

<210> 124

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 124

<210> 125

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 125

<210> 126

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 126

<210> 127

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 127

<210> 128

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 128

<210> 129

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 129

<210> 130

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 130

<210> 131

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 131

<210> 132

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-22

<223> Modified base="2'-hydroxynucleoside"

<400> 132

<210> 133

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 133

<210> 134

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 134

<210> 135

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 135

<210> 136

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 136

<210> 137

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 137

<210> 138

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 138

<210> 139

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 139

<210> 140

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 140

<210> 141

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 141

<210> 142

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 142

<210> 143

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 143

<210> 144

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 144

<210> 145

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 145

<210> 146

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 146

<210> 147

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 147

<210> 148

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 148

<210> 149

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 149

<210> 150

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 150

<210> 151

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 151

<210> 152

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 152

<210> 153

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 153

<210> 154

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 154

<210> 155

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 155

<210> 156

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 156

<210> 157

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 157

<210> 158

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 158

<210> 159

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 159

<210> 160

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 160

<210> 161

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 161

<210> 162

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 162

<210> 163

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 163

<210> 164

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 164

<210> 165

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 165

<210> 166

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 166

<210> 167

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 167

<210> 168

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 168

<210> 169

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 169

<210> 170

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 170

<210> 171

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 171

<210> 172

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 172

<210> 173

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 173

<210> 174

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 174

<210> 175

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 175

<210> 176

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 176

<210> 177

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 177

<210> 178

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 178

<210> 179

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 179

<210> 180

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 180

<210> 181

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 181

<210> 182

<211> 19

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 182

<210> 183

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19,21

<223> Modified base="2'-hydroxynucleoside"

<400> 183

<210> 184

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 184

<210> 185

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 185

<210> 186

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 186

<210> 187

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-24,26

<223> Modified base="2'-hydroxynucleoside"

<400> 187

<210> 188

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-25

<223> Modified base="2'-hydroxynucleoside"

<400> 188

<210> 189

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-24

<223> Modified base="2'-hydroxynucleoside"

<400> 189

<210> 190

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 190

<210> 191

<211> 26

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 191

<210> 192

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-24,26

<223> Modified base="2'-hydroxynucleoside"

<400> 192

<210> 193

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-18

<223> Modified base="2'-hydroxynucleoside"

<400> 193

<210> 194

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-18

<223> Modified base="2'-hydroxynucleoside"

<400> 194

<210> 195

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-18

<223> Modified base="2'-hydroxynucleoside"

<400> 195

<210> 196

<211> 22

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 196

<210> 197

<211> 22

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 197

<210> 198

<211> 21

<212> RNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<400> 198

<210> 199

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19,21

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 199

<210> 200

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 200

<210> 201

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 201

<210> 202

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 202

<210> 203

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-20

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 203

<210> 204

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 204

<210> 205

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 205

<210> 206

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1-19

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 206

<210> 207

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 207

<210> 208

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 208

<210> 209

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 22

<223> Modified base = "Abasic site"

<400> 209

<210> 210

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 210

<210> 211

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 211

<210> 212

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 212

<210> 213

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 213

<210> 214

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 214

<210> 215

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 215

<210> 216

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 216

<210> 217

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 217

<210> 218

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 218

<210> 219

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 219

<210> 220

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 220

<210> 221

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 221

<210> 222

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 222

<210> 223

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 223

<210> 224

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 224

<210> 225

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 225

<210> 226

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 226

<210> 227

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 227

<210> 228

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 228

<210> 229

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 229

<210> 230

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 230

<210> 231

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 231

<210> 232

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 232

<210> 233

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 6

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 233

<210> 234

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 234

<210> 235

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 7

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 235

<210> 236

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15.17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 236

<210> 237

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 237

<210> 238

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 238

<210> 239

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 239

<210> 240

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 240

<210> 241

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 241

<210> 242

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 242

<210> 243

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 243

<210> 244

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 244

<210> 245

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 245

<210> 246

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 246

<210> 247

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 247

<210> 248

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 248

<210> 249

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 249

<210> 250

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 250

<210> 251

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 251

<210> 252

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 252

<210> 253

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 253

<210> 254

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 254

<210> 255

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 255

<210> 256

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 256

<210> 257

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 257

<210> 258

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 258

<210> 259

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,16,18,20,23,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,14,15,17,19,21,22,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 259

<210> 260

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 260

<210> 261

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 261

<210> 262

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 262

<210> 263

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 263

<210> 264

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 264

<210> 265

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 265

<210> 266

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,12,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "phosphate-modified nucleoside"

<400> 266

<210> 267

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 267

<210> 268

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 268

<210> 269

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 269

<210> 270

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 270

<210> 271

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 271

<210> 272

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 272

<210> 273

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 273

<210> 274

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 274

<210> 275

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 275

<210> 276

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 276

<210> 277

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 277

<210> 278

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 278

<210> 279

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 279

<210> 280

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 280

<210> 281

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 281

<210> 282

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 282

<210> 283

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 283

<210> 284

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 284

<210> 285

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 285

<210> 286

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 286

<210> 287

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 287

<210> 288

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 288

<210> 289

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,13,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,15,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 289

<210> 290

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,15,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,16,17,19,21,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 290

<210> 291

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 291

<210> 292

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 292

<210> 293

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 293

<210> 294

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 294

<210> 295

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 295

<210> 296

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 296

<210> 297

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 297

<210> 298

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 298

<210> 299

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 299

<210> 300

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 300

<210> 301

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 301

<210> 302

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 302

<210> 303

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 303

<210> 304

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 304

<210> 305

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 305

<210> 306

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223>

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 306

<210> 307

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 307

<210> 308

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 308

<210> 309

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 309

<210> 310

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 310

<210> 311

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 311

<210> 312

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 312

<210> 313

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 313

<210> 314

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 314

<210> 315

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 315

<210> 316

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,8,10,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,6,7,9,11,12,13,15,16,17,18,19,20,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 316

<210> 317

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 317

<210> 318

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 25

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 318

<210> 319

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "phosphate-modified nucleoside"

<400> 319

<210> 320

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 320

<210> 321

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 321

<210> 322

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 322

<210> 323

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 323

<210> 324

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 324

<210> 325

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 325

<210> 326

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 326

<210> 327

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 327

<210> 328

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 328

<210> 329

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 329

<210> 330

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 330

<210> 331

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 331

<210> 332

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 332

<210> 333

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 333

<210> 334

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 334

<210> 335

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 335

<210> 336

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 336

<210> 337

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 337

<210> 338

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 338

<210> 339

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 339

<210> 340

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 340

<210> 341

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 341

<210> 342

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 342

<210> 343

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 343

<210> 344

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 344

<210> 345

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 345

<210> 346

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 346

<210> 347

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 347

<210> 348

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 348

<210> 349

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 349

<210> 350

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 350

<210> 351

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 351

<210> 352

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 352

<210> 353

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 353

<210> 354

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 354

<210> 355

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 355

<210> 356

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 356

<210> 357

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 357

<210> 358

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 358

<210> 359

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 359

<210> 360

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 360

<210> 361

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 361

<210> 362

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 362

<210> 363

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 363

<210> 364

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 364

<210> 365

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 365

<210> 366

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 366

<210> 367

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 367

<210> 368

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 368

<210> 369

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,23,24

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 369

<210> 370

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 370

<210> 371

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 371

<210> 372

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 372

<210> 373

<211> 23

<212> DNA

<313> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 373

<210> 374

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 374

<210> 375

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 375

<210> 376

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 376

<210> 377

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 377

<210> 378

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 378

<210> 379

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense 2,4,6,10,12,14,1,3,5,7,8,9,11,13,15

<220>

<221> modified base

<222> 17

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 379

<210> 380

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,6,8,9,14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,7,10,11,12,13,15,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,20,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 380

<210> 381

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,6,8,9,14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,4,5,7,10,11,12,13,15,17,18,19,20,21,22,23

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 381

<210> 382

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 382

<210> 383

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 383

<210> 384

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 384

<210> 385

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 385

<210> 386

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 386

<210> 387

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 387

<210> 388

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 388

<210> 389

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 389

<210> 390

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 390

<210> 391

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 391

<210> 392

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 392

<210> 393

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 393

<210> 394

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 394

<210> 395

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 395

<210> 396

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 396

<210> 397

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,22,23

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 397

<210> 398

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 17

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 398

<210> 399

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi Senson Antisense Strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 17

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 399

<210> 400

<211> 17

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,10,12,14

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 17

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 400

<210> 401

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 401

<210> 402

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 402

<210> 403

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 403

<210> 404

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223=,> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 404

<210> 405

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 405

<210> 406

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 406

<210> 407

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 407

<210> 408

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 408

<210> 409

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 409

<210> 410

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 410

<210> 411

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 411

<210> 412

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 412

<210> 413

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<400> 413

<210> 414

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger antisense strand

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18,20

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3,4,21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Vinylphosphonate modified nucleoside"

<400> 414

<210> 415

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-ALNY modified nucleoside"

<400> 415

<210> 416

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-ALNY modified nucleoside"

<400> 416

<210> 417

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-ALNY modified nucleoside"

<400> 417

<210> 418

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Toc-modified nucleoside"

<400> 418

<210> 419

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger gene

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 419

<210> 420

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 420

<210> 421

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 421

<210> 422

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 422

<210> 423

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 423

<210> 424

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 424

<210> 425

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 425

<210> 426

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 426

<210> 427

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 427

<210> 428

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 428

<210> 429

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,5,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 429

<210> 430

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,5,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 430

<210> 431

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,7,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 431

<210> 432

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,9,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 432

<210> 433

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,11,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 433

<210> 434

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,13,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 434

<210> 435

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,6,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 435

<210> 436

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 436

<210> 437

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,10,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 437

<210> 438

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,12,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 438

<210> 439

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 439

<210> 440

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 440

<210> 441

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 441

<210> 442

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 442

<210> 443

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base = "2'-3' ring-opened nucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 443

<210> 444

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 444

<210> 445

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 445

<210> 446

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base="TEG-biotin-modified nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 446

<210> 447

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base="TEG-biotin-modified nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 447

<210> 448

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 448

<210> 449

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 449

<210> 450

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 450

<210> 451

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 451

<210> 452

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 452

<210> 453

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 453

<210> 454

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 454

<210> 455

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 455

<210> 456

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 456

<210> 457

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 457

<210> 458

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 458

<210> 459

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NH2-C6 modified nucleoside"

<400> 459

<210> 460

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 460

<210> 461

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 461

<210> 462

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 462

<210> 463

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 463

<210> 464

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 464

<210> 465

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 465

<210> 466

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 466

<210> 467

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 467

<210> 468

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 468

<210> 469

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18,19

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Nucleosides modified with Alk-SS-C6"

<400> 469

<210> 470

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 470

<210> 471

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 471

<210> 472

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 472

<210> 473

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 473

<210> 474

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 474

<210> 475

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 475

<210> 476

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi Progenitors

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 476

<210> 477

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 477

<210> 478

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 478

<210> 479

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 479

<210> 480

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 480

<210> 481

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 481

<210> 482

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 482

<210> 483

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 483

<210> 484

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 484

<210> 485

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 485

<210> 486

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 486

<210> 487

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 487

<210> 488

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7,25,26

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 488

<210> 489

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,13,15,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 489

<210> 490

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 490

<210> 491

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 491

<210> 492

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger gene

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 492

<210> 493

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 493

<210> 494

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,19

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 2,4,6,10,12,14,16,18

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "reverse nucleoside"

<400> 494

<210> 495

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 495

<210> 496

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 496

<210> 497

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 497

<210> 498

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 498

<210> 499

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 499

<210> 500

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 500

<210> 501

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 501

<210> 502

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 502

<210> 503

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 503

<210> 504

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 504

<210> 505

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 505

<210> 506

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 506

<210> 507

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="Nucleosides decorated with C6-SS-Alk-Me"

<400> 507

<210> 508

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 508

<210> 509

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 509

<210> 510

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 510

<210> 511

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 511

<210> 512

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 512

<210> 513

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 513

<210> 514

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C11-PEG3-NAG3 modified nucleoside"

<400> 514

<210> 515

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 515

<210> 516

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 516

<210> 517

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C11-PEG3-NAG3 modified nucleoside"

<400> 517

<210> 518

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 518

<210> 519

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 519

<210> 520

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,15,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,14,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C11-PEG3-NAG3 modified nucleoside"

<400> 520

<210> 521

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,11,14,16,18,20,22,24,26

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,12,13,15,17,19,21,23,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base="C6-SS-Alk-Me modified nucleoside"

<400> 521

<210> 522

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 522

<210> 523

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 523

<210> 524

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 524

<210> 525

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 525

<210> 526

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 526

<210> 527

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 527

<210> 528

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 528

<210> 529

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 529

<210> 530

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 530

<210> 531

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 531

<210> 532

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,14,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 532

<210> 533

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 533

<210> 534

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 10,14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 534

<210> 535

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,14,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 535

<210> 536

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 536

<210> 537

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 537

<210> 538

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,14,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 538

<210> 539

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 8,14,16,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,9,10,11,12,13,15,17,18,19,21,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 539

<210> 540

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 540

<210> 541

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,14,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,25,26

<223> Modified base = "3'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 541

<210> 542

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 8,14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 542

<210> 543

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 543

<210> 544

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,8,10,12,14,16,18,20,22,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17,19,21,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 544

<210> 545

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 6,10,12,14,16,24

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,8,9,11,13,15,17,18,19,20,21,22,23,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 545

<210> 546

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 546

<210> 547

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 547

<210> 548

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 548

<210> 549

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 549

<210> 550

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 550

<210> 551

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 551

<210> 552

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 7,8

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 552

<210> 553

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 7,8

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 553

<210> 554

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 7,8

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 554

<210> 555

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 14,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,6,7,8,9,10,11,12,13,15,17,18,19,20,21,22,23,24,25,26

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 7,8

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 555

<210> 556

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base="TEG-biotin-modified nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base="Chol-TEG modified nucleoside"

<400> 556

<210> 557

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2

<223> Modified base="2'-hydroxynucleoside"

<220>

<221> modified base

<222> 4,6,8,10,11,12,14,16,18,20,22

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,13,15,17,19,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 23

<223> Modified base="TEG-biotin-modified nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "Chol-C6 modified nucleoside"

<400> 557

<210> 558

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 558

<210> 559

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223>

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 559

<210> 560

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 560

<210> 561

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 561

<210> 562

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 562

<210> 563

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222>26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 563

<210> 564

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 564

<210> 565

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 565

<210> 566

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 566

<210> 567

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 567

<210> 568

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 568

<210> 569

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 569

<210> 570

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 570

<210> 571

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 571

<210> 572

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 572

<210> 573

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 573

<210> 574

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 574

<210> 575

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 575

<210> 576

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 576

<210> 577

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 577

<210> 578

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 578

<210> 579

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 579

<210> 580

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 580

<210> 581

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 581

<210> 582

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 582

<210> 583

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 583

<210> 584

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 584

<210> 585

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 585

<210> 586

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 586

<210> 587

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 587

<210> 588

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 588

<210> 589

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 589

<210> 590

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 590

<210> 591

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 591

<210> 592

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 592

<210> 593

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 593

<210> 594

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 594

<210> 595

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 595

<210> 596

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 596

<210> 597

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 597

<210> 598

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 598

<210> 599

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 599

<210> 600

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 600

<210> 601

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 601

<210> 602

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 602

<210> 603

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 603

<210> 604

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 604

<210> 605

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 605

<210> 606

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 606

<210> 607

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "NAG13 modified nucleoside"

<400> 607

<210> 608

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 11,12,13

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,14,15,16,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 3,4,25

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 608

<210> 609

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24,25

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 6,7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 609

<210> 610

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 11,12,13

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,14,15,16,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 3,4,25

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 610

<210> 611

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger gene

<220>

<221> modified base

<222> 11,12,13

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,14,15,16,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 3,4,25

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 611

<210> 612

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 5,7,8,9

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,6,10,11,12,13,14,15,16,17,18,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "NAG13 modified nucleoside"

<400> 612

<210> 613

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 7,9,10,11,16,17

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,8,12,13,14,15,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 2,3

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "NAG13 modified nucleoside"

<400> 613

<210> 614

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 5,7,8,9

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,6,10,11,12,13,14,15,16,17

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 18

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 2,3

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 614

<210> 615

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 7,9,10,11,16,17

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,8,12,13,14,15,18,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 20

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 2,3

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 615

<210> 616

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 616

<210> 617

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 617

<210> 618

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 618

<210> 619

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 619

<210> 620

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 620

<210> 621

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 621

<210> 622

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 622

<210> 623

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 623

<210> 624

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 14,15,16

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,9,10,11,12,13,17,18,19,20,21,22,23,24

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 26

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 25

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 7

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 624

<210> 625

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "reverse nucleoside"

<400> 625

<210> 626

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4,6,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,7,9,11,13,15,17

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "reverse nucleoside"

<400> 626

<210> 627

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4,6,7,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,9,11,13,15,17

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "reverse nucleoside"

<400> 627

<210> 628

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 2,4,6,7,8,10,12,14,16,18

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,3,5,9,11,13,15,17

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 19

<223> Modified base = "reverse nucleoside"

<400> 628

<210> 629

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 7,8,9

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,10,11,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 629

<210> 630

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 630

<210> 631

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "reverse nucleoside"

<220>

<221> modified base

<222> 1,2,21

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 631

<210> 632

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 21

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 632

<210> 633

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 20,21

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 633

<210> 634

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 634

<210> 635

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 635

<210> 636

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 636

<210> 637

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 20,21

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 637

<210> 638

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 638

<210> 639

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 639

<210> 640

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 20,21

<223> Modified base = "2'-MOE nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 640

<210> 641

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 641

<210> 642

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 642

<210> 643

<211> 22

<212> DNA

<213> Artificial sequences

<220>

<223> HBV RNAi trigger subsense

<220>

<221> modified base

<222> 9,10,11

<223> Modified base="2'-deoxy-3'-fluoronucleoside"

<220>

<221> modified base

<222> 1,2,3,4,5,6,7,8,12,13,14,15,16,17,18,19,20,21

<223> Modified base = "2'-O-methyl nucleoside"

<220>

<221> modified base

<222> 22

<223> Modified base = "reverse abasic nucleoside"

<220>

<221> modified base

<222> 1,2,22

<223> Modified base = "phosphorothioate linked nucleoside"

<220>

<221> modified base

<222> 1

<223> Modified base = "NAG25 modified nucleoside"

<400> 643

<210> 644

<211> 26

<212> PRT

<213> Little Bee

<400> 644

<210> 645

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 645

<210> 646

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 646

<210> 647

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 647

<210> 648

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 648

<210> 649

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 649

<210> 650

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 650

<210> 651

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> (1)..(1)

<223> Xaa is Nle

<400> 651

<210> 652

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 652

<210> 653

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 653

<210> 654

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 654

<210> 655

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> D-type honey bee melittin sequence

<400> 655

<210> 656

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 656

<210> 657

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 657

<210> 658

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 658

<210> 659

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 659

<210> 660

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 660

<210> 661

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 661

<210> 662

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 662

<210> 663

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 663

<210> 664

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 664

<210> 665

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 665

<210> 666

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 666

<210> 667

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 667

<210> 668

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 668

<210> 669

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 669

<210> 670

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 670

<210> 671

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 671

<210> 672

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 672

<210> 673

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 673

<210> 674

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 674

<210> 675

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 675

<210> 676

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 676

<210> 677

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 677

<210> 678

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 678

<210> 679

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 679

<210> 680

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 680

<210> 681

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 681

<210> 682

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 682

<210> 683

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 683

<210> 684

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 684

<210> 685

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 685

<210> 686

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 686

<210> 687

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> 2,5,17,20

<223> Xaa is Nle

<400> 687

<210> 688

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 688

<210> 689

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 689

<210> 690

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> 2,5,17,20

<223> Xaa is Nle

<400> 690

<210> 691

<211> 31

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 691

<210> 692

<211> 31

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 692

<210> 693

<211> 26

<212> PRT

<213> Western Bee

<400> 693

<210> 694

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 694

<210> 695

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> (2)..(2)

<223> Xaa is Nle

<400> 695

<210> 696

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 696

<210> 697

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 697

<210> 698

<211> 29

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 698

<210> 699

<211> 29

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 699

<210> 700

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 700

<210> 701

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> (5)..(5)

<223> Xaa is Nle

<400> 701

<210> 702

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 702

<210> 703

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> D-type melittin-like peptide

<400> 703

<210> 704

<211> 31

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 704

<210> 705

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 705

<210> 706

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 706

<210> 707

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<220>

<221> misc_feature

<222> (1)..(1)

<223> Xaa is Nle

<400> 707

<210> 708

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 708

<210> 709

<211> 34

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 709

<210> 710

<211> 31

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 710

<210> 711

<211> 31

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 711

<210> 712

<211> 30

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 712

<210> 713

<211> 25

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 713

<210> 714

<211> 23

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 714

<210> 715

<211> 21

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 715

<210> 716

<211> 23

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 716

<210> 717

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 717

<210> 718

<211> 29

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 718

<210> 719

<211> 27

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 719

<210> 720

<211> 25

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 720

<210> 721

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 721

<210> 722

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 722

<210> 723

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 723

<210> 724

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 724

<210> 725

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 725

<210> 726

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 726

<210> 727

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 727

<210> 728

<211> 32

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 728

<210> 729

<211> 28

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 729

<210> 730

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 730

<210> 731

<211> 24

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 731

<210> 732

<211> 22

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 732

<210> 733

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 733

<210> 734

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 734

<210> 735

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 735

<210> 736

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 736

<210> 737

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 737

<210> 738

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> Mellittin-like peptide

<400> 738

<210> 739

<211> 26

<212> PRT

<213> Artificial sequences

<220>

<223> D-type melittin-like peptide

<400> 739

<210> 740

<211> 18

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 740

<210> 741

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 741

<210> 742

<211> 16

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus probe

<400> 742

<210> 743

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> HCR gene PCR primers

<400> 743

<210> 744

<211> 24

<212> DNA

<213> Artificial sequences

<220>

<223> HCR gene PCR primers

<400> 744

<210> 745

<211> 28

<212> DNA

<213> Artificial sequences

<220>

<223> HCR gene probe

<400> 745

<210> 746

<211> 18

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 746

<210> 747

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 747

<210> 748

<211> 16

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus probe

<400> 748

<210> 749

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PNA standard

<220>

<221> modified base

<222> 1-19

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 749

<210> 750

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PNA standard

<220>

<221> modified base

<222> 2-19

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 750

<210> 751

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PNA standard

<220>

<221> modified base

<222> 1-19

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 751

<210> 752

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PNA standard

<220>

<221> modified base

<222> 2-19

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 752

<210> 753

<211> 15

<212> DNA

<213> Artificial sequences

<220>

<223> Peptide Nucleic Acid Probes

<400> 753

<210> 754

<211> 15

<212> DNA

<213> Artificial sequences

<220>

<223> Peptide Nucleic Acid Probes

<400> 754

<210> 755

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 755

<210> 756

<211> 16

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 756

<210> 757

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus probe

<400> 757

<210> 758

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 758

<210> 759

<211> 29

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus PCR primer

<400> 759

<210> 760

<211> 26

<212> DNA

<213> Artificial sequences

<220>

<223> Hepatitis B virus probe

<400> 760

<210> 761

<211> 23

<212> DNA

<213> Artificial sequences

<220>

<223> Firefly Luciferase siRNA Strand

<220>

<221> modified base

<222> 1-22

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 761

<210> 762

<211> 21

<212> DNA

<213> Artificial sequences

<220>

<223> Firefly Luciferase siRNA Strand

<220>

<221> modified base

<222> 1-19

<223> Modified base = "2'-hydroxy corresponding nucleoside"

<400> 762

<210> 763

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> Mouse GADPH PCR primer

<400> 763

<210> 764

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Mouse GADPH PCR primer

<400> 764

<210> 765

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> Mouse GADPH PCR primer

<400> 765

<210> 766

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Mouse GADPH PCR primer

<400> 766

Claims (9)

A combination for suppressing hepatitis B virus gene expression, comprising: a) MLP-(LT) _x , wherein MLP is a melittin-like peptide, the melittin-like peptide has the sequence of SEQ ID NO: 650, and -LT has Structure represented by -CO-C( _CH3 )=C(T)-COOH or -CO-C(T)=C( _CH3 )-COOH, where T comprises N-acetylgalactosamine (GalNAc) , and x is greater than 95% of the number of primary amines in the MLP population, b) a first HBV RNAi trigger comprising an antisense strand and a sense strand, wherein the antisense strand comprises any one of SEQ ID NOS: 1-3 a nucleobase sequence, and the sense strand comprises the nucleobase sequence of any one of SEQ ID NOS: 103-105, wherein the sense strand of the first HBV RNAi trigger is connected to a cholesterol targeting group, and c) a second HBV RNAi trigger comprising an antisense strand and a sense strand, wherein the antisense strand comprises the nucleobase sequence of any one of SEQ ID NOS: 1-3, and the sense strand comprises SEQ ID NOS: The nucleobase sequence of any one of 103-105, wherein the sense strand of the second HBV RNAi trigger is linked to a cholesterol targeting group, and wherein the first HBV RNAi trigger is linked to the second HBV RNAi trigger HBV RNAi triggers are different. The combination of claim 1, wherein the first HBV RNAi trigger, the second HBV RNAi trigger, or both the first HBV RNAi trigger and the second HBV RNAi trigger comprise SEQ ID NOS: 210 Antisense strands to the nucleotide sequences of any of 212, 244, and 247, and sense strands comprising the nucleotide sequences of any of SEQ ID NOS: 420 to 421, and 473 to 474. The combination of claim 1, wherein the first HBV RNAi trigger, the second HBV The RNAi trigger, or both the first HBV RNAi trigger and the second HBV RNAi trigger comprise an antisense strand comprising the structure of any one of SEQ ID NOS: 210 to 212, 244, and 247, and comprising Sense strands of the structures of any of SEQ ID NOS: 420-421, and 473-474. The combination of claim 1, wherein the first HBV RNAi trigger comprises AD01385 (SEQ ID NO: 247 and SEQ ID NO: 473) and the second HBV RNAi trigger comprises AD01386 (SEQ ID NO: 244 and SEQ ID NO: 473) : 474); or wherein the first HBV RNAi trigger comprises AD00009 (SEQ ID NO: 210 and SEQ ID NO: 420) and the second HBV RNAi trigger comprises AD00010 (SEQ ID NO: 212 and SEQ ID NO: 421 ). The combination of claim 1, wherein the first HBV RNAi trigger comprises AD01385 (SEQ ID NO: 247 and SEQ ID NO: 473) and the second HBV RNAi trigger comprises AD01386 (SEQ ID NO: 244 and SEQ ID NO: 473) : 474). The combination of claim 1, wherein -( L - T ) has the structure represented by:

where n=1. A composition comprising the combination of any one of claims 1 to 6, wherein the composition additionally comprises a pharmaceutically acceptable excipient. A use of the combination of any one of claims 1 to 6 for the manufacture of a medicament for the treatment of HBV infection. A use of a composition as claimed in claim 7 for the manufacture of a medicament for the treatment of HBV infection.

Images