TWI627283B - Method and kit for the field diagnosis of caprine arthritis-encephalitis virus (caev) infection - Google Patents

Abstract

The present invention provides a method for detecting a goat arthritis encephalitis virus infection, which comprises (a) amplifying a gag segment DNA of CAEV by a recombinase polymerase (nt 618-803); (b) step (a) The amplification product is added dropwise to the one-side flow chromatography device/test piece, and flows laterally to the distal end of the lateral flow chromatography device/test piece, wherein the lateral flow chromatography device/test piece sequentially contains (i) a sample pad, (ii) a bonding pad, (iii) a detection zone, and (iv) a control zone; and (c) detecting whether there is any binding of the amplification product in the detection zone. A kit for the detection of goat arthritis encephalitis virus (CAEV) in the side samples is also provided. The present invention provides a sensitivity and specificity RPA-LFD presence diagnostic method and kit for detecting CAEV proviral DNA in a simple, rapid and cost-effective manner.

Description

Method and kit for detecting goat arthritis encephalitis virus infection in presence

The present invention relates to a method and a kit for detecting sidearthritic arthritis encephalitis virus (CAEV) infection, in particular for using a recombinase polymerase to amplify a lateral flow chromatography rod (RPA-LFD) for conducting CAEV in the field. Methods and kits for detecting and diagnosing.

Goat arthritis encephalitis virus (CAEV) is a type of small ruminant lentiviruses (SRLVs) belonging to the genus Lentivirus and the retroviridae family. The virus can infect goats and sometimes infect sheep and other related ruminants. Epidemiological evidence indicates that the main route of infection of this virus is the colostrum and iatrogenic transmission of lambs infected with CAEV, or the long-term intimate contact with the lateral transmission of infected goats. All breeds and ages are susceptible to the virus, and once the animal is infected, it is a permanent virus carrier during its life. Although most infected goats are asymptomatic, all the originals continue to spread the virus to the environment, resulting in more infections in uninfected goats.

There are no effective drugs to treat CAEV infections, and no vaccines are preventable. Therefore, the removal of CAEV-positive animals from the population immediately after an accurate diagnosis is the main practice to reduce the potential economic loss caused by the disease. The most common test for the diagnosis of CAE is the serological test recommended by the World Organisation for Animal Health, such as: agar gel immunodiffusion (agar) The gel immunodiffusion, AGID) trial, which is based on CAEV serology. However, AGID has a tendency to underestimate infection when infected animals develop a delayed seroconversion phase. Delaying the seroconversion phase can impede early and accurate serological diagnosis, allowing possible infection of the heat source. In Taiwan, conventional laboratory CAEV infection diagnosis is based on enzyme-linked immunosorbent assay (ELISA). In this assay, the transcapsid (TM) domain of the recombinant capsid (CA) protein or envelope glycoprotein subunit is used as the antigen, and this assay has proven to be more sensitive than the AGID method. However, ELISA also has a tendency to underestimate infection when the infected animal is in a delayed seroconversion phase, and if the infected animal has an infected CAEV strain different from that used in the ELISA assay, the heterogeneity of the antigen CA protein and TM domain May cause less sensitivity. Furthermore, antigen preparation is expensive and time consuming, making it impractical for the assay to be used for on-site diagnostics.

Therefore, there is still a need for a method that is highly sensitive and specific, lower cost, easier to implement, more comprehensive, and faster.

One aspect of the invention provides a method for detecting a goat arthritis encephalitis virus infection comprising the steps of: (a) polymerizing through a recombinase in the presence of a pair of forward and reverse primers and a probe sequence Recombinase polymerase amplification (RPA) amplifies the gag segment DNA of CAEV (nt 512-1858) in the sample as a target sequence, and the probe sequence is complementary to an internal region of the target sequence, one of which The primer has a first label, the probe sequence has a second label, such that the target sequence is amplified to produce an amplicon labeled with the first and second labels; (b) the step (a) is expanded The product is added dropwise to a lateral flow device/strip and flows laterally to the distal end of the lateral flow chromatography device/test piece, wherein the lateral flow chromatography device/test piece Included in sequence are (i) a sample pad, (ii) a bonding pad, (iii) a detection zone, and (iv) a control zone, the bonding pad having a movement reporter marked with a first substrate, the first The substrate may specifically bind to the first marker or the second marker of the amplicon, the assay The region has a second substrate that specifically binds to the second label or the first label of the amplicon to inhibit further lateral flow chromatography of the amplicon associated with the mobile reporter, the control The zone provides a control substrate; and (c) detects whether there is any binding of the amplification product in the detection zone.

Another aspect is to provide a set of samples for detecting goat arthritis encephalitis virus in a sample comprising: a pair of forward and reverse primers, with the CAEV gag segment (nt 512-1858) DNA as the target sequence a target; a probe sequence complementary to an internal region of the target sequence; a reagent for performing a recombinase polymerase amplification reaction; and a side stream chromatography device/test piece; wherein the primer has a a first marker, the probe sequence having a second marker, such that the target sequence is amplified to produce an amplicon labeled with the first and second markers; and the lateral flow chromatography device/test strip is sequentially included ( i) a sample pad, (ii) a bonding pad, (iii) a detection zone, and (iv) a control zone, the bonding pad having a movement reporter labeled with a first substrate, the first substrate being specific Sexually binding the first label or the second label of the amplicon, the detection area having a second substrate that specifically binds the second label or the first label, the control region providing a Control the substrate.

The non-limiting and non-exhaustive embodiments are described in conjunction with the drawings. It should be understood that the drawings depict only disclosed in the specification of several embodiments, therefore, not intended to limit the scope thereof, disclosed in this specification will be described in detail by the accompanying drawings, wherein: Figure 1 is the use of the copy number ¹⁰² Preferred RPA reaction temperature for recombinant plastid DNA of CAEV gag gene. M and N are molecular markers and negative controls (DNase-free water, respectively).

Figure 2 shows RPA-AGE (agarose gel electrophoresis, AGE) using the whole DNA of goats infected with goat pox virus (GPV) and bovine leukaemia virus (BLV) as a template. Molecular specificity of RPA-LFD. (A) Results by AGE development. (B) Results of development by LFD. N1: Total DNA extracted by CAEV-negative goats. N2: Negative control (water without DNA hydrolase).

Figure 3 is a graph showing the results of molecular sensitivity test of RPA using 5-fold serial dilution as a template using total DNA extracted from CAEV-infected goats. (A) Results by AGE development. (B) Results of development of the same RPA amplicons by LFD. 50 ng, 10 ng, 2 ng, 400 pg, and 80 pg: serial dilution of total DNA prepared from CAEV-infected goats; N: no template control (water without DNA hydrolase).

Figure 4 is a molecular sensitivity test of RPA using 10-fold serial dilution of plastid DNA as a template. (A) Results of AGE development, M-channel and N-channel: molecular marker and negative control (water without DNA hydrolase). (B) Results of development of the same RPA product by LFD.

The illustrative embodiments and examples of the present invention are described in detail below with reference to the accompanying drawings, in which FIG.

The word "comprising" or "comprises" or "an" or "an" "About or close" or "substantially" means having a value or range that is close to the allowable specified error to avoid any unreasonable use by third parties, illegal or unfair use, to understand the precise or absolute value disclosed herein. "One" means one or more (ie, at least one) of the grammatical objects of the object.

The methods disclosed herein can detect DNA sequences (eg, pathogenic DNA) without the use of optical fluorescence techniques. The method uses RPA analysis and lateral flow chromatography to amplify and detect specific DNA sequences in a variety of sample types, respectively. The RPA assay using phage-based isothermal and - extraction of the recombinant enzyme (phage-derived recombinase) Uvs X , to assist its cofactors Uvs Y, the Uvs X agglomerated two oligonucleotides primers, template DNA to scan Homologous target sequences. In the case of recognizing a specific homologous sequence, a strand-like DNA (double) is generated by a similar PCR method via a S. aureus-extracted DNA polymerase ( Sau DNA polymerase) and subsequent strand-extension amplification. -stranded DNA, dsDNA).

[Invention method]

The method of the first aspect of the invention is for detecting a goat arthritis encephalitis virus infection, the steps comprising: (a) expanding through a recombinant enzyme polymerase in the presence of a pair of forward and reverse primers and a probe sequence Increasing the gag segment DNA of CAEV (nt 512-1858) in the sample as a target sequence, the probe sequence is complementary to an internal region of the target sequence, wherein one primer has a first marker, and the probe sequence has a second label, the target sequence is amplified to produce an amplicon having first and second labels; (b) the amplification product of step (a) is added dropwise to the one side stream chromatography device/test piece (lateral flow device/strip), flowing laterally to the distal end of the lateral flow chromatography device/test piece, wherein the lateral flow chromatography device/test piece sequentially comprises (i) a sample pad, (ii) a a bonding pad, (iii) a detection zone, and (iv) a control zone, the bonding pad having a movement reporter labeled with a first substrate, the first substrate specifically binding the first of the amplicon a label or the second label, the detection zone providing a second substrate that specifically binds to the first of the amplicon Marking the first marker to inhibit further amplification of the amplicons associated with the mobile reporter, the control region providing a control substrate; and (c) detecting whether there is any expansion in the detection region Combination of product enhancement.

In accordance with the present invention, a "sample" can be a biological sample, such as from any sample suspected of having a native CAEV. The sample may be any sample containing the virus in an infected individual, including tissue and fluid samples, such as blood, serum, plasma, peripheral blood cells, including lymphocytes and monocytes, sputum, mucous membranes, urine, feces, throat swabs. Subsamples, dermal lesion swab samples, cerebrospinal fluid, pus and tissue, including spleen, kidney and liver.

According to the present invention, the nucleic acid of the sample is extracted for further evaluation. Preferably, the gDNA from the sample is first extracted, and then the DNA gag segment of CAEV (nt 618-803) is amplified by an RPA reaction, which is viral. A relatively conserved region of the genome. By designing a primer sequence specific for the gag segment (nt 618-803) and avoiding mutation hotspots in the viral sequence, the preferred forward primer has a sequence of SEQ ID NO. 1 (TCAGAGGGGAGCACTTGACAGAAGGAAATTGT) and the reverse primer system. There is a sequence of SEQ ID NO. 2 (CTAATGTGGCCTGCAAAGACATAAAGTCT). In addition, one of the primers has a first mark. When the DNA target sequence is amplified during the amplification reaction, a probe having a second label specifically hybridizes to an internal sequence within the amplicon, such that the amplicon carries a first label and a second a mark, wherein the second mark is different from the first mark. More preferably, the probe sequence is SEQ ID NO. 3 (GGGGAGCACTTGACAGAAGGAAATTGTTTA) having a 5'-end FAM (5'-FAM) antigen label and is ligated to a 3' terminal strip with a THF spacer (THF spacer). There is a C3 spacer (C3-spacer) downstream of the SEQ ID NO. 4 (GGTGCCTTAAAACAT) sequence.

Preferably, the first and second markers are selected from haptens such as biotin, luciferin derivatives (eg FITC or FAM), rose red derivatives (eg TAMRA) , Cascade Blue, Lucifer yellow, 5-bromo-2-deoxyuridine (5-bromo-2-deoxyuridine, BrdU), dinitrophenol (DNP), digoxygenin (DIG), and short peptide tag sequences (ie, short peptides that produce specific antibodies) . More preferably, the first marker is biotin, the second marker is FAM, in which case the amplicon produced in the amplification step will be labeled with biotin and FAM.

Following the amplification step, the amplification product was added dropwise to the one-side flow chromatography device/test piece. The lateral flow chromatography device/test strip comprises a matrix that allows continuous capillary or lateral chromatography of the amplification product added to the buffer to the distal end of the lateral flow chromatography device. In general, the matrix of the lateral flow chromatography device is in the form of a test strip. Preferably, the matrix consists of a nitrocellulose membrane, polyvinylidene fluoride (PVDF), nylon or a single porous material substrate. The lateral flow chromatography device includes a native pad and a bonding pad at the proximal end and a detection zone (also referred to as a detection line) and a control zone (also referred to as a control line) at the distal end or adjacent distal end. The sample pad is configured to carry an amplification product, and when the amplification product flows laterally to the bonding pad, a mobile reporter having a first substrate in the bonding pad will specifically bind to the amplification The first mark or the second mark of the child.

By "mobile reporter" is meant microparticles which may be composed of a wide variety of materials, but are preferably composed of one or more substantially inert materials such as gold, silica, selenium, poly Polystyrene, melamine resin, polymethacrylate, styrene/divinylbenzene copolymer or polyvinyltoluene have the first effect Particles of matter. The particles are preferably non-porous. The microparticles may comprise a substance for imaging the results of the detection zone and the control zone on the lateral flow chromatography device. More conveniently, the substance will be a dye or other colored substance to give the naked eye a visual effect, however, or the substance may be, for example, a labeling substance such that it can be produced. A colored substance (eg, an enzyme or other catalytic label) is imaged by fluorescence, luminescence, or magnetic force (eg, using a fluorometer, luminometer, or magnetic induction).

The first substrate is selected from the group consisting of the first label or the second label and having the ability to specifically bind or react. Thus, the first agent can be an antibody, an antibody fragment (eg, a Fab, F(ab ' )2, and a scfv fragment), a receptor, or other binding partner. The first substrate itself can be bound to the enzyme or catalytic material to cause the detected product to be visualized and detected. When the first label is biotin and the first substrate is designed to bind to the first label, the first substrate may be streptavidin or avidin, but more An anti-biotin antibody.

The detection zone provides a second substrate that specifically binds the second marker or the first marker. The second agent binds to the second label or the first label is dependent on the first substrate and should be different from the binding partner of the first substrate. For example, if the first substrate is designed to bind the first marker, the second substrate should be combined with the second marker. Preferably, the first label is biotin, the second label is FAM, and the first substrate is designed to bind the second label, and the first object may be anti-FAM (anti-FAM) An antibody, and the second agent can be streptavidin, avidin or an anti-biotin antibody.

The detection zone provides detection results. That is, the detection zone uses a second substrate, in combination with the first or second label to immobilize the amplicon (where each amplicon should be bound to the mobile reporter), thereby displaying whether the sample has a pre-detected CAEV The result of the original virus. The "positive" (i.e., the result of the test indicates that there is a CAEV provirus in the sample) is preferably caused by a visual color signal appearing in the detection zone, the color signal being provided by the mobile reporter. When the mobile report is gold particles, the visual color signal will be a slightly pinkish red.

The control zone is a region of the lateral flow chromatography device/test piece that is different from the detection zone. Preferably, the control zone is located between the detection zone and the distal end of the lateral flow chromatography device/test strip. The control zone provides a positive control result. As will be described later, the positive control result may indicate that the mobile reporter has successfully flowed through the test piece. Thus, in the simplest case, the control zone provides a control substrate that specifically binds the first substrate, in which case the control zone combines and immobilizes the mobile reporter to provide a The results show whether the mobile reporter successfully passed through the substrate on the test piece.

[Set of the invention]

The invention also encompasses a set of methods for carrying out the method according to the invention.

As used herein, a "set" is a combination of reagents suitable for detecting a target DNA in accordance with the methods of the invention, in combination with one or more types of elements or compositions (eg, other types of biochemical reactants) , containers, packages suitable for commercial sale, substrates for such reactants, electronic hardware components, etc.).

A second aspect of the invention relates to the kit for detecting a goat arthritis encephalitis virus (CAEV) in a sample comprising: a pair of forward and reverse primers, with a CAEV gag segment (nt 512-1858) DNA as a target sequence; a probe sequence complementary to an internal region of the target sequence; a reagent for performing a recombinase polymerase amplification reaction; and a side stream chromatography device/test piece One of the primers has a first label, the probe sequence has a second label, and the target sequence is amplified to generate an amplicon labeled with the first and second labels; and the lateral flow chromatography device/ The test piece sequentially comprises (i) a sample pad, (ii) a bonding pad, (iii) a detection zone, and (iv) a control zone, the bonding pad having a movement reporter marked with a first substrate, the test piece The first substrate can specifically bind to the first label or the second label of the amplicon, and the detection region provides a first A second substrate that specifically binds to the second label or the first label, the control region providing a control substrate.

As used herein, "recombinase polymerase amplification" is a method of synthesizing DNA by binding a recombinant enzyme substrate to a target oligonucleotide to target DNA. First, a recombinase substrate is contacted with a first and second nucleic acid primer to form a first and second nucleic acid protein primer. Next, the first and second nucleic acid protein primers are contacted with the double-strand target sequence, forming a first double-strand structure in the first portion of the first strand, and forming a first portion in the second portion of the second strand The double-stranded structure, such that the 3' terminal and the second nucleic acid primer of the first nucleic acid primer are directed toward each of the known template DNA molecules. Third, the 3' terminal of the first and second nucleic acid protein primers is used by the DNA polymerase to generate the first and second double stranded nucleic acids, as well as the first and second replacement strands of the nucleic acid. Finally, the second and third steps are repeated until the desired degree of amplification is achieved. Reagents required for RPA are described in U.S. Patent No. US 2015/0240298 A1, the entire disclosure of which is incorporated herein by reference.

[Examples]

The following disclosure will be specifically described with reference to the embodiments and drawings. However, the disclosure herein is not limited to the embodiments and the drawings.

[Materials and Methods]

Animal and blood samples

The blood samples were collected from three groups of different species in different parts of Taiwan (94 Albay goats, 36 Saaneng and 70 slaves), one of which participated in the national goats guided by the Taiwan Council of Agriculture. Arthritis encephalitis (CAEV) disease prevention and elimination program. The other two groups were also those who had previously been serologically tested for CAEV positive. ELISA as described below Tests were performed to detect seronegative and seropositive goats with or without anti-CAEV antibodies for sampling. Includes many goats that exhibit chronic arthritis ("big knees") in seropositive animals, a symptom of a typical CAEV infection. Serum samples and EDTA-anticoagulant samples from each of 200 goats were simultaneously collected by jugular vein puncture. This animal procedure was approved by the Experimental Animal Ethics Committee of the Hsinchu Branch of the Animal Research Institute of the Executive Yuan.

Serological CAEV diagnostic test

Serum was collected from a condensed blood sample by centrifugation at 1,200 x g for 20 minutes and stored at -20 °C until use. Analysis of the presence of CAEV antibodies using a commercially available ELISA kit, using the Checkit medi-visna virus (MVV)/CAEV whole virus ELISA assay from Bommeli Diagnostics (Ribery-Bern, Switzerland) . The test is carried out in accordance with the manufacturer's instructions.

Total DNA template preparation

Total DNA in EDTA-anticoagulation was extracted using a QIAamp DNA Mini kit (Qiagen, Cotabov, France) according to the manufacturer's instructions. The concentration and quality of the DNA were measured at 260 nm and 280 nm using a Nano Drop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA), and then adjusted with water without DNA hydrolase (DNase-free). Up to 50 ng/μL. This quantitative DNA was stored at -20 ° C until the RPA reaction was carried out. One microliter of template was used in the preferred RPA-LFD reaction. Goat poxvirus DNA and bovine leukemia virus RNA were extracted from cell culture. Bovine leukemia virus RNA was amplified by reverse transcriptase PCR according to the method of Rovnak and Casey (1999).

Recombinant plastid construction

Order and synthesis located between the CAEV proviral genomes nt512 and nt1858 The CAEV gag gene sequence (GenBank accession number: M33677.1) was then replicated to the pUCIDT-AMP vector of Integrated DNA Technologies (IDT, Coralville, Iowa, USA). The recombinant plasmid was centrifuged and resuspended in 80 μL of IDTE (10 mM Tris, 0.1 mM EDTA) buffer (pH 7.5-8.0) according to the manufacturer's plastid resuspension protocol to achieve a concentration of approximately 50 ng/μL as a stock concentration. And stored at -20 ° C until use. Two microliters of template was used in each RPA reaction.

Recombinase polymerase amplification primer and probe design

Because the detailed mechanism of RPA is not fully understood, the amplification performance of known oligonucleotide primers is purely based on its sequence. It is recommended that the software design primers be tested and developed to screen a series of candidate primers and select better ones. Lead pair. The reaction TwistAmp ^® kit Manual Appendix, the appropriate range (29-35 bp, GC content of 30-70%) of the primer is by RPA candidate Primer3 to CAEV gag gene (512-1858 nt, GenBank accession number: M33677 .1) Conserved regions in the DNA sequence are designed for the target. The general forward primer P001 (SEQ ID NO. 1, 5 ' -TCAGAGGGGAGCACTTGACAGAAGGAAATTGT-3 ' , nt 618 was used to screen the conserved region of the CAEV gag gene (nt 618-803, 186 bp) according to the TwistAmp Reaction Kit Manual. '(this reverse primer P002 -biotin) of (5' -biotin-CTAATGTGGCCTGCAAAGACATAAAGTCT (SEQ ID NO.2 -3 -649) and having a 55) 'end biotin-labeled', nt 775-803), using TwistAmp ^® The Basic set (TwistDx, Cambridge, UK) meets the requirements of the invention. Thereafter, two nfo DNA probes (LF probe 1 and LF probe 2) for LFD analysis were designed from the sequence between the RPA primers. The probe is flanked by an upstream stretch (30 nt) carrying the 5 ' -FAM antigen and ligated to the adjacent downstream of the C3-spacer (polymerase expansion blocking group) at its 3' end by a THF spacer. It consists of an oligonucleotide (15 nt). Use TwistAmp ^® nfo kit (TwistDx, UK) probes to test the design nfo with the forward and the backward compatibility P001 P002 primers to amplify the CAEV gag gene (nt 512-1858). The LF probe 1 (5 ' -FAM-GGGGAGCACTTGACAGAAGGAAATTGTTTA (SEQ ID NO. 3)-THF-GGTGCCTTAAAACAT (SEQ ID NO. 4)-C3-spacer-3 ' ) showed the best target amplification (183 bp) ). The primer and probe were synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa, USA).

Recombinase polymerase amplification conditions and optimization

For screening of the primer, using slightly modified TwistAmp ^® Basic kit (TwistDx, Cambridge, UK) to the manufacturer's protocol, for RPA reaction volume to 50μL. A mixture of 1 ng of recombinant plastid DNA, 0.42 μM of each RPA primer, 14 mM magnesium acetate, 1×rehydration buffer, and water without DNA hydrolase (DNase-free) was added to the dried enzyme granules. And mix well. The magnesium acetate was pipetted to the tube lid, and then magnesium acetate was centrifuged into the tube, and the RPA mechanism was initiated at 37 ° C for 60 minutes. The reaction was developed by 4% agarose gel electrophoresis (AGE). For screening probe using TwistAmp ^® nfo kit (TwistDx, Cambridge, UK) in 50μL reaction volume of RPA. Through to the 5 'end biotin (5' Biotin) residues labeled reverse primers P002 and P002 P001 make RPA primer suitable for analysis, and testing with the two primers (LF RPA probe according to the LF internal probe designed guide TwistDX Compatibility of needle 1 or LF probe 2). Next, 0.42 μM of each RPA primer (P001 and P002) and 0.12 μM of LF probe (LF probe 1 or LF probe 2) were mixed with 1×rehydration buffer and DNA without hydrolase, and then The mixture was added to dry granules of a Twist Amp nfo kit (TwistDx, Cambridge, UK). The recombinant plastid DNA (1 ng) was added, and 14 mM magnesium acetate was pipetted into the cap, followed by centrifugation at 37 ° C to initiate the RPA mechanism reaction for 60 minutes. The reaction was developed by 4% AGE.

For diagnosis of the presence of CAEV samples, using TwistAmp ^® nfo kit (TwistDx, Cambridge, UK) in 50μL reaction volume of RPA. First mix 1 μL of the field genomic DNA sample, 0.42 μM each RPA primer (P001 + P002 primer), 0.12 μM LF probe 1, 14 mM magnesium acetate, 1 × rehydration buffer, and DNA without DNA hydrolase, then Add to dry enzyme granules. The magnesium acetate was pipetted to the cap, then the lid was closed, and then magnesium acetate was centrifuged into the tube to initiate the RPA mechanism. The tube was incubated at 37 ° C for 30 minutes.

Lateral flow dipstick (LFD) analysis

The RPA amplicon was observed to be a positive line on the LFD test piece (Milenia Biotec, Giessen, Germany). To detect the RPA amplification on LFD, 2 [mu]L of RPA product was added to a new tube containing 120 [mu]L of assay buffer (1 x phosphate buffered saline with 0.1% Tween 20). The LFD test piece was then immersed in the mixture for 5 minutes to visualize the test results. That is, after the LFD test piece is immersed in the mixture, the composition of the mixture can flow through the film, which comprises the same pad, a bonding pad, a detection zone, and a control zone. The mat has a mobile reporter with an anti-FAM antibody so the mobile reporter can bind to the double labeled FAM and biotin amplicon. The test line contains an anti-biotin antibody that "captures" the double-labeled amplicons. Since the double-labeled amplicon binds to the mobile reporter, it is colored with a reddish pink line in the case where the detection line is captured by the anti-biotin antibody. In another aspect, the positive control line comprises a secondary anti-FAM antibody that captures the reporter reporter, either not bound to the amplicon, or is bound to the anti-biotin antibody capture and expansion on the undetected line. Move the report. The positive control line is used to confirm that the mobile reporter has flowed through the membrane. The capture of the mobile reporter at the positive control line also produces a reddish red line. The overall LFD analysis was performed at room temperature.

Molecular specificity of RPA-LFD assay

The molecular specificity of the RPA-LFD assay was evaluated using the RPA P001, P002 primer and LF probe 1, and was evaluated by cross-reactivity assay using two other animal viruses (ie, goat pox virus and bovine leukemia virus). 100 ng of the DNA or cDNA template was performed under established conditions for detection of CAEV. The virus specimens were provided by the Animal Health Laboratory of the Taiwan Executive Yuan. The resulting product was analyzed as LFD and 4% AGE.

Evaluation of RPA molecular sensitivity using LFD and AGE

The total DNA was extracted from goats infected with CAEV for 5 times serial dilutions of 50 ng, 10 ng, 2 ng, 400 pg and 80 pg, and the plastid DNA was subjected to 10-fold serial dilutions 10 ⁸ , 10 ⁷ , 10 ⁶ , 10 ⁵ , 10 ⁴ , 10 ³ , 10 ² and 10 copy numbers are used as RPA templates. The resulting DNA product was compared by LFD and AGE analysis.

Comparison of credibility and positive rate of RPA-LFD with serological ELISA

Simultaneous screening of goat samples with unknown CAEV infection status using RPA-LFD analysis and serological ELISA kits: (1) The RPA-LFD assay is performed according to the procedure for diagnosing CAEV using the on-site sample of genomic DNA as previously described; 2) The serological ELISA was tested with a serum sample using a Checkit MVV/CAEV whole virus ELISA from Bommeli Diagnostics (Ribery-Bern, Switzerland) according to the manufacturer's instructions. And the coefficient of McNemar test consistency was calculated by the coefficient. The 0 equivalent did not exceed the accidental consistency, while the 1.0 indicates the perfect consistency between the RPA-LFD and the ELISA test.

[result]

RPA-LFD condition determination

The preferred temperature for the RPA reaction is confirmed by using 10 ³ fold and 10 ² copy number of plastid DNA as a template, and the copy number amplification is carried out at 37 ° C, 38 ° C or 39 ° C, respectively. The amplification results as determined by AGE did not show significant amplification differences at 37 ° C, 38 ° C or 39 ° C (data not shown). Therefore, the test results and the manufacturer's guidance instructions are known, and 37 ° C is selected as the analysis temperature. The RPA reaction at 10, 20, 30, 45, and 60 minutes was performed at 37 ° C using 10 ² copy number of plastid DNA as a template, and the amount of amplification products at 30, 45, and 60 minutes was similar, but higher than 10 and 20 The amount of amplification product in minutes. In fact, the amplification product determined by AGE showed almost no results at 10 minutes, and only weak results were observed at 20 minutes (as shown in Figure 1). Therefore, in order to be practical and efficient in use in the field, a 30 minute culture time is selected as a preferred condition. LF test strips were also used to detect the detection of RPA amplification products. The amplified product was detected by a culture time as short as 10 minutes, and a clear positive test band was observed in 30 minutes (Fig. 1).

Molecular specificity of RPA-LFD

For the specific detection of RPA P001, P002 primer and LF probe 1 under preferred conditions, the reaction is carried out with DNA or cDNA from other vertebrate viruses. In the case of testing and detection with other vertebrates such as goat pox virus and bovine leukemia virus with AGE (Fig. 2A) and LFD (Fig. 2B), there is no cross reaction, indicating that the primer and the probe are for the CAEV gag gene side. Specific. However, ladder-like patterns and primer/probe residues occasionally occur when AGE is detected under non-preferred conditions, such as: non-preferred culture temperature, non-preferred culture time, and non-preferred template DNA. Quality and quantity. Therefore, the ability of the LFD assay to discriminate its target amplification products from non-related amplicon or primer/probe residues was also evaluated. The LFD assay showed only positive results for its desired 186-bp target amplification product, ie, no primer/probe residues confirmed by AGE in no template control (NTC) False positive results, and only reddish purple control lines appear (Fig. 2B).

Comparison of Molecular Sensitivity between RPA-AGE Analysis and RPA-LFD Analysis

In the case of detecting the sensitivity of the RPA-LFD analysis, using a 5-fold serial dilution of the total DNA extract, it was found that 80 pg of total goat DNA was the detection limit (Fig. 3B). This is 625 times better than the detection limit of 50 ng for the RPA-AGE analysis (Fig. 3A). In the case of recombinant plastids as a template, the RPA-LFD analysis showed a positive signal at the 10-fold copy number of the detection limit (Fig. 4B), but the RPA-AGE showed a weak band only at 100-fold copy number (Fig. 4B). Figure 4A). These results indicate that using the LFD method to detect the RPA product is more sensitive than using the AGE method to detect the RPA product, and that LFD can produce a stronger positive signal even when the AGE detection is not clear.

Comparison of credibility and positive rate of RPA-LFD with serological ELISA

To assess the statistical sensitivity and specificity of this RPA-LFD assay, it was tested in parallel with the on-site samples with conventional ELISA assays. The comparison of the ELISA with the results of the RPA-LFD analysis is shown in Table 1. Of the 200 goat samples tested by ELISA and RPA-LFD, 157 (78.5%) were positive for both analyses. Of the 200 goats, 43 (21.5%) and 36 (18.0%) were negative for ELISA and RPA-LFD analysis, respectively, and 7 (3.5%) of 43 seronegative goats were at RPA-LFD. Positive in the analysis. Therefore, the RPA-LFD analysis (82%) had a significantly higher CAEV positive rate (P < 0.05) compared to the ELISA analysis (78.5%). The coefficient is 0.89, indicating a strong consistency between the two analyses.

The higher sensitivity and specificity exhibited by this LFD method is due to the use of gold-labeled anti-FAM antibodies to specifically capture FAM-labeled RPA amplicons, which have unrelated under non-preferred amplification conditions. The ability of the amplicon to discriminate the target amplicon. The LFD method provides a visible band on the test piece even when the amount of the amplified product is very low, as low as in the AGE (Fig. 3). Obviously, the LFD assay has high sensitivity and is able to counteract the accidental mismatched DNA target sequence, while also providing better sensitivity than the AGE method, by confirming the identity of the RPA amplicon. Without the hybridization step of the amplicon and probe, the detection of the RPA amplicon by LFD is simple and can be determined at room temperature for 5-15 minutes.

In the present invention, the RPA method has been successfully developed for amplifying the gag gene region of the CAEV, and the amplicons can be simply determined by the above semi-quantitative colorimetric change of the LF test piece (Fig. 4B). The amplification reaction can be detected by culturing at 37 ° C for only 30 minutes. Therefore, in a popular area, it is sufficient to use a heating block, a water bath, a battery-powered device, or even a human body temperature to remove the external power supply and the foundation. The needs of the facility. The present invention also shows that the RPA-LFD analysis provides a significantly higher CAEV-positive rate (P < 0.05) compared to ELISA analysis, and the result may be due to the fact that RPA can theoretically even detect a single template DNA copy number. In the clinical evaluation, the results also showed that the RPA-LFD analysis was more sensitive than the regular ELISA analysis. These results also indicate that CAEV can be assayed by RPA-LFD analysis in the absence of detectable antibodies.

Accordingly, the present invention provides a sensitivity and specificity of the RPA-LFD presence diagnostic method for detecting CAEV proviral DNA in a simple, rapid and cost effective manner. The combination of RPA amplification and LFD detection resulted in a total analysis time of approximately 35 minutes, which was only RPA-AGE analysis. A quarter of the time is about 6 times faster than the ELISA assay currently used to detect CAEV. High sensitivity and specificity, short detection time, and confirmation of the amplicon by lateral flow chromatography are the key advantages of this method. The procedure eliminates the need for additional equipment in addition to a simple heating block, making the diagnosis of CAEV infection possible in laboratories with insufficient equipment or even presence.

Embodiments have been disclosed herein, but other variations are possible. The modifications and variations that are obvious to those skilled in the art are included in the scope of the appended claims.

<110> National Taiwan University

<120> Methods and kits for detecting goat arthritis encephalitis virus infection in the field

<130> P161289TW

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 32

<212> DNA

<213> Unknown

<220>

<223> Forward introduction

<220>

<221> Introduction_Combination

<222> (1)..(32)

<400> 1

<210> 2

<211> 29

<212> DNA

<213> Unknown

<220>

<223> Reverse primer

<220>

<221> Introduction_Combination

<222> (1)..(29)

<400> 2

<210> 3

<211> 30

<212> DNA

<213> Unknown

<220>

<223> Probe

<220>

<221> misc_ feature

<222> (1)..(30)

<400> 3

<210> 4

<211> 15

<212> DNA

<213> Unknown

<220>

<223> Downstream of the probe

<220>

<221> misc_ feature

<222> (1)..(15)

<400> 4

Claims (8)

A method for detecting a caprine arthritis-encephalitis virus (CAEV) infection, the method comprising the steps of: (a) a pair of a forward primer having the sequence of SEQ ID NO. 1 and having SEQ ID NO a reverse primer of the sequence of 2 and a gag segment DNA of CAEV in a recombinase polymerase amplification (RPA) sample in the presence of a probe having SEQ ID NO. 3 and SEQ ID NO. a conserved region (nt 618-803, 186 bp) as a target sequence, the probe is complementary to an internal region of the target sequence, wherein an primer has a first label and the probe has a second label The target sequence is amplified to produce an amplicon having first and second labels; (b) the amplification product of step (a) is added dropwise to a lateral flow device/strip Flowing laterally to the distal end of the lateral flow chromatography device/test piece, wherein the lateral flow chromatography device/test piece sequentially comprises (i) a sample pad, (ii) a bonding pad, (iii) a a detection zone and (iv) a control zone; the bonding pad having a movement reporter marked with a first substrate, the first The substance may specifically bind to the first label or the second label of the amplicon; the detection region has a second substrate that specifically binds to the second label or the first of the amplicon a marker for inhibiting further amplification of the amplicons associated with the mobile reporter; the control region provides a control substrate; and (c) detecting whether there is any binding of the amplification product in the detection region . The method of claim 1, wherein the first and second markers are selected from the group consisting of biotin, fluorescein derivatives, rhodamine derivatives, and cascade blue ( Cascade Blue), Lucifer yellow, 5-bromo-2-de 5-bromo-2-deoxyuridine (BrdU), dinitrophenol (DNP), digoxygenin (DIG), and short peptide labeling sequences. The method of claim 2, wherein the reverse primer has a 5'-biotin label. The method of claim 3, wherein the probe is SEQ ID NO. 3 having a 5'-end FAM (5'-FAM) antigen marker and is ligated to a 3' with a THF spacer (THF spacer) The terminal consists of a downstream sequence of SEQ ID NO. 4 with a C3 spacer (C3-spacer). The method of claim 4, wherein the mobile reporter is a gold, silica, selenium, polystyrene, melamine resin, polymethacrylate, A styrene/divinylbenzene copolymer or a particle of polyvinyltoluene. A kit for detecting a goat arthritis encephalitis virus (CAEV) in a side sample comprising: a pair of a forward primer having the sequence of SEQ ID NO. 1 and a reverse primer having the sequence of SEQ ID NO. 2, The CAEV gag segment (nt 512-1858) DNA targets the target sequence; a probe complementary to an internal region of the target sequence, having SEQ ID NO. 3 and SEQ ID NO. 4; a reagent, For performing a recombinase polymerase amplification reaction; and a one-stream chromatography device/test piece; wherein the primer has a first label, the probe has a second label, and the target sequence is amplified to generate a label a first and a second labeled amplicons; and the lateral flow chromatography device/test piece sequentially comprises (i) a sample pad, (ii) a bonding pad, (iii) a detection zone, and (iv) a a control zone, the bonding pad having a movement reporter labeled with a first substrate, the first substrate specifically binding Combining the first marker or the second marker of the amplicon, the detection zone has a second substrate that specifically binds the second marker or the first marker, and the control region provides a control function Things. The kit of claim 6 further comprising a reagent for extracting nucleic acid from the sample. The kit of claim 6, wherein the reverse primer has a 5'-biotin label and the probe is labeled with a 5'-end FAM (5'-FAM) antigen SEQ ID NO. 3, and is ligated with a THF spacer (THF spacer) to a downstream of the sequence of SEQ ID NO. 4 with a C3 spacer at the 3' terminus, the mobile reporter is labeled with an anti-FAM (anti -FAM) microparticles of the antibody, and the control substrate is a secondary antibody against the FAM (anti-FAM) antibody.