TWI592483B - Use of probiotic composition in manufacture of composition for ameliorating intestinal flora and reducing gastric mucosal lesion index - Google Patents

Description

Probiotic composition for preparing a composition for improving intestinal bacteria phase and reducing gastric mucosal damage index the use of

The present invention relates to the technical field of probiotics, in particular to a probiotic composition having an improved intestinal intestinal phase and a reduced gastric mucosal injury index by processing a lactic acid strain Lactobacillus paracasei subsp. paracasei NTU 101.

The "lactic acid bacteria" refers to bacteria capable of metabolizing sugars and producing 50% or more of lactic acid, for example, Lactobacillus, Streptococcus, and Leuconostoc. Human consumption of fermented dairy products has a long history. Therefore, lactic acid bacteria have always been regarded as a highly recognized strain (GRAS) and are the most representative enteric beneficial bacteria.

Lactic acid bacteria are the most important group of "probiotics". Probiotics are defined as "the quality of human intestinal flora can be improved when one or more microorganisms are fed to humans." Among them, the role of lactic acid bacteria in improving the quality of intestinal flora is as follows: (1) production of organic acids, lowering intestinal pH; (2) competing for nutrients with harmful bacteria; (3) adhering to intestinal mucosa epithelium to reduce the proliferation of harmful bacteria; and (4) producing antibacterial substances.

At present, many domestic fermented milk products are subjected to large-scale human drinking experiments, which prove that their products enhance the effect of beneficial bacteria in the intestines and pass the health food certification of the Department of Health.

Lactobacillus paracasei subsp. paracasei NTU 101 is an excellent native lactic acid strain developed by Professor Pan Ziming, Director of the Institute of Microbiology and Biochemistry, National Taiwan University, and its research and development team. At present, many literatures have confirmed that L.paracasei subsp. paracasei NTU 101 has many health effects such as improving gastrointestinal phase, lowering blood pressure, lowering blood fat, lowering cholesterol, and anti-allergy. It has deep market potential and has many products listed or prepared. Listing.

Although, L. paracasei subsp. paracasei NTU 101 has been successfully commercialized, it still lacks the DNA molecular recognition marker required for strain identification and patent protection. The DNA molecule recognition marker is a DNA sequence or a DNA polymorphism map that can be used to identify a particular strain. Compared to conventional biochemical tests, the identification of strains with DNA molecular recognition markers has the following advantages: there is no need to culture isolated strains, no need to culture live bacteria, and is suitable for processing articles.

Therefore, in order to provide the DNA sequence of L. paracasei subsp. paracasei NTU 101 for identifying a specific strain and its DNA polymorphism map, the inventors of the present invention tried to study the invention and finally developed a NTU 101 lactic acid strain of the present invention. , its nucleotide sequence and its introduction group.

A primary object of the present invention is to provide for the use of L. paracasei subsp. paracasei NTU 101 for the preparation of a probiotic composition for improving intestinal flora and reducing gastric mucosal injury index.

Therefore, in order to achieve the above-mentioned main object of the present invention, the inventors of the present invention proposed a lactic acid strain, which is Lactobacillus paracasei subsp. paracasei NTU 101, and which is deposited in the German National Collection of Cultures, the accession number is DSM 28047, wherein Lactobacillus paracasei subsp. paracasei NTU 101 has the nucleotide sequence of one of SEQ ID NO: 1. Wherein, the lactic acid strain can be further prepared into a pure lactic acid bacteria powder or a composite lactic acid bacteria powder, and the adult ingesting at least 4 grams of the pure lactic acid bacteria powder or the composite lactic acid bacteria powder per day helps to improve the bacterial phase of at least one of the bacteria in the intestine, and reduces Gastric mucosal lesion area, reduction of gastric mucosal injury index, and reduction of histamine concentration in gastric mucosa.

Further, in order to achieve the above-mentioned main object of the present invention, the inventors of the present invention proposed an introduction group for identifying the aforementioned Lactobacillus paracasei subsp. paracasei NTU 101 lactic acid strain, which is: (1) A3-5F3 CGCCGAACGCGACTTACATC (SEQ ID NO: 4); or (2) A3-5R3 GGCAAATTTAAACTTGCCTTCAACG (SEQ ID NO: 4). Among them, by multiplying polymorphic DNA and gathering The technique of the synthase chain reaction can amplify the A3-5F3 primer into the nucleotide sequence having SEQ ID NO: 1.

The first picture is the image of the RAPD polymorphism map of the combination A, J and L; the second A picture, the second B picture, the second C picture introduction group A and the casei group RAPD polymorphism Image map of the comparative analysis of the map; image map of the third A map, the third B map, and the third C map introduction group L and the casei group of the RAPD polymorphism map of the casei group; The sequence alignment of the RAPD polymorphic fragment A3-5; the fifth is the sequence alignment of the RAPD polymorphic fragment L3-18; the sixth A and sixth B are the RAPD polymorphic fragment A3- 5 molecular marker specificity test map; the seventh map is the stomach wall image map.

In order to more clearly describe the use of a probiotic composition of the present invention for the preparation of a composition for improving intestinal bacteria phase and reducing gastric mucosal damage index, a preferred embodiment of the present invention will be described in detail below with reference to the drawings.

NTU 101 lactic acid strain, an excellent native lactic acid strain developed by Professor Pan Ziming, director of the Institute of Microbiology and Biochemistry of National Taiwan University, and its research and development team - Lactobacillus paracasei subsp. paracasei NTU 101, which is deposited with the German National Culture Collection Center (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ, Inhoffenstr. 7B, D-38124 Braunschweig, Germany)) and the accession number is DSM 28047. Please refer to Table 1 below. By placing the Lactobacillus paracasei subsp. paracasei NTU 101 and a carbon source in a medium and culturing for at least 24 hours, the Lactobacillus paracasei subsp. paracasei NTU 101 will produce a certain amount. Lactic acid. And, as listed in Table 1, the carbon source may be any of the following: glucose, galactose, D-ribose, xylose, fructose, α-lactose, maltose, sucrose, trehalose, raffinose, inositol, Sorbitol, D-mannitol, citric acid, dextrin, starch, or molasses.

Also, please refer to Table 2 below. By placing the Lactobacillus paracasei subsp. paracasei NTU 101 and a nitrogen source in a medium and culturing for at least 24 hours, the Lactobacillus paracasei subsp. paracasei NTU 101 will produce a certain amount. The amount of lactic acid. Also, as listed in Table 2, the nitrogen source may be any of the following: yeast extract, beef extract, peptone, soybean meal, tryptone, corn syrup, casein, urea, ammonium citrate, or ammonium sulfate.

The experimental data detailed in Tables 1 and 2 above confirm that the lactic acid strain L. paracasei subsp. paracasei NTU 101 can produce a certain amount of lactic acid, and therefore, it is used as a fermentation bacterium for processed products.

Next, in order to effectively identify the DNA sequence of the lactic acid strain L. paracasei subsp. paracasei NTU 101, in the present invention, 20 pieces of random primers (Random Primer) were purchased from BioBio Co., Ltd. (MDBio, Inc., Taipei, Taiwan). ), and these are introduced in the following list.

Next, the 20 primers contained in Table 3 were reconstituted in sterile water to a concentration of 100 μM, and then stored at -20 ° C. Continuing, see Listing 4 below, which is applied to the RAPD primer combination. As shown in Table 4, in order to increase the above primer into a DNA sequence similar to the lactic acid strain L. paracasei subsp. paracasei NTU 101 by the technique of Random Amplification of Polymorphic DNA (RAPD), Table 3 The 20 primers contained in the table were formulated into 16 primer groups according to Table 4, and the final concentration of each primer group was 1 μM.

Continuing, the 16 primer sets of Table 4 above were subjected to RAPD by Polymerase Chain Reaction (PCR). Among them, PCR (Polymerase Chain Reaction) has a total reaction volume of 25 μl and contains 3 ng of strain DNA, 80 nM primer, 1X Exsel reaction buffer, 5 U of Exsel DNA polymerase (Bertec Enterprise, Taipei, Taiwan), and 200 M dNTP. The reaction conditions of the PCR were heated at 95 ° C for 5 min, followed by heating at 95 ° C for 30 sec, 25 ° C for 3 min, 70 ° C for 45 sec, and 35 cycles under this condition; finally, extending at 70 ° C for 7 min.

After completion of the above PCR reaction, the PCR product was taken out and analyzed by electrophoresis in 1% agar colloid (agarose); then, the electrophoresis film was dyed with SYBR Safe dye (Life Technologies Corporation) for 30 min, and after 20 min of defection The stained electrophoretic film was placed in a blue (488 nm) light box and photographed and archived using an image processing system. Further, / PCR Purification Kit (Favorgen biotech Corp) for Gel Extraction via RAPD fragment is the above process is obtained from at FavorPrep ^TM Gel, and at T & ATM Cloning Kit (Yeastern Biotech Co., Ltd., Taipei, Taiwan) recovered RAPD The fragment was selected and finally entrusted to Taipei, Taiwan for confirmation of the unique sequence of the NTU 101 strain.

Please refer to the first figure for the image of the RAPD polymorphism map of the combination A, J and L. As shown in the first figure, among the 16 primer combinations, the introduction group A, J and L can produce an appropriate number of RAPD polymorphic fragments; therefore, the introduction groups A, J and L can produce L. paracasei subsp. The unique RAPD polymorphism map of paracasei NTU 101 strain specificity, especially the primer combinations A and L.

Please continue to see Table 5 below for the strains used to confirm the unique sequence of the NTU 101 strain. As shown in Table 5, except for L. paracasei subsp. paracasei NTU 101, the strains listed in Table 5 were purchased from the Food Industry Research and Development Institute (FIRDI, Hsinchu, Taiwan). And these strains belong to the casei group Lactobacillus which has a close relationship with L. paracasei subsp. paracasei , including 12 L. paracasei , 10 L. casei , 7 L. rhamnosus , and 3 L .zeae .

Please refer to the second A diagram, the second B diagram and the second C diagram, which are image diagrams of the comparison analysis of the RAPD polymorphism map of the introduction group A and the casei group Lactobacillus. As shown in Figure 2A, the RAPD polymorphic fragment of the primer set A was aligned with Lactobacillus paracasei , and the alignment showed that the (nucleic acid) sequence of the RAPD polymorphic fragment of the primer set A had a significant and unique sequence. difference. Furthermore, as shown in the second B-picture, the RAPD polymorphic fragment of the primer set A was aligned with Lactobacillus casei , and the alignment result showed that the sequence of the RAPD polymorphic fragment of the primer group A had a remarkable and unique sequence. difference. Furthermore, as shown in the second C-picture, the RAPD polymorphic fragment of the primer group A was compared with Lactobacillus zeae and Lactobacillus rhamnosus , and the alignment showed that the sequence of the RAPD polymorphic fragment of the primer group A was significant. Unique sequence differences. Among them, the unique introduction group A is obtained by the amplification of primers B02 and D11, and is further labeled as A3-5. And, as shown in the sequence listing of the annex, this A3-5 nucleotide sequence fragment has 838 bp, and its nucleotide sequence is defined as SEQ ID NO: 1. Further, as shown on page 2 of the Sequence Listing of the Annex, the nucleotide sequence fragment of the primer B02 has 10 bp, and its nucleotide sequence is defined as SEQ ID NO: 2; in contrast, the nucleotide sequence fragment of the primer D11 It also has 10 bp and its nucleotide sequence is defined as SEQ ID NO: 3.

Continuing, please refer to the third A diagram, the third B diagram and the third C diagram, which are image diagrams of the comparison analysis of the RAPD polymorphism map of the introduction group L and the casei group Lactobacillus. As shown in Figure A, the RAPD polymorphic fragment of the primer set L was aligned with Lactobacillus paracasei , and the alignment showed that the (nucleic acid) sequence of the RAPD polymorphic fragment of the primer set L has a significant and unique sequence. difference. Moreover, as shown in the third B-picture, the RAPD polymorphic fragment of the primer set L is compared with Lactobacillus casei , and the alignment result shows that the sequence of the RAPD polymorphic fragment of the primer group L has a remarkable and unique sequence. difference. Furthermore, as shown in the third C-picture, the RAPD polymorphic fragment of the primer group L was compared with Lactobacillus zeae and Lactobacillus rhamnosus , and the alignment showed that the sequence of the RAPD polymorphic fragment of the primer group L was significant. Unique sequence differences. Among them, the unique introduction group L is obtained by the amplification of primers B09 and D19, and is further labeled as L3-18. And, as shown in the following Table 6, the L3-18 nucleotide sequence fragment has 2477 bp.

Through the above various experimental results and data, it is preliminarily known that the RAPD polymorphic fragments A3-5 and L3-18 obtained by the amplification of the primer set A and L may carry the unique sequence fragment of L. paracasei subsp. paracasei NTU 101. In order to further confirm this part, it is necessary to take a sequence homologous to L. paracasei subsp. paracasei NTU 101 from the DNA sequence database-Genbank for comparison. Please refer to the fourth and fifth figures, which are the sequence alignment diagrams of the RAPD polymorphic fragments A3-5 and L3-18, respectively. As shown by the dotted line in Figure 4, after comparison with the homologous sequences in the Genbank database, it was found that the RAPD polymorphic fragment A3-5 does have L. paracasei subsp. paracasei NTU 101 The molecular recognition identifies a unique sequence fragment; and, as indicated by the dashed line enclosed in Figure 5, the RAPD polymorphic fragment L3-18 also carries a molecular recognition marker that can be used as L. paracasei subsp. paracasei NTU 101. Unique sequence fragment.

Therefore, from the above comparison results, we can know that the RAPD polymorphic fragments A3-5 and L3-18 all carry a unique sequence fragment which can be used as a molecular recognition marker of L. paracasei subsp. paracasei NTU 101. Therefore, in order to confirm the specificity of molecular markers, further testing of molecular marker specificity must be carried out. As shown in Table 7 below, we have pre-designed the primers to confirm the sequence of specificity.

Please refer to the sixth and sixth panels, which are the test maps for the molecular marker specificity of the RAPD polymorphic fragment A3-5. As shown in Figure 6A and Figure 6B, after using the primers in Table 7 above to test the specificity of NTU 101's close relatives ( casei group Lactobacillus), it was found that the introduction group A3-5 (F3/ R3) has the specificity of NTU 101 strain, so its (nucleic acid) sequence can be used to identify the specificity of NTU 101 strain. As shown in page 3 of the attached Sequence Listing, the nucleotide sequence fragment of the primer set A3-5F3 has 20 bp, and its nucleotide sequence is defined as SEQ ID NO: 4; and, the nucleoside of the primer set A3-5R3 The acid sequence fragment has 25 bp and its nucleotide sequence is defined as SEQ ID NO: 5.

Through the above description, the NTU 101 lactic acid strain, its nucleotide sequence and its primer set have been completely revealed; and, in summary, the present invention has the following advantages: The present invention provides L. paracasei subsp. The nucleotide sequence of the paracasei NTU 101 lactic acid strain and its primer set enable the relevant skilled person to have a basis for the identification of the strain of L. paracasei subsp. paracasei NTU 101; and, further, the relevant skilled person can pass the DNA molecule. The marker is identified to rapidly identify the NTU 101 strain without the need to culture isolates or culture live bacteria.

Continuing, the health application of the lactic acid strain of the present invention (i.e., Lactobacillus paracasei subsp. paracasei NTU 101) will be described below. The probiotic composition of the present invention having an index of improving intestinal bacteria and reducing gastric mucosal damage is processed into a pure lactic acid bacteria powder or a complex lactic acid bacteria powder by processing the above-mentioned lactic acid strain (ie, Lactobacillus paracasei subsp. paracasei NTU 101); Thus, an adult ingesting at least 4 grams of the pure lactic acid bacteria powder (hereinafter referred to as NTU101 lactic acid bacteria powder) or the composite lactic acid bacteria powder can improve at least one bacterial phase of the intestine, reduce the area of gastric mucosal damage, and reduce the gastric mucosal damage index. And reduce the concentration of histamine in the gastric mucosa. In order to confirm that the NTU 101 lactic acid powder does have the effects of reducing the area of gastric mucosal damage, reducing the index of gastric mucosal damage, and reducing the concentration of histamine in the gastric mucosa, a number of experimental data will be provided to prove it.

The experimental animals selected for the validation experiment were 8-week-old SD rats. (Sprague-Dawley rats, SDRs), which weigh about 250 to 275 grams. The validation experiment was divided into group C (C group), 0.5-fold group (0.5X group), 1-fold group (1X group), 5-fold group (5X group), live group (Live group), and dead bacteria A. Group (DA group) and dead group B (DB group), each group containing 8 SD rats. This experiment is based on an adult dose of 4 grams. The body dose conversion formula (BSA) provided by the Food and Drug Administration (FDA) is converted to a rat dose of 0.3 (g). / rat weight). The test materials and doses used in each group of tests are recorded in Table 8 below.

During the 8-week experiment, the rats were fed with a chow diet, and each group of test subjects was placed in a 1.0 mL sterile distilled aqueous solution, and then the rats were fed through a sterile plastic syringe with a stainless steel feeding needle. .

As shown in Table 9 below, during the 8-week experiment period, the body weight of each group increased normally with time, and the body weight of each group changed. There was no significant difference between the test groups (p>0.05).

Moreover, as shown in Table 10 below, after 6 to 8 weeks of continuous feeding of the test articles, the dry weight of feces in each group of rats was significantly higher than that in the control group (C group). The experimental results showed that the long-term feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder can effectively increase the dry weight of feces excreted by animals.

Please continue to refer to Table 11 below, which counts the C. perfringens bacteria contained in the feces and cecal contents of each group of rats. number. The experimental results in Table 11 show that continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 4 weeks and 6 weeks can significantly reduce the number of C. perfringens in the feces of SD rats (p<0.05); The results also showed that continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks could significantly reduce the number of C. perfringens in rat feces (p<0.05).

In addition, after completion of the 8-week test article feeding, SD rats were sacrificed and cecal contents were obtained. As recorded in Table 11 above, in addition to NTU 101 dead powder B, continuous feeding of 8 weeks of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder A can significantly reduce the C. perfringens in the cecum of SD rats. Number of bacteria (p<0.05).

Continue to refer to Table 12 below, which counts the number of Bifidobacterium spp. bacteria contained in the feces and cecal contents of each group of rats. The experimental results in Table 12 show that continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 4 weeks and 6 weeks, can significantly increase the number of Bifidobacterium spp. in the feces of SD rats (p<0.05), in which the bacteria in the live bacteria SD rats contain Bifidobacterium spp. The number is again higher than other groups of SD rats. Moreover, the experimental results also showed that continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks can significantly increase the number of Bifidobacterium spp. in rat feces (p<0.05).

In addition, after completion of the 8-week test article feeding, SD rats were sacrificed and cecal contents were obtained. As recorded in Table 12 above, continuous lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks can significantly increase the number of Bifidobacterium spp. in the cecal of SD rats (p<0.05). Therefore, the experimental statistics of Tables 11 and 12 confirm that daily intake of at least 0.3 g/rat body weight (equivalent to 4 g in adult dose) helps to improve at least one bacterial phase in the intestine.

Please continue to refer to Table 13 below, which counts the number of Lactobacillus spp. bacteria contained in the feces and cecal contents of each group of rats. The experimental results in Table 13 show that continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 4 and 6 weeks can significantly increase the number of Lactobacillus spp. in the feces of SD rats (p<0.05). The number of bacteria containing Lactobacillus spp. in the feces of SD rats was higher than that of other groups. Moreover, the experimental results also showed that the continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks can significantly increase the number of Lactobacillus spp. in rat feces (p<0.05).

In addition, after completion of the 8-week test article feeding, SD rats were sacrificed and cecal contents were obtained. As recorded in Table 12 above, continuous lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks can significantly increase the number of Lactobacillus spp. in the cecum of SD rats. (p<0.05).

Continue to refer to Table 14 below, which counts the amount of Short-chain fatty acids contained in the cecum of each group of rats. The experimental results in Table 14 show that, in addition to feeding 0.5 times of compound lactic acid bacteria powder and NTU101 dead powder-B, continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks, the SD rats in each group were in the cecum. The content of acetic acid (Acetic acid), propionic acid and butyric acid contained is significantly increased. It is well known that these short chain fatty acids, particularly acetic acid, lower intestinal pH and inhibit the growth of intestinal saprophytic bacteria.

Continue to refer to Table 15 below, which provides experimental data on acute gastric lesions in each group of rats; and, see also the seventh panel, which is a map of the stomach wall of each group of rats. From Fig. 7 and Table 15, it can be observed that the control area (C group) has a lesion area of 4.11 ± 2.14 mm 2 and a lesion index of 0.0635 ± 0.0419. Continuous feeding of compound milk After 8 weeks of acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder, SD rats with NTU 101 pure powder, NTU 101 dead powder-A and NTU 101 dead powder-B were found to have relative damage index. The control group decreased by 98.74%, 67.71% and 76.69% respectively. At the same time, the pH value of gastric acid, total gastric acidity, and volume of gastric acid of each group of rats were not significantly different from those of the control group. Therefore, the experimental results in Figures 7 and 15 confirm that daily intake of at least 0.3 g/rat body weight (equivalent to 4 g in adult dose) helps to reduce the area of gastric mucosal damage and reduce the index of gastric mucosal damage.

As shown in Table 16 below, the data of lipid peroxides in the gastric mucosa of each group of rats were counted. From Table 16, it can be observed that the concentration of malonaldehyde (MDA), a secondary product of lipid peroxide in the gastric mucosa of the control group (C group), was 23.28 ± 3.75 μM. After continuous feeding of compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks, the concentration of malonaldehyde (MDA), a secondary product of lipid peroxide in rat gastric mucosa, was significantly decreased. In addition, compared to The activity of superoxide dismutase (SOD) in the gastric mucosa of the control group was 1.69±0.17 U/mL. It was found that the SOD activity in the gastric mucosa of each group was significantly increased after continuous feeding for 8 weeks. p<0.05). Therefore, the experimental results in Table 16 confirm that daily intake of at least 0.3 g / rat body weight (equivalent to 4 g in adult dose) helps to reduce gastric mucosal damage.

Moreover, as shown in Table 16 above, after continuously feeding the compound lactic acid bacteria powder, NTU101 lactic acid bacteria powder and NTU101 dead powder for 8 weeks, it was found that the concentration of histamine in the gastric mucosa of each group was significantly decreased; The concentration of prostaglandin E2 (PGE2) in the gastric mucosa of the rats was also significantly increased (p<0.05). Therefore, the experimental results in Table 16 confirm that daily intake of at least 0.3 g/rat body weight (equivalent to 4 g in adult dose) helps to reduce histamine concentration in the gastric mucosa and increase prostaglandin concentration.

However, it is to be understood that the foregoing detailed description of the embodiments of the present invention is not intended to limit the scope of the invention Implementation or change shall be included in the scope of the patent in this case.

<110> Chenhui Biotechnology Co., Ltd.

<120> Lactic acid strain, its nucleotide sequence and its primer set

<140>

<141>

<160> 5

<210> 1

<211> 838

<212> DNA

<213> Lactic acid strain

<400> 1

<210> 2

<211> 10

<212> DNA

<213> Synthetic

<220>

<223> Synthetic nucleotides

<400> 2

<210> 3

<211> 10

<212> DNA

<213> Synthetic

<220>

<223> Synthetic nucleotides

<400> 3

<210> 4

<211> 20

<212> DNA

<213> Synthetic

<220>

<223> Synthetic nucleotides

<400> 4

<210> 5

<211> 25

<212> DNA

<213> Synthetic

<220>

<223> Synthetic nucleotides

<400> 5

Claims (5)

The use of a probiotic composition for preparing a composition for improving an intestinal flora and reducing a gastric mucosal damage index, wherein the probiotic composition is a pure lactic acid powder or a composite lactic acid powder, and the pure lactic acid powder or the composite lactic acid bacteria The powder is obtained by processing the lactic acid bacteria Lactobacillus paracasei subsp. paracasei NTU 101; wherein the probiotic composition having an adult intake of at least 4 grams per day can significantly reduce the number of bacteria in the intestine, Clostridium perfringens , At the same time, the number of bacteria in Bifidobacterium spp. can be increased; and the index of gastric mucosal damage can be reduced by 98.74%; wherein the probiotic composition contains at least a range of 3x10 ⁹ CFU/g to 1x10 ¹¹ CFU. Lactobacillus paracasei subsp. paracasei NTU 101 live bacteria between /g. The use of the probiotic composition of claim 1 in the preparation of a composition for improving an intestinal flora and reducing a gastric mucosal injury index, wherein the Lactobacillus paracasei subsp. paracasei NTU 101 is placed with a carbon source The Lactobacillus paracasei subsp. paracasei NTU 101 produces lactic acid after entering a medium and after at least 24 hours of cultivation. The use of the probiotic composition of claim 2, in the preparation of a composition for improving intestinal bacteria phase and reducing gastric mucosal damage index, wherein the carbon source may be any of the following: glucose, galactose, D-ribose , xylose, fructose, alpha-lactose, maltose, sucrose, trehalose, raffinose, inositol, sorbitol, D-mannitol, citric acid, dextrin, starch, and molasses. The use of the probiotic composition of claim 1 in the preparation of a composition for improving an intestinal flora and reducing a gastric mucosal injury index, wherein the Lactobacillus paracasei subsp. paracasei NTU 101 is placed with a nitrogen source The Lactobacillus paracasei subsp. paracasei NTU 101 produces lactic acid after entering a medium and after at least 24 hours of cultivation. The use of the probiotic composition of claim 4, in the preparation of a composition for improving intestinal bacteria phase and reducing gastric mucosal damage index, wherein the nitrogen source may be any of the following: yeast extract, beef extract, peptone Soybean meal, trypsin, corn syrup, casein, urea, ammonium citrate, and ammonium sulfate.