TWI458733B - Self-competitive primer and method of use - Google Patents

Description

Self-competitive primer and method of using this self-competitive primer

The present invention relates to methods and primer sets for detecting variation. In particular, the present invention relates to a self-competing primer that can be used to preferentially amplify a sample nucleic acid having a nucleotide variation.

A gene mutation refers to a change in the nucleotide sequence of a particular gene or regulatory sequence compared to a native (or normal) nucleotide sequence. The mutation may be a point mutation (ie, a single nucleotide substitution), a deletion or insertion of one or more nucleotides, a substitution of a plurality of nucleotides, or a chromosome level. Crossing-over.

In the field of molecular genetics, identifying genetic mutations or nucleotide variations is critical. For example, many genes are known to be closely related to the occurrence and/or progression of cancer, and the medical community is attempting to develop molecular targets for such genes. Sequence variation of one or more of the target genes may affect the therapeutic effect when performing targeted therapy. Therefore, detecting one or more genetic mutations in cancer cells helps to design a treatment plan that is most suitable for a particular patient.

A variety of techniques have been developed to detect genetic mutations or nucleotide variations. For example, Sanger's direct sequencing can be used to sequence a target sequence to know one or more nucleotides in which a mutation has occurred. However, the sensitivity of such direct sequencing is not high, and the operation is time consuming and laborious, thus limiting the application of this technology in clinical and research fields.

Alternatively, primers and/or probes specific for nucleotide variation sequences can be used to detect such mutations in the forward direction. Traditionally, when designing a primer or probe to detect a mutation, the sequence of the mutation must be known. For example, allele specific oligonucleotide-polymerase chain reaction (ASO-PCR), which is commonly used to detect gene mutations, requires specificity for wild-type or mutant sequences. The primer is used to determine whether there is a mutant sequence by whether or not an amplification reaction can be performed. One of the disadvantages of ASO-PCR is that its specificity is usually not high, resulting in a higher false positive ratio. In addition, when the specificity is low, the sample nucleic acid which should not be amplified is erroneously amplified, and the primer sequence is introduced into the amplification product, so that the sequence of the amplification product and the true sequence of the sample nucleic acid are obtained. different. Wrong amplification of the sample nucleic acid can make subsequent confirmation steps (such as sequencing) meaningless because the amplification product at this time does not reflect the true sequence of the sample nucleic acid. In addition, in the ASO-PCR method, only one primer can be used in one reaction system, and thus only one sequence (wild type or mutant type) can be detected at a time. Therefore, when multiple nucleotide variations are likely to occur at the same position, multiple primers must be designed to ensure that all of the mutant sequences are covered and that independent responses must be performed to correctly detect all mutations.

Another commonly used detection technique is the ligase chain reaction (LCR), which is often combined with other amplification-based reactions such as PCR. LCR uses a thermostable ligase and two sets of primers. Each primer set contains two primers. When the two primers are in close proximity to each other, they are joined by the zygozyme and can be used. Identify single nucleotide variations (such as point mutations, single nucleotide deletions, and single nucleotide insertions). LCR has its own advantages, but it cannot be used to detect mutant sequences with multiple nucleotide variations.

What's more, when used in the diagnosis of diseases, samples taken from living tissues may contain both wild-type cells and mutant cells. When conceivable, the number of wild-type cells is usually much higher than that of mutant cells, which may affect the amplification and detection of mutant sequences.

In view of the above problems, related technologies need to propose a method for correctly detecting nucleotide variation, including single nucleotide and polynucleotide variation.

SUMMARY OF THE INVENTION The Summary of the Disclosure is intended to provide a basic understanding of the present disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an SUMMARY OF THE INVENTION The Summary of the Disclosure is intended to provide a basic understanding of the present disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an

The present invention is based, at least in part, on a novel primer design that allows for preferential amplification of nucleic acids with variant sequences (as compared to reference nucleic acids) during amplification, and thus can be used to detect nucleosides Acidic variation.

One aspect of the present invention relates to a self-competitive primer that is available A sample nucleic acid having a nucleotide variation is preferentially amplified with or without a nucleotide variation in a selected region based on the same nucleic acid as compared to a selected region of a reference nucleic acid.

According to an embodiment of the invention, the self-competitive primer comprises a 5'-competition domain and a 3'-extension domain. The 5'-competing domain comprises a sequence complementary to a first region of a reference nucleic acid, wherein the first region comprises a selected region of the reference nucleic acid and at least one nucleotide residue immediately downstream of the selected region. The 3'-extension domain comprises a sequence complementary to a second region of a reference nucleic acid, wherein the second region is downstream of the selected region of the reference nucleic acid and does not comprise the selected region; further, the first region is There is at least one nucleotide overlap with the second region. The 3'-extension domain can be used as a forward primer in a PCR amplification reaction, and can preferentially amplify a nucleotide with respect to a sample nucleic acid having no nucleotide variation (ie, a non-variant sample nucleic acid) A mutated sample nucleic acid (ie, a variant sample nucleic acid).

According to some embodiments of the invention, the self-competitive primer described above is a non-chimeric primer. In other alternative embodiments, the self-competitive primer described above is a chimeric primer.

In various embodiments of the invention, the last nucleotide of the 3'-extension domain is complementary to a nucleotide residue located 1-37 nucleotides downstream of a selected region of the reference nucleic acid.

According to some embodiments of the present invention, the 5'-competition domain and the 3'-extension domain of the self-competitive primer can be directly or indirectly connected through a 3'-5' linkage or a 5'-5' linkage. . In the case of this two-domain direct link, the self-competitive primer consists of a 5'-competition domain and a 3'-extension domain. In an alternative reality In the embodiment, the self-competitive primer may further comprise a nucleosidic linker or a non-nucleosidic linker to link the 5'-competition domain to the 3'-extension domain. Illustrative examples of non-nucleoside chains can be peptides, carbohydrates, lipids, fatty acids, C2-C18 alkyl linkers, phosphate groups, phosphate esters, phosphites. (phosphoramidite), poly(ethylene glycol) linker, ethylene glycol chain, branched alkyl linker, glycerol or heterocyclic moiety. In one embodiment of the invention, a C3 spacer (C3 spacer) is used as the non-nucleoside chain.

In one embodiment, the sequence of the 5'-competition domain of the self-competitive primer is GGTAGTTGGAGCTGGTGGCG (SEQ ID NO: 1), the sequence of the 3'-extension domain is GAATATAAACTTGTGGTAGTTGG (SEQ ID NO: 2), and the 5'-competition domain is The 3'-extension domain is linked by a C3 spacer. In another embodiment, the sequence of the 5'-competition domain of the self-competitive primer is ACCGTGCAGCTCATCACGCAG (SEQ ID NO: 8), the sequence of the 3'-extension domain is CTCACCTCCACCGTGCA (SEQ ID NO: 9), and 5'-competition The domain and the 3'-extension domain are linked by a C3 spacer.

One aspect of the present invention relates to a PCR-based amplification method that preferentially amplifies a variant sample nucleic acid based on whether a nucleotide region variation (selected relative to a selected region of a reference nucleic acid) is present in a selected region of the same nucleic acid. .

According to an embodiment of the present invention, the amplification method comprises an amplification step of amplifying a sample nucleic acid using a self-competitive primer according to the above aspect/embodiment of the present invention, thereby causing a sample nucleic acid having a nucleotide variation (ie, a variant sample nucleic acid) can be preferentially amplified relative to a sample nucleic acid that does not have a nucleotide variation (ie, a non-variant sample nucleic acid).

Yet another aspect of the invention is directed to a PCR-based detection method that can be used to detect whether a nucleotide region variation (as compared to a selected region of a reference nucleic acid) is present in a selected region of the same nucleic acid.

According to an embodiment of the invention, the detecting method comprises an amplifying step and a detecting step. In the amplification step, the self-competitive primer according to the above aspect/embodiment of the present invention is used to amplify the sample nucleic acid to generate an amplification product; thereafter, in the detecting step, it is determined whether a nucleus is present in the selected region of the sample nucleic acid. Glycosidic variation.

In one embodiment, the detecting step comprises sequencing the amplification product. Additionally or alternatively, the detecting step comprises quantifying an amplification product having a nucleotide variation in the selected region and/or an amplification product having no nucleotide variation in the selected region.

The basic spirit and other objects of the present invention, as well as the technical means and implementations of the present invention, will be readily apparent to those skilled in the art of the invention.

The description of the embodiments of the present invention is intended to be illustrative and not restrictive. The features of various specific embodiments, as well as the method steps and sequences thereof, are constructed and manipulated in the embodiments. However, it can also be used His specific embodiments are to achieve the same or equivalent functions and sequence of steps.

The scientific and technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention pertains, unless otherwise defined herein. In addition, the singular noun used in this specification covers the plural of the noun in the case of no conflict with the context; the plural noun of the noun is also included in the plural noun used. Also, words such as "at least one" and "one or more" are used herein to include one, two, three or more.

Although numerical ranges and parameter boundaries are used to define a broad range of the present invention, the relevant values of the specific embodiments are presented as precisely as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range. Alternatively, the term "about" means that the actual value falls within the acceptable standard deviation of the average, depending on the considerations of those of ordinary skill in the art to which the invention pertains. Except for the experimental examples, or unless otherwise explicitly stated, all ranges, quantities, values, and percentages used herein are understood (eg, to describe the amount of material used, the length of time, the temperature, the operating conditions, the quantity ratio, and the like. Are all modified by "about". Therefore, unless otherwise indicated to the contrary, the numerical parameters disclosed in the specification and the appended claims are intended to be At a minimum, these numerical parameters should be understood as the number of significant digits indicated and the values obtained by applying the general carry method.

In the present specification, "sample" means any sample containing nucleic acid. The sample may be a "biological sample", which comprises the following components or Subsidiary: Separation of cells, tissues or components (such as body fluids) from animals or plants. The above animals are preferably human. In this specification, a biological sample contains clinical samples taken from an individual in need of medical treatment. Exemplary biological samples include, but are not limited to, samples derived from blood, saliva, sputum, urine, feces, skin cells, hair follicles, semen, vaginal fluid, bone fragments, bone marrow, brain components, cerebrospinal fluid, Amniotic fluid and tissue sections. It will be understood that these illustrations are not intended to limit the types of samples that are deemed suitable for use in the present invention.

The term "nucleic acid" as used herein refers to two or more nucleotides, nucleosides or nucleobases such as deoxyribonucleotides or ribonucleosides. A chain molecule formed by a glycoside. Nucleic acids include, but are not limited to, genetic or part of DNA or RNA viruses; bacterial genomes or parts thereof; fungal, plant or animal genomes or parts thereof; messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA ( tRNA), plastid DNA, granulocyte DNA or synthetic DNA or RNA. The nucleic acid can be linear (e.g., mRNA), circular (e.g., plastid) or branched; and can also be in a double-stranded or single-stranded form.

Here, "nucleotide" is a subunit of a nucleic acid, and is a compound composed of a heterocyclic base, a sugar, and one or more phosphate groups. The most common nucleotides are bases of purine or pyrimidine derivatives, while saccharides are pentose deoxyribose or pentose ribose. Common sputum has adenine (A) and guanine (G); common pyrimidines have cytosine (C), thymine (thymine, T) With uracil (U).

The "sequence" of a nucleic acid as used herein refers to the ordering of the nucleotides that make up a nucleic acid. In the present specification, a nucleic acid has a 5 ' end and a 3 ' end; unless otherwise stated, the left-hand end of the single-stranded nucleotide sequence is the 5 ' end; and the right-hand end is the 3 ' end. The term "downstream" refers to a nucleotide sequence located in the 3 ' direction of the nucleotide sequence; and the term "upstream" refers to 5 ' of the nucleotide sequence. A nucleotide sequence in the direction.

As used herein, the term "variant" refers to a change in one or more nucleotides of a reference nucleic acid molecule; the above alteration comprises the insertion of one or more new nucleotides, A deletion of one or more nucleotides or a substitution of one or more of the existing nucleotides. Broadly speaking, the term "nucleotide variation" encompasses point mutations, multiple point mutations, single nucleotide polymorphism (SNP), deletions, insertions, and translocations.

The term "reference nucleic acid" as used herein refers to a sequence of nucleotides that is a known reference sequence of interest. The above reference sequence may be a "wild type" (or "non-mutant" or "normal") sequence with no mutations in selected regions. Alternatively, the reference sequence can be a mutated sequence. It is conceivable for those of ordinary skill in the art to recognize that when a wild-type sequence is included in a selected region of a reference nucleic acid, the variant sample nucleic acid can be any mutated sequence. Alternatively, the variant sample nucleic acid can be a wild type sequence or any other mutated sequence when a known mutated sequence is present in a selected region of the reference nucleic acid. In the case where the reference nucleic acid is in the form of a double strand, the coding strand Sequences with either of the template strands can be used as reference sequences.

As used herein, "sample nucleic acid" refers to a nucleotide sequence that is intended to be used to probe for a change in one or more of its "selected regions." In the case where the sample nucleic acid is double-stranded DNA, it comprises a coding strand and a template complementary to the coding strand, wherein the sequence of the encoded strand is arranged from 5' to 3', and the sequence of the template strand is from 3' to Arranged in the direction of 5'. In the present specification, there is at least one nucleotide variation in a selected region of the "variant sample nucleic acid" which is compared to a selected region of the reference sequence. Here, when the sequence of the selected region of the sample nucleic acid is identical to the sequence of the selected region of the reference nucleic acid, the sample nucleic acid is also referred to as a "non-variant sample nucleic acid."

The term "introduction" as used herein refers to a single nucleotide sequence in which the primer is in an appropriate environment (eg, with appropriate buffers, salts, temperature, and/or pH) and the presence of nucleotides in the environment and When used for components of nucleic acid polymerization (eg, DNA-dependent polymerase or RNA-dependent polymerase), the primer can serve as a primer to extend the synthesis starting point of the product. In general, the sequence of the primer is substantially complementary to the nucleic acid strand to be replicated; or the primer comprises at least one region that is sufficiently complementary to the nucleic acid strand to be replicated to be capable of binding, and is initiated 5 ' from the primer 3 ' direction chain extension. The above primer may be a DNA primer, an RNA primer or a chimeric DNA/RNA primer. In most, but not necessary, primers are short synthetic nucleic acids, typically from about 12 to about 100 nucleotides in length; preferably from about 30 to about 60 nucleotides.

"hybridization" and "annealing" Alternately used herein, and refers to a dinucleotide sequence having sufficient complementarity to form a complex or hybrid via Watson-Crick base pairing or other non-formal pairing. Hybrid. Hybridization can occur between two strands of DNA, between two strands of RNA, or between one strand of DNA and one strand of RNA. Hybridization can occur under a variety of suitable conditions (such as temperature, pH, salt concentration, etc.) that are well known in the art of molecular biology.

As used herein, the term "amplification" refers to a method or process that increases the amount of a particular nucleotide sequence in a sample. Polymerase chain reaction (PCR) is an amplification reaction well known in the relevant art, and the PCR process used herein will be further detailed below. Here, the terms "reaction mixture" and "mixture" are used interchangeably to refer to a composition that can be used in subsequent polymerase chain reaction reactions.

By "preferred amplification of a variant sample nucleic acid" is meant herein the promotion of amplification of a variant sample nucleic acid and the inhibition of amplification of a non-mutated nucleic acid. It will be understood that, in accordance with the principles and spirit of the present invention, when both mutated and non-variant sample nucleic acids are present in the reaction mixture, both sample nucleic acids are amplified by the action of a self-competitive primer. However, based on the innovative primer design here, the amplification efficiency of the variant sample nucleic acid is much higher than that of the non-variant sample nucleic acid. Therefore, even when the content of the variant sample nucleic acid accounts for only a small portion of the content of the non-variant sample nucleic acid in the reaction mixture, the primers and methods provided by the present invention can correctly amplify the variant sample nucleic acid to The amount of detection.

In order to provide a way to prioritize amplification (and thus detect) A method of selecting a sample nucleic acid having one or more nucleotide variations in a region, wherein a self-competitive primer is designed which has two functional domains (ie, a 5'-competition domain and a 3'-extension domain) capable of Bind to different but overlapping regions of the sample nucleic acid, respectively. Detailed information on this self-competitive primer and related methods is provided below.

(I) Self-competitive primer

The introduction design proposed herein will be described with reference to Figs. 1A to 1C to understand the contents of the present invention. It is to be understood that the sequences shown in the Figures 1A to 1C are for illustration of the present invention and are merely illustrative; therefore, the scope of the patent application is not limited by these sequences.

The reference nucleic acid 200 exemplified in FIG. 1A includes the first to 40th nucleosides of exon 1 of the human rat sarcoma viral oncogene homolog (vRAS) vaginal viral oncogene homolog (KRAS) gene. acid. The coding strand and template strand sequences of this reference nucleic acid 200 are 5'-ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCG-3' (SEQ ID NO: 3) and 3'-TACTGACTTATATTTGAACACCATCAACCTCGACCACCGC-5' (SEQ ID NO: 4), respectively. For the purposes of discussion, the sequence of the template strand is selected as the sequence of reference nucleic acid 200 in the description below. In the context of the present specification, a region is selected in reference nucleic acid 200 to investigate whether or not one or more polynucleotide variations are present in this selected region 215. In the present embodiment, the sequence of the selected region 215 in the reference nucleic acid 200 (template strand) is 3'-TCGACCACC-5' (SEQ ID NO: 5, the 30th to 38th nucleotide of KRAS exon 1, 1A The figure is marked with a bold bottom line).

Theoretically, the nucleotide length of the selected region to be explored is not particularly limited. According to a non-essential embodiment of the invention, the selected region can carry up to 20 nucleotides. For example, the selected region can be about 1, 5, 10, 15, or 20 nucleotides in length.

In order to provide a means of detecting nucleotide variation in a selected region, the self-competitive primer designed has two functional domains that are hybridized to different but overlapping regions of the reference nucleic acid, respectively. This self-competitive primer is described in further detail below.

The self-competing primer set forth herein comprises a 5'-competition domain and a 3'-extension domain, which are complementary to the first region and the second region, respectively, of the reference nucleic acid. The above 3'-extension domain can be used as a forward primer, and can preferentially amplify a sample nucleic acid having a nucleotide variation (ie, a variant sample nucleic acid) during PCR-based sample nucleic acid amplification, and the preferential amplification An increase is relative to a sample nucleic acid that does not have a nucleotide variation (ie, a non-variant sample nucleic acid).

The first region comprises a selected region and at least one nucleotide residue immediately downstream of a selected region of the reference nucleic acid such that in a suitable hybrid environment, the 5'-competition domain can be adjacent to the selected region and at least one adjacent Nucleotide hybridization. Optionally, the nucleotide residues immediately downstream of the selected region may be at least 1 to 20 nucleotide residues. In another optional embodiment, the first region may further comprise at least one nucleotide residue immediately upstream of the selected region. Also optionally, the nucleotide residue immediately upstream of the selected region of the nucleotide residue may be at least 1 to 20 nucleotide residues. According to the invention In certain embodiments, the 5'-competing domain described above can be 15-40 nucleotides in length.

The sequence of the 5'-competition domain 110 of the self-competitive primer 100 exemplified in FIG . 1A is GGTAGTTGG AGCTGGTGG CG (SEQ ID NO: 1, corresponding to the 21st to 38th nucleotides of wild type KRAS exon 1, this specification The selected area 115 (Fig. 1A) is marked with an italic and a bold bottom line respectively in the drawing. The sequence of this 5'-competition domain 110 is complementary to the sequence of the first region 210 of the reference nucleic acid 200, wherein the first region 210 comprises a selected region 215 of the template strand of the reference nucleic acid 200, 9 downstream nucleotides, and two upstream Nucleotide.

The second zone is located downstream of the selected zone. More specifically, the 3' end of the second region is located at least one nucleotide downstream of the 5' end of the selected region, and thus, the second region does not encompass a selected region of the reference nucleic acid. In an alternative embodiment, the 3' end of the second region is located at least 1 to 20 nucleotides downstream of the 5' end of the selected region. According to some embodiments of the invention, the 3'-extension domain described above may be 15-40 nucleotides in length.

Furthermore, the first region and the second region should have at least one nucleotide overlap with each other to promote preferential amplification of the variant sample nucleic acid. Thus, the 3'-extension domain and the 5'-competition domain compete with each other for overlapping one or more nucleotides in a suitable hybrid environment to hybridize to the sample nucleic acid. In certain optional embodiments, the first region and the second region have an overlap of 1-38 nucleotides from each other.

As shown in Figure 1A, the sequence of the exemplary 3'-extension domain 120 is GAATATAAACTTGTGGTAGTTGG (SEQ ID NO: 2, corresponding to the 7th to 29th nucleotides of wild type KRAS exon 1), this sequence is The second region 220 of the reference nucleic acid 200 is complementary. In particular, the second region 220 described above comprises 23 contiguous nucleotide residues immediately downstream of the selected region 215 of the template strand of the reference nucleic acid 200. In the present illustration, the last 9 nucleotides of the 3'-extension domain 120 from the 5' end are identical to the first 9 nucleotides of the 5'-competition domain 110 from the 5' end.

According to various embodiments of the invention, the 5'-competition domain and the 3'-extension domain can be joined together by a common 3'-5' linkage or a less common 5'-5' linkage. The 5'-competition domain 110 and the 3'-extension domain 120 illustrated in Fig. 1A are connected by a 3'-5' chain.

According to an optional embodiment, the 5'-competition domain is directly linked to the 3'-extension domain. Alternatively, a linker chain can be introduced between the 5'-competition domain and the 3'-extension domain. The above linker may be a nucleoside chain or a non-nucleoside chain. A nucleoside chain consists of one or more nucleotides (such as A, T, C, G or U, or other less common nucleotides). Non-limiting examples of non-nucleoside chains can be peptides, carbohydrates, lipids, fatty acids, C2-C18 alkyl chains, phosphates, phosphates, phosphites (eg spacers, phosphites 9, spacers) Phosphonamide 18, spacer phosphite C3, spacer C12 CE phosphite and pyrrolidine-CE phosphite, polyethylene glycol chain, ethylene glycol chain, side chain alkyl chain , glycerol or heterocyclic group. The self-competitive primer 100 shown in Fig. 1A uses a non-nucleoside chain C3 spacer 130 to connect the 3' end of the 5'-competition domain 110 and the 5' end of the 3'-extension domain 120.

According to some embodiments, the self-competitive primer can be a non-chimeric primer, in which case the 5'-competition domain, the 3'-extension domain, and the nucleoside chain (if any) are deoxyribose Nucleotide sequence or ribonucleotide sequence. for example, The self-competitive primer 100 shown in Fig. 1A is a non-chimeric primer, and its 5'-competition domain and 3'-extension domain are composed of DNA bases and do not contain a nucleoside chain.

In certain alternative embodiments, the self-competitive primer can be a chimeric primer, wherein the nucleotides of one of the 5'-competition domain, the 3'-extension domain, and the nucleoside chain (if any) The sequence type is different from the rest. By way of illustration and not limitation, a chimeric self-competitive primer can be in any of the following forms: a DNA type 5'-competing domain is directly linked to an RNA type 3'-extension domain, a DNA type 5'-progression domain is passed through a non-nucleoside chain or The nucleoside chain is indirectly linked to the RNA type 3'-extension domain, the RNA type 5'-competition domain is directly linked to the DNA type 3'-extension domain, and the RNA type 5'-competition domain is indirectly through the non-nucleoside chain or the nucleoside chain. Linking to the DNA type 3'-extension domain, the DNA type 5'-competition domain is indirectly linked to the DNA type 3'-extension domain via the RNA strand, and the RNA type 5'-competition domain is indirectly linked to the RNA type 3'-extension through the DNA strand Domain and so on.

It will be appreciated that the self-competing primers proposed by the present invention are designed such that chain extension (i.e., the addition of nucleotides to a new DNA strand) begins only with the 3' end of the 3'-extension domain, while utilizing 5' - The chain extension reaction of the competition domain as a starting point is inhibited. For the 5'-competition domain and the 3'-extension domain linked together by a traditional 3'-5' linkage, there is no prolonged response with a 5'-competition domain as the chain extension start point, because 5' - The 3'-hydroxyl group of the last nucleotide of the competition domain has been occupied.

Furthermore, the use of the chimeric self-competitive primer described above can also effectively prevent the prolongation reaction initiated by the 5'-competition domain. It is known to distinguish a polymerase into a DNA polymerase or an RNA polymerase depending on the type of template sequence. therefore, For chimeric self-competitive primers, the type of polymerase can be selected depending on the type of 3'-extension domain, thereby achieving the purpose of inhibiting the 5'-competition domain elongation. For example, if the 5'-competition domain consists of RNA bases and the 3'-extension domain consists of DNA bases, the DNA polymerase will only start from the 3' end of the 3'-extension domain. extend. Similarly, if the 5'-competition domain of a chimeric self-competitive primer consists of a DNA base and the 3'-extension domain consists of an RNA base, RNA polymerase can be used to initiate by 3'- Extend the chain extension process at the beginning of the domain.

Yet another exemplary method is to use a less common 5'-5' linkage in a self-competing primer to join the 5'-competition domain to the 3'-extension domain. In this case, if the self-competing primer is a non-chimeric primer, the 3' end of the 5'-competition domain should be modified to prevent chain extension from that point. As for the chimeric self-competitive primer, it is not necessary to carry out such modification at the 3' end of the 5'-competition domain. A non-nucleoside blocker can be utilized to modify the 3' end of the 5'-competition domain; such a non-nucleoside blocker such as a phosphate or phosphate. For example, 3'-propyl phosphate formed by 3'-spacer C3 controlled-pore glass (C3-CPG) is a very effective 3' non-nucleoside. Blocking. The formation of the reverse 3'-3' link by the last nucleotide of the 5'-competition domain at the 3' position can also effectively prevent the polymerase from extending the nucleotide because at its 3' position No hydroxyl groups are available for the initial synthesis reaction.

Another way to avoid polymerase elongation at the 3' end of the 5'-competition domain is to use a nucleosidic blocker, 2',3'-dideoxynucleoside (eg 2', 3'- ddC-CPG) or 3'-deoxynucleosides (eg 3'-dA-CPG, 3'-dC-CPG, 3'-dG-CPG or 3'-dT-CPG). Of course, other equivalent techniques that can be used to modify the 3' end of the primer can also be employed, and such other techniques are also within the scope of the invention.

In the following experimental examples, another exemplary self-competitive primer was proposed based on the above primer design scheme for the human epidermal growth factor receptor (EGFR) gene. The self-competitive primer contains a 5'-competition domain, the sequence of which is ACCGTGCAGCTCATCACGCAG (SEQ ID NO: 8); a C3 spacer; and a 3'-extension domain, the sequence of which is CTCACCTCCACCGTGCA (SEQ ID NO: 9).

(II) A method for preferentially amplifying a mutant sample nucleic acid compared to a non-variant sample nucleic acid

After a detailed introduction of the primer design proposed herein and the illustrated self-competitive primer, a PCR-based preferential amplification method using such a self-competitive primer is described.

It is understood by those of ordinary skill in the art that the biological sample for amplification may contain both wild-type sequences and mutations of a particular target gene. For example, in samples taken from biological tissues (such as tumors or lesions of other diseases), some mutant cells may be contained. In such cases, the mutated sequence (compared to the wild type sequence) may account for only a small portion, and most conventional PCR methods do not correctly amplify the mutated sequence to the extent that it can be used for subsequent sequencing or other qualitative analysis. One of the novel features of the present invention is that the self-competitive primer proposed herein allows for variation of the sample nucleic acid. The preferential amplification of a mutant sample nucleic acid (such as a wild-type sequence in the same biological sample) compared to a non-variant sample nucleic acid (such as a wild-type sequence in the same biological sample) allows the amount of the amplified sample nucleic acid to be amplified enough to be sequenced or detected. This property is particularly useful in fields such as cancer therapy because the genetic makeup of cancer cells can often be used to predict or indicate the progression of a disease and/or an appropriate treatment regimen. In addition, under the appropriate reaction conditions, the amplified product obtained by the method has the same sequence as the sample nucleic acid in the selected region, and no erroneous amplification occurs.

According to an embodiment of the invention, the PCR method for preferentially amplifying a variant sample nucleic acid in comparison to a non-variant sample nucleic acid comprises an amplification step; this step utilizes a self-competitive type according to the above aspect/embodiment of the invention A primer (such as, but not limited to, a self-competitive primer 100) is used to amplify the sample nucleic acid. Specifically, the amplification step comprises preparing a reaction mixture comprising the self-competing primer and the sample nucleic acid, and placing the reaction mixture under a PCR amplification condition. Generally, a selected region of the sample nucleic acid may or may not have a nucleotide variation (as compared to a reference nucleic acid). In accordance with the principles and spirit of the present invention, this method is applicable to situations where the variant sequence is known or unknown. For example, the above sample may contain the non-variant sample nucleic acid 300 illustrated in Figure 1B and the variant sample nucleic acid 300' illustrated in Figure 1C. The first region 310 (including the selected region 315) and the second region 320 of the non-variant sample nucleic acid 300 are both in sequence with the first region 210 (including the selected region 215) and the second region 220 of the reference nucleic acid 200 shown in FIG. the same. The selected region 315' of the variant sample nucleic acid 300' has a nucleotide variation compared to the selected region 215 of the reference nucleic acid 200 (both in Figure 1C) Marked in bold, bottom line and italic), thus the first region 310' sequence of the variant sample nucleic acid 300' is not identical to the first region 210 of the reference nucleic acid 200 and the first region 310 of the non-variant sample nucleic acid 300; The second region 320 of the sample nucleic acid 300' is identical to the second region 220 of the reference nucleic acid 200 and the second region 320 of the non-variant sample nucleic acid 300.

It will be understood by those of ordinary skill in the art to which the present invention pertains that other amplification reaction reagents may be included in the reaction mixture. These amplification reaction reagents for PCR may include, but are not limited to, buffers; reagents; reverse transcriptase activity, polymerase and/or exonuclease (reverse transcriptase) Exonuclease) enzymes; enzyme cofactors such as magnesium or manganese; salts; and deoxyribonucleotide triphosphates (dNTPs), such as deoxyadenosine triphosphate (dATP), Deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP) and deoxyuridine triphosphate , referred to as dUTP). A person skilled in the art can select an appropriate amplification reagent according to the PCR method used.

The reaction mixture is then subjected to a PCR treatment; this treatment sequentially includes a denaturation step, a binding step and an extension step;

In the denaturation step, the DNA duplex formed by the template strand and the cryptographic strand is denatured (i.e., melted). The exact denaturation of double-stranded DNA The process depends on its size, sequence and molecular composition (mainly the ratio of G-C bonds to A-T bonds or G-C%). At appropriate temperatures, double-stranded DNA typically denatures in less than one second, at temperatures between about 80 ° C (typically GC% lower and smaller molecules) to about 95 ° C (typically larger molecules, Between human genomic DNA); in some cases, the denaturation temperature may be lower.

After the denaturation step, the reaction mixture is cooled to the bonding temperature such that the 5'-competition domain and the 3'-extension domain of the self-competing primer are able to compete with each other for one of the sample nucleic acids (as shown in Figures 1A to 1C) In the examples, there is an opportunity for the template strand to adhere. It is understood by those of ordinary skill in the art that the two sequences that are heterozygous to each other do not necessarily need to be fully complementary. Please also refer to Figures 1B and 1C, in which case the 5'-competition domain 110 can be hybridized not only to the template strand of the non-variant sample nucleic acid 300, but also to the template strand of the variant sample nucleic acid 300'. However, compared to the hybrid formed by the 5'-competition domain 110 and the non-variant sample nucleic acid 300, the hybrid formed by the 5'-competition domain 110 and the variant sample nucleic acid 300' is less stable; thus by 5'- The hybrid formed by the competition domain 110 and the variant sample nucleic acid 300' is more susceptible to denaturation, thus giving the 3'-extension domain 120 a higher chance of binding to the variant sample nucleic acid 300' (as compared to the 3'-extension domain 120 bonding to Opportunities for non-variant sample nucleic acids 300). Thus, in the subsequent extension step, amplification of the variant sample nucleic acid 300' is promoted and amplification of the non-variant sample nucleic acid 300 is reduced. In the same reaction system, the amplification efficiency of the variant sample nucleic acid sequence 300' is increased, and the amplification efficiency of the non-variant sample nucleic acid sequence 300 is reduced, resulting in preferential amplification of the variant sample nucleic acid sequence 300'.

In an optional embodiment, the bonding step may comprise two stages, wherein the bonding temperature used in the first stage is higher than the bonding temperature used in the second stage.

After the bonding step, the temperature is adjusted to an extended temperature to allow the nucleotide to be extended. The desired extended temperature is well known in the art; in general, the extended temperature is about 70-80 °C. However, other factors may be employed after considering the relevant factors (such as the type of polymerase used).

The reaction mixture is then cycled between steps of denaturation, binding and elongation to continuously amplify the sample nucleic acid (including the variant and non-variant sample nucleic acids). The PCR treatments presented herein can be applied to any known PCR thermocycler and its equivalents. Furthermore, the PCR-based methods presented herein are compatible with most existing PCR processes. Thus, the method can be applied to a variety of PCR techniques including, but not limited to, asymmetric polymerase chain reaction (PCR), hot start PCR (hot start PCR), mini primer PCR (miniprimer PCR), Multiplex polymerase chain reaction (multiplex-PCR), nested polymerase chain reaction (nested PCR), real-time quantitative PCR polymerase chain reaction (RT-PCR), reverse transcription polymerase chain reaction (reverse transcription PCR), solid phase Polymer phase chain reaction (solid phase PCR) and decreasing polymerase chain reaction (touchdown PCR).

For example, the cycling conditions used in an experimental example of the present specification include: denaturation at about 95 ° C for about 10 minutes, followed by 45 cycles of denaturation (about 94 ° C, about 60 seconds), adhesion (about 60 ° C, about 60 seconds) and elongation (about 72 ° C, about 60 seconds), followed by about 10 minutes at about 72 ° C Finally extend the steps. The cycling conditions used in another experimental example (data not shown) included denaturation at about 95 ° C for about 10 minutes, followed by 45 cycles of denaturation (about 94 ° C, about 60 seconds), first adhesion (about 65). °C, about 180 seconds), second bond (about 57 ° C, about 60 seconds) and elongation (about 72 ° C, about 60 seconds), followed by a final extension step of about 10 minutes at about 72 ° C.

A further aspect of the invention is directed to a PCR-based method for determining whether a nucleotide region of a selected nucleic acid has a nucleotide variation as compared to a selected region of a reference nucleic acid.

According to an embodiment of the invention, the method includes an amplification step and a detection step. In the amplification step described, preferential amplification of the mutated sample nucleic acid is performed using a self-competing primer according to the method described above. Thereafter, in the detecting step, it is determined whether the selected region of the sample nucleic acid has or does not have a nucleotide variation.

For example, the PCR product obtained in the amplification step can be sequenced to confirm the sequence of the sample nucleic acid in the sample.

Various embodiments are set forth below to clarify some aspects of the present invention so that those skilled in the art can practice the invention. Therefore, these examples should not be construed as limiting the scope of the invention. The present invention is based on the description herein, and can be applied without excessive derivation. All documents mentioned herein are considered to be fully incorporated into this specification.

<Experimental Example I> Priority amplification of variant KRAS gene fragments

A total of 153 clinical samples were obtained from Ma Rong Hospital (Taiwan). The samples were collected from cancer patients and the samples were collected and informed by the patient. The sample is processed to isolate the nucleic acid molecules therein. In the initial experiments, the reagents used for PCR-based preferential amplification were as follows: PCR 2X Master Mix Buffer (JMR) 10 μl, 0.2 μM self-competitive primer (5'-competition domain: sequence number: 1; linkage chain: C3 Spacer; 3'-extension domain: SEQ ID NO: 2), 0.2 μM reverse primer (CCTCTATTGTTGGATCATA; SEQ ID NO: 6), DNA sample 100 ng, water added to a final volume of 20 μl. Further, conventional PCR was carried out under the same conditions using a conventional PCR forward primer (AGGCCTGCTGAAAATGACTG; SEQ ID NO: 7). The ABI 9700 PCR equipment was used for preferential amplification or conventional PCR. The cycling conditions used in the reaction were: denaturation temperature 95 ° C for 10 minutes; then temperature cycling was 94 ° C (60 seconds), 60 ° C (60 seconds) and 72 ° C ( 60 seconds), 45 cycles; finally extended at 72 ° C (10 minutes).

After the completion of the PCR, the same sample was taken out from the PCR tank and electrophoretically separated on the vegetable gum. Both the sample and the control mark were stained with ethidium bromide (EtBr) and developed by fluorescence detection while capturing images with a charge coupled device camera. The product strip on the agar extract is cut and the nucleic acid contained therein is sequenced to determine whether the sample contains a mutant strain. The sequencing results show that a total of 12 mutants located in a selected region of the KRAS gene (30-38 nucleotide residues of exon 1) can be preferentially amplified using the PCR-based preferential amplification method proposed herein, and thus Make these mutants detectable Table 1 summarizes the mutant sequences and mutation positions of these mutants. The wild type KRAS gene fragment comprises the coding sequence shown in SEQ ID NO: 3 (i.e., nucleotides 1 to 40 of exon 1 of the KRAS gene).

Table 2 summarizes the results of conventional PCR amplification and the preferential amplification proposed by the present invention. It is understood that the KRAS mutant sample described in Table 2 may contain both the KRAS mutant sequence KRAS and the wild type sequence or only the KRAS mutant sequence, while the KRAS wild type sample contains only the KRAS wild type sequence.

Direct sequencing results showed that 69 were confirmed after preferential amplification Among the samples of the KRAS mutant sequence, only 54 of them were detected by conventional PCR amplification; while among the 99 samples identified as KRAS wild type by conventional PCR amplification, 15 were preferentially amplified and directly sequenced. It was later confirmed as a KRAS mutant sample. From these results, the pseudo-positive ratio of the conventional PCR detection KRAS mutation was about 15%, and the detection sensitivity was about 78%. In contrast, all KRAS mutations and wild-type samples were correctly detected after preferential amplification as presented herein (false positive: 0%; false negative: 0%; sensitivity: 100%). As can be seen from this experimental example, the preferential amplification proposed by the present invention can be used to detect variant sequences in a sample such as a clinical sample.

The plastid DNA containing the KRAS mutation and the wild type sequence was separately purified and prepared into a stock solution (final concentration of 10 ⁵ copies of DNA per μL (μl)). The stock solution containing the KRAS mutation sequence was sequentially diluted to 10 ² -10 ⁵ parts/μl in multiples of 10, and then 1 μl of the diluted stock solution and 9 μl of the KRAS wild type stock solution (10 ⁵ parts/μl) were separately mixed and used as The amplified DNA samples are preferentially amplified and preferentially amplified as described above. The photograph of Fig. 2 shows the results of electrophoresis of KRAS mutant strains 4 and 12 shown in Table 1.

As shown in Fig. 2, the preferential amplification method proposed herein is capable of amplifying pure KRAS wild type samples and pure KRAS mutant samples, respectively. In Fig. 2, the first and second bands from the left are the molecular marker and the negative control group (no nucleic acid sample is added). It can be noted that in Fig. 2, the intensity of the pure KRAS mutant sample (the 4th and 5th bands from the left) is higher than that of the pure KRAS wild type sample (the 3rd band from the left). These results demonstrate that the methods presented herein preferentially amplify variant sample nucleic acids (e.g., KRAS mutants 4, 12 herein) relative to non-variant sample nucleic acids (e.g., KRAS wild type samples herein).

In a mixture containing a KRAS wild type sequence and a KRAS mutant sequence (mutant 4 or 12), the method also preferentially amplifies the KRAS mutant sequence relative to the KRAS wild type sequence, thereby allowing the KRAS mutant sequence to be amplified. A sufficient level for subsequent direct quantification. It can be observed in Figure 2 that as the concentration of the KRAS mutation sequence in the reaction mixture gradually increases, the intensity of the product band becomes stronger (see bands 6-9 and 10-13 from the left). Since the concentration of the non-variant sample nucleic acid (i.e., the KRAS wild type sequence) in these samples is fixed, it can be inferred that the increase in intensity should be the preferential amplification of the variant sample nucleic acid (in this case, the KRAS mutant sequence). Caused.

<Experimental Example II> Priority amplification of variant EGFR gene fragments

A total of 179 clinical samples were obtained from Ma Rong Hospital (Taiwan). The samples were collected from cancer patients and the samples were collected and informed by the patient. The sample is processed to isolate the nucleic acid molecules therein. In the initial experiments, the reagents used for PCR-based preferential amplification were as follows: PCR 2X Master Mix Buffer (JMR) 10 μl, 0.2 μM self-competitive primer (5'-competition domain: SEQ ID NO: 8; Linker: C3 Spacer; 3'-extension domain: SEQ ID NO: 9), 0.2 μM reverse primer (CAAACTCTTGCTATCCCAGGAG; SEQ ID NO: 13), DNA sample 100 ng, water added to a final volume of 20 μl. Further, conventional PCR was carried out under the same conditions using a conventional PCR forward primer (GAAACTCAAGATCGCATTCATG; SEQ ID NO: 14). The cycle conditions used in the reaction were the same as described in Experimental Example I above.

In the present example, the wild-type EGFR gene fragment (ie, 2344 to 2373 nucleotides of the EGFR gene) comprises the sequence shown in SEQ ID NO: 10 (5'-CTCACCTCCACCGTGCAGCTCATCACGCAG-3'; coding strand), and the sequence No.: 11 (3'-GAGTGGAGGTGGCACGTCGAGTAGTGCGTC-5'; template strand), wherein the sequence of the selected region of the EGFR gene fragment (2361-2370 nucleotide residues) is 3'-CGAGTAGTGC-5' ( Serial number: 12).

After the completion of the PCR reaction, the amplification product was treated according to the method described in Experimental Example I above, and the sequencing results showed that the PCR method proposed herein was used first. The amplification method can preferentially amplify a total of 5 mutant strains located in selected regions of the EGFR gene (2361-2370 nucleotide residues), and thus these EGFR mutant strains can be detected; Table 3 summarizes these Mutation sequences and mutation positions of EGFR mutants. .

Table 4 summarizes the results of conventional PCR amplification and the preferential amplifications proposed by the present invention. It is understood that the EGFR mutant sample described in Table IV may contain both the EGFR mutant sequence and the EGFR wild type sequence or only the EGFR mutant sequence, while the wild type sample contains only the EGFR wild type sequence.

Direct sequencing results showed that among the 85 samples that were confirmed to have EGFR mutant sequences after preferential amplification, only 60 of them were detected by conventional PCR amplification; and 119 were identified as EGFR by conventional PCR amplification. Of the wild-type samples, 25 were preferentially amplified and directly sequenced and confirmed as EGFR mutant samples. From these results, the false positive ratio of conventional PCR detection of EGFR mutation was estimated to be about 21%, and the detection sensitivity was about 66%. Compared Under the above-mentioned preferential amplification, all EGFR mutations and wild-type samples were correctly detected (false positive: 0%; false negative: 0%; sensitivity: 100%). As can be seen from this experimental example, the preferential amplification proposed by the present invention can be used to detect variant sequences in a sample such as a clinical sample.

As can be seen from the above description and experimental results, the present invention proposes a novel self-competitive primer which allows simultaneous amplification of wild-type and mutant sequences in the same format. One of the advantages of this feature is that samples taken from lesions or disease sites usually contain both wild-type and mutant sequences, and the amount of the former is usually much higher than the latter, but the present invention still correctly amplifies the mutant sequences therein. For example, some of the samples used in Experimental Example I and Experimental Example II above were taken from lesions of cancer patients, and the mutation sequences contained in these samples were very small (compared to the wild-type sequence). In this case, Conventional PCR is generally unable to amplify a mutated sequence to an extent sufficient for subsequent sequencing or otherwise qualitative. However, the above experimental results show that the preferential amplification method proposed by the present invention provides a detection method without false positive, no false negative, and sensitivity of 100% when conventional PCR cannot correctly detect all mutant samples. Another advantage of the present invention is that the prioritized amplification and detection methods are very sensitive and have a detection limit that is superior to the prior art.

In addition, since the 3'-extension domain does not overlap with the selected region, the probability of erroneous amplification (i.e., the sequence of the selected region in the replication product is different from the original sequence of the sample nucleic acid) can be minimized or even zero. In the case where a true sequence (or phenotype) of the target gene or gene fragment is required, such a characteristic is particularly important because when the erroneously amplified amplification product occurs, the reliability of the analysis is affected, and the subsequent determination is made. The order analysis loses its meaning. For example, in the case of target therapy, the treatment mode is usually determined based on the actual sequence of the patient's target gene or a fragment thereof, and if the sequence of the amplification product is unable to present the patient's true gene sequence due to erroneous amplification, May affect the effectiveness of subsequent treatment.

Although the embodiments of the present invention are disclosed in the above embodiments, the present invention is not intended to limit the invention, and the present invention may be practiced without departing from the spirit and scope of the invention. Various changes and modifications may be made thereto, and the scope of the invention is defined by the scope of the appended claims.

100‧‧‧self-competitive primer

110‧‧‧5’-competition domain

115‧‧‧Selected area

120‧‧‧3’-extended domain

200‧‧‧ reference nucleic acid

210, 310, 310’‧‧‧ first area

215, 315, 315’‧‧‧ Selected areas

220, 320‧‧‧Second area

300‧‧‧Non-variant sample nucleic acid

300'‧‧‧Variable sample nucleic acid

The above and other objects, features, advantages and embodiments of the present invention are made. It can be more clearly understood, and the description of the drawings is as follows: FIGS. 1A to 1C are schematic diagrams schematically showing a design scheme of a self-competitive primer according to an embodiment of the present invention; and FIG. 2 is a photograph showing a photograph according to the present invention. An electrophoresis result of preferential amplification of a variant sequence in an embodiment of the invention.

<110> Taiwan's Presbyterian Church, Ma Rong Memorial Social Enterprise Foundation, Ma Rong Memorial Hospital

<120> Self-competitive primer and method of using this self-competitive primer

<160> 14

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 1

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 2

<210> 3

<211> 40

<212> DNA

<213> Homo sapiens

<400> 3

<210> 4

<211> 40

<212> DNA

<213> Homo sapiens

<400> 4

<210> 5

<211> 9

<212> DNA

<213> Homo sapiens

<400> 5

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 6

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 7

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 8

<210> 9

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 9

<210> 10

<211> 30

<212> DNA

<213> Homo sapiens

<400> 10

<210> 11

<211> 30

<212> DNA

<213> Homo sapiens

<400> 11

<210> 12

<211> 10

<212> DNA

<213> Homo sapiens

<400> 12

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 13

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer

<400> 14

100‧‧‧self-competitive primer

110‧‧‧5’-competition domain

115‧‧‧Selected area

120‧‧‧3’-extended domain

200‧‧‧ reference nucleic acid

210‧‧‧First area

215‧‧‧Selected area

220‧‧‧Second area

Claims (20)

A self-competitive primer for use in a selected region of the nucleic acid with or without a nucleotide variation, as compared to a selected region of a reference nucleic acid, with preferential amplification having the nucleotide variation The sample nucleic acid, wherein the reference nucleic acid comprises a first region and a second region, wherein the first region comprises the selected region and at least one nucleotide residue immediately downstream of the selected region of the reference nucleic acid, And the second region is located downstream of the selected region and does not comprise the selected region of the reference nucleic acid, and the first region and the second region overlap each other by at least one nucleotide, the self-competitive primer comprising: a 5' a competition domain comprising a sequence complementary to the first region, the length of which is 15-40 nucleotide residues, wherein the 5'-competition domain does not serve as a chain elongation start point of the polymerase chain reaction; a '-extension domain comprising a sequence complementary to the second region, the length of which is 15-40 nucleotide residues, wherein the 3'-extension domain acts as a forward primer for polymerization in the sample nucleic acid Enzyme chain reaction Formula amplification process, as compared to not having the nucleotide variation in the sample nucleic acid preferentially amplifying a nucleic acid of the sample having the nucleotide variation. The self-competitive primer according to claim 1, wherein the self-competitive primer is a non-chimeric primer. The self-competitive primer according to claim 1, wherein the self-competitive primer is a chimeric primer. The self-competitive primer according to claim 1, wherein the 5'-competition domain and the 3'-extension domain are directly or indirectly connected by a 3'-5' link or a 5'-5' link. . The self-competitive primer according to claim 1, wherein the self-competitive primer consists of the 5'-competition domain and the 3'-extension domain. The self-competitive primer as set forth in claim 1 further comprises a linker to connect the 5'-competition domain to the 3'-extension domain. The self-competitive primer according to claim 6, wherein the linker is a non-nucleoside chain selected from the group consisting of a peptide, a carbohydrate, a lipid, a fatty acid, a C2-C18 alkyl chain, and a A group consisting of phosphate, monophosphate, monophosphonium, a polyethylene glycol chain, a monoethylene glycol chain, a pendant alkyl chain, a glycerol and a heterocyclic group. A self-competitive primer according to claim 6, wherein the linker is a nucleoside chain. The self-competing primer according to claim 6, wherein the 5'-competing domain and the 3'-extension domain are both a deoxyribonucleic acid sequence, and the linking strand is a C3 alkyl chain. The self-competitive primer according to claim 1, wherein the reference nucleic acid is a gene or a fragment thereof associated with a cancer or a genetic disease. A polymerase chain reaction method for classifying a nucleoside with or without a nucleotide variation in a selected region of the nucleic acid based on a selected region compared to a reference nucleic acid The nucleic acid mutated the sample nucleic acid, the method comprising: amplifying the sample nucleic acid using the self-competitive primer described in claim 1. The polymerase chain reaction method according to claim 11, wherein the self-competitive primer is a non-chimeric primer. The polymerase chain reaction method according to claim 11, wherein the self-competitive primer is a chimeric primer. The polymerase chain reaction method according to claim 11, wherein the 5'-competition domain and the 3'-extension domain are directly or indirectly linked by a 3'-5' linkage or a 5'-5' linkage. And connected. The polymerase chain reaction method according to claim 11, wherein the self-competitive primer consists of the 5'-competition domain and the 3'-extension domain. The polymerase chain reaction method of claim 11, further comprising a linker to link the 5'-competition domain to the 3'-extension domain. The polymerase chain reaction method according to claim 16, wherein the linker is a non-nucleoside chain selected from the group consisting of a peptide, a carbohydrate, a lipid, a fatty acid, and a C2-C18 alkyl chain. a group consisting of monophosphate, monophosphate, monophosphonium, a polyethylene glycol chain, a monoethylene glycol chain, a side chain alkyl chain, a glycerol and a heterocyclic group . The polymerase chain reaction method of claim 16, wherein the linker is a nucleoside chain. The polymerase chain reaction method according to claim 16, wherein the 5'-competing domain and the 3'-extension domain are both a deoxyribonucleic acid sequence, and the linking strand is a C3 alkyl chain. The polymerase chain reaction method according to claim 11, wherein the reference nucleic acid is a gene or a fragment thereof associated with a cancer or a genetic disease.