TWI526532B - Method of a nucleic acid construct used to regulate the bacterial lysis - Google Patents

Description

Recombinant nucleic acid construct and rapid recovery of amino acid composition using recombinant nucleic acid construct method

The present invention relates to a recombinant nucleic acid construct and a method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct, in particular, a method for rapidly recovering Escherichia coli from a culture medium in an industrial process for producing recombinant protein from Escherichia coli The method of protein.

The ultimate goal of the Human genome project is to outline the basic blueprint of life so that humans can understand the physiological functions and the secrets of life. On the other hand, scientists can also use this map to solve human genes. The mystery, and the use of bio-critical technologies to solve the problems of human genetic diseases, as well as the development of related biotechnology that promotes the future of human well-being. Thanks to the smooth development of this greatest human-made plan of the 21st century, it has also promoted the enthusiasm of many eukaryotic and prokaryotic cell genomics programs. It is expected that in the future we will understand more about the basic functions and traceability of many genes. The evolutionary process and correlation between similar protein families, as well as the understanding of the interaction between protein bodies for the basic life of a cell. It is especially important that many proteins with special functions will be discovered and used to enhance human well-being, and recombinant gene technology will play the most critical role at this moment. The scope of this technology will involve the chemical industry, the biotechnology and pharmaceutical industry, agriculture, animal husbandry, and In areas such as source and environmental purification, for example, recombinant gene technology can select the target gene we are interested in to a suitable vector, and then deliver the resulting recombinant vector to a competent host cell. In the (competent host cell), the recombinant host cell thus formed can be cultured under a suitable medium and culture conditions, and the expression of the target gene can be induced at an appropriate timing, and the desired recombinant protein can be synthesized in a large amount. These recombinant proteins may include industrial and agricultural enzymes, lignocellulosic hydrolases, therapeutic proteins, interferons, interleukins, hormones, growth hormones. , antigenic peptides (antigenic polypeptides), antibodies (antibodies) and other products.

The use of bacterial cells such as E. coli as host cells to produce recombinant proteins is still the most economical, simple, and convenient competitive condition. The reason is that Escherichia coli is easy to culture and has a fast growth rate, and the nutrient substrate required is economical and simple. Moreover, it is easy to enlarge the culture volume, and the strain is less sensitive to changes in the environmental conditions of the fermentation, and in particular, a large amount of recombinant protein can be produced in the cells. However, E. coli lacks the ability to excrete proteins out of the cell, so in order to purify the recombinant protein produced by intracellular accumulation, the industrially traditional method must use intracellular machinery to release the cells.

Industrial downstream purification procedures for the production of recombinant proteins by E. coli, mainly including (1) centrifugation of strains, (2) recovery of strains, (3) separation of bacteria, (4) purification of proteins, (5) packaging, etc.; The process was carried out by centrifuging the fermented strain using an industrial grade continuous centrifuge and breaking it with an industrial grade homogenizer to release the protein produced in the cell. However, industrial-grade continuous centrifuges are expensive, have long processing times, and have limited strain recovery efficiency. In addition, industrial-grade homogenizers have limited bactericidal effects and are time-consuming.

In order to facilitate the recovery of recombinant proteins produced intracellularly in E. coli, Morita et al. used bacteriophage T4 lytic gene Gpt and bacteriophage T7 lysozyme to rupture E. coli (Biotechnol. Prog., 2001, 17: 573-576) . The lytic gene Gpt is a protein holin known to act on the cell membrane, and the bacteriophage T7 lysozyme has a function of decomposing the cell wall. Morita et al. cloned the Gpt and T7 lysozyme genes on a vector and used the T7 gene expression system to regulate the expression of these two genes using the T7 promoter. Taking the production of recombinant glucuronidase (GUS) as an example, the experimental results show that when the inducer of 1 mM IPTG is used to force the expression of Gpt and T7 lysozyme, the effect of cell lysis can be effectively achieved, and the recombinant GUS can be released extracellularly. . However, IPTG is difficult to achieve industrial use, the main reasons are (1) IPTG is expensive; (2) IPTG is not metabolized by bacteria, easily contaminates the fermentation broth, and increases the difficulty of purification of the fermentation product; 3) IPTG is potentially toxic and not suitable for the production of medical products; (4) In order to achieve a uniform expression of the gene expression of the cell population, a high saturation dose of IPTG is required. In addition, the T7 gene expression is currently the strongest gene expression system in E. coli and is most effective for the production of recombinant proteins. However, this study uses the T7 gene expression system to control the expression of Gpt and T7 lysozyme. This strategy will make it impossible for the target protein to express the desired protein using the T7 gene expression system, thus limiting the production efficiency of the target protein; On the one hand, Morita et al.'s research report does not specify the efficiency of its target protein (GUS) release extracellular, making it difficult to assess the efficacy of its technology.

Jiae et al., based on the research techniques of Morita et al. (J. Microbiol. Biotechnol., 2007, 17: 1162-1168), developed the ptsG P1 promoter to regulate the gene expression of Gpt and T7 lysozyme to produce green For example, luciferase GFPuv and starch hydrolase amylase. The results show that although this technology can detect the activity of green luciferase and starch hydrolyzing enzyme in the extracellular fermentation broth, the growth of the cells after induction is not affected, which means that the effect of cell rupture cannot be effectively achieved. The efficiency of the release of extracellular proteins from their target proteins is also not specifically described in this report.

On the other hand, Miksch et al. used the function of the kil gene to release the protein produced in the membrane from the extracellular (Appl. Mirobiol. Biotechnol., 1997, 47: 530-536) to produce the glucanase glucanase. For example, the results show that this technique does not cause cell rupture, but the glucanase produced in the intermembrane can be released into the extracellular fermentation broth; however, the intercellular membrane is located in the outer and intima of E. coli. Space, because the cytoplasmic space is much larger than the interstitial membrane, the protein to be produced is more cumulatively produced in the cytoplasm than the interstitial space; and the kil gene product can contribute to the release of mesangial proteins, which means cells The outer membrane structure is changed to cause leakage, so that under the condition of large shear stress generated by the industrial fermentation scale, the cells are not easily enlarged and cultured, thereby limiting the applicability of the technique.

The technology of the present invention constructs a system for inducing bacteriolysis by using temperature in a production cell. When the production bacterium is fermented, the temperature of the mashing solution is increased to induce a lytic system to promote the rupture of the E. coli producing the target protein. It is not necessary to use an industrial grade continuous centrifuge to recover the strain by centrifugation, and then use an industrial grade homogenizer for the sterilization treatment. It can be said that the two steps of the traditional treatment method, the recovery bacteria and the sterilization, can be simplified, and the treatment procedure can be simplified. Reduce equipment investment and further increase the purification efficiency of recombinant proteins. In addition, the use of this technology, in addition to no major upgrades on existing equipment, and can be widely used in a variety of recombinant proteins The production is extremely industrially valuable.

Figure 1 shows the gene map of the plastid pPL- φ XE.

FIG 2 based plasmid pPL * - φ XE of the genetic map.

Figure 3 (A) shows the gene map of the plastid pCL*- φ XEO.

Figure 3 (B) shows the gene map of the plastid pET20bI-T4E.

Figure 3 (C) shows the gene map of the plastid pCL*- φ XT4E.

Figure 4 is a gene map of the plastid pCL*H- φ XT4E.

Figure 5 (A) is a genetic map of the plastid pET20bI-T7E.

Figure 5 (B) shows the gene map of the plastid pCL*H- φ XT7E.

Figure 6 is a flow diagram of a process for the rapid recovery of an amino acid composition of the present invention.

Figure 7 is a flow chart showing the steps of the material of the present invention for releasing the recombinant strain into the medium.

Figure 8 is a growth curve of Escherichia coli BL21 (DE3) containing the plastid pPL- φ XE in the examples of the present invention. DESCRIPTION OF SYMBOLS: Temperature induction (●) was not implemented; temperature induction (○) was implemented.

9 based embodiment of the invention contains a plastid pPL * - E. coli BL21 (DE3) of the growth curve φ XE.

DESCRIPTION OF SYMBOLS: Temperature induction (●) was not carried out; the culture temperature was raised to 39 ° C to carry out temperature induction (○); the culture temperature was raised to 42 ° C to carry out temperature induction (□).

FIG 10 based embodiment of the invention contains a plastid pCL * - E. coli BL21 (DE3) of the growth curve φ XT4E - φ XEO or pCL *. Description of Symbols: Not embodiment the temperature-induced containing the plasmid pCL * - φ XEO strain (●); embodiment of a temperature-induced containing the plasmid pCL * - φ XEO strain (○); embodiment of a temperature-induced containing the plasmid pCL * - φ XT4E strain (□).

Figure 11 is a growth curve of Escherichia coli BL21 (DE3) containing the plastid pCL*H- φ XT4E in the examples of the present invention. DESCRIPTION OF SYMBOLS: Temperature induction (●) was not implemented; temperature induction (○) was implemented.

Figure 12 is a graph showing the growth curve of Escherichia coli BL21 (DE3) containing the plastid pCL*H- φ XT7E in the examples of the present invention. DESCRIPTION OF SYMBOLS: Temperature induction (●) was not implemented; temperature induction (○) was implemented.

Figure 13 is a graph showing the sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) analysis of the recombinant AHL protein in the examples of the present invention. DESCRIPTION OF SYMBOLS: diameter M, protein standard (Fermentas); diameter 1, uninduced strain culture; diameter 2: addition of IPTG inducer, and temperature-induced strain culture in early logarithmic growth phase; diameter 3: The IPTG inducer was added, and the temperature-induced strain culture solution was applied in the mid-log phase growth phase; the diameter 4: the IPTG inducer was added, and the temperature-induced strain culture solution was subjected to the late logarithmic growth phase. Arrows indicate the location of the recombinant AHL enzyme that was induced to form.

Figure 14 is a graph showing the sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) analysis of the recombinant HDT protein in the examples of the present invention. DESCRIPTION OF SYMBOLS: diameter M, protein standard (Fermentas); diameter 1, uninduced strain culture; diameter 2: addition of IPTG inducer, and temperature-induced strain culture in early logarithmic growth phase; diameter 3: The IPTG inducer was added, and the temperature-induced strain culture solution was applied in the mid-log phase growth phase; the diameter 4: the IPTG inducer was added, and the temperature-induced strain culture solution was subjected to the late logarithmic growth phase. Arrows indicate the location of the induced recombinant HDT enzyme.

General experimental methods and materials

The experimental methods employed in the present invention, as well as for DNA cloning, are referenced to textbooks well known in the art: (Sambrook J, Russell DW (2001)) Molecular Cloning: a Laboratory Manual. 3 ^rd ed. Cold Spring Harbor Laboratory Press, New York, for example, cleavage reaction by restricting enzyme, DNA ligation with T4 DNA ligase, polymerase Polymerase chain reaction (PCR), agarose gel electrophoresis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and plastid transformation These technologies are all familiar to the person skilled in the art and can be implemented according to their professionalism. For example, the E. coli plastid transformation method used in the following examples was carried out with calcium chloride-treated competent cells treated with calcium chloride (CaCl ₂ ). Further, the density of the bacterial culture solution was measured using a spectrophotometer (V530, Jasco), and the measurement wavelength was 550 nm, and the obtained absorbance value was recorded as OD ₅₅₀ . Protein concentration analysis uses protein assay reagents (Protein assay Reagent, BioRad Co.) for total protein quantification. Individually labeled proteins are analyzed by gel electrophoresis using a protein analyzer (AlphaImagerEP, AlphaInnotech). Quantitative.

Purification of bacteria and phage chromosomes, plasmids and DNA fragments using Wizard ^® Genomic DNA Purification kit (Promega Co.), High-Speed Plasmid Mini kit (Geneaid Co.) and Gel/PCR DNA Fragments Commercial Purification Drugs Group such as Extraction Kit (Geneaid Co.). Point mutations were purchased from New England Biolabs and Fermentas Life Science using the QuickChange ^® Site-Directed Mutagenesis Kit (Stratagene Co.), Restriction enzyme, T4 DNA-binding enzyme and Pfu DNA polymerase (polymerase) from Promega Co. The primers required for the polymerase chain reaction were synthesized by Mingxin Biotech (Taipei) and Yuanzi Biotech (Taipei).

The mediators used in DNA cloning are Escherichia coli DH5α (Stratagene Co.), BW25142 (Haldimann and Wanner, 2001, J. Bacteriol., 183: 6384-93) and BL21 (DE3) (Invitrogen Co). .), the bacteria are cultured in LB liquid nutrient base, and the transformed strain is cultured with antibiotics in the culture medium. The antibiotic dosage is 50 μg/mL for ampicillin and 50 μg/mL for kanamicin. .

Agrobacterium radiobacter NRRL B11291 amidohydrolase (AHL) activity test is to react the sample with the reaction solution (final concentration: 20 mM CpHPG, 1 mM EDTA and 10 mM sodium phosphate buffer, pH = 6.6 ~ 6.8) at 40 ° C for 20 minutes, then heat at 100 ° C 10 The reaction was terminated in minutes and centrifuged at 12,000 rpm for 10 minutes, and the supernatant was taken for HPLC analysis. HPLC analysis used a C18 column (250 mm x 4.6 mm, Bos Hypersil), a mobile phase of 2 mM ammonium acetate (pH = 3.2): methanol = 91:9 by volume solution, and signal detection with UV at a wavelength of 280 nm. The activity test of A. radiobacter NRRL B11291 hydantoinase (HDT) was similar to that of AHL, and only the reaction solution was changed to a solution having a final concentration of 10 mM HPG, 0.1 M Tris buffer, pH=8.0 and 0.5 mM MnCl ₂ . Enzyme activity is defined as enzyme activity per unit (U) = product production (μmole) / reaction time (min).

In the present invention, the temperature inducing action is to raise the bacterial culture temperature from the original culture temperature to a higher culture temperature between 35 and 50 degrees Celsius for at least twenty minutes, and then The culture temperature is lowered to the original culture temperature. A preferred embodiment of the temperature inducing action is to first use 37 degrees Celsius as the original culture temperature, then raise the culture temperature to 42 degrees Celsius for one hour, and then cool the culture temperature to 37 degrees Celsius.

Example 1: Construction of a temperature-inducing recombinant nucleic acid construct pPL-Φxe

Temperature-induced recombinant nucleic acid construct pPL- φ XE contains λ P _R P _L promoter-driven phage X174 lytic gene E (Xe), multiple cloning site, initiated by P _RM The sub-regulated heat-sensitive repressor protein CI857 gene, the pMB1 plastid replication origin from Escherichia coli, and the anti-ampicillin gene. The construction process is as follows. First, the Xe gene primer is synthesized according to the nucleotide sequence of the National Center for Biotechnology Information (NCBI) Genome Library Xe (Refseq: NC_001422): Forward primer: (5'TTGCG CATATG GTACGCTGGACTTGTG 3')

Reverse primer: (5'TTTT GAATTC AGACATTTTATCACTCCTTCCGCACG 3')

The forward primer is designed to contain the cleavage site of the restriction enzyme Nde I, while the reverse primer design contains the cleavage site of the Eco RI (as indicated by the bottom line). X174 phage DNA purchased from New England Biolabs was used as a template, and PCR reaction was carried out with the above two primers, and a fragment containing Xe (295 bp) was amplified, and the amplified gene fragment was purified by Gel/PCR DNA Fragments Extraction Kit. Thereafter, the gene fragment was cleaved with restriction enzymes Nde I and Eco RI and the plastid pPL452 purified by High-Speed Plasmid Mini kit (Love et al., 1996, Gene 176: 49-53), using Gel/PCR DNA Fragments Extraction Kit recovers the DNA fragment after the enzyme is cut, and then binds the two fragments by T4 ligase, and then transforms the DNA binding product into Escherichia coli strain DH5α according to the above-mentioned "general experimental method" to obtain the temperature. The induced lysosome pPL- φ XE, the plastid map is shown in Figure 1.

Example 2: Construction of temperature-inducing recombinant nucleic acid construct pPL*- φ XE

The temperature-inducing recombinant nucleic acid construct pPL*- φ XE contains the λ P _R P _L promoter-driven Xe, diverse colonization positions, and thermal sensitivity inhibition regulated by the mutant P _RM promoter (P _RM *) Protein CI857 gene, pMB1 plastid replication region from E. coli, anti-ampicillin gene. According to the published literature (Jechlinger W. et al., 2005, J. Biotechnol. 116: 11-20), the P _RM * promoter is stronger than the P _RM promoter, thus increasing the expression of the heat sensitive inhibitory protein CI857 gene. To effectively inhibit the expression of the λ P _R P _L promoter in the uninduced state. The construction process is as follows. First, the point mutation primer was designed according to the pPL452 sequence of the National Center for Biotechnology Information Center (GenBank: AB248920.1), and the primer sequence synthesized according to the requirements of the QuickChange ^® Site-Directed Mutagenesis Kit is as follows: Initiative: (5'GTAAAATAG C CAACACGCACGGTGTTAGATATTTATC 3')

Reverse primer: (5'GATAAATATCTAACACCGTGCGTGTTG G CTATTTTAC 3')

The above primer pair has a single nucleic acid mutation site (such as the bottom line label), and the plastid pPL- φ XE constructed in the first embodiment is used as a DNA template, and the PCR is used to perform point mutation PCR amplification using the QuickChange ^® Site-Directed Mutagenesis Kit. After the PCR fragment was recovered by Gel/PCR DNA Fragments Extraction Kit, the DNA fragment was bound by T4 ligase, and the DNA adhesive product was transformed into Escherichia coli strain DH5α according to the above-mentioned "general experimental method". temperature induction of type recombinant nucleic acid construct was pPL * - φ XE. The plastid map is shown in Figure 2.

Example 3: Construction of temperature-inducing recombinant nucleic acid construct pCL*- φ XT4E

Temperature-induced recombinant nucleic acid construct pCL*- φ XT4E contains λ P _R P _L promoter-driven expression of Xe and phage T4 lysozyme gene (Gpe), heat-sensitive inhibition regulated by P _RM * Protein CI857 gene, a lacO operator site, pSC101 plastid replication region, anti-streptomycin gene. The construction process is as follows. First, the primer sequence is designed according to the lacO control sub-location of the genomic database of the National Center for Biotechnology Information: Forward introduction: (5' GGATAACAATT GATCCTAAGGAGGTTGATCC 3')

Reverse primer: (5' GCTCACAATT CCAATGCTTCGTTTCGTATCACACACC 3')

Above primer position containing a lacO control sub (e.g., underlined at), to implement mass pPL two Construction of Example * - φ XE is a DNA template, using PCR amplification reaction by using Gel / PCR DNA Fragments Extraction Kit The PCR fragment was recovered after using T4 adhesive enzyme (T4 Ligase) bonding the DNA fragment, in accordance with the general experimental method, the adhesive product DNA Transformation into E. coli strain DH5α, the obtained temperature-induced acting recombinant nucleic acid construct was pPL * - φ XEO. Next, the plasmid pPL * - φ XEO in restriction enzyme Pst I and Sma I cut to recover P _RM * regulated heat sensitive CI857 repressor protein gene, lac0 control sub-location, and λ P _R P _L promoter containing some by Driving the Xe gene fragment; the plastid pCL1920 (Claude and Masayori, 1990, Nucl. Acids Res., 18:4631) containing the pSC101 plastid replication region and the anti-streptomycin gene was purified using a High-Speed Plasmid Mini kit. Then, after cutting with the restriction enzymes Pst I and Sma I, the DNA fragment of the enzyme-cleaved DNA was recovered using the Gel/PCR DNA Fragments Extraction Kit, and the two DNA fragments were bound by T4 ligase, according to the above. "general experimental Procedures", the adhesive product DNA Transformation into E. coli strain DH5α, the obtained low copy number (copy number) of the temperature induced recombinant nucleic acid construct type material bodies pCL * - φ XEO, such as its mass spectrum Figure 3 (A) shows.

Next, according to the phage T4 sequence of the National Center for Biotechnology Information Center (Refseq: NC_000866.4) and the plastid pET20bI (Wang ZW et al., 2004, Biotechnol. Prog. 20: 1352-1358) vector sequence design Primer: Forward introduction 1: (5'GAGTT CATATG AATATATTTGAAATGTTAC 3')

Forward introduction 2: (5'GATCC GAGCTC CCCTCTAGAAATAATTTTG 3')

Reverse primer: (5'AGTAA CTCGAG CCCGGGTTATAGATTTTTATACGCGTCC 3')

In the above primer, the forward primer 1 is designed to have a Nde I cutting site (the position of the bottom line), and the forward primer 2 is designed to have a Sac I cutting site (the position of the bottom line), and the reverse primer design Is the cutting site with Xho I (the position of the underline). The phage T4 DNA purified by Wizard ^® Genomic DNA Purification kit was used as a DNA template, and PCR was carried out by using the forward primer 1 and the reverse primer, and the Gpe gene (510 bp) was amplified. PCR was carried out using Nde I and Xho I restriction endonucleases. The amplified DNA fragment and the plastid pET20bI purified using the High-Speed Plasmid Mini kit were used for cleavage, and the cleavage DNA fragment was recovered using the Gel/PCR DNA Fragments Extraction Kit, and the Gpe gene was conjugated to the plastid pET20bI using T4 binding enzyme. Thereafter, the DNA-binding product was transformed into Escherichia coli strain DH5α to obtain plastid pET20bI-T4E, and its map is shown in Fig. 3(B). Next, the plastid pET20bI-T4E was used as a DNA template, PCR amplification was performed using the forward primer 2 and the reverse primer, and the DNA fragment amplified by PCR using Sac I and Xho I restriction endonuclease was purified using High-Speed Plasmid Mini kit. The plastid pCL*- φ XEO is cleaved, and the cleavage DNA fragment is recovered using the Gel/PCR DNA Fragments Extraction Kit, and the recovered two-stage DNA is bonded using T4 adhesive enzyme, and the DNA adhesive product is subjected to a general experimental method. Transformation into E. coli strain DH5α, the obtained temperature-induced acting recombinant nucleic acid construct was pCL * - φ XT4E. The gene map of the plastid is shown in Figure 3(C).

Example 4: Construction of a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E

The recombinant nucleic acid construct of the present invention, in one embodiment thereof, comprises a nucleic acid sequence of a phage ψX174 lytic gene E, a nucleic acid sequence of a bacteriophage T4 lysozyme gene, and a heat-sensitive repressor protein. a nucleic acid sequence of the CI857 gene, a nucleic acid sequence of a λ P _R P _L promoter, a nucleic acid sequence of a heat shock protein groEL promoter, and a nucleic acid sequence at a lacO control sub position, in this embodiment This is called a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E, which is produced as follows: temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E contains λ P _R P _L promoter And the heat shock protein groEL promoter drives the expression of the Xe and Gpe genes, the heat sensitive inhibitory protein CI857 gene regulated by P _RM *, a lacO operator site, the pSC101 plastid replication region, Anti-streptomycin gene. The construction process is as follows. First, according to the Escherichia coli MG1655 gene sequence of the National Biotechnology Information Center (Refseq: NC_000913.2), the primer is introduced: Forward introduction: (5'GTCCG TCTAGA CCCAAATTTTGGGCAACTGC 3')

Reverse primer: (5'CTCTC GGTACC GAAAGTCGGTATCTGTTATG3')

In the above primer, the forward primer is designed to have a cleavage site of Xba I (the position of the underline), and the reverse primer is designed as a cleavage site with Kpn I (the position of the underline). The E. coli MG1655 gene purified by Wizard ^® Genomic DNA Purification kit was used as a DNA template, and the groEL promoter gene (249 bp) was amplified by PCR using a forward primer and a reverse primer. Xba I and Kpn I were used to limit the incision. PCR enzymes will increase the use of DNA fragments, and High-Speed Plasmid Mini kit purified plasmid pCL three embodiments Construction Example * - cutting φ XT4E, DNA fragments after the cleavage using Gel / PCR DNA fragments Extraction Kit recovered, along with The purified two DNA fragments were conjugated with T4 binding enzyme, and the DNA binding product was transformed into Escherichia coli strain DH5α according to a general experimental method to obtain a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E. The plastid map is shown in Figure 4.

Example 5: Construction of temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E

The recombinant nucleic acid construct of the present invention, in one embodiment thereof, comprises a nucleic acid sequence of a phage ψX174 lytic gene E, a nucleic acid sequence of a bacteriophage T7 lysozyme gene, and a heat-sensitive repressor protein. a nucleic acid sequence of the CI857 gene, a nucleic acid sequence of a λ P _R P _L promoter, a nucleic acid sequence of a heat shock protein groEL promoter, and a nucleic acid sequence at a lacO control sub position, in this embodiment This is called a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E, which is prepared as follows: temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E contains λ P _R P _L promoter And heat shock protein groEL promoter drives the expression of Xe and phage T7 lysozyme gene (T7e) gene, P _RM * regulated heat sensitive inhibitory protein CI857 gene, a lacO control sublocation (operator site ), pSC101 plastid replication region, anti-streptomycin gene. The construction process is as follows. First, according to the phage T7 sequence of the National Center for Biotechnology Information Center (Refseq: NC_001604.1) and the plastid pET20bI (Wang ZW et al., 2004, Biotechnol. Prog. 20: 1352-1358 Sequence design primer: forward primer 1: (5'AAGAA CATATG GCTCGTGTACAGTTTAAAC 3')

Forward introduction 2: (5'GATCC GAGCTC CCCTCTAGAAATAATTTTG 3')

Reverse primer: (5'TTAGT CTCGAG CCCGGGTTATCCACGGTCAGAAGTGAC 3')

In the above primer, the forward primer 1 is designed to have a Nde I cutting site (the position of the bottom line), and the forward primer 2 is designed to have a Sac I cutting site (the position of the bottom line), and the reverse primer design Is the cutting site with Xho I (the position of the underline). The pLysS plastid (Promega Co.) containing the bacteriophage T7 lysin gene was purified as a DNA template by High-Speed Plasmid Minikit, and the phage T7e gene (464 bp) was amplified by PCR using the forward primer 1 and the reverse primer. The PCR-amplified DNA fragment and the plastid pET20bI vector purified using the High-Speed Plasmid Mini kit were cleaved using Nde I and Xho I restriction endonucleases, and the cleaved DNA fragment was recovered using the Gel/PCR DNA Fragments Extraction Kit. After the purified two-stage DNA was bound using T4 binding enzyme, the DNA adhesion product was transformed into E. coli strain DH5α according to a general experimental method to obtain a plastid pET20bI-T7E. The plastid map is shown in Figure 5(A). Next, the plastid pET20bI-T7E was used as a DNA template, PCR amplification was performed using the forward primer 2 and the reverse factor, and the DNA fragment amplified by PCR was amplified using Sac I and Xho I restriction endonucleases and purified using a High-Speed Plasmid Mini kit. The plastid pCL*H- φ XT4E constructed in Example 4 was cut, and the cut DNA fragment was recovered using Gel/PCR DNA Fragments Extraction Kit, and the purified two-stage DNA was bonded using T4 adhesive enzyme. In the experimental method, the DNA binding product was transformed into Escherichia coli strain DH5α to obtain a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E. The plastid map is shown in Figure 5(B).

Example 6: Antibacterial effect of temperature-inducing recombinant nucleic acid construct pPL- φ XE

Using the general experimental method described above, the temperature-inducing recombinant nucleic acid construct pPL- φ XE constructed in Example 1 was transformed into Escherichia coli strain BL21 (DE3), and cultured at 30 ° C in an ampicillin solid medium. A single colony was selected, cultured in a beaker containing amphicilin antibiotic LB broth (10 mL), cultured overnight at 30 ° C, 200 rpm, and inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics, and the initial cell density was reached. OD ₅₅₀ =0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ = 0.3, the culture temperature was increased from 30 ° C to 37 ° C to continue the culture until the end of the experiment, the experimental results are shown in Figure 8. Compared with the growth curve of the strain without temperature induction (filled circle), the growth curve (open circle) of the strain induced by this temperature showed a significant downward trend, indicating the induced phage ψX174 lytic gene E (ψXe) Can cause bacterial death. However, the growth of the strain without temperature induction was slow, indicating that the temperature-inducing recombinant nucleic acid construct pPL- φ XE was too sensitive to temperature.

Example 7: Breaking effect of temperature-inducing recombinant nucleic acid construct pPL*- φ XE

Sixth Example shows the temperature induction of recombinant nucleic acids pPL- φ XE construct was too sensitive to temperature, is not conducive to practical use, so as described in Example Construction for the two temperature-induced acting recombinant nucleic acid construct was pPL * - φ XE. With the foregoing "General Experimental Procedures", the temperature of the induction of type recombinant nucleic acid construct was pPL * - φ XE Transformation to E. coli strain BL21 (DE3), a solid culture containing amoxicillin amps based culture at 30 deg.] C, single colonies were picked The cells were cultured in a beaker containing amphicilin antibiotic LB medium (10 mL), cultured overnight at 30 ° C, 200 rpm, and inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics to an initial cell density of OD ₅₅₀ = 0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ = 0.3, the culture temperature was increased from 30 ° C to 39 ° C or 42 ° C, after one hour, warmed to 37 ° C to continue the culture until the end of the experiment The experimental results are shown in Fig. 9. Compared with the growth curve (open circles) of the strain without temperature induction, the growth (solid circles) of the strain induced at 39 °C has no effect, but the growth of both strains is equivalent. Slow; however, the growth curve (open squares) of the strain induced at 42 °C showed a significant decrease. These results show that the temperature of the induction of a recombinant nucleic acid construct type were pPL * - φ XE less sensitive to temperature, and phage ψX174 to elevated temperature (e.g. 42 ℃) induced the lysis gene E (ψXe) can lead to bacterial death.

Example 8: Breaking effect of temperature-inducing recombinant nucleic acid construct pCL*- φ XT4E

Example VII show that had not been induced by temperature, the temperature induced type comprising a recombinant nucleic acid construct was pPL * - φ XE strain growth retardation, showing ψX174 phage lysis gene E (ψXe) under uninduced conditions are still traces performance, is not conducive to practical use, so as described in Example Construction for the three temperature-induced acting recombinant nucleic acid construct was pCL * - φ XEO. Using "General Experimental Procedures", the temperature of the induction of type recombinant nucleic acid construct was pCL * - φ XEO Transformation to E. coli strain BL21 (DE3), a solid culture containing amoxicillin culture based amperes at 30 ℃, single colonies were picked, The cells were cultured in a beaker containing amphicilin antibiotic LB medium (10 mL), cultured overnight at 30 ° C, 200 rpm, and then inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics to an initial cell density of OD ₅₅₀ =0.08. Subculture was then carried out at 30 ° C and 200 rpm until the end of the experiment. The results of the experiment are shown in Figure 10, relative to the growth of the strain containing the temperature-inducing recombinant nucleic acid construct pPL*- φ XE (refer to Figure 9 circle), temperature induced type comprising a recombinant nucleic acid construct was pCL * - φ XEO growth of strain (filled circle) good display performance ψX174 phage lysis gene E (ψXe) can be tightly controlled.

Further, in order to view the temperature induced type recombinant nucleic acid construct was pCL * - φ XEO cell growth induced late performance, training methods as described above, the first type comprising a temperature induced recombinant nucleic acid construct was pCL * - φ The XEO strain was cultured overnight, inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics, and the initial cell density reached OD ₅₅₀ =0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ At 2.5, the culture temperature was increased from 30 ° C to 42 ° C. After one hour, the temperature was increased to 37 ° C and the culture was continued until the end of the experiment. The experimental results are shown in Figure 10. The growth curve of the temperature-inducing strain (open square) It showed a decrease, indicating that the induced phage ψX174 lytic gene E could not effectively kill the strain.

To further enhance the effectiveness of fracture strain, and therefore the three carried out as described in Example Construction of temperature-induced acting recombinant nucleic acid construct was pCL * - φ XT4E. Using "General Experimental Procedures", the temperature of the induction of type recombinant nucleic acid construct was pCL * - φ XT4E Transformation to E. coli strain BL21 (DE3), a solid culture containing amoxicillin culture based amperes at 30 ℃, single colonies were picked, The cells were cultured in a beaker containing amphicilin antibiotic LB medium (10 mL), cultured overnight at 30 ° C, 200 rpm, and then inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics to an initial cell density of OD ₅₅₀ =0.08. Then, subculture was carried out at 30 ° C and 200 rpm. When the cell density reached OD ₅₅₀ = 2.5, the culture temperature was increased from 30 ° C to 42 ° C. After one hour, the temperature was warmed to 37 ° C and the culture was continued until the end of the experiment. As shown in Fig. 10, the growth curve (open circles) of the temperature-inducing strains still slightly decreased, indicating that the induced production of phage ψX174 lysin gene E and bacteriophage T4 lysozyme (Gpe) could not effectively cause the death of the strain.

Example 9: Breaking effect of temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E

In order to further enhance the efficiency of strain rupture, the temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E was constructed as described in Example 4. The temperature-inducible recombinant nucleic acid construct pCL*H- φ XT4E was transformed into E. coli strain BL21 (DE3) by "general experimental method", and cultured at 30 ° C with ampicillin solid medium to select a single colony. The cells were cultured in a beaker containing amphicilin antibiotic LB medium (10 mL), cultured overnight at 30 ° C, 200 rpm, and inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics to an initial cell density of OD ₅₅₀ = 0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ = 2.5, the culture temperature was increased from 30 ° C to 42 ° C, and after one hour, the temperature was warmed to 37 ° C to continue the culture until the end of the experiment, the experimental results As shown in Fig. 11, the growth-inducing strain did not grow well (filled circles), but the growth curve (open circles) of the strain induced at 42 °C showed a significant decrease, indicating that this temperature-induced recombinant nucleic acid construction The substance can be induced at a high temperature in the late stage of cell growth, and the phage ψX174 lytic gene E (ψXe) and the bacteriophage T4 lysozyme (Gpe) which are induced to produce can effectively cause bacterial death.

Example 10: Breaking effect of temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E

Further, a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E was constructed as described in Example 5. The temperature-inducible recombinant nucleic acid construct pCL*H- φ XT7E was transformed into E. coli strain BL21 (DE3) by "general experimental method", and cultured at 30 ° C with ampicillin solid medium to select a single colony. The cells were cultured in a beaker containing amphicilin antibiotic LB medium (10 mL), cultured overnight at 30 ° C, 200 rpm, and inoculated into fresh LB medium (30 mL) containing ampicillin antibiotics to an initial cell density of OD ₅₅₀ = 0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ = 2.5, the culture temperature was increased from 30 ° C to 42 ° C, and after one hour, the temperature was warmed to 37 ° C to continue the culture until the end of the experiment, the experimental results As shown in Fig. 12, the growth-inducing strain did not grow well (filled circles), but the growth curve (open circles) of the strain induced at 42 °C showed a significant decrease, indicating that this temperature-induced recombinant nucleic acid construction The substance can be induced at a high temperature in the late stage of cell growth, and the phage ψX174 lysing gene E (ψXe) and the bacteriophage T7 lysozyme (T7e) which are induced to produce can effectively cause bacterial death.

Example 11: Using a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E to release a recombinant protein produced intracellularly

As shown in the tenth embodiment, the temperature-inducing recombinant nucleic acid construct pCL*H- φ XT7E can induce a bacteriostatic effect at a high temperature in the late stage of cell growth, and a large amount of recombinant protein can be accumulated in the late stage of production cell growth, so that Increase the extracellular release of recombinant protein after bacteriostatic. In order to test the efficiency of this system to release the recombinant protein produced by the strain in the strain, the production of Agrobacterium radiobacter NRRL B11291 amidohydrolase (AHL) is taken as an example, and the plastid pCL*H- φ XT7E and plastid pChA203 (Chiang CJ. et al) .2008, J. Agri. Food Chem. 56, 6348-6354) simultaneously transformed into E. coli strain BL21 (DE3), wherein the plastid pChA203 contains the THL promoter-driven AHL gene, pMB1 plastid replication region (replication) Origin), anti-ampheparin antibiotic gene. The cells were cultured at 30 ° C in a solid medium containing streptomycin and ampicillin antibiotics, and a single colony was selected and cultured in a beaker containing amphicilin and connamycin antibiotic LB broth (10 mL), and cultured overnight at 30 ° C, 200 rpm. After inoculation into fresh LB medium (30 mL) containing streptomycin and ampicillin antibiotics, the initial cell density reached OD ₅₅₀ =0.08, followed by subculture at 30 ° C, 200 rpm, when the cell density reached OD ₅₅₀ = Add 1 mM IPTG at 0.3 to induce production of recombinant AHL, followed by cell density up to OD ₅₅₀ = 1.5 (early logarithmic growth phase), OD ₅₅₀ = 3.0 (mid-log phase) or OD ₅₅₀ = 4.5 (late logarithmic growth phase) At the same time, the culture temperature was increased from 30 ° C to 42 ° C, and after one hour, the temperature was further raised to 37 ° C to continue the culture to induce a bacteriostatic effect. After the fermentation time is over, the culture solution is centrifuged at 4 ° C and 6000 rpm using a centrifuge, and then the supernatant liquid is recovered (ie, the culture solution), and 15 μL of the culture solution is analyzed by SDS-PAGE according to the procedure of "general experimental method". The soluble protein contained in the medium shown in Figure 13 is that the recombinant AHL cannot be detected in the culture medium without the addition of the IPTG inducer (diameter 1), but the medium in which the IPTG inducer is added but not subjected to temperature induction is included ( Path 2) only a very small amount of recombinant AHL was detected, but a large amount of recombinant AHL (path 3-5) accumulated in the culture solution after temperature induction. According to SDS-PAGE, the release rate of the target protein is analyzed, which is defined as: (the mass of the target protein in the culture solution) / (the mass of the target protein in the culture solution + the mass of the target protein remaining in the intracellular medium); In (A), it can be known that when the temperature is induced in the early logarithmic growth phase of the strain, the AHL release rate is 87%; when the temperature is induced in the mid-log phase growth phase of the strain, the AHL release rate can reach 93%; When the temperature induction effect was carried out in the late logarithmic growth phase of the strain, the AHL release rate was 70%. After detecting the activity of AHL enzyme released from the culture solution, the results showed that the enzyme activity of AHL released into the culture solution was 400, 1990, 2840 U/L, respectively, when the temperature induction effect was applied to the early, middle and late logarithmic growth phases of the strain. . Combining the above results, it is sufficient to show that the nucleic acid construct of the present invention has an excellent bactericidal effect, and can effectively induce the release of the intracellular protein of the strain regardless of the growth period of the strain.

Example 12: Using a temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E to release a recombinant protein produced intracellularly

As shown in Example 9, the temperature-inducing recombinant nucleic acid construct pCL*H- φ XT4E can induce a bacteriostatic effect at a high temperature in the late stage of cell growth, and a large amount of recombinant protein can be accumulated in the late stage of production cell growth, so that Increase the extracellular release of recombinant protein after bacteriostatic. In order to detect the efficiency of the recombinant protein released intracellularly by this system, the production of A. radiobacter NRRL B11291 hydantoinase (HDT) is used as an example, and the "general experimental method" is used to induce the temperature-inducing recombinant nucleic acid construct pPL. *H- φ XT4E and plastid pChHDT (Chern JT and Chao YP. 2005, J. Biotechnol. 117:267-275), in which plastid pChHDT contains the T7 promoter-driven HDT gene, pMB1 plastid replication region (replication) Origin), anti-ampheparin antibiotic gene. At the same time, it was transformed into E. coli strain BL21 (DE3), cultured in solid medium containing streptomycin and ampicillin antibiotics at 30 ° C, and single colonies were selected and cultured in LB medium containing streptomycin and ampicillin antibiotics (10 mL). In a beaker, cultured overnight at 30 ° C, 200 rpm, inoculated into fresh LB medium (30 mL) containing streptomycin and ampicillin antibiotics, the initial cell density reached OD ₅₅₀ = 0.08, followed by 30 ° C, 200 rpm Subculture was carried out, and 1 mM IPTG was added when the cell density reached OD ₅₅₀ = 0.3 to induce the production of recombinant HDT, followed by cell density up to OD ₅₅₀ = 1.5 (early logarithmic growth phase), OD ₅₅₀ = 3.0 (intermediate logarithmic growth phase) Or when OD ₅₅₀ = 4.5 (late logarithmic growth phase), the culture temperature was increased from 30 ° C to 42 ° C, and after one hour, the temperature was further increased to 37 ° C to continue the culture to induce a bacteriostatic effect. After the fermentation time is over, the culture solution is centrifuged at 4 ° C and 6000 rpm using a centrifuge, and then the supernatant liquid is recovered (ie, the culture solution), and the 15 L culture medium is analyzed by SDS-PAGE according to the procedure of "general experimental method". The soluble protein contained in Fig. 14 shows that recombinant HDT could not be detected in the culture medium without the addition of IPTG inducer (diameter 1), but in the culture medium to which the IPTG inducer was added but not subjected to temperature induction (diameter) 2) Only a small amount of recombinant HDT can be detected. However, a large amount of recombinant HDT (path 3-5) is accumulated in the culture solution after temperature induction. According to SDS-PAGE, the release rate of the target protein is analyzed, which is defined as: (the mass of the target protein in the culture solution) / (the mass of the target protein in the culture solution + the mass of the target protein remaining in the intracellular medium); In (B), it can be known that when the temperature is induced in the early logarithmic growth phase of the strain, the AHL release rate is 84%; when the temperature is induced in the mid-log phase of the strain, the AHL release rate can reach 92%; When the temperature induction effect was applied to the late logarithmic growth phase of the strain, the AHL release rate reached 71%. After detecting the activity of AHL enzyme released from the culture solution, the results showed that the enzyme activities of AHL released in the culture solution reached 370, 1170, 1510 U/L, respectively, when the temperature induction effect was applied to the early, middle and late logarithmic growth stages of the strain. . Combining the above results, it is sufficient to show that the nucleic acid construct of the present invention has an excellent bactericidal effect, and can effectively induce the release of the intracellular protein of the strain regardless of the growth period of the strain.

Example 13: Method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct

(a) constructing a first nucleic acid construct comprising a first nucleic acid sequence and a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a bacteriophage ψX174 lytic gene E, the second nucleic acid sequence Included is a bacteriophage lysin gene; (b) constructs a plastid comprising a second nucleic acid construct, wherein the second nucleic acid construct further comprises a nucleic acid sequence of a heat sensitive inhibitory protein CI857 gene, a λ P _R P a nucleic acid sequence of the _L promoter, a nucleic acid sequence of a heat shock protein groEL promoter, and a nucleic acid sequence at a lacO control sub position; (c) implanting the first nucleic acid construct into the plastid to form a recombinant nucleic acid a construct; (d) transforming the recombinant nucleic acid construct formed in step (c) into a host bacterium to obtain a recombinant strain; (e) cultivating the recombinant strain in a medium at a temperature After the induction, the first nucleic acid construct is rendered to rupture the bacteria to release the intracellular material; (f) the recombinant strain of step (e) is released into the medium. The phage lysin gene described in the step (a) may be a T4 phage lysin gene or a T7 phage lysin gene. The substance obtained in the step (f) includes a recombinant protein, an insoluble inclusion, a retained intracellular substance, and a combination thereof. Wherein the recombinant protein comprises a protein, an enzyme, an antibody, a peptide, an amino acid, and combinations thereof. Wherein the recombinant protein is a recombinant enzyme. Wherein the temperature inducing action comprises increasing the culture temperature from the original culture temperature to between 38 and 42 degrees Celsius for at least thirty minutes, and then lowering the culture temperature to the original culture temperature. The original culture temperature may be 37 degrees Celsius.

Wherein the step (f) is to harvest the substances released into the medium by the recombinant strain, and further comprising the steps of: (1) implanting a nucleic acid construct containing a gene sequence of a specific gene product into the recombinant strain; And (2) cultivating the recombinant strain of the step (1) in a culture medium, and after the recombinant strain produces the specific gene product, a temperature induction effect is performed to cause the first nucleic acid construct to express the bacteria The rupture releases the intracellular material, which is then harvested in the medium.

<110> Feng Chia University

<120> A recombinant nucleic acid construct and method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct

<160> 11

<210> 1

<211> 4508

<212> DNA

<213> Artificial sequence

<220>

<223> pPL-φXE

<400> 1

<210> 2

<211> 4508

<212> DNA

<213> Artificial sequence

<220>

<223> pPL*-φXE

<400> 2

<210> 3

<211> 6216

<212> DNA

<213> Artificial sequence

<220>

<223> pCL*-φXEO

<400> 3

<210> 4

<211> 5872

<212> DNA

<213> Artificial sequence

<220>

<223> pET20bI-T4E

<400> 4

<210> 5

<211> 7013

<212> DNA

<213> Artificial sequence

<220>

<223> pCL*-φXT4E

<400> 5

<210> 6

<211> 7177

<212> DNA

<213> Artificial sequence

<220>

<223> pCL*H-φXT4E

<400> 6

<210> 7

<211> 5833

<212> DNA

<213> Artificial sequence

<220>

<223> pET20bI-T7E

<400> 7

<210> 8

<211> 7138

<212> DNA

<213> Artificial sequence

<220>

<223> pCL*H-φXT7E

<400> 8

<210> 9

<211> 283

<212> DNA

<213> Enterobacteria phage phiX174

<400> 11

<210> 10

<211> 498

<212> DNA

<213> Enterobacteria phage T4

<400> 10

<210> 11

<211> 459

<212> DNA

<213> Enterobacteria phage T7

<400> 9

Claims (12)

A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct, comprising the steps of: (a) constructing a first nucleic acid construct comprising a first nucleic acid sequence and a second a nucleic acid sequence, wherein the first nucleic acid sequence comprises a bacteriophage ψX174 lytic gene E, the second nucleic acid sequence comprises a bacteriophage lysin gene; (b) constructing a plastid comprising a second nucleic acid construct, wherein the second nucleic acid The construct further comprises a nucleic acid sequence of a heat sensitive inhibitory protein CI857 gene, a nucleic acid sequence of a λ P _R P _L promoter, a nucleic acid sequence of a heat shock protein groEL promoter, and a nucleic acid sequence at a lacO control position; (c) implanting the first nucleic acid construct into the plastid to form a recombinant nucleic acid construct, wherein the first nucleic acid construct is located in the nucleic acid sequence of the λ P _R P _L promoter, the heat shock protein groEL nucleic acid sequence downstream of a promoter and a nucleic acid sequence controlling the position of the lacO promoter and nucleic acid sequence by λ P _R P _L promoter, the heat shock protein groEL promoters and promoter control the lacO The nucleic acid sequence is co-regulated; (d) the recombinant nucleic acid construct formed in the step (c) is transformed into a host bacterium to obtain a recombinant strain; (e) the recombinant strain is cultured in the medium Passing a temperature-inducing action such that the first nucleic acid construct behaves to rupture the bacteria to release the intracellular material; and (f) the recombinant strain released in step (e) is released into the medium Wherein the phage ψX174 lytic gene E is SEQ ID NO: 9, and the phage lysin gene is SEQ ID NO: 10 or SEQ ID NO: 11. The method for rapidly recovering an amino acid composition using the recombinant nucleic acid construct according to the first aspect of the invention, wherein the phage lysin gene according to the step (a) is a T4 phage lysin gene, T7. Phage lysin gene. A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct according to claim 1, wherein the material obtained in the step (f) comprises a recombinant protein and an insoluble inclusion body (inclusion) ), a substance that is trapped inside the cell, and a combination thereof. A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct as described in claim 3, wherein the recombinant protein comprises a protein, an enzyme, an antibody, a peptide, an amino acid, and a combination thereof. A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct as described in claim 4, wherein the recombinant protein is a recombinant enzyme. A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct according to claim 1, wherein the temperature inducing action comprises increasing the culture temperature from a raw culture temperature to between 38 and 42 degrees Celsius. Maintain at least thirty minutes and then reduce the culture temperature to the original culture temperature. A method for rapidly recovering an amino acid composition using a recombinant nucleic acid construct as described in claim 6, wherein the original culture temperature is 30 degrees Celsius. The method for rapidly recovering an amino acid composition using the recombinant nucleic acid construct according to the first aspect of the invention, wherein the step (f) is to harvest the substances released into the medium by the recombinant strain, and further includes Step: (1) implanting a nucleic acid construct containing a gene sequence of a specific gene product into the recombinant step And (2) cultivating the recombinant strain of step (1) in a culture medium, and after the recombinant strain produces the specific gene product, performing a temperature induction to cause the first nucleic acid construct to be expressed, The bacteria are ruptured to release intracellular material, and then the specific gene product in the medium is harvested. A recombinant nucleic acid construct comprising a bacteriophage ψX174 lytic gene E nucleic acid sequence; a phage T7 lysozyme gene nucleic acid sequence; a heat-sensitive repressor protein CI857 gene nucleic acid sequence; a nucleic acid sequence of a λ P _R P _L promoter; a nucleic acid sequence of a heat shock protein groEL promoter; and a nucleic acid sequence at a lacO control sub position; wherein the nucleic acid of the λ P _R P _L promoter The sequence, the nucleic acid sequence of the heat shock protein groEL promoter, and the nucleic acid sequence of the lacO promoter position are located upstream of the recombinant nucleic acid construct, and collectively control the expression of the nucleic acid sequence downstream of the phage ψX174 lytic gene E or Expression of the nucleic acid sequence of the bacteriophage T7 lysozyme gene. The recombinant nucleic acid construct of claim 9, wherein the bacteriophage ψX174 lytic gene E has the nucleic acid sequence of SEQ ID NO: 9, and the bacteriophage T7 lysozyme gene has the nucleic acid sequence of SEQ ID NO: 11 . A recombinant nucleic acid construct comprising: a nucleic acid sequence of a bacteriophage ψX174 lytic gene E; a nucleic acid sequence of a bacteriophage T4 lysozyme gene; a nucleic acid sequence of a heat-sensitive repressor protein CI857 gene a nucleic acid sequence of a λ P _R P _L promoter; a nucleic acid sequence of a heat shock protein groEL promoter; and a nucleic acid sequence at a lacO control sub position; wherein the λ P _R P _L promoter The nucleic acid sequence, the nucleic acid sequence of the heat shock protein groEL promoter, and the nucleic acid sequence of the lacO promoter position are located upstream of the recombinant nucleic acid construct, and collectively control the performance of the nucleic acid sequence downstream of the phage ψX174 lytic gene E or Expression of the nucleic acid sequence of the bacteriophage T4 lysozyme gene. The recombinant nucleic acid construct of claim 11, wherein the bacteriophage ψX174 lytic gene E has the nucleic acid sequence of SEQ ID NO: 9, and the bacteriophage T4 lysozyme gene has the nucleic acid sequence of SEQ ID NO: 10. .