EA044937B1 - RNAi AGENTS AGAINST HEPATITIS B VIRUS INFECTION - Google Patents

Description

Cross-references to related applications

This application claims priority to U.S. Provisional Patent Application No. 62/540,639, filed Aug. 3, 2017, U.S. Provisional Patent Application No. 62/534,733, filed July 20.

2017, and US Provisional Patent Application No. 62/370,754, filed August 4, 2016, the disclosures of each application being incorporated herein by reference in their entirety.

Scope of the invention

Disclosed herein are RNA interference (RNAi) agents for inhibiting hepatitis B virus gene expression, compositions that include anti-HBV RNAi agents, and methods of using them.

Prerequisites for creating the invention

Hepatitis B virus (HBV) is an exclusively hepatotropic virus containing double-stranded DNA. Although DNA is the genetic material, the replication cycle includes a reverse transcription step to copy pregenomic RNA into DNA. Hepatitis B virus is classified as one of the representatives of the hepadnaviruses and belongs to the Hepadnaviridae family. Primary infection with the hepatitis B virus in adults causes acute hepatitis with symptoms of organ inflammation, fever, jaundice and increased liver transaminases in the blood. Patients who are unable to overcome the viral infection experience chronic disease progression over many years and are at increased risk of developing cirrhosis or liver cancer. Perinatal transmission from mothers infected with hepatitis B virus to their newborns also leads to chronic hepatitis.

Once captured by hepatocytes, the nucleocapsid is transported into the nucleus and DNA is released. At this point, the DNA strand is synthesized and gaps are repaired to form a covalently closed circular (ccc) supercoiled DNA of 3.2 kb in size. cccDNA provides a template for transcription of five major viral mRNAs, which are 3.5, 3.5, 2.4, 2.1, and 0.7 kb in length. All mRNAs are capped at the 5' end and polyadenylated at the 3' end. There is sequence overlap at the 3' end between all five mRNAs.

A single 3.5 kb mRNA acts as a template for the production of capsid protein and polymerase. In addition, the same transcript serves as a pregenomic replication intermediate and allows the viral polymerase to initiate reverse transcription into DNA. The capsid protein is required for the formation of the nucleocapsid. Another 3.5 kb mRNA encodes the precore part, i.e. secreted e-antigen (HBeAg). In the absence of replication inhibitors, a large amount of e-antigen in the blood correlates with hepatitis B virus replication in the liver and serves as an important diagnostic marker for monitoring disease progression.

The 2.4 and 2.1 kb mRNAs contain pre-S1, pre-S2, and S open reading frames (ORFs) for expression of the large, medium, and small viral surface antigen. S-antigen is associated with infectious complete particles. In addition, the blood of infected patients also contains non-infectious particles formed only from the s-antigen and free of genomic DNA or polymerase. The function of these particles is not fully understood. Complete and long-term disappearance of detectable s-antigen from the blood is considered a reliable indicator of clearance of the hepatitis B virus.

The 0.7 kb mRNA encodes protein X. This gene product is important for efficient transcription of viral genes and also acts as a transactivator of host gene expression. The latter type of activity appears to be important for the transformation of hepatocytes during the development of liver cancer.

Patients with detectable s-antigen, e-antigen and/or viral DNA in the blood for more than 6 months are considered chronically infected. Nucleoside analogues as inhibitors of reverse transcriptase activity are typically the first choice drugs for the treatment of many patients. Administration of lamivudine, tenofovir, and/or entecavir has been shown to inhibit hepatitis B virus replication, sometimes to undetectable concentrations, with improved liver function and reduced liver inflammation considered the most important benefits. However, only a few patients achieve complete and sustained remission after treatment. Moreover, as the duration of treatment increases, the hepatitis B virus develops drug resistance. This is especially true for patients infected with both hepatitis B virus and human immunodeficiency virus (HIV). Both viruses are susceptible to nucleoside analogues and they can both co-develop resistance.

The second treatment method is the administration of interferon-alpha. In this case, patients receive high doses of interferon-alpha for 6 months. Asian genotype B exhibits very low treatment response rates. Concurrent infection with hepatitis D virus (HDV) or human immunodeficiency virus has been shown to render interferon-alpha therapy completely ineffective. Patients with advanced liver disease and severe fibrotic disease are not suitable for interferon alfa therapy.

Several hepatitis B virus-specific RNA interference (RNAi) agents have previously been shown to inhibit HBV gene expression. For example, in U.S. Patent Application Publication No.

- 1 044937

2013/0005793 (to Chin et al.), which is incorporated herein by reference in its entirety, discloses certain double-stranded ribonucleic acid (dsRNA) molecules for inhibiting hepatitis B virus gene expression.

Summary

There is a need for novel hepatitis B virus (HBV)-specific RNA interference (RNAi) agents (also referred to herein as RNAi agent, RNAi trigger, or trigger) that are capable of selectively and effectively inhibiting hepatitis B virus (HBV) gene expression. In addition, there is a need for combinations of new HBV-specific RNAi agents to treat HBV infection and prevent HBV-associated diseases.

Disclosed herein are HBV gene-specific RNAi agents capable of selectively and effectively reducing HBV gene expression. The disclosed anti-HBV RNAi agents may be used in methods of therapeutically treating and/or preventing symptoms and diseases associated with HBV infection, including, but not limited to, chronic liver diseases/disorders, inflammatory diseases, fibrotic diseases, proliferative disorders (including cancers such as hepatocellular carcinoma), hepatitis D virus (HDV) infection and acute HBV infection. In some embodiments, anti-HBV RNAi agents can be used in methods of therapeutically treating and/or preventing symptoms and diseases associated with chronic HBV infection and/or HDV infection. Such methods include administering one or more anti-HBV RNAi agents described herein to a subject, such as a human or animal.

Also disclosed herein are compositions containing one or more of the disclosed anti-HBV RNAi agents that are capable of selectively and effectively reducing HBV gene expression. Compositions containing one or more anti-HBV RNAi agents can be administered to a subject, such as a human or animal, to treat and/or prevent symptoms and diseases associated with HBV infection.

Each anti-HBV RNAi agent described herein includes at least a coding strand and an antisense strand. The coding strand and the antisense strand may be partially, substantially or completely complementary to each other. The length of the RNAi agent coding and antisense strands described herein can range from 16 to 30 nucleotides. In some embodiments, the coding and antisense strands are independently between 17 and 26 nucleotides in length. In some embodiments, the coding and antisense strands are independently between 19 and 26 nucleotides in length. In some embodiments, the coding and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the coding and antisense strands are independently 21 to 24 nucleotides in length. The coding and antisense strands may be the same length or different lengths. The anti-HBV RNAi agents described herein are designed to incorporate antisense strand sequences that are at least partially complementary to a sequence in the HBV genome that is conserved among most known HBV serotypes. The RNAi agents described herein, when delivered to a cell expressing HBV, inhibit the expression of one or more HBV genes in vivo or in vitro.

The anti-HBV RNAi agent includes a coding strand (also called a chaperone strand), which includes a first sequence, and an antisense strand (also called a guide strand), which includes a second sequence. The coding strand of the HBV RNAi agents described herein includes a core fragment that is at least about 85% identical to the nucleotide sequence of at least 16 contiguous nucleotides in HBV mRNA. In some embodiments, the length of the core nucleotide fragment of the coding strand that is at least about 85% sequence identical to the HBV mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. The antisense strand of an HBV RNAi agent contains a nucleotide sequence that is at least about 85% complementary within a core fragment of at least 16 contiguous nucleotides of the sequence in the HBV mRNA and the corresponding coding strand. In some embodiments, the length of the core nucleotide sequence of the antisense strand on at least about 8% of the complementary sequence in the HBV mRNA or corresponding coding strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

Examples of coding strands and antisense strands of anti-HBV RNAi agents that can be used in anti-HBV RNAi agents are presented in Table. 3 and 4. Examples of anti-HBV RNAi agent duplexes are presented in table. 5. Examples of the 19 nucleotide core sequences that comprise or are included in the coding strands and antisense strands of the HBV RNAi agents described herein are presented in Table. 2.

In some embodiments, one or more anti-HBV RNAi agents are delivered to target cells or target tissues using any oligonucleotide delivery technology known in the art. Methods for delivering nucleic acids include, but are not limited to, liposome encapsulation, iontophoresis, or embedding in other carrier media such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein vectors, or dynamic polyconjugates (DPCs) (see, e.g. , publications WO 2000/053722, WO 2008/0022309, WO 2011/104169 and WO 2012/083185, each of which is incorporated herein by reference). In some embodiments, the anti-HBV RNAi agent is delivered to target cells or tissues by covalently binding the RNAi agent to a targeting moiety. In some embodiments, the targeting moiety may include a cellular receptor ligand, such as an asialoglycoprotein receptor (ASGPr) ligand. In some embodiments, the ASGPr ligand includes or consists of a cluster of galactose derivatives. In some embodiments, the galactose derivative cluster includes an N-acetylgalactosamine trimer or an N-acetylgalactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetylgalactosamine trimer or an N-acetylgalactosamine tetramer.

The targeting group can be linked to the 3' or 5' end of the coding strand or antisense strand of the HBV RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the coding strand. In some embodiments, the targeting group is linked to the 5' end of the coding strand. In some embodiments, the targeting moiety is linked to the RNAi agent via a linker.

A targeting group (with or without a linker) can be linked to the 5' or 3' end of any of the coding and/or antisense strands described in Table 1. 2, 3 and 4. A linker (with or without a targeting group) can be attached to the 5' or 3' end of any of the coding and/or antisense strands described in table. 2, 3 and 4.

In some embodiments described herein, compositions are provided that include one or more anti-HBV RNAi agents having the duplex sequences described in Table. 5.

In some embodiments described herein, compositions are provided that include a combination or cocktail of at least two anti-HBV RNAi agents having different nucleotide sequences. In some embodiments, two or more different anti-HBV RNAi agents are each separately and independently associated with targeting moieties. In some embodiments, two or more different anti-HBV RNAi agents are each associated with targeting moieties consisting of N-acetyl-galactosamines. In some embodiments, in which two or more RNAi agents are included in the composition, each of the RNAi agents is associated with the same targeting group. In some embodiments, in which two or more RNAi agents are included in the composition, each of the RNAi agents is associated with different targeting moieties, such as targeting moieties having different chemical structures.

In some embodiments, targeting moieties are linked to anti-HBV RNAi agents without the use of an additional linker. In some embodiments, the targeting moiety is configured to have a readily accessible linker to facilitate binding to the anti-HBV RNAi agent. In some embodiments, in which two or more RNAi agents are included in the composition, the two or more RNAi agents may be linked to targeting moieties using the same linkers. In some embodiments, in which two or more RNAi agents are included in the composition, the two or more RNAi agents are linked to targeting moieties via different linkers.

In some embodiments described herein, compositions are provided that include a combination of at least two anti-HBV RNAi agents having different sequences, each anti-HBV RNAi agent targeting a different site or region of the HBV gene. In some embodiments described herein, compositions are provided that include a combination of at least two anti-HBV RNAi agents, wherein each anti-HBV RNAi agent is configured to target a different HBV transcript (e.g., a composition that includes two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the S ORF of the HBV gene, and the second anti-HBV RNAi agent includes an antisense strand that is at least least partially complementary to the nucleotide sequence located in ORF X of the HBV gene). Herein, an RNAi agent that includes an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF targets a portion of the HBV genome of SEQ ID NO: 1 between positions 1-1307 and 3185-3221. Herein, an RNAi agent that includes an antisense strand at least partially complementary to a nucleotide sequence located in ORF X targets the portion of the HBV genome of SEQ ID NO: 1 between positions 1308-1930.

HBV mRNA is known to be polycistronic, resulting in the translation of multiple polypeptides, and within this RNA sequence there is overlap between individual mRNAs, so a single RNAi agent targeting the HBV gene can result in inhibition of most or all transcripts

- 3 044937

HBV. However, while not wishing to be bound by any theory, it is believed that a composition that includes two or more anti-HBV RNAi agents targeting different regions or regions of the HBV gene (and in particular two or more RNAi agents anti-HBV, of which one anti-HBV RNAi agent targets ORF S and a second anti-HBV RNAi agent targets ORF X) may provide additional benefits compared to a composition that includes only one anti-HBV RNAi agent, such as ( a) ensuring that all HBV viral transcripts are targeted (i.e., 3.5 kb pregenomic RNA; 3.5 kb precore mRNA; 2.4 kb pre-S1 mRNA; 2.1 kb pre-S2/S mRNA kb; 0.7 kb X mRNA; as well as any S-antigen-expressing mRNA derived from integrated HBV DNA); (b) promoting expansion of genotype coverage to potentially impact a larger patient population; and/or (c) potential reduction in viral resistance due to mutations in the miRNA binding site.

In some embodiments described herein, compositions are provided that include a combination of a single anti-HBV RNAi agent that targets the HBV S RNA ORF (i.e., has an antisense strand that targets S transcripts (S, pre-S1, and pre-S2), pre-genomic RNA (core and polymerase) and pre-core transcripts (HBeAg) of the HBV genome) and one anti-HBV RNAi agent that targets the X ORF of HBV RNA (i.e. has an antisense strand that targets the X genome transcript HBV, S transcripts (S, pre-S1 and pre-S2), pre-genomic RNA (core and polymerase) and pre-core transcripts (HBeAg) of the HBV genome). In some embodiments, the compositions described herein include at least one anti-HBV RNAi agent that contains a sequence targeting the HBV gene ORF S and a second anti-HBV RNAi agent that contains a sequence targeting the HBV gene ORF X.

Disclosed herein are methods of inhibiting HBV gene expression comprising administering one or more anti-HBV RNAi agents having an antisense strand containing any of the sequences listed in Table 1. 3.

Disclosed herein are methods of inhibiting HBV gene expression, comprising administering one or more anti-HBV RNAi agents having a coding strand containing any of the sequences listed in Table 1. 4.

Disclosed herein are methods of inhibiting HBV gene expression comprising administering one or more anti-HBV RNAi agents having an antisense strand containing any of the sequences listed in Table 1. 3, and a coding chain containing any of the sequences given in table. 4, which is at least partially complementary to the antisense strand.

Disclosed herein are methods of inhibiting HBV gene expression, comprising administering one or more anti-HBV RNAi agents having an antisense strand that consists of any of the sequences listed in Table 1. 3, and a coding chain, which consists of any of the sequences given in table. 4, which is at least partially complementary to the antisense strand.

Disclosed herein are methods of inhibiting HBV gene expression in a cell, comprising administering one or more anti-HBV RNAi agents having the duplex structure shown in Table 1. 5.

Described herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering one or more anti-HBV RNAi agents having an antisense strand containing any of the sequences shown in Table 1. 3.

Described herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering one or more anti-HBV RNAi agents having a coding strand containing any of the sequences listed in Table 1. 4.

Described herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering one or more anti-HBV RNAi agents having an antisense strand containing any of the sequences shown in Table 1. 3, and a coding chain containing any of the sequences given in table. 4, which is at least partially complementary to the antisense strand.

Disclosed herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering one or more anti-HBV RNAi agents having an antisense strand that consists of any of the sequences listed in Table 1. 3, and a coding chain, which consists of any of the sequences given in table. 4, which is at least partially complementary to the antisense strand.

Disclosed herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering one or more anti-HBV RNAi agents having the duplex structure shown in Table 1. 5.

Disclosed herein are methods of inhibiting HBV gene expression comprising administering (i) an anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences set forth in Table 1. 2 or 3, and (ii) a second anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences shown in table. 2 or 3.

Disclosed herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering (i) an anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences shown in Table 1. 2 or 3, and (ii) a second anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences shown in table. 2 or 3.

Disclosed herein are methods of inhibiting HBV gene expression, comprising administering (i) a first anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences set forth in Table. 2 or 3, and a coding strand containing or consisting of any of the sequences given in table. 2 or 4, which is at least partially complementary to the antisense sequence of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand containing or consisting of any of the sequences shown in table. 2 or 3, and a coding strand containing or consisting of any of the sequences given in table. 2 or 4, which is at least partially complementary to the antisense sequence of the second HBV RNAi agent.

Disclosed herein are methods of treating HBV infection or preventing disease or symptoms caused by HBV infection, comprising administering (i) a first anti-HBV RNAi agent having an antisense strand containing or consisting of any of the sequences set forth in Table. 2 or 3, and a coding strand containing or consisting of any of the sequences given in table. 2 or 4, which is at least partially complementary to the antisense sequence of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand containing or consisting of any of the sequences shown in table. 2 or 3, and a coding strand containing or consisting of any of the sequences given in table. 2 or 4, which is at least partially complementary to the antisense sequence of the second HBV RNAi agent.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

a) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AUUGAGAGAAGUCCACCAC (SEQ ID NO: 7), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUggUggacUUcUcUcaaU (SEQ ID NO: 34); or

b) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UUUGAGAGAAGUCCACCAC (SEQ ID NO: 8), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUggUggacUUcUcUcaaA (SEQ ID NO: 35); or

c) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or

d) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40); or

e) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or

f) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45); or

g) an antisense strand that contains a nucleotide sequence that differs by 0,

- 5 044937

1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGC (SEQ

ID NO: 22), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 49); or

h) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCCAAUUUAUGCCUACAGC (SEQ ID NO: 23), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 50); or

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or

j) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or

k) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, compositions for inhibiting HBV gene expression in a cell, comprising an anti-HBV RNAi agent, are described herein.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two or more anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a coding strand that contains a nucleotide sequence that differs at 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

and wherein the second anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a coding strand that contains a nucleotide sequence that differs 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or iii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a coding strand that contains a nucleotide sequence that differs at 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two or more anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ

- 6 044937

ID NO: 17), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a coding strand that contains a nucleotide sequence that differs at 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a coding strand that contains a nucleotide sequence that differs 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or iii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a coding strand that contains a nucleotide sequence that differs at 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two or more anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or ii) an antisense strand that contains a nucleotide sequence differing by 0,

1, 2, or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5' ^3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);

and wherein the second anti-HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to the ORF X portion of the HBV mRNA.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two or more anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises:

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a coding strand that contains a nucleotide sequence that differs at 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);

and wherein the second anti-HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to the ORF X portion of the HBV mRNA.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two or more anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of ORF S HBV mRNA, and wherein the second anti-HBV RNAi agent contains:

i) an antisense strand that contains a nucleotide sequence that differs by 0,

- 7 044937

1, 2 or 3 nucleotide bases from the sequence (5%3') GACCAAUUUAUGCCUACAG (SEQ

ID NO: 27), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5%3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or iii) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).

In some embodiments, an anti-HBV RNAi agent described herein comprises:

a) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or

b) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or

c) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or

d) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or

e) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or

f) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or

g) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or

h) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or

i) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or

j) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or

k) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or

l) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or

m) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or

n) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or

o) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') AGAAAAUUGAGAGAAGUCCUU

- 8 044937 (SEQ ID NO: 178); or

p) an antisense strand that contains a nucleotide sequence that differs by 0,

1, 2 or 3 nucleotide bases from the sequence (5%3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 17 9); or

q) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or

r) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or

s) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or

t) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or

u) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or

v) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or

w) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 18 6); or

x) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or

y) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or

z) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or aa) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or bb) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or cc) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or dd) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or thereof) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194);

and wherein the anti-HBV RNAi agent further comprises a coding strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

a) an antisense strand which consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or

b) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or

c) an antisense strand, which consists of a nucleotide sequence that differs by 0,

- 9 044937

1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or

d) an antisense strand, which consists of a nucleotide sequence that differs by 0,

1, 2 or 3 nucleotide bases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or

e) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or

f) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or

g) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or

h) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or

i) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or

j) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or

k) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or

l) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or

m) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or

n) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or

o) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or

p) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 17 9); or

q) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or

r) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or

s) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or

t) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or

u) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or

v) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or

w) an antisense strand, which consists of a nucleotide sequence that differs by

- 10 044937

0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or

x) an antisense strand, which consists of a nucleotide sequence that differs by 0,

1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or

y) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or

z) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or aa) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or bb) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or thereof) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or dd) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or.

Her) an antisense strand that consists of a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194);

and wherein the anti-HBV RNAi agent further comprises a coding strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

i) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or ii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or iii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or iv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64); or

v) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfUGfcCfUAfcAfgusu (SEQ ID NO: 68); or vi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or vii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or viii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or ix) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or

x) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or xi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or xii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or xiii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or

- 11 044937 xiv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO:

108); or xv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO: 109); or xvi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO: 110); or xvii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO: 111); or xviii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or xix) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or xx) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125);

xxi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or xxii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or xxiii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or xxiv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 129); or xxv) an antisense strand that contains a sequence other than 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or xxvi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 131); or xxvii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or xxviii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or xxix) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or xxx) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or xxxi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or xxxii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or xxxiii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or xxxiv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or xxxv) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or xxxvi) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or xxxvii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or xxxviii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or xxxix) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or

- 12 044937 xl) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or xli) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 14 6); or xlii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or xliiii) an antisense strand that contains a sequence that differs by 0, 1, 2 or 3 nucleotides from the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148);

where a, g, c and u are 2'-O-methyl(2'-OMe)-modified nucleotides; Af, Cf, Gf and Uf are 2'-fluoro-modified nucleotides;

s represents a phosphorothioate internucleotide bond, and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is a 5'-cyclopropylphosphonate-2-O-methyl-modified nucleotide; and wherein the anti-HBV RNAi agent further comprises a coding strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

i) an antisense strand which consists of the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or ii) an antisense strand which consists of the sequence (5'^3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or iii) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or iv) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64); or

v) an antisense strand, which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68); or vi) an antisense strand which consists of the sequence (5'^3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or vii) an antisense strand which consists of the sequence (5'^3')usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or viii) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or ix) an antisense strand which consists of fuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or

x) an antisense strand, which consists of fuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or xi) an antisense strand that consists of fuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or xii) an antisense strand which consists of fuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or from the sequence (5'^3') usAfscsCfaAfrom the sequence (5'^3') usAfscsCfaAfrom the sequence (5'^3') usAfscsCfaAfrom the sequence (5'^3') usAfscsCfaA- xiii) the antisense strand, which consists of the sequence (5 '^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or xiv) an antisense strand which consists of the sequence (5'^3') cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or xv) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO: 109); or xvi) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID nO: 110); or xvii) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO: 111); or xviii) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or xix) an antisense strand which consists of the sequence (5'^3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or xx) an antisense strand which consists of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125);

xxi) an antisense strand which consists of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or xxii) an antisense strand, which consists of the sequence (5'^3') asGfsasAfaAfuUfgAfgAf-

- 13 044937 gAfaGfuCfcacusu (SEQ ID NO: 127); or xxiii) an antisense strand which consists of the sequence (5'^3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or xxiv) an antisense strand which consists of the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 129); or xxv) an antisense strand which consists of the sequence (5'^3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or xxvi) an antisense strand which consists of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 131); or xxvii) an antisense strand which consists of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or xxviii) an antisense strand which consists of the sequence (5'^3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or xxix) an antisense strand which consists of the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or xxx) an antisense strand which consists of the sequence (5'^3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or xxxi) an antisense strand which consists of the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or xxxii) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or xxxiii) an antisense strand which consists of the sequence (5'^3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or xxxiv) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or xxxv) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or xxxvi) an antisense strand which consists of the sequence (5'^3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or xxxvii) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or xxxviii) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or xxxix) an antisense strand which consists of the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or xl) an antisense strand which consists of the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or xli) an antisense strand which consists of the sequence (5'^3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 14 6); or xlii) an antisense strand which consists of the sequence (5'^3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or xlii i) an antisense strand which consists of the sequence (5'^3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148);

where a, g, c and u are 2'-O-methyl(2'-OMe)-modified nucleotides; Af, Cf, Gf and Uf are 2'-fluoro-modified nucleotides; s represents a phosphorothioate internucleotide bond, and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is a 5'-cyclopropylphosphonate-2-O-methyl-modified nucleotide; and wherein the anti-HBV RNAi agent further comprises a coding strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

a) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or

b) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or

c) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or

- 14 044937

d) a coding strand that contains a nucleotide sequence that differs by 0, 1, or 3 nucleotide bases from the sequence (5'^3') CGUGGUGGACUUCUCUCAAUU (SEQ

ID NO: 285); or

e) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or

f) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or

g) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or

h) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or

i) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or

j) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303); or

k) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or

l) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or

m) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or

n) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or

o) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or

p) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or

q) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or

r) a coding strand that contains a nucleotide sequence that differs by 0.1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or

s) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or

t) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or

u) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or

v) a coding strand that contains a nucleotide sequence that differs by 0,1,2 or 3 nucleotide bases from the sequence (5'^3')GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or

w) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or

- 15 044937

x) a coding strand that contains a nucleotide sequence that differs by 0, 1, or 3 nucleotide bases from the sequence (5'^3') AGCUGUAGGCAUAAAUUGGUA (SEQ

ID NO: 327); or

y) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or

z) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or aa) an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or bb) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or cc) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or dd) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or its) a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334);

and wherein the anti-HBV RNAi agent further comprises an antisense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, an anti-HBV RNAi agent described herein comprises:

a) a coding chain, which consists of a nucleotide sequence (5'^3')

UUGCCUGUAGGCAUAAAAUUGGUAUT (SEQ ID NO: 275); or

b) the coding chain, which consists of a nucleotide sequence (5'^3')

UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or

c) a coding strand which consists of the nucleotide sequence (5'^3') CUGUAGGCAUAAAAUUGGUAUU (SEQ ID NO: 278); or

d) a coding strand which consists of the nucleotide sequence (5'^3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or

e) a coding strand which consists of the nucleotide sequence (5'^3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or

f) a coding strand which consists of the nucleotide sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or

g) a coding strand which consists of the nucleotide sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or

h) a coding strand which consists of the nucleotide sequence (5'^3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or

i) a coding strand which consists of the nucleotide sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or

j) a coding strand which consists of the nucleotide sequence (5'^3') GCUGUAGGCAUAAAAUUGGUAUU (SEQ ID NO: 303); or

k) a coding strand, which consists of the nucleotide sequence (5'^3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 3 04); or

l) a coding strand, which consists of the nucleotide sequence (5'^3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or

m) a coding strand which consists of the nucleotide sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or

n) a coding strand which consists of the nucleotide sequence (5'^3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or

o) a coding strand that contains the nucleotide sequence (5'^3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or

p) a coding strand which consists of the nucleotide sequence (5'^3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or

- 16 044937

q) a coding strand which consists of the nucleotide sequence (5%3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or

r) a coding strand which consists of the nucleotide sequence (5%3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or

s) a coding strand which consists of the nucleotide sequence (5%3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or

t) a coding strand which consists of the nucleotide sequence (5%3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or

u) a coding strand which consists of the nucleotide sequence (5%3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or

v) a coding strand which consists of the nucleotide sequence (5%3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or

w) a coding strand which consists of the nucleotide sequence (5%3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or

x) a coding strand which consists of the nucleotide sequence (5%3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327); or

y) coding chain, which consists of a nucleotide sequence (5%3')

CGCUGUAGGCAUAAAAUUGGUA (SEQ ID NO: 328); or

z) the coding chain, which consists of a nucleotide sequence (5%3')

GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or aa) an antisense strand that contains the nucleotide sequence (5%3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or bb) a coding strand that consists of the nucleotide sequence (5%3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or cc) a coding strand which consists of the nucleotide sequence (5%3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or dd) a coding strand, which consists of a nucleotide sequence (5%3')

CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or its) coding strand, which consists of a nucleotide sequence (5%3')

CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334);

and wherein the anti-HBV RNAi agent further comprises an antisense strand at least partially complementary to the corresponding antisense strand.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases. from the sequence (5%3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO : 307); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases from the sequence (5%3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5%3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO : 175), and a coding strand which consists of the nucleotide sequence (5%3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5%3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a coding strand that consists of the nucleotide sequence (5%3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases. from the sequence (5%3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5%3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO : 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ

ID NO: 188), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') AGAAAAUUGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand which consists of the nucleotide sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a coding strand that consists of the nucleotide sequence (5'^3') CGCUGUAGGCAUAAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases. from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') AGAAAAUUGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand which consists of the nucleotide sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand that consists of the nucleotide sequence (5'^3') GGCUGUAGGCAUAAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2, or 3 nucleotide bases. from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein the first anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') AGAAAAUUGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand which consists of the nucleotide sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that consists of the nucleotide sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand that consists of the nucleotide sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or a second anti-HBV RNAi agent are

- 18 044937 modified nucleotides, and wherein the first anti-HBV RNAi agent contains an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175 ), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 2 92).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAAUUGGUA (SEQ ID NO: 294).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a coding strand that contains a nucleotide sequence differing by 0, 1, 2 or 3

- 19 044937 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), and wherein the coding strand of a first anti-HBV RNAi agent and a second anti-HBV RNAi agent conjugated to a targeting ligand, N-acetylgalactosamine.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328), and wherein the coding strand of a first anti-HBV RNAi agent and a second anti-HBV RNAi agent conjugated to a targeting ligand, N-acetylgalactosamine.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), and wherein the coding strand of a first anti-HBV RNAi agent and a second anti-HBV RNAi agent conjugated to a targeting ligand, N-acetylgalactosamine.

In some embodiments, compositions for inhibiting HBV gene expression in a cell are described herein, comprising two anti-HBV RNAi agents, wherein all or substantially all of the nucleotides in the coding strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or the second anti-HBV RNAi agent are modified nucleotides, and wherein the first anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a coding strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second anti-HBV RNAi agent comprises an antisense strand that contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a coding strand, which contains a nucleotide sequence that differs by 0, 1, 2 or 3 nucleotide bases from the sequence (5'^3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307), and wherein the coding strand of a first anti-HBV RNAi agent and a second anti-HBV RNAi agent conjugated to a targeting ligand, N-acetylgalactosamine.

In some embodiments, methods of treating HBV infection or preventing disease or symptoms caused by HBV infection are described herein, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2:1. In some embodiments, the ratio

- 20 044937

AD04872 and AD05070 administered to a subject in need thereof is approximately 3:1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1:1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5:1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1:2.

In some embodiments, about 1 mg/kg (mpk) of AD04872 and about 1 mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg AD04872 and about 1.5 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 2.0 mg/kg AD04872 and about 1.0 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 3.0 mg/kg AD04872 and about 1.0 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 3.2 mg/kg AD04872 and about 0.8 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 2.7 mg/kg AD04872 and about 1.3 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 4.0 mg/kg AD04872 and about 1.0 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 3.3 mg/kg AD04872 and about 1.7 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, about 0.05 to about 5 mg/kg AD04872 and about 0.05 to about 5 mg/kg AD05070 are administered to a subject in need thereof. In some embodiments, approximate amounts of AD04872 and AD05070 are administered separately (eg, by separate injections). In some embodiments, a corresponding dose of AD04872 and a corresponding dose of AD05070 are administered together (eg, in a single injection). In some embodiments, a corresponding dose of AD04872 and a corresponding dose of AD05070 are provided in a single pharmaceutical composition.

In some embodiments, methods of treating HBV infection or preventing diseases or symptoms caused by HBV infection are described herein, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04776. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1:2.

In some embodiments, about 1 mg/kg (mpk) of AD04872 and about 1 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg AD04872 and about 1.5 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 2.0 mg/kg AD04872 and about 1.0 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 3.0 mg/kg AD04872 and about 1.0 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 3.2 mg/kg AD04872 and about 0.8 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 2.7 mg/kg AD04872 and about 1.3 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 4.0 mg/kg AD04872 and about 1.0 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 3.3 mg/kg AD04872 and about 1.7 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, about 0.05 to about 5 mg/kg AD04872 and about 0.05 to about 5 mg/kg AD04776 are administered to a subject in need thereof. In some embodiments, respective doses of AD04872 and AD04776 are administered separately (eg, by separate injections). In some embodiments, respective doses of AD04872 and AD04776 are administered together (eg, in a single injection). In some embodiments, respective doses of AD04872 and AD04776 are formulated in a single pharmaceutical composition.

In some embodiments, methods of treating HBV infection or preventing disease or symptoms caused by HBV infection are described herein, comprising administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04982. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1:2.

In some embodiments, about 1 mg/kg (mpk) of AD04872 and about 1 mg/kg of AD04982 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg AD04872 and about 1.5 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 2.0 mg/kg AD04872 and about 1.0 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 3.0 mg/kg AD04872 and about 1.0 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 3.2 mg/kg AD04872 and about 0.8 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 2.7 mg/kg AD04872 and about 1.3 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 4.0 mg/kg AD04872 and about 1.0 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 3.3 mg/kg AD04872 and about 1.7 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, about 0.05 to about 5 mg/kg AD04872 and about 0.05 to about 5 mg/kg AD04982 are administered to a subject in need thereof. In some embodiments, respective doses of AD04872 and AD04982 are administered separately (eg, by separate injections). In some embodiments, respective doses of AD04872 and AD04982 are administered together (eg, in a single injection). In some embodiments, respective doses of AD04872 and AD04982 are formulated in a single pharmaceutical composition.

In some embodiments, methods of treating HBV infection or preventing disease or symptoms caused by HBV infection are described herein, comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2:1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3:1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5:1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1:1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1:2. In some embodiments, about 1 mg/kg (mpk) of AD04580 and about 1 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg AD04580 and about 1.5 mg/kg AD04585 are administered to a subject in need thereof. In some embodiments, about 0.05 to about 5 mg/kg AD04580 and about 0.05 to about 5 mg/kg AD04585 are administered to a subject in need thereof.

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD05070 linked to (NAG37)s, shown as a sodium salt, and has the structure shown below:

- 22 044937

- 23 044937

- 24 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD05070 linked to (NAG25)s, shown as a sodium salt, and has the structure shown below:

- 25 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD05070 bound to (NAG37)s shown as the free acid and has the structure shown below:

- 27 044937

- 28 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD04580 linked to (NAG31)s, shown as a sodium salt, and has the structure shown below:

- 29 044937

- 30 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD04585 linked to (NAG25)s, shown as a sodium salt, and has the structure shown below:

- 31 044937

- 32 044937

- 33 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD04872 linked to (NAG37)s, shown as a sodium salt, and has the structure shown below:

- 34 044937

- 35 044937

- 36 044937

- 37 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD04872 linked to (NAG25)s, shown as a sodium salt, and has the structure shown below:

- 38 044937

- 39 044937

In some embodiments, the anti-HBV RNAi agent described herein consists of or contains the compound AD04872 bound to (NAG37)s shown as the free acid and has the structure shown below:

- 40 044937

- 41 044937

- 42 044937

In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional (ie, second, third, etc.) therapeutic agents. The second therapeutic agent may be another anti-HBV RNAi agent (eg, an anti-HBV RNAi agent that targets a different sequence within the HBV genome). The additional therapeutic agent may also be a small molecule drug, antibody, antibody fragment, and/or vaccine. Anti-HBV RNAi agents, whether or not containing one or more additional therapeutic agents, can be combined with one or more excipients to form pharmaceutical compositions.

In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is a nucleoside inhibitor or a nucleotide inhibitor. In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is entecavir, tenofovir, tenofovir alafenamide, tenofovir disoproxil, lamivudine, or other antiviral therapeutic agent. In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is an interferon. In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is interferon alpha. In some embodiments, the disclosed HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents, wherein the additional therapeutic agent is an HBV vaccine.

In some embodiments, the disclosed anti-HBV RNAi agent(s) are optionally combined with one or more additional therapeutic agents in a single dosage form (ie, the mixture is administered in a single injection). In some embodiments, the disclosed anti-HBV RNAi agent(s) may be administered separately from one or more optional additional therapeutic agents. In some embodiments, the disclosed anti-HBV RNAi agent(s) are administered to a subject in need thereof by subcutaneous injection and one or more additional therapeutic agents are administered orally, which together constitute a regimen for treating diseases and conditions associated with HBV infection. In some embodiments, the disclosed anti-HBV RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and one or more additional therapeutic agents are administered via a separate subcutaneous injection.

In some embodiments, compositions for delivering an anti-HBV RNAi agent to a liver cell in vivo are described herein, which include an anti-HBV RNAi agent conjugated or linked to a targeting moiety. In some embodiments, the targeting moiety is an asialoglycoprotein receptor ligand. In some embodiments, compositions for delivering an anti-HBV RNAi agent to a liver cell in vivo are described that include an anti-HBV RNAi agent linked to an N-acetylgalactosamine targeting ligand.

In some embodiments, one or more of the disclosed anti-HBV RNAi agents is administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

The use of RNAi agent(s) against hepatitis B virus are methods for therapeutic and/or prophylactic treatment of diseases/disorders associated with HBV infection. Described anti-HBV RNAi agents mediate RNA interference to inhibit the expression of one or more genes required for hepatitis B virus replication and/or pathogenesis. In particular, for example, anti-HBV RNAi agents can inhibit viral polymerase, capsid protein, surface antigen, e- antigen and/or protein X in a cell, tissue or body of a mammal. Anti-HBV RNAi agents can be used to treat HBV infection. Anti-HBV RNAi agents can also be used to treat or prevent chronic liver diseases/disorders, inflammatory diseases, fibrotic diseases, and proliferative disorders such as cancers associated with HBV infection. In some embodiments, the methods further comprise treating hepatitis D virus (HDV) in the subject. Such methods include administering an anti-HBV RNAi agent to a human or animal infected with HBV. Additionally, compositions for delivering anti-HBV RNAi agents to liver cells in vivo are described.

Pharmaceutical compositions containing one or more anti-HBV RNAi agents can be administered in a variety of ways depending on whether local or systemic treatment is required. Administration may be, without limitation, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (eg, via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

The disclosed anti-HBV RNAi agents and/or compositions containing them can be used in methods of therapeutically treating HBV infection or disease or conditions caused by HBV infection. Such methods include administering an anti-HBV RNAi agent described herein to a subject, such as a human or animal.

As used herein, the terms oligonucleotide and polynucleotide mean a polymer of linked nucleosides, each of which may be independently modified or unmodified.

As used herein, the term RNAi agent or RNAi trigger means a composition that contains an RNA oligonucleotide molecule or an RNA-like oligonucleotide molecule (e.g., chemically modified RNA) that is capable of disrupting or inhibiting sequence-specific translation of messenger RNA (mRNA) transcripts way. As used herein, RNAi agents may function through an RNA interference mechanism (i.e., induce RNA interference by interacting with the RNA interference pathway system (RNA-induced gene shutdown complex or RISC) of mammalian cells) or any alternative mechanism(s). (s) or path(s). Although RNAi agents, as that term is used herein, are believed to function primarily through the mechanism of RNA interference, the RNAi agents described are not associated with or limited to any particular pathway or mechanism of action. The RNAi agents described herein consist of a coding strand and an antisense strand and include, but are not limited to: small interfering RNA (siRNA), double-stranded RNA (dsRNA), siRNA (siRNA), short hairpin RNA (shRNA), and enzyme substrates Dicer. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted. RNAi agents may consist of modified nucleotides and/or one or more non-phosphodiester linkages.

As used herein, the terms turn off, reduce, inhibit, suppress, or downregulate the expression of a given gene mean that the expression of the gene, measured by the concentration of RNA transcribed from the gene, or the concentration of the polypeptide, protein, or protein subunit translated from the mRNA in the cell , group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with oligomeric compounds, such as the RNAi agents described herein, compared to a second cell , a group of cells, tissue, organ or subject that has not been subjected to such treatment.

As used herein, the term sequence or nucleotide sequence means a contiguous series or order of nucleotide bases or nucleotides, described by a sequence of letters using standard nomenclature.

As used herein, the term nucleotide base or nucleotide is a heterocyclic pyrimidine or purine compound that is a standard constituent of all nucleic acids and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). The nucleotide base can be further modified to include, but is not limited to, universal bases, hydrophobic bases, mixed bases, extended bases, and fluorine-containing bases.

As used herein, unless otherwise noted, the term complementary is used to describe a first nucleotide sequence (e.g., the coding strand of an RNAi agent or target mRNA) with respect to a second nucleotide sequence (e.g., an antisense sequence of an RNAi agent or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide, including the first nucleotide sequence, to hybridize (form hydrogen bonds between base pairs under physiological conditions for a mammal (or similar in vitro conditions)) and form a duplex or double helical structure under certain conditions with the oligonucleotide or polynucleotide, including the second nucleotide subsequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimetics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

As used herein, the term absolutely complementary or fully complementary means that all (100%) of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide. The contiguous sequence may contain all or part of the first or second nucleotide sequence.

As used herein, the term partially complementary means that in a hybridized pair of nucleotide sequences, at least 70% (but not all) of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide.

As used herein, the term substantially complementary means that, in a hybridized pair of nucleotide sequences, at least about 85% (but not all) of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide. The terms complementary, fully complementary, and substantially complementary as used herein may be used to refer to bases matching between a coding strand and the antisense strand of a double-stranded RNAi agent, between an antisense strand of an RNAi agent and a target mRNA sequence, or between a single-stranded antisense oligonucleotide and a target mRNA sequence.

As used herein, the term substantially identical or substantially identical to a nucleotide sequence means that the nucleotide sequence contains a sequence that is at least about 85% or more, preferably at least 90%, at least 95% identical to a nucleotide sequence. or at least 99% identical when compared to the reference sequence. Percent sequence identity was determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions at which identical nucleobases occur in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage sequence identity. The inventions described herein cover nucleotide sequences substantially identical to those described herein, for example in Table. 2, 3, and 4. In some embodiments, the sequences described herein are completely identical or at least about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98 or 99% identical to the sequences described herein, for example in table. 1, 2, 3 and 4.

As used herein, the terms treat, treat, and the like. mean ways

- 45 044937 or steps performed to alleviate or reduce the number, severity and/or frequency of one or more symptoms of a disease or condition in a subject.

As used herein, the phrase cellular administration in relation to an oligomeric compound means functionalized delivery of the oligomeric compound into a cell. The phrase functionalized delivery means delivery of an oligomeric compound into a cell in a manner that allows the oligomeric compound to exhibit an expected biological activity, such as sequence-specific inhibition of gene expression.

Unless otherwise indicated, the use of a symbol in the context of this document means that any group or groups that fall within the scope of the inventions described herein may be attached herein.

As used herein, the term isomers refers to compounds having identical molecular formulas but differing in the nature or sequence of binding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called stereoisomers. Stereoisomers that are not mirror images of each other are called diastereomers, and stereoisomers that are mirror images that are not identical when superimposed are called enantiomers or, in some cases, optical isomers. A carbon atom bonded to four non-identical substituents is called a chiral center.

Herein, unless a structure is specifically stated to have a particular conformation, for each structure in which asymmetric centers are present and which therefore gives rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure described herein is intended to reflects all such possible isomers, including their optically pure and racemic forms. For example, the structures described herein are intended to encompass mixtures of diastereomers as well as individual stereoisomers.

When used in the claims set forth herein, the phrase consisting of excludes any element, step or ingredient not mentioned in the claims. When used in the claims of this document, the phrase essentially consisting of limits the scope of the claims to specific materials or steps and those that do not significantly affect the essential and novel characteristics of the claimed invention.

One of ordinary skill in the art will readily appreciate that the compounds and compositions described herein may have certain atoms (eg, N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is exposed. Accordingly, when using the structures presented herein, it is contemplated that certain functional groups, such as, for example, OH, SH or NH, may be protonated or deprotonated.

The present invention is intended to cover the described compounds and compositions, regardless of their environmental (eg, pH)-dependent protonation state, as will be readily apparent to one of ordinary skill in the art.

All technical and scientific terms used herein, unless otherwise defined, have the same meaning as would be understood by one of ordinary skill in the art. Examples of methods and materials are described herein, although suitable methods and materials similar or equivalent to those described below may be used to test or analyze the present invention. All publications, patent applications, patents and other literature referenced herein are incorporated herein in their entirety by reference. In case of conflict, this description, including definitions, will control. In addition, materials, methods, and examples are provided for illustrative purposes only and are not intended to be limiting.

Other features and advantages of the invention will become clear from the detailed description presented below, as well as from the claims.

Detailed description

Disclosed herein are RNAi agents for inhibiting hepatitis B virus (HBV) expression (herein referred to as anti-HBV RNAi agents or anti-HBV RNAi triggers). Each HBV RNAi agent contains a coding strand and an antisense strand. Each of the coding strand and the antisense strand can be between 16 and 30 nucleotides in length. In some embodiments, each of the coding and antisense strands may be between 17 and 26 nucleotides in length. The coding and antisense strands may be the same length, or they may be different lengths. In some embodiments, the coding and antisense strands are each independently between 17 and 26 nucleotides in length. In some embodiments, the coding and antisense strands are each independently between 17 and 21 nucleotides in length. In some embodiments, the coding and antisense strands are each between 21 and 26 nucleotides in length. In some embodiments, the coding strand is about 19 nucleotides in length, then

- 46 044937 as an antisense strand is about 21 nucleotides long. In some embodiments, the coding strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, the coding strand and the antisense strand are each 26 nucleotides in length. In some embodiments, the coding and antisense strands of the RNAi agent are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. This region of absolute or substantial complementarity between the coding strand and the antisense strand is typically 15-25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length and located 5' at or near the end of the antisense strand (eg, this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not absolutely or substantially complementary).

Each coding strand and antisense strand contains a core fragment sequence that is 16 to 23 nucleotides in length. The core sequence of the antisense strand is 100% (absolutely) complementary, or at least about 85% (substantially) complementary, to the nucleotide sequence (sometimes referred to, for example, as a target sequence) present in the target HBV mRNA. The coding strand core sequence is 100% (absolutely) complementary or at least about 85% (substantially) complementary to the core sequence in the antisense strand, and therefore the coding strand core sequence is absolutely identical or at least about 85% identical. % identical to the nucleotide sequence (target sequence) present in the target HBV mRNA. The coding strand core sequence may be the same length as the corresponding antisense core sequence, or it may be of a different length. In some embodiments, the core sequence of the antisense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the core sequence of the coding strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

Examples of nucleotide sequences of the coding and antisense strands used to form RNAi agents against HBV are presented in Table. 3 and 4. Examples of duplexes of RNAi agents that include the nucleotide sequences from table. 3 and 4 are presented in table. 5.

The coding and antisense strands of the HBV RNAi agent combine to form a duplex. The coding strand and antisense strand of the HBV RNAi agent may be partially, substantially, or completely complementary to each other. Within the complementary duplex region, the coding strand core sequence is at least about 85% complementary or 100% complementary to the antisense strand core sequence. In some embodiments, the coding strand core fragment sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least about 85% or is 100% complementary to the corresponding 16, 17, 18, 19, 20, or 21 nucleotide antisense core sequence (i.e., the coding strand core and antisense strand sequences of the HBV RNAi agent have a region of at least 16, at least at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that are at least 85% or 100% base paired).

In some embodiments, the antisense strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences listed in Table. 2 or 3. In some embodiments, the coding strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the coding strand sequences listed in Table. 2 or 4.

The HBV RNAi agent coding and antisense strands described herein independently range in length from 16 to 30 nucleotides. In some embodiments, the coding and antisense strands are independently between 17 and 26 nucleotides in length. In some embodiments, the coding and antisense strands are between 19 and 26 nucleotides in length. In some embodiments, the described coding and antisense strands of the RNAi agent are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The coding and antisense strands may be the same length, or they may be different lengths. In some embodiments, the coding strand and the antisense strand are each 26 nucleotides in length. In some embodiments, the coding strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the coding strand is 22 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the coding strand is 21 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the coding strand is 19 nucleotides long and the antisense strand is 21 nucleotides long.

- 47 044937

The coding strand and/or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5 or 6 nucleotides (extension) at the 3' end, 5' end, or both 3' and 5' ends of the core sequences. Additional antisense strand nucleotides (if present) may or may not be complementary to the corresponding sequence in the HBV mRNA. Additional nucleotides of the coding strand (if present) may or may not be identical to the corresponding sequence in HBV mRNA. Additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding additional nucleotides of the coding strand (if present).

As used herein, the extension comprises 1, 2, 3, 4, 5 or 6 nucleotides at the 5 and/or 3' end of the coding strand core sequence and/or the antisense core sequence. Extension nucleotides on the coding strand may or may not be complementary to core fragment sequence nucleotides or extension nucleotides on the corresponding antisense strand. Conversely, extension nucleotides on the antisense strand may or may not be complementary to core sequence nucleotides or extension nucleotides on the corresponding coding strand. In some embodiments, the coding strand and antisense strand of the RNAi agent comprise extensions at the 3' and 5' ends. In some embodiments, one or more of the 3' extension nucleotides of one strand are base paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides on one strand are not base paired with one or more 5' extension nucleotides on the other strand. In some embodiments, the anti-HBV RNAi agent has an antisense strand having a 3' extension and a coding strand having a 5' extension.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the anti-HBV RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding HBV mRNA sequence. In some embodiments, the 3' antisense strand extension includes or consists of, without limitation: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U , UU (each of them is written from 5' to 3').

In some embodiments, the 3' end of the antisense strand may include additional nucleosides lacking a nitrogenous base (Ab). In some embodiments, an Ab or AbAb may be added to the 3' end of the antisense strand.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand having a 5' extension of 1, 2, 3, 4, or 5 nucleotides. In other embodiments, the anti-HBV RNAi agent comprises an antisense strand having a 1 or 2 nucleotide 5' extension. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding HBV mRNA sequence. In some embodiments, the 5' antisense strand extension includes or consists of, but is not limited to, UA, TU, U, T, UU, TT, CUC (each written 5' to 3'). The antisense strand may have any of the 3' extensions described above in combination with any of the 5' antisense strand extensions described above (if any).

In some embodiments, the anti-HBV RNAi agent comprises a coding strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more of the coding strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the HBV mRNA sequence. In some embodiments, a 3' coding strand extension includes or consists of, without limitation: T, UT, TT, UU, UUT, TTT, or TTTT (each written 5' to 3').

In some embodiments, the 3' end of the coding strand may include additional nucleosides lacking a nitrogenous base. In some embodiments, a UUAb, UAb, or Ab may be added to the 3' end of the coding strand. In some embodiments, one or more baseless nucleosides added to the 3' end of the coding strand may be inverted (invAb). In some embodiments, one or more inverted nucleosides lacking a nitrogenous base may be inserted between the targeting ligand and the nucleotide sequence of the RNAi agent coding strand. In some embodiments, the inclusion of one or more inverted nucleosides lacking a nitrogenous base at or near the end or ends of the coding strand of the RNAi agent may result in increased activity of the RNAi agent or other desired properties.

In some embodiments, the anti-HBV RNAi agent comprises a coding strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments

- 48 044937 one or more of the nucleotides of the coding strand extension contain uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the HBV mRNA sequence. In some embodiments, the 5' coding strand extension may be, without limitation: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each of them is written from 5' to 3'). The coding strand may have a 3' extension and/or a 5' extension.

In some embodiments, the 5' end of the coding strand may include an additional nucleoside lacking a nitrogenous base (Ab) or nucleosides lacking a nitrogenous base (AbAb). In some embodiments, one or more baseless nucleosides added to the 5' end of the coding strand may be inverted (invAb). In some embodiments, one or more inverted nucleosides lacking a nitrogenous base may be inserted between the targeting ligand and the nucleotide sequence of the RNAi agent coding strand. In some embodiments, the inclusion of one or more inverted nucleosides lacking a nitrogenous base at or near the end or ends of the coding strand of the RNAi agent may result in increased activity of the RNAi agent or other desired properties.

Examples of nucleotide sequences used to form RNAi agents against HBV are presented in table. 3 and 4. In some embodiments, the antisense strand of the HBV RNAi agent includes any of the nucleotide sequences presented in table. 3. In some embodiments, the antisense strand of the HBV RNAi agent includes the nucleotide sequence 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2 -20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26 or 2-26 any of the sequences presented in table. 3. In some embodiments, the anti-HBV RNAi agent coding strand includes any of the nucleotide sequences presented in Table. 4. In some embodiments, the anti-HBV RNAi agent coding strand includes the nucleotide sequence 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1 -26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23 , 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5 -25, 5-26, 6-23, 6-24, 625, 6-26, 7-24, 7-25, 7-25, 8-25, 8-26, any of the sequences presented in table. 4.

In some embodiments, the coding and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the coding and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the coding strand and the 3' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, the 3' end of the coding strand and the 5' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is blunt ended. As used herein, the term blunt end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two joined strands are complementary (form a complementary base pair). In some embodiments, the 5' end of the coding strand and the 3' end of the antisense strand of the RNAi agent form the open end.

In some embodiments, the 3' end of the coding strand and the 5' end of the antisense strand of the RNAi agent form the open end. In some embodiments, both ends of the RNAi agent form an open end. In some embodiments, neither end of the RNAi agent is exposed. As used herein, the term open end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two joined strands form a pair (ie, do not form an overhang) but are not complementary (ie, form a non-complementary pair). As used herein, the term overhang is a fragment of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent. Unpaired nucleotides can be present on the coding strand or antisense strand, creating overhangs at the 3' end or at the 5' end. In some embodiments, the RNAi agent comprises: a blunt end and an open end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, an open end and a 5' overhang, an open end and a 3' overhang, two 5' overhanging ends, two 3' overhanging ends, 5' overhanging end and 3' overhanging end, two open ends or two blunt ends.

A nucleotide base (nucleotide) is a heterocyclic pyrimidine or purine compound that is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term nucleotide may include a modified nucleotide (such as, for example, a nucleotide mimetic, an ablation region (Ab), or a surrogate replacement fragment).

Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve the activity of the compound in cells while increasing the stability of these compounds in serum, and can also minimize the likelihood of activation of interferon activity in humans when administered such a polynucleotide or oligonucleotide construct.

In some embodiments, the anti-HBV RNAi agent is produced or offered as a salt, mixed salt, or free acid. In some embodiments, the anti-HBV RNAi agent is provided as a sodium salt. Such forms are within the scope of the inventions described herein.

Modified nucleotides

In some embodiments, the anti-HBV RNAi agent comprises one or more modified nucleotides. As used herein, the modified nucleotide is a non-ribonucleotide nucleotide (2'-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least at least 98%, at least 99 or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimetics, baseless nucleotides (referred to herein as Ab), 2'-modified nucleotides, 3' to 3' (inverted) nucleotides (referred to herein as Ab) as invdN, invN, invn, invAb), non-naturally occurring base-containing nucleotides, bridging nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimetics (unlocked nucleotide analogues, referred to herein as N _una or NUNA ), blocked nucleotides (referred to herein as N _lna or NLNA), 3'-O-methoxy (2'-internucleoside-linked) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinonucleotides ( referred to herein as NfANA or Nf _ANA ), 5'-Me, 2'-fluoronucleotide (referred to herein as 5Me-Nf), morpholinonucleotides, vinylphosphonate deoxyribonucleotides (referred to herein as vpdN), vinylphosphonate-containing nucleotides and cyclopropylphosphonate-containing nucleotides. containing nucleotides (cPrpN). 2'Modified nucleotides (i.e., nucleotides with a group other than a hydroxyl group at the 2' position of a five-membered sugar ring) include, but are not limited to, 2'-O-methylnucleotides (referred to herein as the lowercase n in nucleotide sequences), 2'deoxy-2'-fluoronucleotides (referred to herein as Nf, also referred to herein as 2'-fluoronucleotide), 2'-deoxynucleotides (referred to herein as dN), 2'-methoxyethyl (2 '-O-2-methoxyethyl)nucleotides (referred to herein as NM or 2'-MOE), 2'-aminonucleotides and 2'-alkylnucleotides. Not all positions in a given connection need to be modified equally. Conversely, more than one modification can be made to a single HBV RNAi agent, or even to a single nucleotide. The coding strands and antisense strands of the HBV RNAi agent can be synthesized and/or modified by methods known in the art. A modification in one nucleotide is independent of a modification in another nucleotide.

Modified nucleobases include synthetic and natural nucleotide bases such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2-, N-6-, and O-6-substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5- propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g. 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) adenine derivatives and guanine, 2-alkyl (for example, 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil , cytosine, 5-propynyluracil, 5propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothimine, 5-uracil (pseudouracil), 4-thiouracil, 8halogen, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halogen (e.g. 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-dezazaguanine, 7 -deazaadenine, 3-deazaguanine and 3-deazaadenine.

In some embodiments, all or substantially all of the RNAi agent nucleotides are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent in which there are four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the coding strand and and in the antisense strand, are ribonucleotides. As used herein, a coding strand in which substantially all of the present nucleotides are modified nucleotides is a coding strand in which two or less (ie, 0, 1, or 2) of the nucleotides in the coding strand are ribonucleotides. As used herein, an antisense coding strand in which substantially all of the present nucleotides are modified nucleotides is an antisense strand in which two or less (ie, 0, 1, or 2) of the nucleotides in the coding strand are ribonucleotides. In some embodiments, one or more RNAi agent nucleotides are ribonucleotides.

- 50 044937

Modified internucleoside linkages

In some embodiments, one or more nucleotides of the HBV RNAi agent are linked by non-standard linkages or backbones (ie, modified internucleoside linkages or modified backbones). In some embodiments, the modified internucleoside linkage is a non-phosphate covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, 5'phosphorothioate groups (referred to herein as lowercase s), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g. 3'-aminophosphoramidates, aminoalkylphosphoramidates or thionophosphoramidates), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholine linkages, boranophosphates having conventional 3'-5' linkages, 2'-5'-linked analogues of boranophosphates or boranophosphates having inverse polarity, with adjacent pairs of nucleoside units connected by bonds from 3'-5' to 5'-3' or from 2'-5' to 5'2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl linkages between sugars, mixed heteroatom and alkyl or cycloalkyl linkages between sugars, or one or more short-chain heteroatom or heterocyclic linkages between sugars. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimine and methylene backbones. hydrazine skeletons, sulfonate and sulfonamide backbones, amide backbones and other backbones having mixed N, O, S and CH ₂ components.

In some embodiments, the coding strand of an anti-HBV RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an anti-HBV RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the chain and the antisense chain may independently contain 1, 2, 3, 4, 5 or 6 phosphorothioate bonds. In some embodiments, the coding strand of the HBV RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the HBV RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the coding strand and the antisense strand may independently contain 1, 2, 3 or 4 phosphorothioate bonds.

In some embodiments, the anti-HBV RNAi agent coding strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3' end of the coding strand. In some embodiments, at least two phosphorothioate internucleoside linkages are between nucleotides at positions 1-3, 2-4, 3-5, 46, 4-5, or 6-8 from the 5' end of the coding strand. In some embodiments, the antisense strand of the HBV RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 5' end of the coding strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24- 26 from the 5' end. In some embodiments, the anti-HBV RNAi agent contains at least two phosphorothioate internucleoside linkages on the coding strand and three or four phosphorothioate internucleoside linkages on the antisense strand.

In some embodiments, the anti-HBV RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2'-modified nucleoside is combined with a modified internucleoside linkage.

RNAi agents against HBV

In some embodiments, the anti-HBV RNAi agents described herein target the HBV gene at or near the positions of the HBV genome shown in the following table. 1. In some embodiments, the antisense strand of the HBV RNAi agent described herein includes a core fragment sequence that is wholly, substantially, or at least partially complementary to the HBV 19-mer target sequence described in Table. 1.

- 51 044937

Table 1. Approximate 19-mer HBV cDNA target sequences for HBV RNAi agents (derived from hepatitis B virus (ADW2 subtype), genotype A, complete genome in GenBank

AM282986.1 (SEQ ID NO: 1)).

SEQ ID No. 19-mer HBV target sequences (5' - 3') Genome Position SEQ ID NO: 1 HBV gene target region 2 Gtggtggacttctctcaat 256-274 ORF S 3 tggtggacttctctcaatt 257-275 ORF S 4 ggacttctctcaattttct 261-279 ORF S 5 Gctgtaggcataaattggt 1780-1798 ORF X 6 ctgtaggcataaattggtc 1781-1799 ORF X

In some embodiments, the anti-HBV RNAi agent includes an antisense strand in which position 19 (5'^3') is capable of forming a base pair with position 1 of the 19-mer target sequence described in Table. 1. In some embodiments, the anti-HBV RNAi agent includes an antisense strand in which position 1 (5'^3') is capable of forming a base pair with position 19 of the 19-mer target sequence described in Table. 1.

In some embodiments, the anti-HBV RNAi agent includes an antisense strand in which position 2 (5'^3') is capable of forming a base pair with position 18 of the 19-mer target sequence described in Table. 1. In some embodiments, the anti-HBV RNAi agent includes an antisense strand in which positions 2-18 (5'^3') are capable of forming base pairs with each of the corresponding complementary bases located at positions 18-2 of the 19-mer target sequence described in table. 1.

In some embodiments, anti-HBV RNAi agents include core

The 19-mer nucleotide sequences shown in the following table. 2.

Table 2. Antisense core and coding strand sequences of the HBV RNAi agent (N=any nucleotide)

SEQ ID NO:

Antisense sequence(5’ 3’) (19-mer)

AUUGAGAGAAGUC CAC CAC UUUGAGAGAAGUC CAC CAC AUUGAGAGAAGUC CAC CAN UUUGAGAGAAGUC CAC CAN NUUGAGAGAAGUC CAC CAN AAUUGAGAGAAGUCSASSA UAUUGAGAGAAGUCSASSA AAUUGAGAGAAGUCCACCN UAUUGAGAGAAGUCCACCN NAUUGAGAGAAGUCCACCN AGAAAAUUGAGA GAAGUCC UGAAAAUUGAGAGAAGUCC AGAAAAUUGAGAGAAGUCN UGAAAAUUGAGAGAAGUCN NGAAAAUUGAGAGAAGUCN ACCAAUUUAUGCCUACAGC UCCAAUUUAUGCCUACAGC ACCAAUUUAUGCCUACAGN UCCAAUUUAUGCCUACAGN NCCAAUUUAUGCCUACAGN GAC CAAUUUAUGC CUACAG AAC CAAUU UAUGC CUACAG UAC CAAUUUAUGC CUACAG GAC CAAUUUAUGC CUACAN AAC CAAUUUAUGC CUACAN UAC CAAUUUAUGC CUACAN NAC CAAUUUAUGC CUACAN

SEQ ID NO:

Coding sequence (5' 3') (19-mer)

GUggUggacUUcUcUcaaU GUggUggacUUcUcUcaaA NUggUggacUUcUcUcaaU NUggUggacUUcUcUcaaA NUggUggacUUcUcUcaaN UggUggacUUcUcUcaaUU UggUggacUUcUcUcaaUA NggUggacUUcUcUcaaUU NggU ggacUUcUcUcaaUA NggUggacUUcUcUcaaUN ggacUUcUcUcaaUUUUcU ggacUUcUcUcaaUUUUcA NgacUUcUcUcaaUUUUcU NgacUUcUcUcaaUUUUcA NgacUUcUcUcaaUUUUcN GcUgUaggcaUaaaU UggU GcUgUaggcaUaaaUUggA NcUgUaggcaUaaaUUggU NcUgUaggcaUaaaUUggA NcUgUaggcaUaaaUUggN cUgUaggcaUaaaUUggUc cUgUaggcaUaaaUUggUU cUgUaggcaUaaaUUggUA NUgUaggcaUa aaUUggUc NUgUaggcaUaaaUUggUU NUgUaggcaUaaaUUggUA NUgUaggcaUaaaUUggUN

Genome Position SEQ ID NO: 1 256-274 256-274 256-274 256-274 256-274 257-275 257-275 257-275 257-275 257-275 261-279 261-279 261-279 261-27 9 261 -279 1780-1798 1780-1798 1780-1798 1780-1798 1780-1798 1781-1799 1781-1799 1781-1799 1781-1799 1781-1799 1781-1799 1781-17 99

The coding strands and antisense strands of the HBV RNAi agent, which contain or consist of the nucleotide sequences from Table. 2 may be modified nucleotides or unmodified nucleotides. In some embodiments, anti-HBV RNAi agents having coding and antisense strand sequences that contain or consist of nucleotide sequences from Table. 2, consist entirely or substantially entirely of modified nucleotides.

In some embodiments, the antisense strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences listed in Table. 2. In some embodiments, the coding strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the coding strand sequences listed in Table. 2.

The modified sequences of the antisense strand of the HBV RNAi agent, as well as their original unmodified sequences, are presented in Table. 3. The modified sequences of the coding strand of the anti-HBV RNAi agent, as well as their original unmodified sequences, are presented in Table. 4. When forming RNAi agents against HBV, each of the nucleotides in each of the unmodified sequences listed in table. 3 and 4 may be a modified nucleotide.

- 52 044937

Throughout this document (including Tables 3 and 4), the following conventions are used to designate modified nucleotides, targeting groups, and linking groups. As one of ordinary skill in the art will appreciate, unless otherwise indicated in the sequence, the monomers, when present in the oligonucleotide, are interconnected by 5'-3' phosphodiester bonds:

A = adenosine 3'-phosphate;

C = cytidine 3'-phosphate;

G = guanosine 3'-phosphate;

U = uridine-3'-phosphate n = any 2'-OMe-modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O -methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2' -O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate and = 2'-O-methyluridine-3'-phosphate us = 2'-O- Methyluridine-3'-phosphorothioate

Nf = any 2'-fluoro-modified nucleotide

Af = 2'-fluoroadenosine 3'-phosphate

Afs = 2'-fluoroadenosine-3'-phosphorothioate

Cf = 2'-fluorocytidine-3'-phosphate

Cfs = 2'-fluorocytidine-3'-phosphorothioate

Gf = 2'-fluoroguanosine-3'-phosphate

Gfs = 2'-fluoroguanosine-3'-phosphorothioate

Tf = 2'-fluoro-5'-methyluridine-3'-phosphate

Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate

Uf = 2'-fluorouridine-3'-phosphate

Ufs = 2'-fluorouridine 3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine 3'-phosphate

N _una = 2',3'-seconucleotide mimetics (unblocked nucleotide analogues)

N _lna = blocked nucleotide

Nf _ANA = 2'-F-arabinonucleotide

NM = 2'-methoxyethylnucleotide

AM = 2'-methoxyethyl adenosine 3'-phosphate

AMs = 2'-methoxyethyladenosine-3'-phosphorothioate

TM = 2'-methoxyethylthymidine-3'-phosphate

TMs = 2'-methoxyethylthymidine-3'-phosphorothioate

R = ribitol (invdN) = any inverted deoxyribonucleotide (3'-3'-linked nucleotide) (invAb) = inverted (3'-3'-linked) deoxyribonucleotide devoid of a nitrogenous base, see table. 6 (invAb)s = inverted (3'-3'-linked) deoxyribonucleotide 5'-phosphorothioate, see table. 6 (invn) = any inverted 2'-OMe nucleotide (3'-3'-linked nucleotide) s = phosphorothioate bond vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me, 2'-fluoronucleotide cPrp = cyclopropylphosphonate, see table 6 epTcPr = see table. 6 erTM = see table. 6

One of ordinary skill in the art will appreciate that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of the monomer instead of a phosphate group ex vivo. Thus, for example, as shown above in the image of the structure of AD05070, the g-modified nucleotide at the 3' end of the AM06606-AS antisense strand has a hydroxyl group located at the 3' position. Unless otherwise expressly stated herein, such understanding of one of ordinary skill in the art is used when describing the anti-HBV RNAi agents and the compositions of anti-HBV RNAi agents described herein.

Targeting groups and linking groups include the following moieties, chemically

- 53 044937 whose structures are given below in the table. 6: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s , (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each coding strand and/or antisense strand may have any of the targeting or binding groups listed below, as well as other targeting or binding groups conjugated to the 5' and/or 3' end of the sequence.

Table 3. Antisense strand sequences of the HBV RNAi agent

Antisense chain identifier Modified sequence (5' - 3') SEQ ID NO: Unmodified sequence (5' -+ 3') SEQ ID NO: AM03508-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsu suAu 61 UACCAAUUUAUGCCUACAGGCCUUAU 149 AM04441-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscs u 62 UACCAAUUUAUGCCUACAGGCCU 150 AM04442-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccs u 63 UACCAAUUUAUGCCUACAGGCCU 150 AM04443-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc 64 UACCAAUUUAUGCCUACAGGC 151 AM04661-AS usGfsugaAfgCfGfaaguGfcAfcacsusu 65 UGUGAAGCGAAGUGCACACUU 152 AM04768-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcsus ccgc 66 UACCAAUUUAUGCCUACAGCCUCCCGC 153 AM04769-AS vpusAfscCfaAfuUfuAfuGfcCfuAfcAfgCfcs usccgc 67 UACCAAUUUAUGCCUACAGCCUCCCGC 153 AM05011-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfgusu 68 UACCAAUUUAUGCCUACAGUU 154 AM05012-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsc 69 UACCAAUUUAUGCCUACAGGC 151 AM05013-AS vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfs 70 UACCAAUUUAUGCCUACAGGC 151 AM05014-AS vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 71 UACCAAUUUAUGCCUACAGUU 154 AM05052-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfsa 72 AUUGAGAGAAGUCCACCACGA 155 AM05053-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgsa 73 AUUGAGAGAAGUCCACCACGA 155 AM05054-AS asUfSusGfaGfaGfaAfgUfcCfaCfcAfcusu 74 AUUGAGAGAAGUCCACCACUU 156 AM05055-AS vpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfs a 75 UUUGAGAGAAGUCCACCACGA 157 AM05056-AS asAfSusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 76 AAUUGAGAGAAGUC CAC CAC G 158 AM05057-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfacsg 77 AAUUGAGAGAAGUCCACCAC G 158 AM05058-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfausu 78 AAUUGAGAGAAGUCCACCAUU 159 AM05060-AS vpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfs g 79 UAUUGAGAGAAGUCCACCAC G 160 AM05351-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfgGfsu 80 UACCAAUUUAUGCCUACAGGU 161 AM05608-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgsusu 81 UACCAAUUUAUGCCUACAGUU 154 AM05609-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 82 UACCAAUUUAUGCCUACAGCC 162 AM05610-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusu 83 UACCAAUUUAUGCCUACAGCCUU 163 AM05611-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusc 84 UACCAAUUUAUGCCUACAGCCUC 164 AM05612-AS usAf scscaauUfuAfuGfcCfuacagcsc 85 UACCAAUUUAUGCCUACAGCC 162 AM05613-AS usAf scscaauUfuAfuGfcCfuacagccusu 86 UACCAAUUUAUGCCUACAGCCUU 163 AM05614-AS usAfscscaauUfuAfuGfcCfuacagccusc 87 UACCAAUUUAUGCCUACAGCCUC 164 AM05618-AS asUfsusgagaGfaAfgUfcCfaccacusu 88 AUUGAGAGAAGUCCACCACUU 156 AM05621-AS usUfSusGfaGfaGfaAfgUfcCfaCfcAfcusu 89 UUUGAGAGAAGUCCACCACUU 165 AM05623-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcggusu 90 AUUGAGAGAAGUCCACCACGGUU 166 AM05626-AS asUfsusgagaGfaAfgUfcCfaccacggusu 91 AUUGAGAGAAGUCCACCACGGUU 166 AM05628-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgagsu 92 AUUGAGAGAAGUCCACCACGAGU 167 AM05631-AS usAfSusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 93 UAUUGAGAGAAGUC CAC CAC G 160 AM05632-AS usAfsusugagAfgAfaGfuCfcaccacsg 94 UAUUGAGAGAAGUC CAC CAC G 160 AM05633-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgus u 95 UAUUGAGAGAAGUC CAC CAC GUU 168 AM05634-AS usAf susugagAfgAfaGfuCfcaccacgasg 96 UAUUGAGAGAAGUC CAC CAC GAG 169 AM05635-AS usAfSusUfgAfgAfgAfaGfuCfcAfcCfaCfgas g 97 UAUUGAGAGAAGUC CAC CAC GAG 169 AM05637-AS usAf susUfgAfgAfgAfaGfuCf cAfcCfaCfgsa 98 UAUUGAGAGAAGUC CAC CAC GA 170 AM05638-AS usAfsusugagAfgAfaGfuCfcaccacgsa 99 UAUUGAGAGAAGUC CAC CAC GA 170 AM05747-AS asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 100 AGAAAAUUGAGAGAAGUCCCAC 171 AM05849-AS usAfscsCfaAfuuuauGfcCfuAfcAfgusu 101 UACCAAUUUAUGCCUACAGUU 154 AM05850-AS usAfscsCfaAfuuuauGfcCfuAfcAfgcsc 102 UACCAAUUUAUGCCUACAGCC 162 AM05851-AS usAf scsCfaAfuuuauGfcCfuAfcAfgcusu 103 UACCAAUUUAUGCCUACAGCUU 172 AM05852-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccsu 104 UACCAAUUUAUGCCUACAGCCU 173 AM05853-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccusu 105 UACCAAUUUAUGCCUACAGCCUU 163 AM05854-AS usAf scsCfaAfuuuauGfcCfuAfcAfgccusc 106 UACCAAUUUAUGCCUACAGCCUC 164 AM05855-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgu su 107 UACCAAUUUAUGCCUACAGUU 154

- 54 044937

AM05860-AS cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfаС _Ί f sg UAUUGAGAGAAGUCCACCACG 160 AM05862-AS usAfsusUfgAfgagaaGfuCfcAfcCfausu 109 UAUUGAGAGAAGUC CACCAUU 174 AM05863-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsg 110 UAUUGAGAGAAGUCCACCACG 160 AM05864-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsusu 111 UAUUGAGAGAAGUC CACCACUU 175 AM05865-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa 112 UAUUGAGAGAAGUCCACCACGA 17 0 AM05867-AS vpusAfsusUfgAfgagaaGfuCfcAfcCfaCfsg 113 UAUUGAGAGAAGUCCACCACG 160 AM05873-AS usUfsusGfaGfagaagUfcCfaCfcAfcusu 114 UUUGAGAGAAGUC CACCACUU 165 AM05874-AS usUfsusGfaGfagaagUfcCfaCfcAfcgsa 115 UUUGAGAGAAGUCCACCACGA 157 AM05875-AS usUfsusGfaGfagaagUfcCfaCfcAfcgusu 116 UUUGAGAGAAGUC CAC CAC GUU 17 6 AM05876-AS usUfsusGfaGfagaagUfcCfaCfcAfcgasg 117 UUUGAGAGAAGUC CAC CAC GAG 177 AM05877-AS cPrpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcu . _{Ί o} Ho SU UUUGAGAGAAGUCCACCACUU, 165 AM06074-AS cPrpusAfsusUfgAfgagaaGfuCfcAfcCfacsu SU UAUUGAGAGAAGUC CACCACUU _{± ? 5} AM06142-AS usAfsusUfgAfgagaaGfuCfcAfcCfacusu 120 UAUUGAGAGAAGUC CACCACUU 175 AM06143-AS usAfsusUfgAfgagaaGfuCfcAfcCfacgusu 121 UAUUGAGAGAAGUCCACCACGUU 168 AM06144-AS usAfsusUfgAfgagaaGfuCfcAfcCfacuus(in vAb) UAUUGAGAGAAGUC CACCACUU _{± ? 5} AM06145-AS usAfsusUfgAfgagaaGfuCfcAfcCfacgasg 123 UAUUGAGAGAAGUCCACCACGAG 169 AM06222-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfacusu 124 UAUUGAGAGAAGUC CACCACUU 175 AM06281-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 125 AGAAAAUUGAGAGAAGUCCUU 17 8 AM06282-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcase 126 AGAAAAUUGAGAGAAGUCCCAC 171 AM06283-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 127 AGAAAAUUGAGAGAAGUCCACUU 17 9 AM06284-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc 128 AGAAAAUUGAGAGAAGUCCACC 18 0 AM06285-AS usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 129 UGAAAAUUGAGAGAAGUCCUU 152 AM0 62 8 6-AS usGfsasAfaAfuUfgAfgAfgAfaGfuCfcase 130 UGAAAAUUGAGAGAAGUCCAC 181 AM06299-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu 131 ACCAAUUUAUGCCUACAGCUU 182 AM06300-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 132 ACCAAUUUAUGCCUACAGCCUU 183 AM06301-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc 133 ACCAAUUUAUGCCUACAGCCUC 184 AM06302-AS usCfScsAfaUfuUfaUfgCfcUfaCfaGfcusu 134 UCCAAUUUAUGCCUACAGCUU 185

AM06303-AS usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 135 UCCAAUUUAUGCCUACAGCCUU 186 AM06463-AS cPrpusAfscsCfaAfuUfuAfuGfcCf uAfcAfgc ₁₃₆ sc UACCAAUUUAUGCCUACAGCC 162 AM06464-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfgsesc 137 UACCAAUUUAUGCCUACAGCC 162 AM06465-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgs _Ί 1J o CSC UACCAAUUUAUGCCUACAGCC _Ί 162 AM06604-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu 139 UACCAAUUUAUGCCUACAGCU 187 AM06606-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfgcsg 14 0 UACCAAUUUAUGCCUACAGCG 188 AM06608-AS asAf scsCfaAfuUfuAfuGfcCfuAfcAfgcsc 141 AACCAAUUUAUGCCUACAGCC 189 AM06611-AS usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu 142 UACCAAUUUAUGCCUACAGUU 154 AM06612-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfgCfsc 143 UACCAAUUUAUGCCUACAGCC 162 AM06614-AS asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 144 ACCAAUUUAUGCCUACAGCCU 190 AM06616-AS usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 145 UCCAAUUUAUGCCUACAGCCU 191 AM06618-AS asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg 146 ACCAAUUUAUGCCUACAGCCG 192 AM06620-AS usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg 147 UCCAAUUUAUGCCUACAGCCG 193 AM06751-AS usAf scsCfaAfuUfuAfuGfcCfuAfcAfggsg 14 8 UACCAAUUUAUGCCUACAGGG 194

Table 4. Anti-HBV RNAi agent coding strand sequences

P circuit identifier Modified sequence (5' -+ 3') SEQ ID NO: Unmodified sequence (5' -+ 3') SEQ ID NO: AM04444-SS (NAG25)uusgsccuguagGfCfAfuaaauuggguaus(invdT ) 195 UUGCCUGUAGGCAUAAAAUUGGUAUT 275 AM04445-SS (NAG25)uauausgsccuguagGfCfAfuaaauuggu(invdA ) 196 UAUAUGCCUGUAGGCAUAAAAUUGGUA 276 AM04767-SS (NAG25)gcggagsgcuguagGfCfAfuaaauuggTM(invdA ) 197 GCGGAGGCUGUAGGCAUAAAAUUGGTA 277 AM05010-SS (NAG25)scsuguagGfCfAfuaaauugguauus(invAb) 198 CUGUAGGCAUAAAAUUGGUAUU 278 AM05015-SS (NAG25)sgsccuguagGfCfAfuaaauugguas(invAb) 199 GCCUGUAGGCAUAAAAUUGGUA 279 AM05016-SS (NAG25)sgsccuguagGfCfAfuaaauuggus(invdA) 200 GCCUGUAGGCAUAAAAUUGGUA 279 AM05017-SS (NAG25)sgsccuguagGfCfAfuaaauugguAMs(invAb) 201 GCCUGUAGGCAUAAAAUUGGUA 279 AM05018-SS (NAG25)sgsccuguagGfCfAfuaaauuggTMAMs(invAb) 202 GCCUGUAGGCAUAAAAUUGGTA 280

- 55 044937

AM05019-SS (NAG25)sasacuguagGfCfAfuaaauugguas(invAb) 203 AACUGUAGGCAUAAAAUUGGUA 281 AM05034-SS (NAG25)suscguggugGfAfCfuucucucaaus(invAb) 204 UCGUGGUGGACUUCUCUCAAU 282 AM05046-SS (NAG25)sasaguggugGfAfCfuucucucaaus(invAb) 205 AAGUGGUGGACUUCUCUCAAU 283 AM05047-SS (NAG25)suscguggugGfAfCfuucucucaAMTMs(invAb) 206 UCGUGGUGGACUUCUCUCAAT 284 AM05048-SS (NAG25)scsgugguggAfCfUfucucucaauus(invAb) 207 CGUGGUGGACUUCUCUCAAUU 285 AM05049-SS (NAG25)sasaugguggAfCfUfucucucaauus(invAb) 208 AAUGGUGGACUUCUCUCAAUU 286 AM05050-SS (NAG25)scsgugguggAfCfUfucucucaaTMTMs(invAb) 209 CGUGGUGGACUUCUCUCAATT 287 AM05051-SS (NAG25)sgsgacuucuCfUfCfaauuuucuaas(invAb) 210 GGACUUCUCUCAAUUUUCUAA 288 AM05063-SS (NAG25)scsgugguggAfCfUfucucucaauas(invAb) 211 CGUGGUGGACUUCUCUCAAUA 289 AM05064-SS (NAG25)suscguggugGfAfCfuucucucaaas(invAb) 212 UCGUGGUGGACUUCUCUCAAA 290 AM05346-SS (NAG31)sasccuguagGfCfAfuaaauugguas(invAb) 213 ACCUGUAGGCAUAAAAUUGGUA 291 AM05347-SS (NAG31)s(invAb)scuguagGfCfAfuaaauugguas(inv Ab) 214 CUGUAGGCAUAAAAUUGGUA 292 AM05606-SS (NAG25)s(invAb)scuguagGfCfAfuaaauugguas(inv Ab) 215 CUGUAGGCAUAAAAUUGGUA 292 AM05607-SS (NAG37)s(invAb)scuguagGfCfAfuaaauugguas(inv Ab) 216 CUGUAGGCAUAAAAUUGGUA 292 AM05615-SS (NAG25)s(invAb)sacuguagGfCfAfuaaauugguas(in vAb) 217 ACUGUAGGCAUAAAAUUGGUA 293 AM05616-SS (NAG25)sgsgcuguagGfCfAfuaaauugguas(invAb) 218 GGCUGUAGGCAUAAAAUUGGUA 294 AM05617-SS (NAG37)sasaguggugGfAfCfuucucucaaus(invAb) 219 AAGUGGUGGACUUCUCUCAAU 283 AM05620-SS (NAG25)sasaguggugGfAfCfuucucucaaus(invAb) 220 AAGUGGUGGACUUCUCUCAAA 295 AM05622-SS (NAG25)scscguggugGfAfCfuucucucaaus(invAb) 221 CCGUGGUGGACUUCUCUCAAU 296 AM05624-SS (NAG25)s(invAb)sccguggugGfAfCfuucucucaaus(i nvAb) 222 CCGUGGUGGACUUCUCUCAAU 296 AM05627-SS (NAG25)scsucguggugGfAfCfuucucucaaus(invAb) 223 CUCGUGGUGGACUUCUCUCAAU 297 AM05629-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaaus(inv Ab) 224 GUggUggacUUcUcUcaaU 298 AM05630-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaauusu(i nvAb) 225 GUGGUGGACUUCUCUCAAUUU 299 AM05636-SS (NAG25)suscgugguggAfCfUfucucucaauus(invAb) 226 UCGUGGUGGACUUCUCUCAAUU 300 AM05639-SS (NAG25)s(invAb)sugguggAfCfUfucucucaauus(inv Ab) 227 UggUggacUUcUcUcaaUU 301 AM05640-SS (NAG37)s(invAb)sugguggAfCfUfucucucaauus(inv Ab) 228 UggUggacUUcUcUcaaUU 301 AM05746-SS (NAG25)sgsuggacuuCfUfCfucaauuuucus(invAb) 229 GUGGACUUCUCUCAAUUUUCU 302 AM05856-SS (NAG25)s(invAb)scuguagGfCfAfuaaauuggguausu(i nvAb) 230 CUGUAGGCAUAAAAUUGGUAUU 278 AM05857-SS (NAG25)s(invAb)sgcuguagGfCfAfuaaauugguausu( invAb) 231 GCUGUAGGCAUAAAUUGGUAUU 303 AM05858-SS (NAG25)s(invAb)sggcuguagGfCfAfuaaauugguausu (invAb) 232 GGCUGUAGGCAUAAAAUUGGUAUU 304 AM05859-SS (NAG25)s(invAb)saacuguagGfCfAfuaaauuggguausu (invAb) 233 AACUGUAGGCAUAAAAUUGGUAUU 305 AM05868-SS (NAG25) s (invAb) ugguggAfCfUfucucucaauausu (in vAb) 234 UGGUGGACUUCUCUCAAUAUU 306 AM05869-SS (NAG25)s(invAb)sgugguggAfCfUfucucucaauausu( invAb) 235 GUGGUGGACUUCUCUCAAUAUU 307 AM05870-SS (NAG25)sasaugguggAfCfUfucucucaauausu(invAb) 236 AAUGGUGGACUUCUCUCAAUAUU 308 AM05871-SS (NAG25)scsgugguggAfCfUfucucucaauausu(invAb) 237 CGUGGUGGACUUCUCUCAAUAUU 309 AM05872-SS (NAG31)scsgugguggAfCfUfucucucaauas(invAb) 238 CGUGGUGGACUUCUCUCAAUA 289 AM05879-SS (NAG25)s(invAb)saaguggugGfAfCfuucucucaaus(i nvAb) 239 AAGUGGUGGACUUCUCUCAAU 283 AM05880-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaaausu(i nvAb) 240 GUGGUGGACUUCUCUCAAAUU 310 AM05881-SS (NAG25)s(invAb)scguggugGfAfCfuucucucaaausu( invAb) 241 CGUGGUGGACUUCUCUCAAAUU 311 AM05882-SS (NAG25)sasaguggugGfAfCfuucucucaaausu(invAb) 242 AAGUGGUGGACUUCUCUCAAAUU 312 AM05883-SS (NAG25)suscguggugGfAfCfuucucucaaausu(invAb) 243 UCGUGGUGGACUUCUCUCAAAUU 313 AM06146-SS (NAG37)s(invAb)sgugguggAfCfUfucucucaauausu( invAb) 244 GUGGUGGACUUCUCUCAAUAUU 307 AM06147-SS (NAG37)s(invAb)scgugguggAfCfUfucucucaauausu 245 CGUGGUGGACUUCUCUCAAUAUU 309

- 56 044937

(invAb) AM06148-SS (NAG37)s(invAb)scucgugguggAfCfUfucucucaauas (invAb) 246 CUCGUGGUGGACUUCUCUCAAUA 314 AM06149-SS (NAG37)s(invAb)scucgugguggAfCfUfucucucaauau su(invAb) 247 CUCGUGGUGGACUUCUCUCAAUAUU 315 AM06150-SS (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguas(i nvAb) 248 GGCUGUAGGCAUAAAAUUGGUA 294 AM06151-SS (NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguas (invAb) 249 GAGGCUGUAGGCAUAAAAUUGGUA 316 AM06152-SS (NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguau su(invAb) 250 GAGGCUGUAGGCAUAAAAUUGGUAUU 317 AM06287-SS (NAG37)s(invAb)sggacuuCfUfCfucaauuuucus(inv Ab) 251 GGACUUCUCUCAAUUUUCU 318 AM06288-SS (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(i nvAb) 252 GUGGACUUCUCUCAAUUUUCU 302 AM06289-SS (NAG37)s(invAb)sgguggacuuCfUfCfucaauuuucus( invAb) 253 GGUGGACUUCUCUCAAUUUUCU 319 AM06290-SS (NAG37)s(invAb)sggacuuCfUfCfucaauuuucas(inv Ab) 254 GGACUUCUCUCAAUUUUCA 320 AM06291-SS (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucas(i nvAb) 255 GUGGACUUCUCUCAAUUUUCA 321 AM06304-SS (NAG37)s(invAb)sgcuguaGfGfCfauaaauuggas(inv Ab) 256 GcUgUaggcaUaaaUUggU 322 AM06305-SS (NAG37)s(invAb)sggcuguaGfGfCfauaaauuggus(in vAb) 257 GGCUGUAGGCAUAAAAUUGGU 323 AM06306-SS (NAG37)s(invAb)sgaggcuguaGfGfCfauaaauuggus( invAb) 258 GAGGCUGUAGGCAUAAAAUUGGU 324 AM06307-SS (NAG37)s(invAb)sgcuguaGfGfCfauaaauuggas(inv Ab) 259 GCUGUAGGCAUAAAAUUGGA 325 AM06308-SS (NAG37)s(invAb)sggcuguaGfGfCfauaaauuggas(in vAb) 260 GGCUGUAGGCAUAAAAUUGGA 326 AM06603-SS (NAG37)s(invAb)sagcuguagGfCfAfuaaauugguas(i nvAb) 261 AGCUGUAGGCAUAAAAUUGGUA 327 AM06605-SS (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(i nvAb) 262 GGCUGUAGGCAUAAAAUUGGUA 328 AM06607-SS (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguus(i nvAb) 263 GGCUGUAGGCAUAAAAUUGGUU 329 AM06609-SS (NAG37)s(invAb)scuguagGfCfAfuaaauugguasuus( invAb) 264 CUGUAGGCAUAAAAUUGGUAUU 278 AM06610-SS (NAG37)s(invAb)scuGfuAfgGfCfAfuAfaAfuUfgGfu asuus(invAb) 265 CUGUAGGCAUAAAAUUGGUAUU 278 AM06613-SS (NAG37)s(invAb)saggcuguaGfGfCfauaaauuggus(i nvAb) 266 AGGCUGUAGGCAUAAAAUUGGU 330 AM06615-SS (NAG37)s(invAb)saggcuguaGfGfCfauaaauuggas(i nvAb) 267 AGGCUGUAGGCAUAAAAUUGGA 331 AM06617-SS (NAG37)s(invAb)scggcuguaGfGfCfauaaauuggus(i nvAb) 268 CGGCUGUAGGCAUAAAAUUGGU 332 AM06619-SS (NAG37)s(invAb)scggcuguaGfGfCfauaaauuggas(i nvAb) 269 CGGCUGUAGGCAUAAAAUUGGA 333 AM06750-SS (NAG37)s(invAb)scccuguagGfCfAfuaaauugguas(i nvAb) 270 CCCUGUAGGCAUAAAAUUGGUA 334 AM06752-SS (NAG37)csgcuguagGfCfAfuaaauugguas(invAb) 271 GGCUGUAGGCAUAAAAUUGGUA 328 AM06753-SS (NAG37)csccuguagGfCfAfuaaauugguas(invAb) 272 CCCUGUAGGCAUAAAAUUGGUA 334 AM06776-SS (NAG25)s(invAb)sguggacuuCfUfCfucaauuuucus(i nvAb) 273 GUGGACUUCUCUCAAUUUUCU 302 AM06777-SS (NAG25)s(invAb)scgcuguagGfCfAfuaaauugguas(i nvAb) 274 GGCUGUAGGCAUAAAAUUGGUA 328

The anti-HBV RNAi agents described herein are generated by coupling the antisense strand to the coding strand. The coding chain containing the sequence given in table. 4 can be hybridized with any antisense strand containing the sequence shown in table. 3, provided that the two sequences have a region that is at least about 85% complementary to a contiguous nucleotide sequence of 16, 17, 18, 19, 20, or 21 nucleotides.

In some embodiments, the antisense strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences listed in Table. 3. In some embodiments, the coding strand of the HBV RNAi agent described herein differs by 0, 1, 2, or 3 nucleotides from any of the coding strand sequences listed in Table. 4.

In some embodiments, the antisense strand of the HBV RNAi agent comprises any of the nucleotide sequences presented in Table. 3. In some embodiments, the antisense strand of the HBV RNAi agent comprises the nucleotide sequence (5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2- 19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26 or 2-26 any of the sequences presented in table. 3.

In some embodiments, the anti-HBV RNAi agent coding strand comprises any of the nucleotide sequences presented in Table. 4. In some embodiments, the coding strand of the HBV RNAi agent comprises the nucleotide sequence (5' to 3') 1-17, 2-17, 3-17, 4-17, 1-18, 2-18 , 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 420, 1-21, 2-21, 3-21 , 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4 -24, 1-25, 2-25, 3- 57 044937

25, 4-25, 1-26, 2-26, 3-26 or 4-26 any of the sequences presented in table. 4.

For the anti-HBV RNAi agents described herein, the nucleotide at position 1 of the antisense strand (5' to 3') may be perfectly complementary to the HBV gene or may not be complementary to the HBV gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3') is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3' end) forms an A:U or U:A base pair with the coding strand.

In some embodiments, the antisense strand of the HBV RNAi agent comprises the nucleotide sequence (5' to 3') 2-18 or 2-19 of any of the antisense strand sequences in Table 1. 3. In some embodiments, the coding strand of the HBV RNAi agent comprises the nucleotide sequence (5' to 3') 1-17 or 1-18 of any of the coding strand sequences in Table 1. 4.

In some embodiments, the anti-HBV RNAi agent includes (i) an antisense strand comprising the nucleotide sequence (5' to 3') 2-18 or 2-19 of any of the antisense strand sequences from Table 3, and (ii) a coding strand containing the nucleotide sequence (from the 5' end to the 3' end) 1-17 or 1-18 of any of the coding strand sequences from Table. 4.

The coding chain containing the sequence given in table. 4 can be hybridized with any antisense strand containing the sequence shown in table. 3, provided that the two sequences have a region that is at least about 85% complementary to a contiguous nucleotide sequence of 16, 17, 18, 19, 20, or 21 nucleotides. Examples of paired sequences, designated by duplex identification numbers, are shown in Table. 5.

In some embodiments, the anti-HBV RNAi agent comprises any of the duplex IDs provided herein. In some embodiments, the anti-HBV RNAi agent consists of any of the duplex identification numbers provided herein. In some embodiments, the anti-HBV RNAi agent comprises the nucleotide sequences of the coding strand and/or antisense strand of any of the duplex identification numbers provided herein. In some embodiments, the anti-HBV RNAi agent comprises the nucleotide sequences of the coding strand and antisense strand of any of the duplex identification numbers provided herein, and a targeting group and/or a linking group, wherein the targeting group and/or binding group is covalently linked (i.e., e. conjugated) to the coding strand or antisense strand. In some embodiments, the anti-HBV RNAi agent comprises modified nucleotide sequences of the coding strand and antisense strand of any of the duplex identification numbers provided herein. In some embodiments, the anti-HBV RNAi agent comprises modified nucleotide sequences of the coding strand and the antisense strand of any of the duplex identification numbers provided herein, and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the coding group. strand or antisense strand.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand and a coding strand having the nucleotide sequences of any of the antisense strand/coding strand duplexes from Table 1. 5, and additionally contains a targeting group representing an asialoglycoprotein receptor ligand.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand and a coding strand having any of the nucleotide sequences of the antisense strand and/or the coding strand of any of the duplexes from Table 1. 5, and further contains a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), ( NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, ( NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36 )s, (NAG37), (NAG37)s.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand and a coding strand having modified nucleotide sequences of any of the nucleotide sequences of the antisense strand and/or the coding strand of any of the duplexes from Table. 5.

In some embodiments, the anti-HBV RNAi agent comprises an antisense strand and a coding strand having modified nucleotide sequences of any of the nucleotide sequences of the antisense strand and/or the coding strand of any of the duplexes from Table. 5, and additionally contains a targeting group representing an asialoglycoprotein receptor ligand.

- 58 044937

In some embodiments, the anti-HBV RNAi agent comprises any of the duplexes from Table. 5.

In some embodiments, the anti-HBV RNAi agent consists of any of the duplexes from Table. 5.

Table 5. Examples of anti-HBV RNAi agent duplexes

Duplex ID Antisense strand ID Coding Chain ID AD03498 AM03508-AS AM04445-SS AD03499 AM04441-AS AM04444-SS AD03500 AM04442-AS AM04444-SS AD03501 AM04443-AS AM04444-SS AD03738 AM04768-AS AM04767-SS AD03739 AM04769-AS AM04767-SS AD03967 AM04443-AS AM05010-SS AD03968 AM05011-AS AM05010-SS AD03969 AM04443-AS AM05015-SS AD03970 AM05011-AS AM05019-SS AD03971 AM05012-AS AM05015-SS AD03972 AM04443-AS AM05016-SS AD03973 AM04443-AS AM05017-SS AD03974 AM04443-AS AM05018-SS AD03975 AM05013-AS AM05015-SS AD03976 AM05014-AS AM05019-SS AD03977 AM05013-AS AM05017-SS AD03978 AM05013-AS AM04444-SS AD04001 AM05052-AS AM05034-SS

Duplex ID Antisense chain identifier Coding chain identifier AD04426 AM05623-AS AM05622-SS AD04427 AM05623-AS AM05624-SS AD04428 AM05626-AS AM05622-SS AD04429 AM05626-AS AM05624-SS AD04430 AMO5628-AS AM05627-SS AD04431 AM05054-AS AM05629-SS AD04432 AM05054-AS AM05630-SS AD04433 AM05631-AS AM05048-SS AD04434 AM05632-AS AM05048-SS AD04435 AM05633-AS AM05048-SS AD04436 AM05635-AS AM05048-SS AD04437 AM05634-AS AM05048-SS AD04438 AM05637-AS AM05636-SS AD04439 AM05638-AS AM05636-SS AD04440 AM05058-AS AM05639-SS AD04441 AM05057-AS AM05639-SS AD04442 AM05057-AS AM05640-SS AD04511 AM05747-AS AM05746-SS AD04570 AM05011-AS AM05856-SS

- 59 044937

AD04002 AM05053-AS AM05034-SS AD04003 AM05054-AS AM05046-SS AD04004 AM05052-AS AM05047-SS AD04005 AM05055-AS AM05064-SS AD04006 AM05056-AS AM05048-SS AD04007 AM05057-AS AM05048-SS AD04008 AM05058-AS AM05049-SS AD04009 AM05056-AS AM05050-SS AD04010 AM05060-AS AM05063-SS AD04176 AM05351-AS AM05346-SS AD04177 AM04443-AS AM05347-SS AD04178 AM05011-AS AM05347-SS AD04412 AM05011-AS AM05606-SS AD04413 AM05011-AS AM05607-SS AD04414 AM05608-AS AM05606-SS AD04415 AM05011-AS AM05615-SS AD04416 AM05609-AS AM05616-SS AD04417 AM05610-AS AM05616-SS AD04418 AM05611-AS AM05616-SS AD04419 AM05612-AS AM05616-SS AD04420 AM05613-AS AM05616-SS AD04421 AM05614-AS AM05616-SS AD04422 AM05054-AS AM05617-SS AD04423 AM05618-AS AM05046-SS AD04425 AM05621-AS AM05620-SS op duplex ID Identifier op antisense oh chain Coding Chain ID AD04598 AM05874-AS AM05883-SS AD04599 AM05877-AS AM05620-SS AD04734 AM06074-AS AM05869-SS AD04771 AM06142-AS AM06146-SS AD04772 AM06143-AS AM06147-SS AD04773 AM06144-AS AM06146-SS AD04774 AM06145-AS AM06148-SS AD04775 AM06145-AS AM06149-SS AD04776 AM05850-AS AM06150-SS AD04777 AM05854-AS AM06151-SS AD04778 AM05854-AS AM06152-SS AD04822 AMO6222-AS AM06146-SS AD04823 AM05609-AS AM06150-SS AD04871 AM06281-AS AM06287-SS AD04872 AMO6282-AS AM06288-SS AD04873 AM06283-AS AM06288-SS AD04874 AMO6284-AS AM06289-SS AD04875 AM06285-AS AM06290-SS AD04876 AM06286-AS AM06291-SS AD04881 AM06299-AS AM06304-SS AD04882 AM06300-AS AM06305-SS AD04883 AM06301-AS AM06306-SS AD04884 AM06302-AS AM06307-SS AD04885 AM06303-AS AM06308-SS AD04962 AM05864-AS AM06146-SS AD04963 AM05855-AS AM05607-SS AD04981 AM06463-AS AM06150-SS AD04982 AM06464-AS AM06150-SS AD04983 AM06465-AS AM06150-SS AD05069 AM06604-AS AM06603-SS AD05070 AM06606-AS AM06605-SS AD05071 AM06608-AS AM06607-SS

AD04571 AM05849-AS AM05856-SS AD04572 AM05850-AS AM05856-SS AD04573 AM05851-AS AM05857-SS AD04574 AM05852-AS AM05857-SS AD04575 AM05853-AS AM05858-SS AD04576 AM05854-AS AM05858-SS AD04577 AM05011-AS AM05859-SS AD04578 AM05850-AS AM05858-SS AD04579 AM05014-AS AM05347-SS AD04580 AM05855-AS AM05347-SS AD04581 AM05860-AS AM05063-SS AD04583 AMO5862-AS AM05868-SS AD04584 AM05863-AS AM05868-SS AD04585 AM05864-AS AM05869-SS AD04586 AM05865-AS AM05869-SS AD04587 AMO5862-AS AM05870-SS AD04588 AM05863-AS AM05871-SS AD04590 AM05867-AS AM05063-SS AD04591 AM05860-AS AM05872-SS AD04592 AM05054-AS AM05879-SS AD04593 AM05873-AS AM05880-SS AD04594 AM05874-AS AM05880-SS AD04595 AM05875-AS AM05881-SS AD04596 AM05876-AS AM05881-SS AD04597 AM05873-AS AM05882-SS

AD05072 AD05073 AD05074

AD05075 AD05076 AD05077 AD05078 AD05147 AD05148 AD05149 AD05164 AD05165

AM05011-AS AM06611-AS

AM06612-AS AM06614-AS

AM06616-AS AM06618-AS AM06620-AS~ AM06751-AS

AM06606-AS AM06751-AS

AMO 6282-AS AM06606-AS

AM06609-SS AM06610-SS

AM0615Q-SS AM06613-SS AM06615-SS AM06617-SS AM06619^SS~ AM06750-SS

AM06752-SS AM06753-SS

AM06776-SS AM06777-SS

In some embodiments, the anti-HBV RNAi agent is produced or offered as a salt, mixed salt, or free acid. The RNAi agents described herein, when delivered to a cell expressing the HBV gene, inhibit or reduce the expression of one or more HBV genes in vivo.

Targeting groups, linking groups and delivering carrier media

In some embodiments, the anti-HBV RNAi agent is conjugated to one or more non-nucleotide moieties, including, without limitation, a targeting moiety, a binding moiety, a delivery polymer, or a delivery vehicle. The non-nucleotide group may enhance the targeting, delivery or binding of the RNAi agent. Examples of targeting groups and binding groups are presented in table b. The non-nucleotide group may be covalently linked to the 3' and/or 5' end of either the coding strand and/or the antisense strand. In some embodiments, the anti-HBV RNAi agent comprises a non-nucleotide moiety associated with the 3' and/or 5' end of the coding strand. In some embodiments, the non-nucleotide moiety is linked to the 5' end of the anti-HBV RNAi agent coding strand. The non-nucleotide group may be directly or indirectly linked to the RNAi agent via a linker/binding group. In some embodiments, the non-nucleotide moiety is linked to the RNAi agent via a transient, cleavable or reversible bond or linker.

In some embodiments, the non-nucleotide moiety enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to enhance cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide moiety enhances endocytosis of the RNAi agent.

Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate to which they are attached to improve cell-specific distribution and cell-specific uptake of the conjugate. The targeting group may be monovalent, divalent, trivalent, tetravalent, or higher valency. Typical targeting moieties include, but are not limited to, cell surface affinity compounds, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and cell surface affinity antibody mimetics. In some embodiments, the targeting moiety is linked to the RNAi agent via a linker, such as a PEG linker or one, two, or three baseless and/or ribitol (ribose baseless) groups. In some embodiments, the targeting group comprises a cluster of galactose derivatives.

The anti-HBV RNAi agents described herein can be synthesized with a reactive group, such as an amino group, at the 5' end. The reactive group can be used to subsequently attach a targeting moiety using methods typical in the art.

In some embodiments, the targeting moiety comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes galactose and galactose derivatives having an affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Examples of galactose derivative include, but are not limited to: galactose, galactosamine, Nformylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-n-butanoylgalactosamine and N-isobutanoylgalactosamine (see, for example: Iobst, S.T. and Drickamer, K. J.B.C. 1996, 271, 6686 ) . Galactose derivatives and clusters of galactose derivatives are known in the art and can be used to target in vivo oligonucleotides and other molecules to the liver (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. Binding of ASGPr ligands to ASGPr(s) promotes cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. ASGPr ligands can be monomeric (eg, have one galactose derivative) or multimeric (eg, have multiple galactose derivatives). A galactose derivative or a cluster of galactose derivatives can be attached to the 3' end or 5' end of an RNAi polynucleotide using methods known in the art. The preparation of targeting groups, such as clusters of galactose derivatives, is described, for example, in US patent applications No. 15/452,324 and 15/452,423, the contents of which are incorporated herein by reference in their entirety.

As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule via its C-1 carbon atom. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a tri-antennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster contains N-acetylgalactosamines. In some embodiments, the galactose derivative cluster contains three N-acetylgalactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a quadruple galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster contains four N-acetylgalactosamines.

Herein, the galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. Herein, a galactose derivative tetramer contains four galactose derivatives, each associated with a central branch point. Galactose derivatives can be attached to the central branch point by

- 61 044937 vom carbon atoms C-1 of saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, US Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG ₃ spacer. The branch point can be any small molecule that allows attachment of three galactose derivatives and further allows attachment of the branch point to the RNAi agent. An example of a branch point group is dilysine or diglutamate. Attachment of the branch point to the RNAi agent can be accomplished through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative contains or consists of N-acetylgalactosamine. In some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which may be, for example, an N-acetylgalactosamine tetramer.

In some embodiments, pharmaceutical compositions are described for delivering an anti-HBV RNAi agent to a liver cell in vivo. Such pharmaceutical compositions may include, for example, an anti-HBV RNAi agent conjugated to a cluster of galactose derivatives. In some embodiments, the galactose derivative cluster consists of a galactose derivative trimer, which may be, for example, an N-acetylgalactosamine trimer, or a galactose derivative tetramer, which may be, for example, an N-acetylgalactosamine tetramer.

Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, ( NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31 )s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37 ), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s. Other targeting groups are known in the art, including galactose cluster targeting ligands.

In some embodiments, the binding group is conjugated to an RNAi agent. The linking group facilitates covalent binding of the agent to the targeting group or delivery polymer or delivery carrier medium. The binding group may be linked to the 3' or 5' end of the coding strand or antisense strand of the RNAi agent. In some embodiments, the binding group is linked to the coding strand of the RNAi agent. In some embodiments, the binding group is conjugated to the 5' or 3' end of the coding strand of the RNAi agent. In some embodiments, the binding group is conjugated to the 5' end of the coding strand of the RNAi agent. Examples of linking groups include, but are not limited to: reactive groups such as primary amines and alkynes, alkyl groups, baseless nucleosides, ribitol (baseless ribose) and/or PEG groups.

A linker or binding group is a connection between two atoms that links one chemical group of interest (such as an RNAi agent) or segment to another chemical group of interest (such as a targeting group or delivery polymer) or segment through one or more covalent bonds. An unstable connection contains an unstable connection. The connection may optionally include a spacer that increases the distance between the two connected atoms. The spacer may further increase the flexibility and/or length of the connection. Spacers may include, without limitation, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the above list is not intended to limit the scope of this description.

Any of the nucleotide sequences of the anti-HBV RNAi agent listed in Table. 3 and 4, both modified and unmodified, may contain a targeting group and/or a linking group at the 3' or 5' end. Any of the anti-HBV RNAi agent sequences listed in Table. 3 and 4, which contains a targeting group and/or a binding group at the 3' or 5' end, may alternatively not contain a targeting group and/or a binding group at the 3' or 5' end, or may contain a different targeting group and/ or a linking group at the 3' or 5' end, including, without limitation, the groups shown in table. 3. Any of the anti-HBV RNAi agent duplexes listed in Table. 5, modified or unmodified, may further contain a targeting group and/or a linking group, including, without limitation, the groups shown in table. 3, and the targeting group or binding group can be attached to the 3' or 5' end of the coding strand or antisense strand of the HBV RNAi agent duplex.

Examples of targeting groups and binding groups are presented in table. 6. In table. 4 depicts several embodiments of anti-HBV RNAi agent coding strands having a targeting moiety or binding moiety linked to the 5' or 3' end.

- 62 044937

Table 6. Structures representing various modified nucleotides, targeting groups and linking groups

- 63 044937

- 64 044937

- 65 044937

- 66 044937

- 67 044937

- 68 044937

In each of the above structures from table. 6 NAG contains N-acetylgalactosamine or other ASGPr ligand, as will be understood by one of ordinary skill in the art, to be attached in view of the above structures and the description given herein. For example, in some embodiments, NAG in the structures shown in table. 6 is represented by the following structure:

- 69 044937

(N-acetylgalactosamine)

Each (NAGx) can be attached to an anti-HBV RNAi agent via a phosphate group (as in (NAG25), (NAG30) and (NAG31)) or a phosphorothioate group (as in (NAG25)s, (NAG29)s, (NAG30)s , (NAG31)s or (NAG37)s), or other linking group.

About S

Phosphate group

Phosphorothioate group

Other linking groups known in the art may be used.

Delivery carrier media

In some embodiments, a delivery carrier medium can be used to deliver an RNAi agent into a cell or tissue. A delivery vehicle is a compound that enhances the delivery of an RNAi agent into a cell or tissue. The delivery carrier medium may include or consist of, without limitation: a polymer such as an amphipathic polymer, a membrane-active polymer, a peptide, a melitin peptide, a melitin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine .

In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, diphosphatidylcholines (DPCs), or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting moieties, lipids (including, but not limited to, cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000/053722, WO 2008/0022309, WO 2011/104169 and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference) or other delivery systems available in the art.

Pharmaceutical compositions and formulations

The anti-HBV RNAi agents described herein can be obtained in the form of pharmaceutical compositions or formulations. In some embodiments, the pharmaceutical compositions include at least one anti-HBV RNAi agent. These pharmaceutical compositions are particularly used to inhibit the expression of a target mRNA in a target cell, group of cells, tissue or organism. The pharmaceutical compositions can be used to treat a subject having a disease or disorder in which reducing the concentration of the target mRNA or inhibiting the expression of the target gene will have a beneficial effect. The pharmaceutical compositions can be used to treat a subject who is at risk of developing a disease or disorder in which reducing the concentration of the target mRNA or inhibiting the expression of the target gene will have a beneficial effect. In one embodiment, the method includes administering an anti-HBV RNAi agent linked to a targeting ligand as described herein to the subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including carrier vehicles, carriers, diluents, and/or delivery polymers) are added to pharmaceutical compositions, including an anti-HBV RNAi agent, thereby forming a pharmaceutical composition suitable for delivery to humans in vivo.

Pharmaceutical compositions that include an anti-HBV RNAi agent and the methods described herein can reduce the concentration of the target mRNA in a cell, group of cells, group of cells, tissue or subject, including: administering to the subject a therapeutically effective amount of the agent described herein RNAi against HBV, thereby inhibiting the expression of the target mRNA in the subject.

In some embodiments, the disclosed pharmaceutical compositions comprising an anti-HBV RNAi agent are used to treat or relieve clinical manifestations associated with HBV infection. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment, prevention, or relief. In some embodiments, administration of any of the described anti-HBV RNAi agents can be used to reduce the number, severity, and/or frequency of disease symptoms in a subject.

The disclosed pharmaceutical compositions, including an anti-HBV RNAi agent, can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reducing or inhibiting the expression of anti-HBV mRNA. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an anti-HBV RNAi agent is administered to a subject, thereby treating a symptom. In other embodiments, a prophylactically effective amount of one or more anti-HBV RNAi agents is administered to the subject, thereby preventing at least one symptom.

The route of administration is the route by which the anti-HBV RNAi agent is brought into contact with the body. In general, methods of administering drugs and nucleic acids for the treatment of mammals are well known in the art and can be used to administer the compositions described herein. The anti-HBV RNAi agents described herein can be administered by any suitable route in a formulation specifically designed for a particular route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

Pharmaceutical compositions comprising the anti-HBV RNAi agent described herein can be delivered to a cell, group of cells, tumor, tissue or subject using oligonucleotide delivery methods known in the art. In general, any acceptable method used in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery may be by local administration (eg, direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (eg, intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, inhalation ( aerosol), nasal, oral, rectal or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

Accordingly, in some embodiments, the pharmaceutical compositions described herein may contain one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to a subject.

As used herein, a pharmaceutical composition or drug includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than an active pharmaceutical ingredient (API, therapeutic agent, such as an anti-HBV RNAi agent) that are intentionally included in a drug delivery system. Excipients do not provide or are not intended to provide a therapeutic effect at the intended dose. Excipients may: a) assist in processing the drug delivery system during formulation, b) protect, maintain, or enhance the stability, bioavailability or patient tolerance of the API, c) assist in determining the identity of the product, and/or d) enhance any other characteristic of overall safety, effectiveness, delivery of APIs during storage or use. The pharmaceutically acceptable excipient may or may not be an inert substance.

Excipients include, but are not limited to: absorption enhancers, antiadhesives, antifoaming agents, antioxidants, binders, buffering agents, carriers, coating agents, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, dry diluents, fillers , flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity regulators, carrier media, water repellents and wetting agents .

Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or dispersions and sterile powders for the preparation of sterile solutions or dispersions for injection immediately prior to administration. For intravenous administration, acceptable vehicles include saline, bacteriostatic water, Cremophor ELTM (BASF, Parsipany, NJ, USA) or phosphate-buffered saline. It must be stable under the conditions of receipt and storage and must be protected from the contaminating effects of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerin, propylene glycol and liquid polyethylene glycol) and suitable mixtures thereof. Proper fluidity can be ensured, for example, by the use of coating agents such as lecithin, by maintaining the required particle size in the case of a dispersion, and also by the use of surfactants. In many cases it will be preferable to include isotonic agents such as sugars, polyhydric alcohols such as mannitol, sorbitol and sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example aluminum monostearate and gelatin.

Sterile injection solutions can be prepared by introducing the active compound in the required amount into a suitable solvent with one or a combination of the ingredients listed above, as appropriate, followed by sterilization by filtration. Essentially, dispersions are prepared by introducing the active compound into a sterile carrier medium that contains the basic dispersion medium and other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze drying, which results in the formation of a powder of the active ingredient and any additional desired ingredient from a previously sterilized solution by filtration.

Formulations suitable for intra-articular administration may be in the form of a sterile aqueous drug preparation, which may be in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. Liposome formulations or biodegradable polymer systems can also be used to incorporate drug for intra-articular and intraocular administration.

Active compounds can be formulated with carriers that will protect the compound from rapid elimination from the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Methods for preparing such compositions will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. They can be prepared in accordance with methods known to those skilled in the art, for example, as described in US Pat. No. 4,522,811.

Anti-HBV RNAi agents can be formulated in unit dosage form for ease of administration and dose uniformity. Dosage form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit containing a predetermined amount of active compound calculated to produce the desired therapeutic effect in combination with the desired pharmaceutical carrier. The specification for dosage forms of the present disclosure is dictated by and is directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved and the limitations inherent in the art of formulating such active compound for treatment of subjects.

The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, without limitation: antipruritics, astringents, local anesthetics or anti-inflammatory agents (eg, antihistamine, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs that express or contain the RNA agents described herein can be used as pharmaceutical compositions. As used herein, the term pharmacologically effective amount, therapeutically effective amount, or simply effective amount refers to that amount of an RNAi agent that achieves a pharmacological, therapeutic, or prophylactic result.

A substantially effective amount of the active compound will range from about 0.1 to about 100 mg/kg body weight/day, such as from about 1.0 to about 50 mg/kg body weight/day. In some embodiments, the effective amount of the active compound will range from about 0.25 to about 5 mg/kg body weight per dose. In some embodiments, the effective amount of the active ingredient will range from about 0.5 to about 3 mg/kg body weight per dose. The amount administered will also likely depend on variables such as the general health of the patient, the relative biological effectiveness of the compound being delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. It should also be understood that the initial dose administered may be increased beyond the above upper level to quickly achieve the desired blood concentration or tissue concentration, or the initial dose may be less than optimal.

To treat a disease or to form a drug or composition for treating a disease, the pharmaceutical compositions described herein, including an anti-HBV RNAi agent, can be combined with an excipient or with a second therapeutic agent or type of treatment, including, without limitation: a second or other RNAi agent , small molecule drug, antibody, antibody fragment and/or vaccine.

The disclosed anti-HBV RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged in kits, containers, packages or dispensers. Described

- 72 044937 herein, pharmaceutical compositions may be packaged in pre-filled syringes or vials.

Treatment Methods and Expression Inhibition

The anti-HBV RNAi agents described herein can be used to treat a subject (eg, human or mammal) having a disease or disorder that would benefit from administration of the compound. In some embodiments, the RNAi agents described herein can be used to treat a subject (eg, a human) having a disease or disorder that would benefit from reducing or inhibiting HBV mRNA expression. The subject is administered a therapeutically effective amount of any one or more RNAi agents. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. The described pharmaceutical compositions, including the anti-HBV RNAi agent, can be used as methods for the therapeutic treatment of diseases. Such methods include administering to a human or animal a pharmaceutical composition described herein.

In some embodiments, the anti-HBV RNAi agents described herein are used to treat a subject infected with HBV. In some embodiments, the disclosed anti-HBV RNAi agents are used to treat at least one symptom in a subject having an HBV infection. The subject is administered a therapeutically effective amount of any one or more disclosed RNAi agents.

In some embodiments, the subject has both an HBV infection and an HDV infection. In some embodiments, the anti-HBV RNAi agents described herein are used to treat a subject infected with both HBV and HDV. In some embodiments, the disclosed anti-HBV RNAi agents are used to treat at least one symptom in a subject having HBV or HDV infection. The subject is administered a therapeutically effective amount of any one or more disclosed RNAi agents.

In some embodiments, anti-HBV RNAi agents are used to treat or reverse clinical manifestations in a subject infected with HBV. The subject is administered a therapeutically effective amount of one or more anti-HBV RNAi agents or anti-HBV RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering to a subject to be treated a composition comprising an anti-HBV RNAi agent described herein.

In some embodiments, the gene expression level and/or concentration of HBV gene mRNA in a subject receiving a disclosed anti-HBV RNAi agent is reduced by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 , 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or greater than 99% relative to a subject receiving an HBV RNAi agent or to a subject not receiving an HBV RNAi agent . The level of gene expression and/or the concentration of mRNA in a subject may be reduced in a cell, group of cells and/or tissue of the subject. In some embodiments, the concentration of expressed HBV gene protein in a subject administered a disclosed anti-HBV RNAi agent is reduced by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60. 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or greater than 99% relative to a subject receiving an anti-HBV RNAi agent or to a subject not receiving an anti-HBV RNAi agent. The protein concentration in a subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. For example, in some embodiments, the amount or concentration of hepatitis B surface antigen (HBsAg) in a subject administered a disclosed anti-HBV RNAi agent is reduced by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45 , 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or greater than 99% relative to a subject receiving an HBV RNAi agent or to a subject not receiving an RNAi agent against HBV. In some embodiments, the amount or concentration of hepatitis B e antigen (HBeAg) in a subject administered a disclosed anti-HBV RNAi agent is reduced by at least about 5, 10, 15, 20, 25, 3θ, 35, 40, 45. 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or greater than 99% relative to a subject receiving an anti-HBV RNAi agent or to a subject not receiving an anti-HBV RNAi agent HBV. In some embodiments, the amount or serum concentration of HBV DNA in a subject administered a disclosed anti-HBV RNAi agent is reduced by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 , 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or greater than 99% relative to a subject receiving an anti-HBV RNAi agent or to a subject not receiving an anti-HBV RNAi agent. Reductions in the presence of serum HBV DNA concentrations, HBV gene expression, HBV mRNA, or HBV protein amounts or concentrations can be assessed by methods known in the art. Reducing or reducing the amount or concentration of HBV mRNA, the amount or concentration of expressed protein, and/or the amount or serum concentration of HBV DNA is collectively referred to herein as reducing or reducing HBV or inhibiting or reducing HBV expression.

Cells and tissues and non-human organisms

Covers cells, tissues and non-human organisms, which include

- 73 044937 at least one of the anti-HBV RNAi agents described herein. A cell, tissue, or non-human organism is produced by delivering an RNAi agent to a cell, tissue, or non-human organism.

The above embodiments and elements are shown together with the following non-limiting examples.

Examples

Example 1. Synthesis of RNAi agents against HBV.

Given in table. 5 anti-HBV RNAi agent duplexes were synthesized as described below.

A. Synthesis.

Sense and antisense strands of HBV RNAi agents were synthesized according to the solid phase amidophosphite method used in oligonucleotide synthesis. Depending on the scale, either MerMade96E® (BioAutomation), MerMade12® (BioAutomation), or OP Pilot 100 (GE Healthcare) equipment was used. The synthesis was carried out on a solid substrate made of glass with controlled porosity (SKP, 500 A or 600 A, manufactured by Prime Synthesis, Aston, Pennsylvania, USA). All RNAs and 2′-modified amidophosphites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). In particular, the following 2'-O-methylamidophosphites were used: (5'-O-dimethoxytrityl-N ⁶ -(benzoyl)-2'-O-methyladenosine-3'-O-(2cyanoethyl-N,N-diisopropylamino)amidophosphite, 5'-O-dimethoxytrityl-N ⁴ -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-MD-diisopropylamino)amidophosphite, (5'-O-dimethoxytrityl-M ² - (isobutyryl)-2'O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)amidophosphite and 5'-O-dimethoxytrityl-2'-Omethyluridine-3'-O-(2-cyanoethyl- N,N-diisopropylamino)amidophosphites. 2'-deoxy-2'-fluoramidophosphites contained the same protecting groups as 2'-O-methylamidophosphites. Deprived of nitrogenous bases (3'O-dimethoxytrityl-2'-deoxyribiso-5'- O-(2-cyanoethyl-N,N-diisopropylamino)amidophosphites were purchased from ChemGenes (Wilmington, MA, USA) Targeting ligand-containing amidophosphites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidophosphites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added.The activating solution was 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile ). The binding duration values were 12 min (RNA), 15 min (targeting ligand), 90 s (2'OMe) and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-diothiazolin-5-one (POS, purchased from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

B. Cleavage and deprotection of the oligomer bound to the substrate.

After completion of solid phase synthesis, the dried solid support was treated for 1.5 hours at 30°C with a 1:1 volume of 40 wt% methylamine in water and 28 wt% ammonium hydroxide solution (Aldrich). The solution was evaporated and the solid residue was diluted in water (see below).

C. Cleaning.

Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ 5PW 13 μm column and a Shimadzu LC-8 system. Buffer solution A (pH 9.0) consisted of 20 mM Tris, 5 mM EDTA and contained 20% acetonitrile, buffer solution B had the same composition as buffer solution A, but with the addition of 1.5 M sodium chloride. UV spectra were recorded at 260 nm. The appropriate fractions were pooled and analyzed by size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-2 5 with a running buffer solution consisting of deionized (DI) water or 100 mM ammonium bicarbonate (pH 6.7) and 20 % acetonitrile.

D. Annealing.

To obtain RNAi agents, complementary strands were mixed by combining equimolar solutions of RNA (coding and antisense) in 1x phosphate-buffered saline (Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the optical absorbance of the solution using a UV-Vis spectrometer in 1x phosphate-buffered saline. Then, to determine the duplex concentration, the optical absorbance of the solution at 260 nm was multiplied by the conversion factor and dilution factor. Unless otherwise stated, all conversion factors were 0.037 mg/(mL-cm). For some experiments, the conversion factor was calculated based on the experimentally determined extinction coefficient.

Example 2: pHBV Mouse Model

Six to eight week old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were transiently transfected in vivo by hydrodynamic injection of MC-HBV1.3 into the tail vein (Yang PL et al. Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection, PNAS USA 2002 Vol. 99: p. 13825-13830), carried out 30-45 days before the administration of an anti-HBV RNAi agent or control drug. MC-HBV1.3 is a plasmid-based minicircle containing the same terminally redundant human hepatitis B virus HBV1.3 sequence,

- 74 044937 as in plasmid pHBV1.3 and in transgenic mice HBV1.3.32 (GenBank accession no. V01460) (Guidotti LG et al., High-level hepatitis B virus replication in transgenic mice, J Virol 1995 Vol. 69, p6158 -6169). To establish a pHBV model of chronic HBV infection, mice were injected into the tail vein with 5 or 10 μg of MCHBV1.3 in Ringer's solution (in a total volume of 10% of the animal's body weight). The solution was injected over 5-7 seconds through a 27 gauge needle as described previously (Zhang G et al., High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA. Human Gene Therapy 1999 Vol. 10, p1735- 1737.). Before administration of this solution (either on day 1 before administration, or on days -1 and -2), serum hepatitis B surface antigen (HBsAg) expression levels were measured by ELISA and mice were grouped according to average HBsAg expression levels.

Analyzes.

Concentrations of HBsAg, HBeAg, serum HBV DNA, or liver HBV RNA can be measured at various times before and after administration of HBV RNAi agents. HBV expression levels were normalized to expression levels before administration and to control mice injected with phosphate-buffered saline (PBS).

1) Collection of serums

Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 min. To separate the serum, the tubes were centrifuged for 3 min at 8000xg and stored at 4°C.

ii) Serum concentrations of hepatitis B surface antigen (HBsAg)

Serum was collected and diluted 10- to 8000-fold in PBS containing 5% nonfat dry milk. Secondary reference standards of HBsAg, diluted in a solution of skim milk, were obtained from the serum of ICR mice (Harlan Sprague Dawley) transfected with 10 μg of the pRc/CMV HBs plasmid expressing HBsAg (Aldevron, Fargo, North Dakota, USA). HBsAg concentrations were determined using the GS HBsAg EIA 3.0 kit (Bio Rad Laboratories, Inc., Redmond, WA, USA) according to the manufacturer's description. The primary standard was recombinant HBsAg protein, subtype ayw (Aldevron), also diluted in a solution of skim milk in PBS.

To account for the decrease in MC-HBV1.3 expression not associated with treatment, HBsAg expression for each animal was normalized to the control group of PBS-injected mice. First, to determine the ratio of expression normalized to pre-treatment levels, the HBsAg level for each animal at a given time point was divided by the pre-treatment expression level of that animal. Expression at a given time point was then normalized to that of the control group by dividing the normalized to pretreatment ratio for an individual animal by the average normalized to pretreatment ratio for all mice in the control group receiving regular PBS.

iii) Serum concentrations of hepatitis B e antigen (HBeAg).

Determination of HBeAg was carried out by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's description (DiaSorin) using serum diluted 4-20 times in 5% nonfat dry milk. Quantitative determination of the antigen was carried out in the linear range of this analysis in relation to a standard protein sample HBeAg (Fitzgerald Industries International, catalog no. 30-AN18, Acton, Massachusetts, USA).

To account for the decrease in MC-HBV1.3 expression not associated with treatment, HBeAg expression for each animal was normalized to the control group of PBS-injected mice. To estimate serum HBeAg concentrations, HBeAg from a pooled group or subset of serum samples was analyzed. First, to determine the ratio of expression normalized to pre-treatment levels, the HBeAg level for each pooled group or subgroup was divided by the pre-treatment expression level in the same group or subgroup. Expression at a given time point was then normalized to that of the control group by dividing the normalized to pretreatment ratio for the group or subgroup by the average normalized to pretreatment ratio for all samples from the control group receiving regular PBS.

iv) Serum HBV DNA concentrations

Equal volumes of serum obtained from mice per group or subgroup were pooled to a final volume of 100 μl. DNA from serum samples was isolated using the QIAamp MinElute Virus Spin kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Sterile 0.9% saline was added to each sample to a final volume of 200 μl. Serum samples were added to tubes containing buffer and protease. Carrier RNA was added to facilitate the isolation of small amounts of DNA. As an isolation control, 1 ng of pHCR/UbC-SEAP plasmid DNA was added (Wooddell CI, et al. Long-term RNA interference from optimized siRNA expression constructs in adult mice. Biochem Biophys Res Commun (2005) 334, 117-127). After incubation for 15 min at 56°C, nucleic acids were precipitated from the lysates with ethanol and the entire solution was applied to the column. After washing, samples were eluted in 50 μl of AVE buffer solution.

- 75 044937

The copy number of HBV genomes in DNA isolated from the serum of a mouse model of pHBV was determined by quantitative polymerase chain reaction (qPCR). Plasmid pSEAP-HBV353-777, encoding a short segment of the HBV genome within the S gene (bases 353-777 of GenBank accession number V01460), was used to generate a standard logarithmic curve spanning six logarithms. Samples with DNA recovery less than 2 standard deviations from the mean based on pHCR/UbC-SEAP detection results were excluded. TaqMan fluorine/ZEN/IBFQ chemical primers and probes were used.

qPCR assays were performed on a 7500 Fast or StepOne Plus Real-Time PCR System (Life Technologies). To assess HBV DNA in serum, DNA was isolated through single or double purification steps from pooled serum samples obtained from the panel. Quantitative HBV DNA contents and control plasmid recovery were determined by qPCR reactions performed in triplicate. HBV quantitation and pHCR/UbC-SEAP samples were included in each reaction mixture.

Example 3: RNAi Agents Against HBV in the pHBV Mouse Model

The pHBV mouse model described in Example 2 above was used. On day 1, each mouse received one 200 μL subcutaneous injection containing 2 mg/kg (mpk) anti-HBV RNAi agent in phosphate-buffered saline (PBS), or 200 μL phosphate-buffered saline without the anti-HBV RNAi agent used in quality of control. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. The HBV RNAi agents studied included agents that have the duplex numbers shown in Table. 7 below. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on days 8, 15, 22, and 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table.

Table 7. Mean HBsAg concentrations normalized to pre-treatment and control (PBS) levels in pHBV mice after administration of HBV RNAi agents from Example 3 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 PBS 1.000±0.185 1.000 ± 0.288 1.000 ± 0.540 1.000 + 0.326 AD04178 0.164+ 0.043 0.206 + 0.044 0.293 + 0.050 0.348 + 0.099 AD04579 0.083 ± 0.028 0.099 ± 0.022 0.112 ± 0.022 0.138 + 0.056 AD04580 0.048 ± 0.007 0.073 ± 0.012 0.085 ± 0.012 0.126+ 0.014 AD04570 0.241±0.076 0.294 ± 0.071 0.276±0.068 0.474 + 0.092 AD04572 0.190 ± 0.040 0.279 ± 0.011 0.323±0.049 0.441 + 0.046 AD04573 0.333±0.143 0.505 ± 0.106 0.361 ± 0.060 0.444 + 0.068 AD04574 0.291±0.032 0.650 ± 0.056 0.388±0.048 0.485±0.070 AD04575 0.397±0.189 0.514 ± 0.234 0.574 ± 0.204 0.689 ± 0.207 AD04419 0.262±0.038 0.174 ± 0.042 0.258±0.064 0.311±0.089 AD04578 0.210±0.056 0.235±0.033 0.298±0.035 0.336±0.049

Each of the RNAi agents AD04178, AD04579, AD04580, AD04570, AD04572, AD04573, AD04574, AD04575, AD04419, and AD04578 was designed such that its antisense strand sequences were at least partially complementary to the X open reading frame at positions 1781-1789 of the genome and HBV shown in table. 1 and 2 above. Each of the anti-HBV RNAi agents showed a significant reduction in HBsAg compared to the PBS control at all time points noted. For example, AD04580 showed a greater than 95% reduction in s-antigen concentrations at day 8 (HBsAg concentration 0.048 ± 0.007) after normalization to pre-treatment levels and PBS controls.

In addition, serum HBV DNA concentrations were determined for the PBS, AD04579, and AD04580 groups from serum samples collected on days 8, 15, 22, 29, 36, 43, and 50, according to the procedure described in Example 2 above. Serum from each group was pooled and subsequently

- 76 044937 DNA was isolated from serum in duplicate. The data is presented in the following table.

Table 8. Mean serum HBV DNA concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 3 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 PBS 1.0000 ± 0.1185 1.0000 ± 0.0591 1.0000 ± 0.0322 1.0000 0.0597 + AD04579 0.1541 ± 0.0070 0.1776 ± 0.0027 0.1810 ± 0.0450 0.3738 0.0302 + AD04580 0.0921 ± 0.0253 0.0869 ± 0.0117 0.1444 ± 0.0755 0.0950 0.0026 + Group Day 36 Day 4 3 Day 50 PBS 1.0000 ± 0.1625 1.0000 ± 0.0055 1.0000 ± 0.1484

AD04579 0.9670 ± 0.1247 0.7643 ± 0.1334 0.6299 ± 0.1319 AD04580 0.4949 + 0.0096 0.4350 + 0.0344 0.6819 ± 0.0266

The data presented in table. 8 show that both RNAi agents tested provided significant reductions in HBV DNA concentrations compared to the PBS group, with AD04580 resulting in a reduction slightly greater than 1 log at its lowest point (eg, mean serum DNA concentration on day 15 was 0.0869± 0.0117).

Example 4: Anti-HBV RNAi Agents in the pHBV Mouse Model

The pHBV mouse model described in Example 2 above was used. On day 1, each mouse was injected subcutaneously with 200 μl containing 2 mg/kg (mpk) anti-HBV RNAi agent in phosphate-buffered saline, or 200 μl phosphate-buffered saline without anti-HBV RNAi agent used as a control. Each of the anti-HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. The administered anti-HBV RNAi agents included the agents listed below in Table. 9. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on days 8, 15, 22, and 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table.

Table 9. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 4 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 PBS 1,000 ± 0.085 1.000 ± 0.235 1,000 ± 0.171 1,000 ± 0.099 AD0401 0.229 ± 0.165 ± 0.142 ± 0.116 ± 0 0.141 0.091 0.085 0.076 AD0458 0.379 ± 0.221 ± 0.135 ± 0.112 ± 1 0.042 0.066 0.040 0.050 AD0459 0.285 ± 0.145 ± 0.086 ± 0.081 ± 1 0.101 0.064 0.024 0.026 AD0443 0.295 ± 0.191 ± 0.147 ± 0.187 ± 4 0.041 0.008 0.016 0.049 AD0458 0.488 ± 0.545 ± 0.511 ± 0.663 ± 3 0.018 0.037 0.086 0.112 AD0458 0.392 ± 0.337 ± 0.364 ± 0.515 ± 4 0.136 0.073 0.075 0.155 AD0458 0.099 ± 0.042 ± 0.030 ± 0.044 ± 5 0.016 0.014 0.009 0.014 AD0458 0.222 ± 0.107 ± 0.074 ± 0.106 ± b 0.056 0.034 0.016 0.039 AD0458 0.255 ± 0.205 ± 0.185 ± 0.207 ± 8 0.065 0.021 0.021 0.024 AD0443 0.265 ± 0.113 ± 0.091 ± 0.130 ± 8 0.106 0.045 0.031 0.038

The RNAi agents AD04010, AD04581, AD04591, AD04434, AD04583, AD04584, AD04585, AD04586, AD04588, and AD04438 were designed such that their antisense strand sequences were at least partially complementary to the S open reading frame at position 770449 37 yah 257 -275 of the HBV genome, as shown in Table. 1 and 2. Each of the anti-HBV RNAi agents shown in Table. 9 above showed a significant reduction in HBsAg compared to control (PBS) at all time points noted. For example, AD04585 showed a reduction in HBsAg of about 90% per day

8, 95% reduction on day 15, 97% reduction on day 22, and 95% reduction on day 29.

In addition, serum HBV DNA concentrations were determined for the PBS-treated groups, AD04585, from serum samples collected on days 8, 15, 22, 29, 36, 43, and 50, according to the procedure described in Example 2 above. Serum from each the groups were combined, and DNA was subsequently extracted from the serum in duplicate. The data is presented in the following table.

Table 10. Mean serum HBV DNA concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 4 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 1,000 ± 1,000 ± 1,000 ± 1,000+ PBS 0.248 0.089 0.195 0.180 AD04585 0.901 ± 0.225 ± 0.187 ± 0.191 ± 0.183 0.003 0.023 0.004 Group Day 36 Day 43 Day 50 1,000+ 1,000+ 1,000+ PBS 0.018 0.033 0.778 AD04585 0.209 ± 0.171 ± 0.305 ± 0.017 0.019 0.010

The data presented in table. 10 indicate that the anti-HBV RNAi agent AD04585 resulted in decreased HBV DNA concentrations compared to the PBS group.

Example 5 Treatment response as a function of dose and combination of anti-HBV RNAi agents in a pHBV mouse model.

The pHBV mouse model described in Example 2 above was used. The mice were divided into various groups, including those shown in table. 11 below, and mice were given subcutaneous injections of 200 μl in accordance with the dosing regimen given in table. eleven.

Table 11: pHBV Mice Dosing Groups for Example 5

Group RNAi agent and dose Dosage regimen A PBS (no agent RNAi) Single injection on day 1 IN 3.0 mg/kg AD04585 Single injection on day 1 WITH 3.0 mg/kg AD04585 Injection on day 1, day 8 and day 15 (i.e. three injections once a week) D 3.0 mg/kg AD04580 Single injection on day 1 E 3.0 mg/kg AD04580 Injection on day 1, day 8 and day 15 (i.e. three injections once a week) F 1.0 mg/kg AD4585 + 1.0 mg/kg AD04580 Injection on day 1 and other injection on day 22 G 1.0 mg/kg AD4585 + 1.0 mg/kg AD04580 Injection on day 1, day 8, day 15 and day 43 N 1.5 mg/kg AD4585 + Injection on day 1, day 22 and day 1.5 mg/kg AD04580 43 I 1.5 mg/kg AD4585 + 1.5 mg/kg AD04580 Injection on day 1, day 8, day 15 and day 43

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 11. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on day 8, day 15, day 22, day 29, day 36, day 43, day 50, and day 57, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in the example above. 2. The experimental data is shown in the following table.

Table 12. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 5 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.162 1,000 ± 0.138 1,000 ± 0.083 1.000 ± 0.204 IN 0.060 ± 0.015 0.010 ± 0.003 0.006 ± 0.002 0.007 ± 0.002 WITH 0.087 ± 0.004 ± 0.001 ± 0.0002 ± 0.014 0.001 0.0003 0.0001 D 0.026 ± 0.009 0.035 ± 0.013 0.037 ± 0.014 0.046±0.006 E 0.023 ± 0.002 ± 0.001 ± 0.001 ± 0.005 0.001 0.0003 0.0004 F 0.063 ± 0.046 0.083 ± 0.051 0.086 ± 0.016 0.027 ± 0.006 G 0.062 ± 0.011 0.022 ± 0.008 0.009 ± 0.003 0.008 ± 0.002 N 0.055 ± 0.015 0.062 ± 0.002 0.072 ± 0.013 0.011 ± 0.001 I 0.031 ± 0.008 ± 0.003 ± 0.003 ± 0.006 0.001 0.0004 0.0003 Group Day 36 Day 43 Day 50 Day 57 A 1.000 ± 0.211 1,000 ± 0.189 1,000 ± 0.179 1,000±0.062 IN 0.013 ± 0.005 0.027 ± 0.004 0.026 ± 0.004 0.057 ± 0.012 WITH 0.001 ± 0.0002 0.002 ± 0.001 0.008 ± 0.004 0.020 + 0.015 D 0.116 ± 0.019 0.214 ± 0.056 0.263 ± 0.046 0.404±0.030 E 0.003 ± 0.0001 0.007 ± 0.001 0.012 ± 0.002 0.033 ± 0.011 F 0.029 ± 0.003 0.065 ± 0.005 0.064 ± 0.004 0.161±0.033 G 0.014 + 0.008 0.039 + 0.011 0.018 + 0.008 0.046 ± 0.008 N 0.017 ± 0.005 0.039 ± 0.008 0.007 ± 0.001 0.013 ± 0.003 I 0.007 ± 0.001 0.020 ± 0.002 0.005 ± 0.001 0.011 ± 0.002

The anti-HBV RNAi agents AD04580 and AD04585 each individually resulted in a reduction

HBsAg compared to PBS control at all time points noted. In addition, combination treatment with AD04585 and AD04580, which, as noted in the examples above, targets different regions of the HBV genome, also resulted in a decrease in HBsAg compared to the PBS control at all time points observed.

In addition, serum concentrations of HBV DNA were determined for each of the groups shown in Table. 11, in serum samples collected on days 8, 15, 22, 29 and 36, according to the procedure described in Example 2 above. Serum from each group was pooled, and DNA was subsequently isolated from the serum in two reaction mixtures. The data is presented in the following table.

- 79 044937

Table 13. Mean serum HBV DNA concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 5 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 A 1,000 ± 0.063 1,000 ± 0.059 1.000 ± 0.372 1,000+ 0.237 IN 0.267+ 0.003 0.043 + 0.016 0.038 + 0.008 0.044 + 0.004 WITH 0.236 + 0.016 0.023 + 0.001 0.004 ± 0.001 0.002 ± 0,000 D 0.058 + 0.016 0.085+ 0.017 0.252 ± 0.071 0.217 + 0.009 E 0.056 + 0.002 0.0009 + 0.0004 0.0005+ 0.0002 0.003+ 0.002 F 0.298 ± 0.013 0.351 ± 0.032 0.823 ± 0.127 0.217 + 0.007 G 0.276 ± 0.035 0.112 ± 0.020 0.061 ± 0.002 0.073 ± 0.002 N 0.232 ± 0.012 0.213 ± 0.028 0.403 ± 0.047 0.079 ± 0.005 I 0.092 + 0.026 0.055+ 0,000 0.002+ 0.003 0.010+ 0.004 Group Day 36 A 1,000+ 0.024 IN 0.046 ± 0.007 WITH 0.003+ 0,000 D 0.319 ± 0.034 E 0.002 ± 0,000 F 0.122 ± 0.004 G 0.047 + 0.006 N 0.056 ± 0.003 I 0.021 + 0.007

The data presented in table. 13 indicate that the RNAi agents tested, either individually or in combination, provided a reduction in HBV DNA concentrations compared to the PBS group. Repeated dosing or increasing dose amounts resulted in additional reductions in HBV DNA.

Example 6: Anti-HBV RNAi Agents in pHBV Mice: Dose-Response and Combination Treatment Studies

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in the table. 14 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 14.

Table 14: pHBV Mice Dosing Groups for Example 6

Group RNAi agent and dose Dosage regimen A PBS (no RNAi agent) Single injection on day 1 IN 4.0 mg/kg AD04981 Single injection on day 1 WITH 1.0 mg/kg AD04981 Single injection on day 1 D 2.0 mg/kg AD04981 Single injection on day 1 E 1.0 mg/kg AD04963 Single injection on day 1 F 2.0 mg/kg AD04963 Single injection on day 1 G 3.0 mg/kg AD04872 Single injection on day 1 N 3.0 mg/kg AD04872 + 1.0 mg/kg AD04981 Single injection on day 1 I 3.0 mg/kg AD04872 + 1.0 mg/kg AD04963 Single injection on day 1 J 3.0 mg/kg AD04872 + 2.0 mg/kg AD04981 Single injection on day 1

- 80 044937

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 14. Each of the anti-HBV RNAi agents HBV included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table. 4 and 5. Injections were made between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected 1 day before administration, and then serum HBsAg concentrations were determined on day 8, day 15, day 22, day 29, and day 36 according to the procedure described in Example 2 above. Experimental data is shown in the following table. 15, where the mean HBsAg values reflect the normalized mean HBsAg values.

Table 15. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 6 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 A 1.000 ± 0.068 1.000 ± 0.183 1.000 ± 0.181 IN 0.085±0.020 0.068 ± 0.005 0.089 ± 0.014 WITH 0.283 + 0.039 0.343 + 0.055 0.436 + 0.004 D 0.161±0.052 0.137 ± 0.036 0.190 ± 0.068 E 0.182±0.040 0.233 ± 0.023 0.436 ± 0.029 F 0.078±0.024 0.093 ± 0.015 0.167±0.028 G 0.066±0.030 0.013 ± 0.002 0.010 ± 0.002 N 0.033±0.012 0.016 ± 0.005 0.020 ± 0.005 I 0.040±0.011 0.028 ± 0.003 0.032 ± 0.007 J 0.035±0.010 0.019 ± 0.002 0.021 ± 0.001 Group Day 2 9 Day 36 A 1.000 ± 0.032 1.000 ± 0.141 IN 0.148 ± 0.016 0.194 ± 0.047 WITH 0.622 ± 0.041 0.741 ± 0.132 D 0.234 ± 0.055 0.280 ± 0.071 E 0.623±0.116 0.782 ± 0.114 F 0.259±0.014 0.368±0.068 G 0.010±0.003 0.009 ± 0.004 N 0.022±0.005 0.024 ± 0.009 I 0.065±0.014 0.087 ± 0.015 J 0.031 ± 0.0001 0.044 ± 0.002

The HBV RNAi agents tested resulted in decreased HBsAg compared to PBS control at all time points noted. In addition, combination treatment with AD04872 (which includes an antisense strand sequence that is at least partially complementary to ORF S at positions 261-279 of the HBV genome, as shown in Tables 1 and 2) and one of AD04981 or AD04963 (both of which include antisense strand sequences that are at least partially complementary to ORF X at positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2), which is shown in groups H, I and J of Example 6, demonstrates that combination treatment two RNAi agents, one targeting ORF S and the other targeting ORF X of the HBV genome, similarly resulted in a decrease in HBsAg compared to the PBS control at all time points noted.

In addition, serum concentrations of hepatitis B e antigen (HBeAg) were also assessed. First, samples from mice in each respective group were pooled, and the resulting serum samples were analyzed in one step. The experimental data is shown in the following table.

Table 16. Mean HBeAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of HBV RNAi agents from Example 6

Group Day 8 Day 15 Day 22 Day 29 Day 3 6 A 1,000 1,000 1,000 0.183 1,000 IN 0.138 0.180 0.274 0.005 0.089 WITH 0.316 0.376 0.588 0.055 0.436 D 0.167 0.250 0.262 0.036 0.190 E 0.301 0.327 0.447 0.023 0.436 F 0.167 0.172 0.305 0.015 0.167 G 0.275 0.135 0.158 0.002 0.010 N 0.080 0.053 0.094 0.005 0.020 I 0.165 0.124 0.185 0.003 0.032 J 0.120 0.057 0.101 0.002 0.021

As shown in table. 16, combination of AD04872 (which targets ORF S of the HBV genome) and one of

- 81 044937

AD04981 or AD04963 (both of which target ORF X of the HBV genome) showed additional reductions in HBeAg concentrations compared with AD04872 alone.

Example 7: Anti-HBV RNAi Agents in pHBV Mice: Additional Dose-Response and Combination Treatment Studies

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in the table. 17 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 17.

Table 17: pHBV Mice Dosing Groups for Example 7

Group RNAi agent and dose Dosage regimen A PBS (no RNAi agent) Single injection on day 1 IN 4.0 mg/kg AD04776 Single injection on day 1 WITH 1.0 mg/kg AD04982 Single injection on day 1 D 2.0 mg/kg AD04982 Single injection on day 1 E 1.0 mg/kg AD04776 Single injection on day 1 F 2.0 mg/kg AD04776 Single injection on day 1 G 3.0 mg/kg AD04872 Single injection on day 1 N 3.0 mg/kg AD04872 + 1.0 mg/kg AD04982 Single injection on day 1 I 3.0 mg/kg AD04872 + 2.0 mg/kg AD04982 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 17. Each of the anti-HBV RNAi agents HBV included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Four (4) mice in each group were examined on day -1 and day 8 (n=4), and then one mouse from each group was sacrificed for histological evaluation. Three (3) mice per group were studied on day 22 and day 29 (n=3).

Serum was collected on day -1 predose, and then on day 8, day 15, day 22, and day 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table. 18.

Table 18. Mean HBsAg concentrations normalized to pre-treatment (day -1) and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 7 (standard deviation shown as (+/-)).

Group Day 8 Day 15 Day 22 Day 29 A 1.000±0.347 1.000 ± 0.278 1.000±0.194 1.000 ± 0.318 IN 0.117+ 0.085+ 0.148 + 0.198+ 0.069 0.039 0.045 0.049 WITH 0.519±0.058 0.375±0.012 0.422±0.046 0.525±0.037 D 0.342±0.062 0.255±0.046 0.272±0.122 0.314±0.068 E 0.279±0.057 0.245±0.032 0.374±0.121 0.304±0.035 F 0.224 ± 0.018 0.161 ± 0.009 0.310±0.016 0.482±0.053 G 0.029 + 0.010 0.005 + 0.001 0.004 + 0.001 0.006 + 0.001 N 0.016 ± 0.005 0.004 ± 0.001 0.010±0.006 0.015 ± 0.008 I 0.026 ± 0.012 0.008 ± 0.001 0.010±0.002 0.015 ± 0.005

The HBV RNAi agents tested resulted in decreased HBsAg compared to PBS control at all time points noted.

In addition, serum concentrations of hepatitis B e antigen (HBeAg) were also assessed. First, samples from mice in each respective group were pooled, and the resulting serum samples were analyzed in one step. The experimental data is shown in the following table.

- 82 044937

Table 19. Mean HBeAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 7

Group Day 8 Day 15 Day 22 Day 2 9 Day 36 A 1,000 1,000 1,000 1,000 1,000 IN 0.193 0.213 0.260 0.307 0.464 WITH 0.471 0.424 0.562 0.513 0.705 D 0.335 0.310 0.411 0.442 0.500 E 0.381 0.368 0.355 0.564 0.483 F 0.275 0.255 0.370 0.495 0.449 G 0.323 0.218 0.205 0.250 0.190 N 0.124 0.102 0.099 0.156 0.156 I 0.081 0.059 0.045 0.063 0.086

Table 19-1. Average fold reduction in HBeAg normalized to pre-treatment and control levels

PBS, in pHBV mice after administration of HBV RNAi agents from Example 7

Group Day 8 (Fold reduction) Day 15 (Fold reduction) Day 22 (Multiples reduction) Day 2 9 (Multiple reduction) Day 36 (Fold reduction) A 1.0 10 10 10 10 IN 5, 2 4.7 3, 8 3.3 2.2 WITH 2.1 2.4 1.8 20 1.4 D thirty 3.2 2.4 2.3 20 E 2, 6 2.7 2.8 18 2, 1 F 3, 6 3, 9 2.7 20 2.2 G 3, 1 4, 6 4.9 4, 0 5, 3 N 8.1 9, 8 10, 1 6, 4 6, 4 I 12.3 17, 0 22.3 15, 7 11, 6

In table Figure 19-1 shows the fold reduction ratio of HBeAg compared to control, which is calculated as the normalized HBeAg concentration in the control group (PBS)/normalized HBeAg concentration in the corresponding RNAi agent(s) group (i.e., 1,000/HBeAg concentration). The data in Table 19-1 indicate that the combination of AD04872 (which, as noted above, includes an antisense strand sequence that is at least partially complementary to ORF S at positions 261-279 of the HBV genome) with AD04982 (which includes antisense strand sequence that is at least partially complementary to ORF X at positions 1781 to 1799 of the HBV genome) resulted in additional reductions in HBeAg concentrations compared to administration of single RNAi agents alone (see, for example, Tables 19 and 19-1, groups H and I). Additionally, the data from this example also show that the combination of AD04872 with AD04982 resulted in a fold reduction in HBeAg greater than the sum of the fold reductions in HBeAg observed when AD04872 and AD04982 were administered separately. For example, in group I (in which 3.0 mg/kg AD04872+2.0 mg/kg AD04982 was administered) there was a 17.0-fold decrease in HBeAg on day 15, which is greater than the sum of the fold reduction in group G (3.0 mg /kg AD04872), which was 4.6, and a fold reduction in group D (2.0 mg/kg AD04982), which was 3.2.

Additionally, serum concentrations of HBV DNA were determined for each of the groups shown in Table. 17, in serum samples collected on days -1, 8, 15, 22, 29 and 36, according to the procedure described in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data is presented in the following table.

- 83 044937

Table 20. Mean serum HBV DNA concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 7 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 A 1.000 + 0.493 1,000+ 0.358 1,000 ± 0.424 1,000 ± 0.387 IN 0.224 + 0.150 0.263+ 0.185 0.335 ± 0.204 0.449 ± 0.108 WITH 0.358 + 0.207 0.428 + 0.073 0.433 ± 0.220 0.474 ± 0.090 D 0.516 ± 0.163 0.523 ± 0.264 0.244 ± 0.123 0.241 ± 0.085 E 0.601 + 0.388 0.319 + 0.125 0.279 ± 0.138 0.506 ± 0.525 F 0.363+ 0.128 0.374 + 0.197 0.275 ± 0.146 0.385 ± 0.141 G 0.071 + 0.032 0.022+ 0.009 0.015 ± 0.015 0.025 ± 0.005 N 0.069 + 0.070 0.018 + 0.014 0.019 ± 0.020 0.022 ± 0.001 I 0.044± 0.024 0.033+ 0.016 0.017 ± 0.012 0.022 ± 0.014 Group Day 36 A 1.000 ± 0.326 IN 0.603 ± 0.068 WITH 0.509 ± 0.163 D 0.543 ± 0.079 E 0.444 ± 0.407 F 0.721 ± 0.043 G 0.058 ± 0.030 N 0.047 ± 0.021 I 0.058 ± 0.051

The data presented in table. 20 show that the RNAi agents tested, both alone and in combination, resulted in decreased HBV DNA concentrations compared to the PBS-treated group, and further show that the combination of AD04872 (which targets the S ORF) and AD04982 (which targets on ORF X) reduces serum concentrations of HBV DNA to the same extent as a similar amount of AD04872 alone.

Example 8: Anti-HBV RNAi Agents in pHBV Mice: Further Studies of Dose-Response and Combination Treatment

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in Table 21 below, and each mouse was given one subcutaneous injection of 200 μl in accordance with the dosing regimen given in Table. 21.

- 84 044937

Table 21: pHBV Mice Dosing Groups for Example 8

Group RNAi agent and dose Dosage regimen Number of animals (n) 1 BBS (no RNAi agent) Single injection on day 1 4 2A 4.0 mg/kg AD04872+ 1.0 mg/kg AD05070 Single injection on day 1 4 2B 4.0 mg/kg AD04872+ 1.0 mg/kg AD05070 Single injection on day 1 4 BEHIND 3.3 mg/kg AD04872+ 1.7 mg/kg AD05070 Single injection on day 1 4 ZV 3.3 mg/kg AD04872+ 1.7 mg/kg AD05070 Single injection on day 1 4 4A 3.2 mg/kg AD04872+ 0.8 mg/kg AD05070 Single injection on day 1 4 4B 3.2 mg/kg AD04872+ 0.8 mg/kg AD05070 Single injection on day 1 4 5Ά 2.7 mg/kg AD04872+ 1.3 mg/kg AD05070 Single injection on day 1 4 5V 2.7 mg/kg AD04872+ Single injection into 4

1.3 mg/kg AD05070 day 1 6A 4.0 mg/kg AD05070 Single injection on day 1 4 6V 4.0 mg/kg AD05070 Single injection on day 1 4 7A 1.7 mg/kg AD05070 Single injection on day 1 4 7V 1.7 mg/kg AD05070 Single injection on day 1 4 8A 0.8 mg/kg AD05070 Single injection on day 1 4 8V 0.8 mg/kg AD05070 Single injection on day 1 4 9 1.7 mg/kg AD05148 Single injection on day 1 4 10 2.7 mg/kg AD04872 Single injection on day 1 3 eleven 1.7 mg/kg AD05147 Single injection on day 1 3 12 4.0 mg/kg AD04872 Single injection on day 1 3 13 1.7 mg/kg AD05149 Single injection on day 1 3

In addition, mice are planned to be killed according to the following schedule:

Day 11: Kill 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A and kill one mouse from group 9.

Day 14: Kill 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A.

Day 21: Kill 2 mice from groups 2B, 3B, 4B, 5B, 6B, 7B and 8B.

Day 28: Kill 2 mice from groups 1, 2B, 3B, 4B, 5B, 6B, 7B and 8B and all 4 mice from groups 10 and 12.

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 21. Each of the HBV RNAi agents included

- 85 044937 themselves N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in table. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. As shown in table. 14 above, four (4) mice were studied in each group (n=4), except for groups 10, 11, 12 and 13, in which three mice were studied (n=3).

Serum was collected on day -1 before administration and on days 8, 14, 21 and 28, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table.

Table 22. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 8 (standard deviation shown as (+/-))

Group number Day 8 Day 14 Day 21 Day 28 1 1.000±0.089 1,000 ± 0.087 1.000 + 0.132 1.000±0.138 2A 0.009 ± 0.003 0.005 ± 0.001 2B 0.006±0.003 0.002 ± 0.001 0.004 + 0.001 0.005±0.001 BEHIND 0.032 ± 0.021 0.009±0.004 ZV 0.028 ± 0.027 0.008 ± 0.006 0.012+ 0.005 0.015 ± 0.005 4A 0.036 ± 0.020 0.012 ± 0.006 4B 0.029±0.025 0.010 ± 0.008 0.015+ 0.005 0.022 ± 0.004 5A 0.027 ± 0.014 0.008 ± 0.002 5V 0.027 ± 0.013 0.007 ± 0.003 0.019 + 0.004 0.031 ± 0.005 6A 0.058 ± 0.035 0.069 ± 0.039 6V 0.117 ± 0.058 0.079 ± 0.047 0.145 ± 0.082 0.135 ± 0.061 7A 0.189±0.100 0.084 ± 0.029 7V 0.099±0.010 0.147 ± 0.025 0.267±0.048 0.345±0.063 8A 0.355±0.099 0.366±0.069 8V 0.271±0.058 0.334±0.060 0.464 ± 0.055 0.624 ± 0.053 9 0.239±0.148 0.179 ± 0.127 0.309 ± 0.213 0.345 ± 0.225 10 0.018±0.009 0.005 ± 0.003 0.005 ± 0.002 0.007 ± 0.003 eleven 0.129±0.068 0.138 ± 0.060 0.239±0.092 0.315±0.119 12 0.033±0.022 0.002 ± 0.001 0.002 ± 0.001 0.002 ± 0.0004 13 0.200 + 0.093 0.239 + 0.114 0.367 + 0.123 0.477 + 0.125

The HBV RNAi agents tested, either alone or in combination, resulted in a significant reduction in HBsAg compared to the PBS control at all time points noted.

Example 9 Delivery of RNAi Agent

The pHBV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous injection of 200 μl containing 10 mg/kg (mpk) anti-HBV RNAi agent in phosphate-buffered saline, or 200 μl phosphate-buffered saline without anti-HBV RNAi agent to serve as a control. The HBV RNAi agents studied included those with the duplex numbers listed in Table 1. 23 below, each of which included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected predose and then on days 8, 15, 22, and 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure given

- 86 044937 above in example 2. The experimental data is shown in the following table.

Table 23. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 9 (standard deviation shown as (+/-))

RNAi agent HBsAg in serum at the nadir (normal, fraction) % reduction at lowest point Low point day PBS 1,000 N/A N/A AD03498 0.087 ± 0.016 91.3% 8 AD03499 0.069 ± 0.011 93.1% 15 AD03500 0.095 ± 0.031 90.5% 8 AD03501 0.046 ± 0.020 95.4% 15

Each of the anti-HBV RNAi agents shown in Table. 23 above included an antisense strand sequence that is at least partially complementary to ORF X at positions 1781-1799 of the HBV genome. Each of the RNAi agents resulted in a significant reduction compared to the PBS control.

Example 10: RNAi Agents Against HBV in pHBV Mice: Additional Combination Treatment Studies

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in the table. 24 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 24.

Table 24: pHBV Mice Dosing Groups for Example 10

Group RNAi agent and dose Dosage regimen A Group I with PBS (no RNAi agent) Single injection on day 1 and day 22 IN Group II with PBS (no RNAi agent) Single injection on day 1 and day 22 WITH 3.0 mg/kg AD04585 Single injection on day 1, day 22, day 50 and day 64 D 3.0 mg/kg AD04771 Single injection on day 1 and day 22 E 3.0 mg/kg AD04580 Single injection on day 1, day 22, day 50 and day 64 F 3.0 mg/kg AD04776 Single injection on day 1 and day 22 G 1.5 mg/kg AD04585 + 1.5 mg/kg AD04580 Single injection on day 1, day 22, day 50 and day 64

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as listed in Table 24. Each of the anti-HBV RNAi agents HBV included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected before administration and then on day -1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, and day 64. Serum hepatitis B surface antigen (HBsAg) concentrations were determined at following the procedure given in example 2 above. The experiment data is shown below.

- 87 044937

Table 25. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels (Group A was used as control) in pHBV mice following administration of the HBV RNAi agents of Example 10 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 A 1.000 ± 0.146 1.000 ± 0.095 1.000 ± 0.202 IN 0.931 ± 0.161 1.091 ± 0.156 1.132 ± 0.259 WITH 0.071 ± 0.050 0.031 ± 0.022 0.024 ± 0.013 D 0.134 ± 0.035 0.130 ± 0.024 0.119 ± 0.028 E 0.015 ± 0.001 0.041 ± 0.012 0.087 ± 0.015 F 0.197 ± 0.081 0.308 ± 0.138 0.476 ± 0.156 G 0.029 ± 0.015 0.069 ± 0.029 0.094 ± 0.016 N 0.191 ± 0.057 0.315 ± 0.094 0.420 ± 0.126 I 0.153 ± 0.050 0.194 ± 0.076 0.233 ± 0.116 J 0.155 + 0.059 0.177 + 0.067 0.316 + 0.117 Group Day 29 Day 36 Day 4 3 A 1.000 ± 0.182 1.000 ± 0.287 1.000 ± 0.298 IN 1.417 ± 0.414 1.166 ± 0.248 WITH 0.007 ± 0.005 0.004 ± 0.003 0.006 ± 0.001 D 0.048 ± 0.023 0.036 ± 0.020 0.052 ± 0.027 E 0.014 ± 0.006 0.021 ± 0.011 0.026 ± 0.011 F 0.246 ± 0.081 0.244 ± 0.097 0.179 ± 0.061 G 0.023 ± 0.009 0.027 ± 0.009 0.037 ± 0.013 N 0.200 ± 0.080 0.185 ± 0.081 0.194 ± 0.055 I 0.141 ± 0.082 0.133 ± 0.051 0.151 ± 0.082 J 0.133 ± 0.064 0.102 ± 0.039 0.129 ± 0.050 Group Day 50 Day 57 Day 64 A 1.000 ± 0.296 1.000 ± 0.394 1.000 ± 0.395 IN WITH 0.015 ± 0.0001 0.002 ± 0.001 0.004 ± 0.001 D E 0.052 ± 0.015 0.009 ± 0.002 0.018 ± 0.007 E G 0.076 ± 0.020 0.012 ± 0.003 0.020 ± 0.007 N I J

The HBV RNAi agents AD04585 and AD04771 were designed such that their antisense strand sequences were at least partially complementary to the S open reading frame at positions 257 to 275 of the HBV genome, as shown in Table 1. 1 and 2. The HBV RNAi agents AD04580 and AD04776 were designed such that their antisense strand sequences were at least partially complementary to open reading frame X at positions 1781 to 1799 of the HBV genome, as shown in Table 1. 1 and 2. The HBV RNAi agents tested, either alone or in combination, resulted in a decrease in HBsAg compared to the PBS control at all time points noted. Each subsequent dose further enhanced the reduction in HBsAg at nadir.

In addition, serum HBV DNA concentrations were determined for group C (3.0 mg/kg AD04585), group E (3.0 mg/kg AD04580), and group G (1.5 mg/kg AD04585+1.5 mg/kg AD04580) from table. 24 in serum samples collected on days -1, 8, 15, 22, 29, 36, 43 and 50, according to the procedure given in Example 2 above.

Serum HBV DNA was isolated from each animal at each of these time points. The data is presented in the following table.

- 88 044937

Table 26. Mean serum concentrations of HBV DNA normalized to pre-treatment levels and PBS controls (both groups A and B treated with PBS) in pHBV mice after administration of the anti-HBV RNAi agents from Example 10 (standard deviation shown as (+/- ))

Group Day 8 Day 15 Day 22 Day 29 A/B 1,000 ± 1,000 ± 1,000 ± 1,000 ± (PBS) 0.316 0.427 0.428 0.475 0.172 ± 0.142 ± 0.252 ± 0.072 ± WITH 0.151 0.079 0.132 0.086 0.024 ± 0.042 ± 0.449 ± 0.053 ± E 0.015 0.037 0.184 0.048 0.093 ± 0.083 ± 0.370 ± 0.211 ± G 0.053 0.037 0.153 0.060

Group Day 36 Day 4 3 Day 50 A/B (PBS) 1.000 + 0.623 1.000 + 0.532 1.000 + 0.532 WITH 0.044 ± 0.020 0.104 ± 0.033 0.156 ± 0.016 E 0.012 ± 0.004 0.061 ± 0.031 0.161±0.019 G 0.048+ 0.022 0.147+ 0.010 0.295 + 0.041

The data presented in table. 26 indicate that the HBV RNAi agents tested, either individually or in combination, resulted in decreased HBV DNA concentrations compared with the PBS group.

Example 11: RNAi agents against HBV in pHBV mice: combination treatment studies.

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in the table. 27 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 27.

Table 27: pHBV Mice Dosing Groups for Example 11

Group RNAi agent and dose Dosage regimen

A PBS (no RNAi agent) Single injection on day 1

IN 3.0 mg/kg AD04962 Single injection on day 1 WITH 3.0 mg/kg AD04963 Single injection on day 1 D 1.5 mg/kg AD04962 + 1.5 mg/kg AD04963 Single injection on day 1 E 2.0 mg/kg AD04962 + 1.0 mg/kg AD04963 Single injection on day 1 F 2.25 mg/kg AD04962 + 0.75 mg/kg AD04963 Single injection on day 1 G 1.5 mg/kg AD04962 + 1.5 mg/kg AD04963 Single injection on day 1 N 3.0 mg/kg AD04962 + 3.0 mg/kg AD04963 Single injection on day 1 I 1.5 mg/kg AD04962 + 1.5 mg/kg AD04963 Single injection on day 1 J 4.5 mg/kg AD04962 + 4.5 mg/kg AD04963 Single injection on day 1 TO 3.0 mg/kg AD04872 Single injection on day 1 L 3.0 mg/kg AD04882 Single injection on day 1 M 3.0 mg/kg AD04885 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 24. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on day −1 before administration and then on day 8, day 15, day 22, day 29, and day 36 (except for group L (AD04882) and group M (AD04885), and serum concentrations of hepatitis B surface antigen were determined ( HBsAg) according to the procedure given above in Example 2. The experimental data is shown in the following table.

- 89 044937

Table 28. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 11 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 A 1.000±0.048 1.000±0.144 1.000±0.083 IN 0.125 + 0.025 0.083+ 0.014 0.063+ 0.016 WITH 0.019 ± 0.005 0.035 ± 0.008 0.052 ± 0.009 D 0.054 ± 0.013 0.079 ± 0.009 0.108 ± 0.021 E 0.099 ± 0.025 0.098 ± 0.053 0.142 ± 0.050 F 0.070 ± 0.015 0.103 ± 0.036 0.140 ± 0.020 G 0.041 ± 0.021 0.012 ± 0.008 0.021 ± 0.013 N 0.020 ± 0.006 0.044 ± 0.010 0.062 ± 0.019 I 0.077 ± 0.017 0.019 ± 0.004 0.004 ± 0.001 J 0.012 ± 0.002 0.021 ± 0.001 0.032 ± 0.002 TO 0.045 ± 0.014 0.013 ± 0.005 0.008 ± 0.005 L 0.106 ± 0.020 0.176 ± 0.044 0.215±0.082 M 0.275±0.029 0.378±0.080 0.572 ± 0.043 Group Day 2 9 Day 36 A 1.000 ± 0.209 1.000 ± 0.270 IN 0.079 ± 0.020 0.096 ± 0.007 WITH 0.087 ± 0.014 0.164±0.026 D 0.176 ± 0.014 0.292±0.030 E 0.223±0.082 0.373±0.150 F 0.213±0.020 0.328±0.034 G 0.031 ± 0.013 0.078 ± 0.064 N 0.97 ± 0.028 0.160±0.060 I 0.008± 0.001 0.002±0.0003 J 0.044 + 0.069 +

0.008 0.009 TO 0.011 ± 0.007 0.011 ± 0.009 L 0.299±0.009 M 0.792 ± 0.057

The RNAi agent AD04962 was designed such that its antisense strand sequence was at least partially complementary to the S open reading frame at positions 257 to 275 of the HBV genome, as shown in Table 1. 1 and 2. RNA agents AD04872 was designed such that its antisense strand sequence was at least partially complementary to the S open reading frame at positions 261-279 of the HBV genome, as shown in Table 1. 1 and 2. The RNAi agent AD04963 was designed such that its antisense strand sequence was at least partially complementary to open reading frame X at positions 1781-1799 of the HBV genome, as shown in Table 1. 1 and 2. The RNAi agents AD04882 and AD04885 were designed such that their antisense strand sequences were at least partially complementary to open reading frame X at positions 1780-1798 of the HBV genome, as shown in Table 1. 1 and 2. Each of the anti-HBV RNAi agents shown in Table. 9 above resulted in a significant reduction in HBsAg compared to the PBS control at all time points noted when administered either alone or in combination. Repeated dosing resulted in additional

- 90 044937 reduction of HBsAg.

In addition, serum concentrations of hepatitis B e antigen (HBeAg) were also assessed in all groups except groups L and M. Samples from mice in each respective group were first pooled, and the resulting serum samples were analyzed in one go. The experimental data is shown in the following table.

Table 29. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of HBV RNAi agents from Example 11

Group Day 8 Day 22 Day 29 Day 36 A 1,000 1,000 1,000 1,000 IN 0.425 0.291 0.371 0.365 WITH 0.152 0.170 0.328 0.356 D 0.266 0.249 0.456 0.440 E 0.278 0.295 0.589 0.561 F 0.306 0.291 0.718 0.522 G 0.183 0.138 0.291 0.249 N 0.091 0.131 0.315 0.238 I 0.183 0.052 0.069 0.036 J 0.089 0.114 0.190 0.236 TO 0.458 0.172 0.322 0.207

Additionally, serum concentrations of HBV DNA were determined for each of the groups shown in Table. 27, in serum samples collected on days 8, 15, 22 and 29, according to the procedure described in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data is presented in the following table.

Table 30. Mean serum concentrations of HBV DNA normalized to pre-treatment and PBS control levels in pHBV mice following administration of the anti-HBV RNAi agents of Example 7 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 A 1.000 + 0.232 1,000+ 0.463 1.000 + 0.272 1,000+ 0.205 IN 0.577 ± 0.219 0.222 ± 0.064 0.196 ± 0.055 0.261 ± 0.117 WITH 0.165 ± 0.051 0.070 ± 0.042 0.142 ± 0.105 0.228 ± 0.174 D 0.343 ± 0.125 0.307 ± 0.091 0.300 ± 0.092 0.356 ± 0.032 E 0.262 ± 0.033 0.216 ± 0.018 0.227 ± 0.028 0.279 ± 0.090 F 0.320 ± 0.134 0.332 ± 0.208 0.344 ± 0.209 0.338 ± 0.211 G 0.231 ± 0.036 0.034 ± 0.024 0.069 ± 0.039 0.077 ± 0.020 N 0.229 ± 0.101 0.155 ± 0.121 0.148 ± 0.079 0.215 ± 0.035 I 0.281 ± 0.129 0.109 ± 0.071 0.023 ± 0.019 0.011 ± 0.009 J 0.078 ± 0.050 0.061 ± 0.020 0.074 ± 0.029 0.056 ± 0.030 TO 0.314 ± 0.119 ± 0.076 ± 0.078 ± 0.064 0.043 0.067 0.095 L 0.295 ± 0.077 0.305 ± 0.101 0.213 ± 0.088 0.186 ± 0.084 M 0.515 ± 0.247 0.505 ± 0.293 0.488 ± 0.318 0.478 ± 0.267

The data presented in table. 30 indicate that the RNAi agents tested, either individually or in combination, provided a reduction in HBV DNA concentrations compared to the PBS group. Repeated dosing resulted in an additional reduction in HBV DNA.

Example 12: RNAi agents against HBV in pHBV mice.

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in Table 31 below, and each mouse was given one subcutaneous injection of 200 μl in accordance with the dosage regimen given in Table. 31.

- 91 044937

Table 31: pHBV Mice Dosing Groups for Example 12

Group RNAi agent and dose Dosage regimen A PBS (no RNAi agent) Single injection on day 1 IN 2.0 mg/kg AD04871 Single injection on day 1 WITH 2.0 mg/kg AD04872 Single injection on day 1 D 2.0 mg/kg AD04874 Single injection on day 1 E 2.0 mg/kg AD04875 Single injection on day 1 F 2.0 mg/kg AD04876 Single injection on day 1 G 2.0 mg/kg AD04881 Single injection on day 1 N 2.0 mg/kg AD04883 Single injection on day 1 I 2.0 mg/kg AD04884 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 24. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected before administration and then on day 8, day 15 and day 22. In group A (PBS), group B (2.0 mg/kg AD04871), group C (2.0 mg/kg AD04872), group D (2.0 mg/kg AD04874), group E (2.0 mg/kg AD04875), and group F (2.0 mg/kg AD04876) also collected serum on day 29, day 36, day 43, and day 50. Serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. The experimental data is shown in the following table.

Table 32. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 12 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 A 1,000 + 0.132 1,000 ± 0.089 1.000±0.080 1.000±0.098 IN 0.102 + 0.034 0.041 ± 0.021 0.049 ± 0.033 0.048 ± 0.031 WITH 0.153 + 0.064 0.064 ± 0.032 0.063 ± 0.034 0.042 ± 0.017 D 0.123 + 0.022 0.049 ± 0.017 0.039 ± 0.010 0.023 ± 0.001 E 0.190 + 0.075 0.094 ± 0.038 0.107 ± 0.061 0.081 ± 0.051 F 0.190 + 0.031 0.076 ± 0.035 0.084 ± 0.038 0.049 ± 0.024 G 0.159 + 0.047 0.216±0.057 0.235±0.151 N 0.508 + 0.078 0.666±0.131 0.543±0.048 I 0.279 + 0.087 0.357 ± 0.078 0.614 ± 0.156 Group Day 36 Day 4 3 Day 50 A 1,000 + 0.065 1.000 ± 0.242 1.000 ± 0.224 IN 0.054 + 0.038 0.064 ± 0.030 0.092 ± 0.025 WITH 0.049 + 0.017 0.054 ± 0.015 0.085 ± 0.010 D 0.037 + 0.004 0.037 ± 0.010 0.065 ± 0.012 E 0.126 + 0.077 0.125 ± 0.170 ±

0.063 0.079 F 0.089 ± 0.044 0.082 ± 0.034 0.115 ± 0.028 G N I

Each of the HBV RNAi agents AD04871, AD04872, AD04874, AD04875 and AD04876 was designed such that its antisense strand sequence was at least partially complementary to the S open reading frame at positions 261-279 of the HBV genome, as shown in Table 1. 1 and 2. Each of these HBV RNAi agents should result in a significant reduction in HBsAg compared to the PBS control. For example, a single 2 mg/kg dose of each of AD04871 (Group B), AD04872 (Group C), AD04874 (Group D) and AD04876 (Group F) resulted in a greater than 90% reduction in HBsAg in each of the measurements. time stamps from day 15 to day 4 3 compared to control. Each of the HBV RNAi agents AD04881, AD04883, AD04884 was designed such that its antisense strand sequence was at least partially complementary to open reading frame X at positions 1780-1798 of the HBV genome, as shown in Table 1. 1 and 2.

Example 13 Treatment Response Based on Dose and Combination of Anti-HBV RNAi Agents in a Region X Knockout Mouse Model

As an alternative means of assessing the effects of a combination of an RNAi agent that includes an antisense strand sequence that is at least partially complementary to a region located in the HBV mRNA S ORF, and a second RNAi agent that includes an antisense strand sequence that is at least partially complementary to the region located in ORF X of HBV mRNA, a plasmid was created that included the HBV genome with a knockout of the binding site by anti-HBV RNAi agents that target positions 1780 and 1781, as shown in Table 1. 1 and 2 (hereinafter referred to as region X knockout mice). This model was created by mutating ten (10) bases in plasmid pHBV1.3 within the binding site of these RNAi agents. The remainder of HBV mRNA, including the S region, remained functional. Thus, in this mouse model of HBV, inclusion of an anti-HBV RNAi agent having an antisense strand that targets positions 1780 and 1781 of the HBV genome described herein is expected to be ineffective in suppressing expression.

The mice were divided into various groups, including those shown in table. 33 below, and mice were given subcutaneous injections of 200 μl according to the dosing regimen given in the following table.

Table 33: Dosing Groups for Region X Knockout Mice for Example 13

Group RNAi agent and dose Dosage regimen Number of animals (n) 1 PBS (no RNAi agent) Single injection on day 1 4 2 2.0 mg/kg AD04585 + 1.0 mg/kg AD04963 Single injection on day 1 4 3 2.0 mg/kg AD04872 + 1.0 mg/kg AD04963 Single injection on day 1 4 4 2.5 mg/kg AD04585 + 0.5 mg/kg AD04963 Single injection on day 1 4 5 2.5 mg/kg AD04872 + 0.5 mg/kg AD04963 Single injection on day 1 4 6 3.0 mg/kg AD04963 Single injection on day 15 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 33. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on day 5, day 8, day 15, day 22, and day 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. In groups 1-5, serum was also collected on days 36 and 43. The experimental data is shown in the following table. 34.

- 93 044937

Table 34. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in region X knockout mice following administration of the HBV RNAi agents of Example 13 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 1 1.000 + 0.186 1.000 ± 0.165 1.000±0.132 2 0.061+ 0.034 0.041 ± 0.035 0.030±0.015 3 0.020±0.011 0.007 ± 0.003 0.003±0.002 4 0.063 + 0.039 0.022+ 0.011 0.029 + 0.013 5 0.027+ 0.014 0.003 ± 0.003 0.001 ± 0.001 b 0.948 1,360 1,652 Day 2 9 Day 36 Day 4 3 1 1.000 + 0.059 1.000±0.044 1,000 ± 0.045 2 0.051 ± 0.029 0.062 ± 0.029 3 0.004 + 0.003 0.008 ± 0.003 0.018 ± 0.007 4 0.040 + 0.022 0.061 ± 0.030 5 0.002+ 0.001 0.003 ± 0.002 0.014 ± 0.006 6 1.831

As expected, group 6, which received a single dose of 3.0 mg/kg of the HBV RNAi agent AD04963, which includes an antisense strand that is at least partially complementary to open reading frame X at positions 1781-1799 of the HBV genome, failed ensure reduction of HBsAg. In addition, each of Groups 2-5 provided a significant reduction in HBsAg compared to the PBS control, with both Group 3 and Group 5 seeing greater than 2 log reductions in HBsAg at trough (day 22).

Example 14: Treatment Response Based on Dose and Combination of Anti-HBV RNAi Agents in a Region X Knockout Mouse Model

The region X knockout mouse model described in Example 13 above was used. The mice were divided into various groups, including those shown in table. 31 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 35.

Table 35: pHBV Mice Dosing Groups for Example 14

Group RNAi agent and dose Dosage regimen 1 PBS (no RNAi agent) Single injection on day 1 2 2.0 mg/kg AD04872 Single injection on day 1 3 2.0 mg/kg AD04872 + 0.7 mg/kg AD05070 Single injection on day 1 4 2.0 mg/kg AD04872 + 1.0 mg/kg AD05070 Single injection on day 1 5 2.0 mg/kg AD04872 + 2.0 mg/kg AD05070 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 35. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice were studied in each group shown in Table 1. 35 (n=3).

Serum was collected on day 1 (pre-dose), day 8, day 15, day 22, and day 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table .

- 94 044937

Table 36: Mean HBsAg Concentrations Normalized to Pre-Treatment Levels and PBS Control in Region X Knockout Mice of Example 14

Group Day 8 Day 15 Day 22 Day 2 9 1 1.000±0.120 1.000 ± 0.255 1.000 ± 0.224 1.000 ± 0.143 2 0.104 ± 0.104 0.009 ± 0.009 0.005 ± 0.004 0.005 ± 0.003 3 0.076 ± 0.041 0.010 ± 0.009 0.006 ± 0.005 0.005 ± 0.005 4 0.036 ± 0.008 0.002 ± 0.001 0.001 ± 0.001 0.002 ± 0.001 5 0.019 ± 0.017 0.003 ± 0.002 0.003 ± 0.001 0.004 ± 0.000

In table 36 shows that the anti-HBV RNAi agent AD04872 was administered alone, and the combination of AD04872 (which includes an antisense strand that is at least partially complementary to the S open reading frame at positions 261-279 of the HBV genome) and AD05070 (which includes antisense strand that is at least partially complementary to open reading frame X at positions 1781 to 1799 of the HBV genome) resulted in a significant decrease in HBsAg compared to the PBS control at all time points noted. Addition of 0.7 to 2 mg/kg of the HBV RNAi agent AD05070, which has a mutated target site present in this region X knockout model, did not reduce the activity of the 2 mg/kg HBV RNAi agent AD04872.

In addition, serum concentrations of HBV DNA were determined in serum samples collected on days 8, 15 and 22, according to the procedure described in Example 2 above. Serum from each group was pooled, and DNA was subsequently extracted from the serum in one step. The data is presented in the following table.

Table 37. Mean Serum HBV DNA Concentrations Normalized to Pre-Treatment Levels and PBS Controls in Region X Knockout Mice Following Administration of the HBV RNAi Agents of Example 14 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 1 1.000 + 0.007 1.000 + 0.011 1.000 + 0.066 2 0.225 + 0.019 0.022 + 0.001 0.036 + 0.001 3 0.151 + 0.002 0.029 + 0.001 0.042 + 0.003 4 0.140 + 0.006 0.016 ± 0.000 0.018 ± 0.000 5 0.069 + 0.002 0.018 + 0.003 0.043 + 0.002

Addition of 0.7 to 2 mg/kg of the HBV RNAi agent AD05070, which has a mutated target site present in this region X knockout model, did not reduce the activity of the 2 mg/kg HBV RNAi agent AD04872.

Example 15: RNAi Agents Against HBV in pHBV Mice

The pHBV mouse model described in Example 2 above was used. The mice were divided into various groups, including those shown in table. 38 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 38.

- 95 044937

Table 38: pHBV Mice Dosing Groups for Example 15

Group RNAi agent and dose Dosage regimen 1 PBS (no RNAi agent) Single injection on day 1 2 2.0 mg/kg AD04776 Single injection on day 1 3 2.0 mg/kg AD05069 Single injection on day 1 4 2.0 mg/kg AD05070 Single injection on day 1 5 2.0 mg/kg AD05071 Single injection on day 1 6 2.0 mg/kg AD05073 Single injection on day 1 7 2.0 mg/kg AD05074 Single injection on day 1 8 2.0 mg/kg AD05075 Single injection on day 1 9 2.0 mg/kg AD05076 Single injection on day 1 10 2.0 mg/kg AD05077 Single injection on day 1 eleven 2.0 mg/kg AD05078 Single injection on day 1 12 3.0 mg/kg AD04872 + 1.0 mg/kg AD04776 Single injection on day 1 13 3.0 mg/kg AD04872 + 1.0 mg/kg AD05069 Single injection on day 1 14 3.0 mg/kg AD04872 + 1.0 mg/kg AD05070 Single injection on day 1 15 3.0 mg/kg AD04872 + 1.0 mg/kg AD05071 Single injection on day 1 16 3.0 mg/kg AD04872 + 1.0 mg/kg AD05073 Single injection on day 1 17 3.0 mg/kg AD04872 + 1.0 mg/kg AD05074 Single injection on day 1 18 3.0 mg/kg AD04872 + 1.0 mg/kg AD05075 Single injection on day 1 19 3.0 mg/kg AD04872 + 1.0 mg/kg AD0507 6 Single injection on day 1 20 3.0 mg/kg AD04872 + 1.0 mg/kg AD05077 Single injection on day 1 21 3.0 mg/kg AD04872 + 1.0 mg/kg AD05078 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 38. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected on day −1 predose and then on day 8, day 15, day 22, day 29, day 36, day 43, and day 50. Serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure given in example 2 above. The experimental data is shown in the following table. 39, where mean HBsAg values reflect normalized mean HBsAg values.

Table 39. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of HBV RNAi agents from Example 15

Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.119 1,000 ± 0.047 1.000 ± 0.080 1,000 ± 0.027 2 0.339 ± 0.076 0.414±0.126 0.385 ± 0.067 0.450±0.075 3 0.240 ± 0.096 0.361 ± 0.078 0.446 ± 0.073 0.508 ± 0.114 4 0.081 + 0.026 0.127+ 0.031 0.223 + 0.057 0.330+ 0.112 5 0.452 ± 0.020 0.431 ± 0.126 0.373 ± 0.079 0.383 ± 0.080

- 96 044937

6 0.375 ± 0.181 0.632 ± 0.192 0.463 ± 0.117 0.567 ± 0.159 7 0.325 ± 0.032 0.438 ± 0.125 0.393 ± 0.056 0.443 ± 0.096 8 0.155 ± 0.031 0.322 ± 0.019 0.333 ± 0.077 0.463 ± 0.043 9 0.245 ± 0.063 0.467 ± 0.090 0.477 ± 0.045 0.562 ± 0.049 10 0.120 ± 0.062 0.173 ± 0.029 0.289 ± 0.019 0.331 ± 0.042 eleven 0.128 ± 0.042 0.172 ± 0.046 0.179 ± 0.015 0.215 ± 0.049 12 0.040 ± 0.015 0.014 ± 0.004 0.014 ± 0.006 0.015 ± 0.004 13 0.050 ± 0.020 0.015 ± 0.011 0.017 ± 0.008 0.022 ± 0.009 14 0.020 ± 0.011 0.011 ± 0.006 0.015 ± 0.006 0.023 ± 0.004 15 0.043 ± 0.005 0.013 ± 0.005 0.010 ± 0.002 0.011 ± 0.004 16 0.021 ± 0.017 0.008 ± 0.004 0.012 ± 0.003 0.011 ± 0.001 17 0.032 ± 0.011 0.009 ± 0.003 0.007 ± 0.002 0.008 ± 0.0003 18 0.023 ± 0.014 0.010 ± 0.006 0.009 ± 0.006 0.009 ± 0.004 19 0.025 ± 0.006 0.010 ± 0.004 0.009 ± 0.002 0.010 ± 0.003 20 0.061 ± 0.013 0.027 ± 0.006 0.020 ± 0.003 0.029 ± 0.006 21 0.061 ± 0.050 0.013 ± 0.010 0.012 ± 0.005 0.018 ± 0.006 Group Day 36 Day 43 Day 50 1 1.000 ± 0.031 1,000 ± 0.114 1.000 ± 0.112 2 0.617 ± 0.116 0.643 ± 0.154 0.665 ± 0.199 3 0.638 ± 0.067 0.743 ± 0.015 0.792 ± 0.115 4 0.472 ± 0.121 0.515 ± 0.126 0.689 ± 0.167 5 0.591 ± 0.159 0.604 ± 0.086 0.709 ± 0.115 6 0.717 ± 0.136 0.686 ± 0.194 0.781 ± 0.301 7 0.586 ± 0.069 0.775 ± 0.143 0.747 ± 0.095

- 97 044937

8 0.666 + 0.066 0.803 ± 0.096 0.856 ± 0.180 9 0.801 + 0.047 0.667 ± 0.055 0.765 ± 0.208 10 0.640 + 0.059 0.667 ± 0.034 0.742 ± 0.133 eleven 0.429 + 0.063 0.383±0.005 0.497 ± 0.060 12 0.037 + 0.013 0.044 ± 0.012 0.056±0.014 13 0.046 + 0.011 0.055 ± 0.010 0.070 ± 0.010 14 0.054 + 0.016 0.070 ± 0.018 0.096 ± 0.012 15 0.029 + 0.011 0.032 ± 0.015 0.051 ± 0.020 16 0.033 + 0.005 0.038 ± 0.007 0.062 ± 0.004 17 0.021 + 0.002 0.031 ± 0.004 0.061 ± 0.005 18 0.034 + 0.014 0.047 ± 0.016 0.079 ± 0.017 19 0.028 + 0.005 0.037 ± 0.006 0.060 ± 0.011 20 0.070 + 0.009 0.063 ± 0.018 0.097 ± 0.018 21 0.040 + 0.012 0.066+ 0.007 0.120 + 0.036

Each of the RNAi agents AD0477 6, AD05069, AD05070, AD05071, AD05073 and AD05074 was designed such that its antisense strand sequence was at least partially complementary to open reading frame X at positions 1781-1799 of the HBV genome, as shown in Table . 1 and 2. Each of the RNAi agents AD05075, AD05076, AD05077 and AD05078 was designed such that its antisense strand sequence was at least partially complementary to the X open reading frame at positions 1780-1798 of the HBV genome, as shown in Table. 1 and 2.

In table 39 shows that the HBV RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074, administered alone or in combination with AD04872 (which includes an antisense strand that is at least partially complementary to the S open reading frame at positions 261- 279 of the HBV genome) resulted in a significant decrease in HBsAg compared to the PBS control at all time points noted.

Example 16: RNAi agents against HBV in pHBV mice: dose-response and combination treatment studies.

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in Table 40 below, and each mouse was given one subcutaneous injection of 200 μl in accordance with the dosing regimen given in Table. 40.

- 98 044937

Table 40: pHBV Mice Dosing Groups for Example 16

Group RNAi agent and dose Dosage regimen 1 PBS (no agent RNAi) Single injection on day 1 2 3.2 mg/kg AD04872 Single injection on day 1 3 3.2 mg/kg AD04872 Single injection on day 1 and day 22 4 3.0 mg/kg AD04872 + 0.8 mg/kg AD05070 Single injection on day 1 5 3.0 mg/kg AD04872 + 0.8 mg/kg AD05070 Single injection on day 1 and day 22 6 3.0 mg/kg AD04872 + 1.0 mg/kg AD05070 Single injection on day 1 7 3.0 mg/kg AD04872 + 1.0 mg/kg AD05070 Single injection on day 1 and day 22 8 2.7 mg/kg AD04872 + 1.3 mg/kg AD05070 Single injection on day 1 9 2.7 mg/kg AD04872 + 1.3 mg/kg AD05070 Single injection on day 1 and day 22 10 2.0 mg/kg AD04872 + 2.0 mg/kg AD0477 6 Single injection on day 1 and day 22 eleven 0.8 mg/kg AD05070 Single injection on day 1 and day 22 12 1.3 mg/kg AD05070 Single injection on day 1 and day 22

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 40. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Six (6) mice per group (n=6) were studied.

Serum was collected before dosing and then on days 8, 15, 22, and 29, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table. 41.

Table 41. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 16 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.117 1.000 + 0.213 1.000±0.169 1.000±0.130 2 0.050 ± 0.018 0.015+ 0.007 0.011 ± 0.005 0.009±0.006 3 0.051 ± 0.037 0.014 + 0.011 0.010±0.006 0.002 ± 0.001 4 0.029 + 0.018 0.010+ 0.006 0.011+ 0.006 0.010 + 0.005 5 0.022 ± 0.003 0.007+ 0.001 0.009 + 0.003 0.001+ 0.001 6 0.027 ± 0.012 0.007+ 0.004 0.008 + 0.005 0.011+ 0.005 7 0.028 ± 0.012 0.010+ 0.005 0.009 + 0.005 0.001+ 0,000 8 0.033 ± 0.016 0.016 + 0.008 0.020 + 0.009 0.021 + 0.011 9 0.034 + 0.025 0.015+ 0.011 0.018 + 0.013 0.003 + 0.002 10 0.038 ± 0.021 0.015+ 0.005 0.019±0.004 0.003±0.001 eleven 0.446 + 0.143 0.376 + 0.120 0.474 ± 0.149 0.338 ± 0.123 12 0.307 ± 0.111 0.257 ± 0.122 0.236±0.057 0.138 ± 0.031

The HBV RNAi agents tested, either individually or in combination, resulted in a reduction in HBsAg compared to the PBS control at all time points noted. HBsAg expression was further reduced in all groups that were re-dosed on day 22.

In addition, serum concentrations of hepatitis B e antigen (HBeAg) were also assessed. For measurements on day 8, serum samples from all six mice in each group were pooled and

- 99 044937 samples were analyzed in one step. For measurements on day −1, day 15, day 22, and day 29, six mice from each group were paired within each group, and their respective serum samples were pooled to form three subgroups for each group. Serum samples from each of the three subgroups were subsequently analyzed for each group. The experimental data is shown in the following table.

42.

Table 42. Mean HBeAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of HBV RNAi agents from Example 16 (standard deviation for days 15, 22 and 29 shown as (+/-))

Group Day 8 Day 15 Day 22 Day 2 9 1 1,000 1.000 ± 0.011 1.000 ± 0.170 1.000 ± 0.173 2 0.510 0.308 ± 0.031 0.217 ± 0.021 0.226 ± 0.035 3 0.488 0.301 ± 0.065 0.283 ± 0.081 0.147 ± 0.030 4 0.213 0.216 ± 0.067 0.192 ± 0.029 0.141 ± 0.048 5 0.192 0.211 ± 0.053 0.216 ± 0.088 0.047 ± 0.016 6 0.176 0.163 ± 0.022 0.238 ± 0.069 0.117 ± 0.011 7 0.165 0.175 ± 0.046 0.215 ± 0.061 0.028 ± 0.012 8 0.128 0.166 ± 0.065 0.386 ± 0.284 0.167 ± 0.118 9 0.172 0.171 ± 0.037 0.244 ± 0.052 0.032 ± 0.010 10 0.180 0.211 ± 0.012 0.283 ± 0.034 0.034 ± 0.001 eleven 0.634 0.594 ± 0.082 0.840 ± 0.152 0.271 ± 0.029 12 0.486 0.441 ± 0.066 0.804 ± 0.096 0.214 ± 0.039

The HBV RNAi agents tested, either individually or in combination, resulted in decreased HBeAg compared to saline control at all time points noted. HBeAg expression was further reduced in all groups that were re-dosed on day 22.

Additionally, serum concentrations of HBV DNA were determined for each of the groups shown in Table. 40, in serum samples collected on days -1, 8, 15 and 22, according to the procedure described in Example 2 above. Serum from each pair of mice was pooled, and then DNA was isolated from each serum pool in one step. The data is presented in the following table.

Table 43. Mean serum HBV DNA concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 16 (standard deviation shown as (+/-))

Group Day 8 Day 15 Day 22 1 1.000 + 0.122 1.000 + 0.299 1.000 + 0.241 2 0.312 + 0.016 0.126 + 0.008 0.087 + 0.018 3 0.264 + 0.065 0.081 + 0.023 0.073 + 0.028 4 0.321 + 0.254 0.120 + 0.066 0.134 + 0.101 5 0.319 + 0.081 0.108 + 0.038 0.098 + 0.051 6 0.260 ± 0.095 0.068 ± 0.010 0.076 ± 0.031 7 0.170 ± 0.028 0.082 ± 0.013 0.062 ± 0.018 8 0.188 ± 0.020 0.192 ± 0.160 0.307 ± 0.309 9 0.242 + 0.003 0.100 + 0.042 0.075 + 0.028 10 0.322 + 0.028 0.159 + 0.025 0.086 + 0.016 eleven 1.124 + 0.142 0.742 + 0.127 0.807 + 0.192 12 1.004 + 0.144 0.541 + 0.340 0.569 + 0.060

The HBV RNAi agents tested, either alone or in combination, resulted in a decrease in serum HBV DNA compared to saline control at all time points noted, except for groups 11 and 12, which did not experience a decrease in serum HBV DNA per day 8.

Example 17. RNAi agents against HBV in mice pHBV

The pHBV mouse model described in Example 2 above was used. The mice were divided into different groups as indicated in the table. 44 below, and each mouse received one subcutaneous injection with a volume of 200 μl in accordance with the dosing regimen given in table. 44.

Table 44: pHBV Mice Dosing Groups for Example 17

Group RNAi agent and dose Dosage regimen 1 PBS (no RNAi agent) Single injection on day 1 2 5 mg/kg AD04585 + Single injection on day 1

- 100 044937

1 mg/kg AD04963 3 5 mg/kg AD04872 + 1 mg/kg AD04963 Single injection on day 1 4 5 mg/kg AD04585 + 1 mg/kg AD04963 Single injection on day 1 and day 8 5 5 mg/kg AD04872 + 1 mg/kg AD04963 Single injection on day 1 and day 8 6 2.5 mg/kg AD04585 + 0.5 mg/kg AD04963 Single injection on day 1 7 2.0 mg/kg AD04585 + 1.0 mg/kg AD04963 Single injection on day 1 8 2.5 mg/kg AD04872 + 0.5 mg/kg AD04963 Single injection on day 1 9 2.0 mg/kg AD04872 + 1.0 mg/kg AD04963 Single injection on day 1 10 5 mg/kg AD04872 + 1 mg/kg AD04981 Single injection on day 1 eleven 2.5 mg/kg AD04872 + 0.5 mg/kg AD04981 Single injection on day 1 and day 8 12 2.5 mg/kg AD04872 + 0.5 mg/kg AD04981 Single injection on day 1 13 2 mg/kg AD04872 + 1 mg/kg AD04981 Single injection on day 1 14 2.5 mg/kg AD04585 + 0.5 mg/kg AD04981 Single injection on day 1 15 2 mg/kg AD04585 + 1 mg/kg AD04981 Single injection on day 1 16 0.5 mg/kg AD04981 Single injection on day 1

Each mouse was injected subcutaneously with 200 μl containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or 200 μl of phosphate-buffered saline without anti-HBV RNAi agent, as indicated in Table 1. 44. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area. Three (3) mice per group (n=3) were studied.

Serum was collected predose and then on day 8, day 14, day 21, day 29, and day 36, and serum hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. Experimental data is shown in the following table 45.

- 101 044937

Table 45. Mean HBsAg concentrations normalized to pre-treatment and PBS control levels in pHBV mice following administration of the HBV RNAi agents of Example 17 (standard deviation shown as (+/-))

Group Day 8 Day 14 Day 21 Day 2 9 1 1.000 ± 0.068 1.000±0.125 1.000±0.152 1.000±0.110 2 0.058 ± 0.033 0.059 ± 0.022 0.085 ± 0.023 0.158 ± 0.021 3 0.025 ± 0.009 0.014 ± 0.006 0.015 ± 0.008 0.026±0.015 4 0.032 ± 0.007 0.005 ± 0.001 0.006 ± 0.002 0.014 ± 0.002 5 0.024 ± 0.009 0.003 ± 0.001 0.001 ± 0.0004 0.001 ± 0.0005 6 0.063 ± 0.020 0.077 ± 0.013 0.131 ± 0.011 0.214±0.026 7 0.041 ± 0.018 0.059±0.017 0.091 ± 0.016 0.140 ± 0.045 8 0.070 ± 0.008 0.046 ± 0.016 0.043 ± 0.009 0.055 ± 0.012 9 0.043 + 0.006 0.027 ± 0.003 0.064 ± 0.017 0.064 ± 0.014 10 0.015 ± 0.008 0.005 ± 0.003 0.005 ± 0.003 0.005 ± 0.003 eleven 0.047 ± 0.014 0.005 ± 0.003 0.003 ± 0.002 0.003 ± 0.003 12 0.062 ± 0.006 0.025+ 0.007 0.027+ 0.005 0.033+ 0.005 13 0.092 ± 0.029 0.050 ± 0.021 0.050 ± 0.022 0.054 ± 0.0019 14 0.310 ± 0.180 0.056±0.010 0.081 ± 0.010 0.112 ± 0.0018 15 0.304 ± 0.044 0.083 ± 0.021 0.115 ± 0.013 0.165±0.025 16 1.667 ± 0.217 0.416 ± 0.163 0.341 ± 0.179 0.511 ± 0, UN Group Day 36 1 1.000±0.225 2 3 0.049 ± 0.019 4 5 0.004 ± 0.0004 6 7 8 0.081 ± 0.010 9 0.108 ± 0.026 10 0.009 ± 0.004 eleven 0.005 ± 0.003 12 0.060 ± 0.014 13 0.094 ± 0.027 14 15 16 0.634 ± 0.005

Combinations of HBV RNAi agents tested resulted in decreased HBsAg compared to saline control at all time points noted. Combinations containing AD04872 resulted in greater reductions than similar combinations containing AD04585 instead of AD04872.

In addition, serum HBV DNA concentrations were determined in serum samples collected on days 8, 14, 21 and 29, according to the procedure described in Example 2 above. Serum HBV DNA was isolated from each animal at each time point. The data is presented in the following table. 46.

- 102 044937

Table 46. Mean serum concentrations of HBV DNA normalized to pre-treatment and PBS control levels in pHBV mice following administration of the anti-HBV RNAi agents of Example 17 (standard deviation shown as (+/-))

Group Day 8 Day 14 Day 21 Day 2 9 1 1.000 ± 0.280 1.000 ± 0.269 1.000 ± 0.418 1.000 ± 0.383 2 0.136 ± 0.068 0.192 ± 0.071 0.173 ± 0.032 0.292±0.039 3 0.097 ± 0.034 0.068 ± 0.016 0.076 ± 0.034 0.131 ± 0.061 4 0.061 ± 0.039 0.002 ± 0.001 0.003 ± 0.001 0.019 ± 0.013 5 0.068 ± 0.025 0.003 ± 0.002 0.0009 ± 0.0003 0.0009 ± 0.0003 6 0.354 ± 0.299 0.345±0.187 0.522 ± 0.234 0.509±0.106 7 0.103 ± 0.064 0.291±0.025 0.203±0.043 0.203±0.015 8 0.336 + 0.142 0.185 ± 0.071 0.183 ± 0.065 0.162 ± 0.064 9 0.198 ± 0.055 0.093 ± 0.023 0.118 ± 0.054 0.143 ± 0.032 10 0.122 ± 0.071 0.024 + 0.026 0.023 + 0.020 0.014 + 0.017 eleven 0.160 ± 0.069 0.016 ± 0.023 0.003 ± 0.001 0.005 ± 0.004 12 0.158 ± 0.039 0.120 ± 0.044 0.100 ± 0.049 0.091 ± 0.034 13 0.190 ± 0.038 0.169 + 0.025 0.066+ 0.015 0.081 + 0.015 14 0.434 ± 0.136 0.318±0.104 0.144 ± 0.094 0.240±0.029 15 0.358 ± 0.185 0.287 ± 0.108 0.279±0.080 0.303±0.038 16 0.713 ± 0.085 0.674 ± 0.140 0.496±0.128 0.590±0.093

Combinations of HBV RNAi agents tested resulted in decreased serum HBV DNA compared with saline control at all time points noted. Combinations containing AD04872 resulted in greater reductions than similar combinations containing AD04585 instead of AD04872. These more pronounced decreases were observed on day 22 and day 29.

Example 18: Anti-HBV RNAi Agents in an HBV-Infected Humanized Mouse Model

For this study, male FRG® (fan -/-/ Rag2 -/-/ Il2rg -/- triple knockout mice derived from C57BL/6 (Yecuris) mice) were transplanted with human hepatocytes at 1-2 months of age. Human hepatocytes were allowed to repopulate the liver for about 6 months with periodic treatment with NTBC to prevent the growth of murine hepatocytes. At 9 months of age, mice were intravenously inoculated with 4 x 10 ⁸ genomes/kg of genotype C HBV, which infected human hepatocytes. After 2–3 months, serum HBV DNA concentrations reached a plateau, indicating maximal infection of human hepatocytes (mouse hepatocytes cannot be infected by HBV). The mice were one year old at the start of treatment with HBV RNAi agents, meaning they were nearing the end of their lifespan.

Pre-treatment serum samples were collected on day -10 and day -3. Beginning on day 1, each mice were forced to oral gavage daily with 0.01 mg/kg entecavir dissolved in water to inhibit HBV replication. Daily entecavir dosing was continued until the day the mice were sacrificed. Administration of entecavir was expected to reduce serum HBV DNA in chronically infected human patients but not to reduce HBsAg.

The mice were divided into various groups, including the groups shown in table. 47 below.

- 103 044937

Table 47. Dosing groups of HBV-infected humanized FRG mouse model for Example 18

Group RNAi agent and dose Dosage regimen Last day A - mouse 1 PBS (no RNAi agent) Single injection on day 1 Killed on day 21 (unhealthy animal) A - mouse 2 PBS (no RNAi agent) Single injection on day 1 and day 29 Killed on day 36 B - mouse 1 4.0 mg/kg AD04872 + 2.0 mg/kg AD05070 Single injection on day 1 and day 29 Killed on day 36 B - mouse 2 4.0 mg/kg AD04872 + 2.0 mg/kg AD05070 Single injection on day 1 and day 29 Killed on day 40 C - mouse 1 4.5 mg/kg AD04872 + 1.5 mg/kg AD05070 Single injection on day 1 Killed on day 15 C - mouse 2 4.5 mg/kg AD04872 + 1.5 mg/kg AD05070 Single injection on day 1 and day 29 Killed on day 36 C - mouse 3 4.5 mg/kg AD04872 + 1.5 mg/kg AD05070 Single injection on day 1 and day 29 Killed on day 40

Each mouse was also given a subcutaneous injection of 100 μl per 20 grams of body weight containing a specified amount of anti-HBV RNAi agent(s) in phosphate-buffered saline, or a similar volume of phosphate-buffered saline without the anti-HBV RNAi agent on day 1 or day 29 (if the animal was still alive on day 29) in accordance with the schedule given in table. 47 above. Each of the HBV RNAi agents included N-acetylgalactosamine targeting ligands conjugated to the 5' end of the coding strand, as shown in Table 1. 4 and 5. Injections were performed between the skin and muscles (i.e., injections were subcutaneous) into loose skin in the neck and shoulder area.

Serum was collected on day 8, day 15, day 22, day 29, day 36 and day 40 and hepatitis B surface antigen (HBsAg) concentrations were determined according to the procedure described in Example 2 above. The experimental data are shown in the following table.

Table 48. Mean HBsAg concentrations normalized to pre-treatment levels (day -3) for each individual HBV-infected humanized FRG mouse model from Example 18

Group Day 8 Day 15 Day 22 Day 29 Day 3 6 Day 4 0 A-1 0.830 0.828 0.932 0.858 1.107 A-2 1.303 1.328 IN 1 0.548 0.314 0.272 0.207 0.138 AT 2 0.592 0.337 0.243 0.215 0.160 0.175 S-1 0.643 0.460 0.415 0.251 0.164 S-2 0.353 0.228 0.182 0.172 0.224 0.216 S-3 0.814 0.674

In addition, serum HBV DNA concentrations were determined in serum samples collected on days -10, -3, 8, 15, 22, 29, 36 and 40, according to the procedure described in Example 2 above. The data are presented in the following table. 49.

Table 49. Serum HBV DNA concentrations were normalized to the mean pre-treatment value (day -10 and day -3) for each HBV-infected humanized FRG mouse after administration of the anti-HBV RNAi agents of Example 14

Group Day - 10 Day -3 Day 8 Day 15 Day 22 Day 29 Day 36 Day 40 A-1 0.883 1.117 0.072 0.038 0.015 0.027 0.060 A-2 1,070 0.930 0.130 0.075 IN 1 1.538 0.462 0.032 0.017 0.011 0.006 0.010 AT 2 1,350 0.650 0.042 0.018 0.012 0.007 0.008 0.007 s-1 1,348 0.652 0.041 0.020 0.016 0.005 0.004 S-2 1,030 0.970 0.031 0.015 0.006 0.011 0.008 0.008

As expected, entecavir administration reduced viral replication both in the absence and presence of anti-HBV RNAi agents.

Other embodiments

It should be understood that while the present invention has been described in detail, the foregoing description is intended to be illustrative and does not limit the scope of the present invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are included within the scope of the following claims.

- 104 -

Claims (62)

CLAIM 1. An RNAi agent for inhibiting hepatitis B virus gene expression in a subject, wherein the RNAi agent comprises: (a) an antisense strand containing a nucleotide base sequence according to any of the following: SEQ ID NO: 171, SEQ ID NO: 179 and SEQ ID NO: 180, and (b) a sense strand containing a nucleotide base sequence according to any of the following: SEQ ID NO: 302 and SEQ ID NO: 319. 2. The RNAi agent according to claim 1, wherein the RNAi agent does not contain a modified nucleotide or a modified internucleoside linkage. 3. The RNAi agent according to claim 1, wherein the RNAi agent comprises at least one modified nucleotide or at least one modified internucleoside linkage. 4. The RNAi agent of claim 3, wherein substantially all of the nucleotides in the RNAi agent are modified nucleotides. 5. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 100, SEQ ID NO: 126, SEQ ID NO: 127 and SEQ ID NO: 128. 6. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 229, SEQ ID NO: 252, SEQ ID NO: 253 and SEQ ID NO: 273. 7. The RNAi agent of claim 1, wherein the RNAi agent further comprises a targeting ligand, wherein the targeting ligand comprises N-acetylgalactosamine (NAG). 8. The RNAi agent of claim 7, wherein the targeting ligand comprises an N-acetylgalactosamine trimer or an N-acetylgalactosamine tetramer. 9. The RNAi agent according to claim 8, wherein the targeting ligand is selected from the group consisting of - 105 044937 - 106 044937 - 107 044937 - 108 044937 - 109 044937 - 110 044937 10. The RNAi agent according to claim 9, wherein the targeting ligand is - 111 044937 11. The RNAi agent according to claim 7, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent. 12. The RNAi agent according to claim 7, wherein the targeting ligand is conjugated to the antisense strand of the agent RNAi. 13. The RNAi agent of claim 11, wherein the targeting ligand is conjugated to the 5' end of the sense strand of the RNAi agent. 14. The RNAi agent of claim 12, wherein the targeting ligand is conjugated to the 5' end of the antisense strand of the RNAi agent. 15. The RNAi agent according to claim 1, wherein the sense strand further comprises one or more inverted nucleosides lacking a nitrogenous base. 16. The RNAi agent according to claim 1, where the RNA interference agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) (SEQ ID NO: 252), and an antisense strand , having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126). 17. A composition for inhibiting hepatitis B virus gene expression in a subject, comprising: a) a first RNAi agent comprising an RNAi agent according to any one of claims 1 to 16; And b) a second RNAi agent, wherein the second RNAi agent comprises: (i) an antisense strand comprising any of the following nucleotide sequences: SEQ ID NO: 140, SEQ ID NO: 137, SEQ ID NO: 102, SEQ ID NO: 162 and SEQ ID NO: 188, and (ii) a sense strand, containing any of the following nucleotide sequences: SEQ ID NO: 248, SEQ ID NO: 294, SEQ ID NO: 262, SEQ ID NO: 271, SEQ ID NO: 274 and SEQ ID NO: 328. 18. The composition of claim 17, wherein the composition contains a first RNAi agent and/or a second RNAi agent independently selected from the group consisting of AD04571 (SEQ ID NO: 100 and SEQ ID NO: 229), AD04776 (SEQ ID NO: 102 and SEQ ID NO: 248), AD04872 (SEQ ID NO: 126 and SEQ ID NO: 252), AD04873 (SEQ ID NO: 127 and SEQ ID NO: 252), AD04874 (SEQ ID NO: 128 and SEQ ID NO: 253), AD04982 (SEQ ID NO: 137 and SEQ ID NO: 248), AD05070 (SEQ ID NO: 140 and SEQ ID NO: 262), AD05148 (SEQ ID NO: 140 and SEQ ID NO: 271), AD05164 ( SEQ ID NO: 126 and SEQ ID NO: 273) and AD05165 (SEQ ID NO: 140 and SEQ ID NO: 274). 19. The composition of claim 18, wherein the weight ratio of the first RNAi agent to the second RNAi agent is from 1:2 to 5:1. 20. The composition of claim 19, wherein the weight ratio of the first RNAi agent to the second RNAi agent is 2:1 or 3:1. 21. The composition of claim 20, wherein the first RNAi agent comprises an antisense strand comprising SEQ ID NO: 126 and a sense strand comprising SEQ ID NO: 252, and the second RNAi agent comprises an antisense strand comprising SEQ ID NO: 140, and a sense strand comprising SEQ ID NO: 262. 22. The composition according to claim 21, where the first RNAi agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s-(invAb)sguggacuuCfUfCfucaauuuucus(invAb) (SEQ ID NO: 252), and an antisense strand , having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID No: 126), and the second RNAi agent contains a sense strand linked at the 5' end to NAG37 and having - 112 044937 structure (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 262), and a complementary antisense strand having the structure usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140). 23. The composition of claim 20, wherein the first RNAi agent comprises an antisense strand comprising SEQ ID NO: 126 and a sense strand comprising SEQ ID NO: 252, and the second RNAi agent comprises an antisense strand comprising SEQ ID NO: 102, and a sense strand comprising SEQ ID NO: 248. 24. The composition according to claim 23, where the first RNAi agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s(mvAb)sguggacuuCfUfCfucaauuuueus(mvAb) (SEQ ID NO: 252), and an antisense strand, having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID No: 126), and the second RNAi agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 248), and a complementary antisense strand having the structure usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102). 25. The composition of claim 20, wherein the first RNAi agent comprises an antisense strand comprising SEQ ID NO: 126 and a sense strand comprising SEQ ID NO: 252, and the second RNAi agent comprises an antisense strand comprising SEQ ID NO: 137, and a sense strand comprising SEQ ID NO: 248. 26. The composition according to claim 25, where the first RNAi agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) (SEQ ID NO: 252), and an antisense strand, having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID No: 126), and the second RNAi agent contains a sense strand linked at the 5' end to NAG37 and having the structure (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 248), and a complementary antisense strand having the structure usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137). 27. The composition of claim 18, wherein the first RNAi agent and/or the second RNAi agent are each independently conjugated to a targeting ligand containing N-acetylgalactosamine. 28. The composition according to claim 27, where the targeting ligand is selected from the group consisting of - 113 044937 - 114 044937 - 115 044937 - 116 044937 - 117 044937 - 118 044937 29. The composition according to claim 28, where the targeting ligand is - 119 044937 30. The composition of claim 29, wherein the targeting ligand is conjugated to the sense strand of the first RNAi agent and/or the second RNAi agent. 31. The composition of claim 29, wherein the targeting ligand is conjugated to the antisense strand of the first RNAi agent and/or the second RNAi agent. 32. The composition of claim 31, wherein the targeting ligand is conjugated to the 5' end of the first RNAi agent and/or the second RNAi agent. 33. The composition of claim 32, wherein the targeting ligand is conjugated to the 5' end of the antisense strand of the first RNAi agent and/or the second RNAi agent. 34. The composition of claim 17, wherein the sense strand further comprises one or more inverted nucleosides lacking a nitrogenous base. 35. A pharmaceutical composition containing the RNAi agent according to claim 1 and a pharmaceutically acceptable excipient, carrier or diluent. 36. A kit for inhibiting hepatitis B virus gene expression in a subject, comprising: a) the pharmaceutical composition according to claim 35 and b) syringe or ampoule. 37. Use of an RNAi agent according to any one of claims 1 to 16 for treating a subject suffering from HBV infection, chronic liver disease, a disorder or condition caused by HBV infection or infection by hepatitis B virus and at least one of hepatitis D virus and human immunodeficiency virus (HIV). 38. Use according to claim 37 for treating a subject having HBV infection. 39. Use according to claim 38, wherein the HBV infection is a chronic HBV infection. 40. Use according to claim 37 for the treatment of a subject having chronic liver disease, disorder or condition caused by HBV infection. 41. Use according to claim 40, wherein the chronic liver disease, disorder or condition caused by HBV infection is liver inflammation. 42. Use according to claim 40, wherein the chronic liver disease, disorder or condition caused by HBV infection is hepatocellular carcinoma. 43. Use according to claim 40, wherein the chronic liver disease, disorder or condition caused by HBV infection is chronic hepatitis. 44. Use according to claim 37 for treating a subject infected with hepatitis B virus and at least one of hepatitis D virus and human immunodeficiency virus (HIV). 45. Use according to claim 44 for the treatment of a subject infected with hepatitis B virus and hepatitis D virus. 46. Use according to claim 45, wherein the subject has a chronic hepatitis D virus infection. 47. Use of a composition according to any one of claims 17 to 35 for treating a subject suffering from an infection - 120 044937 HBV; chronic liver disease, disorder or condition caused by HBV infection; or infected with hepatitis B virus and at least one of hepatitis D viruses and human immunodeficiency virus (HIV). 48. Use according to claim 47 for treating a subject having an HBV infection. 49. Use according to claim 48, wherein the HBV infection is a chronic HBV infection. 50. Use according to claim 47 for the treatment of a subject having chronic liver disease, disorder or condition caused by HBV infection. 51. Use according to claim 50, wherein the chronic liver disease, disorder or condition caused by HBV infection is liver inflammation. 52. Use according to claim 50, wherein the chronic liver disease, disorder or condition caused by HBV infection is hepatocellular carcinoma. 53. Use according to claim 50, wherein the chronic liver disease, disorder or condition caused by HBV infection is chronic hepatitis. 54. Use according to claim 47 for treating a subject infected with hepatitis B virus and at least one of hepatitis D viruses and human immunodeficiency virus (HIV). 55. Use according to claim 54 for the treatment of a subject infected with hepatitis B virus and hepatitis D virus. 56. Use according to claim 55, wherein the subject has a chronic hepatitis D virus infection. 57. Composition according to any one of paragraphs. 17-34, wherein the first RNAi agent and/or the second RNAi agent are in the form of a salt. 58. The composition according to claim 57, wherein the salt form is a sodium salt form. 59. The use of claim 37, further comprising one or more additional therapeutic agents. 60. The use of claim 59, wherein the one or more additional therapeutic agents includes lamivudine, tenofovir, tenofovir alafenamide, tenofovir disoproxil or entecavir. 61. Use according to claim 59, wherein the one or more additional therapeutic agents includes interferon. 62. The use of claim 59, wherein the one or more additional therapeutic agents are small molecule drugs, antibodies, antibody fragments and/or vaccines. Eurasian Patent Organization, EAPO Russia, 109012, Moscow, Maly Cherkassky lane, 2 - 121 -