TWI454575B - Anti-prothrombin aptamer, diagnostic kit and method thereof and optimized selection method for aptamer - Google Patents

Description

Aptamer of anticoagulogen, detection kit and method thereof, and optimization method thereof

The present invention relates to an aptamer. More particularly, the invention relates to an aptamer that binds to prothrombin. The present invention also relates to a method for detecting prothrombin and detecting a blood coagulation disease using the above aptamer. The invention further relates to an optimized screening method for an aptamer.

Prothrombin is a prothrombin precursor (Zymogen) that is converted to a thrombin during the blood coagulation process, which in turn catalyzes the formation of fibrin by fibrinogen to complete the coagulation reaction. In normal humans, the concentration of prothrombin is in a constant state. When it is caused by trauma or abnormal blood coagulation mechanism (such as thrombosis), a large amount of prothrombin will be reduced to produce coagulation protein, so it can detect coagulation protein. It is originally judged whether the patient has abnormal blood coagulation disease, or whether the patient is at high risk for blood coagulation disease.

An aptamer is an oligonucleic acid that binds to a protein and a nucleic acid, that is, a single-stranded nucleic acid having antibody properties. In addition to the specific properties of general protein antibodies, aptamers have the property of mass production of nucleic acids by chemical synthesis (oligonucleotide synthesis) or polymerase chain reaction, and have high chemical stability, unlike proteins. Antibodies have problems in that they are difficult to synthesize and have poor chemical stability. Compared with protein antibodies, aptamers can overcome many of the limitations of use, such as the need to screen animals for animal or cell culture, so that aptamers against toxic or non-immune targets can be screened. . Furthermore, due to the small molecular weight of the aptamer, it is a good tool for image analysis in vitro and in cells. Most importantly, aptamers can be used in conjunction with chemical modifications, such as Functional groups are introduced for detection or immobilization. Currently, aptamers are also available for use in capillary electrophoresis, affinity chromatography, flow cytometry, and biosensors.

The aptamer was screened in 1990 by the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) (Ellington and Szostak, 1990). The SELEX technique is essentially similar to Darwin's evolution theory. It uses a large number of single-stranded RNA or DNA libraries with different sequences to hybridize with the target, and washes the sequence of non-specific bonds after washing. After the sequence amplification and single-stranding process using the polymerase chain reaction, the next screening process is performed again, and after repeated screening and elimination cycles, the single-stranded molecular library is screened for the dissociation constant of the target (Dissociation constant). ) It can be reduced from the original μM to the nM level, and after being processed by sequencing, purification, etc., an array can be obtained to obtain an aptamer with high specificity and sensitivity to the target.

So far, the development of SELEX technology has gradually improved. From the use of radioactive calibration to quantify the presence or absence of bound oligonucleic acid to a fluorescent cursor, the disadvantages of cost and environmental damage are improved. Methods for screening for oligonucleic acid with or without labeling are also quite diverse, such as centrifugation, nitrocellulose filter, affinity chromatography, capillary electrophoresis, flow cytometry, and magnetic beads. Characteristics (Stoltenburg, Reinemann et al., 2005) and the like. The method of fixing the target on the magnetic beads for SELEX has the advantages that the target object to be used is small and easy to operate, and the aptamer can be obtained in a smaller cycle than in the nitrocellulose filter paper filtration method.

As used herein, the term "plurality" is used to describe the number of elements or units of the invention. this Terms are to be understood to mean two or more unless expressly stated otherwise.

The articles "a" or "an" are used herein to describe the elements and compositions of the invention. This terminology is only for convenience of description and the basic idea of the invention. This description is to be construed as inclusive of the singular

The term "or" in this document means "and/or".

The present invention provides an aptamer that binds to prothrombin, comprising the following nucleotide sequence: 5'-TCCCTACGGGCGCTAACMVYNSVWBSRSYSHNWNVBVMYSNVDHYBBGCCACCGTGCTACAAC-3' (SEQ ID NO: 14) wherein the first nucleotide T or non-existent And the 10th nucleotide is G or absent; N is A, T, C or G; R is G or A; Y is T or C; M is A or C; S is G or C; A or T; B is G, C or T; D is A, G or T; H is A, C or T; and V is A, C or G.

In a specific embodiment, the aptamer that binds to prothrombin comprises a nucleotide sequence selected from the group consisting of: 5'-TCCCTACGGGCGCTAACCCTCCCACCACCCCCAGCCACCCAAATCCCGCCACCGTGCTACAAC-3' (SEQ ID NO: 4); 5'-CCCTACGGCGCTAACCCTCCCACCACCCCCAGCCACCCAAATCCCGCCCCCGTGCTACAAC- 3' (SEQ ID NO: 6); 5'-TCCCTACGGCGCTAACCCCTCCACGGCTCTCATGCCTCGCAATGTGCCACCGTGCTACAAC-3' (SEQ ID NO: 7); 5'-TCCCTACGGCGCTAACAGTGGGAGGGGTCTATGGTACCGTGGTTGGGCCACCGTGCTACAAC-3 '(SEQ ID NO: 8); 5'-TCCCTACGGCGCTAACCACACATCCACTGCTACACCACGCCTTCTTGCCACCGTGCTACAAC-3' (SEQ ID NO: 9); 5'-TCCCTACGGCGCTAACCATACATTCTGAGAAGGGCTCACTCTTGGCCACCGTGCTACAAC-3 '(SEQ ID NO: 10); and 5'-GTTGTAGCACGGTGGCGGGATTTGGGTGGCTGGGGGTGGTGGGAGGGTTAGCGCCGTAGGG -3' (SEQ ID NO: 12).

In another specific embodiment, the suitable system for binding to prothrombin consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 4, 6, 7, 8, 9, 10 or 12.

In a specific embodiment, the aptamer of the invention that binds to prothrombin does not bind to a coagulation protein.

In a specific embodiment, the dissociation constant (Kd) of the aptamer of the invention that binds to prothrombin is less than 19.5 nM. In another specific embodiment, the dissociation constant (Kd) of the aptamer of the invention that binds to prothrombin is less than 12.7 nM.

In a specific embodiment, the aptamer of the invention that binds to prothrombin has a GC content greater than 50%. In another specific embodiment, the aptamer of the invention that binds to prothrombin has a GC content of between about 60% and about 70%.

The invention also provides a kit for detecting a blood coagulation disorder comprising an aptamer that binds to prothrombin as described above.

The term "coagulopathy" as used herein refers to a disease in which a large amount of prothrombin is reduced to produce a coagulation protein when it is caused by trauma or abnormal coagulation mechanism (eg, thrombosis). In one embodiment, thromboembolism is referred to. Sexual diseases, including arterial thromboembolic diseases and venous thromboembolic diseases such as, but not limited to, myocardial infarction, cerebral infarction, peripheral arterial thrombosis, and deep vein thrombosis. Therefore, the kit for detecting a blood coagulation disease of the present invention can be used for measuring prothrombin to determine whether the patient has an abnormal blood coagulation disease, or whether the patient is a high risk person for blood coagulation disease.

The present invention further provides a method for detecting prothrombin in a sample, comprising: (1) providing an aptamer that binds to prothrombin as in claim 1; (2) mixing the sample with the aptamer To form a prothrombin-aptamer complex; and (3) to detect prothrombin or aptamer in the prothrombin-aptamer complex.

The "samples" described herein are collected from biological individuals and may be blood, serum or plasma. The individuals referred to in the present invention are animals, including human or non-human animals, such as dogs, cats, mice, rats, cows, sheep, pigs, goats, or non-human primates, of which Humanity.

In a specific embodiment, the aptamer that binds to prothrombin is labeled with a labeling substance. In another specific embodiment, the labeling substance is selected from the group consisting of isotopes (eg, ¹²⁵ I, ¹³¹ I, ³⁵ S, ³ H, or ³² P), enzymes (eg, alkaline phosphatase, wasabi) Phytase (horseradish peroxidase, luciferase, or β-galactosidase), fluorescent substances (eg, fluorescein, rhodamine, phycoerythrin) ), green fluorescent protein (GFP) or blue fluorescent protein (BFP), a luminescent substance (eg, Qdot ^TM nanoparticle, supplied by Quantum Dot Corporation, Palo Alto, CA) or a group of magnetic substances .

The aptamer of the present invention which binds to prothrombin is screened by a simplified SELEX technique with high specificity and affinity. This screening method omits the elution step, directly amplifies the screened DNA molecules via the polymerase chain reaction, and passes the single-stranding process to the next screening.

Accordingly, the present invention provides an optimized screening method for an aptamer comprising the steps of: a. providing a library of aptamer molecules consisting of a single strand of deoxyribonucleic acid sequence; b. providing a target protein; c. The molecular library is mixed with the target protein to form a mixture for hybridization; d. washing the mixture to remove a single-stranded DNA sequence that is not bound to the target protein; e. amplifying the target protein by polymerase chain reaction amplification Single stranded deoxyribonucleic acid sequence to obtain a polymerase chain reaction product; and f. single stranding the polymerase chain reaction product.

In a specific embodiment, the protein of interest is calibrated with vitamin H and conjugated to magnetic beads. In another embodiment, the washing of step d is carried out in TBSM buffer. In yet another embodiment, steps c through f are repeated five to ten times to obtain an aptamer with high specificity and affinity. Each iteration of steps c through f is called a cycle.

During the screening process, the control group experiment can be further carried out to hybridize with the magnetic beads and the aptamer library to determine the sequence and protein specificity in the aptamer library. The difference between non-specific combinations. The amount of aptamer bound by specificity and non-specificity was compared by testing the number of cycles of the polymerase chain reaction and collimating with nucleic acid colloid.

The screening method of the present invention further comprises a counter selection step, which can be arranged between any two cycles. In the anti-screening step, the magnetic beads bound to the egg protein (and not bound to prothrombin) are hybridized with the aptamer screened by the previous cycle, leaving the aptamer not bound to the magnetic beads, in the polymerase After the chain reaction is amplified and single-stranded, the above steps c to f are performed again.

The invention may be embodied in different forms and is not limited to the examples mentioned below. The following examples are merely representative of the various aspects and features of the present invention.

Embodiment 1 Random single strand DNA molecular library and primer pairs

The sequence in the oligonucleotide library contains a central random region of 30 nucleotides in length, with a specific sequence of 16 nucleotides long on each side: 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTCAAC-3' (SEQ ID NO: 1). Using the forward primer 5'-TCCCTACGGCGCTAAC-3' (SEQ ID NO: 2) and the reverse primer 5'-biotin-GTTGTAGCACGGTGGC-3' (SEQ ID NO: 3) to obtain a double by polymerase chain reaction (PCR) Strand DNA. All oligonucleotides are from Purigo Biotech, Inc. (Taipei, Taiwan) synthesis, and its length was confirmed by denaturing PAGE analysis.

Embodiment 2 Systematic Coordination Index Exponential Deduction Program (SELEX) Step 1. Vitamin H calibration of the target protein (biotinylation)

The use of colloidal clotting fibrinogen column chromatography (CentriSep ^TM), for buffer exchange, replaced with 0.1 M sodium carbonate buffer solution (50 mM sodium carbonate, 50 mM sodium bicarbonate, 15 mM sodium hydrogen azide, pH = 9.6), and add an appropriate amount of NHS-biotin to shake at room temperature for 1 hour. The buffer solution was exchanged back to TBSM (20 mM Tris, 200 mM sodium chloride, 5 mM potassium chloride, 1 mM magnesium chloride, pH = 7.5) in the same manner to facilitate subsequent experimental work. After the calibration was completed, the Braford protein quantification method was used, and the absorbance at 595 nm was measured by a spectrophotometer to quantitatively analyze the proteogen of the labeled vitamin H.

Step 2: Hybridization with an aptamer molecule library

The magnetic beads were first washed twice with TBSM buffer, then the procoagulogen that had completed step 1 was ligated with the magnetic beads, shaken at room temperature for 1 hour with an oscillating mixer, and then assisted by a magnetic base to remove excess Solution. Immediately add the aptamer molecular library back to 95 °C, shake and mix at room temperature for 1 small When to complete the hybridization step. Here, hybridization of magnetic beads without prothrombin with the same aptamer molecule library was used as a control group to determine the difference between specificity and non-specificity.

Step 3: DNA Molecular Enlargement and Qualitative Analysis

After the excess liquid is removed by the magnetic holder, the magnetic beads are additionally washed three times. Immediately, 100 μL of TBSM buffer was added for polymerase chain reaction, and the product was qualitatively analyzed by nucleic acid colloid electrophoresis. A suitable polymerase chain reaction cycle is obtained by a nucleic acid colloid electrophoresis method, and the polymerase chain reaction is again performed in this number of turns to carry out a mass amplification step of the obtained DNA molecule for subsequent experimental analysis.

Step 4: Single stranding of DNA molecules and screening of the next stage

Since the product amplified by the polymerase chain reaction is a double-stranded DNA, the process of DNA single-stranding is required to carry out the next screening process. The PCR product was disassembled into a single-stranded DNA having a tertiary structure by using a reverse primer with a vitamin H calibration, a magnetic base, an egg protein-modified magnetic bead and a sodium hydroxide solution. The colloidal solution was then column chromatography (CentriSep ^TM) replacing TBSM buffer is ready for the next stage of screening.

The above steps are continuously repeated, and each time the electrophoresis analysis is compared, after the fifth round, the magnetic beads modified with egg protein are subjected to counter selection, that is, the prothrombin is not immobilized on the magnetic beads. Direct screening, leaving the DNA molecules not bound to the magnetic beads in the screening process, and continuing the sequence amplification of the polymerase chain reaction and the single stranding of the DNA molecules, To continue with the next SELEX. It is hoped that this step will reduce the non-specific combination. It can be seen from the first figure that there is a gradual decrease in the difference in the number of PCR reaction laps of the target sequence obtained by amplifying the specific binding and the non-specific binding in the sixth and seventh cycles. In order to increase the specificity of the screening DNA, from the eighth cycle, the amount of target protein added was reduced to 30 μg. It can be seen that the amount of the specific bond at the ninth cycle is significantly ahead of the non-specific bond. However, the non-specific combination in the tenth cycle is again leading the combination of specificity, indicating that this is the time to end the screening.

Embodiment 3 Gene selection and sequencing

The DNA was screened from the SELEX process by ligation using pGEM®-T Easy Vector. After culturing overnight at 4 ° C, it was transformed into a competent cell (HIT ^TM -Competent Cell), and then applied to an antibiotic-containing LB vegetable medium, and cultured at 36 ° C for 18 hours. Since the vector used has an antibiotic-resistant gene, bacteria that do not colonize the vector cannot survive. Using a large number of asexual reproduction of bacteria into colonies, gently stain each colony with a toothpick, gently stir in a 96-well dish containing 100 μL of LB medium, and incubate at 36 ° C for 18 hours, then use the polymerization. The enzyme chain reaction copies a large amount of the desired DNA fragment. Finally, after purification, it will be sent to the public instrument room of the Academia Sinica for sequencing.

The DNA library obtained after ten screening cycles is copied in large quantities by gene transfer and sent to sequencing and alignment. According to the results, it was found that there were 3 repetitive sequences (B8, F1, C2) and 4 conserved sequences (E2, A1, C5, B2) in the 26 sequences as listed in Table 1. The repeated sequence may be a group with a higher affinity for the target protein, because it is continuously copied in large quantities during the screening process, and the probability of being transferred when doing the bonding is greatly increased. The secondary structure of the repetitive sequence and the conserved sequence is drawn by the DNA Mfold server as shown in the second figure.

It is known from the literature that the DNA aptamer of anticoagulogen has higher GC content, comparing the original DNA library, 26 sequencing results, repetitive sequences (B8, F1, C2) and suitable screening in the literature. The GC content of the body is as shown in the third to third B charts. It can be found that the 26 sequencing results have higher GC content than the original DNA library, and the GC content of the sequences B8, F1, C2 is higher, even higher than the aptamer in the literature. From this point, it can be seen that the DNA sequence screened has a considerable possibility to bind to prothrombin.

Embodiment 4 Affinity and specificity test

The affinity and specificity of the aptamer to the prothrombin was measured by the principle of the conformational change of the aptamer and the protein, and the characteristics of the fluorochrome were measured. Briefly, 500 nM of fluorescent dye (BOBO-3, available from Invitrogen) dissolved in TBSM buffer was first mixed with 99 μL of 150 nM screened aptamer for 30 minutes to form an aptamer. - (BOBO-3) complex, which is then thoroughly mixed with 1 μL of the concentration of the protein to be reacted (human prothrombin, human α-coagulin or bovine serum albumin (BSA)), and the mixture is moved to In a 96-well plate, scanning was performed with a fluorescence spectrometer (Gemini EM, available from Molecular Device Inc.).

Due to the structural changes caused by the recognition of the target protein by each group of aptamers, the base-pairing structure in the aptamer may be altered to cause desorption of the fluorescent dye (Zhou et al., 2006), or Helps the formation of double-stranded structures to cause fluorescence dye adsorption (Lai et al., 2007). In order to consider these two conditions and correct the error caused by each experiment, the experiment will measure the fluorescence reading. The value is normalized, as in Formula I. Where Δ S is the difference between the fluorescence signal readings of the experimental group and the control group (not reacting with the protein), and the fluorescent reading of the control group is divided. The normalized fluorescence reading is between 0 and 1.

The curve binding to prothrombin is subjected to curve fitting using a total binding assay model, such as Formula II, where S _B is the background signal and C _P is the protein concentration. The dissociation constant of the aptamer to prothrombin can be determined to understand its affinity for prothrombin. The fraction of the non-specific target protein (coagulation protein and bovine serum albumin) was analyzed according to the modified formula of the total binding assay (formula III). The affinity of the non-specific target and the aptamer should be linear, so the curve is fitted in a linear regression manner.

The reproducible sequence F1 and the unrepeated sequence C5 were tested for affinity and specificity, respectively, and the results are as shown in the fourth and fifth figures. After comparison, it was found that the affinity of sequence F1 for prothrombin was not greater than that of sequence C5 (K _D =19.5 nM>K _D =12.7 nM), and the specificity of prothrombin (with coagulation protein and bovine serum albumin) In comparison, it is not as good as sequence C5. In addition, the anti-strand sequence (r-C2) of the repeat sequence C2 has the same fragment sequence as the sequence (SEQ ID NO: 13, TAGG-TGGGTAGGGTGGT) in the literature (Fitter and James, 2005) as shown in the box in Table 2. Prove the possibility that the sequence can bind to prothrombin. The sequence r-C2 was also tested for affinity and specificity. As shown in the sixth panel, it was found to have a good affinity with prothrombin (K _D = 9.45 nM) and specificity.

In addition, aptamer microarrays were also used to test the specificity of aptamers to prothrombin. Five conserved sequences such as B5, C5, B2, E2 and A1 and four control sequences such as HT3, HT5, HTNC and F16 were repeatedly printed on the slide. 20 μL of a solution consisting of 500 nm Cy3 labeled prothrombin, 500 nm Cy5 labeled thrombin protein, 1% blocker (purchased from Roche Applied Science) and TBSM buffer, and the aptamer microarray at room temperature Cultivate for 40 minutes. After the completion of the culture, the aptamer microarray was carefully rinsed with PB ST buffer (10 mM phosphate, 137 mM NaCl, 3 mM KCl, and 0.05% Tween 20, pH 7.4). The aptamer microarray was then washed three times for ten minutes in PBST buffer in the dark to further remove proteins not bound to the array. After a brief rinse with secondary deionized water and spin drying, the fluorophore signals of the aptamer microarrays were recorded on a biochip laser fluorescent scanner (GenePix 4000B scanner, available from Molecular Devices Inc.).

As can be seen from the results of Figure A, these conserved sequences are highly specific to prothrombin and do not interact with coagulation proteins. Analysis of the fluorescence intensity ratio of prothrombin to coagulation protein, found that the signal intensity of aptamer E2 is even 15 times the intensity of anti-prothrombin aptamer F16 signal (the first Seven B)).

A person skilled in the art will readily appreciate that the present invention can be easily accomplished with the results and advantages and those present in the present invention. The screening methods in the present invention are representative of the preferred embodiments, which are exemplary and not limited to the field of the invention. Those skilled in the art will be aware of the modifications and other uses therein. These modifications are intended to be within the spirit of the invention and are defined in the scope of the claims.

The present invention has been described in detail with reference to the embodiments of the present invention, and the invention may be Spirit and scope.

All patents and publications mentioned in the specification are subject to the general skill of the art in the field of the invention. All patents and publications are hereby incorporated by reference to the same extent as if each individual publication is specifically and individually indicated.

The invention as exemplified herein may be practiced in the absence of any element, or a plurality of elements, limitations, or limitations. The nouns and expressions used are as a description and not a limitation of the description, and are not intended to be used to exclude any nouns and expressions that are equivalent to the features or parts thereof shown and described, but Various changes are possible within the scope of the patent application of the invention. Therefore, it is to be understood that the present invention has been disclosed and described herein in accordance with the preferred embodiments and the features of the present invention. Within the scope.

The first panel shows the difference in the number of PCR laps of the first PCR product obtained from the non-specific and specific-bonded DNA in the SELEX process.

The second panel shows the secondary structure of the aptamer screened with higher reproducibility: (second A) B8, dG is -2.67 kcal/mol; (second B) F1, dG is -3.36 kcal/mol; (second C map) C2, dG is -1.11 kcal/mol; (second D map) E2, dG is -4.77 kcal/mol; (second E map) A1, dG is -6.73 kcal/mol; 2F) C5, dG is -13.18 kcal/mol; and (second G map) B2, dG is -4.77 kcal/mol.

The third graph shows a comparison of GC content. (Pic. A) A comparison of the original aptamer molecular library, 26 sequencing results, repetitive sequences (B8, F1, C2) and GC content of the aptamer (F16) screened in the literature; B) Comparison of the GC content of the original aptamer molecular library, 26 sequencing results, conserved sequences, B8 and E2, and the aptamer (F16) screened in the literature.

The fourth panel shows the results of testing the affinity and specificity of the repeat sequence F1 with the fluorescent dye BOBO-3. ▲The solid line is the reaction to prothrombin, ■ is the reaction to coagulation protein, ● is the reaction to bovine serum albumin.

The fifth panel shows the results of testing the affinity and specificity of the unrepeated sequence C5 with the fluorescent dye BOBO-3. The part of the reaction to coagulation protein does not match the linearity, but is closer to the two-site binding (Two Site Binding), so the curve is adapted to this formula.

The sixth figure shows the anti-strand sequence r-C2 of the repeat sequence C2 with the fluorescent dye BOBO-3 test pro The result of strength and specificity. ▲The solid line is the reaction to prothrombin, ■ is the reaction to coagulation protein, ● is the reaction to bovine serum albumin.

Figure 7 confirms the results of specificity with aptamer microarrays. B5, C5, B2, E2 and A1 are conserved sequences; HT3 and HT5 are coagulation protein aptamers; HTNC is a non-antithrombin aptamer; and F16 is a previously published anti-thrombinogen body. (Fig. 7A) The aptamer is simultaneously hybridized with Cy3-labeled prothrombin and Cy5-labeled coagulation protein; (Section 7B) the fluorescence intensity ratio of prothrombin to coagulation protein.

<110> National Taiwan University

<120> aptamer of anticoagulogen, detection kit and method thereof, and optimization method thereof

<130> 1686-NTU-TW

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic sequences in aptamer libraries

<220>

<221> misc_feature

<222> (1)..(61)

<220>

<221> misc_feature

<222> (17)..(46)

<223> n is a, c, g or t

<400> 1

<210> 2

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic forward primer

<220>

<221> misc_feature

<222> (1)..(16)

<400> 2

<210> 3

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic reverse primer

<220>

<221> misc_feature

<222> (1)..(16)

<400> 3

<210> 4

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Screened B8 aptamer

<220>

<221> misc_feature

<222> (1)..(63)

<400> 4

<210> 5

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Screened F1 aptamers

<220>

<221> misc_feature

<222> (1)..(62)

<400> 5

<210> 6

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Screened C2 aptamer

<220>

<221> misc_feature

<222> (1)..(61)

<400> 6

<210> 7

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Screened E2 aptamers

<220>

<221> misc_feature

<222> (1)..(61)

<400> 7

<210> 8

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Screened A1 aptamer

<220>

<221> misc_feature

<222> (1)..(62)

<400> 8

<210> 9

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Screened C5 aptamer

<220>

<221> misc_feature

<222> (1)..(62)

<400> 9

<210> 10

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Screened B2 aptamer

<220>

<221> misc_feature

<222> (1)..(60)

<400> 10

<210> 11

<211> 84

<212> DNA

<213> Artificial sequence

<220>

<223> Reported F16 aptamer

<220>

<221> misc_feature

<222> (1)..(84)

<400> 11

<210> 12

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Complementary sequence of C2 aptamer

<220>

<221> misc_feature

<222> (1)..(61)

<400> 12

<210> 13

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Sequences in the literature

<220>

<221> misc_feature

<222> (1)..(17)

<400> 13

<210> 14

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Screening for prothrombin aptamers

<220>

<221> misc_feature

<222> (1)..(63)

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (32)..(32)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (34)..(34)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (41)..(41)

<223> n is a, c, g or t

<400> 14

Claims (10)

An aptamer that binds to prothrombin, comprising the following nucleotide sequence or its complement: 5'-TCCCTACGGGCGCTAACMVYNSVWBSRSYSHNWNVBVMYSNVDHYBBGCCACCGTGCTACAAC-3' (SEQ ID NO: 14) wherein the first nucleotide T or not Exist, and the 10th nucleotide is G or absent; N is A, T, C or G; R is G or A; Y is T or C; M is A or C; S is G or C; Line A or T; B line G, C or T; D line A, G or T; H line A, C or T: and V line A, C or G, wherein the aptamer is selected from SEQ ID NOs: 4, The nucleotide sequence of the group consisting of 6, 7, 8, 9, 10 and 12. An aptamer that binds to prothrombin, as disclosed in claim 1, does not bind to a coagulation protein. An aptamer that binds to prothrombin as claimed in claim 1 has a dissociation constant (Kd) of less than 19.5 nM. An aptamer that binds to prothrombin as claimed in claim 1 has a dissociation constant (Kd) of less than 12.7 nM. The aptamer that binds to prothrombin as in item 1 of the patent application has a GC content greater than 50%. If the aptamer of the first aspect of the patent application is bound to prothrombin, the GC content is about 60% to about 70%. A kit for detecting a blood coagulation disease comprising an aptamer that binds to prothrombin as in claim 1 of the scope of the patent application. A method for detecting prothrombin in a sample, comprising: (1) providing an aptamer that binds to prothrombin as in claim 1; (2) mixing the sample with the aptamer to form a a prothrombin-aptamer complex; and (3) detecting prothrombin or aptamer in the prothrombin-aptamer complex. A method of detecting prothrombin in a sample according to claim 9 of the patent application, wherein the aptamer bound to prothrombin is labeled with a labeling substance. A method for detecting prothrombin in a sample according to claim 10, wherein the labeling substance is selected from the group consisting of an isotope, an enzyme, a fluorescent substance, a luminescent substance, or a magnetic substance.