TWI701331B - Enteral health benefits and alcohol tolerance characteristic probiotic strains and applications in health care product and beer manufacturing - Google Patents

Abstract

The present invention provides a probiotic strain having enteral health benefits and alcohol tolerance characteristic, wherein the probiotic strain is selected from one or more strains consisting of: Lactobacillus plantarum subsp. plantarum TTL 8-16 having a registration number of BCRC 910871, and Lactobacillus paracasei subsp. paracasei TTL T6-7 having a registration number of BCRC 910870. Further, the present invention provides a health care product comprising the probiotic strain, and a beer-based beverage comprising the probiotic strain.

Description

Probiotic strains with intestinal health effects and alcohol resistance and in health care products and beer Application

The present invention relates to a probiotic strain, in particular a probiotic strain with intestinal health effects and alcohol tolerance, and the application of the probiotic strain in the manufacture of health products and beer.

Probiotics are usually found in fermented foods, such as kimchi and miso. In addition, for convenience, there are also many yogurt and lactic acid bacteria drinks that contain probiotics. But there is currently no beer containing probiotics on the market. Because probiotics are not resistant to alcohol, it is difficult for probiotics to cultivate sufficient and active probiotics in beer.

The prior art has used microbial fermentation to produce beer. For example, Chinese Patent CN 105602775B discloses a beer preparation method by co-fermentation of lactic acid bacteria and yeast, which is characterized in that lactic acid bacteria are first activated and cultured at high concentration in wort without hops. 10 ⁷ cfu/ml lactic acid bacteria liquid, followed by inoculation to the fermentation of the general high-bridity wort, which means that the lactic acid bacteria are not resistant to hops and alcohol.

Another Chinese patent CN 102080031A discloses a method for producing beer beverages, which is characterized by controlling the temperature, pressure, and dissolved oxygen conditions of the fermentation process, which represents that lactic acid bacteria obtain sufficient fermentation conditions only by temperature control, and does not clearly indicate that lactic acid bacteria remain after fermentation. Number of lactic acid bacteria.

But unlike most probiotic drinks on the market, probiotic beer is a non-dairy product, which means that probiotic beer can be consumed by patients with lactose intolerance.

The production process of probiotic beer. In view of the problems of the existing technology: (1) Lactic acid bacteria are difficult to culture and survive in hop wort, and (2) Lactic acid bacteria are difficult to culture and survive in alcoholic beer (about 3.5%). There is no product so far. appear. To solve the above technical problems, the present invention provides a probiotic strain with intestinal health care and alcohol tolerance, which has the ability to withstand alcohol and can survive in hop wort and alcoholic beer.

In one aspect, the present invention provides a probiotic strain with intestinal health effects and alcohol tolerance, wherein the probiotic strain is selected from one or more strains consisting of: Lactobacillus plantarum subspecies TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16), deposited at the Institute of Food Industry Development on February 15, 2019, deposit number: BCRC 910871; and Lactobacillus paracasei subspecies TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7), deposited at the Institute of Food Industry Development on February 15, 2019, with the deposit number: BCRC 910870.

In an embodiment of the present invention, the probiotic strain is selected from cereal sources.

In another embodiment of the present invention, the probiotic strain is selected from lactic acid bacteria.

In an embodiment of the present invention, the acid tolerance of the probiotic strain is greater than pH2 and less than pH7.

In an embodiment of the present invention, the probiotic strain has hop acid tolerance.

In an embodiment of the present invention, the probiotic strain is alcohol-tolerant.

According to the present invention, the probiotic strain of the present invention has one or more of the following characteristics: ability to adsorb intestinal epithelial cells, acid tolerance, bile salt tolerance, and antibacterial ability.

According to the present invention, the probiotic strain of the present invention has the property of regulating immune cells to secrete allergy-related cytokines.

On the other hand, the present invention provides a health care product, which is characterized by comprising the probiotic strain of the present invention, and food-acceptable carriers, excipients, diluents or base materials.

In still another aspect, the present invention provides a beer beverage, which is characterized by containing the probiotic strain of the present invention and made by fermenting hops.

When read in conjunction with the drawings, one will better understand the foregoing content of the invention and the following detailed description of the invention. For the purpose of illustrating the present invention, the presently preferred specific embodiments are shown in the drawings.

In the drawings: Figure 1 is an electrophoresis diagram of the identification of Lactobacillus plantarum 8-16 by polymerase chain reaction against the target gene groESL. M: DNA molecular weight standard; 1: negative control group; 2: positive control group (BCRC10069); 3: Lactobacillus plantarum subsp. Plantarum TTL 8-16.

Figure 2 is an electrophoresis diagram of the identification of Lactobacillus paracasei T6-7 by polymerase chain reaction against the target gene dnaK. M: DNA molecular weight standard; 1: negative control group; 2: positive control group (BCRC17002); 3: Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7).

Figure 3 shows the effect of the two probiotic strains invented in this case on increasing ovalbumin and stimulating the secretion of IL-12 cytokine by peripheral monocytes. OVA: Ovalbumin; LP2: Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7); LR1: Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL) 8-16).

Figure 4 shows the effect of two probiotic strains invented in this case on increasing ovalbumin to stimulate IFN-γ cytokine secretion by peripheral monocytes. OVA: Ovalbumin; LP2: Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7); LR1: Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL) 8-16).

Figure 5 shows that the two probiotic strains invented in this case inhibited ovalbumin and stimulated peripheral monocytes to secrete IL-6 cytokine. OVA: Ovalbumin; LP2: Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7); LR1: Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL) 8-16).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. It should be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting.

As used herein, the singular forms "one" (a, an) and "the" include plural references unless the content is clearly indicated otherwise. Therefore, for example, a reference to "a sample" includes a plurality of these samples and their equivalents known to those familiar with the technology.

As used herein, "probiotics" refers to live microorganisms, mainly lactic acid bacteria and some yeasts, which are edible and can promote the balance of intestinal bacteria and are beneficial to the host (such as humans or animals). Things.

The present invention provides a probiotic strain with intestinal health effects and alcohol tolerance, wherein the probiotic strain is selected from one or more strains consisting of: Lactobacillus plantarum subsp. Plantarum TTL 8-16), deposited with the Food Industry Development Research Institute on February 15, 2019, deposit number: BCRC 910871; and Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7 ), deposited at the Food Industry Development Research Institute on February 15, 2019, deposit number: BCRC 910870.

According to the present invention, according to the general process of screening strains, lactic acid bacteria are selected from lactic acid bacteria that have acid tolerance greater than pH 2 and less than pH 7, and have hop acid tolerance and alcohol tolerance. In order to verify the relevant capabilities and properties, it was unexpectedly discovered that it has the ability to adsorb intestinal epithelial cells, acid tolerance, bile salt tolerance, and antibacterial ability; and it has the characteristics of regulating immune cells to secrete allergy-related cytokines. Therefore, it can be used to develop health products for intestinal health care, or can be used to prepare probiotic beer.

The present invention also provides a health care product, which is characterized by comprising the probiotic strain and a carrier, excipient, diluent or base material acceptable for food.

As used herein, food acceptable carriers, excipients, diluents or base materials include but are not limited to edible microcrystalline α-cellulose, crystalline fructose, homoisomalto-oligosaccharides, fatty acid glycerides, Spice powder, maltodextrin, sugar, glucose, citric acid, whole milk powder, skimmed milk powder, or silicon dioxide, etc.

On the one hand, the health care product is prepared in the following way: a total of 11 strains of a single strain are first cultivated independently and then subjected to a 3L shake flask culture condition test. After confirming the parameters, it is opened to expand the culture in a 50L ferment tank, followed by liquid fermentation. The ferment is mass-produced and cultivated. The lactic acid bacteria are concentrated by continuous centrifugation and then embedded and freeze-dried to retain the activity of the bacteria. Finally, they are crushed, mixed and packaged into powder products.

In addition, the present invention provides a beer beverage, which is characterized by containing the probiotic strain.

More preferably, the present invention provides a fermented beer beverage, which is characterized by comprising a barley malt, a hop, water and the probiotic strain.

On the one hand, the probiotic strain is screened in the following way: adding yeast liquid to the hop-containing wort and fermenting at about 20°C, monitoring the fermentation sugar content daily until about 2~3°P, and removing the precipitate Leave the fermentation supernatant liquor after the yeast, and then activate and culture the two probiotics separately, add about 2~3% lactic acid bacteria fermentation broth to the yeast fermentation supernatant liquor (about 10 ⁶ ~ 10 ⁷ CFU/mL after the initial addition of bacteria ), and the sample was observed after culturing at a fermentation temperature of about 25 deg.] C two probiotic bacteria count in the liquor proliferation was found after 2 48hr probiotics reach 10 ⁸ (CFU / mL) or more.

Example

Example 1 Screening of probiotic strains

Screening of probiotics with intestinal health effects and resistance to hops acid and alcohol includes the following steps: After a number of lactic acid strains are initially screened from cereal-derived raw materials through biochemical tests, the basic characteristics of probiotics are screened to confirm the basic characteristics of probiotics. Characteristic lactic acid strains, select 4 kinds of pathogenic bacteria for bacteriostasis test and use mouse peripheral mononuclear cells (PBMC) for anti-allergic test, and then identify the strains with good bacteriostatic ability and anti-allergic effect.

The probiotic strains selected by the above test were activated by MRS broth medium for 24 to 48 hours to about 10 ⁸ cfu/ml, and then about 2% lactic acid bacteria liquid was placed into hop wort and beer. After 24 hours, it was confirmed that the probiotics were in The degree of viability and tolerance in hop acid and alcohol, and the total bacterial count can reach more than 10 ⁸ CFU/mL, and the hop acid and alcohol resistant probiotics can be screened.

After identification, the following two strains were screened: (1) Lactobacillus plantarum subsp. Plantarum TTL 8-16, deposited at the Food Industry Development Institute on February 15, 2019 , Deposit number: BCRC 910871; and (2) Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7), deposited with the Food Industry Development Institute on February 15, 2019 , Deposit number: BCRC 910870.

Example 2 Identification of Analytical Profile Index (API)

The present invention uses the API50CHL kit (bioMerieux, France) to evaluate Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16) and Lactobacillus paracasei subspecies TTL T6-7 ( Lactobacillus paracasei subsp. . paracasei TTL T6-7) utilization characteristics of sugars, which results are shown in table 1. The fermentation test indicated that the biochemical properties of Lactobacillus plantarum subsp. Plantarum TTL 8-16 are similar to those of Lactobacillus plantarum subsp. Plantarum TTL 8-16, while Lactobacillus plantarum subsp. Plantarum TTL 8-16 The biochemical properties of ( Lactobacillus paracasei subsp. paracasei TTL T6-7) are similar to those of Lactobacillus paracasei subsp. paracasei .

Example 3 Strain identification

The two probiotic strains of the present invention are Lactobacillus plantarum subsp. Plantarum TTL 8-16 and Lactobacillus paracasei subsp. paracasei TTL T6-7 ) Is identified by 16S rDNA sequence sequencing, and the resulting sequences are shown in SEQ ID NO 1 and SEQ ID NO 2, respectively. In addition, polymerase chain reaction was used to amplify specific gene fragments to identify the probiotics. Lactobacillus plantarum subsp. Plantarum TTL 8-16 was based on the primer LplantarumF CATGGGACGACTACTGCAACGG (SEQ ID NO 3) and The primer LplantarumR CCATAGCGTGTAATGAGTCAACC (SEQ ID NO 4) was used to amplify the groESL gene fragment ( Figure 1 ), and the Lactobacillus paracasei subsp. paracasei TTL T6-7 was based on the primer LparacaseiF CAGACACAGATCAGCTTG (SEQ ID NO 5) and the primer LparacaseiR AACTTGGCATCCTTCAAA (SEQ ID NO 6) for dnaK gene fragment amplification ( Figure 2 ).

Example 4 Test for the ability to adsorb intestinal epithelial cells

The intestinal epithelial cells Caco-2 are respectively combined with two probiotic strains of Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16) and Lactobacillus paracasei subsp. TTL T6-7 ( Lactobacillus paracasei). subsp. paracasei TTL T6-7) observed after 2 hours of co-cultivation, calculated the average number of probiotic cells adsorbed by each epithelial cell in 10 Caco-2 epithelial cells, and judged that the probiotics>15cfu/cell, this strain was identified as With adsorption capacity.

As shown in Table 2 , the two strains of probiotics were co-cultured with Caco-2 cells for 2 hours, and they all exceeded 15 cfu/cell, indicating that both strains of probiotics have the ability to adsorb intestinal epithelial cells.

Example 5 Acid resistance test

The two probiotic strains of the present invention are Lactobacillus plantarum subsp. Plantarum TTL 8-16 and Lactobacillus paracasei subsp. paracasei TTL T6-7 ) Solution was incubated with a pH 2.0 phosphate solution for 0 to 3 hours and then the number of bacteria was counted by serial dilution culture. When the probiotics are at least >10 ⁷ cfu/ml, the strain is considered to be acid-tolerant.

As shown in Table 3 , the number of the two probiotics of the present invention reached at least 10 ⁸ cfu/ml after 3 hours, indicating that the two probiotics have acid tolerance.

Example 6 Bile salt tolerance

The two probiotic strains of the present invention are Lactobacillus plantarum subsp. Plantarum TTL 8-16 and Lactobacillus paracasei subsp. paracasei TTL T6-7 ) Solution was cultured with 0.3% bile salt for 0~3 hours and then the number of bacteria was counted by serial dilution culture. When the probiotic bacteria reaches at least >10 ⁶ cfu/ml, the strain is considered to be resistant to bile salts.

As shown in Table 4, the number of bacteria reaches the two probiotic than 3 hours at least 10 ⁸ cfu / or more ml, indicating that the two probiotic resistant Bile.

Example 7 Bacteriostatic Ability Test

The indicator strains (a total of 4 pathogenic bacteria strains) cultured in NB and LB overnight were diluted to 10 ⁷ CFU/mL and smeared on the culture plate. After the bacterial liquid is dried, a hole with a diameter of 8 mm is made on the culture plate with a sterile straw, and then the sterile supernatant of the MRS cultured with lactic acid bacteria is injected into the hole, so that the bacterial liquid does not overflow and cause errors. The petri dish is placed in a 37°C incubator for 16 hours and then the size of the inhibition zone is measured.

When the diameter of the inhibition zone is greater than 11mm, it is considered to have antibacterial ability. The larger the inhibition zone, the stronger the antibacterial ability of the probiotic against the index pathogen.

It can be seen from Table 5 that the two probiotic strains have inhibitory zone diameters greater than 11 mm for the four index pathogens E. coli , Pseudomonas aeruginosa , Enterobacter aerogenes , and Staphylococcus sp. Bacteria ability.

Example 8 Anti-allergic efficacy test

Add the calculated peripheral mononuclear cell (PBMC) suspension to the 24-well culture plate, and after the cells settle, add 100μL of lactic acid bacteria that has been washed with PBS and re-dissolved with fresh cell culture medium (the final concentration of bacteria is 10 ⁵ , 10 ⁶ , 10 ⁷ and 10 ⁸ CFU/mL) and 100 μL ovalbumin (OVA) (final concentration 200 μg/mL), and add medium as the positive control group, OVA (200 μg/mL) is the negative control group, After culturing for 24 hours, take the supernatant and put it in the refrigerator at -80℃, and wait for the Enzyme-Linked Immunosorbent Assay (ELISA) to detect the cytokines related to allergy, including interferon gamma (IFN- gamma), IL-12, IL-6.

Previous studies have shown that IL-12 and IFN-γ can promote anti-allergic reactions. Therefore, the present invention uses ovalbumin as an allergen to stimulate peripheral monocytes, and probiotics are added to detect the anti-allergic cytokine IL-12 And IFN-γ. As shown, the two plants probiotic Lactobacillus subspecies FIG. 3 TTL 8-16 (Lactobacillus plantarum subsp. Plantarum TTL 8-16) and Lactobacillus paracasei subsp paracasei TTL T6-7 (Lactobacillus paracasei subsp. Paracasei TTL T6-7) whether it is high or low bacteria count can significantly increase the IL-12 content in cells (P<0.05), among which, Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum) TTL 8-16) has the highest increase. In addition, Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16) strain stimulated IFN-γ in a dose-dependent manner (P<0.05) ( Figure 4 ).

On the other hand, IL-6 is regarded as an allergic reaction hormone. Therefore, the IL-6 concentration secreted by ovalbumin stimulated by peripheral monocytes was detected, and it was found that two probiotics inhibited the IL-6 concentration induced by ovalbumin in the cells. Dependency, among which Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7) in the number of bacteria (10 ⁷ CFU/mL) and Lactobacillus plant subspecies TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16) can significantly inhibit IL-6 cytokine content in PBMC cells (P<0.05) at high bacterial counts (10 ⁸ CFU/mL), and the concentration can be reduced to the same as the blank group, and paracasei Lactobacillus paracasei subsp TTL T6-7 (Lactobacillus paracasei subsp. paracasei TTL T6-7) of the group in a lower number of bacteria (10 ⁶ CFU / mL) may also be effective to reduce cytokine IL-6 (P < 0.05) ( Figure 5 ). This experiment shows that these two lactic acid bacteria can increase the secretion of anti-allergic cytokine and inhibit the secretion of allergic cytokine.

Example 9 Hop acid and alcohol tolerance test

After 2 probiotics and purchased lactic acid strains are activated by MRS broth medium for 24hr~48hr to about 10 ⁸ (CFU/mL), take about 2% lactic acid bacteria liquid and put it into 5ml containing hops wort and gold beer. After 24hr, use MRS Count the number of bacteria on the plate medium to confirm the survival rate.

As shown in Table 6 , the bacterial count of the 2 strains of probiotics can still reach 10 ⁷ CFU/mL after being cultured in beer, and the bacterial count of 2 strains of probiotics can still reach 10 ⁵ CFU/mL after being cultured in wort containing hops. The standard strain BCRC 16000: Lactobacillus rhamnosus (LGG) and the purchased lactic acid strain number BCRC12187: Lactobacillus brevis , BCRC12945: Lactobacillus sp. and BCRC 11196: Lactobacillus brevis were tested as a control group. The results showed that there was no growth under the same conditions, and the results showed that 2 strains of probiotics The bacteria are resistant to hop acid and alcohol.

Those skilled in the art will understand that changes can be made to the specific embodiments described above without departing from the broad inventive concept. Therefore, it should be understood that the present invention is not limited to the specific specific embodiments disclosed, but is intended to cover the spirit and modifications within the scope of the present invention defined by the scope of the appended patent application.

【Biological Material Deposit】

Lactobacillus plantarum subsp. Plantarum TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16) was deposited with the Institute of Food Industry Development on February 15, 2019, with the deposit number: BCRC 910871.

Lactobacillus paracasei subsp. paracasei TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7) was deposited with the Institute of Food Industry Development on February 15, 2019, with the deposit number: BCRC 910870.

<110> Taiwan Tobacco and Liquor Co., Ltd.

<120> Probiotic strains with intestinal health effects and alcohol resistance and their applications in health care products and beer manufacturing

<130>

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1504

<212> DNA

<213> Lactobacillus plantarum

<400> 1

<210> 2

<211> 1521

<212> DNA

<213> Lactobacillus paracasei

<400> 2

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 3

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 4

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 5

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 6

Claims (7)

A probiotic strain with intestinal health care function and alcohol tolerance, wherein the probiotic strain has both hop acid tolerance and alcohol tolerance; wherein the probiotic strain is selected from one strain or a combination of the following: Lactobacillus plantarum Plant subspecies TTL 8-16 ( Lactobacillus plantarum subsp. Plantarum TTL 8-16), deposited at the Institute of Food Industry Development on February 15, 2019, deposit number: BCRC 910871; and Lactobacillus paracasei subsp. TTL T6-7 ( Lactobacillus paracasei subsp. paracasei TTL T6-7) was deposited with the Food Industry Development Institute on February 15, 2019, with the deposit number: BCRC 910870. For example, the probiotic strain of claim 1, which is selected from cereal sources. The probiotic strain of claim 1, wherein the acid tolerance of the probiotic strain is greater than pH 2 and less than pH 7. The probiotic strain of claim 1, wherein the probiotic strain has one or more of the following characteristics: ability to adsorb intestinal epithelial cells, acid tolerance, bile salt tolerance, and bacteriostatic ability. The probiotic strain of claim 1, wherein the probiotic strain has the property of regulating immune cells to secrete allergy-related cytokines. A health care product comprising the probiotic strain according to any one of claims 1 to 5, and food-acceptable carriers, excipients, diluents or base materials. A beer-type beverage comprising the probiotic strain according to any one of claims 1 to 5.

Images