CN114774331A

CN114774331A - Compound probiotics, preparation method thereof and application thereof in resisting HP and oral caries

Info

Publication number: CN114774331A
Application number: CN202210623620.5A
Authority: CN
Inventors: 魏珂; 王晓娟
Original assignee: Guangzhou Jintian Fangyan Cosmetics Co ltd
Current assignee: Guangzhou Jintian Fangyan Cosmetics Co ltd
Priority date: 2022-06-02
Filing date: 2022-06-02
Publication date: 2022-07-22

Abstract

The application discloses a composite probiotic, a preparation method thereof and application thereof in resisting HP and oral caries. The preparation method comprises respectively activating Lactobacillus gasseri, Lactobacillus casei, Lactobacillus paracasei and Clostridium butyricum; inoculating the activated clostridium butyricum bacterial suspension into a fermentation liquid culture medium for culture, then continuously inoculating lactobacillus casei and lactobacillus paracasei bacterial suspension into a fermentation system, and continuously fermenting for 2-3 hours; and continuously inoculating the lactobacillus gasseri suspension into the fermentation system, completing the fermentation, and obtaining the fermentation liquor containing the composite probiotics. The prepared composite probiotic freeze-dried preparation not only has the effect of improving the mouse gastritis reaction caused by HP, but also can provide help for Wistar rats to resist dental caries, and has double effects of resisting helicobacter pylori and balancing oral microecology and wider application prospect.

Description

Compound probiotics, preparation method thereof and application thereof in resisting HP and oral caries

Technical Field

The application relates to the technical field of composite probiotics, in particular to composite probiotics, a preparation method thereof and application thereof in resisting HP and oral caries.

Background

Caries, a common disease of the daily cavity caused by bacterial infection, can cause pulpitis and periapical periodontitis in severe cases, and even can cause collar bone inflammation. Streptococcus mutans(s) is the major cariogenic bacterium currently recognized, and is capable of forming a dental plaque biofilm on the tooth surface, providing a micro-ecological environment for accumulation and growth of pathogenic bacteria, enhancing the pathogenicity of the pathogenic bacteria, and enhancing the resistance of the pathogenic bacteria to the host immune system and antibiotic therapy. Research shows that the occurrence of a plurality of diseases is closely related to the imbalance of the daily cavity micro-ecology, wherein the dental caries is the disease that the imbalance of the daily cavity micro-ecology causes the generation of dental plaque biomembrane, resulting in the chronic progressive destruction of the hard tissues of the teeth. Dental plaque is a biofilm complex that is attached to the solid surface of enamel or the root of the tooth by microbial flora and exopolysaccharides, proteins and minerals secreted by microbes.

Probiotics is a general name for active beneficial microorganisms which are colonized in human bodies and beneficial to hosts, and can produce exact health effects so as to improve the microbial ecological balance of the hosts and exert beneficial effects. The probiotics known to produce oral cavity with anticaries properties can be broadly divided into two main groups, lactobacillus and lactococcus. The Lactobacillus includes Lactobacillus casei (Lactobacillus casei), Lactobacillus acidophilus (Lactobacillus acidophilus), Lactobacillus helveticus (Lactobacillus helveticus), and the like, and the Lactococcus lactis is mainly Streptococcus thermophilus (Streptococcus thermophilus), Lactococcus lactis (Lactobacillus lactis), and the like.

Disclosure of Invention

In view of the above, the present application aims to provide a composite probiotic with oral cavity anticaries and anti-helicobacter pylori effects.

In a first aspect, the embodiment of the application discloses a preparation method of composite probiotics, which comprises the following steps:

respectively activating lactobacillus gasseri, lactobacillus casei, lactobacillus paracasei and clostridium butyricum;

inoculating the activated clostridium butyricum suspension into a fermentation liquid culture medium and culturing for 4-5 h;

inoculating lactobacillus casei and lactobacillus paracasei suspension into the fermentation system, and continuing to ferment for 2-3 hours;

and continuously inoculating the lactobacillus gasseri suspension into the fermentation system, completing the fermentation, and harvesting the fermentation liquor, wherein the fermentation liquor contains the composite probiotics.

In the examples of the present application, the fermentation broth was composed of lactose 62.21g/L, yeast extract powder 46.25g/L, yeast peptone 19.12g/L, sodium dihydrogen phosphate 17.25g/L, disodium hydrogen phosphate 1.75g/L, MgSO₄·7H₂O 0.96g/L，MnSO₄·5H₂O0.063 g/L, L-cysteine hydrochloride 0.17 g/L.

In the examples of the present application, the conditions for fermentation of clostridium butyricum are: the initial pH value is 5.8-6.0, the temperature is 37 ℃, the inoculation amount is 1%, 25% ammonia water is adopted to ensure the pH value to be 5.5 in the fermentation process, nitrogen is simultaneously introduced to keep the pressure of the tank to be 0.03-0.04 MPa, and stirring is simultaneously maintained at 125rpm in the fermentation process.

In the embodiment of the application, the inoculation amounts of the lactobacillus casei and the lactobacillus paracasei are both 3-4 v/v%.

In the examples of the present application, the inoculation of Lactobacillus casei, Lactobacillus paracasei was supplemented simultaneously with 25% by volume of the fermentation broth in the fermentation system.

In the embodiment of the application, the inoculation amount of the lactobacillus gasseri is 1.5-2 v/v%.

In the examples of the present application, the inoculation with Lactobacillus gasseri was simultaneously supplemented with 10% by volume of the fermentation broth.

In a second aspect, the embodiment of the application discloses a preparation method of a composite probiotic microbial inoculum, which comprises the preparation method related to the first aspect, and the steps of collecting the composite probiotic, mixing a protective agent, and freeze-drying to obtain the composite probiotic microbial inoculum.

In a third aspect, the embodiment of the application discloses a composite probiotic microbial inoculum, which comprises not less than 10 percent⁹cfu/g of Lactobacillus gasseri, not less than 10⁸cfu/g of Lactobacillus casei, BullLess than 10⁸cfu/g of Lactobacillus paracasei and not less than 10¹⁰cfu/g of clostridium butyricum and not less than 2.00mg/g of surface layer protein.

In a fourth aspect, the application example discloses the application of the composite probiotics prepared by the preparation method related to the first aspect in preparing helicobacter pylori resistant products and/or preparing oral cavity caries resistant products.

Compared with the prior art, the application has at least the following beneficial effects:

the composite probiotic provided by the embodiment of the application not only has the effect of improving the gastritis reaction of mice caused by HP, but also can provide help for Wistar rats in resisting dental caries. Therefore, the composite probiotic preparation provided by the embodiment of the application has double effects of resisting helicobacter pylori and balancing oral micro-ecology, and has wider application prospects, such as preparation of a probiotic preparation for improving the oral cavity, a probiotic preparation for improving the intestines and stomach and the like.

Drawings

Fig. 1 is a microscopic examination image of the complex probiotics provided in the embodiment of the present application, in which a is lactobacillus gasseri, B is lactobacillus paracasei, C is lactobacillus casei, and D is clostridium butyricum.

FIG. 2 is a graph showing HE staining of gastric tissue of control mice in anti-HP experiments provided in the examples of the present application.

FIG. 3 is a graph showing HE staining of gastric tissue of a model group of mice in an anti-HP experiment provided in the examples of the present application.

FIG. 4 is another graph of HE staining of gastric tissue from a model group of mice in an anti-HP assay as provided in the examples of the present application.

FIG. 5 is a graph of HE staining of gastric tissue of mice in the administration group in the anti-HP assay provided in example 1 of the present application.

FIG. 6 is a graph showing HE staining of gastric tissue of mice in the administration group in the anti-HP test provided in comparative example 1 of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more clearly understood, the present application is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

Preparation method of composite probiotic preparation

1. Materials and methods

1.1 probiotic bacteria used

Lactobacillus gasseri (Lactobacillus gasseri, abbreviated as LG, cat # B81004, Minzhou organism), Lactobacillus casei (Lactobacillus casei, abbreviated as LC, cat # BMZ134814, Minzhou organism), Lactobacillus paracasei (Lactobacillus paracasei, abbreviated as LP, cat # JCM15307, Minzhou organism) and Clostridium butyricum (Clostridium butyricum, abbreviated as CB, cat # XL-119, Xinlu organism).

1.2 Strain activation

Activation of LG: taking 1 freeze-dried tube of lactobacillus gasseri, dissolving the freeze-dried tube with 0.5mL of MRS liquid culture solution, inoculating the freeze-dried tube to 1 MRS plate to grow single colonies, taking the single colonies, diluting the single colonies with 0.5mL of sterile water, inoculating the diluted single colonies in an MRS liquid culture medium in an inoculation amount of 2 v/v%, activating and passaging, and culturing at the fermentation culture temperature of 37 ℃ for 24 hours to obtain activated LG bacterial suspension.

Activation of LC: taking 1 freeze-dried tube of lactobacillus gasseri, dissolving the freeze-dried tube with 0.5mL of MRS liquid culture solution, inoculating the freeze-dried tube to 1 MRS plate to grow single colonies, taking the single colonies, diluting the single colonies with 0.5mL of sterile water, inoculating the diluted single colonies in an MRS liquid culture medium in a 3 v/v% inoculation amount, activating and subculturing, wherein the fermentation culture temperature is 37 ℃, and culturing for 15 hours to obtain activated LC bacterial suspension.

And (3) activating LP: taking 1 freeze-dried tube of lactobacillus gasseri, dissolving the freeze-dried tube by using 0.5mL of MRS liquid culture solution, inoculating the freeze-dried tube to 1 MRS plate to grow single colonies, diluting the single colonies by using 0.5mL of sterile water, inoculating the diluted single colonies in an MRS liquid culture medium in a 3 v/v% inoculation amount, activating and subculturing, wherein the fermentation culture temperature is 37 ℃, and culturing for 16h to obtain an activated LP bacterial suspension.

Activation of CB: dissolving 1 Lactobacillus gasseri freeze-dried tube with 0.5mL GAM liquid culture medium (Nishui pharmaceutical Co., Ltd.), inoculating to 1 MRS plate to grow single colony, diluting the single colony with 0.5mL sterile water, inoculating to GAM liquid culture medium with 3 v/v% inoculum size to activate and passage, fermenting at 37 deg.C, and culturing for 12h to obtain activated CB bacterial suspension.

1.3 fermentation of strains

The specific fermentation process of example 1 is as follows:

1) inoculating the activated CB bacteria suspension into a fermentation culture, wherein the components of a fermentation liquid culture medium are 62.21g/L of lactose, 46.25g/L of yeast extract powder, 19.12g/L of yeast peptone, 17.25g/L of sodium dihydrogen phosphate, 1.75g/L of disodium hydrogen phosphate and MgSO 2₄·7H₂O 0.96g/L，MnSO₄·5H₂Preparing a culture medium for high-density culture by 0.063g/L of O and 0.17g/L of L-cysteine hydrochloride; the initial pH value is 6.0, the temperature is 37 ℃, the inoculation amount is 1%, 25% ammonia water is adopted to ensure the pH value to be 5.5 in the fermentation process, nitrogen is introduced to keep the pressure of the tank to be 0.03-0.04 MPa, and the stirring speed is kept to be 125rpm in the fermentation process.

2) After fermenting for about 4 hours in the step 1), continuously inoculating an LC bacterial suspension and an LP bacterial suspension into a fermentation system, wherein the inoculation amounts are 3 v/v%, and simultaneously supplementing the fermentation liquid culture medium with 25% of the volume of the fermentation liquid;

3) after continuing fermenting for about 2 hours, continuing inoculating the LG bacterial suspension into the fermentation system, wherein the inoculation amount is 2 v/v% (volume ratio of the LG bacterial suspension to the fermentation system), and simultaneously supplementing the fermentation liquid culture medium with 10% of the volume of the fermentation liquid;

4) and after continuing fermenting for about 10 hours, harvesting the fermentation liquor.

The specific fermentation process of example 2 is as follows:

1) inoculating the activated CB bacterial suspension into a fermentation culture, wherein the components of a fermentation culture medium are the same as those of the embodiment 1; the initial pH value is 5.8, the temperature is 37 ℃, the inoculation amount is 1%, 25% ammonia water is adopted to ensure the pH value to be 5.5 in the fermentation process, nitrogen is introduced to keep the pressure of the tank to be 0.03-0.04 MPa, and the stirring speed is kept to be 125rpm in the fermentation process.

2) After fermenting for about 4 hours in the step 1), continuously inoculating an LC bacterial suspension and an LP bacterial suspension into a fermentation system, wherein the inoculation amount is 3 v/v%, and simultaneously supplementing the fermentation liquid culture medium with 25% of the volume of the fermentation liquid;

3) after continuing fermenting for about 2 hours, continuing inoculating the LG bacterial suspension into the fermentation system, wherein the inoculation amount is 2 v/v%, and simultaneously supplementing the fermentation liquid culture medium with 10% of the volume of the fermentation liquid;

The specific fermentation process of example 3 is as follows:

1) same as in example 1.

2) After fermenting for about 5 hours in the step 1), continuously inoculating an LC bacterial suspension and an LP bacterial suspension into a fermentation system, wherein the inoculation amount is 4 v/v%, and simultaneously supplementing the fermentation liquid culture medium with 25% of the volume of the fermentation liquid;

The specific fermentation process of example 4 is as follows:

1) same as in example 1.

2) Same as in example 1.

3) Continuing fermenting for about 3 hours, continuing inoculating LG bacterial suspension into the fermentation system, wherein the inoculation amount is 1.5 v/v%, and simultaneously supplementing the fermentation liquid culture medium with 10% of the volume of the fermentation liquid;

The strain fermentation process of comparative example 1 is implemented by fermenting the four strains respectively for the preparation of the subsequent microbial inoculum, and comprises the following steps:

1) inoculating the activated LG bacterial suspension into an MRS liquid culture medium by using the inoculation amount of 2 v/v% for fermentation for 24 hours, introducing nitrogen to keep the pressure of a tank at 0.03-0.04 MPa at the fermentation culture temperature of 37 ℃, and harvesting fermentation liquor.

2) Inoculating the activated LC bacterial suspension into an MRS liquid culture medium by 3 v/v% inoculation amount, fermenting for 15h at the fermentation culture temperature of 37 ℃, introducing nitrogen to keep the pressure of a tank at 0.03-0.04 MPa, and harvesting the fermentation liquor.

3) Inoculating the activated LP bacterial suspension into an MRS liquid culture medium by 3 v/v% inoculation amount, fermenting for 16h, introducing nitrogen to keep the pressure of a tank at 0.03-0.04 MPa, and harvesting the fermentation liquid, wherein the fermentation culture temperature is 37 ℃.

4) Inoculating the activated CB bacterial suspension into a GAM liquid culture medium by 3 v/v% inoculation amount, fermenting for 12h, introducing nitrogen to keep the pressure of a tank at 0.03-0.04 MPa, and harvesting fermentation liquor, wherein the fermentation culture temperature is 37 ℃.

Comparative example 2 was prepared as follows:

1) inoculating the activated CB bacterial suspension into a fermentation culture, wherein GAM liquid culture medium is adopted as the fermentation culture medium, and the other conditions are the same as the example 1;

2) after fermenting for about 4 hours in the step 1), continuously inoculating an LC bacterial suspension and an LP bacterial suspension into a fermentation system, wherein the inoculation amount is 3 v/v%, and meanwhile, a MAS liquid culture medium with 25% volume of fermentation liquor is supplemented;

3) after continuing fermenting for about 2 hours, continuing inoculating the LG bacterial suspension into the fermentation system, wherein the inoculation amount is 2 v/v%, and simultaneously supplementing a MAS liquid culture medium with 10% volume of fermentation liquor;

The preparation of comparative example 3 was carried out as follows:

1) inoculating the activated LG bacterial suspension into a fermentation culture, wherein MAS liquid culture medium is adopted as the fermentation medium component, and the other conditions are the same as the example 1;

3) after continuing fermenting for about 2 hours, continuing inoculating CB bacterial suspension into the fermentation system, wherein the inoculation amount is 2 v/v%, and simultaneously supplementing GAM liquid culture medium with 10% volume of fermentation liquor;

Comparative example 4 was prepared as follows:

1) inoculating the activated LG bacterial suspension into a fermentation culture, wherein the fermentation culture medium is the same as that in example 1, and the other conditions are the same as those in example 1;

2) after fermenting for about 4 hours in the step 1), continuously inoculating an LC bacterial suspension and an LP bacterial suspension into a fermentation system, wherein the inoculation amount is 3 v/v%, and simultaneously supplementing a liquid culture medium which is 25% of the volume of the fermentation liquid and is the same as that of the liquid culture medium in the example 1;

3) after continuing fermenting for about 2 hours, continuing inoculating the CB bacterial suspension into the fermentation system, wherein the inoculation amount is 2 v/v%, and simultaneously supplementing a liquid culture medium which is 10% of the volume of the fermentation liquor and is the same as that of the example 1;

1.4 preparation of lyophilized preparation

And (3) centrifugally collecting thalli: and subpackaging the obtained bacterial liquid after culture into 500ml centrifuge buckets, centrifuging for 10min at 8000rpm, discarding supernatant, collecting thalli, weighing the thalli, counting the weight of the obtained total thalli, and calculating the number of viable bacteria of the strains. As shown in FIG. 1, the fermentation broth was subjected to microscopic examination, in which LP, LC, LG and CB four probiotics were found.

Vacuum freeze drying: and (2) fully and uniformly mixing the protective agent and the thalli in a weight ratio of 1:1 in a sterile environment, pre-freezing the mixture in an environment at the temperature of-20 ℃, freezing the mixture in an environment at the temperature of-80 ℃ after pre-freezing, standing overnight, completely freezing the bacterium liquid, putting the bacterium liquid into a freeze dryer, and freeze-drying the bacterium liquid until the bacterium liquid is completely frozen to obtain a freeze-dried preparation of the composite probiotics, namely the composite probiotic preparation.

Wherein the protective agent is at least one of glucose, sucrose, skimmed milk powder, glycerol, mannitol, trehalose, sericin and lactalbumin. Specifically, for example, the protective agent is an aqueous solution containing 5 wt% of skimmed milk powder, 1 wt% of glycerol, 10 wt% of mannitol, and 5 wt% of trehalose, and the microbial cells collected by centrifugation are added to the solution of the protective agent so that the weight of solute in the protective agent is the same as the weight of the microbial cells.

The preparation process of the freeze-drying agent of the comparative example 1 is approximate, and the four fermentation liquors are mixed according to the equal volume, added with the protective agent and then subjected to freeze-drying treatment. Specifically, the same protective agent was used for each of the lyophilizates prepared in the above-mentioned real-time streams 1 to 4 and comparative examples 1 to 4.

The fermentation liquids obtained in examples 1 to 4 and comparative examples 1 to 4 were respectively prepared into lyophilized preparations according to the above-mentioned methods, and then viable cell counts were respectively performed. The viable count is determined according to GB4789.35-2010 by adopting a dilution coating flat plate counting method, each sample selects three dilution gradients, each gradient is subjected to three parallel experiments, and the samples are cultured in a 37 ℃ incubator and then counted to obtain an average value.

1.5 extraction and expression quantity determination of surface layer protein

The lyophilizates obtained in the above examples and comparative examples were dissolved in 0.01mol/L sterile PBS (pH 7.2) by the method disclosed in A collagen-binding s-layer protein in Lactobacillus crispus [ J ]. Applied and Environmental Microbiology,1995,61(7): 2467:. 2471, and 1/20 volumes of 5mol/L LiCl solution were added thereto, and the resulting solution was treated in a constant temperature shaker at 37 ℃ and 200rpm for 30min, and centrifuged at 12000rpm and 4 ℃ for 15min to obtain a supernatant as a crude extract of surface layer protein.

The crude extract of LiCl, a surface protein, was filtered through a 0.22 μm microporous membrane and dialyzed against deionized water at 4 ℃. The water can be changed for many times during dialysis, and the water is changed by 10g/L AgNO₃The solution was checked and dialysis was complete without white precipitate. The precipitate, i.e.the S-layer protein, was taken by centrifugation (10000rpm, 4 ℃, 20min) and the protein concentration was determined by the Bradford method (kit, Merck Sigma-Aldrich).

2. As a result, the

TABLE 1

Table 1 shows the viable count content of the lyophilized preparation prepared in each example and comparative example and the surface layer protein content of the lyophilized preparation. As can be seen from Table 1, the viable count contents of the fermentation liquid and the freeze-drying agent prepared in examples 1 to 4 and the expression level of the surface layer protein in the freeze-drying agent are both significantly higher than those of the comparative example.

anti-HP test

1. Materials and methods

1.1 Strain Source and HP bacterial liquid

Helicobacter pylori (HP, cat. code B84182) was purchased from Minboat organisms.

HP recovery and activation: using direct streaking, HP was picked up by an inoculating loop and smeared onto Skirrow's selective and non-fish selective media. Placing the culture dish at 37 deg.C humidity>90% pH-neutral, microaerophilic Environment (5% O)₂，10％CO₂，85％N₂) Culturing for 5 days, observing separation effect, and carrying out subculture enrichment on positive cells. Resuscitated, identified HP was inoculated into Brookfield broth in microaerophilic environment (5% O) at 37 deg.C₂，10％CO₂，85％N₂) Shaking and culturing for 48h, washing with PBS, and adjusting the bacterial concentration to 10⁹And (5) distributing the cfu/mL concentration into eppdorf tubes for later use to obtain the HP bacterial liquid.

1.2 establishing HP infection model mouse

Male Balb/c mice (Jiangsu Ji extract medicine Kangbiotech Co., Ltd.) were 6-8 weeks old, SPF-rated, and were randomly divided into 4 groups after 1 week of adaptive feeding, which were a control group, a model group, and an administration group.

And (3) preparing a composite probiotic agent, and dissolving 0.1g of the freeze-dried preparation prepared in each example and each comparative example in 100mL of sterile water to obtain a solution for administration.

Wherein, each mouse in the control group is gavaged with 0.5mL PBS every other day. In the model group, 0.5mL of HP bacterial liquid was perfused every other day to each mouse, and after 2 weeks of continuous perfusion, 1 mouse was sacrificed to determine whether HP was colonized in the stomach.

The administration group adopts the same molding process as the model group, 0.5mL of HP bacterial liquid is continuously used for intragastric administration for 2 weeks, 0.8mL of intragastric administration solution is continuously used for administration to the mice, and the model group does not perform intragastric administration treatment.

After 7 days of treatment of all the administration groups of mice, the mice were sacrificed to carry out the following experiments.

1.3 Collection of stomach tissue specimens

Anaesthetizing the mouse, opening the abdominal cavity of the mouse, finding out the stomach of the mouse, then finding out the gastric antrum downwards, finding out the esophagus upwards along the stomach body, and obtaining the stomach tissue (containing the gastric antrum and the fundus); the obtained stomach tissue of the mouse is washed by 4-degree PBS solution to wash the stomach cavity. The stomach tissue was cut along the greater curvature of the stomach, fixed with 4% paraformaldehyde, paraffin sections were made, and HE staining was performed.

Identification of helicobacter pylori infection: infiltrating the stomach tissue with sterile PBS, fully homogenizing by a homogenizer, and adding 100 mu L of enzymatic reaction liquid into each hole; after the medicine membrane in each hole is completely dissolved, sucking 100 mu L of uniformly mixed PBS solution by using a sterile gun head, and then adding the uniformly mixed PBS solution into the medicine solution; the result was observed after 5 minutes of incubation at 25 ℃.

Amount of colonization of mouse stomach tissue by helicobacter pylori: obtaining homogenate of mouse stomach tissue by adopting the same method, carrying out gradient dilution on the homogenate to obtain diluents with different concentration coefficients, absorbing the diluents, inoculating the diluents to a Columbia culture medium (2 years of Beijing edge Biochemical technology Co., Ltd.) containing antibiotics, fully coating the diluents, and then culturing the diluents in an incubator at 37 ℃ for 5-7 d; plates were removed and the number of HP colonies on the plates was read and the amount of colonization expressed as log cfu/g stomach tissue.

1.4 detection of RNA expression level in stomach tissue

Using the same procedure as above, a homogenate of mouse gastric tissue was obtained and RNA extraction kit (GenElute) was continuously used^TMSigma-Aldrich) from the culture medium;

synthesizing cDNA through reverse transcription: template RNA extracted at 65 ℃ is thermally denatured for 5 minutes, and then immediately placed on ice for cooling, and cDNA is synthesized according to the procedures specified in the reverse transcription kit (Saimeifei); the reaction solution (on ice) was prepared in an EP tube according to the proportions of Table 5. Table 5 after all the reverse transcription reaction systems are added, the PCR tube is placed in a PCR instrument, reverse transcription is carried out according to the conditions of 37 ℃ for 15min, 50 ℃ for 5min and 98 ℃ for 5min, and finally the reverse transcription is maintained at 4 ℃, and after the reverse transcription reaction is finished, a PCR product is taken out and stored at-20 ℃.

RT-PCR reaction:

primer: IL-6-F: ggcccttgctttctcttcg, as shown in SEQ ID NO. 1;

IL-6-R: ataataaagttttgattatgt, as shown in SEQ ID NO. 2;

beta-actin-F: catgtacgttgctatccaggc, as shown in SEQ ID NO. 3;

beta-actin-R: ctccttaatgtcacgcacga, as shown in SEQ ID NO. 4.

(1) Subpackaging primers: the primers were centrifuged at 3000rpm for 1min and diluted to 10uM with Nuclear-free Water, all primers being supplied by Shanghai Biotech according to the above sequence.

(2) Using the synthesized cDNA as a template, sequentially performing PCR reaction mix of 1. mu.L of cDNA, 0.4. mu.L of each of the upstream and downstream primers and 5. mu.L, and finally supplementing the volume of the reaction solution to 10. mu.L (on ice) by means of Nuclear-free Water; adding all reaction systems, and performing pre-denaturation at 95 ℃ for 60 s; amplification was performed in Fast 7500 at 95 ℃ for 15s,60 ℃ for 15s, and 72 ℃ for 45s for a total of 40 cycles.

(3) Expression level adopted 2^-ΔΔCtThe method carries out relative quantitative analysis, wherein the reference gene beta-actin is taken as a reference gene, Ct is taken as a cycle threshold value, each sample is repeated for 5 times, and the average value is taken for statistical analysis.

1.5, detecting the protein expression level by Western blot

Taking the homogenate of the mouse stomach tissue, and using LSBIO kit (T-PER)^TMSaimerfi) extracting total protein and transferring the total protein to a PVDF membrane, sealing the PVDF membrane for 2 hours at room temperature by using 5% skimmed milk powder, adding an antibody, incubating for 2 hours, taking beta-actin as an internal reference protein, and calculating the related expression quantity by using image software to perform protein gray scale analysis.

Relative expression levels were calculated.

1.6, data analysis

The experimental data are subjected to data analysis by using Excel 2013 and SPSS 22.0 statistical software for statistical arrangement, each data is measured for multiple times and is represented by a mean value and a standard deviation thereof, single-way ANOVA (One-way ANOVA) and DunCan's multiple comparison are respectively carried out by using SPSS 22.0, and significance difference marking is carried out.

2. As a result, the

TABLE 2 relative expression amounts

TABLE 3 relative expression amounts

As shown in the HE staining results in FIG. 2, the stomach tissue of the control group mice was normal, the stomach tissue of the model group mice in FIG. 3 had normal gastric crypts with blurred structures, indicating severe inflammatory response, and a large number of black particles were observed in FIG. 4, indicating that HP had colonized. As shown in fig. 5 and 6, after the complex probiotic preparation provided in example 1 is administered to mice, the stomach tissue structure is clear, the inflammatory reaction disappears, and a large amount of inflammatory reaction still exists in comparative example 1.

Tables 2 and 3 show the expression levels of IL6 and NF-. kappa.B pathway, I.kappa.B.alpha.and JAK2 pathway-related proteins in the stomach tissues of each group of mice.

Wherein, the expression levels of IL6, NF kappa B-P65, P-I kappa B alpha, P-P38 and P-JAK2 are higher in the model group than in the control group, which shows that the modeling experiment is successful. The expression level of the proteins of the model group mice is increased, which indicates that the HP expression level is increased after the HP is colonized in the stomach tissues of the mice, and the expression of IL6 inflammatory factors is related to the phosphorylation of NF kappa B pathway, I kappa B alpha and JAK2 pathway.

In the administration group, after the compound probiotic prepared in examples 1 to 4 is administered to mice for gastric lavage, the expression of the mouse gastric tissue inflammatory factor IL6 can be obviously reduced, and the expression level of phosphorylated protein of the related pathway is reduced, while comparative examples 1 to 4 have certain effect of reducing inflammatory reaction caused by HP compared with the model group, but the effect is far less obvious than that of examples 1 to 4.

It can be seen from the results in Table 1 that examples 1-4 obtained probiotic bacteria with higher expression levels of S-layer proteins than comparative examples 1-4. Therefore, the complex probiotics obtained in examples 1-4 can improve mouse gastritis reaction caused by HP due to the high expression of surface layer protein.

Anti-caries test

1. Materials and methods

1.1 Experimental animals

Male Wistar rats, 18 days old, were selected and purchased from setaria italica.

1.2, building caries model animal

Male wistar rats were fed cariogenic diet and 5% dextrose in water, plaque samples were collected weekly (11 times total) starting from the first week, weighed, sacrificed at the age of 90 days, and upper and lower collarbone specimens removed. The cariogenic feed comprises 56 wt% of sucrose, 6 wt% of whole wheat flour, 28 wt% of refined milk powder, 4 wt% of refined soybean flour, 4 wt% of yeast and 2 wt% of edible salt.

1.4, group experiments

The experiment was divided into control group, model group and administration group. Wherein, the control group is fed with common feed. Model groups were fed for 11 weeks according to the modeling method described above. In the modeling process, the compound probiotic bacteria agent prepared in the above embodiments and comparative examples is fed 1h after feeding cariogenic feed to rats, wherein the weight of the rats is 50mg/kg, and the compound probiotic bacteria agent can be dissolved in 0.75% physiological saline and fed to the rats.

1.5, Keyes score

The feeding was continued for 11 weeks with Keyes scoring.

1.6 plaque sample Collection

Fasting is carried out 2 hours before the collection of the sample, 10% chloral hydrate is injected into the abdominal cavity for anesthesia, a cotton swab is used for collecting bacterial plaque on the molar tooth surface of a rat, and the bacterial plaque is placed in a centrifugal tube containing a thioglycolate conveying liquid for elution and is stored at the temperature of minus 20 ℃.

1.7 RT-PCR detection of expression of related genes

1.7.1 plaque Total RNA extraction

Centrifuging the bacterial plaque sample at 8000g for 5min at 4 deg.C, discarding the supernatant, adding 1ml Trizol reagent (Saimerfi), adjusting the scale, blowing with a pipette, ultrasonicating, and vibrating for 15s and 3 times.

Taking 1.5mL of homogenate lysate, standing for 5min at room temperature, adding 0.2mL of chloroform, covering a centrifugal tube cover tightly, shaking until the solution is fully emulsified, standing for 5min at room temperature, centrifuging for 15min at 12000g and 4 ℃, and then separating into three layers of colorless supernatant, a middle white protein layer and a lower organic phase with color.

Sucking 0.5mL of supernatant, transferring the supernatant into an enzyme-inactivated centrifuge tube, adding 0.5mL of isopropanol into the centrifuge tube, fully mixing the mixture, standing the mixture at room temperature for 10min, centrifuging the mixture at 12000g and 4 ℃ for 10min, removing the supernatant, slowly adding 1mL of 75% ethanol along the wall of the centrifuge tube, slightly reversing the upper part and the lower part of the centrifuge tube to wash the wall of the centrifuge tube, and centrifuging the mixture at 12000g and 4 ℃ for 5min, carefully removing the ethanol.

Drying the precipitate at room temperature for 10min, adding 30 μ L EPC water to dissolve the precipitate, and storing at-80 deg.C after the RNA precipitate is completely dissolved.

1.7.2 Synthesis of cDNA

Before cDNA synthesis, the purity and concentration of the extracted RNA samples were determined by agarose gel electrophoresis and UV spectrophotometer detection of the absorbance of the samples at 260nm and 280 nm.

cDNA was synthesized by reverse transcription using the reverse transcription Kit All-in-one (TM) miRNA First-Strand cDNA Synthesis Kit (cat # QP014: purchased from GeneCopoeia) to extract 5. mu.L of RNA solution, and cDNA was synthesized.

1.7.3、RT-PCR

The primer sequences were as follows, and were all synthesized by Shanghai bioengineering Co.

spaP-F: tgatgttgcttcttctatggag, as shown in SEQ ID NO. 5;

spaP-R: caggttagtgtatgtaagctgt, as shown in SEQ ID NO. 6;

the size of the amplification product of the spaP gene is 145 bp.

gtfb-F: agcaatgcagccaatctacaaat, as shown in SEQ ID NO. 7;

gtfb-R: acgaactttgccgttattgtca, as shown in SEQ ID NO. 8;

the size of the amplification product of gtfb gene is 96bp

ldh-F: cttgatactgctcgtttccgtc, as shown in SEQ ID NO. 9;

ldh-R: gagtcaccatgttcacccat, as shown in SEQ ID NO. 10;

the size of the ldh gene amplification product is 93bp

F-atpase-F: cggatgcgtgttgctcttactg, as shown in SEQ ID NO. 11;

f-atpase-R: ggctgataaccaacggctgatg, as shown in SEQ ID NO. 12;

the size of the f-atpase gene amplification product is 167bp

The reference gene reca-F: gcctatgctgctgctcttg, as shown in SEQ ID NO. 13;

reca-R: tcaccaatatctccgtcaatctc, as shown in SEQ ID NO. 14;

the size of the reca gene amplification product is 179bp

Diluting the cDNA product by 10 times, taking 2 mu L as a template, taking 2 mu L (10 mu mol/L) of a Primer, 2 mu L (10 mu mol/L) of All-in-one (TM) miRNA qPCR Mix10 mu L, 2 mu L of a Universal adapter PCR Primer, 0.1 mu L of ROX Reference Dye, preparing a fluorescent quantitative PCR reaction system with the total volume of 20 mu L by double-distilled water, and carrying out fluorescent quantitative PCR reaction according to the conditions of three steps, namely initial denaturation at 95 ℃ for 15min (1 cycle) → 94 ℃ for 20s denaturation, annealing at 65 ℃ for 30s, pre-amplification at 72 ℃ for 34s extension (5 cycles) → 94 ℃ for 20s denaturation, annealing and extension at 61 ℃ for 34s for amplification, and collecting fluorescent signals (40 cycles).

After the amplification reaction is finished, the computer system automatically analyzes the acquired fluorescence intensity increase index of each reaction tube during each cycle reaction, draws an amplification kinetic curve of each reaction tube, and determines the amplification cycle number, namely a Ct value, when the fluorescence intensity in each reaction tube increases to a certain specific threshold value according to the kinetic curve.

After the Ct values of the mRNA copies of the target gene and the reference gene of the standard sample at each dilution gradient are obtained, the horizontal scale is the logarithm of the initial copy number (the original standard template is N) of the target gene and the reference gene, the vertical scale is the Ct value, and a standard curve is synthesized. According to the standard curve equation, the amplification efficiency Ex is calculated to be 10^1/-k(k is the slope of the standard curve)

1.7.4 measurement of the relative expression level of the target Gene

Collecting the intensity of fluorescence, drawing an amplification curve, and determining the Ct value of each sample purpose and the reference gene. The experiment was repeated 3 times for each sample and the results were averaged.

And (3) determining the relative expression quantity of the target gene by a comparison threshold method, wherein the formula is as follows: Δ t ═ Ct_X-Ct_oWherein Ct is_xCt value for the gene of interest; ct_oCt value for reference gene); Δ Δ Ct ═ Δ Ct (sample to be measured) - Δ Ct (calibration sample); wherein the calibration sample is a sample selected to represent a 1-fold-order gene expression level; then, the relative expression level of the target gene is 2^-ΔΔCt

1.8, data analysis

2. Results

TABLE 4

Table 3 lists the caries lesion ranking keyes scores for each group of rats 11 weeks after the experiment. Wherein, compared with the control group, the E, Ds, Dm and Dx grades of the model group rats have carious lesions with different degrees, which indicates the success of modeling.

In the administration group, after the rats in the comparative examples 1 to 4 are fed with the cariogenic feed, the prepared composite probiotic preparation continuously fed has a certain protection effect on carious lesions of the rats, which is mainly expressed on E and carious lesions of E, Ds grades, and has little protection effect on Wista carious lesions of Dm and Dx grades of the rats in the comparative examples 1 to 4. The composite probiotics prepared in examples 1-4 have a protection effect on decayed lesions of the teeth of rats at the levels of E, Ds, Dm and Dx, especially on the levels of E, Ds and Dm, the scores of the decayed lesions keyes of the rats are almost equivalent to those of a control group, and the decayed lesions at the Dx level are not much different from those of the control group. Therefore, the composite probiotic provided by the embodiment of the application has an ultra-strong protective effect on rat carious lesions. The results in Table 1 show that the protective effect may be related to the expression level of the S-layer protein in the complex probiotics provided in examples 1-4.

TABLE 5 expression level of related genes

In table 5, the gtfb expression level in the model group was significantly higher than that in the control group, indicating that the molding was successful. In general, the high sugar environment in cariogenic feed can promote growth of cariogenic bacteria, further promote secretion of Glycosyltransferase (GTF), and simultaneously increase expression of related gene gtfb.

GTFs, in turn, catalyze sucrose synthesis of a variety of extracellular polysaccharides, including dextran, to help cariogenic bacteria form a biological barrier (biofilm) on the tooth surface, to limit the diffusion of substances inside and outside the plaque, and to maintain the lower pH of the plaque deep layer. One of the glycosyltransferases, gtfb, is closely related to sucrose-dependent adhesion of cariogenic bacteria, and the decrease of the gene expression level of the gtfb can cause streptococcus mutans and other related cariogenic bacteria to lose adhesion to smooth surfaces (such as tooth surfaces).

In table 5, the expression level of rat gtfb in the administration group is reduced correspondingly, and the complex probiotics provided in examples 1 to 4 can significantly reduce the expression of the gene, which indicates that the complex probiotics have a greater destructive effect on the adhesion of cariogenic bacteria.

Cariogenic bacteria utilize various sugars in food to eventually metabolize to lactic acid via glycolysis. The key enzyme of glycolysis is Lactate Dehydrogenase (LDH), which catalyzes pyruvate to generate lactate, so LDH activity influences the acid production capability of cariogenic bacteria, and is one of important virulence factors of cariogenic bacteria for tooth cariogenic. The examples of the present application also analyzed the ldh expression of plaque on molar tooth surface of each group of rats.

As can be seen from Table 5, the expression level of ldh in the model group is significantly higher than that in the control group, which indicates that the modeling is successful, and a large amount of lactic acid with tooth erosion effect is generated on the molar tooth surface of the rat by the cariogenic bacteria to form dental plaque. The ldh expression level of the dental plaque on the molar tooth surface of the rat in the administration group is obviously reduced, and the ldh expression level of the dental plaque on the molar tooth surface of the rat can be reduced to be similar to that of the control group by the composite probiotic prepared in the examples 1-4; while comparative examples 1-4 had limited effect on the amount of ldh expression. Therefore, the complex probiotic preparation provided by the embodiment of the application can reduce the expression of cariogenic bacteria lactate dehydrogenase, reduce the capacity of the cariogenic bacteria to form lactic acid, interfere the glycolysis pathway of saccharides of the cariogenic bacteria, and further play a role in protecting teeth.

The acid resistance of cariogenic bacteria is another important virulence factor and is one of the direct causes of caries. The acid resistance of cariogenic bacteria is related to the activity of the acid-resistant enzyme F-ATPase, and the higher the activity of the acid-resistant enzyme F-ATPase is, the higher the expression level is, the more viable the cariogenic bacteria can survive in a high lactic acid environment, and the bacteria can be killed by acid substances.

In Table 5, the expression level of F-ATPase in the model group is significantly higher than that of the control group, which indicates that the model is successful, and the cariogenic bacteria have high F-ATPase expression level on the molar surface of a rat, further have high acid resistance and determine that the cariogenic bacteria have high physiological activity. The expression level of f-atpase of dental plaque on the molar tooth surface of the rat in the administration group is obviously reduced, and the compound probiotic prepared in the examples 1 to 4 can reduce the expression level of f-atpase of cariogenic bacteria on the molar tooth surface of the rat to be similar to that of the control group; while comparative examples 1-4 had limited effect on the amount of ldh expression. Therefore, the composite probiotic preparation provided by the embodiment of the application can reduce the expression of the cariogenic bacteria resistant to the enzyme F-ATPase and the acid resistance of the cariogenic bacteria, further reduce the physiological activity of the cariogenic bacteria on the molar tooth surface of a rat, form an environment which is not beneficial to the growth of the cariogenic bacteria, and further play a role in protecting teeth.

In conclusion, the complex probiotic provided by the embodiment is analyzed from the expression amounts of the gtfb, ldh and f-atpase genes through animal experiments, and the complex probiotic can reduce the cariogenic action of cariogenic bacteria on teeth and protect teeth on the basis of reducing the adhesion of the cariogenic bacteria, interfering the glycolysis pathway of saccharides of the cariogenic bacteria and reducing the acid resistance of the cariogenic bacteria. The combination of the expression analysis of the surface layer proteins in the composite probiotic provided by the embodiment of the application shows that the expression level of the surface layer proteins in the composite probiotic provided by the embodiment 1-4 is significantly higher than that in the comparative example 1-4, so that the expression level results of the three genes of gtfb, ldh and f-atpase of the molar tooth surface of a rat in the comparative example 1-4 show that the expression level of the surface layer proteins in the composite probiotic may influence the expression of the three genes of gtfb, ldh and f-atpase of cariogenic bacteria. The complex probiotics provided by the embodiment of the application can find the influencing factors and can be applied to related preparations for resisting the caries.

Therefore, the composite probiotic provided by the embodiment of the application has the effect of improving the mouse gastritis reaction caused by HP, and can provide help for Wistar rats in resisting dental caries. Therefore, the composite probiotic preparation provided by the embodiment of the application has double functions of resisting helicobacter pylori and balancing oral micro-ecology, and has wider application prospects, such as being used for preparing probiotic preparations for improving oral cavity, probiotic preparations for improving intestines and stomach and the like.

The above description is only for the preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present application should be covered within the scope of the present application.

Sequence listing

<110> Guangzhou Jintianfang cosmetics Co., Ltd

<120> composite probiotics, preparation method thereof and application thereof in resisting HP and oral caries

<141> 2022-05-15

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 1

ggcccttgct ttctcttcg 19

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 2

ataataaagt tttgattatg t 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 3

catgtacgtt gctatccagg c 21

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

ctccttaatg tcacgcacga 20

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 5

tgatgttgct tcttctatgg ag 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 6

caggttagtg tatgtaagct gt 22

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 7

agcaatgcag ccaatctaca aat 23

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 8

acgaactttg ccgttattgt ca 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 9

cttgatactg ctcgtttccg tc 22

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

gagtcaccat gttcacccat 20

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

cggatgcgtg ttgctcttac tg 22

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 12

ggctgataac caacggctga tg 22

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 13

gcctatgctg ctgctcttg 19

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 14

tcaccaatat ctccgtcaat ctc 23

Claims

1. A preparation method of composite probiotics comprises the following steps:

inoculating the activated clostridium butyricum bacterial suspension into a fermentation liquid culture medium for culture for 4-5 hours;

and continuously inoculating the lactobacillus gasseri suspension into the fermentation system, completing the fermentation, and harvesting the fermentation liquor containing the composite probiotics.

2. The production method according to claim 1, wherein the fermentation liquid medium comprises: 62.21g/L of lactose, 46.25g/L of yeast extract powder, 19.12g/L of yeast peptone, 17.25g/L of sodium dihydrogen phosphate, 1.75g/L of disodium hydrogen phosphate and MgSO₄·7H₂O 0.96g/L，MnSO₄·5H₂O0.063 g/L, L-cysteine hydrochloride 0.17 g/L.

3. The method of claim 1, wherein the conditions for fermentation of clostridium butyricum comprise: the initial pH value is 5.8-6.0, the temperature is 37 ℃, the inoculation amount is 1%, 25% ammonia water is adopted to ensure the pH value to be 5.5 in the fermentation process, nitrogen is simultaneously introduced to keep the pressure of the tank to be 0.03-0.04 MPa, and stirring is simultaneously maintained at 125rpm in the fermentation process.

4. The method according to claim 2, wherein the inoculum size of the lactobacillus casei and the lactobacillus paracasei is 3-4 v/v%.

5. The method according to claim 2, wherein the lactobacillus casei and lactobacillus paracasei are inoculated while supplementing 25% by volume of the fermentation broth in a fermentation system.

6. The method according to claim 2, wherein the amount of the Lactobacillus gasseri inoculated is 1.5 to 2 v/v%.

7. The method according to claim 2, wherein the inoculation with Lactobacillus gasseri is supplemented with 10% by volume of the fermentation broth.

8. A preparation method of a composite probiotic preparation comprises the preparation method of any one of claims 1 to 6, and specifically, the composite probiotic is collected, mixed with a protective agent, and subjected to freeze drying to obtain the composite probiotic preparation.

9. A composite probiotic preparation contains not less than 10% of probiotic bacteria⁹cfu/g of Lactobacillus gasseri, not less than 10⁸cfu/g of Lactobacillus casei, not less than 10⁸cfu/g of lactobacillus paracasei and not less than 10¹⁰cfu/g of clostridium butyricum, and not less than 2.00mg/g of surface protein.

10. Use of the complex probiotics prepared by the preparation method of any one of claims 1 to 6 in preparation of anti-helicobacter pylori products and/or anti-oral caries products.