TWI409334B - Probe, method and kit for rapidly identifying dermatophytes - Google Patents

Abstract

The present invention provides a probe, method and kit for identifying dermatophytes. Particularly, the use of the internal transcribed spacer sequence of the rRNA genes for the identification of dermatophytes.

Description

Rapid identification of probes, methods and kits for dermatophytes

The present invention relates to a method for identifying a dermatophyte; in particular, the present invention relates to a method for identifying a dermatophyte using a specific probe.

In mild and humid climates, epidemic infections occur frequently, of which dermatophytes are an important infectious agent, for example caused by Epidermophyton , Microsporum or Tricophyton . Head lice, body lice, femoral hernia, athlete's foot, handcuffs, armor, etc. In general, these infections are limited to the epidermis, mucous membranes, hair, nails, etc., so the superficial mildew infection mostly causes aesthetic problems and does not cause serious tissue damage. However, under the influence of the humid and warm climate in the subtropical region of Taiwan, due to the frequent occurrence of symptoms of epithelial fungal infections, it has caused many problems. Therefore, if the infected strains can be quickly identified clinically, the symptoms can be prescribed in time.

The traditional methods for identifying Pichia in clinical microbiology laboratories mainly include observing the colony pattern, color, growth rate, pigment production, and observing the morphology of hyphae and reproductive structures (such as megaspores or microspores) under a microscope. The disadvantage is that the method steps are cumbersome and time consuming. On the other hand, the application of molecular biology identification methods utilizes restriction fragment length polymorphism (RFLP) or polymerase chain reaction amplification. Although these molecular biology methods are more precise, the common limitation is that the number of analyzable strains is limited. Among them, the restriction length polymorphism method must select appropriate restriction enzymes to distinguish various strains; When amplifying the target DNA at the same time, since multiple sets of primers affect the efficiency of polymerase chain reaction amplification, only a small number of strains can be identified at a time. Therefore, the conventional method has the disadvantages of complicated operation, poor sensitivity, and unsatisfactory specificity.

"Microarray wafer" refers to a product that can be applied to biochemical analysis on a substrate using industrial techniques such as microelectronics and micromachines. At present, biochips have many advantages such as fast analysis speed, few samples and reagents, and holistic (parallelization) experimental data, and have become a great tool for studying genes, proteins, cells and tissues. The biochip system immobilizes DNA/proteins of various sequences on a substrate as a probe, and the wafer can be widely used in the fields of gene mapping analysis, gene mutation analysis, differential analysis of a large number of gene expressions, drug development, and disease diagnosis. In the identification of strains, the application of the hybridization reaction of the wafer can improve the accuracy of the identification, shorten the identification time, and make the identification process consistent, and has the advantages of simplification, rapidization and automation. However, there is still no good microarray wafer for the identification of Pichia bacteria. Therefore, there is a need in the art for a rapid, convenient, and highly sensitive and specific method for identifying Pichia bacteria in a sample.

It is an object of the present invention to provide a probe for identifying Pichia bacteria, which can be applied to a microarray platform for simultaneously analyzing a plurality of targets, and to identify a wide range of Pichia bacteria with high sensitivity and specificity. A probe according to the present invention comprising a selected from the group consisting of Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9), Trurb3 (SEQ ID NO: 10), Trrs1c (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15), Trver2e ( SEQ ID NO: 16) and the sequence of the population consisting of Trvio1c (SEQ ID NO: 17), a fragment thereof or a complement thereof.

Another object of the present invention is to provide a method for identifying a dermatophyte comprising the steps of hybridizing at least one of the above probes to a sequence of a transcribed region of a rRNA gene in a sample, and observing whether a hybridization step occurs. .

It is still another object of the present invention to provide a kit for identifying a bacterium of the bacterium of the sample, the kit comprising at least one of the above-described probes.

The present invention provides a probe comprising: selected from the group consisting of Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9), Trurb3 (SEQ ID NO: 10), Trrs1c (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15), Trver2e ( Sequences of the population consisting of SEQ ID NO: 16) and Trvio1c (SEQ ID NO: 17), fragments thereof and Complement the sequence.

As used herein, the term "probe" refers to a molecule comprising at least 8 nucleotides in succession, preferably 10 to 50 nucleotides in length, more preferably 15 to 40 nucleotides in length, optimal. It is 17 to 30 nucleotides in succession. The probe can be hybridized with the target nucleotide under hybridization conditions. Those of ordinary skill in the art to determine the conditions of the hybridization reaction, wherein the preferred conditions for the hybridization reaction are about 5 times Saline-Sodium Citrate at about 45 ° C. Medium to about 65 ° C is included in about 0.1 times SSC.

The term "fragment" as used herein means having Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID) NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9), Trurb3 (SEQ ID NO: 10), Trrs1c (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15), Trver2e (SEQ ID NO) : 16) or any portion of the Trvio1c (SEQ ID NO: 17) sequence of at least 8 nucleotides in succession and capable of hybridizing to the rRNA intra-transcribed spacer (ITS) region sequence. For example, if the nucleotide sequence of a fragment encompasses the 3' terminal nucleotide of the above sequence, the fragment sequence may extend downstream from the 3' end of the sequence according to the rRNA gene internal transcribed spacer (ITS) sequence; If the nucleotide sequence of a fragment encompasses the 5' terminal nucleotide of the above sequence, the piece The segment sequence can be extended upstream from the 5' terminal nucleotide of the above sequence according to the sequence of the transcribed region of the rRNA gene.

The term "complementary sequence" as used herein, refers to a nucleic acid molecule that hybridizes to a probe according to the invention, preferably a nucleic acid molecule that is fully complementary to the base of the probe according to the invention.

The probe according to the present invention can be used to identify the dermatophyte, which is designed for the sequence of the transcribed region of the rRNA gene of 14 species of the genus Trichophyton. It is believed that the internal transcribed region used to separate 18S and 28S rRNA is an excellent region for species identification and strain typing of Pichia, and the similarity of species and interspecies except for a few strains of ITS sequences. Low (40% to 95%), but the similarity of intraspecies is extremely high (99% to 100%), and many ITS sequences of Pichia have been published and included in national genetic databases. . The method of the present invention is more easily distinguished than the method of targeting the D1-D2 region of the 28S rRNA gene. After preliminary hybridization test, probes that cross-react with different strains or produce weak hybridization signals with the same strain were discarded, and finally 17 probes were screened. Under most conditions, each probe can identify a single species with specificity and sensitivity, and when one of the Migyp3b or Migyp5b two probes hybridizes, it is identified as M. gypseum . ; Trmen2d when one or two Trmen3g probe hybridization reaction occurs, i.e. sore be identified as Trichophyton rubrum (T.mentagrophytes); Trter1 when one or two Trter6b probe hybridization reaction occurs, i.e., identified as trichostatin Tyrese Tsui Bacteria ( T. terrestre ). On the other hand, when the two probes Trrs1c Trrub3 and while generating a hybridization reaction, i.e., identified as Trichophyton rubrum (T.rubrum).

In a preferred embodiment of the invention, wherein the probe is 5' or 3' The terminal further comprises a plurality of additional thymine bases, preferably 4 to 20, more preferably 6 to 18, which enhance the hybridization signal of the oligonucleotide probe. Although the mechanism is not clear, it is known to reduce the steric hindrance of the probe to hybridize with the target DNA or to enhance the binding of the probe to the substrate film.

Preferably, the probe according to the present invention comprises a marker for detecting the result of the hybridization reaction, and the method of the marker is well known to those of ordinary skill in the art to which the present invention pertains, for example, to generate radiation, firefly Light and/or color markers (Kondoh et al., 1998, DNA Res. 5: 217-220; Martin et al., 2000, J. Clin. Microbiol. 38: 3735-3742; Huang et al., 2006, J. Clin. Microbiol. 44: 3299-3305), wherein preferably the marker produces a color, such as the use of digoxigenin.

Another object of the present invention is to provide a method for identifying a dermatophyte comprising the steps of hybridizing at least one of the above probes to a sequence of a transcribed region of a rRNA gene in a sample, and observing whether a hybridization step occurs. .

For the genus Epidermidis, if the transcribed region sequence of the rRNA gene hybridizes to a probe comprising Epflo2c, a fragment thereof or a complement thereof, the dermatophyte is identified as E. floccosum .

For the genus Bacillus, if the transcribed region of the rRNA gene hybridizes to a probe comprising Miaud3b, a fragment thereof or a complement thereof, the bacterium is identified as M. audouinii ; Preferably, the probe, a fragment thereof or a complementary sequence thereof further comprises 14 additional thymine bases at the 5' or 3'end; if the rRNA gene internal transcribed region sequence and the probe comprising Mican2g, a fragment thereof or If the complementary sequence is hybridized, the dermatophyte is identified as M. canis ; preferably, the probe, its fragment or its complementary sequence further comprises 11 additional thymines at the 5' or 3' end. a base; if the transcribed region sequence of the rRNA gene hybridizes to a probe comprising Mifer1c, a fragment thereof or a complement thereof, the dermatophyte is identified as M. ferrugineum ; preferably, the The probe, a fragment thereof or a complementary sequence thereof further comprises 8 additional thymine bases at the 5' or 3'end; if the rRNA gene internal transcribed region sequence hybridizes to a probe comprising Migyp3b or Migyp5b, a fragment thereof or a complement thereof , the dermatophytes were identified as Glycyrrhiza glabrata ( M.gy Pseum ); if the transcribed region sequence of the rRNA gene hybridizes to a probe comprising Miper2, a fragment thereof or a complement thereof, the dermatophyte is identified as M. persicolor ; preferably, the The probe, its fragment or its complementary sequence additionally contains 8 additional thymine bases at the 5' or 3' end.

For Trichophyton, if the sequence comprising a transcribed region of a probe Trmen3g Trmen2d or within the rRNA gene, a fragment thereof or a complementary sequence hybridized, is identified as the dermatophytes Trichophyton rubrum be sore (T.mentagrophytes Preferably, the Trmen2d probe, a fragment thereof or a complementary sequence thereof further comprises 17 additional thymine bases at the 5' or 3'end; if the rRNA gene internal transcribed region sequence and a probe comprising TRrub3 and Trrsc , a fragment or a complementary sequence hybridized, the identification of the dermatophyte Trichophyton rubrum (T.rubrum); the other preferably, the Trrub3 probe, a fragment thereof or the complementary sequence 5 'or 3' end Including 11 additional thymine bases; preferably, the 2' or 3' end of the Trr1c probe, its fragment or its complement further comprises 6 additional thymine bases; if the rRNA gene has an internal transcribed region sequence The Trsch2b-containing probe, a fragment thereof or a complement thereof is hybridized, and the dermatophyte is identified as T. schoenleinii ; preferably, the probe, a fragment thereof or a complement thereof is 5' or The 3' end further contains 7 additional thymine bases; if the rRNA gene is transcribed Trrs1c sequence comprising the probe, a fragment or a complementary sequence hybridized probe but does not contain the Trrub3, a fragment or a complementary sequence hybridized, the identification of the dermatophyte Trichophyton Sultan (T.soudanense) Preferably, the 2' or 3' end of the Trr1c probe, a fragment thereof or a complement thereof further comprises 6 additional thymine bases; if the rRNA gene internal transcribed region sequence and a probe comprising Trter1 or Trter6b, If the fragment or its complementary sequence hybridizes, the dermatophyte is identified as T. terrestre ; preferably, the Trter6b probe, a fragment thereof or a complement thereof 5' or 3' The terminal further comprises 16 additional thymine bases; if the transcribed region sequence of the rRNA gene hybridizes to a probe comprising TRton1e, a fragment thereof or a complement thereof, the dermatophyte is identified as T. tonsurans Preferably, the probe, a fragment thereof or a complementary sequence thereof further comprises 18 additional thymine bases at the 5' or 3'end; if the transcribed region sequence of the rRNA gene hybridizes to a sequence comprising Trver2e or its complement, the identification of the dermatophyte Trichophyton rubrum tinea shape (T.verrucosum) Preferably, the probe, a fragment thereof or a complementary sequence thereof further comprises 15 additional thymine bases at the 5' or 3'end; and if the rRNA gene has an internal transcribed region sequence and a probe comprising Trvio1c, a fragment thereof or which hybridize to complementary sequences, it is identified as the dermatophytes Trichophyton violaceum (T.violaceum); preferably, the probe, a fragment thereof or the complementary sequence 5 'or 3' terminus of the other contains seven additional Thymine base.

In a preferred embodiment of the invention, Epflo2c, Miaud3b, Mican2g, Mifer1c, Migyp3b, Migyp5b, Miper2, Trmen2d, Trmen3g, Trurb3, Trrs1c, Trsch2b, Trter1, Trter6b, Trton1e, Trver2e and Trvio1c probes are used. Hybridization reaction with the sequence of the transcribed region of the sputum rRNA gene in the sample, combined with the use of microarray technology, can identify 14 species of dermatophytes in a single operation.

In a preferred embodiment of the invention, the rRNA gene internal transcribed region of the sample can be amplified in a polymerase chain reaction prior to hybridization to facilitate convenient manipulation. Preferably, a fungal-specific universal primer is used to amplify the transcribed region of the rRNA gene in the sample to avoid low amplification efficiency due to the use of multiple primers and at the same time to increase sensitivity; in one embodiment of the invention Wherein the fungal-specific universal primers include the ITS1 primer (SEQ ID NO: 18) and the ITS4 primer (SEQ ID NO: 19).

In a preferred embodiment of the invention, the transcribed region of the rRNA gene in the sample can be labeled. Methods for labeling transcribed regions within genes are well known to those of ordinary skill in the art to which the invention pertains. For example, when a polymerase chain reaction is performed to amplify an intragenic transcribed region, the fungal-specific universal primer comprises a marker, preferably the marker is digoxigenin, or a labeled dUTP. It can be used to introduce a label into the product.

In a preferred embodiment of the invention, the method further comprises a positive control step. Any identifying probe for identifying a known microorganism is suitable for this positive control step. In a more preferred embodiment of the invention, the positive control step comprises hybridizing the 5.8S rRNA gene retaining region of the bacterium of the sample to the PC (SEQ ID NO: 20) probe; preferably, the PC probe 5' Or another 9 additional thymine bases at the 3' end.

The reason why the method of the present invention can exert a better effect is that the ITS sequence has strain specificity, and a small number of cross-reactive fungi cannot produce typical colonies on a general medium as the target strain can. The method of the present invention can identify more species of dermatophytes by increasing the variety of oligonucleotide probes without increasing cost or complexity.

It is still another object of the present invention to provide a kit for identifying a bacterium of the bacterium of the sample, the kit comprising at least one of the above probes.

Preferably, the kit according to the present invention may be in the form of a microarray wafer comprising a substrate and the probe is located on a substrate. Substrate materials and coating methods have been well established in the art, wherein the substrate is preferably nylon or glass.

The probes according to the present invention are preferably arranged in a microarray on a solid or a wafer to allow identification of multiple microorganisms in a single operation, saving significant time, expense, space and labor. Any of the commonly used gene expression detection methods in the art can be used in the present invention, which can replace the different biochemical reactions for different Pichia bacteria in the prior art to identify the species. In one embodiment of the invention, a total of 17 oligonucleotide probes are screened for 14 species of dermatophytes and spotted into microarray wafers. In one embodiment of the invention, 182 strains (including 52 reference strains and 130 clinical isolates) were tested on this wafer with a sensitivity of 99.5%. In another embodiment of the present invention, among the 90 non-target species, 88 strains have no hybridization reaction, and the other 2 strains are found to have a cross-reaction phenomenon, and the specificity is still as high as 97.8%. Therefore, the microarray wafer of the present invention can quickly and correctly identify different strains, but is an effective detection tool, and can be completed within 24 hours from the start of a single colony to the completion of strain identification.

According to the invention, the kit further comprises reagents for obtaining a transcribed region of the rRNA gene. The composition of the reagents is also well known to those of ordinary skill in the art to which the invention pertains. In a preferred embodiment of the invention, the reagents are used in a polymerase chain reaction. In a more preferred embodiment of the invention, the kit further comprises a fungal-specific universal primer. In another preferred embodiment of the invention, the kit further comprises a reagent for hybridization reaction.

The invention is illustrated by the following examples, which are not intended to limit the invention to the invention.

Example: Pipibacterium

A total of 182 strains of the dermatophytes used in this example were included, including 52 reference strains and 130 isolates, as shown in Table 1 below. Reference strains are from four bacterial centers: Taiwan Bioresources Collection and Research Center (HB), American Standard Culture Collection (ATCC, American Type Culture Collection, Manassas, USA), Netherlands Center for the species (CBS, Centraalbureau voor Schimmelcultures, Utrech, The Netherlands) and the Belgian Co-ordinated Collections of Microorganisms (Brussels, Belgium). The isolates were obtained from the National Cheng Kung University Hospital, Prof. Jean P. Bouchara (Laboratory of Parasitology and Mycology, Angers University Hospital, France) and Dr. Richard Barton (Mycology Reference Centre, Division of Microbiology University of Leeds, UK). ).

^a LMA representative was obtained from the Laboratory of Parasitology and Mycology, Angers University Hospital; the LM representative was obtained from the Mycology Reference Centre, Division of Microbiology University of Leeds; the NCKU representative was obtained from the National Cheng Kung University Hospital. ^{The b} strain CBS 161.69 was classified as Glycyrrhiza glabrata in 1989, but was classified as Nannizzia gypseum in 2001. ^{The c} strains CBS 421.74, CBS 468.74, and CBS 871.70 have only the sexual generation name variegated skin filamentous fungus on the CBS webpage (http://www.cbs.knaw.nl). ^d Bacillus licheniformis strain CBS 511.73 is synonymous with Trichophyton rubrum on the CBS webpage. ^e. sulcata is synonymous with T. violaceum on the CBS webpage, but the genus Trichophyton and Trichophyton rubrum are on the ATCC website (http://www.atcc.org). Two different species. ^{The f} strains CBS 117.61, CBS 464.62, CBS 165.62 and CBS 567.94 only named their sexual generations on the CBS webpage as tetrasarcoma filamentous fungi.

DNA extraction

Part of the hyphae (about 0.5 cm × 0.5 cm) was excavated from SDA medium to 2 ml of spiral cap tubes (SCT-300-C, Axygen Scientific, Union City, CA) and suspended in 0.5 ml of sterilized water. . Add about 300 mg of 0.5 mm diameter zirconia/talc beads (BioSpec Product, Inc., 11079105z, South San Francisco, CA) using a bead-collision tissue grinder (mini-bead beater, Biospec, Mini-Beadbeater, USA) ) The hyphae were broken by shaking at 4,200 rpm for 1 to 5 minutes. Take the 100 μl to 1.5 ml microcentrifuge tube of the sterilized bacteria in the above procedure, centrifuge at 12,000 rpm for 10 minutes, and remove the supernatant. The DNA was extracted with a Blood & Tissue Genomic DNA Mini kit (Viogene GG1002, Taipei, Taiwan) by adding 200 μl of LYS buffer and 20 μl of proteinase K (provided by the kit) to the bacterial solution and shaking well for 20 seconds. The reaction was carried out in a dry bath at 60 ° C for 1 hour. The temperature was further raised to 70 ° C and allowed to stand for 20 minutes to terminate the reaction of proteinase K. 200 μl of EX buffer (provided by the kit) was added to the centrifuge tube and reacted in a 70 ° C dry bath for 10 minutes. After adding 210 μl of 95% alcohol, the mixture was added to a 2 ml microcentrifuge tube (containing a chromatography tube) (provided by the kit), and centrifuged at 8,000 rpm for 1 minute to remove the centrate. Add 500 μl of wash buffer (provided by the kit) to the centrifuge tube, centrifuge at 8,000 rpm for 1 minute, remove the supernatant, and repeat this step again. After centrifugation at 12,000 rpm for 1 minute, the tube was removed and placed in another new 1.5 ml microcentrifuge tube. 100 μl of 70 ° C sterile water was added to the centrifuge tube and allowed to stand for 3 minutes. After centrifugation at 12,000 rpm for 2 minutes, the DNA extracted in the filtrate can be stored at -20 ° C or used directly in subsequent steps, such as polymerase chain reaction.

Amplification of transcribed regions in DNA

The transcribed region within the ITS was amplified by a universal primer pair (ITS1 and ITS4). The sequence of ITS1 is 5'-TCC GTA GGT GAA CCT GCG G-3' (SEQ ID NO: 21), and the sequence of ITS4 is 5'-TCC TCC GCT TAT TGA TAT GC-3' (SEQ ID NO: 22). The polymerase chain reaction program was: 95 ° C, 3 minutes; 95 ° C, 1 minute; 60 ° C, 1 minute; 72 ° C, 1 minute, 35 cycles; 72 ° C, 5 minutes. The DNA fragment amplified by the polymerase chain reaction was purified by PCR-M Clean Up purification kit (Viogene, Taipei, Taiwan), and then subjected to sequencing analysis.

Oligonucleotide probe design

After sequencing of the polymerase chain reaction products of each strain, Discovery Studio Gene (DS gene, version 1.5, Accelrys Inc., San Diego, Calif.) was used for multi-sequence parallel analysis to find similarities between homologous and different species. And dissimilarity, and design probes containing approximately 17 to 30 nucleotides in length. The characteristics of the probe including length, T _m value, GC%, and secondary structure were confirmed by Vector NTI software (Invitrogen Corporation, Carlsbad, Calif.). A total of 65 probes were designed. The designed probes were cross-reactive with the existing strains on GenBank using BLAST alignment, and then the probes with stronger response and least cross-reactivity to the target species were selected from these probes (Table 2). As a probe attached to a nylon membrane.

Production of oligonucleotide wafers

Dosing nucleotide probe with dye (30% (v/v) glycerol, 1 mM sodium edetate, 40% (v/v) dimethyl hydrazine, 0.15% (w/v) bromophenol blue And 10 mM Tris-HCl pH 7.5) was diluted 1:1 (final concentration of probe was 10 μM). The probe was spotted on a positively charged nylon membrane with an area of 1 cm ² (or smaller) using a 400 μm diameter solid needle by Ezspot Arrayer (SR-A300, EZlife Technology, Taipei, Taiwan) (Roche, Mannheim) , Germany). After the probe was spotted, the film was irradiated with short-wave ultraviolet (Stratalinker 1800; Stratagen, La Jolla, Calf., USA) for 30 seconds to fix the probe. The unfixed oligonucleotide nucleic acid was washed away with 0.5 x SSC (1 x SSC of 0.15 M NaCl, 0.015 M sodium citrate) and 0.1% sodium dodecyl sulfate. The nylon membrane can be stored dry at room temperature for later use.

There are 36 detection points (6 × 6 points) on one wafer, including 1 positive control point (the general primer PC (5GCATCGATGAAGAACGCAGC3' (SEQ ID NO: 23) with 3' plus 9 T on it, final concentration of 5 μ M), 5 th negative control group containing only stain, marker coordinate point 10 (which is indicated by the 5'-prime primer ITS4 digitalis, a final concentration of 0.05 μ M) and probe 20 a needle point (which is the species-specific probes, each with a final concentration of 10 μ M). after the hybridization reaction, may provide a marker coordinate determination ready identification of the correct position of the probe signal.

Amplification of the transcribed region within the target DNA

Using the universal primer ITS1 and ITS4 with a digoxigenin molecule at the 5' end, the DNA of the ITS1-5.8S rDNA-ITS2 region of the strain was amplified to allow the PCR product to decompose with alkaline phosphate. The anti-digoxigenin antibody of the enzyme phosphatase (AP) binds to the color reaction after DNA hybridization. The PCR reaction procedure was: 95 ° C, 3 minutes; 95 ° C, 1 minute; 60 ° C, 1 minute; 72 ° C, 1 minute, 35 cycles; 72 ° C, 5 minutes.

Hybridization reaction

Each wafer was first mixed with a solution (5X SSC, 1% (w/v) blocker (Roche 1096176, Mannheim, Germany), 0.1% N-laurylsarcosine, Sigma L -9150, St. Louis, USA) and 0.02% SDS) The prehybridization reaction was carried out at room temperature. The PCR product labeled with digoxigenin was heated at 95 ° C for 5 minutes to separate the double-stranded DNA into two single-stranded DNA, and immediately cooled in an ice bath to maintain a single-strand state. The denatured PCR product was added to a hybridization solution impregnated with a DNA wafer, and subjected to hybridization reaction with a complementary DNA probe on the wafer at 55 °C. Then, it was washed with 0.25 X SSC buffer at room temperature to wash away unbound DNA, and then dissolved in a blocking buffer [1% (w/v) in maleic acid buffer ( 0.1 M maleic acid, 0.15 M sodium chloride (NaCl), blocking reagent in pH 7.5) was subjected to a wafer surface blocking reaction. Then, after reacting with the anti-triolin antibody with alkaline phosphatase (AP), the malic acid washing buffer [0.3% (v/v) of Tween 20 is dissolved in maleic acid buffer. (maleic buffer)] cleaning. The assay buffer (0.1 M Tris-HCl and 0.15 M NaCl, pH 9.5) was added and shaken at room temperature for 5 minutes to remove the assay buffer. A color reaction can then be carried out (about 30 to 45 minutes). The entire identification process (from DNA extraction to hybridization and color reaction) can be completed within 6 hours. Finally, a high-resolution (about 3000 dpi) scanner (Umax powerlook 3000) is used for scanning to store images of the reaction results.

Inconsistent result analysis

A total of 182 reference strains were tested in this experiment, including 52 reference strains and 130 clinical isolates (Table 1). The results of the wafer test were as follows: 52 reference strains were able to obtain correct identification results; 13 of the 130 clinical isolates were identified by the traditional type and the wafer identification results were inconsistent (Table 3). The reference strain represents a strain which can be identified by the probe according to the present invention.

These 13 strains were further confirmed by sequence analysis of the D1-D2 region and the ITS internal transcribed region rRNA gene sequence. The D1-D2 region utilizes a universal primer pair NL1 (5'-GCA TAT CAA TAA GCG GAG GAA AAG-3', SEQ ID NO: 21) and NL4 (5'-GGT CCG TGT TTC AAG ACG G-3', SEQ ID NO: 22) amplified; the ITS 1 internal transcribed region was amplified by primer pair ITS1 (SEQ ID NO: 18) and ITS2 (5'-GCT GCG TTC TTC ATC GAT GC-3, SEQ ID NO: 25). The ITS 2 internal transcribed region is preceded by ITS3 (5'-GCA TCG ATG AAG AAC GCA GC-3, SEQ ID NO: 23) and ITS4 (5'-TCC TCC GCT TAT TGA TAT GC-3', SEQ ID NO: 24) Enlarged. The sequencing results were subjected to sequence alignment and strain identification by the BLAST program of National Center for Biotechnology Information (NCBI, USA), and the results are shown in Table 4.

No hybridization reaction occurred between B. sphaeroides LMA 597 and probe Miaud 3b. It was found by ITS 2 sequencing that LMA 597 strain had one more nucleotide C insertion in this region, resulting in pseudo-negative hybridization results.

This strain was not identified by the ITS 1 and 2 and D1-D2 sequences. Therefore, the results identified by LMA 922 and LMA 951682 by conventional methods are not correct.

The results of ITS 1 and 2 sequence alignment of G. glabrata LMA 90603 showed that it was M. fulvum ; and the results of D1-D2 sequence alignment showed that it was gypsum-like spores or Bacillus licheniformis (Table 4). Since there was no probe for identifying P. oxysporum in the wafer of the present invention (Table 2), a negative hybridization result was shown.

Trichophyton mentas LMA 831, LMA 835, LMA 979, LMA 5050094 and LMA 50600067 were aligned with ITS 1 and 2 and D1-D2 sequences to show that all of these strains were Trichophyton rubrum. Trichophyton rubrum LMA 951336, which was aligned with the sequences of ITS 1 and 2 and D1-D2, showed that it was Trichophyton.

The results of the alignment of Trichophyton rubrum NCKU 3156 with Trichophyton rubrum LMA 40204990 and LMA 50200673 showed that all of the strains were Trichophyton rubrum.

The results of the ITS and D1-D2 sequence library and wafer identification in this study show that the identification rate of the wafer of the present invention can reach 99.5% (194/195), and the range of about 1 to about 10 pg of bacterial DNA can be detected. .

Wafer specificity analysis

In terms of wafer specificity, among 90 non-target species (as shown in Table 5), 88 strains did not have a hybridization reaction, and the other 2 strains were found to have a cross-reaction (specificity 97.8%).

The cross-reactive strains were M. equinum LMA 40396666 and Trichophyton gourvilii var. intermedium CBS 170.65. A hybridization reaction occurred between B. globosa LMA 40396666 and the probe Mican 2g, and the two strains were further confirmed by DNA sequence analysis of the D1-D2 region and the ITS internal transcribed region by the above method. The results are shown in Table 6. The length of IBS 2 is 1 nucleotide more than that of canine spores, so the length of ITS 2 can be used to distinguish the two species. T.gourvilii var.intermedium CBS 170.65 and probe Trrs1c have hybridization reactions, and the results of ITS 1 and 2 can also be found to be as similar as that of T. sulphide to 97 and 98%, but T. gourvilii var. intermedium is not human. Pathogenic dermatophytes do not cause erroneous identification in clinical practice.

The above-described embodiments are merely illustrative of the principles and effects of the invention, and are not intended to limit the invention. Modifications and variations of the embodiments described above will be apparent to those skilled in the art without departing from the spirit of the invention. The scope of the invention should be as set forth in the appended claims.

<110> National Cheng Kung University <120> Probe, method and kit for rapid identification of Pichia bacteria <130> No <160> 25 <170> PatentIn version 3.3 <210> 1 <211> 24 <212> DNA <213 > manual sequence <400> 1 <210> 2 <211> 21 <212> DNA <213> Artificial sequence <400> 2 <210> 3 <211> 24 <212> DNA <213> Artificial sequence <400> 3 <210> 4 <211> 22 <212> DNA <213> Artificial sequence <400> 4 <210> 5 <211> 27 <212> DNA <213> Artificial sequence <400> 5 <210> 6 <211> 25 <212> DNA <213> Artificial sequence <400> 6 <210> 7 <211> 22 <212> DNA <213> Artificial sequence <400> 7 <210> 8 <211> 21 <212> DNA <213> Artificial sequence <400> 8 <210> 9 <211> 24 <212> DNA <213> Artificial sequence <400> 9 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <400> 10 <210> 11 <211> 24 <212> DNA <213> Artificial sequence <400> 11 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 <210> 13 <211> 27 <212> DNA <213> Artificial sequence <400> 13 <210> 14 <211> 19 <212> DNA <213> Artificial sequence <400> 14 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <400> 15 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <400> 16 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <400> 17 <210> 18 <211> 19 <212> DNA <213> Artificial sequence <400> 18 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 <210> 21 <211> 24 <212> DNA <213> Artificial sequence <400> 21 <210> 22 <211> 19 <212> DNA <213> Artificial sequence <400> 22 <210> 23 <211> 20 <212> DNA <213> Artificial sequence <400> 22 <210> 24 <211> 20 <212> DNA <213> Artificial sequence <400> 24 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25

Claims (34)

A probe set comprising probes of the following sequences or their complements: Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9), Trurb3 ( SEQ ID NO: 10), Trrsc (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15) ), Trver2e (SEQ ID NO: 16) and Trvio1c (SEQ ID NO: 17). The probe set according to claim 1, wherein the probe 5' or 3' end further comprises a plurality of additional thymine bases. The probe set according to claim 2, wherein the probe further comprises 4 to 20 additional thymine bases at the 5' or 3' end. The probe set according to claim 3, wherein the probe further comprises 6 to 18 additional thymine bases at the 5' or 3' end. A probe set according to any one of claims 1 to 4, which comprises a flag. The probe set according to claim 5, wherein the marker is digoxigenin. A method for identifying a dermatophyte, the method comprising: hybridizing at least one probe set according to any one of claims 1 to 6 with a sequence of an transcribed region of a rRNA gene in a sample, and observing whether a hybridization occurs The steps. The method of claim 7, wherein: if the rRNA gene internal transcribed region sequence hybridizes to a probe comprising Epflo2c (SEQ ID NO: 1) or a complement thereof, the dermatophyte is identified as Epidermophyton floccosum); if the sequence of the transcribed region of the rRNA gene comprising Miaud3b (SEQ ID NO: 2 probe hybridization) or its complementary sequences, then the dermatophyte identified as Bacillus small woolly (Microsporum audouinii); if the The rRNA gene internal transcribed region sequence is hybridized with a probe comprising Mican2g (SEQ ID NO: 3) or its complementary sequence, and the dermatophyte is identified as Microsporum canis ; if the rRNA gene internal transcribed region sequence Hybridization with a probe comprising Mifer1c (SEQ ID NO: 4) or its complement, the dermatophyte is identified as Microsporum ferrugineum ; if the rRNA gene transcribed region sequence contains Migyp3b (SEQ ID NO: 5) or Migyp5b (SEQ ID NO: 6) or a probe of its complementary sequence is hybridized, and the dermatophyte is identified as Microsporum gypseum ; if the transcribed region sequence of the rRNA gene is Contains Miper2 (SEQ ID NO: 7 Or the probe of its complementary sequence hybridizes, the dermatophyte is identified as Microsporum persicolor ; if the rRNA gene internal transcribed region sequence comprises Trmen2d (SEQ ID NO: 8) or Trmen3g (SEQ ID NO: 9), or sequences complementary to probe hybridization, to the identification of the dermatophyte Trichophyton rubrum be sore (Trichophyton mentagrophytes); if the sequence of the transcribed region of the rRNA gene comprising Trrub3 (SEQ ID NO: 10) And hybridizing with a probe of Trrs1c (SEQ ID NO: 11) or its complementary sequence, the dermatophyte is identified as Trichophyton rubrum ; if the rRNA gene internal transcribed region sequence comprises Trsch2b (SEQ ID NO) :12) or a probe of its complementary sequence hybridizes, the dermatophyte is identified as Trichophyton schoenleinii ; if the rRNA gene internal transcribed region sequence comprises or complements Trrsc (SEQ ID NO: 11) The probe of the sequence hybridizes, but does not hybridize to a probe comprising Trurb3 (SEQ ID NO: 10) or its complement, and the dermatophyte is identified as Trichophyton soudanense ; if the rRNA gene is transcribed Region sequence with Trter1 (SEQ ID NO: 13) or Tr ter6b (SEQ ID NO: 14) or a complementary sequence of the probe hybridizes, is identified as the dermatophytes Tyrese Chui dermatophyte (Trichophyton terrestre); if the sequence of the transcribed region of the rRNA gene comprising Trton1e (SEQ ID NO: 15) or a probe of its complementary sequence, which is identified as Trichophyton tonsurans ; if the rRNA gene internal transcribed region sequence comprises Trver2e (SEQ ID NO: 16) or The probe of the complementary sequence is hybridized, and the dermatophyte is identified as Trichophyton verrucosum ; and if the transcribed region sequence of the rRNA gene comprises Trvio1c (SEQ ID NO: 17) or its complementary sequence When the probe is hybridized, the dermatophyte is identified as Trichophyton violaceum . According to the method of claim 7, it is Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID) NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9), Trurb3 (SEQ ID NO: 10), Trrs1c (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15), Trver2e (SEQ ID NO) The 16:16 and Trvio1c (SEQ ID NO: 17) probes hybridize to the sequence of the transcribed region of the rRNA gene in the sample. The method of claim 9, wherein the 5' or 3' end of the probe further comprises a plurality of additional thymine bases. The method of claim 10, wherein the probe further comprises 4 to 20 additional thymine bases at the 5' or 3' end. According to the method of claim 11, wherein the probe 5' or 3' end further comprises 6 to 18 additional thymine bases. The method of any one of claims 7 to 12, wherein the probe comprises a flag. According to the method of claim 13, wherein the marker is digoxigenin. The method of any one of claims 7 to 12, wherein the rRNA gene internal transcribed region sequence in the sample is obtained by polymerase chain reaction amplification. The method of claim 15, wherein the rRNA gene internal transcribed region sequence in the sample is obtained by amplification of a fungal-specific universal primer. The method of claim 16, wherein the fungal-specific universal primers comprise an ITS1 primer (SEQ ID NO: 18) and an ITS4 primer (SEQ ID NO: 19). The method of claim 16, wherein the fungal-specific universal primer comprises a marker. The method of claim 18, wherein the marker is digoxigenin. The method of any one of claims 7 to 12, wherein the hybridization reaction is carried out on a microarray wafer. The method of any one of claims 7 to 12, further comprising a positive control step comprising: hybridizing the 5.8S rRNA gene retaining region of the bacterium of the sample to the PC (SEQ ID NO: 20) probe . A kit for identifying a dermatophyte in a sample, the kit comprising the probe set according to any one of claims 1 to 6. According to the kit of claim 22, it comprises a microarray wafer. The kit of claim 23, wherein the microarray wafer comprises a substrate and the probe is on the substrate. According to the kit of claim 22, further comprising reagents for obtaining a sequence of the transcribed region of the dermatophyte rRNA gene. The kit of claim 25, wherein the reagents are for a polymerase chain reaction. According to the kit of claim 26, it further comprises a fungal-specific universal primer. The kit according to claim 27, wherein the fungal-specific universal primer comprises an ITS1 primer (SEQ ID NO: 18) and an ITS4 primer (SEQ ID NO: 19). The kit of claim 27, wherein the fungal-specific universal primer comprises a flag. According to the kit of claim 29, wherein the marker is digoxigenin. The kit of any one of claims 22 to 30, wherein the probes comprise Epflo2c (SEQ ID NO: 1), Miaud3b (SEQ ID NO: 2), Mican2g (SEQ ID NO: 3), Mifer1c (SEQ ID NO: 4), Migyp3b (SEQ ID NO: 5), Migyp5b (SEQ ID NO: 6), Miper2 (SEQ ID NO: 7), Trmen2d (SEQ ID NO: 8), Trmen3g (SEQ ID NO: 9) , Trurb3 (SEQ ID NO: 10), Trrsc (SEQ ID NO: 11), Trsch2b (SEQ ID NO: 12), Trter1 (SEQ ID NO: 13), Trter6b (SEQ ID NO: 14), Trton1e (SEQ ID NO: 15), Trver2e (SEQ ID NO: 16) and Trvio1c (SEQ ID NO: 17). The kit of any one of claims 22 to 30, further comprising an agent for the hybridization reaction. A kit according to any one of claims 22 to 30, further comprising a reagent for hybridization reaction of the microarray wafer. The kit according to any one of claims 22 to 30, further comprising a PC (SEQ ID NO: 20) probe which hybridizes to the 5.8S rRNA gene retention region of the dermatophyte.