TWI630920B - Agent for sedating response to external stimulation in skin and method for sedating that response - Google Patents

Abstract

It is an object of the present invention to provide a formulation for mitigating the response of the skin to external stimuli. This goal was achieved by finding a component that promotes the expression of the CD39 gene in Langerhans cells. More specifically, the present invention promotes the expression of the CD39 gene based on a combination of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, and rose water. Find.

Description

Formulation for alleviating skin's response to external stimuli and method for mitigating the reaction

The present invention relates to a pharmaceutical preparation for reducing the response of skin to external stimuli.

The skin is located on the outermost layer of the body and is continuously exposed to external stimuli such as ultraviolet light, physical stimuli, chemical stimuli or biological invasion. The skin has a three-layer structure composed of epidermis, dermis, and subcutaneous tissue, and wherein the outermost epidermis consists of keratinocytes, Langerhans cells, melanocytes, and the like, and is used to prevent Water loss and the entry of foreign objects and protect the body from ultraviolet light and other elements of the external environment. After receiving the external stimulus, the keratinocytes release the stimulating response factor, and then the peripheral keratinocytes that receive the signal of the released stimulatory response factor secrete inflammatory cytokines, thereby inducing immune cells and inflaming at the stimulation site (Non-patent document) 1). In addition, it has been determined from recent research that Langerhans cells play an important role in skin immune function by means of antigen processing and antigen presentation. Langerhans cells rapidly contact and process antigens from external sources as foreign objects, deliver them to lymph nodes and present them to T cells, and then induce a series of immune responses. Therefore, it has been determined that Langerhans cells help counter the functions of chemical and biological invasion. On the other hand, Langerhans cells express CD39, and CD39 is used as an ATPase, and thus it has an ability to reduce the amount of ATP (extracellular stimulatory response factor) (Non-Patent Document 2). Extracellular ATP is identified as a signal for inflammatory treatment. Therefore, it is believed that Langerhans cells can help reduce inflammation caused by ultraviolet light or physical stimuli by mediating the degradation of extracellular ATP. It has been reported that when the Langerhans cell number is reduced due to zinc deficiency, the function of the CD39 molecule to alleviate the skin's response to external stimuli is reduced, thereby causing an excessive reaction to the stimuli, thereby causing excessive inflammation (Non-Patent Document 3). .

Therefore, due to increased skin immune function, it is expected that reduced inflammation and reduction in sunburn and other skin conditions can be achieved by increasing or activating Langerhans cells, and screening methods using Langerhans cells as indicators are being developed. (Patent Document 1) and pharmaceutical agents or reducing inhibitors for increasing or activating Langerhans cells (Patent Document 2).

[Previous Technical Document] [Patent Document]

[Patent Document 1] Japanese Unexamined Patent Publication No. 2000-236775

[Patent Document 2] Japanese Unexamined Patent Publication No. 2000-239144

[Patent Document 3] Japanese Unexamined Patent Publication No. 2004-83541

[Non-patent document]

[Non-Patent Document 1] Holzer, A.M. and Granstein, R.D., "Role of extracellular adenosine triphosphate in human skin", J. Cutan. Med. Surg., 2004, 8(2): 90-96

[Non-Patent Document 2] Mizumonot, N. et al., "CD 39 is the dominant Langerhans cell-associated ectoTNPDase: Modulatory roles in inflammation and immune responsiveness", Nat. Med., 2002, 8(4): 358-365

[Non-Patent Document 3] Kawamura, T. et al., "Severe dermatitis with loss of epidermal Langerhans cells in human and mouse zinc deficiency", J. Clin. Invest., 2012, 122(2): 722-732

[Non-Patent Document 4] Koivukangas, V. and Oikarinen, A.: Suction Blister Model of Wound Healing (2003), Methods in Molecular Medicine, 78: 255-261

The object of the present invention is to develop a pharmaceutical formulation or method for mitigating the response of the skin to external stimuli by mediating the activation of Langerhans cells.

Since extensive research has been conducted on the indicator of Langerhans cell activation, the inventors of the present invention have found that the CD39 gene expression can be used as an indicator thereof. When the CD39 gene expression was used as an indicator for screening, it was found that polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, carboxymethyl-β-glucan sodium and rose water were able to make stress conditions. The suppressed CD39 gene expression in the Lower Langerhans cells is increased. Furthermore, it has been surprisingly found that in the case of a combination of polyoxyethylene (POE) / polyoxypropylene (POP) random copolymer methyl ether, sodium carboxymethyl - beta glucan and rose water, Langehan The CD39 gene expression in the cells is synergistically increased, thereby producing the invention as set forth below.

Accordingly, the present invention is directed to the following description.

(1) A CD39 gene expression promoter comprising three kinds of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, and rose water. Component.

(2) A CD39 gene expression promoter produced by three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water Use.

(3) A method for promoting expression of a CD39 gene comprising administering to a subject in need of promoting expression of a CD39 gene comprising carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) A combination of three components of a random copolymer methyl ether and rose water.

(4) A preparation for relieving the skin's response to external stimuli, comprising Three components consisting of pyridine-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water.

(5) A use of three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, and rose water, which is used for Formulations for mitigating the skin's response to external stimuli.

(6) A method for alleviating the skin's response to external stimuli comprising administering to a subject in need of reducing the external stimuli of the skin comprising carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/ A combination of three components of a polyoxypropylene (POP) random copolymer methyl ether and rose water.

(7) A preparation for alleviating a skin immune response comprising carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water The three components that make up.

(8) A use of three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, and rose water, which is used for A preparation for mitigating the skin's immune response is produced.

(9) A method for alleviating a skin immune response comprising administering to a subject in need of reducing a skin immune response comprising carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) A combination of three components of a random copolymer methyl ether and rose water.

The present invention is capable of exhibiting at least one of an effect of increasing the expression of the CD39 gene, alleviating the skin's response to external stimuli, and alleviating the skin's immune response.

Figure 1 shows the simultaneous addition of polyoxyethylene (POE) 14 / polyoxypropylene (POP) 7 random copolymer methyl ether (A), sodium carboxymethyl - beta glucan (B) and rose water (C) The three components (A, B, C) can significantly restore the Langerhans cells in the Langerhans cells by the addition of the stress hormone in the form of dexamethasone.

Figure 2 indicates the application of CD39 containing carboxymethyl-β-glucan sodium, polyoxyethylene (POE) 14/polyoxypropylene (POP) 7 random copolymer methyl ether and rose water as shown in Table 1. The change in the amount of molecules.

Best mode for carrying out the invention

The present invention relates to a CD39 gene expression promoting agent, a preparation for relieving skin external stimuli, and a preparation for alleviating skin immune reaction, which comprises β-glucan, polyoxyethylene (POE) 14/poly Three components consisting of oxypropylene (POP) 7 random copolymer methyl ether and rose water.

The CD39, which is expressed by the CD39 gene expression promoter, is a protein called extracellular nucleoside diphosphate hydrolase-1 (ENTPD1), which hydrolyzes ATP/UTP and ADP/UDP to AMP and others, respectively. Nucleoside enzyme. CD39 is a membrane protein with two membrane osmotic domains and is recognized for expression in Langerhans cells as well as other cells including T cell subsets, B cells and dendritic cells. CD39 has the effect of degrading extracellular ATP, and due to this effect, cells expressing CD39 have been determined to have an effect of alleviating inflammation.

Although ATP is used as an energy medium in cells after being degraded outside the cell by the enzymatic activity of CD39, it is a substance that functions as an information transduction. For example, ATP is known to act as a neurotransmitter in the nervous system. On the other hand, in the skin, ATP is released outside the cell in response to mechanical, chemical or ultraviolet stimuli or due to cell destruction, and is believed to promote the production of cytokines and chemokines by acting on nearby immune cells. Thereby, immune cells are induced to contribute to immunity, allergy and inflammatory reaction (Non-Patent Document 1). Thus, cells expressing CD39 can reduce the skin's response to external stimuli or reduce excessive immune responses by degrading extracellular ATP.

In the skin, the cells expressing CD39 are mainly composed of Langerhans cells and melanocytes, and the gene expression of CD39 in the skin may be promoted with the cells and specifically Activation, proliferation, induction, or inhibition of the reduction of Langerhans cells. The Langerhans cell line is derived from bone marrow dendritic cells, which are derived from the spine cell layer to the upper layer of migrating cells, and which exhibit markers such as CD1a in addition to CD39. Examples of Langerhans cell function include capturing and recognizing foreign objects that have entered the foreign body and presenting them to T cells, identifying cancer cells, inducing immune tolerance, and degrading extracellular ATP, and Langehan Cells are primarily involved in the immune response in the skin. In many of the functions of Langerhans cells, the action of CD39-mediated degradation of extracellular ATP reduces the excessive response to external stimuli and reduces excessive immune responses in the skin, and in particular in the epidermis. The CD39 gene expression promoting agent of the present invention refers to a pharmaceutical preparation which promotes the expression of CD39 gene in cells expressing CD39 and, in particular, Langerhans cells.

Therefore, the CD39 gene expression promoter of the present invention can also be used as a preparation for alleviating the response to external stimuli. The formulations of the invention for alleviating the response to external stimuli reduce the skin and, in particular, the response in the epidermis by external stimulation. Examples of external skin irritation include ultraviolet light, mechanical stimulation, thermal stimulation, cold stimulation, chemical stimulation, and biological invasion. When the skin is subjected to such external stimuli, the keratinocytes of the epidermis release a stimulatory response factor, and in particular ATP, outside the cell, and as previously disclosed, extracellular ATP acts as an information transmitter to induce an immune, allergic or inflammatory response. Examples of mechanical stimuli include abrasions, scratches, and insect bites that cause, for example, abrasions, lacerations, wounds, redness, or swelling, while sunburns or burns, and the like, are caused by ultraviolet light stimulation. Chemical stimuli are induced by chemicals that exhibit stress in the skin, which are induced, for example, by acids, bases or organic solvents, and cause eczema, rash or dermatitis. An example of a biological attack is a bacterial infection.

The formulation of the present invention for relieving the skin's response to external stimuli is capable of reducing or reducing the skin's response to the external stimuli, and in particular to inflammation, irritations, redness, pain, burns or swelling caused by inflammation. And the like, thereby reducing, reducing or treating the symptoms exhibited by them. Accordingly, the preparation of the present invention for relieving the skin's response to external stimuli may be a preparation for alleviating, treating or preventing the above symptoms. In addition, by The immunological reaction in the skin may be reduced by mitigating the response to external stimuli, and the preparation of the present invention for relieving the skin's external stimuli may also be a preparation for alleviating the skin's immune response.

On the other hand, the preparation of the present invention for alleviating the skin's response to external stimuli does not directly inhibit the cascade of skin irritation, but is believed to indirectly alleviate the stimulatory response by promoting the expression of the gene of CD39 having ATPase function. Therefore, the preparation for relieving the response to the external stimuli can enhance the function of the skin which is usually provided with an excessive reaction to alleviate the external stimuli, thereby enabling it to be used as a preparation for enhancing the function of alleviating the response to the stimuli. Since it is common to use a formulation that enhances the function of mitigating the response to stimuli even when it is not inflamed, it can exhibit inhibition of, for example, itching, redness, pain, burns during external stimulation. The function of an inflammatory response in the form of sensation, swelling or rash. Therefore, although a preparation for reducing the response to external stimuli can be incorporated into medicine, it is preferably incorporated into a cosmetic which is intended to be commonly used. In the case where the preparation of the present invention for alleviating the external stimuli of the skin is incorporated into medicine, the incorporation together with another pharmaceutical preparation having an anti-inflammatory effect makes it possible to assist or enhance the anti-inflammatory action of the pharmaceutical preparation.

The preparation of the present invention for relieving the skin's response to external stimuli is also a pharmaceutical preparation which reduces the immune response in the skin and can help reduce the reduction of Langerhans cells or the increase of extracellular ATP. The immune response, and in particular the reduction of excessive inflammation. Examples of excessive inflammation include chronic dermatitis (such as atopic dermatitis, psoriasis or erythroderma) and acute dermatitis (such as rash or other contact dermatitis, liposuction dermatitis or solar dermatitis), and use A pharmaceutical preparation, quasi drug or cosmetic incorporating a formulation of the invention for mitigating the response of the skin to external stimuli makes it less prone to overreaction in the form of redness or itching that occurs when the skin is subjected to various types of external stimuli. This in turn makes it possible to treat or prevent the onset of an inflamed skin disease. In the case of skin diseases (specifically, atopic dermatitis), since the symptoms may be exacerbated by scratches accompanied by itching, the probability of reducing the occurrence of excessive inflammatory reactions is useful for the treatment system. of.

The carboxymethyl-β-glucan used in the present invention is a water-soluble β glucan modified by carboxymethylation of insoluble β glucan. Carboxymethyl-beta glucan can be produced from beta glucan derived from any plant, fungus or bacteria or by synthesis therefrom. Natural beta glucan can be produced by mushroom fungi (such as Agaricus blazei, Ganoderma lucidum or Schizophyllum commune) or by yeast. The weight average molecular weight of carboxymethyl-β-glucan is, for example, 1,000 daltons to 5,000,000 daltons, which corresponds to the source, and is carboxymethyl-β-glucan obtained from yeast. In the case, the upper limit of the weight average molecular weight thereof is preferably 5,000,000 Daltons, more preferably 3,000,000 Daltons and even more preferably 2,000,000 Daltons, and the lower limit is preferably 10,000 Daltons, more preferably 100,000. Dalton and even better 500,000 Daltons. The carboxymethyl-beta glucan may also be in the form of any salt and may be in the form of, for example, a sodium, potassium, ammonium or triethanolamine salt. Although sodium carboxymethyl-β-glucan in the form of CM-dextran (Mibelle Biochemistry) can be used as a commercially available carboxymethyl-β glucan, commercially available carboxymethyl-β glucan is not limited this. Although the form of the drug according to the cosmetic or pharmaceutical form incorporated in the form of the drug varies, the amount incorporated is, for example, 0.0001% by weight or more, preferably 0.0002% by weight or more, from the viewpoint of exhibiting sufficient efficacy. More preferably 0.002% by weight or more. On the other hand, from the viewpoint of solubility, the carboxymethyl-β glucan is preferably 0.5% by weight or less, more preferably 0.1% by weight or less and even more preferably 0.01% by weight. Or less to use.

The polyoxypropylene (POP) used in the polyoxyethylene (POE) / polyoxypropylene (POP) random copolymer methyl ether used in the present invention preferably has an average number of moles of from 2 to 50, and is added. The average number of moles of oxyethylene (POE) is preferably from 8 to 100, and the average number of moles of polyoxyethylene (POE) added is added to the total of added polyoxyethylene (POE) and polyoxypropylene (POP). The ratio of the number of moles [POE / (POE + POP)] is preferably 0.5 or more. Here, POE and POP are abbreviations of polyoxyethylene and polyoxypropylene, respectively, and the following are abbreviated in the same manner. In addition, since From the viewpoint of obtaining a polymer exhibiting a desired effect, the polyoxyethylene to polyoxypropylene used in the polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether has a molar ratio of 1:5. In the range of 5:1, preferably in the range of 1:3 to 3:1, and more preferably in the range of 1:2 to 2:1. For example, a polymer having a ratio of POE:POP of 2:1 can be used. Polyoxyethylene (POE) / polyoxypropylene (POP) random copolymer methyl ether can be produced according to a known method (Patent Document 3). For example, after ethylene oxide and propylene oxide have been added to a compound having a hydroxyl group by addition polymerization, polyoxyethylene (POE)/polyoxygen is obtained by etherifying an alkyl halide in the presence of a basic catalyst. Propylene (POP) random copolymer methyl ether. Although the form of the drug according to the cosmetic or pharmaceutical preparation incorporated in the pharmaceutical form varies, the amount incorporated is, for example, 0.01% by weight or more, preferably 0.05% by weight or more, from the viewpoint of exhibiting sufficient efficacy. And more preferably 0.1% by weight or more. On the other hand, from the viewpoint of solubility, the amount incorporated is preferably 3% by weight or less, more preferably 1% by weight or less, and even more preferably 0.5% by weight or less. In this regard, it is known that polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether itself or in combination with another component exerts a humidifying effect, and polyoxyethylene (POE)/polyoxygen is not known. The effect of propylene (POP) random copolymer methyl ether on the performance of the CD39 gene.

Rose water used in the present invention means having a genus by steam distillation An aromatic component of the aroma of a plant of the genus Rosa. Although the variety of roses used in rose water can be any type, examples of the types that can be used include Rosa damascena Miller and Rosa centifolia L. The rose water system is obtained by subjecting the rose petals to steam distillation at a high temperature and a high pressure (for example, 4 atm and 120 ° C), followed by filtering the obtained aqueous layer component, and then using the filtrate as it is. From the standpoint of exhibiting sufficient performance, the amount incorporated is, for example, 0.01% (v/v) or more, preferably 0.5% (v/v) or more, and more preferably 0.1% (v/). v) or more. On the other hand, from the viewpoint of solubility, the amount incorporated is preferably 3% (v/v) or less, more preferably 1% (v/v) or less and even more preferably 0.5%. (v/v) or less.

The amount of the aqueous solution based on 2% of carboxymethyl-β-glucan or a salt thereof is 1 The blend ratio of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water used in the invention is 1:1 to 100: 1 to 100, preferably 1:1 to 20:1 to 20 and more preferably 1:10:10.

The CD39 gene expression promoter, the preparation for relieving the response to external stimuli, and the preparation for mitigating the immune response in the skin can be incorporated into cosmetics, medicines or drugs, respectively. Such pharmaceutical preparations can be administered orally, parenterally or transdermally. In the case of transdermal administration, the pharmaceutical preparation may be in the form of an external skin preparation. The external skin preparation is not particularly limited as long as it can be applied to the skin, and examples of the form of the drug which can be applied include solution, emulsion, solid, semi-solid, powder, water-oil separate two-layer preparation, water-oil- The powder is divided into three layers of preparations, ointments, gels, aerosols, mousse, adhesives, and any other pharmaceutical form. In the case of formulating an external skin preparation, a base ingredient of the preparation and a vehicle (for example, a preservative, an emulsifier or a pH adjuster) which are usually used in an external skin preparation, and an anti-inflammatory component such as a steroid may be used. Or antihistamine. In the case of being incorporated into a cosmetic, the pharmaceutical preparation of the present invention can be incorporated into a cosmetic for a face or body (for example, a skin lotion, a milky lotion, a skin lotion, a cream, a lotion, a mask, a serum or a gel). Including cosmetic makeup (such as foundation, cosmetic base or concealer), or into a bath additive. The use of a cosmetic containing the components of the present invention makes it possible to maintain healthy skin less prone to redness, itching or rash, as the components of the present invention are capable of reducing or preventing an inflammatory response.

The present invention also relates to a method for applying a cosmetic, a method for relieving a response to external stimuli, a method for maintaining healthy skin, and a method for treating inflammation, which comprises administering a CD39 gene expression promoting agent, a preparation for relieving skin external stimuli And a preparation of the invention for alleviating skin immune response, namely carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE) 14/polyoxypropylene (POP) 7 random copolymer methyl ether and rose water The three components that make up. In such methods, the administration of the three components of the present invention can be carried out by using a skin preparation or cosmetic in addition to all three components, or can be incorporated into individual groups by continuous use. It is carried out in the form of a skin preparation or a cosmetic.

[Example] Example 1: CD39 performance-promoting effect of each component in human Langerhans cell-like cells

THP-1 cells (American Type Culture Collection, VA, USA) were used as an alternative to human Langerhans cells. Approximately 200,000 THP-1 cells were cultured to confluence in RPMI 1640 medium containing 10% FBS. After the incubation, 10 nM dexamethasone form of stress hormone was added, followed by 0.1% polyoxyethylene (POE) 14 / polyoxypropylene (POP) 7 random copolymer methyl ether (A), 0.01% of 2% carboxy, respectively. Methyl-β-glucan sodium (CM-dextran, Mibelle Biochemistry) aqueous solution (B) and 0.1% rose water (Bulgaria Rose Water, Toyotama International) (C). In addition, three types of mixture groups (ABC) incorporating one-third of each of all three components were added. After 24 hours of culture after the addition, RNA was extracted using Isogen (Wako Pure Chemical Industries), followed by synthesis of cDNA using Superscript III and random primers (Invitrogen). RT-PCR was performed using Prism 7900HT (ABI) using SYBR Green (Invitrogen) and the primers indicated below.

CD39-forward: GGAGAATGACACAGGCGTGGTGCATC (SEQ ID NO: 1)

CD39-reverse: GTGGCTCCCAGGTAAACGGGTGTCT (SEQ ID NO: 2)

RPS9-forward: TGCTGACGCTTGATGAGAAG (SEQ ID NO: 3)

RPS9-reverse: CGCAGAGAGAAGTCGATGTG (SEQ ID NO: 4)

During this RT-PCR, ribosomal protein S9 was used as a normalization factor. The results are shown in Figure 1. When a stress hormone in the form of dexamethasone was added, the performance of CD39 was reduced in Langerhans cell-like cells. Add polyoxyethylene (POE) 14 / polyoxypropylene (POP) 7 random copolymer methyl ether (Group A), carboxymethyl-β glucan sodium (Group B) and rose water (group In the case of C), the reduced CD39 performance level has been changed to some extent. good. On the other hand, in the case of adding three types of mixture groups (group ABC) incorporating one-third of each of all three components, the reduced CD39 performance level was restored to the point where dexamethasone was not added. The performance levels of the groups were almost the same, and showed statistically significant improvement effects compared to the other test groups (Groups A, B, and C) (p<0.01, Scheffe's F test) .

Example 2: Changes in CD39 performance levels after application of each component in a test individual

0.1% polyoxyethylene (POE) 14/polyoxypropylene (POP) 7 random copolymer methyl ether, 0.01% 2% carboxymethyl-β-glucan sodium (CM-glucan) was used in the application test. , Mibelle Biochemistry) Aqueous solution and 0.1% rose water (Bulgaria Rose Water, Toyotama International) cosmetics (detailed composition is shown in Table 1). The cosmetics described in Table 1 were applied twice daily to 10 healthy male individuals aged 20 to 30 and 12 healthy male individuals aged 49 to 58 for 6 weeks. A sample of the epidermis was collected by a physician using a suction bubbling method. The suction bubbling method is carried out before and after continuous application according to Non-Patent Document 4, and a sample of the epidermis is collected by bringing a syringe attached to the end of the vacuum pump into contact with the skin, and suction is performed for 30 minutes to 60 minutes. And cut to form a bubbling skin. The collected epidermis was washed with phosphate buffered saline (PBS), fixed with acetone and blocked with 10% goat serum, followed by anti-CD39 antibody (ab97552, Abcam) and Alexa Fluor 488-labeled goat anti-mouse antibody (Alexa Fluor 488, Molecular Probes, A11001) were immunofluorescent staining. Profile images were obtained using a laser scanning confocal microscope (Pascal, Zeiss) and the resulting images were quantified using a ratio of positive sites to the image analysis software (IP Labo 4.0, Solution System). The results are shown in Figure 2. Applying a cosmetic containing a mixture of polyoxyethylene (POE) 14 / polyoxypropylene (POP) 7 random copolymer methyl ether, 2% aqueous solution of sodium carboxymethyl - β glucan and rose water to the forearm for 6 weeks Therefore, the presence of CD39 molecules in the epidermis was significantly increased (Fig. 2).

[Table 1] Table 1

[Example of formulation]

Claims (6)

A CD39 gene expression promoter comprising three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether, and rose water. A preparation for relieving skin external stimuli, comprising carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water The three components that make up. A preparation for alleviating skin immune response, comprising three kinds of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water Component. A use of three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water for the manufacture of CD39 Gene expression enhancer. A use of three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water, which is used for manufacturing A preparation for relieving the skin's response to external stimuli. A use of three components consisting of carboxymethyl-β-glucan or a salt thereof, polyoxyethylene (POE)/polyoxypropylene (POP) random copolymer methyl ether and rose water, which is used for manufacturing A preparation for alleviating skin immune response.